Nucleic acid constructs and methods of use

Abstract

To provide nucleic acid constructs that allow insertion and / or expression of a sequence of interest, such as a transgene.SOLUTION: The present invention provides a bidirectional nucleic acid construct comprising: a) a first segment comprising a coding sequence for an agent such as a polypeptide; and b) a second segment comprising a reverse complement of a coding sequence of the agent, wherein the construct does not comprise a promoter that drives the expression of the agent such as a polypeptide. Compositions and methods of using such constructs for expression of a polypeptide or therapeutic agent are also provided.SELECTED DRAWING: None

Description

[Technical field]

[0001] This application claims the benefit of priority from U.S. Provisional Application No. 62 / 747,393, filed October 18, 2018, and U.S. Provisional Application No. 62 / 840,343, filed April 29, 2019. The specifications of each of the foregoing applications are incorporated herein by reference in their entirety. [Background technology]

[0002] Genome editing in gene therapy approaches arises from the idea that exogenous introduction of missing or otherwise impaired genetic material can correct genetic diseases. Gene therapy has long been recognized for its enormous potential in how practitioners approach and treat human diseases. Instead of relying on drugs or surgery, patients with underlying genetic factors can be treated by directly targeting the underlying cause. Furthermore, by targeting the underlying genetic cause, gene therapy may have the potential to effectively cure patients. However, the clinical application of existing approaches still requires improvement in several aspects.

[0003] The present disclosure provides bidirectional nucleic acid constructs that allow for enhanced insertion and expression of a nucleic acid sequence of interest, e.g., encoding a therapeutic agent, such as a polypeptide. As described herein, the bidirectional constructs include at least two nucleic acid segments, one segment (first segment) includes a coding sequence that encodes the agent of interest (the coding sequence may be referred to herein as a "transgene" or first transgene), while the other segment (second segment) includes a sequence whose complement of the sequence encodes the agent of interest, i.e., a second transgene. In some embodiments, the constructs include at least two nucleic acid segments, one segment (first segment) includes a coding sequence that encodes a polypeptide of interest, while the other segment (second segment) includes a sequence whose complement of the sequence encodes the polypeptide of interest. When used in conjunction with gene editing systems, the bidirectional nature of the nucleic acid construct allows the construct to be inserted in either orientation (not limited to insertion in one orientation) within the target insertion site, allowing expression of a polypeptide of interest from either a) the coding sequence of one segment, or b) the complement of the other (second) segment, as exemplified herein, thereby improving insertion and expression efficiency. [Brief description of the drawings]

[0004] [Figure 1] The construct formats represented in the AAV genome are shown: SA = splice acceptor, pA = polyA signal sequence, HA = homology arm, LHA = left homology arm, RHA = right homology arm. [Diagram 2] This shows that vectors without homology arms are not effective in immortalized liver cell line (Hepa1-6). The scAAV derived from plasmid P00204, which contains 200 bp homology arms, resulted in detectable expression of hFIX in this cell line. The use of AAV vectors derived from P00123 (scAAV lacking homology arms) and P00147 (ssAAV bidirectional construct lacking homology arms) did not result in detectable expression of hFIX. [Diagram 3] Figure 1 shows the results of in vivo testing of insertion templates with and without homology arms using vectors derived from P00123, P00147, or P00204. (A) Liver editing levels, as measured by indel formation, of approximately 60% were detected in each group of animals treated with LNPs containing CRISPR / Cas9 system components. (B) Animals receiving ssAAV vectors without homology arms (derived from P00147) combined with LNP treatment resulted in the highest levels of hFIX expression in serum. [Figure 4A] Figure 1 shows the results of in vivo testing of ssAAV insertion templates with and without homology arms, comparing targeted insertion to vectors derived from plasmids P00350, P00356, P00362 (with asymmetric homology arms as shown), and P00147 (bidirectional construct as shown in B). [Figure 4B] 1 shows the results of in vivo testing of ssAAV insertion templates with and without homology arms, comparing insertion into the targeted second site with vectors derived from plasmids P00353, P00354 (with symmetric homology arms as shown), and P00147. [Figure 5A] 1 shows the results of targeted insertion with three bidirectional constructs across 20 target sites in primary mouse hepatocytes. A schematic diagram of each of the vectors tested is shown. [Figure 5B] 1 shows the results of targeted insertion with three bidirectional constructs across 20 target sites in primary mouse hepatocytes. Editing as measured by indel formation is shown for each treatment group across each combination tested. [Figure 5C]Figure 1 shows the results of targeted insertion with three bidirectional constructs across 20 target sites in primary mouse hepatocytes. It shows that significant levels of editing (at a particular target site) did not necessarily result in more efficient insertion or expression of the transgene. The constructs tested effectively led to transgene expression in this targeted insertion study. hSA = human F9 splice acceptor, mSA = mouse albumin splice acceptor, HiBit = tag for luciferase-based detection, pA = polyA signal sequence, Nluc = nanoluciferase reporter, GFP = green fluorescent reporter. [Figure 5D] Figure 1 shows the results of targeted insertion with three bidirectional constructs across 20 target sites in primary mouse hepatocytes. It shows that significant levels of editing (at a particular target site) did not necessarily result in more efficient insertion or expression of the transgene. The constructs tested effectively led to transgene expression in this targeted insertion study. hSA = human F9 splice acceptor, mSA = mouse albumin splice acceptor, HiBit = tag for luciferase-based detection, pA = polyA signal sequence, Nluc = nanoluciferase reporter, GFP = green fluorescent reporter. [Figure 6] 1 shows the results of an in vivo screen of targeted insertion with bidirectional constructs across 10 target sites using ssAAV derived from P00147. As shown, significant levels of editing do not necessarily result in high levels of transgene expression. [Figure 7A] Figures 7A-D show the results of in vivo screening of bidirectional constructs across 20 target sites using ssAAV derived from P00147. A shows the editing detected for each of the treatment groups for each LNP / vector combination tested. [Figure 7B] Figures 7A-7D show the results of in vivo screening of bidirectional constructs across 20 target sites using ssAAV derived from P00147. Figure 7B provides the corresponding target insertion data. The results show poor correlation between editing and insertion / expression of bidirectional constructs. [Figure 7C]Figures 7A-7D show the results of in vivo screening of bidirectional constructs across 20 target sites using ssAAV derived from P00147. In C, the results show a positive correlation between in vitro and in vivo results. [Figure 7D] Figures 7A-7D show the results of in vivo screening of bidirectional constructs across 20 target sites using ssAAV derived from P00147. In D, the results show poor correlation between editing and insertion / expression of the bidirectional constructs. [Figure 8A] An in situ hybridization technique using a probe capable of detecting the junction between the hFIX transgene and the mouse albumin exon 1 sequence is used to demonstrate insertion of the bidirectional construct at the cellular level. [Figure 8B] Circulating hFIX levels correlated with the number of cells that were positive for the hybrid transcript. [Figure 9A] 1 shows durability of hFIX expression in vivo. [Figure 9B] This shows that expression from intron 1 of albumin was maintained. [Figure 10A] This shows that by varying the AAV or LNP dose it is possible to modulate the amount of hFIX expression from intron 1 of the albumin gene in vivo. [Figure 10B] This shows that by varying the AAV or LNP dose it is possible to modulate the amount of hFIX expression from intron 1 of the albumin gene in vivo. [Figure 11A] 1 shows the results of screening bidirectional constructs spanning the target site in primary cynomolgus monkey hepatocytes, showing the various levels of editing, as measured by indel formation, detected for each of the samples. [Figure 11B] 1 shows the results of screening bidirectional constructs spanning the target site in primary cynomolgus monkey hepatocytes, showing that significant levels of indel formation were not predictive of insertion or expression of bidirectional constructs into intron 1 of albumin. [Figure 11C]1 shows the results of screening bidirectional constructs spanning the target site in primary cynomolgus monkey hepatocytes, showing that significant levels of indel formation were not predictive of insertion or expression of bidirectional constructs into intron 1 of albumin. [Figure 12A] 1 shows the results of screening bidirectional constructs spanning target sites in primary human hepatocytes, with editing measured by indel formation detected for each of the samples. [Figure 12B] 1 shows the results of screening bidirectional constructs spanning the target site in primary human hepatocytes, showing that significant levels of indel formation were not predictive of insertion or expression of the bidirectional construct into intron 1 of the albumin gene. [Figure 12C] 1 shows the results of screening bidirectional constructs spanning the target site in primary human hepatocytes, showing that significant levels of indel formation were not predictive of insertion or expression of the bidirectional construct into intron 1 of the albumin gene. [Figure 12D] 13 shows that significant levels of indel formation were not predictive of insertion or expression of the bidirectional construct into intron 1 of the albumin gene. [Figure 13] The results of an in vivo study in which non-human primates were administered LNP with a bidirectional hFIX insertion template (derived from P00147) are shown. Systemic hFIX levels were achieved only in animals treated with both LNP and AAV, with no detectable hFIX using AAV or LNP alone. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0005] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the present teachings will be described in conjunction with various embodiments, it is not intended to limit the present teachings to those embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those skilled in the art.

[0006] Before describing the present teachings in detail, it should be understood that the present disclosure is not limited to specific compositions or process steps, as such may vary. As used herein and in the appended claims, it is noted that the singular forms "a," "an," and "the" include plural references unless the context dictates otherwise. Thus, for example, a reference to "a conjugate" includes a plurality of conjugates, a reference to "a cell" includes a plurality of cells, and so forth. As used herein, the term "include" and grammatical variations thereof are intended to be non-limiting, such that the recitation of items in a list does not exclude other similar items that may be substituted for or added to the listed items.

[0007] Numerical ranges are inclusive of the numbers defining the range. Measurements and measurable values ​​are understood to be approximate, taking into account significant digits and errors associated with the measurements. Additionally, the use of "comprise", "comprises", "comprising", "contain", "contains", "containing", "include", "includes" and "including" are not intended to be limiting. It should be understood that both the general description and the detailed description set forth above are exemplary and are for purposes of illustration only and are not intended to limit the teachings herein.

[0008] Unless otherwise stated herein, embodiments herein that recite various components as "comprising" are also assumed to "consist" or "consist essentially of" the recited components. Embodiments herein that recite various components as "consisting of" are also assumed to "comprising" or "consist essentially of" the recited components. Embodiments herein that recite various components as "consisting essentially of" are also assumed to "consist" or "comprising" the recited components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or," unless the context clearly indicates otherwise. The term "about," when used prior to a list, modifies each element of the list. The term "about" or "approximately" refers to an allowable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined.

[0009] The section headings used herein are for organizational purposes only and should not be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference conflicts with any term defined herein or any other express content of this specification, this specification shall control.

[0010] I. Definition Unless otherwise stated, the following terms and phrases used herein are intended to have the following meanings.

[0011] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds that contain nucleosides or nucleoside analogs (including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof) with nitrogenous heterocyclic bases or base analogs linked together along the backbone. The nucleic acid "backbone" can be composed of a variety of linkages, including one or more of sugar phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT No. WO95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with any substitution, e.g., 2' methoxy or 2' halide substitutions. The nitrogenous bases can be the conventional bases (A, G, C, T, U), their analogs (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, or others), derivatives of inosine, purine, or pyrimidine (e.g., N 4 -methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituents at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with substituents at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 No. 5,378,825 and PCT WO 93 / 13121). For a general discussion, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 thed., 1992). Nucleic acids may contain one or more "abasic" residues in which the backbone does not contain a nitrogenous base at a position or positions in the polymer (U.S. Pat. No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain both conventional building blocks and substitutions (e.g., conventional nucleosides with 2' methoxy substituents, or polymers containing both conventional nucleotides and one or more nucleotide analogs). Nucleic acids include "locked nucleic acids" (LNAs), which are analogs that contain one or more LNA nucleotide monomers that have a bicyclic furanose unit locked to an RNA-mimetic sugar structure and increase hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA have different sugar moieties and may differ by the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.

[0012] "Guide RNA", "gRNA", and simply "guide" are used interchangeably herein to refer to either a guide comprising a guide sequence, e.g., a crRNA (also known as CRISPR RNA), or a combination of crRNA and trRNA (also known as tracrRNA). The crRNA and trRNA may be associated as a single-stranded RNA molecule (single guide RNA, sgRNA) or, for example, in two separate RNA molecules (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to each type. The trRNA may be a naturally occurring sequence or a trRNA sequence having a modification or mutation compared to the naturally occurring sequence. The guide RNA, such as the sgRNA or dgRNA, may comprise a modified RNA as described herein.

[0013] As used herein, "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct the guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA-binding agent. A "guide sequence" may also be referred to as a "targeting sequence" or a "spacer sequence." A guide sequence may be, for example, 20 base pairs in length for Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologues. Shorter or longer sequences, such as 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length, may also be used as a guide. In some embodiments, the target sequence is, for example, within a gene or on a chromosome, and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence may be at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In other embodiments, the guide sequence and the target region may contain at least one mismatch. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, and the total length of the target sequence is at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and the target region may contain 1-4 mismatches, and the guide sequence comprises at least 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and the target region may contain 1, 2, 3, or 4 mismatches, and the guide sequence comprises 20 nucleotides.

[0014] Since the nucleic acid substrate of the RNA-guided DNA binder is a double-stranded nucleic acid, the target sequence of the RNA-guided DNA binder includes both the plus and minus strands of genomic DNA (i.e., the given sequence and the reverse complement of the sequence). Thus, when a guide sequence is said to be "complementary to a target sequence," it should be understood that the guide RNA can be directed to bind to the sense or antisense strand (e.g., reverse complement) of the target sequence. Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to a particular nucleotide of the target sequence (e.g., the target sequence without the PAM), except for the substitution of U to T in the guide sequence.

[0015] As used herein, "RNA-guided DNA binding agent" refers to a polypeptide or complex of polypeptides having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, where the DNA-binding activity is sequence-specific and dependent on the sequence of the RNA. The term RNA-guided DNA binding agent also includes nucleic acids encoding such polypeptides. Exemplary RNA-guided DNA binding agents include Cas cleavase / nickases. Exemplary RNA-guided DNA binding agents may include inactivated forms thereof ("dCas DNA binding agents") (e.g., when these agents are modified to enable DNA cleavage, e.g., via fusion with a FokI cleavase domain). As used herein, "Cas nuclease" encompasses Cas cleavase and Cas nickase. Cas cleavase and Cas nickase include the Csm or Cmr complex of type III CRISPR system, its Cas10, Csm1, or Cmr2 subunits, the Cascade complex of type I CRISPR system, its Cas3 subunit, and class 2 Cas nuclease. As used herein, a "Class 2 Cas nuclease" is a single-chain polypeptide with RNA-guided DNA binding activity. Class 2 Cas nucleases include Class 2 Cas cleavase / nickases that further have RNA-guided DNA cleavase or nickase activity (e.g., H840A, D10A, or N863A variants) and Class 2 dCas DNA binders with inactivated cleavase / nickase activity, where the agents have been modified to enable DNA cleavage. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins, and modifications thereof.The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) also contains a RuvC-like nuclease domain. Zetsche's Cpf1 sequence is incorporated by reference in its entirety. See, e.g., Tables S1 and S3 of Zetsche. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015). As used herein, delivery of an RNA-guided DNA-binding agent (e.g., Cas nuclease, Cas9 nuclease, or S. pyogenes Cas9 nuclease) includes delivery of a polypeptide or mRNA.

[0016] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA combined with an RNA-guided DNA binding agent, such as a Cas nuclease, such as a Cas cleavase, a Cas nickase, a Cas9 cleavase, or a Cas9 nickase. In some embodiments, the guide RNA guides an RNA-guided DNA binding agent, such as Cas9, to a target sequence, where the guide RNA hybridizes to the target sequence, the agent binds to the target sequence, and cleaves or nicks after binding.

[0017] As used herein, a first sequence is considered to "contain a sequence having at least X% identity" with a second sequence if alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence are matched by the first sequence. For example, the sequence AAGA contains a sequence having 100% identity with the sequence AAG, because the alignment gives 100% identity in that there is a match at all three positions of the second sequence. The differences between RNA and DNA (generally the exchange of thymidine for uridine or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to the difference in identity or complementarity between polynucleotides, so long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine, another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as complements). Thus, for example, the sequence 5'-AXG, where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine, is considered to be 100% identical to AUG, in that both are perfectly complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand what choice of algorithm and parameter settings is appropriate for a given pair of sequences to be aligned. Generally, for sequences of similar length and predicted identity of more than 50% for amino acids or more than 75% for nucleotides, the Needleman-Wunsch algorithm using the default settings of the Needleman-Wunsch algorithm interface provided by the EBI at the www.ebi.ac.uk web server is generally appropriate.

[0018] As used herein, a first sequence is considered to be "X% complementary" to a second sequence if X% of the bases of the first sequence base pair with the second sequence. For example, a first sequence 5'AAGA3' is 100% complementary to a second sequence 3'TTCT5', and the second sequence is 100% complementary to the first sequence. In some embodiments, the first sequence 5'AAGA3' is 100% complementary to a second sequence 3'TTCTGTGA5', while the second sequence is 50% complementary to the first sequence.

[0019] "mRNA" is used herein to refer to a polynucleotide that is entirely or primarily RNA or modified RNA and contains an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by ribosomes and aminoacylated tRNAs). An mRNA can contain a phosphate sugar backbone that contains ribose residues or analogs thereof, e.g., 2'-methoxyribose residues. In some embodiments, the sugars of the mRNA phosphate sugar backbone consist essentially of ribose residues, 2'-methoxyribose residues, or combinations thereof. The bases of an mRNA can be modified bases, such as pseudouridine, N-1-methyl-pseudouridine, or other naturally occurring or non-naturally occurring bases.

[0020] Exemplary guide sequences useful in the compositions and methods described herein are provided in Table 1 and throughout the application.

[0021] As used herein, "indel" refers to an insertion / deletion mutation consisting of several nucleotides that are either inserted or deleted at the site of a double-stranded break (DSB) in a target nucleic acid.

[0022] As used herein, "polypeptide" refers to a wild-type protein or a variant protein (e.g., a mutant, a fragment, a fusion, or a combination thereof). A variant polypeptide may have at least or about 5%, 10%, 15%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% functional activity of the wild-type polypeptide. In some embodiments, a variant is at least 70%, 75%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of a wild-type polypeptide. In some embodiments, a variant polypeptide may be a hyperactive variant. In certain instances, the variant has from about 80% to about 120%, 140%, 160%, 180%, 200%, 300%, 400%, 500% or more of the functional activity of the wild-type polypeptide.

[0023] As used herein, a "heterologous gene" refers to a gene that has been introduced as an exogenous source into a site within a host cell genome (e.g., at a genomic locus such as the safe harbor locus, including the albumin intron 1 site). That is, the introduced gene is heterologous with respect to its insertion site. A polypeptide expressed from such a heterologous gene is referred to as a "heterologous polypeptide." A heterologous gene can be naturally occurring or engineered and can be wild-type or variant. A heterologous gene can include nucleotide sequences other than the sequence encoding the heterologous polypeptide (e.g., an internal ribosome entry site). A heterologous gene can be a gene that naturally occurs within the host genome as a wild-type or variant (e.g., mutant). For example, the host cell contains a gene of interest (as a wild-type or variant), but the same gene or a variant thereof can be introduced as an exogenous source for expression, for example, at a highly expressed locus. A heterologous gene can also be a gene that does not naturally occur in the host genome or that expresses a heterologous polypeptide that does not naturally occur in the host genome. "Heterologous gene," "exogenous gene," and "transgene" are used interchangeably. In some embodiments, a heterologous gene or transgene comprises an exogenous nucleic acid sequence, e.g., the nucleic acid sequence is not endogenous to the recipient cell. In certain embodiments, a heterologous gene does not naturally occur in the recipient cell. For example, a heterologous gene can be heterologous both with respect to its insertion site and with respect to its recipient cell.

[0024] As used herein, "target sequence" refers to a nucleic acid sequence in a target gene that has complementarity to the guide sequence of a gRNA. The interaction between the target sequence and the guide sequence directs the RNA-guided DNA binding agent to bind and potentially (depending on the activity of the agent) nick or cleave within the target sequence.

[0025] As used herein, a "bidirectional nucleic acid construct" (interchangeably referred to herein as a "bidirectional construct") comprises at least two nucleic acid segments, one segment (first segment) comprises a coding sequence encoding an agent of interest (the coding sequence may be referred to herein as a "transgene" or first transgene), while the other segment (second segment) comprises a sequence whose complement of the sequence encodes the agent of interest, i.e., a second transgene. The agent may be a therapeutic agent, such as a polypeptide, functional RNA, mRNA, etc. The transgene may encode an agent, such as a polypeptide, functional RNA, or mRNA. In some embodiments, a bidirectional nucleic acid construct comprises at least two nucleic acid segments, one segment (first segment) comprises a coding sequence encoding a polypeptide of interest, while the other segment (second segment) comprises a sequence whose complement of the sequence encodes the polypeptide of interest, i.e., a second transgene. That is, the at least two segments may encode the same or different polypeptides or the same or different agents. When two segments code for the same polypeptide, the coding sequence of the first segment does not have to be identical to the complement of the sequence of the second segment. In some embodiments, the sequence of the second segment is the reverse complement of the coding sequence of the first segment. Bidirectional constructs can be single-stranded or double-stranded. Bidirectional constructs disclosed herein include constructs that can express any polypeptide of interest. Bidirectional constructs are useful for genomic insertion of transgene sequences, particularly for targeted insertion of transgenes.

[0026] As used herein, "reverse complement" refers to a sequence that is the complementary sequence of a reference sequence, where the complementary sequence is written in reverse. For example, for a hypothetical sequence 5'CTGGACCGA3' (SEQ ID NO:500), the "perfect" complementary sequence is 3'GACCTGGCT5' (SEQ ID NO:501), and the "perfect" reverse complementary sequence is written as 5'TCGGTCCAG3' (SEQ ID NO:502). A reverse complementary sequence does not have to be "perfect" and can still code for the same or similar polypeptide as the reference sequence. Due to redundancy in codon usage, a reverse complementary sequence may deviate from the reference sequence that codes for the same polypeptide. As used herein, "reverse complement" also includes a sequence that is, for example, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the reverse complement sequence of a reference sequence.

[0027] In some embodiments, the bidirectional nucleic acid construct comprises a first segment comprising a coding sequence encoding a first polypeptide (first transgene) and a second segment comprising a sequence whose complement encodes a second polypeptide (second transgene). In some embodiments, the first and second polypeptides are at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical. In some embodiments, the first and second polypeptides comprise amino acid sequences that are at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical, for example, over 50, 100, 200, 500, 1000 or more amino acid residues.

[0028] II. Bidirectional nucleic acid constructs Described herein are bidirectional nucleic acid constructs that facilitate enhanced insertion, e.g., enhance productive insertion and expression of a gene of interest. Briefly, various bidirectional constructs disclosed herein include at least two nucleic acid segments, one segment (first segment) includes a coding sequence (the coding sequence may be referred to herein as a "transgene" or first transgene) that encodes an agent of interest, e.g., a heterologous gene, while the other segment (second segment) includes a sequence whose complement of the sequence encodes the agent of interest, e.g., a heterologous gene, i.e., a second transgene. The agent may be a therapeutic agent, such as a polypeptide, functional RNA, mRNA, or the like. The transgene may encode an agent, such as a polypeptide, functional RNA, mRNA, or transcription factor. In some embodiments, the coding sequence encodes a therapeutic agent, such as a polypeptide, or functional RNA. The at least two segments may encode the same or different polypeptides or the same or different agents. In some embodiments, a bidirectional construct disclosed herein comprises at least two nucleic acid segments, one segment (a first segment) comprises a coding sequence that encodes a polypeptide of interest, while the other segment (a second segment) comprises a sequence whose complement encodes the polypeptide of interest.

[0029] In one embodiment, a bidirectional construct comprises at least two nucleic acid segments in cis, one segment (first segment) comprises a coding sequence (sometimes interchangeably referred to herein as a "transgene"), while the other segment (second segment) comprises a sequence whose complement encodes the transgene. The first transgene and the second transgene may be identical or different. A bidirectional construct may comprise at least two nucleic acid segments in cis, one segment (first segment) comprises a coding sequence encoding a heterologous gene in one orientation, while the other segment (second segment) comprises a sequence whose complement encodes a heterologous gene in the other orientation. That is, the first segment is the complement (not necessarily a perfect complement) of the second segment, and the complement of the second segment is the reverse complement of the first segment (both encode the same heterologous protein, but not necessarily a perfect reverse complement). A bidirectional construct can include a first coding sequence encoding a heterologous gene linked to a splice acceptor and a second coding sequence whose complement encodes a heterologous gene in the other orientation and is also linked to a splice acceptor.

[0030] As used herein, such constructs are sometimes referred to as "donor constructs / templates." In some embodiments, the constructs are DNA constructs. Methods for designing and creating various functional / structural modifications to donor constructs are known in the art. In some embodiments, the constructs may include any one or more of a polyadenylation tail sequence, a polyadenylation signal sequence, a splice acceptor site, or a selectable marker. In some embodiments, the polyadenylation tail sequence is encoded, for example, as a "poly-A" stretch at the 3' end of the coding sequence.

[0031] When used in combination with the gene editing system described herein, the bidirectional nature of the nucleic acid construct allows the construct to be inserted in either direction (not limited to insertion in one direction) within the target insertion site, allowing expression of the polypeptide of interest from either a) the coding sequence of one segment (e.g., the left segment encoding "human F9" in the ssAAV construct at the top left of FIG. 1), or b) the complement of the other segment (e.g., the complement of the right segment encoding "human F9" shown upside down in the ssAAV construct at the top left of FIG. 1), as exemplified herein, thereby improving insertion and expression efficiency. Targeted cleavage by the gene editing system can facilitate construct integration and / or transgene expression. A variety of known gene editing systems can be used in the practice of the present disclosure, including, for example, site-specific DNA cleavage systems including CRISPR / Cas systems, zinc finger nuclease (ZFN) systems, or transcription activator-like effector nuclease (TALEN) systems.

[0032] In some embodiments, the bidirectional nucleic acid construct does not comprise a promoter driving expression of an agent or polypeptide, for example, expression of the polypeptide is driven by a host cell promoter (e.g., the endogenous albumin promoter when the transgene is integrated into the albumin locus of the host cell).

[0033] In some embodiments, the bidirectional nucleic acid construct comprises a first segment comprising a coding sequence of a polypeptide, and a second segment comprising a reverse complement of the coding sequence of the polypeptide. The same is true for non-polypeptide drugs. That is, the coding sequence in the first segment can express a polypeptide, but the complement of the reverse complement in the second segment can also express a polypeptide. As used herein, when referring to a second segment comprising a reverse complement sequence, "coding sequence" refers to the complementary (coding) strand of the second segment (i.e., the complementary coding sequence of the reverse complement sequence in the second segment).

[0034] In some embodiments, the coding sequence encoding polypeptide A in the first segment is less than 100% complementary to the reverse complement of the coding sequence also encoding polypeptide A. That is, in some embodiments, the first segment comprises coding sequence (1) of polypeptide A, and the second segment is the reverse complement of coding sequence (2) of polypeptide A, and coding sequence (1) is not identical to coding sequence (2). For example, coding sequence (1) and / or coding sequence (2) encoding polypeptide A may utilize different codons. In some embodiments, one or both sequences may be codon-optimized such that the reverse complements of coding sequence (1) and coding sequence (2) have 100% or less than 100% complementarity. In some embodiments, the coding sequence of the second segment encodes a polypeptide using one or more alternative codons for one or more amino acids of the same polypeptide encoded by the coding sequence in the first segment. As used herein, "alternative codons" refer to variations in codon usage for a given amino acid, which may or may not be preferred or optimized codons for a given expression system (codon optimization). Preferred codon usage, or codons that are well tolerated in a given expression system, are known in the art.

[0035] In some embodiments, the second segment comprises a reverse complement sequence that employs a different codon usage than the coding sequence of the first segment to reduce hairpin formation. Such a reverse complement forms fewer base pairs with all nucleotides of the coding sequence in the first segment, but still optionally encodes the same polypeptide. In such cases, the coding sequence of the first segment, for example of polypeptide A, may be homologous, but not identical, to the coding sequence of the second half of the bidirectional construct, for example of polypeptide A. In some embodiments, the second segment comprises a reverse complement sequence that is not substantially complementary (e.g., 70% or less complementary) to the coding sequence in the first segment. In some embodiments, the second segment comprises a reverse complement sequence that is highly complementary (e.g., at least 90% complementary) to the coding sequence in the first segment. In some embodiments, the second segment comprises a reverse complement sequence having at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, or about 99% complementarity to the coding sequence in the first segment.

[0036] In some embodiments, the second segment comprises a reverse complement sequence having 100% complementarity to the coding sequence in the first segment. That is, the sequence in the second segment is a perfect reverse complement of the coding sequence in the first segment. As an example, the first segment comprises the hypothetical sequence 5'CTGGACCGA3' (SEQ ID NO: 500) and the second segment comprises the reverse complement of SEQ ID NO: 1, i.e., 5'TCGGTCCAG3' (SEQ ID NO: 502).

[0037] In some embodiments, the bidirectional nucleic acid construct comprises a first segment comprising a coding sequence for a polypeptide or agent (e.g., a first polypeptide) and a second segment comprising a reverse complement of the coding sequence for a polypeptide or agent (e.g., a second polypeptide). In some embodiments, the first polypeptide and the second polypeptide are the same, as described above. In some embodiments, the first therapeutic agent and the second therapeutic agent are the same, as described above. In some embodiments, the first polypeptide and the second polypeptide are different. In some embodiments, the first therapeutic agent and the second therapeutic agent are different. For example, the first polypeptide is polypeptide A and the second polypeptide is polypeptide B. As a further example, the first polypeptide is polypeptide A and the second polypeptide is a variant of polypeptide A (e.g., a fragment (such as a functional fragment), a mutant, a fusion (including the addition of as little as one amino acid at the polypeptide terminus), or a combination thereof). The coding sequence encoding the polypeptide may optionally include one or more additional sequences, such as a sequence encoding an amino- or carboxy-terminal amino acid sequence, such as a signal sequence, a tag sequence (e.g., HiBit), or a heterologous functional sequence (e.g., a nuclear localization sequence (NLS) or self-cleaving) linked to the polypeptide. The coding sequence encoding the polypeptide may optionally include a sequence encoding one or more amino-terminal signal peptide sequences. Each of these additional sequences may be the same or different in the first and second segments of the construct.

[0038] The bidirectional constructs described herein can be used to express any polypeptide according to the methods disclosed herein. In some embodiments, the polypeptide is a secreted polypeptide. In some embodiments, the polypeptide is one whose function normally acts (e.g., is functionally active) as a secreted polypeptide. As used herein, a "secreted polypeptide" refers to a protein that is secreted by a cell and / or is functionally active as a soluble extracellular protein.

[0039] In some embodiments, the polypeptide is an intracellular polypeptide. In some embodiments, the polypeptide is one whose function normally operates (e.g., is functionally active) within a cell. As used herein, "intracellular polypeptide" refers to a protein that is not secreted by the cell, including soluble cytoplasmic polypeptides. In some embodiments, the polypeptide is a wild-type polypeptide.

[0040] In some embodiments, the polypeptide is a liver protein or a variant thereof. As used herein, a "liver protein" is, for example, a protein that is endogenously produced in the liver and / or functionally active in the liver. In some embodiments, the liver protein is a circulating protein produced by the liver or a variant thereof. In some embodiments, the liver protein is a protein that is functionally active in the liver or a variant thereof. In some embodiments, the liver protein exhibits elevated expression in the liver compared to one or more other tissue types. In some embodiments, the polypeptide is a non-liver protein. In some embodiments, the polypeptide includes, but is not limited to, factor IX and variants thereof.

[0041] In some embodiments, the bidirectional nucleic acid construct is linear. For example, the first and second segments are linked in a linear fashion through a linker sequence. In some embodiments, the 5' end of the second segment that includes the reverse complement sequence is linked to the 3' end of the first segment. In some embodiments, the 5' end of the first segment is linked to the 3' end of the second segment that includes the reverse complement sequence. In some embodiments, the linker sequence is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 500, 1000, 1500, 2000 or more nucleotides in length. As will be appreciated by one of skill in the art, other structural elements in addition to or in place of a linker sequence may be inserted between the first and second segments.

[0042] The constructs disclosed herein can be modified to include any suitable structural features necessary for any particular use and / or that confer one or more desired functions. In some embodiments, the bidirectional nucleic acid constructs disclosed herein do not include homology arms. In some embodiments, the bidirectional nucleic acid constructs disclosed herein are homology-independent donor constructs. In some embodiments, due in part to the bidirectional function of the nucleic acid construct, the bidirectional construct can be inserted into a genomic locus in any orientation described herein to allow for efficient insertion and / or expression of a polypeptide of interest. In some embodiments, the bidirectional nucleic acid construct includes a first segment and a second segment, each having a splice acceptor upstream of the transgene. In certain embodiments, the splice acceptor is compatible with the splice donor sequence of a safe harbor site of the host cell, for example, the splice donor of intron 1 of the human albumin gene.

[0043] In some embodiments, the compositions described herein contain one or more internal ribosome entry sites (IRES). IRES, first identified as a characteristic picornavirus RNA, plays an important role in initiating protein synthesis in the absence of a 5' cap structure. IRES can act as the only ribosome binding site or as one of multiple ribosome binding sites of a polynucleotide. Constructs containing more than one functional ribosome binding site can code for several peptides or polypeptides ("multicistronic nucleic acid molecules") that are translated independently by ribosomes. Alternatively, constructs can contain an IRES to express heterologous proteins that are not fused to an endogenous polypeptide (i.e., albumin signal peptide). Examples of IRES sequences that may be utilized include, but are not limited to, those derived from picornaviruses (e.g., FMDV), vermin viruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (ECMV), foot and mouth disease viruses (FMDV), hepatitis C viruses (HCV), classical swine fever viruses (CSFV), murine leukemia viruses (MLV), simian immunodeficiency viruses (SIV), or cricket paralysis viruses (CrPV).

[0044] In some embodiments, the nucleic acid construct comprises a sequence encoding a self-cleaving peptide, such as a 2A sequence or a 2A-like sequence. In some embodiments, the self-cleaving peptide is located upstream of the polypeptide of interest. In one embodiment, the sequence encoding the 2A peptide can be used to separate the coding regions of two or more polypeptides of interest. In another embodiment, this sequence can be used to separate the coding sequence from the construct and separate the coding sequence from the endogenous locus (i.e., the endogenous albumin signal sequence). As a non-limiting example, the sequence encoding the 2A peptide can be between region A and region B (A-2A-B). The presence of the 2A peptide results in cleavage of one long protein into protein A, protein B, and the 2A peptide. Protein A and protein B can be the same or different polypeptides of interest.

[0045] In some embodiments, one or both of the first and second segments comprises a polyadenylation tail sequence and / or a polyadenylation signal sequence downstream of the open reading frame. In some embodiments, the polyadenylation tail sequence is encoded at the 3' end of the first and / or second segment, e.g., as a "poly-A" stretch. In some embodiments, the polyadenylation tail sequence is provided co-transcriptionally as a result of a polyadenylation signal sequence encoded at or near the 3' end of the first and / or second segment. In some embodiments, the poly-A tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, and optionally up to 300 adenines. In some embodiments, the poly-A tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides. Methods for designing suitable polyadenylation tail sequences and / or polyadenylation signal sequences are well known in the art. Suitable splice acceptor sequences are disclosed and exemplified herein, including mouse albumin and human FIX splice acceptor sites. In some embodiments, the polyadenylation signal sequence AAUAAA (SEQ ID NO: 800) is commonly used in mammalian systems, although variants such as UAUAAA (SEQ ID NO: 801) or AU / GUAAA (SEQ ID NO: 802) have been identified. See, e.g., NJ Proudfoot, Genes&Dev. 25(17):1770-82, 2011. In some embodiments, a polyA tail sequence is included.

[0046] In some embodiments, the constructs disclosed herein can be DNA or RNA, single-stranded, double-stranded, or partially single-stranded and partially double-stranded, and can be introduced into a host cell in linear or circular (e.g., minicircle) form. See, for example, U.S. Patent Publication Nos. 2010 / 0047805, 2011 / 0281361, and 2011 / 0207221. When introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonuclease degradation) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues are added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides are ligated to one or both ends. See, e.g., Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of a terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.

[0047] In some embodiments, the construct may be inserted such that its expression is driven by an endogenous promoter at the insertion site (e.g., the endogenous albumin promoter when the donor is integrated into the albumin locus of the host cell). In such cases, the transgene may lack control elements (e.g., promoters and / or enhancers) that drive its expression (e.g., promoterless constructs). Nevertheless, it will be apparent that in other cases, the construct may include a promoter and / or enhancer, e.g., a constitutive promoter that drives expression of a functional protein upon integration, or an inducible or tissue-specific (e.g., liver or platelet specific) promoter. The construct may include a sequence encoding a heterologous protein downstream of a signal sequence encoding a signal peptide, and may be operably linked to a signal sequence encoding a signal peptide.

[0048] In some embodiments, the nucleic acid construct functions in homology-independent insertion of nucleic acid encoding a heterologous polypeptide. In some embodiments, the nucleic acid construct functions in non-dividing cells, for example, cells in which NHEJ, not HR, is the primary mechanism by which double-stranded DNA breaks are repaired. The nucleic acid can be a homology-independent donor construct. For example, the construct can be single-stranded or double-stranded DNA. In some embodiments, the nucleic acid can be modified as described herein (e.g., using nucleoside analogs).

[0049] In some embodiments, the constructs disclosed herein include a splice acceptor site at either or both ends of the construct, e.g., 5' of the open reading frame in the first and / or second segment, or on the 5' of one or both transgene sequences. In some embodiments, the splice acceptor site comprises NAG. In further embodiments, the splice acceptor site consists of NAG. In some embodiments, the splice acceptor is an albumin splice acceptor, e.g., the albumin splice acceptor used in splicing together exons 1 and 2 of albumin. In some embodiments, the splice acceptor is from the human albumin gene. In some embodiments, the splice acceptor is from the mouse albumin gene. In some embodiments, the splice acceptor is an F9 (or "FIX") splice acceptor, e.g., the F9 splice acceptor used in splicing together exons 1 and 2 of F9. In some embodiments, the splice acceptor is derived from the human F9 gene. In some embodiments, the splice acceptor is derived from the mouse F9 gene. Additional suitable splice acceptor sites useful in eukaryotes, including artificial splice acceptors, are known and can be derived from the art. For example, see Shapiro, et al., 1987, Nucleic Acids Res., 15, 7155-7174; Burset, et al., 2001, Nucleic Acids Res., 29, 255-259.

[0050] In some embodiments, the constructs disclosed herein may be modified at either or both termini to include one or more suitable structural features as needed and / or to confer one or more functional benefits. For example, structural modifications may vary depending on the method(s) used to deliver the constructs disclosed herein to the host cell, for example, using viral vector delivery or packaging into lipid nanoparticles for delivery. Such modifications include, but are not limited to, terminal structures such as inverted terminal repeats (ITRs), hairpins, loops, and other structures such as toroids. In some embodiments, the constructs disclosed herein include one, two, or three ITRs. In some embodiments, the constructs disclosed herein include two or fewer ITRs. Various methods of structural modifications are known in the art.

[0051] In some embodiments, one or both ends of the construct can be protected (e.g., from exonucleolytic degradation) by methods known in the art. For example, one or more dideoxynucleotide residues can be added to the 3' end of a linear molecule and / or self-complementary oligonucleotides can be ligated to one or both ends. See, for example, Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963, Nehls et al. (1996) Science 272:886-889. Additional methods for protecting constructs from degradation include, but are not limited to, the addition of terminal amino group(s) and the use of modified internucleotide linkages, such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.

[0052] In some embodiments, the constructs disclosed herein may be introduced into cells as part of a vector with additional sequences, such as an origin of replication, a promoter, and a gene encoding antibiotic resistance. The construct may omit viral elements. In some embodiments, the constructs may be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome, a polymer, or a poloxamer, or may be delivered by a viral vector (e.g., adenovirus, AAV, herpes virus, retrovirus, lentivirus).

[0053] In some embodiments, although not required for expression, the constructs disclosed herein may also include transcriptional or translational control sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, peptide coding sequences, and / or polyadenylation signals.

[0054] In some embodiments, a construct comprising a coding sequence for a polypeptide of interest may include one or more of the following modifications: codon optimization (e.g., to human codons) and / or the addition of one or more glycosylation sites. See, e.g., McIntosh et al. (2013) Blood(17):3335-44.

[0055] III. Gene editing systems Various known gene editing systems can be used in the implementation of the present disclosure, including, for example, CRISPR / Cas system, zinc finger nuclease (ZFN) system, and transcription activator-like effector nuclease (TALEN) system. Generally, these methods can involve the use of engineered cleavage systems to induce double-strand breaks (DSBs) or nicks (e.g., single-strand breaks or SSBs) in target DNA sequences. Cleavage or nicking can occur through the use of specific nucleases, such as engineered ZFNs, TALENs, or by using CRISPR / Cas systems with engineered guide RNAs to induce specific cleavage or nicking of target DNA sequences. Additionally, targeted nucleases have been developed, for example, based on the Argonaute system (e.g., from T. thermophilus known as "TtAgo", see Swarts et al (2014) Nature 507(7491):258-261), which may also have potential use in genome editing and gene therapy, and additional nucleases are being developed.

[0056] In some embodiments, the CRISPR / Cas system can be used to create an insertion site at a desired locus in the host genome, where the bidirectional construct disclosed herein can be inserted to express one or more polypeptides of interest. Methods for designing suitable guide RNAs that target any desired locus in the host genome for insertion are well known in the art. The bidirectional construct containing a transgene can be heterologous with respect to its insertion site, for example, the insertion of a heterologous transgene into a "safe harbor" locus. The bidirectional construct containing a transgene can be non-heterologous with respect to its insertion site, for example, the insertion of a wild-type transgene into its endogenous locus.

[0057] A "safe harbor" locus is a locus in a genome into which an exogenous nucleic acid may be inserted without significant deleterious effects on a host cell, e.g., a hepatocyte, e.g., without causing apoptosis, necrosis, and / or senescence, or without causing more than 5%, 10%, 15%, 20%, 25%, 30%, or 40% apoptosis, necrosis, and / or senescence compared to a control cell. See, e.g., Hsin et al., "Hepatocyte death in liver inflammation, fibrosis, and tumorigenesis," 2017. In some embodiments, a safe harbor locus allows expression of an exogenous nucleic acid (e.g., an exogenous gene) without significant deleterious effects on a host cell or cell population, such as a hepatocyte or liver cell, e.g., without causing apoptosis, necrosis, and / or senescence, or without causing more than 5%, 10%, 15%, 20%, 25%, 30%, or 40% apoptosis, necrosis, and / or senescence compared to a control cell population. The safe harbor can be within an albumin gene, such as the human albumin gene. The safe harbor can be within the albumin intron 1 region, e.g., human albumin intron 1. The safe harbor can be, for example, a human safe harbor for liver tissue or hepatocyte host cells. Non-limiting examples of safe harbor loci targeted by the nuclease(s) include CCR5, HPRT, AAVS1, Rosa, albumin, AAVS1(PPP1 R12C), AnggtiS, ApoC3, ASGR2, FIX(F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, SERPINAl, TF, and TTR. See, e.g., U.S. Patent Nos. 7,951,925 and 8,110,379, U.S. Publication Nos. 2008 / 0159996, 2010 / 00218264, 2012 / 0017290, 2011 / 0265198, 2013 / 0137104, 2013 / 0122591, 2013 / 0177983, 2013 / 0177960, and WO2017 / 093804.As exemplified herein, in some embodiments, guide RNAs may be designed to target the human or mouse albumin locus (e.g., intron 1). Examples of guide RNAs exemplified herein are shown in Tables 5-10. It will be understood that any other locus can be targeted for insertion of a bidirectional construct containing a transgene by the present methods.

[0058] In some embodiments, a heterologous gene may be inserted into a safe harbor locus and use the endogenous signal sequence of the safe harbor locus, e.g., the albumin signal sequence encoded by exon 1. For example, a coding sequence can be inserted into human albumin intron 1 such that it is downstream of and fused to the signal sequence of human albumin exon 1.

[0059] In some embodiments, a gene may include its own signal sequence, may be inserted into a safe harbor locus, or may further use the endogenous signal sequence of a safe harbor locus. For example, a coding sequence including its native signal sequence may be inserted into human albumin intron 1 such that it is downstream of and fused to the signal sequence of human albumin encoded by exon 1.

[0060] In some embodiments, a gene may contain its own signal sequence and internal ribosome entry site (IRES), may be inserted into a safe harbor locus, or may even use the endogenous signal sequence of a safe harbor locus. For example, a coding sequence containing its own native signal sequence and an IRES sequence may be inserted into human albumin intron 1 such that it is downstream of and fused with the signal sequence of human albumin encoded by exon 1.

[0061] In some embodiments, a gene may contain its own signal sequence and IRES, may be inserted into a safe harbor locus, and does not use the endogenous signal sequence of the safe harbor locus. For example, a coding sequence containing its own native signal sequence and IRES sequence may be inserted into human albumin intron 1 such that it is not fused with the signal sequence of human albumin encoded by exon 1. In these embodiments, the protein is translated from the IRES site and is not a chimera (e.g., an albumin signal peptide fused to a heterologous protein), which may advantageously be non-immunogenic or low immunogenic. In some embodiments, the protein is not secreted and / or transported outside the cell.

[0062] In some embodiments, the gene may be inserted into a safe harbor locus, may contain an IRES, and does not use any signal sequence. For example, a coding sequence containing an IRES sequence and no native signal sequence may be inserted into human albumin intron 1 such that it is not fused with the signal sequence of human albumin encoded by exon 1. In some embodiments, the protein is translated from the IRES site without any signal sequence. In some embodiments, the protein is not secreted and / or transported outside the cell.

[0063] It will also be appreciated that the guide RNA of a Cas nuclease, such as a Cas9 nuclease, that may be used in the present methods may include any of a variety of known variations and modifications (e.g., chemical modifications), including the presence of one or more non-natural and / or naturally occurring components or configurations used in place of or in addition to the standard A, G, C, and U residues. For example, each of the guide sequences exemplified herein (Tables 5-10) may further include additional nucleotides to form a crRNA, guide RNA, and / or sgRNA, e.g., from the SpyCas9 CRISPR / Cas system. For example, each of the guide sequences exemplified herein (Tables 5-10) may further include additional nucleotides to form a crRNA or sgRNA, having at its 3' end the following exemplary nucleotide sequence following the guide sequence: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 200) in the 5' to 3' orientation. In the case of sgRNAs, the guide sequences, such as those listed in Tables 5-10, may further include additional nucleotides to form the sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence (SpyCas9 guide sequence): GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 201) or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 202) in the 5' to 3' orientation.

[0064] The guide RNA may optionally include a trRNA. In each of the composition and method embodiments described herein, the crRNA and trRNA may be associated as a single RNA (sgRNA) or may be on separate RNAs (dgRNA). In the context of an sgRNA, the components of the crRNA and trRNA may be covalently linked, for example, via a phosphodiester bond or other covalent bond. In some embodiments, the sgRNA includes one or more linkages between nucleotides that are not phosphodiester bonds. In each of the composition, use, and method embodiments described herein, the guide RNA may include two RNA molecules as a "dual guide RNA" or "dgRNA." The dgRNA includes a first RNA molecule that includes a crRNA that includes a guide sequence, for example, as shown in any one of Tables 5-10, and a second RNA molecule that includes a trRNA. The first and second RNA molecules may not be covalently linked, but may form an RNA duplex via base pairing between portions of the crRNA and the trRNA.

[0065] In some embodiments, the guide RNA disclosed herein binds to a region upstream of a propospacer adjacent motif (PAM). As will be understood by those skilled in the art, the PAM sequence occurs on the strand opposite the strand containing the target sequence. That is, the PAM sequence is on the complementary strand of the target strand (the strand containing the target sequence to which the guide RNA binds). In some embodiments, the PAM is selected from the group consisting of NGG, NNGRRT, NNGRR(N), NNAGAAW, NNNNG(A / C)TT, and NNNNRYAC. In some embodiments, the PAM is NGG.

[0066] In some embodiments, the guide RNA sequences provided herein are complementary to sequences adjacent to the PAM sequence.

[0067] In some embodiments, the guide RNA sequence comprises a sequence that is complementary to a sequence within a genomic region selected from a table herein according to coordinates within the human reference genome hg38. In some embodiments, the guide RNA sequence comprises a sequence that is complementary to a sequence that comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides from within a genomic region selected from Tables 5-10. In some embodiments, the guide RNA sequence comprises a sequence that is complementary to a sequence that comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides spanning a genomic region selected from Tables 5-10.

[0068] The guide RNAs disclosed herein mediate target-specific cleavage that results in a double-stranded break (DSB). The guide RNAs disclosed herein mediate target-specific cleavage that results in a single-stranded break (SSB or nick).

[0069] Methods for using various RNA-guided DNA binding agents, such as Cas nucleases, e.g., nucleases such as Cas9, are also well known in the art. Although the use of bidirectional nucleic acids with CRISPR / Cas systems is exemplified herein, it will be understood that suitable modifications to the system can also be used. Depending on the context, it will be understood that the RNA-guided DNA binding agent can be provided as a nucleic acid (e.g., DNA or mRNA) or as a protein. In some embodiments, the method can be performed in a host cell that already contains and / or expresses the RNA-guided DNA binding agent.

[0070] In some embodiments, the RNA-guided DNA binding agent, such as Cas9 nuclease, has cleavase activity, which may also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA binding agent, such as Cas9 nuclease, has nickase activity, which may also be referred to as single-stranded endonuclease activity. In some embodiments, the RNA-guided DNA binding agent comprises a Cas nuclease. Examples of Cas nucleases include those of S.pyogenes, S.aureus, and other prokaryotic type II CRISPR systems (see, for example, the list in the next paragraph), as well as variants or mutants thereof (e.g., engineered, non-natural, natural, or other variants). See, for example, US2016 / 0312198A1, US2016 / 0312199A1.

[0071] Non-limiting exemplary species from which Cas nucleases can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp.、Lachnospiraceae மாட்ட்டிந்துND2006、、、Acaryochloris marina is mentioned。.

[0072] In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is a Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is a Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus sp. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacteria, Butyrivibrio proteoclasticus, Peregrinibacteria bacteria, Parcubacteria bacteria, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus or Lachnospiraceae.

[0073] In some embodiments, the gRNA combined with the RNA-guided DNA-binding agent is referred to as a ribonucleoprotein complex (RNP). In some embodiments, the RNA-guided DNA-binding agent is a Cas nuclease. In some embodiments, the gRNA combined with the Cas nuclease is referred to as a Cas RNP. In some embodiments, the RNP comprises type I, type II, or type III components. In some embodiments, the Cas nuclease is a Cas9 protein from a type II CRISPR / Cas system. In some embodiments, the gRNA combined with Cas9 is referred to as a Cas9 RNP.

[0074] Wild-type Cas9 has two nuclease domains: RuvC and HNH. The RuvC domain cleaves the non-target DNA strand and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 protein comprises more than one RuvC domain and / or more than one HNH domain. In some embodiments, the Cas9 protein is wild-type Cas9. In each of the composition, use, and method embodiments, Cas induces a double-stranded break in the target DNA.

[0075] In some embodiments, chimeric Cas nucleases are used, where one domain or region of a protein is replaced by a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced with a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.

[0076] In other embodiments, the Cas nuclease may be from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of a cascade complex of a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.

[0077] In some embodiments, the RNA-guided DNA binding agent has single-stranded nickase activity, i.e., it can cleave one DNA strand to generate a single-stranded break (also known as a "nick"). In some embodiments, the RNA-guided DNA binding agent comprises a Cas nickase. A nickase is an enzyme that creates a nick in dsDNA, i.e., it cleaves one strand of the DNA double helix but not the other. In some embodiments, the Cas nickase is an aspect of a Cas nuclease (e.g., the Cas nucleases discussed above) in which the endonucleolytic active site has been inactivated, e.g., by one or more modifications (e.g., point mutations) in the catalytic domain. See, e.g., U.S. Pat. No. 8,889,356 for a discussion of Cas nickases and exemplary catalytic domain modifications. In some embodiments, the Cas nickase, such as the Cas9 nickase, has an inactivated RuvC or HNH domain.

[0078] In some embodiments, the RNA-guided DNA binding agent is modified to contain only one functional nuclease domain. For example, the drug protein may be modified to have one of the nuclease domains mutated or completely or partially deleted to reduce nucleic acid cleavage activity. In some embodiments, a nickase with a RuvC domain with reduced activity is used. In some embodiments, a nickase with an inactive RuvC domain is used. In some embodiments, a nickase with an HNH domain with reduced activity is used. In some embodiments, a nickase with an inactive HNH domain is used.

[0079] In some embodiments, conserved amino acids in the Cas protein nuclease domain are substituted to reduce or alter nuclease activity. In some embodiments, the Cas nuclease may include an amino acid substitution in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3):759-771. In some embodiments, the Cas nuclease may include an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB-A0Q7Q2(CPF1_FRATN)).

[0080] In some embodiments, a nickase is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of a target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), thereby introducing a DSB. In some embodiments, a nickase is used with two separate guide RNAs that target opposite strands of DNA, generating a double nick in the target DNA. In some embodiments, a nickase is used with two separate guide RNAs that are selected to be in close proximity to each other, generating a double nick in the target DNA.

[0081] In some embodiments, the RNA-guided DNA binding agent comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).

[0082] In some embodiments, the heterologous functional domain may facilitate the transport of the RNA-guided DNA binding agent to the cell nucleus. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binding agent may be fused with 1-10 NLS(s). In some embodiments, the RNA-guided DNA binding agent may be fused with 1-5 NLS(s). In some embodiments, the RNA-guided DNA binding agent may be fused with one NLS. When one NLS is used, the NLS may be linked at the N-terminal or C-terminal end of the sequence of the RNA-guided DNA binding agent. It may also be inserted within the sequence of the RNA-guided DNA binding agent. In other embodiments, the RNA-guided DNA binding agent may be fused with more than one NLS. In some embodiments, the RNA-guided DNA binding agent may be fused with two, three, four, or five NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the RNA-guided DNA binding agent is fused to a sequence of two SV40 NLSs linked at the carboxy-terminal end. In some embodiments, the RNA-guided DNA binding agent may be fused with two NLSs, one linked to the N-terminal end and one linked to the C-terminal end. In some embodiments, the RNA-guided DNA binding agent may be fused with three NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused without an NLS. In some embodiments, the NLS may be a monokaryotic sequence, such as the SV40 NLS, PKKKRKV (SEQ ID NO: 600) or PKKKRRV (SEQ ID NO: 601). In some embodiments, the NLS may be a bikaryotic sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 602). In certain embodiments, a single PKKKRKV (SEQ ID NO: 600) NLS may be linked at the C-terminal end of the RNA-guided DNA binding agent. One or more linkers are optionally included in the fusion site.

[0083] As mentioned above, the RNA-guided DNA binding agent can be a nucleic acid encoding an RNA-guided DNA-binding polypeptide. In some embodiments, the RNA-guided DNA binding agent comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binding agent, such as a Cas-integrated nuclease as described herein. In some embodiments, an RNA-guided DNA binding agent, such as an mRNA comprising an ORF encoding a Cas nuclease, is provided, used, or administered. As described below, an mRNA comprising a Cas nuclease can comprise a Cas9 nuclease, such as a S.pyogenes Cas9 nuclease with cleavase, nickase, and / or site-specific DNA binding activity. In some embodiments, the ORF encoding the RNA-guided DNA nuclease is a "modified RNA-guided DNA binding agent ORF" or simply a "modified ORF", which is used as an abbreviation to indicate that the ORF is modified.

[0084] Cas9 ORFs, including modified Cas9 ORFs, are provided herein and are known in the art. As an example, Cas9 ORFs can be codon-optimized such that the coding sequence includes one or more alternative codons for one or more amino acids. As used herein, "alternative codons" refers to variations in codon usage for a given amino acid, which may or may not be preferred or optimized codons (codon optimization) for a given expression system. Preferred codon usage, or codons that are well tolerated in a given expression system, are known in the art. The Cas9 coding sequences, Cas9 mRNAs, and Cas9 protein sequences of WO2013 / 176772, WO2014 / 065596, WO2016 / 106121, and WO2019 / 067910 are incorporated herein by reference. In particular, the ORF and Cas9 amino acid sequence in the table in paragraph

[0449] of WO2019 / 067910, and the Cas9 mRNA and ORF in paragraphs

[0214] to

[0234] of WO2019 / 067910 are incorporated by reference into this specification.

[0085] In some embodiments, the modified ORF may include a modified uridine at at least one, more than one, or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5 position, e.g., with a halogen, methyl, or ethyl. In some embodiments, the modified uridine is a pseudouridine modified at the 1 position, e.g., with a halogen, methyl, or ethyl. The modified uridine may be, e.g., pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methylpseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.

[0086] In some embodiments, the mRNA disclosed herein comprises a 5' cap, e.g., Cap0, Cap1, or Cap2. The 5' cap is generally a 7-methylguanine ribonucleotide (which may be further modified, e.g., for ARCA, as discussed below) linked via a 5'-triphosphate to the 5' position of the first nucleotide (i.e., the first cap-proximal nucleotide) of the 5'-3' strand of the mRNA. In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2'-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the mRNA both comprise a 2'-methoxy and a 2'-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2'-methoxy. See, for example, Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous higher eukaryotic mRNAs, including mammalian mRNAs such as human mRNAs, contain Cap1 or Cap2. Cap0 and other cap structures distinct from Cap1 and Cap2 may be immunogenic in mammals, such as humans, because they are recognized as "non-self" by components of the innate immune system, such as IFIT-1 and IFIT-5, and may cause increased levels of cytokines, including type I interferons. Components of the innate immune system, such as IFIT-1 and IFIT-5, may also compete with eIF4E for binding to mRNAs with caps other than Cap1 or Cap2, potentially inhibiting translation of the mRNA.

[0087] Caps can be included co-transcriptionally. For example, ARCA (anti-reverse cap analog, Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of guanine ribonucleotides and can be incorporated into transcripts in vitro at initiation. ARCA results in a Cap0 cap in which the 2' position of the first cap-proximal nucleotide is a hydroxyl. See, e.g., Stepinski et al., (2001) "Synthesis and properties of mRNAs containing the novel 'anti-reverse' cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG," RNA 7:1486-1495. The structure of ARCA is shown below. JPEG2025028917000001.jpg29164

[0088] CleanCap™ AG (m7G(5')ppp(5')(2'OMeA)pG, TriLink Biotechnologies catalog number N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG, TriLink Biotechnologies catalog number N-7133) can be used to provide the Cap1 structure co-transcriptionally. 3'-O-methylated versions of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies as catalog numbers N-7413 and N-7433, respectively. The structure of CleanCap™ AG is shown below. JPEG2025028917000002.jpg64168

[0089] Alternatively, a cap can be added to RNA post-transcriptionally. For example, Vaccinia capping enzyme is commercially available (New England Biolabs Catalog No. M2080S) and has RNA triphosphatase and guanylyltransferase activities provided by its D1 subunit and guanine methyltransferase provided by its D12 subunit. Thus, in the presence of S-adenosylmethionine and GTP, 7-methylguanine can be added to RNA to give Cap0. See, e.g., Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479.

[0090] In some embodiments, the mRNA further comprises a polyadenylation (poly-A) tail. In some embodiments, the poly-A tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, and optionally up to 300 adenines. In some embodiments, the poly-A tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides.

[0091] IV. Delivery method The nucleic acid construct disclosed herein can be delivered to a host cell or subject in vivo or ex vivo using various known suitable methods available in the art. The nucleic acid construct can be delivered together with the components of the suitable gene editing system described herein (e.g., RNA-guided DNA binding agent, such as Cas nuclease with its corresponding guide RNA).

[0092] Conventional viral and non-viral based gene delivery methods can be used to introduce the constructs disclosed herein and the components of the gene editing system into cells (e.g., mammalian cells) and target tissues. As further provided herein, non-viral vector delivery systems include non-viral vectors, nucleic acids such as plasmid vectors, and nucleic acids complexed with delivery vehicles such as liposomes, lipid nanoparticles (LNPs), or poloxamers. Viral vector delivery systems include DNA and RNA viruses.

[0093] Methods and compositions for non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, LNPs, polycation or lipid:nucleic acid complexes, naked nucleic acids (e.g., naked DNA / RNA), artificial virions, and drug-enhanced uptake of DNA. Sonoporation, for example using the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acids.

[0094] Further exemplary nucleic acid delivery systems include those provided by AmaxaBiosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Ma.), and Copernicus Therapeutics Inc. (see, e.g., U.S. Patent No. 6,008,336). Lipofection is described, for example, in U.S. Patent Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam™ and Lipofectin™). Preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known in the art and as described herein.

[0095] Various delivery systems (e.g., vectors, liposomes, LNPs) containing bidirectional constructs and / or gene editing components (e.g., guide RNA and Cas) can also be administered, alone or in combination, to an organism for delivery to cells in vivo, or to cells or cell cultures ex vivo. Administration is by any of the routes typically used to introduce molecules into blood, fluids, or ultimate contact with cells, including, but not limited to, injection, infusion, topical application, and electroporation. Suitable methods of administering such nucleic acids are available and well known to those skilled in the art.

[0096] In certain embodiments, the present disclosure provides a vector comprising the bidirectional nucleic acid construct disclosed herein for delivery to a host cell.In certain embodiments, the components of the gene editing system (e.g., RNA-guided DNA binding agent and guide RNA) are also delivered to the host cell as part of the vector.In certain embodiments, a viral vector can be used to deliver any one or more of the bidirectional nucleic acid construct, guide RNA, and / or RNA-guided DNA binding agent to the host cell.

[0097] In some embodiments, compositions and methods are provided herein for delivering the bidirectional nucleic acid constructs disclosed herein to a host cell or subject, where the constructs are part of a vector system described herein. In some embodiments, the vector system includes additional components, such as components of a gene editing system (e.g., a guide RNA and / or an RNA-guided DNA binding agent).

[0098] In some embodiments, disclosed herein is a vector composition comprising the bidirectional nucleic acid construct disclosed herein. In some embodiments, the composition further comprises a component of a gene editing system (e.g., a guide RNA and / or an RNA-guided DNA binding agent).

[0099] In some embodiments, the vector may be circular. In other embodiments, the vector may be linear. In some embodiments, the vector may be delivered via a lipid nanoparticle, a liposome, a non-lipid nanoparticle, or a viral capsid. Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, mini-chromosomes, transposons, viral vectors, and expression vectors.

[0100] In some embodiments, the vector system may be capable of driving expression of one or more nuclease components in the cell. In some embodiments, the bidirectional construct, optionally as part of the vector system, may include a promoter capable of driving expression of a coding sequence in the cell. In some embodiments, the cell may be a eukaryotic cell, such as a yeast, plant, insect, or mammalian cell. In some embodiments, the eukaryotic cell may be a mammalian cell. In some embodiments, the eukaryotic cell may be a rodent cell. In some embodiments, the eukaryotic cell may be a human cell. Suitable promoters for driving expression in different types of cells are known in the art. In some embodiments, the promoter may be wild type. In other embodiments, the promoter may be modified for more efficient or effective expression. In still other embodiments, the promoter may be truncated but still maintain its function. For example, the promoter may have a normal or reduced size suitable for proper packaging of the vector into a virus. In some embodiments, the vector does not include a promoter that drives expression of one or more coding sequences in the cell (e.g., expression of the coding sequence is driven by an endogenous promoter when inserted into the target endogenous locus).

[0101] In some embodiments, the vector may be a viral vector. In some embodiments, the viral vector may be genetically modified from its wild-type counterpart. For example, the viral vector may include one or more nucleotide insertions, deletions, or substitutions to facilitate cloning or to alter one or more properties of the vector. Such properties may include packaging ability, transduction efficiency, immunogenicity, genomic integration, replication, transcription, and translation. In some embodiments, a portion of the viral genome may be deleted to allow the virus to package foreign sequences having a larger size. In some embodiments, the viral vector may have enhanced transduction efficiency. In some embodiments, the immune response elicited by the virus in the host may be reduced. In some embodiments, a viral gene that facilitates integration of viral sequences into the host genome (such as integrase) may be mutated to render the virus non-integrating. In some embodiments, the viral vector may be replication-deficient. In some embodiments, the viral vector may include foreign transcriptional or translational control sequences that drive expression of coding sequences on the vector. In some embodiments, the virus may be helper-dependent. For example, the virus may require one or more helper viruses to provide viral components (e.g., viral proteins, etc.) required to amplify and package the vector into a viral particle. In such cases, one or more helper components, including one or more vectors encoding viral components, may be introduced into a host cell along with the vector system described herein. In some embodiments, the virus may be helper-free. For example, the virus may be capable of amplifying and packaging the vector without a helper virus. In some embodiments, the vector system described herein may also encode viral components required for viral amplification and packaging.

[0102] The use of RNA or DNA virus-based systems for delivery of nucleic acids takes advantage of the highly evolved processes for targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. Viral vectors can be administered directly to a subject (in vivo) or they can be used to treat cells in vitro. In some embodiments, cells modified in vitro are administered to a subject (e.g., as an ex vivo manipulation of cells from a subject or from a donor source). Non-limiting exemplary viral vectors include adeno-associated virus (AAV) vectors, lentivirus vectors, adenovirus vectors, helper-dependent adenovirus vectors (HDAd), herpes simplex virus (HSV-1) vectors, bacteriophage T4, baculovirus vectors, and retrovirus vectors. Integration within the host genome is possible, for example, with retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiency has been observed in many different cell types and target tissues.

[0103] The tropism of retroviruses can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and typically produce high viral titers. The choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimal cis-acting LTRs are sufficient for vector replication and packaging, which are then used to integrate the transgene-containing bidirectional construct into target cells and provide persistent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT / US94 / 05700).

[0104] In some embodiments, an adenovirus-based system can be used. Adenovirus-based vectors can have very high transduction efficiency in many cell types and do not require cell division. Such vectors have been used to obtain high titers and high levels of expression. The vectors can be produced in large quantities in a relatively simple system. Replication-deficient recombinant adenovirus vectors can be produced at high titers and easily infect several different cell types. Most adenovirus vectors are engineered such that a transgene replaces the Ad E1a, E1b, and / or E3 genes, and the replication-deficient vector is then propagated in human 293 cells that supply the deleted gene function in trans. Ad vectors can transduce multiple types of tissues in vivo, including non-dividing differentiated cells such as those found in liver, kidney, and muscle. Traditional Ad vectors have a large transport capacity. An example of the use of Ad vectors in clinical trials involved polynucleotide therapy for anti-tumor immunization by intramuscular injection (Sterman et al., Hum. Gene Ther. 7:1083-9 (1998)). Further examples of the use of adenovirus vectors for gene transfer in clinical trials include Rosenecker et al., Infection 24:1 5-10 (1996); Sterman et al., Hum. Gene Ther. 9:7 1083-1089 (1998); Welsh et al., Hum. Gene Ther. 2:205-18 (1995); Alvarez et al., Hum. Gene Ther. 5:597-613 (1997); Topf et al., Gene Ther. 5:507-513 01998); Sterman et al., Hum. Gene Ther. 7:1083-1089 (1998).

[0105] In some embodiments, adeno-associated virus (AAV) vectors are used to deliver the bidirectional nucleic acid constructs provided herein. AAV vectors are well known and have been used to transduce cells with target nucleic acids, for example, in the in vitro production of nucleic acids and peptides, and in in vivo and ex vivo gene therapy procedures (see, for example, West et al., Virology 160:38-47 (1987); U.S. Patent No. 4,797,368; WO93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994)). The construction of recombinant AAV vectors has been described in several publications, including U.S. Patent No. 5,173,414, Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985), Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984), Hermonat & Muzyczka, PNAS 81:6466-6470 (1984), and Samulski et al., J. Virol. 63:03822-3828 (1989). In some embodiments, the viral vector may be an AAV vector. In some embodiments, the AAV vector is, for example, AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, or AAVLK03, as well as any novel AAV serotypes may also be used in accordance with the present invention. AAV Vectors Recombinant adeno-associated virus vectors are a promising alternative nucleic acid delivery system, for example, based on the defective and non-pathogenic parvovirus adeno-associated type 2 virus.

[0106] As used herein, "AAV" refers to all serotypes, subtypes, and naturally occurring AAV, as well as recombinant AAV. "AAV" can be used to refer to the virus itself or its derivatives. The term "AAV" includes AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10, and hybrids thereof, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. The genome sequences of various serotypes of AAV, as well as the sequences of natural terminal repeats (TRs), Rep proteins, and capsid subunits, are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. As used herein, "AAV vector" refers to an AAV vector that contains heterologous sequences that are not of AAV origin (i.e., nucleic acid sequences that are heterologous to AAV), and typically contains sequences that code for heterologous polypeptides of interest. The construct may comprise AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10, and hybrids thereof, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV capsid sequences. In general, the heterologous nucleic acid sequence (transgene) is flanked by at least one, and generally two, AAV inverted terminal repeats (ITRs). AAV vectors may be either single-stranded (ssAAV) or self-complementary (scAAV).

[0107] In some embodiments, the viral vector may be a lentiviral vector. In some embodiments, the lentivirus may be non-integrating. In some embodiments, the viral vector may be an adenoviral vector. In some embodiments, the adenovirus may be a high cloning capacity, or "gutless" adenovirus, in which all coding viral regions are free of the 5' and 3' inverted terminal repeats (ITRs) and the packaging signal ("I") has been deleted from the virus to increase its packaging capacity. In yet other embodiments, the viral vector may be an HSV-1 vector. In some embodiments, the HSV-1 based vector is helper dependent, while in other embodiments, it is vector independent. For example, an amplicon vector that retains only the packaging sequence requires a helper virus that has structural components for packaging, while a 30 kb deleted HSV-1 vector that has removed non-essential viral functions does not require a helper virus. In further embodiments, the viral vector may be bacteriophage T4. In some embodiments, bacteriophage T4 can package any linear or circular DNA or RNA molecule when the viral head is empty. In further embodiments, the viral vector can be a baculovirus vector. In yet further embodiments, the viral vector can be a retrovirus vector. In embodiments using AAV or lentivirus vectors with smaller cloning capacity, it may be necessary to use more than one vector to deliver all the components of the vector system as disclosed herein. For example, one AAV vector can contain a sequence encoding an RNA-guided DNA-binding agent such as a Cas protein (e.g., Cas9), while a second AAV vector can contain one or more guide sequences.

[0108] Packaging cells are used to form viral particles that can infect host cells. Such cells include 293 cells, which can package adenovirus and AAV, and Ψ2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by producer cell lines that package nucleic acid vectors into viral particles. The vectors typically contain minimal viral sequences required for packaging, with other viral sequences being replaced by sequences that code for proteins to be expressed. Missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only have inverted terminal repeat (ITR) sequences from the AAV genome that are required for packaging. Viral DNA is packaged in cell lines that contain a helper plasmid that codes for other AAV genes, namely rep and cap, but lacks ITR sequences. The cell line can also be infected with adenovirus as a helper. The helper virus promotes the replication of the AAV vector and the expression of the AAV genes from the helper plasmid.

[0109] Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial injection) or local application, as described below. Alternatively, vectors can be delivered ex vivo to cells removed from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsies) or cells such as universal donor hematopoietic stem cells, which can then be reimplanted into the patient, usually after selection of cells that have incorporated the vector.

[0110] In some embodiments, in addition to the bidirectional nucleic acid constructs disclosed herein, the vector system may further comprise a nucleic acid encoding a nuclease. In some embodiments, in addition to the bidirectional nucleic acid constructs disclosed herein, the vector system may further comprise a nucleic acid encoding a guide RNA and / or a nucleic acid encoding an RNA-guided DNA binder (which may be a Cas protein such as Cas9). In some embodiments, the nucleic acid encoding the guide RNA and / or the nucleic acid encoding the RNA-guided DNA binder or the nuclease are each or both on a vector separate from the vector comprising the bidirectional constructs disclosed herein. In any of the embodiments, the vector system may comprise other sequences, including but not limited to promoters, enhancers, control sequences, as described herein. In some embodiments, a promoter in the vector system does not drive expression of the transgene of the bidirectional construct. In some embodiments, the vector system comprises one or more nucleotide sequence(s) encoding a crRNA, a trRNA, or a crRNA and a trRNA. In some embodiments, the vector comprises one or more nucleotide sequence(s) encoding the sgRNA and an mRNA encoding an RNA-guided DNA binding agent, which may be a Cas nuclease (e.g., Cas9). In some embodiments, the vector system comprises one or more nucleotide sequence(s) encoding the crRNA, trRNA and an mRNA encoding an RNA-guided DNA binding agent, which may be a Cas nuclease, such as Cas9. In some embodiments, the Cas9 is from Streptococcus pyogenes (i.e., Spy Cas9). In some embodiments, the nucleotide sequence encoding the crRNA, trRNA, or the crRNA and trRNA (which may be the sgRNA) comprises or consists of a guide sequence flanked by all or a portion of repeat sequences from a naturally occurring CRISPR / Cas system.The vector system may include a nucleic acid that includes or consists of crRNA, trRNA, or crRNA and trRNA, and the vector system includes or consists of a nucleic acid that is not naturally found with crRNA, trRNA, or crRNA and trRNA. Any of the vectors described herein may be delivered by liposomes, nanoparticles, exosomes, microvesicles, and / or lipid nanoparticles (LNPs). Donor constructs that include one or more guide RNAs, RNA-binding DNA binders (e.g., mRNA), or sequences encoding heterologous proteins may be delivered by liposomes, nanoparticles, exosomes, or microvesicles, individually or in any combination. Donor constructs that include one or more guide RNAs, RNA-binding DNA binders (e.g., mRNA), or sequences encoding heterologous proteins may be delivered by LNPs, individually or in any combination. Any of the LNPs and LNP formulations described herein are suitable for delivery of guides.

[0111] Lipid nanoparticles (LNPs) are well-known means for the delivery of nucleotide and protein cargoes and can be used to deliver the bidirectional nucleic acid constructs disclosed herein. In some embodiments, LNPs can be used to deliver components of gene editing systems. In some embodiments, LNPs deliver nucleic acids (e.g., DNA or RNA), proteins (e.g., RNA-guided DNA binders), or nucleic acids together with proteins.

[0112] In some embodiments, provided herein are methods for delivering a bidirectional nucleic acid construct disclosed herein to a host cell or subject, wherein the construct is delivered via an LNP. In some embodiments, provided herein are methods for delivering a bidirectional nucleic acid construct disclosed herein to a host cell or subject, wherein one or more components of a gene editing system, such as a CRISPR / Cas nuclease system, are delivered via an LNP. In some embodiments, the LNP comprises the bidirectional construct and / or one or more components of the gene editing system (e.g., a guide RNA and / or an RNA-guided DNA binding agent or an mRNA encoding an RNA-guided DNA binding agent).

[0113] In some embodiments, compositions are provided herein that include the bidirectional nucleic acid constructs disclosed herein and LNPs. In some embodiments, the compositions further include components of a gene editing system (e.g., a guide RNA and / or an RNA-guided DNA binding agent, such as Cas9 or a vector system that can encode it). In some embodiments, compositions are provided herein that include the bidirectional nucleic acid constructs disclosed herein and LNPs that include mRNA that encodes a guide RNA and / or an RNA-guided DNA binding agent, such as Cas9.

[0114] In some embodiments, the LNPs comprise a biodegradable ionic lipid. In some embodiments, the LNPs comprise (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate), also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, or another ionic lipid. See, e.g., the lipids of PCT / US2018 / 053559 (filed September 28, 2018), WO / 2017 / 173054, WO2015 / 095340, and WO2014 / 136086, and the references provided therein. In some embodiments, in the context of LNP lipids, the terms cationic and ionizable are interchangeable, e.g., an ionizable lipid is cationic depending on the pH.

[0115] Electroporation is a well-known means for delivery of cargo, and any electroporation methodology can be used to deliver the bidirectional constructs disclosed herein. In some embodiments, electroporation can be used to deliver the bidirectional constructs disclosed herein, optionally with guide RNA and / or RNA-guided DNA binding agents (e.g., Cas9) or mRNA encoding RNA-guided DNA binding agents (e.g., Cas9) delivered by the same or different means.

[0116] In some embodiments, the disclosure includes a method of delivering a bidirectional construct disclosed herein to a cell in vitro, wherein the bidirectional construct is delivered via LNP. In some embodiments, the bidirectional construct is delivered by a non-LNP means, such as via an AAV system, and the guide RNA and / or the RNA-guided DNA binding agent (e.g., Cas9) or the mRNA encoding the RNA-guided DNA binding agent (e.g., Cas9) is delivered by LNP.

[0117] In some embodiments, the bidirectional constructs described herein, alone or as part of a vector, are formulated in or administered via lipid nanoparticles, see, e.g., WO / 2017 / 173054, the contents of which are incorporated herein by reference in their entirety.

[0118] Any of the vectors described herein can be delivered by LNP. Any of the LNPs and LNP formulations described herein are suitable for delivery of the gRNA, Cas nuclease or mRNA encoding Cas nuclease, combinations thereof, and / or bidirectional constructs disclosed herein. In some embodiments, LNP compositions are included that include an RNA component and a lipid component, where the lipid component includes an amine lipid, such as a biodegradable ionic lipid, and the RNA component includes a guide RNA and / or an mRNA encoding a Cas nuclease.

[0119] In some examples, the lipid component includes a biodegradable, ionic lipid, cholesterol, DSPC, and PEG-DMG.

[0120] It will be apparent that the components of the gene editing system (e.g., guide RNA and / or RNA-guided DNA binding agent) and the bidirectional construct can be delivered using the same or different systems. For example, the guide RNA, the RNA-guided DNA binding agent sequence, and the bidirectional construct can be carried by the same vector (e.g., AAV vector) or can be formulated with one or more LNP components. Alternatively, the RNA-guided DNA binding agent (as a protein or mRNA) and / or gRNA can be carried by or associated with the LNP, while the bidirectional construct can be carried by a vector, or vice versa. Furthermore, the different delivery systems can be administered by the same or different routes.

[0121] The different delivery systems can be delivered in vitro or in vivo simultaneously or in any sequential order. In some embodiments, the bidirectional construct, guide RNA, and RNA-guided DNA binding agent can be delivered in vitro or in vivo simultaneously, for example, in one vector, two vectors, individual vectors, one LNP, two LNPs, individual LNPs, or combinations thereof. In some embodiments, the bidirectional construct can be delivered in vivo or in vitro as a vector and / or in association with LNPs (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more) before the guide RNA and / or RNA-guided DNA binding agent is delivered as a vector and / or in association with LNPs alone or in combination as ribonucleoproteins (RNPs). In some embodiments, the donor construct can be delivered in multiple doses, for example, every day, every 2 days, every 3 days, every 4 days, every week, every 2 weeks, every 3 weeks, or every 4 weeks. In some embodiments, the donor construct may be delivered at weekly intervals, such as, for example, at week 1, week 2, and week 3. As a further example, the guide RNA and / or the RNA-guided DNA binding agent may be delivered in vivo or in vitro (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more) before delivery of the bidirectional construct as a vector and / or in association with the LNP, alone or in combination with the LNP. In some embodiments, the albumin guide RNA may be delivered in multiple doses, for example, every day, every 2 days, every 3 days, every 4 days, every week, every 2 weeks, every 3 weeks, or every 4 weeks. In some embodiments, the albumin guide RNA may be delivered at weekly intervals, such as, for example, at week 1, week 2, and week 3. In some embodiments, the Cas nuclease can be delivered in multiple doses, for example, every day, every 2nd day, every 3rd day, every 4th day, every week, every 2 weeks, every 3 weeks, or every 4 weeks. In some embodiments, the Cas nuclease can be delivered at weekly intervals, for example, at week 1, week 2, and week 3.

[0122] V. How to use The present disclosure provides methods of using the bidirectional nucleic acid constructs described herein in various applications. In some embodiments, the methods of using the bidirectional nucleic acid constructs described herein in various applications include the use of gene editing systems, such as CRISPR / Cas systems, as described herein.

[0123] In some embodiments, provided herein are in vitro or in vivo methods of modifying a target locus (e.g., inserting a transgene at a target site within the locus) comprising administering or delivering to a host cell a bidirectional nucleic acid construct as described herein, a guide RNA, and an RNA-guided DNA binding agent as described herein (e.g., a Cas nuclease such as Cas9). In some embodiments, provided herein are in vitro or in vivo methods of modifying a target locus comprising cleaving a target sequence in a host cell, optionally using in the cleavage step a guide RNA and an RNA-guided DNA binding agent as described herein (e.g., a Cas nuclease such as Cas9), and inserting a bidirectional nucleic acid construct as described herein.

[0124] In some embodiments, provided herein are in vitro or in vivo methods of introducing a construct into a host cell, comprising administering or delivering to the host cell a bidirectional nucleic acid construct described herein, a guide RNA, and an RNA-guided DNA binding agent (e.g., a Cas nuclease, such as Cas9) described herein. In some embodiments, provided herein are in vitro or in vivo methods of introducing a construct into a host cell, comprising administering or delivering to the host cell a bidirectional nucleic acid construct described herein, and a gene editing system, such as a ZFN, TALEN, or CRISPR / Cas9 system.

[0125] In some embodiments, provided herein is an in vitro or in vivo method for increasing expression of a polypeptide in a host cell, comprising administering or delivering to the host cell a bidirectional nucleic acid construct as described herein, a guide RNA, and an RNA-guided DNA binding agent (e.g., a Cas nuclease, such as Cas9) as described herein. In some embodiments, provided herein is an in vitro or in vivo method for increasing expression of a polypeptide in a host cell, comprising administering or delivering to the host cell a bidirectional nucleic acid construct as described herein, and a gene editing system, such as a ZFN, TALEN, or CRISPR / Cas9 system. The polypeptide may be extracellular.

[0126] The bidirectional construct can be administered via a vector, such as a nucleic acid vector. The guide RNA and the RNA-guided DNA binding agent can be administered individually or in any combination, for example, via LNPs that contain the mRNA encoding the guide RNA and the RNA-guided DNA binding agent. Administration and delivery to the host cell can be effected by any of the delivery methods described herein.

[0127] In some embodiments, provided herein is an in vitro or in vivo method of expressing a polypeptide encoded by a transgene at a target locus, comprising administering or delivering to a host cell a bidirectional nucleic acid construct as described herein, a guide RNA, and an RNA-guided DNA-binding agent as described herein (e.g., a Cas nuclease, such as Cas9). In some embodiments, provided herein is an in vitro or in vivo method of expressing a polypeptide encoded by a transgene at a target locus, comprising administering or delivering to a host cell a bidirectional nucleic acid construct as described herein, and a gene editing system, such as a ZFN, TALEN, or CRISPR / Cas9 system. In some embodiments, a method of generating a host cell for expressing a polypeptide comprises administering or delivering to a host cell a bidirectional nucleic acid construct as described herein, and a gene editing system, such as a ZFN, TALEN, or CRISPR / Cas9 system.

[0128] The bidirectional construct, the guide RNA, and the RNA-guided DNA binding agent can be administered individually or in any combination, for example, as described herein. In some embodiments, the bidirectional construct, the guide RNA, and the RNA-guided DNA binding agent can be delivered simultaneously or sequentially, for example, in one vector, two vectors, individual vectors, one LNP, two LNP, individual LNP, or a combination thereof. Administration and delivery to the host cell can be effected by any of the delivery methods described herein.

[0129] Additionally, in some embodiments, the method involves an insertion into an albumin locus, such as albumin intron 1, using a guide RNA comprising a sequence selected from any of Tables 5, 6, 7, 8, 9, and 10. In certain embodiments involving an insertion into an albumin locus, the individual's circulating albumin level is normal. The method may include maintaining the individual's circulating albumin level within ±5, ±10, ±15, ±20, or ±50% of the normal circulating albumin level. In certain embodiments, the individual's albumin level is unchanged by at least 4 weeks, 8 weeks, 12 weeks, or 20 weeks, compared to the albumin level of an untreated individual. In certain embodiments, the individual's albumin level is temporarily reduced and then returns to normal levels. In particular, the method may include not detecting a significant change in the level of plasma albumin.

[0130] In some embodiments, the invention includes a method or use thereof for modifying an albumin gene, such as a human albumin gene, comprising administering or delivering to a host cell or a host cell population any one or more of the gRNA, a donor construct (e.g., a bidirectional construct comprising a sequence encoding factor IX), and an RNA-guided DNA binding agent (e.g., a Cas nuclease) described herein. In some embodiments, the invention includes a method or use thereof for modifying an albumin intron 1 region, such as human albumin intron 1, comprising administering or delivering to a host cell or a host cell population any one or more of the gRNA, a donor construct (e.g., a bidirectional construct comprising a nucleic acid encoding a heterologous polypeptide), and an RNA-guided DNA binding agent (e.g., a Cas nuclease or a nucleic acid encoding a Cas nuclease) described herein. In some embodiments, the invention includes a method or use of modifying a human safe harbor, such as a liver cell or hepatocyte host cell, (e.g., creating a double-stranded break) comprising administering or delivering to a host cell or host cell population any one or more of the gRNAs, donor constructs (e.g., bidirectional constructs comprising a sequence encoding a heterologous polypeptide), and RNA-guided DNA binding agents (e.g., Cas nucleases or nucleic acids encoding Cas nucleases) described herein.

[0131] Insertion and / or expression of a transgene can be at its cognate locus (e.g., insertion of a wild-type transgene into an endogenous locus) or into a non-cognate locus (e.g., a safe harbor locus such as albumin), as described herein.

[0132] In some embodiments, the host cell is a non-dividing cell type. As used herein, "non-dividing cells" refers to terminally differentiated, non-dividing cells, as well as quiescent cells that do not divide but retain the ability to re-enter cell division and proliferation. For example, liver cells retain the ability to divide (e.g., when injured or ablated), but do not typically divide. During mitotic cell division, homologous recombination is the mechanism by which the genome is protected and double-stranded breaks are repaired. In some embodiments, "non-dividing" cells refer to cells in which homologous recombination (HR) is not the primary mechanism by which double-stranded DNA breaks are repaired in the cell, e.g., compared to control dividing cells. In some embodiments, "non-dividing" cells refer to cells in which non-homologous end joining (NHEJ) is the primary mechanism by which double-stranded DNA breaks are repaired in the cell, e.g., compared to control dividing cells. Non-dividing cell types have been described in the literature, e.g., by active NHEJ double-stranded DNA break repair mechanisms. See, for example, Iyama, DNA Repair (Amst.) 2013, 12(8):620-636. In some embodiments, the host cell includes, but is not limited to, a liver cell, a muscle cell, or a neuronal cell. In some embodiments, the host cell is a liver cell, such as a mouse, a cynomolgus monkey, or a human liver cell. In some embodiments, the host cell is a muscle cell, such as a mouse, a cynomolgus monkey, or a human muscle cell. In some embodiments, provided herein is a host cell as described above, comprising a bidirectional construct as disclosed herein. In some embodiments, the host cell expresses a transgene polypeptide encoded by a bidirectional construct as disclosed herein. In some embodiments, provided herein is a host cell produced by a method as disclosed herein. In certain embodiments, the host cell is produced by administering or delivering to the host cell a bidirectional nucleic acid construct as disclosed herein and a gene editing system, such as a ZFN, TALEN, or CRISPR / Cas9 system.

[0133] Methods of expressing a polypeptide from a bidirectional construct described herein are also provided. Similarly, a host cell comprising a bidirectional construct described herein can express a polypeptide encoded by the construct. In some embodiments, the polypeptide is a secreted polypeptide. In some embodiments, the polypeptide is one whose function normally acts (e.g., is functionally active) as a secreted polypeptide. As used herein, a "secreted polypeptide" refers to a protein that is secreted by a cell. In some embodiments, the polypeptide is an intracellular polypeptide. In some embodiments, the polypeptide is one whose function normally acts (e.g., is functionally active) within a cell. As used herein, an "intracellular polypeptide" refers to a protein that is not secreted by a cell, including soluble cytoplasmic polypeptides. In some embodiments, the polypeptide is a wild-type polypeptide. In some embodiments, the polypeptide is a mutant polypeptide (e.g., a hyperactive mutant of a wild-type polypeptide). In some embodiments, the polypeptide is a liver protein. In some embodiments, the polypeptide is a non-liver protein. In some embodiments, the polypeptide includes, but is not limited to, factor IX and variants thereof. In some embodiments, the liver polypeptide is a polypeptide for treating a liver disorder such as, for example, but not limited to, tyrosinemia, Wilson's disease, Tay-Sachs disease, hyperbilirubinemia (Crigler-Najjar), acute intermittent porphyria, type 1 citrullinemia, progressive familial intrahepatic cholestasis, or maple syrup urine disease.

[0134] In some embodiments, the method further comprises achieving a long-term effect, e.g., at least 1 month, 2 months, 6 months, 1 year, or 2 years of effect. In some embodiments, the method further comprises achieving a therapeutic effect in a long-term and sustained manner, e.g., at least 1 month, 2 months, 6 months, 1 year, or 2 years of effect. In some embodiments, the level of heterologous polypeptide activity and / or level is stable for at least 1 month, 2 months, 6 months, 1 year, or more. In some embodiments, steady state activity and / or level of the polypeptide is achieved by at least 7 days, at least 14 days, or at least 28 days. In further embodiments, the method comprises maintaining the heterologous polypeptide activity and / or protein level for at least 1, 2, 4, or 6 months, or at least 1, 2, 3, 4, or 5 years after a single administration of the bidirectional construct.

[0135] In some embodiments, expression of the polypeptide by a host cell (whether in vitro or in vivo) is increased by at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or more relative to the level expressed by a host cell control that has not been administered a construct containing a transgene. In some embodiments, expression of the polypeptide by a host cell (whether in vitro or in vivo) is increased by at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more of a known normal level (e.g., the level of the polypeptide in a healthy subject). In some embodiments, expression of the polypeptide by a host cell (whether in vitro or in vivo) is at least about 1 μg / ml, 2 μg / ml, 3 μg / ml, 4 μg / ml, 5 μg / ml, 6 μg / ml, 7 μg / ml, 8 μg / ml, 9 μg / ml, 10 μg / ml, 15 μg / ml, 20 μg / ml, 25 μg / ml, 30 μg / ml, 35 μg / ml, 40 μg / ml, 45 μg / ml, 50 μg / ml, 55 μg / ml, 60 μg / ml, 65 μg / ml, 70 μg / ml, 75 μg / ml, 80 μg / ml, 85 μg / ml, 90 μg / ml, 95 μg / ml, 100 μg / ml, 120 μg / ml, 140 μg / ml, 160 μg / ml, 180 μg / ml, 190 μg / ml, 200 μg / ml, 210 μg / ml, 220 μg / ml, 230 μg / ml, 240 μg / ml, 250 μg / ml, 260 μg / ml, 270 μg / ml, 280 μg / ml, 290 μg / ml, 300 μg / ml, 310 μg / ml, 320 μg / ml, 330 μg / ml, 340 μg / ml, 350 μg / ml, 360 μg / ml, 370 μg / ml, 380 μg / ml, 390 μg / ml, 400 μg / ml, 400 μg / ml, 400 μg / ml, 400 μg / ml, 400 μg / ml 40μg / ml, 160μg / ml, 180μg / ml, 200μg / ml, 225μg / ml, 250μg / ml, 275μg / ml, 300μg / ml, 325μg / m l, 350μg / ml, 400μg / ml, 450μg / ml, 500μg / ml, 550μg / ml, 600μg / ml, 650μg / ml, 700μg / ml, 750μ g / ml, 800 μg / ml, 850 μg / ml, 900 μg / ml, 1000 μg / ml, 1100 μg / ml, 1200 μg / ml, 1300 μg / ml, 1400 μg / ml, 1500 μg / ml, 1600 μg / ml, 1700 μg / ml, 1800 μg / ml, 1900 μg / ml, 2000 μg / ml, or more.

[0136] In some embodiments, the present invention provides a method for treating liver-related disorders by the methods described herein.As used herein, "liver-related disorders" refers to disorders that directly cause damage to liver tissue, disorders that result from damage to liver tissue, and / or disorders of non-liver organs or tissues that result from defects in the liver.

[0137] In some embodiments, the bidirectional construct, the guide RNA, and the RNA-guided DNA binding agent are administered individually or in any combination locally or systemically, for example, intravenously. In some embodiments, the bidirectional construct, the guide RNA, and the RNA-guided DNA binding agent are administered individually or in any combination into the hepatic circulation.

[0138] In some embodiments, the host or subject is a mammal. In some embodiments, the host or subject is a human. In some embodiments, the host or subject is a primate. In some embodiments, the host or subject is a rodent (e.g., mouse, rat), cow, pig, monkey, sheep, dog, cat, fish, or poultry.

[0139] This description and exemplary embodiments should not be construed as limiting. For the purposes of this specification and the appended claims, unless otherwise specified, all numbers expressing quantities, percentages or proportions, and other numerical values ​​used in the specification and claims should be understood to be modified in each case to the extent that they are not yet so modified by the term "about". Thus, unless otherwise indicated, the numerical parameters set forth in the following specification and the appended claims are approximations that may vary depending on the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. The present invention also relates to the following: [Item 1] 1. A bidirectional nucleic acid construct comprising: a) a first segment comprising a coding sequence for an agent, such as a polypeptide; and b) a second segment comprising the reverse complement of the coding sequence of the agent; wherein said construct does not comprise a promoter driving expression of said agent, such as a polypeptide. [Item 2] 1. A bidirectional nucleic acid construct comprising: a) a first segment comprising a coding sequence for a first agent, such as a first polypeptide; and b) a second segment comprising the reverse complement of a coding sequence for a second agent, such as a second polypeptide. wherein said construct does not comprise a promoter driving expression of said agent(s). [Item 3] 3. The bidirectional nucleic acid construct of claim 1 or 2, wherein the second segment is 3' of the first segment. [Item 4] 4. The bidirectional nucleic acid construct of any one of claims 1 to 3, wherein the coding sequence of the reverse complement in the second segment adopts a different codon usage than that of the first coding sequence of the first segment. [Item 5] 5. The bidirectional nucleic acid construct of any one of items 1 to 4, wherein the second segment comprises a nucleotide sequence having at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, or about 99% complementarity to the coding sequence in the first segment. [Item 6] 6. The bidirectional nucleic acid construct according to any one of items 1 to 5, wherein the coding sequence of the second segment encodes the polypeptide using one or more alternative codons for one or more amino acids encoded by the coding sequence in the first segment. [Item 7] 7. The bidirectional nucleic acid construct of any one of items 1 to 6, wherein the second segment comprises a reverse complement of the coding sequence of the first segment, or a fragment thereof. [Item 8] The reverse complement is a. is not substantially complementary to the coding sequence of the first segment; b. is not substantially complementary to a fragment of the coding sequence of the first segment; c. highly complementary to the coding sequence of the first segment; d. highly complementary to a fragment of the coding sequence of the first segment; e. at least 60% identical to the reverse complement of the coding sequence of the first segment; f. at least 70% identical to the reverse complement of the coding sequence of the first segment; f. at least 90% identical to the reverse complement of the coding sequence of the first segment; g. is 50-80% identical to the reverse complement of the coding sequence of the first segment; and / or h. 60-100% identical to the reverse complement of the coding sequence of the first segment; 8. The bidirectional nucleic acid construct according to item 7. [Item 9] 9. The bidirectional nucleic acid construct according to any one of items 1 to 8, wherein the construct does not comprise homology arms. [Item 10] 10. The bidirectional nucleic acid construct according to any one of items 1 to 9, wherein the first segment is linked to the second segment by a linker. [Item 11] 11. The bidirectional nucleic acid construct of item 10, wherein the linker is about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 1500, 2000 nucleotides in length. [Item 12] 12. The bidirectional nucleic acid construct of any one of items 1 to 11, wherein each of the first and second segments comprises a polyadenylation sequence, such as a polyadenylation signal sequence or a polyadenylation tail sequence. [Item 13] 13. The bidirectional nucleic acid construct according to any one of items 1 to 12, wherein the construct comprises a splice acceptor site. [Item 14] 14. The bidirectional nucleic acid construct of claim 13, wherein the construct comprises a first splice acceptor site 5' of the first segment and a second splice acceptor site 3' of the second segment. [Item 15] 15. The bidirectional nucleic acid construct according to any one of items 1 to 14, wherein the construct is double-stranded, optionally double-stranded DNA. [Item 16] 16. The bidirectional nucleic acid construct according to any one of items 1 to 15, wherein the construct is single-stranded, optionally single-stranded DNA. [Item 17] 17. The bidirectional nucleic acid construct according to any one of items 1 to 16, wherein the sequence encoding the polypeptide is codon-optimized. [Item 18] 18. The bidirectional nucleic acid construct of any one of items 1 to 17, wherein the construct comprises one or more of the following terminal structures: a hairpin, a loop, an inverted terminal repeat (ITR), or a toroid. [Item 19] 19. The bidirectional nucleic acid construct of any one of items 1 to 18, wherein the construct comprises one, two, or three inverted terminal repeats (ITRs). [Item 20] 20. The bidirectional nucleic acid construct according to any one of items 1 to 19, wherein the construct comprises no more than two ITRs. [Item 21] 21. The bidirectional nucleic acid construct according to any one of items 1 to 20, wherein the polypeptide is a secreted polypeptide. [Item 22] 21. The bidirectional nucleic acid construct according to any one of items 1 to 20, wherein the polypeptide is an intracellular polypeptide. [Item 23] 23. The bidirectional nucleic acid construct according to any one of items 2 to 22, wherein the first polypeptide and the second polypeptide are different. [Item 24] 24. The bidirectional nucleic acid construct according to any one of items 1 to 23, wherein the polypeptide is a variant polypeptide. [Item 25] 25. The bidirectional nucleic acid construct according to any one of items 1 to 24, wherein the polypeptide is a liver protein. [Item 26] 25. The bidirectional nucleic acid construct according to any one of items 1 to 24, wherein the polypeptide is a non-liver protein. [Item 27] 27. The bidirectional nucleic acid construct according to any one of items 1 to 26, wherein the construct is a homology-independent construct. [Item 28] 28. The bidirectional nucleic acid construct of any one of items 1 to 27, wherein the polypeptide, when expressed, comprises a heterologous signal peptide. [Item 29] 29. The bidirectional nucleic acid construct according to any one of items 1 to 28, wherein the nucleic acid encodes a heterologous signal peptide. [Item 30] 28. The bidirectional nucleic acid construct according to any one of items 1 to 27, wherein the nucleic acid does not encode a signal peptide. [Item 31] 28. The bidirectional nucleic acid construct according to any one of items 1 to 27, wherein the polypeptide, when expressed, contains its own signal peptide. [Item 32] 32. The bidirectional nucleic acid construct according to any one of items 1 to 31, wherein the nucleic acid encodes a heterologous peptide. [Item 33] 33. The bidirectional nucleic acid construct of item 32, wherein the heterologous peptide is 2A. [Item 34] A vector comprising the construct according to any one of items 1 to 33. [Item 35] 35. The vector of item 34, wherein the vector is an adeno-associated virus (AAV) vector. [Item 36] 36. The vector of item 34 or 35, wherein the AAV comprises a single-stranded genome (ssAAV) or a self-complementary genome (scAAV). [Item 37] 36. The vector of item 34 or 35, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10, and hybrids thereof. [Item 38] A viral vector comprising a self-complementary (or double-stranded) nucleic acid construct comprising a nucleotide sequence encoding a polypeptide, wherein the vector does not comprise a promoter that drives expression of the polypeptide. [Item 39] 39. The vector of claim 38, wherein the vector does not contain homology arms. [Item 40] A lipid nanoparticle comprising the construct according to any one of items 1 to 33. [Item 41] 34. A host cell comprising the construct according to any one of items 1 to 33. [Item 42] 42. The host cell of item 41, wherein the host cell is a liver cell, a muscle cell, or a neuronal cell. [Item 43] 42. The host cell of item 41, wherein the host cell is a non-dividing cell type. [Item 44] 44. The host cell according to any one of items 41 to 43, wherein the host cell expresses the polypeptide encoded by the construct. [Item 45] 45. The host cell according to any one of items 41 to 44, wherein the host cell is a hepatocyte. [Item 46] A method for modifying a target locus, comprising providing a cell with the construct according to any one of items 1 to 33, the vector according to any one of items 34 to 39, or the LNP according to item 40. [Item 47] A method for introducing a construct into a cell, the method comprising providing to the cell the construct according to any one of items 1 to 33, the vector according to any one of items 34 to 39, or the LNP according to item 40. [Item 48] A method for expressing a polypeptide in a cell, the method comprising providing to the cell a construct according to any one of items 1 to 33, a vector according to any one of items 34 to 39, or an LNP according to item 40. [Item 49] A method for increasing expression of a polypeptide in a cell, the method comprising providing to the cell a construct according to any one of items 1 to 33, a vector according to any one of items 34 to 39, or an LNP according to item 40. [Item 50] 50. The method of any one of items 46 to 49, wherein the construct, vector, or LNP is provided in vivo. [Item 51] 50. The method of any one of items 46 to 49, wherein the construct, vector, or LNP is provided in vitro. [Item 52] An ex vivo method of modifying a target locus, comprising providing a cell with the construct according to any one of items 1 to 33, the vector according to any one of items 34 to 39, or the LNP according to item 40. [Item 53] 53. The method according to any of items 46 to 52, wherein the cells are of a non-dividing cell type. [Item 54] 54. The method of any of items 46 to 53, further comprising providing to the cell a nuclease, wherein the nuclease is capable of introducing site-specific ssDNA or dsDNA breaks. [Item 55] 55. The method according to any one of items 46 to 54, comprising providing the cell with an RNA-guided DNA binding agent and a guide RNA (gRNA). [Item 56] 56. The method of claim 55, wherein the gRNA is a single gRNA (sgRNA). [Item 57] 57. The method of claim 55 or 56, wherein the construct, the RNA-guided DNA binding agent, and the gRNA are provided to the cell simultaneously. [Item 58] 57. The method of claim 55 or 56, wherein the construct, the RNA-guided DNA binding agent, and the gRNA are provided to the cell sequentially in any order. [Item 59] 59. The method of claim 58, wherein the construct is provided to the cell prior to providing the gRNA and the RNA-guided DNA binding agent. [Item 60] Item 61. The method according to item 58, wherein the RNA-guided DNA binding agent, or a combination of the RNA-guided DNA binding agent and the gRNA, is provided to the cell prior to providing the construct. The method according to any one of Items 54 to 60, wherein the construct is provided in a vector. 61. The method according to any one of items 54 to 60, wherein the construct is provided in a lipid nanoparticle. [Item 63] 63. The method according to any one of items 54 to 62, wherein the RNA-guided DNA binding agent is provided as a nucleic acid encoding the RNA-guided DNA binding agent. [Item 64] 63. The method according to any one of items 54 to 62, wherein the RNA-guided DNA-binding agent is provided as an mRNA encoding a Cas enzyme or an RNA-guided DNA-binding agent. [Item 65] 63. The method of any one of items 54 to 62, wherein the RNA-guided DNA binding agent is a Cas nuclease, such as a Cas9 nuclease. [Item 66] 66. The method of claim 65, wherein the Cas nuclease is a class 2 Cas nuclease or a variant thereof. [Item 67] 67. The method of any one of items 54 to 66, wherein the Cas nuclease is S. pyogenes Cas9, or a variant thereof. [Item 68] 68. The method of any one of items 54 to 67, wherein the Cas nuclease is a nickase. [Item 69] 69. The method of any one of items 54 to 68, wherein the locus is the albumin locus. [Item 70] 70. The method according to any one of items 54 to 69, wherein the cells are of a non-dividing cell type. [Item 71] 71. The method according to any one of items 54 to 70, wherein the cell is a liver cell, a neuronal cell, or a muscle cell. [Item 72] A cell produced by the method according to any one of items 46 to 71. [Item 73] 73. The cell of item 72, wherein the cell is a host cell. [Item 74] 74. The host cell of item 73, wherein the host cell is a liver cell, a muscle cell, or a neuronal cell. [Item 75] The cell according to any one of items 72 to 74, wherein the host cell is a non-dividing cell type. 76. The cell of any one of items 72 to 75, wherein the host cell expresses the polypeptide encoded by the construct. [Item 77] 77. The cell according to any one of items 72 to 76, wherein the host cell is a hepatocyte. [Item 78] 34. The bidirectional nucleic acid construct according to any one of items 1 to 33, wherein the drug is a therapeutic drug. [Item 79] 34. The bidirectional nucleic acid construct according to any one of items 1 to 33, wherein the agent is any one or more of a functional RNA, an mRNA, or a polypeptide. [Item 80] 34. The bidirectional nucleic acid construct according to any one of items 1 to 33, wherein the agent is a polypeptide. [Item 81] 34. The bidirectional nucleic acid construct according to any one of items 1 to 33, wherein the agent is a therapeutic polypeptide. EXAMPLES

[0140] The following examples are provided to illustrate certain disclosed embodiments and should not be construed as limiting the scope of the disclosure in any way.

[0141] Example 1 - Materials and Methods Cloning and plasmid preparation The bidirectional insertion constructs flanked by ITRs were synthesized and cloned into pUC57-Kan by a commercial vendor. The resulting construct (P00147) was used as the parent cloning vector for the other vectors. Other insertion constructs (not including ITRs) were also commercially synthesized and cloned into pUC57. The purified plasmids were digested with BglII restriction enzyme (New England BioLabs, Cat. No. R0144S) and the insertion constructs were cloned into the parent vector. The plasmids were propagated in Stbl3™ Chemically Competent E. coli (Thermo Fisher, Cat. No. C737303).

[0142] AAV generation Triple transfection in HEK293 cells was used to package genomes with constructs of interest for AAV8 and AAVDJ generation, and the resulting vectors were purified from both lysed cells and culture medium by iodixanol gradient ultracentrifugation (see, e.g., Lock et al., Hum Gene Ther. 2010 Oct;21(10):1259-71). Plasmids used in triple transfection that contained genomes with constructs of interest are referenced in the examples by "PXXXX" numbers, see also, e.g., Table 11. Isolated AAV was dialyzed in storage buffer (PBS with 0.001% Pluronic F68). AAV titers were determined by qPCR using primers / probes located within the ITR region.

[0143] In vitro transcription ("IVT") of nuclease mRNA Capped, polyadenylated Streptococcus pyogenes ("Spy") Cas9 mRNA containing N1-methylpseudo-U was generated by in vitro transcription using linearized plasmid DNA template and T7 RNA polymerase. Generally, plasmid DNA containing a T7 promoter and a 100 nt poly(A / T) tract was linearized by incubation with XbaI at 37°C to complete digestion, followed by heat inactivation of XbaI at 65°C. Linearized plasmids were purified from enzymes and buffer salts. The IVT reaction to generate Cas9 modified mRNA was incubated at 37°C for 4 hours with the following conditions: 50ng / μL linearized plasmid, 2mM each of GTP, ATP, CTP, and N1-methyl pseudo-UTP (Trilink), 10mM ARCA (Trilink), 5U / μL T7 RNA polymerase (NEB), 1U / μL mouse Rnase inhibitor (NEB), 0.004U / μL inorganic E. coli pyrophosphatase (NEB), and 1x reaction buffer. TURBO Dnase (ThermoFisher) was added to a final concentration of 0.01U / μL, and the reaction was incubated for an additional 30 minutes to remove the DNA template. Cas9 mRNA was purified using the MegaClear Transcription Clean-up kit according to the manufacturer's protocol (ThermoFisher). Alternatively, Cas9 mRNA was purified using LiCl, ammonium acetate, and sodium acetate precipitation, or using the LiCl precipitation method, followed by further purification by tangential flow filtration. Transcript concentrations were determined by measuring the optical absorbance at 260 nm (Nanodrop), and transcripts were analyzed by capillary electrophoresis with a Bioanlayzer (Agilent).

[0144] The following Cas9 mRNAs comprise Cas9 ORF SEQ ID NO:703 or SEQ ID NO:704, or the sequences of Table 24 of PCT / US2019 / 053423 (incorporated herein by reference).

[0145] Lipid formulations for delivery of Cas9 mRNA and gRNA Cas9 mRNA and gRNA were delivered to cells and animals using lipid formulations containing the ionic lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate), also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate), cholesterol, DSPC, and PEG2k-DMG.

[0146] For experiments utilizing premixed lipid formulations (referred to herein as "lipid packets"), the components were reconstituted in 100% ethanol at a molar ratio of 50:38:9:3 ionic lipid:cholesterol:DSPC:PEG2k-DMG before being mixed with the RNA cargo (e.g., Cas9 mRNA and gRNA) at a lipid amine to RNA phosphophosphate (N:P) molar ratio of approximately 6.0, as further described herein.

[0147] For experiments utilizing components formulated as lipid nanoparticles (LNPs), the components were diluted in various molar ratios in 100% ethanol. RNA cargo (e.g., Cas9 mRNA and gRNA) was dissolved in 25 mM citrate, 100 mM NaCl, pH 5.0 to obtain an RNA cargo concentration of approximately 0.45 mg / mL.

[0148] For the experiments described in Example 2, LNPs were formed by microfluidic mixing of lipid and RNA solutions using a Precision Nanosystems NanoAssemblr™ Benchtop Instrument according to the manufacturer's protocol. A 2:1 ratio of aqueous to organic solvent was maintained during mixing using differential flow rates. After mixing, LNPs were collected, diluted in water (approximately 1:1 v / v), held at room temperature for 1 hour, and further diluted in water (approximately 1:1 v / v) before a final buffer exchange. A final buffer exchange into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) was completed using a PD-10 desalting column (GE). When necessary, the formulation was concentrated by centrifugation through an Amicon 100 kDa centrifugal filter (Millipore). The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNPs were stored at −80° C. until further use. LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 4.5, and a gRNA to mRNA weight ratio of 1:1, with an ionic lipid:cholesterol:DSPC:PEG2k-DMG molar ratio of 45:44:9:2.

[0149] For the experiments described in other examples, LNPs were prepared by impingement jet mixing of lipids in ethanol with two volumes of RNA solution and one volume of water using cross-flow technology. Lipids in ethanol were mixed with two volumes of RNA solution through a mixing cross. A fourth water stream was mixed with the outlet flow of the cross through a tee in the line (see FIG. 2 of WO2016010840). LNPs were kept at room temperature for 1 hour and further diluted with water (approximately 1:1 v / v). The diluted LNPs were concentrated using tangential flow filtration on a flat sheet cartridge (Sartorius, 100 kD MWCO) and then buffer exchanged into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) by diafiltration. Alternatively, the final buffer exchange into TSS was completed using a PD-10 desalting column (GE). When necessary, the formulation was concentrated by centrifugation through an Amicon 100 kDa centrifugal filter (Millipore). The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNP was stored at 4° C. or -80° C. until further use. The LNP was formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6.0, and a gRNA to mRNA weight ratio of 1:1, with an ionic lipid:cholesterol:DSPC:PEG2k-DMG molar ratio of 50:38:9:3.

[0150] Cell culture and in vitro delivery of Cas9 mRNA, gRNA, and insertion constructs Hepa1-6 cells Hepa1-6 cells were seeded at a density of 10,000 cells / well in 96-well plates. After 24 hours, cells were treated with LNPs and AAV. Before treatment, medium was aspirated from the wells. LNPs were diluted to 4ng / ul in DMEM+10%FBS medium, and further diluted to 2ng / ul in 10%FBS (in DMEM) and incubated at 37°C for 10 minutes (at a final concentration of 5% FBS). The target MOI of AAV was 1e6 and diluted in DMEM+10%FBS medium. 50μl of the above diluted LNPs at 2ng / ul were added to the cells (delivering a total of 100ng of RNA cargo), followed by 50μl of AAV. LNP and AAV treatments were separated by several minutes. The total volume of medium in the cells was 100μl. After 72 hours and 30 days post-treatment, supernatants from these treated cells were collected for human FIX ELISA analysis, as described below.

[0151] primary hepatocytes Primary mouse hepatocytes (PMH), primary cynomolgus monkey hepatocytes (PCH), and primary human hepatocytes (PHH) were thawed and resuspended in Hepatocyte Thawing Medium with supplements (ThermoFisher), followed by centrifugation. The supernatant was discarded and the pelleted cells were resuspended in Hepatocyte Seeding Medium and Supplement Pack (ThermoFisher). Cells were counted and plated on Bio-coat collagen I-coated 96-well plates at a density of 33,000 cells / well for PHH, 50,000 cells / well for PCH, and 15,000 cells / well for PMH. The plated cells were incubated at 37°C and 5% CO. 2 The cells were then left in a tissue culture incubator at ambient temperature for 5 hours to allow for attachment. After incubation, the cells were examined for monolayer formation, washed three times with Hepatocyte Maintenance and incubated at 37°C.

[0152] In experiments utilizing lipid packet delivery, Cas9 mRNA and gRNA were each diluted separately to 2 mg / ml in maintenance medium, and 2.9 μl of each was added to wells (in a 96-well Eppendorf plate) containing 12.5 μl of 50 mM sodium citrate, 200 mM sodium chloride (pH 5), and 6.9 μl of water. Then, 12.5 μl of lipid packet formulation was added, followed by 12.5 μl of water, and 150 μl of TSS. Each well was diluted to 20 ng / μl (with respect to total RNA content) using hepatocyte maintenance medium, then diluted to 10 ng / μl (with respect to total RNA content) with 6% fresh mouse serum. Media was aspirated from cells prior to transfection, and 40 μl of lipid packet / RNA mixture was added to cells, followed by AAV (diluted in maintenance medium) at an MOI of 1e5. Media was collected 72 hours after treatment for analysis and cells were harvested for further analysis as described herein.

[0153] Luciferase assay For experiments involving NanoLuc detection in cell culture media, 1 volume of Nano-Glo® Luciferase Assay Substrate was combined with 50 volumes of Nano-Glo® Luciferase Assay Buffer. The assay was run on a Promega Glomax runner with a 0.5 second integration time using a 1:10 dilution of sample (50 μl reagent + 40 μl water + 10 μl cell culture media).

[0154] For experiments involving detection of HiBit tags in cell media, LgBiT protein and Nano-GloR HiBiT extracellular matrix were diluted 1:100 and 1:50, respectively, in Nano-GloR HiBiT extracellular buffer at room temperature. Assays were run on a Promega Glomax runner with a 1.0 second integration time using a 1:10 dilution of sample (50 μl reagent + 40 μl water + 10 μl cell media).

[0155] In vivo delivery of LNPs and / or AAV Mice were administered AAV, LNP, both AAV and LNP, or vehicle (PBS+0.001% Pluronic for AAV vehicle, TSS for LNP vehicle) via the lateral tail vein. AAV was administered in the amount described herein (vector genome / mouse, "vg / ms") in a volume of 0.1 mL per mouse. LNP was diluted in TSS and administered in the amount indicated herein, approximately 5 μl / gram body weight. Typically, mice were injected first with AAV, then with LNP, if applicable. At various time points after treatment, serum and / or liver tissue were collected for certain analyses, as further described below.

[0156] Human Factor IX (hFIX) ELISA Analysis For in vitro studies, total human factor IX levels secreted into cell culture medium were determined using a human factor IX ELISA kit (Abcam, catalog no. ab188393) according to the manufacturer's protocol. Secreted hFIX levels were quantified from a standard curve using a four-parameter logistic fit and expressed as ng / ml of culture medium.

[0157] For in vivo studies, blood was collected and serum was isolated as indicated. Total human factor IX serum levels were determined using a human factor IX ELISA kit (Abcam, catalog number ab188393) according to the manufacturer's protocol. Serum hFIX levels were quantified from a standard curve using a four-parameter logistic fit and expressed as μg / mL of serum.

[0158] Next-generation sequencing ("NGS") and analysis of on-target cleavage efficiency Deep sequencing was used to identify the presence of insertions and deletions introduced by gene editing (e.g., within intron 1 of albumin). PCR primers were designed around the target sites to amplify the genomic region of interest. Primer sequence design was performed as standard practice in the field.

[0159] An additional PCR was performed according to the manufacturer's protocol (Illumina) to add the necessary chemistry for sequencing. Amplicons were sequenced on an Illumina MiSeq instrument. After removing reads with low quality scores, the reads were aligned to the reference genome. The resulting files containing the reads were mapped (BAM files) against the reference genome, reads that overlapped with the target region of interest were selected, and the number of wild type reads versus the number of reads containing insertions or deletions ("indels") was calculated.

[0160] The editing percentage (e.g., "editing efficiency" or "editing rate") is defined as the total number of sequence reads that contain insertions or deletions ("indels") relative to the total number of sequence reads that contain the wild type.

[0161] In situ hybridization analysis BaseScope (ACDbio, Newark, CA) is a specialized RNA in situ hybridization technology that can provide specific detection of exon junctions, for example, in hybrid mRNA transcripts containing an inserted transgene (hFIX) and coding sequences from the insertion site (exon 1 of albumin). BaseScope was used to measure the percentage of liver cells expressing the hybrid mRNA.

[0162] To detect hybrid mRNA, two probes for hybrid mRNA that may result after insertion of bidirectional constructs were designed by ACDbio (Newark, CA). One probe was designed to detect hybrid mRNA resulting from insertion of the construct in one orientation, while the other probe was designed to detect hybrid mRNA resulting from insertion of the construct in the other orientation. Livers of different groups of mice were collected, fresh frozen and sectioned. BaseScope assay was performed using single or pooled probes according to the manufacturer's protocol. Slides were scanned and analyzed by HALO software. The background of this assay (saline-treated group) was 0.58%.

[0163] Example 2 - In vitro testing of insertion templates with and without homology arms In this example, Hepa1-6 cells were cultured and treated with insertion templates bearing various forms of AAV (e.g., bearing either a single-stranded genome ("ssAAV") or a self-complementary genome ("scAAV")) in the presence or absence of LNPs delivering Cas9 mRNA and G000551, e.g., as described in Example 1 (n=3). AAV and LNPs were prepared as described in Example 1. After treatment, media was collected for transgene expression (e.g., human factor IX levels) as described in Example 1.

[0164] Hepa1-6 cells are an immortalized mouse liver cell line that continues to divide in culture. As shown in FIG. 2 (72 hours after treatment), only vectors containing 200 bp homology arms (scAAV derived from plasmid P00204) resulted in detectable expression of hFIX. Use of AAV vectors derived from P00123 (scAAV lacking homology arms) and P00147 (ssAAV bidirectional construct lacking homology arms) did not result in any detectable expression of hFIX in this experiment. Cells were maintained in culture and these results were confirmed when re-assayed 30 days after treatment (data not shown).

[0165] Example 3 - In vivo testing of insertion templates with and without homology arms In this example, mice were treated with AAV derived from the same plasmids (P00123, P00204, and P00147) tested in vitro in Example 2. Dosage materials were prepared and administered as described in Example 1. C57Bl / 6 mice were each administered LNPs containing 3e11 vector genome (vg / ms) followed by G000551 ("G551") at a dose of 4 mg / kg (in terms of total RNA cargo content) (n=5 for each group). Four weeks after dosing, animals were euthanized and liver tissue and serum were collected for editing and transgene (e.g., hFIX) expression, respectively.

[0166] As shown in Figure 3A and Table 12, approximately 60% liver editing levels were detected in each group of animals treated with LNPs containing gRNA targeting intron 1 of mouse albumin. However, despite robust and consistent levels of editing in each treatment group, animals receiving a ssAAV vector without homology arms (ssAAV vector derived from P00147) in combination with LNP treatment produced the highest levels of hFIX expression in serum (Figure 3B and Table 13). Table 12: Indel % JPEG2025028917000003.jpg37154Table 13: Factor IX levels JPEG2025028917000004.jpg41158

[0167] Example 4 - In vivo testing of ssAAV insertion templates with and without homology arms The experiments described in this Example investigated the effect of incorporating homology arms into ssAAV vectors in vivo.

[0168] The dosing materials used in this experiment were prepared and administered as described in Example 1. C57Bl / 6 mice were administered LNPs containing 3e11vg / ms followed by G000666 ("G666") or G000551 ("G551") at a dose of 0.5mg / kg (in terms of total RNA cargo content) (n=5 for each group). Four weeks after administration, animal serum was collected for transgene (e.g., hFIX) expression.

[0169] As shown in Figure 4A and Table 14, the use of ssAAV vectors with asymmetric homology arms (300 / 600 bp arms, 300 / 2000 bp arms, and 300 / 1500 bp arms for vectors derived from plasmids P00350, P00356, and P00362, respectively) for insertion into the site targeted by G551 resulted in levels of circulating hFIX below the lower detection limit for the assay. However, the use of ssAAV vectors without homology arms and with two hFIX open reading frames (ORFs) in bidirectional orientation (derived from P00147) resulted in detectable levels of circulating hFIX in each animal.

[0170] Similarly, use of ssAAV vectors with symmetric homology arms (500 bp and 800 bp arms for vectors derived from plasmids P00353 and P00354, respectively) for insertion into the site targeted by G666 resulted in lower, but detectable, levels compared to use of the bidirectional vector without homology arms (derived from P00147) (see Figure 4B and Table 15). Table 14: Serum FIX levels JPEG2025028917000005.jpg36159Table 15: Serum FIX levels JPEG2025028917000006.jpg30158

[0171] Example 5 - In vitro screening of bidirectional constructs spanning target sites in primary mouse hepatocytes Having demonstrated that bidirectional constructs lacking homology arms outperform vectors with other configurations, the experiments described in this example explored the effect of modifying the bidirectional constructs, here the ORF and splice acceptor modules, and modifying the gRNA to target CRISPR / Cas9-mediated insertion. These diverse bidirectional constructs were tested across a panel of target sites, utilizing 20 different gRNAs targeting intron 1 of mouse albumin in primary mouse hepatocytes (PMH).

[0172] The ssAAV and lipid packet delivery agents tested in this example were prepared and delivered to PMH as described in Example 1, with AAV at an MOI of 1e5. After treatment, isolated genomic DNA and cell media were collected for editing and transgene expression analysis, respectively. Each of the vectors contained a reporter that could be measured by luciferase-based fluorescence detection, as described in Example 1, and plotted as relative luciferase units ("RLU") in FIG. 5C. For example, AAV vectors containing the hFIX ORF contained HiBit peptides fused at their 3' ends, and AAV vectors containing only the reporter gene contained the NanoLuc ORF (in addition to GFP). A schematic diagram of each of the vectors tested is provided in FIG. 5A. The gRNAs tested are shown in FIG. 5B and 5C, using truncated numbers for those listed in Table 4 (e.g., leading zeros have been omitted, e.g., "G551" corresponds to "G000551" in Table 4).

[0173] As shown in Figure 5B and Table 16, consistent but varying levels of editing were detected for each of the treatment groups across each combination tested. Transgene expression using various combinations of template and guide RNA is shown in Figure 5C and Table 17. As shown in Figure 5D, significant levels of indel formation did not necessarily result in more efficient expression of the transgene. Using P00411-derived templates and P00418-derived templates, when no guides with less than 10% edits were included, R 2The values ​​were 0.54 and 0.37, respectively. The mouse albumin splice acceptor and the human FIX splice acceptor each led to efficient transgene expression. Interestingly, despite the different ORFs and splice acceptors, the relative expression levels, measured in RLU, were consistent among the three vectors tested, demonstrating the robustness, reproducibility, and modularity of the bidirectional construct system (see FIG. 5C). Table 16: Indel % JPEG2025028917000007.jpg138163Table 17: Luciferase levels JPEG2025028917000008.jpg189166

[0174] Example 6 - In vivo screening of bidirectional constructs spanning target sites The ssAAV and LNPs tested in this example were prepared and delivered to C57Bl / 6 mice to evaluate the performance of the bidirectional constructs across target sites in vivo as described in Example 1. Four weeks after administration, animals were euthanized and liver tissue and serum were collected for editing and transgene (e.g., hFIX) expression, respectively.

[0175] In initial experiments, 10 different LNP formulations containing 10 different gRNAs targeting intron 1 of albumin were delivered to mice along with ssAAV derived from P00147. AAV and LNP were delivered at 3e11 vg / ms and 4 mg / kg (with respect to total RNA cargo content), respectively. The gRNAs tested in this experiment are shown in Figure 6 and Table 18. As shown in Figure 6 and observed in vitro, significant levels of indel formation were not predictive of transgene insertion or expression.

[0176] In another experiment, the complete panel of 20 gRNAs targeting the 20 different target sites tested in vitro in Example 5 was tested in vivo. To this end, 20 LNP formulations containing 20 gRNAs targeting intron 1 of albumin were delivered to mice along with ssAAV derived from P00147. AAV and LNP were delivered at 3e11 vg / ms and 1 mg / kg (in terms of total RNA cargo content), respectively. The gRNAs tested in this experiment are shown in Figures 7A and 7B and Tables 19 and 20, using abbreviated numbers for those listed in Table 4.

[0177] As shown in Figure 7A, various levels of editing were detected for each of the treatment groups across each LNP / vector combination tested. However, as shown in Figure 7B and consistent with the in vitro data described in Example 5, higher levels of editing do not necessarily result in higher levels of expression of the transgene in vivo, indicating a lack of correlation between editing and insertion / expression of the bidirectional construct. In fact, there is little correlation between the amount of editing achieved and the amount of transgene (hFIX) expression seen in the plot provided in Figure 7D. Notably, when gRNAs achieving less than 10% editing are removed from the analysis, there is an R of only 0.34 between the editing and expression datasets of this experiment. 2 Interestingly, as shown in FIG. 7C, a correlation plot is provided comparing the levels of expression as measured in RLU from the in vitro experiment of Example 5 with the in vivo transgene expression levels detected in this experiment, showing that R 2 The value was 0.70, demonstrating a positive correlation between the primary cell screen and the in vivo treatment.

[0178] To assess the insertion of the bidirectional construct at the cellular level, liver tissues from treated animals were assayed using an in situ hybridization method (BaseScope), for example, as described in Example 1. The assay utilized a probe capable of detecting the junction between the hFIX transgene and mouse albumin exon 1 sequence as a hybrid transcript. As shown in FIG. 8A, cells positive for the hybrid transcript were detected in animals receiving both AAV and LNP. Specifically, when only AAV was administered, less than 1.0% of cells were positive for the hybrid transcript. Upon administration of LNP containing G011723, G000551, or G000666, 4.9%, 19.8%, or 52.3% of cells were positive for the hybrid transcript. Furthermore, as shown in FIG. 8B and Table 14, circulating hFIX levels correlated with the number of cells that were positive for the hybrid transcript. Finally, the assay utilized a pooled probe capable of detecting the insertion of the bidirectional construct in either orientation. However, when a single probe detecting only a single orientation was used, the amount of cells that were positive for hybrid transcripts was approximately half of the cells detected using pooled probes (4.46% vs. 9.68% in one example), suggesting that bidirectional constructs can indeed be inserted in either orientation, resulting in expressed hybrid transcripts that correlate with the amount of transgene expression at the protein level. Table 18: Factor IX levels and % indels JPEG2025028917000009.jpg76164 Table 19: Liver Editing % JPEG2025028917000010.jpg123156Table 20: FIX Level JPEG2025028917000011.jpg142167

[0179] Example 7 - Durability of hFIX expression in vivo In this example, the durability of hFIX expression over time in treated animals was evaluated. To this end, hFIX was measured in the serum of treated animals after dosing as part of a one-year durability study.

[0180] The ssAAV and LNPs tested in this example were prepared and delivered to C57Bl / 6 mice as described in Example 1. The LNP formulation contained G000551 and the ssAAV was derived from P00147. AAV was delivered at 3e11 vg / ms and LNPs were delivered at either 0.25 or 1.0 mg / kg (with respect to total RNA cargo content) (n=5 for each group).

[0181] As shown in Figures 9A and 9B and Tables 21 and 22, hFIX expression was maintained for both groups at each time point evaluated up to 41 or 52 weeks, respectively. The decrease in levels observed at 8 weeks in Figure 9A is likely due to variability in the ELISA assay. Serum albumin levels were measured by ELISA at weeks 2 and 41, showing that circulating albumin levels were maintained throughout the study. Table 21: hFIX Levels JPEG2025028917000012.jpg59164 Table 22: hFIX Levels JPEG2025028917000013.jpg59164

[0182] Example 8 - Effect of various doses of AAV and LNP to modulate hFIX expression in vivo In this example, the effect of varying doses of both AAV and LNP to modulate expression of hFIX was evaluated in C57Bl / 6 mice.

[0183] The ssAAV and LNPs tested in this example were prepared and delivered to mice as described in Example 1. The LNP formulation contained G000553 and the ssAAV was derived from P00147. AAV was delivered at 1e11, 3e11, 1e12, or 3e12 vg / ms and LNP was delivered at 0.1, 0.3, or 1.0 mg / kg (with respect to total RNA cargo content) (n=5 for each group). Two weeks after administration, animals were euthanized. Serum was collected at two time points for hFIX expression analysis.

[0184] As shown in Figure 10A (1 week), Figure 10B (2 weeks), and Table 23, the amount of hFIX expression in vivo can be modulated by varying the dose of either AAV or LNP. Table 23: Serum hFIX JPEG2025028917000014.jpg153159

[0185] Example 9 - In vitro screening of bidirectional constructs spanning target sites in primary cynomolgus monkey and primary human hepatocytes In this example, ssAAV vectors containing bidirectional constructs were tested across a panel of target sites utilizing gRNAs targeting intron 1 of cynomolgus ("cyno") and human albumin in primary cynomolgus monkeys (PCH) and primary human hepatocytes (PHH), respectively.

[0186] The ssAAV and lipid packet delivery materials tested in this example were prepared and delivered to PCH and PHH as described in Example 1. After processing, isolated genomic DNA and cell media were collected for editing and transgene expression analysis, respectively. Each of the vectors contained a reporter that can be measured by luciferase-based fluorescence detection as described in Example 1 (derived from P00415) and plotted as relative luciferase units ("RLU") in Figures 11B and 12B. For example, the AAV vector contained a NanoLuc ORF (in addition to GFP). Schematic diagrams of the vectors tested are provided in Figures 11B and 12B. The gRNAs tested are shown in each of the figures using abbreviated numbers for those listed in Tables 1 and 7.

[0187] Various levels of editing were detected for each of the combinations tested, as shown in Figure 11A for PCH and Figure 12A for PHH (editing data for some combinations tested in the PCH experiment are not reported in Figure 11A and Table 1 due to the poor performance of certain primer pairs used for amplicon-based sequencing). The editing data shown graphically in Figures 11A and 12A are numerically reproduced in Tables 1 and 2 below. However, as shown in Figures 11B, 11C, and Figures 12B and 12C, significant levels of indel formation were not predictive for transgene insertion or expression, indicating little correlation between editing and insertion / expression of bidirectional constructs in PCH and PHH, respectively. As a measure, the R calculated in Figure 11C 2 The value is 0.13, and the R 2 The value is 0.22. Table 1: Albumin intron 1 editing and transgene expression data for sgRNA delivered to primary cynomolgus monkey hepatocytes. JPEG2025028917000015.jpg158164Table 2: Albumin intron 1 editing and transgene expression data for sgRNA delivered to primary human hepatocytes JPEG2025028917000016.jpg187160

[0188] In addition, ssAAV vectors containing the bidirectional constructs were tested across a panel of target sites using a single guide RNA targeting intron 1 of human albumin in primary human hepatocytes (PHH).

[0189] ssAAV and LNP materials were prepared and delivered to PHH as described in Example 1. After processing, isolated genomic DNA and cell media were collected for editing and transgene expression analysis, respectively. As described above, each of the vectors contains a reporter that can be measured by luciferase-based fluorescence detection (derived from plasmid P00415), as described in Example 1, plotted in Figure 12C and shown as relative luciferase units ("RLU") in Table 23. For example, the AAV vector contained a NanoLuc ORF (in addition to GFP). Schematic diagrams of the vectors tested are provided in Figures 11B and 12B. The gRNAs tested are shown in Figure 12C using abbreviated numbers for those listed in Tables 1 and 7. Table 23: Albumin intron 1 transgene expression data for sgRNA delivered to primary human hepatocytes JPEG2025028917000017.jpg148159

[0190] Example 10 - In vivo testing of Factor IX expression from alternative safe harbor loci In this example, insertion of ssAAV containing bidirectional hFIX constructs at alternative safe harbor loci was evaluated. To test insertion at alternative safe harbor loci, AAV was prepared as described above. Mice were administered AAV at a dose of 3e11vg / mouse, followed immediately by LNP formulated with Cas9 mRNA and guide RNA at a dose of 0.3mg / kg. Four weeks after administration, animals were sacrificed and liver and blood samples were collected. Editing was determined in liver samples by NGS. Human hFIX levels in serum were determined by ELISA. NGS and ELISA data showed effective insertion and expression of hFIX in alternative safe harbor loci.

[0191] Example 11 - In vivo testing of human Factor IX gene insertions in non-human primates In this example, an 8-week study was conducted to evaluate human factor IX gene insertion and hFIX protein expression in cynomolgus monkeys by administration of adeno-associated virus (AAV) and / or lipid nanoparticles (LNP) containing various guides. The study was performed with LNP and AAV formulations prepared as described above. Each LNP formulation contained Cas9 mRNA and guide RNA (gRNA) at a weight ratio of 2:1 mRNA:gRNA. The ssAAV was derived from P00147.

[0192] Male cynomolgus monkeys were treated in cohorts of n=3. Animals were administered AAV by slow bolus injection or infusion at the doses listed in Table 3. After AAV treatment, animals received buffer or LNP as listed in Table 3 by slow bolus or infusion.

[0193] Two weeks after dosing, liver specimens were collected by a single ultrasound-guided percutaneous biopsy. Each biopsy specimen was flash frozen in liquid nitrogen and stored at -86 to -60 °C. Editing analysis of liver specimens was performed by NGS sequencing as previously described.

[0194] Blood samples were collected from animals for Factor IX ELISA analysis on days 7, 14, 28, and 56 after dosing. After blood collection, blood samples were collected, processed to plasma, and stored at -86 to -60°C until analysis.

[0195] Total human factor IX levels were determined from plasma samples by ELISA. Briefly, Reacti-Bind 96-well microplates (VWR Cat. No. PI15041) were coated with capture antibody (mouse mAB against human factor IX antibody (HTI, Cat. No. AHIX-5041)) at a concentration of 1 μg / ml and then blocked using 1x PBS with 5% bovine serum albumin. Test samples or standards of purified human factor IX protein (ERL, Cat. No. HFIX 1009, Lot No. HFIX4840) diluted in cynomolgus monkey plasma were then incubated in individual wells. Detection antibody (sheep anti-human factor 9 polyclonal antibody, Abcam, Cat. No. ab128048) was adsorbed at a concentration of 100 ng / ml. Secondary antibody (donkey anti-sheep IgG pAb with HRP, Abcam, Cat. No. ab97125) was used at 100 ng / mL. Plates were developed using TMB substrate reagent set (BD OptEIA Cat. No. 555214). Optical density was assessed spectrophotometrically at 450 nm on a microplate reader (Molecular Devices i3 system) and analyzed using SoftMax pro 6.4.

[0196] Indel formation was detected, confirming that editing had occurred. NGS data showed effective indel formation. Expression of hFIX from the albumin locus in NHPs was measured by ELISA and is shown in Table 4 and Figure 13. Plasma levels of hFIX reached levels previously described as therapeutically effective (George, et al., NEJM 377(23), 2215-27, 2017).

[0197] As measured, circulating hFIX protein levels were maintained over the 8-week study (see FIG. 13, showing mean levels of about 135, about 140, about 150, and about 110 ng / mL on days 7, 14, 28, and 56, respectively), achieving protein levels ranging from about 75 ng / mL to about 250 ng / mL. Plasma hFIX levels were calculated using a specific activity approximately 8-fold higher for the R338L hyperactive hFIX variant (Simioni et al., NEJM 361(17), 1671-75, 2009) (reporting a protein specific activity of 390±28 U per milligram for hFIX-R338L and 45±2.4 U per milligram for wild-type factor IX). Calculating the functionally normalized factor IX activity of the hyperactive factor IX variants tested in this example, the experiment achieved stable levels of human factor IX protein in NHPs over the 8 week study, corresponding to approximately 20-40% of wild-type factor IX activity (ranging from 12-67% of wild-type factor IX activity). Table 3: Editing in the liver JPEG2025028917000018.jpg70159Table 4: hFIX Expression JPEG2025028917000019.jpg69164

[0198] Example 12 In vivo testing of factor IX insertions in non-human primates In this example, a study was conducted to evaluate factor IX gene insertion and hFIX protein expression in cynomolgus monkeys following administration of CRISPR / Cas9 lipid nanoparticles (LNPs) containing various guides including ssAAV derived from P00147 and / or G009860 and various LNP components.

[0199] Indel formation was measured by NGS to confirm that editing had occurred. Total human factor IX levels were determined from plasma samples by ELISA using mouse mAB against human factor IX antibody (HTI, Cat. No. AHIX-5041), sheep anti-human factor 9 polyclonal antibody (Abcam, Cat. No. ab128048), and donkey anti-sheep IgG pAb with HRP (Abcam, Cat. No. ab97125) as described in Example 11. More than 3-fold higher human FIX protein levels were obtained from bidirectional templates using alternative CRISPR / Cas9 LNP than those achieved in the experiment in Example 13. In this study, ELISA assay results indicate that circulating hFIX protein levels above the normal range for human FIX levels (3-5ug / mL, Amiral et al., Clin. Chem., 30(9), 1512-16, 1984) were achieved using G009860 in NHPs by at least the day 14 and day 28 time points. Initial data show circulating human FIX protein levels of approximately 3-4μg / mL on day 14 after a single dose, and levels (approximately 3-5μg / mL) were maintained over the first 28 days of the study.

[0200] Circulating albumin levels were measured by ELISA and showed that baseline albumin levels were maintained at 28 days. In the study, the albumin levels tested in untreated animals varied by about ±15%. In treated animals, circulating albumin levels changed only slightly and did not fall out of the normal range, with levels returning to baseline within one month.

[0201] Circulating human FIX protein levels were also determined by a sandwich immunoassay with a larger dynamic range. Briefly, MSD GOLD 96-well Streptavidin SECTOR Plates (Meso Scale Diagnostics, Cat. No. L15SA-1) were blocked with 1% ECL blocking agent (Sigma, GERPN2125). After tapping off the blocking solution, biotinylated capture antibody (Sino Biological, 11503-R044) was immobilized on the plate. Recombinant human FIX protein (Enzyme Research Laboratories, HFIX1009) was used to prepare calibration standards in 0.5% ECL blocking agent. After washing, calibration standards and plasma samples were added to the plate and incubated. After washing, detection antibody complexed with a sulfo-tag label (Haematologic Technologies, AHIX-5041) was added to the wells and incubated. After washing off any unbound detection antibody, Read Buffer T was applied to the wells. Plates were imaged without any additional incubation on an MSD Quick Plex SQ120 instrument, and data was analyzed with the Discovery Workbench 4.0 software package (Meso Scale Discovery). Concentrations are expressed as mean calculated concentrations in ug / ml. For samples, N=3 unless indicated with an asterisk, in which case N=2. Expression of hFIX from the albumin locus in treated study groups as measured by MSD ELISA is shown in Table 24. Table 24: Serum human factor IX protein levels JPEG2025028917000020.jpg45165

[0202] Example 13 - Off-target analysis of Albumin Human Guide Biochemical methods (see, e.g., Cameron et al., Nature Methods. 6, 600-606; 2017) were used to determine potential off-target genomic sites cleaved by Cas9 targeting albumin. In this experiment, 13 sgRNAs targeting human albumin and two control guides with known off-target profiles were screened using isolated HEK293 genomic DNA. The number of potential off-target sites detected using a guide concentration of 16 nM in the biochemical assay is shown in Table 26. This assay identified potential off-target sites for the sgRNAs tested. Table 25: Off-target analysis JPEG2025028917000021.jpg96164

[0203] In known off-target detection assays such as the biochemical methods used above, many potential off-target sites are typically collected by design to "cast a wide net" for potential sites that can be verified in other situations, such as primary cells of interest.For example, biochemical methods typically over-represent the number of potential off-target sites, because the assay utilizes purified high molecular weight genomic DNA that does not contain cellular environment and depends on the dosage of Cas9 RNP used.Therefore, the potential off-target sites identified by these methods can be verified using targeted sequencing of the identified potential off-target sites.

[0204] Example 14 - Construction of constructs for expression of secreted or non-secreted proteins Constructs, such as bidirectional constructs, can be designed so that they express secreted or non-secreted proteins. For the production of secreted proteins, the constructs can include a signal sequence that aids in translocating the polypeptide into the ER lumen. Alternatively, the constructs can utilize the host cell's endogenous signal sequence (e.g., the endogenous albumin signal sequence when the transgene is integrated into the host cell's albumin locus).

[0205] In contrast, constructs for the expression of non-secreted proteins can be designed so that they do not contain signal sequences and so that they do not utilize endogenous signal sequences of the host cell. Some ways in which this can be achieved include the incorporation of an internal ribosome entry site (IRES) sequence in the construct. An IRES sequence, such as the EMCV IRES, allows translation to begin at any position within the mRNA immediately downstream from where the IRES is located. This allows the expression of proteins that lack endogenous signal sequences of the host cell from an insertion site that contains a signal sequence upstream (e.g., the signal sequence found in exon 1 of the albumin locus is not included in the expressed protein). In the absence of a signal sequence, the protein is not secreted. Examples of IRES sequences that can be used in the construct include those derived from picornaviruses (e.g., FMDV), vermin viruses (CFFV), polioviruses (PV), encephalomyocarditis virus (ECMV), foot and mouth disease virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV), or cricket paralysis virus (CrPV).

[0206] An alternative approach to expressing non-secreted proteins is to include one or more self-cleaving peptides upstream of the polypeptide of interest in the construct. Self-cleaving peptides, such as 2A or 2A-like sequences, function as ribosomal skipping signals to generate multiple individual proteins from a single mRNA transcript. As shown in plasmid ID P00415 from Table 11, a self-cleaving peptide (e.g., P2A) can be used to generate a bicistronic vector expressing two transgenes (e.g., nanoluciferase and GFP). Alternatively, a self-cleaving peptide can be used to express a protein that lacks an endogenous signal sequence of the host cell (e.g., a 2A sequence located upstream of the protein of interest results in cleavage between the endogenous albumin signal sequence and the protein of interest). Representative 2A peptides that can be utilized are shown in Table 12. In addition, a (GSG) residue may be added to the 5' end of the peptide to improve cleavage efficiency, as shown in Table 12. JPEG2025028917000022.jpg58170 Table 5: Human guide RNA sequences JPEG2025028917000023.jpg186163Table 6: Mouse guide RNA sequences JPEG2025028917000024.jpg128161Table 7: Cynomolgus monkey guide RNA sequence JPEG2025028917000025.jpg186164Table 8. Human albumin sgRNAs and modification patterns JPEG2025028917000026.jpg242168JPEG2025028917000027.jpg253169JPEG2025028917000028.jpg253168JPEG2025028917000029.jpg255170JPEG2025028917000030.jpg120170Table 9. Mouse albumin guide sgRNAs and modification patterns JPEG2025028917000031.jpg243169JPEG2025028917000032.jpg254168JPEG2025028917000033.jpg232167Table 10: Cynomolgus sgRNAs and modification patterns JPEG2025028917000034.jpg242170JPEG2025028917000035.jpg251170JPEG2025028917000036.jpg252170JPEG2025028917000037.jpg252170JPEG2025028917000038.jpg251170JPEG2025028917000039.jpg251170JPEG2025028917000040.jpg162170Table 11: Vector components and sequences JPEG2025028917000041.jpg219168 Human albumin intron 1: (SEQ ID NO: 1) GTAAGAAATCCATTTTTCTATTGTTCAACTTTTATTCTATTTTCCCAGTAAAATAAAGTTTTAGTAAACTCTGCATCTTTAAAGAATTATTTTGGCATTTATTTCTAAAATGGCATAGTATTTTGTATTTGTGAAGTCTTACAAGGTTATCTTATTAATAAAATTCAAACATCCTAG GTAAAAAAAAAAAAAGGTCAGAATTGTTTAGTGACTGTAATTTTCTTTTGCGCACTAAGGAAAGTGCAAAGTAACTTAGAGTGACTGAAACTTCACAGAATAGGGTTGAAGATTGAATTCATAACTATCCCAAAGACCTATCCATTGCACTATGCTTTATTTAAAAACCACAAAACC TGTGCTGTTGATCTCATAAATAGAACTTGTATTTATATTTATTTTCATTTTAGTCTGTCTTCTTGGTTGCTGTTGATAGACACTAAAAGAGTATTAGATATTATCTAAGTTTGAATATAAGGCTATAAATATTTAATAATTTTTAAAATAGTATTCTTGGTAATTGAATTATTCTTC TGTTTAAAGGCAGAAGAAATAATTGAACATCATCCTGAGTTTTTCTGTAGGAATCAGAGCCCAATATTTTGAAACAAATGCATAATCTAAGTCAAATGGAAAGAAATATAAAAAGTAACATTATTACTTCTTGTTTTCTTCAGTATTTAACAATCCTTTTTTTTCTTCCCTTGCCCAG 5'ITR sequence (SEQ ID NO:263): TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT Mouse albumin splice acceptor (first orientation) (SEQ ID NO:264): TAGGTCAGTGAAGAGAAGAACAAAAAGCAGCATATTACAGTTAGTTGTCTTCATCAATCTTTAAATATGTTGTGTGGTTTTTCTCTCCCTGTTTCCACAG Human Factor IX (R338L), first orientation (SEQ ID NO:265): PolyA (first orientation) (SEQ ID NO:266): CCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTC ATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCC PolyA (second orientation) (SEQ ID NO:267): AAAAAACCTCCCACACCTCCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTG Human Factor IX (R338L), second orientation (SEQ ID NO:268): Mouse albumin splice acceptor (second orientation) (SEQ ID NO:269): CTGTGGAAACAGGGAGAGAAAAACCACACAACATATTTAAAGATTGATGAAGACAACTAACTGTAATATGCTGCTTTTTGTTCTTCTCTTCACTGACCTA 3'ITR sequence (second orientation) (SEQ ID NO:270): AGGAACCCCTAGTGATGGAGTTGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGGGAGTGGCCAA Human Factor IX splice acceptor (first orientation) (SEQ ID NO:271): GATTATTTGGATTAAAAAACAAAGACTTTCTTAAGAGATGTAAAATTTTCATGATGTTTTCTTTTTTGCTAAAACTAAAGAATTATTCTTTTACATTTCAG Human Factor IX (R338L)-HiBit (first orientation) (SEQ ID NO: 272): Human Factor IX (R338L)-HiBit (second orientation) (SEQ ID NO: 273): Human Factor IX splice acceptor (second orientation) (SEQ ID NO:274): CTGAAATGTAAAAGAATAATTCTTTAGTTTTAGCAAAAAAGAAAACATCATGAAAATTTTACATCTCTTAAGAAAGTCTTTGTTTTTAATCCAAATAATC Nluc-P2A-GFP (first orientation) (SEQ ID NO: 275): Nluc-P2A-GFP (second orientation) (SEQ ID NO: 276): P00147 complete sequence (ITR to ITR): (SEQ ID NO: 277) P00411 complete sequence (ITR to ITR): (SEQ ID NO: 278) P00415 complete sequence (ITR to ITR): (SEQ ID NO: 279) P00418 complete sequence (ITR to ITR): (SEQ ID NO: 280) P00123 complete sequence (ITR to ITR): (SEQ ID NO: 281) P00204 complete sequence (ITR to ITR): (SEQ ID NO: 282) P00353 complete sequence (ITR to ITR): (SEQ ID NO: 283) P00354 complete sequence (ITR to ITR): (SEQ ID NO: 284) P00350: 300 / 600bp HA F9 construct (for G551) (SEQ ID NO: 285) P00356: 300 / 2000bp HA F9 construct (for G551) (SEQ ID NO: 286) P00362: 300 / 1500bp HA F9 construct (for G551) (SEQ ID NO: 287) Cas9 ORF (SEQ ID NO:703) U-dep Cas9 ORF (SEQ ID NO:704) mRNA containing U dep Cas9 (SEQ ID NO: 705)

[0207] SEQUENCE LISTING <110> INTELLIA THERAPEUTICS, INC. REGENERON PHARMACEUTICALS, INC. <120> NUCLEIC ACID CONSTRUCTS AND METHODS OF USE <130> PA24-661 <150> US 62 / 840,343 <151> 2019-04-29 <150> US 62 / 747,393 <151> 2018-10-18 <160> 1138 <170> PatentIn version 3.5 <210> 1 <211> 709 <212> DNA <213> Homo sapiens <400> 1 gtaagaaatc catttttcta ttgttcaact tttattctat tttcccagta aaataaagtt 60 ttagtaaact ctgcatcttt aaagaattat tttggcattt atttctaaaa tggcatagta 120 ttttgtattt gtgaagtctt acaaggttat cttattaata aaattcaaac atcctaggta 180 aaaaaaaaaa aaggtcagaa ttgtttagtg actgtaattt tcttttgcgc actaaggaaa 240 gtgcaaagta acttagagtg actgaaactt cacagaatag ggttgaagat tgaattcata 300 actatcccaa agacctatcc attgcactat gctttattta aaaaccacaa aacctgtgct 360 gttgatctca taaatagaac ttgtatttat atttatttc attttagtct gtcttcttgg 420 ttgctgttga tagacactaa aagagtatta gatattatct aagtttgaat ataaggctat 480 aaatatttaa taatttttaa aatagtattc ttggtaattg aattatctt ctgtttaaag 540 gcagaagaaa taattgaaca tcatcctgag ttttctgta ggaatcagag cccaatattt 600 tgaaacaaat gcataatcta agtcaaatgg aaagaaatat aaaaagtaac attattactt 660 cttgttttct tcagtattta acaatccttt tttttcttcc cttgcccag 709 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 2 gagcaaccuc acucuugucu 20 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 3 augcauuugu uucaaaauau 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 4 ugcauuuguu ucaaaauauu 20 <210> 5 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 5 auuuaugaga ucaacagcac 20 <210> 6 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 6 gaucaacagc acagguuuug 20 <210> 7 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 7 uuaaauaaag cauagugcaa 20 <210> 8 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 8 uaaagcauag ugcaauggau 20 <210> 9 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 9 uagugcaaug gauaggucuu 20 <210> 10 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 10 uacuaaaacu uuauuuuacu 20 <210> 11 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 11 aaaguugaac aauagaaaaa 20 <210> 12 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 12 aaugcauaau cuaagucaaa 20 <210> 13 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 13 uaauaaaauu caaacauccu 20 <210> 14 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 14 gcaucuuuaa agaauuauuu 20 <210> 15 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 15 uuuggcauuu auuucuaaaa 20 <210> 16 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 16 uguauuugug aagucuuaca 20 <210> 17 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 17 uccuagguaa aaaaaaaaaa 20 <210> 18 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 18 uaauuuucuu uugcgcacua 20 <210> 19 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 19 ugacugaaac uucacagaau 20 <210> 20 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 20 gacugaaacu ucacagaaua 20 <210> 21 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 21 uucauuuuag ucugucuucu 20 <210> 22 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 22 auuaucuaag uuugaauaua 20 <210> 23 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 23 aauuuuuaaa auaguauucu 20 <210> 24 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 24 ugaauuauuc uucuguuuaa 20 <210> 25 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 25 aucauccuga guuuuucugu 20 <210> 26 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 26 uuacuaaaac uuuauuuuac 20 <210> 27 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 27 accuuuuuuu uuuuuuaccu 20 <210> 28 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 28 agugcaaugg auaggucuuu 20 <210> 29 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 29 ugauuccuac agaaaaacuc 20 <210> 30 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 30 ugggcaaggg aagaaaaaaa 20 <210> 31 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 31 ccucacucuu gucugggcaa 20 <210> 32 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 32 accucacucu ugucugggca 20 <210> 33 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 33 ugagcaaccu cacucuuguc 20 <210> 34 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 34 gagcaaccuc acucuugucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 35 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 35 augcauuugu uucaaaauau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 36 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 36 ugcauuuguu ucaaaauauu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 37 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 37 auuuaugaga ucaacagcac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 38 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 38 gaucaacagc acagguuuug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 39 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 39 uuaaauaaag cauagugcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 40 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 40 uaaagcauag ugcaauggau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 41 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 41 uagugcaaug gauaggucuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 42 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 42 uacuaaaacu uuauuuuacu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 43 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 43 aaaguugaac aauagaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 44 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 44 aaugcauaau cuaagucaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 45 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 45 uaauaaaauu caaacauccu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 46 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 46 gcaucuuuaa agaauuauuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 47 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 47 uuuggcauuu auuucuaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 48 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 48 uguauuugug aagucuuaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 49 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 49 uccuagguaa aaaaaaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 50 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 50 uaauuuucuu uugcgcacua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 51 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 51 ugacugaaac uucacagaau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 52 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 52 gacugaaacu ucacagaaua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 53 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 53 uucauuuuag ucugucuucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 54 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 54 auuaucuaag uuugaauaua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 55 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 55 aauuuuuaaa auaguauucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 56 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 56 ugaauuauuc uucuguuuaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 57 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 57 aucauccuga guuuuucugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 58 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 58 uuacuaaaac uuuauuuuac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 59 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 59 accuuuuuuu uuuuuuaccu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 60 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 60 agugcaaugg auaggucuuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 61 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 61 ugauuccuac agaaaaacuc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 62 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 62 ugggcaaggg aagaaaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 63 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 63 ccucacucuu gucugggcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 64 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 64 accucacucu ugucugggca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 65 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 65 ugagcaaccu cacucuuguc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 66 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 66 gagcaaccuc acucuugucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 67 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 67 augcauuugu uucaaaauau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 68 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 68 ugcauuuguu ucaaaauauu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 69 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 69 auuuaugaga ucaacagcac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 70 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 70 gaucaacagc acagguuuug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 71 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 71 uuaaauaaag cauagugcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 72 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 72 uaaagcauag ugcaauggau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 73 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 73 uagugcaaug gauaggucuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 74 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 74 uacuaaaacu uuauuuuacu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 75 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 75 aaaguugaac aauagaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 76 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 76 aaugcauaau cuaagucaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 77 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 77 uaauaaaauu caaacauccu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 78 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 78 gcaucuuuaa agaauuauuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 79 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 79 uuuggcauuu auuucuaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 80 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 80 uguauuugug aagucuuaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 81 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 81 uccuagguaa aaaaaaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 82 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 82 uaauuuucuu uugcgcacua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 83 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 83 ugacugaaac uucacagaau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 84 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 84 gacugaaacu ucacagaaua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 85 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 85 uucauuuuag ucugucuucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 86 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 86 auuaucuaag uuugaauaua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 87 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 87 aauuuuuaaa auaguauucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 88 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 88 ugaauuauuc uucuguuuaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 89 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 89 aucauccuga guuuuucugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 90 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 90 uuacuaaaac uuuauuuuac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 91 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 91 accuuuuuuu uuuuuuaccu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 92 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 92 agugcaaugg auaggucuuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 93 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 93 ugauuccuac agaaaaacuc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 94 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 94 ugggcaaggg aagaaaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 95 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 95 ccucacucuu gucugggcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 96 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 96 accucacucu ugucugggca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 97 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 97 ugagcaaccu cacucuuguc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 98 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 98 auuugcaucu gagaacccuu 20 <210> 99 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 99 aucgggaacu ggcaucuuca 20 <210> 100 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 100 guuacaggaa aaucugaagg 20 <210> 101 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 101 gaucgggaac uggcaucuuc 20 <210> 102 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 102 ugcaucugag aacccuuagg 20 <210> 103 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 103 cacucuuguc uguggaaaca 20 <210> 104 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 104 aucguuacag gaaaaucuga 20 <210> 105 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 105 gcaucuucag ggaguagcuu 20 <210> 106 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 106 caaucuuuaa auauguugug 20 <210> 107 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 107 ucacucuugu cuguggaaac 20 <210> 108 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 108 ugcuuguauu uuucuaguaa 20 <210> 109 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 109 guaaauaucu acuaagacaa 20 <210> 110 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 110 uuuuucuagu aauggaagcc 20 <210> 111 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 111 uuauauuauu gauauauuuu 20 <210> 112 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 112 gcacagauau aaacacuuaa 20 <210> 113 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 113 cacagauaua aacacuuaac 20 <210> 114 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 114 gguuuuaaaa auaauaaugu 20 <210> 115 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 115 ucagauuuuc cuguaacgau 20 <210> 116 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 116 cagauuuucc uguaacgauc 20 <210> 117 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 117 caaugguaaa uaagaaauaa 20 <210> 118 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 118 ggaaaaucug aagguggcaa 20 <210> 119 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 119 ggcgaucuca cucuugucug 20 <210> 120 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 120 auuugcaucu gagaacccuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 121 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 121 aucgggaacu ggcaucuuca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 122 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 122 guuacaggaa aaucugaagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 123 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 123 gaucgggaac uggcaucuuc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 124 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 124 ugcaucugag aacccuuagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 125 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 125 cacucuuguc uguggaaaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 126 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 126 aucguuacag gaaaaucuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 127 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 127 gcaucuucag ggaguagcuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 128 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 128 caaucuuuaa auauguugug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 129 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 129 ucacucuugu cuguggaaac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 130 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 130 ugcuuguauu uuucuaguaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 131 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 131 guaaauaucu acuaagacaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 132 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 132 uuuuucuagu aauggaagcc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 133 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 133 uuauauuauu gauauauuuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 134 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 134 gcacagauau aaacacuuaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 135 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 135 cacagauaua aacacuuaac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 136 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 136 gguuuuaaaa auaauaaugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 137 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 137 ucagauuuuc cuguaacgau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 138 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 138 cagauuuucc uguaacgauc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 139 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 139 caaugguaaa uaagaaauaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 140 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 140 ggaaaaucug aagguggcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 141 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 141 ggcgaucuca cucuugucug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 142 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 142 auuugcaucu gagaacccuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 143 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 143 aucgggaacu ggcaucuuca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 144 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 144 guuacaggaa aaucugaagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 145 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 145 gaucgggaac uggcaucuuc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 146 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 146 ugcaucugag aacccuuagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 147 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 147 cacucuuguc uguggaaaca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 148 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 148 aucguuacag gaaaaucuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 149 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 149 gcaucuucag ggaguagcuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 150 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 150 caaucuuuaa auauguugug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 151 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 151 ucacucuugu cuguggaaac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 152 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 152 ugcuuguauu uuucuaguaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 153 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 153 guaaauaucu acuaagacaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 154 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 154 uuuuucuagu aauggaagcc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 155 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 155 uuauauuauu gauauauuuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 156 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 156 gcacagauau aaacacuuaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 157 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 157 cacagauaua aacacuuaac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 158 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 158 gguuuuaaaa auaauaaugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 159 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 159 ucagauuuuc cuguaacgau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 160 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 160 cagauuuucc uguaacgauc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 161 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 161 caaugguaaa uaagaaauaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 162 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 162 ggaaaaucug aagguggcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 163 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 163 ggcgaucuca cucuugucug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 164 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 164 gagcaaccuc acucuugucu 20 <210> 165 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 165 agcaaccuca cucuugucug 20 <210> 166 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 166 accucacucu ugucugggga 20 <210> 167 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 167 ccucacucuu gucuggggaa 20 <210> 168 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 168 cucacucuug ucuggggaag 20 <210> 169 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 169 ggggaagggg agaaaaaaaa 20 <210> 170 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 170 gggaagggga gaaaaaaaaa 20 <210> 171 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 171 augcauuugu uucaaaauau 20 <210> 172 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 172 ugcauuuguu ucaaaauauu 20 <210> 173 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 173 ugauuccuac agaaaaaguc 20 <210> 174 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 174 uacagaaaaa gucaggauaa 20 <210> 175 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 175 uuucuucugc cuuuaaacag 20 <210> 176 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 176 uuauaguuuu auauucaaac 20 <210> 177 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 177 auuuaugaga ucaacagcac 20 <210> 178 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 178 gaucaacagc acagguuuug 20 <210> 179 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 179 uuaaauaaag cauagugcaa 20 <210> 180 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 180 uaaagcauag ugcaauggau 20 <210> 181 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 181 uagugcaaug gauaggucuu 20 <210> 182 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 182 agugcaaugg auaggucuua 20 <210> 183 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 183 uuacuuugca cuuuccuuag 20 <210> 184 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 184 uacuuugcac uuuccuuagu 20 <210> 185 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 185 ucugaccuuu uauuuuaccu 20 <210> 186 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 186 uacuaaaacu uuauuuuacu 20 <210> 187 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 187 aaaguugaac aauagaaaaa 20 <210> 188 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 188 aaugcauaau cuaagucaaa 20 <210> 189 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 189 auuauccuga cuuuuucugu 20 <210> 190 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 190 ugaauuauuc cucuguuuaa 20 <210> 191 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 191 uaauuuucuu uugcccacua 20 <210> 192 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 192 aaaaggucag aauuguuuag 20 <210> 193 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 193 aacauccuag guaaaauaaa 20 <210> 194 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 194 uaauaaaauu caaacauccu 20 <210> 195 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 195 uugucaugua uuucuaaaau 20 <210> 196 <211> 20 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> 196 uuugucaugu auuucuaaaa 20 <210> 197 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 197 gagcaaccuc acucuugucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 198 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 198 agcaaccuca cucuugucug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 199 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 199 accucacucu ugucugggga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 200 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 200 ccucacucuu gucuggggaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 201 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 201 cucacucuug ucuggggaag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 202 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 202 ggggaagggg agaaaaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 203 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 203 gggaagggga gaaaaaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 204 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 204 augcauuugu uucaaaauau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 205 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 205 ugcauuuguu ucaaaauauu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 206 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 206 ugauuccuac agaaaaaguc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 207 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 207 uacagaaaaa gucaggauaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 208 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 208 uuucuucugc cuuuaaacag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 209 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 209 uuauaguuuu auauucaaac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 210 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 210 auuuaugaga ucaacagcac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 211 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 211 gaucaacagc acagguuuug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 212 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 212 uuaaauaaag cauagugcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 213 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 213 uaaagcauag ugcaauggau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 214 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 214 uagugcaaug gauaggucuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 215 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 215 agugcaaugg auaggucuua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 216 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 216 uuacuuugca cuuuccuuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 217 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 217 uacuuugcac uuuccuuagu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 218 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 218 ucugaccuuu uauuuuaccu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 219 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 219 uacuaaaacu uuauuuuacu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 220 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 220 aaaguugaac aauagaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 221 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 221 aaugcauaau cuaagucaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 222 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 222 auuauccuga cuuuuucugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 223 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 223 ugaauuauuc cucuguuuaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 224 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 224 uaauuuucuu uugcccacua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 225 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 225 aaaaggucag aauuguuuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 226 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 226 aacauccuag guaaaauaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 227 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 227 uaauaaaauu caaacauccu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 228 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 228 uugucaugua uuucuaaaau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 229 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 229 uuugucaugu auuucuaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 230 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 230 gagcaaccuc acucuugucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 231 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 231 agcaaccuca cucuugucug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 232 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 232 accucacucu ugucugggga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 233 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 233 ccucacucuu gucuggggaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 234 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 234 cucacucuug ucuggggaag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 235 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 235 ggggaagggg agaaaaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 236 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 236 gggaagggga gaaaaaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 237 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 237 augcauuugu uucaaaauau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 238 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 238 ugcauuuguu ucaaaauauu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 239 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 239 ugauuccuac agaaaaaguc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 240 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 240 uacagaaaaa gucaggauaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 241 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 241 uuucuucugc cuuuaaacag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 242 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 242 uuauaguuuu auauucaaac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 243 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 243 auuuaugaga ucaacagcac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 244 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 244 gaucaacagc acagguuuug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 245 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 245 uuaaauaaag cauagugcaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 246 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 246 uaaagcauag ugcaauggau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 247 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 247 uagugcaaug gauaggucuu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 248 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 248 agugcaaugg auaggucuua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 249 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 249 uuacuuugca cuuuccuuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 250 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 250 uacuuugcac uuuccuuagu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 251 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 251 ucugaccuuu uauuuuaccu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 252 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 252 uacuaaaacu uuauuuuacu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 253 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 253 aaaguugaac aauagaaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 254 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 254 aaugcauaau cuaagucaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 255 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 255 auuauccuga cuuuuucugu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 256 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 256 ugaauuauuc cucuguuuaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 257 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 257 uaauuuucuu uugcccacua guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 258 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 258 aaaaggucag aauuguuuag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 259 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 259 aacauccuag guaaaauaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 260 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 260 uaauaaaauu caaacauccu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 261 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 261 uugucaugua uuucuaaaau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 262 <211> 100 <212> RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 262 uuugucaugu auuucuaaaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 263 <211> 145 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 263 ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttcct 145 <210> 264 <211> 100 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 264 taggtcagtg aagagaagaa caaaaagcag catattacag ttagttgtct tcatcaatct 60 ttaaatatgt tgtgtggttt ttctctccct gtttccacag 100 <210> 265 <211> 1296 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 265 tttcttgatc atgaaaacgc caacaaaatt ctgaatcggc caaagaggta taattcaggt 60 aaattggaag agtttgttca agggaacctt gagagagaat gtatggaaga aaagtgtagt 120 tttgaagaag cacgagaagt ttttgaaaac actgaaagaa caactgaatt ttggaagcag 180 tatgttgatg gagatcagtg tgagtccaat ccatgtttaa atggcggcag ttgcaaggat 240 gacattaatt cctatgaatg ttggtgtccc tttggatttg aaggaaagaa ctgtgaatta 300 gatgtaacat gtaacattaa gaatggcaga tgcgagcagt tttgtaaaaa tagtgctgat 360 aacaaggtgg tttgctcctg tactgaggga tatcgacttg cagaaaacca gaagtcctgt 420 gaaccagcag tgccatttcc atgtggaaga gtttctgttt cacaaacttc taagctcacc 480 cgtgctgaga ctgtttttcc tgatgtggac tatgtaaatt ctactgaagc tgaaaccatt 540 600. ttggataaca tcactcaaag cacccaatca tttaatgact tcactcgggt tgttggtgga gaagatgcca aaccaggtca attcccttgg caggttgttt tgaatggtaa agttgatgca ttctgtggag gctctatcgt taatgaaaaa tggattgtaa ctgctgccca ctgtgttgaa actggtgtta aaattacagt tgtcgcaggt gacataata ttgaggagac aagacataca gagcaaaagc gaaatgtgat tcgaattatt cctcaccaca actacaatgc agctattaat aagtacaacc atgacattgc ccttctgga ctggacgac ccttagtgct aaacagctac gttacaccta tttgcattgc tgacaagga tacacgaaca tcttcctcaa atttggatct ggctatgtaa gtggctgggg aagagtcttc cacaaaggga gatcagcttt agttcttcag taccttagag ttccacttgt tgaccgagcc acatgtcttc tatctacaaa gttcaccatc 1080 tataacaaca tgttctgtgc tggcttccat gaggaggta gagattcatg tcaaggagat agtgggggac cccatgttac tgaagtggaa gggaccagtt tcttaactgg aattattagc 1200 tggggtgaag agtgtgcaat gaaaggcaaa tatggaatat ataccaaggt atcccggtat 1260 gtcaactgga ttaaggaaaa aacaaagctc acttaa 1296 <210> 266 <211> 276 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 266 cctcgactgt gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct 60 tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc 120 attgtctgag taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg 180 aggattggga agacaatagc aggcatgctg gggatgcggt gggctctatg gcttctgagg 240 cggaaagaac cagctggggc tctagggggt atcccc 276 <210> 267 <211> 192 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 267 aaaaaacctc ccacacctcc ccctgaacct gaaacataaa atgaatgcaa ttgttgttgt 60 taacttgttt attgcagctt ataatggtta caaataaagc aatagcatca caaatttcac 120 aaataaagca tttttttcac tgcattctag ttgtggtttg tccaaactca tcaatgtatc 180 ttatcatgtc tg 192 <210> 268 <211> 1296 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 268 ttaggtgagc ttagtctttt cttttatcca attcacgtag cgagagacct tcgtatagat 60 gccatatttc cccttcatcg cacattcctc cccccaactt attatcccgg tcaagaaact tgttccttcg acttcagtga cgtgtggtcc acctgaatca ccttggcatg agtcgcgacc 180 gccctcgtga aacccagcac aaaacatgtt attgtaaatc gtaaatttcg tggacagaag acaggtcgct ctatcgacca acgggacgcg caatattgc agaacgaggg ctgatcgacc ttttgtggaag acccgccccc acccactcac atatccgctc ccaaatttca agaagatatt tgtatattct ttatcggcta tacaaatcgg ggtaacatag gagttaagta cgagtggctc gtccagctcc aggagggcta tatcatggtt gtacttgttt atagcggcat tataattgtg 480 atggggtatg atcctgataa cattcctttt ctgttcagta tgctcagttt cttcaatgtt 540 gtgttcgcca gccacgaccg taatcttaac ccccgtctcg acacagtgtg cggccgttac aatccacttt tcattgacta tggagcccc acaaaacgcg tcgacttttc cgttgagcac 660 cacctgccat ggaaattggc caggtttagc gtcctcgccc ccgacaaccc tagtaaagtc 720 attaaatgac tgtgtggatt gtgttatatt atcaagaatc gtttcggctt footagagtt 780 aacgtagtcc acatcgggaa aaactgtctc ggcccttgtc aactttgatg tctgggacac 840 acttacccga ccgcacggga agggcaccgc cggttcacag ctcttttgat tctcagcgag 900 ccggtagccc tcagtgcaac tacacaac tttgttgtcg gcggaatttt tacagaattg 960 ctcgcatcgt ccatttttaa tgttgcaggt gacgtccaac tcgcagtttt ttccttcaaa 1020 accaaaaggg caccaacact cgtaggaatt tatatcgtct ttacaactcc ccccattcag 1080 acatggatta gattcgcatt ggtccccatc gacatattgc ttccagaact cagtggtccg 1140 ttctgtattc tcaaacacct cgcgcgcttc ttcaaaactg catttttcct ccatacactc 1200 tcgctccaag ttcccttgca cgaattcttc aagctttcct gagttatacc ttttaggccg 1260 gttaagtatc ttattcgcgt tttcgtggtc cagaaa 1296 <210> 269 <211> 100 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 269 ctgtggaaac agggagagaa aaaccacaca acatatttaa agattgatga agacaactaa 60 ctgtaatatg ctgctttttg ttcttctctt cactgaccta 100 <210> 270 <211> 145 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 270 aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60 ccgcccgggc aaagcccggg cgtcgggcga cctttggtcg cccggcctca gtgagcgagc 120 gagcgcgcag agagggagtg gccaa 145 <210> 271 <211> 100 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 271 gattatttgg attaaaaaca aagactttct taagagatgt aaaattttca tgatgttttc 60 ttttttgcta aaactaaaga attattcttt tacatttcag 100 <210> 272 <211> 1329 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 272 tttcttgatc atgaaaacgc caacaaaatt ctgaatcggc caaagaggta taattcaggt 60 aaattggaag agtttgttca agggaacctt gagagagaat gtatggaaga aaagtgtagt 120 180 tatgttgatg gagatcagtg tgagtccaat ccatgtttaa atggcggcag ttgcaaggat 240 gacattaatt cctatgaatg ttggtgtccc tttggatttg aagaaaagaa ctgtgaatta 300 gatgtaacat gtaacaattaa gaatggcaga tgcgagcagt tttgtaaaaa tagtgctgat 360 aacaaggtgg tttgctcctg tactgaggga tatcgacttg cagaaaacca gaagtcctgt 420 gaaccagcag tgccatttcc atgtggaaga gtttctgttt caaaacttc taagctcacc 480 cgtgctgaga ctgtttttcc tgatgtggac tatgtaaatt ctactgaagc tgaaaccatt 540 ttggataaca tcactcaaag cacccaatca tttaatgact tcactcgggt tgttggtgga 600 gaagatgcca aaccaggtca attcccttgg caggttgttt tgaatggtaa agttgatgca 660 ttctgtggag gctctatcgt taatgaaaaa tggattgtaa ctgctgccca ctgtgttgaa actggtgtta aaattacagt tgtcgcaggt gacataata ttgaggagac aagacataca gagcaaaagc gaaatgtgat tcgaattatt cctcaccaca actacaatgc agctattaat aagtacaacc atgacattgc ccttctgga ctggacgac ccttagtgct aaacagctac gttacaccta tttgcattgc tgacaagga tacacgaaca tcttcctcaa atttggatct ggctatgtaa gtggctgggg aagagtcttc cacaaaggga gatcagcttt agttcttcag taccttagag ttccacttgt tgaccgagcc acatgtcttc tatctacaaa gttcaccatc 1080 tataacaaca tgttctgtgc tggcttccat gaggaggta gagattcatg tcaaggagat agtggggac cccatgttac tgaagtgga gggaccagtt tcttaactgg aattattagc tggggtgaag agtgtgcaat gaaaggcaaa tatggaat ataccaaggt ctcccggtat gtcaactgga ttaaggaaaa aacaaagctc actgtcagcg gatggagact gttcaagaag 1320 atcagctaa 1329 <210> 273 <211> 1329 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 273 ttaggaaatc ttcttaaaca gccgccagcc gctcacggtg agcttagtct tttcttttat 60 ccaattcacg tagcgagaga ccttcgtata gatgccatat ttccccttca tcgcacattc 120 ctccccccaa cttattatcc cggtcaagaa acttgttcct tcgacttcag tgacgtgtgg 180 tccacctgaa tcaccttggc atgagtcgcg accgccctcg tgaaacccag cacaaaacat 240 gttattgtaa atcgtaaatt tcgtggacag aagacaggtc gctctatcga ccaacgggac 300 gcgcaaatat tgcagaacga gggctgatcg acctttgtgg aagacccgcc cccacccact 360 cacatatccg ctcccaaatt tcaagaagat atttgtatat tctttatcgg ctatacaaat 420 cggggtaaca taggagttaa gtacgagtgg ctcgtccagc tccaggaggg ctatatcatg 480 gttgtacttg tttatagcgg cattataatt gtgatggggt atgatcctga taacattcct 540 tttctgttca gtatgctcag tttcttcaat gttgtgttcg ccagccacga ccgtaatctt 600 aacccccgtc tcgacacagt gtgcggccgt tacaatccac ttttcattga ctatggagcc 660 cccacaaaac gcgtcgactt ttccgttgag caccacctgc catggaaatt ggccaggttt 720 agcgtcctcg cccccgacaa ccctagtaaa gtcattaaat gactgtgtgg attgtgttat 780 attatcaaga atcgtttcgg cttcagtaga gttaacgtag tccacatcgg gaaaaactgt 840 ctcggccctt gtcaactttg atgtctggga cacacttacc cgaccgcacg ggaagggcac 900 cgccggttca cagctctttt gattctcagc gagccggtag ccctcagtgc aactacacac 960 aactttgttg tcggcggaat ttttacagaa ttgctcgcat cgtccatttt taatgttgca 1020 ggtgacgtcc aactcgcagt tttttccttc aaaaccaaaa gggcaccaac actcgtagga 1080 atttatatcg tctttacaac tccccccatt cagacatgga ttagattcgc attggtcccc 1140 atcgacatat tgcttccaga actcagtggt ccgttctgta ttctcaaaca cctcgcgcgc 1200 ttcttcaaaa ctgcattttt cctccataca ctctcgctcc aagttccctt gcacgaattc 1260 ttcaagcttt cctgagttat accttttagg ccggttaagt atcttattcg cgttttcgtg 1320 gtccagaaa 1329 <210> 274 <211> 100 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 274 ctgaaatgta aaagaataat tctttagttt tagcaaaaaa gaaaacatca tgaaaatttt 60 acatctctta agaaagtctt tgtttttaat ccaaataatc 100 <210> 275 <211> 1446 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 275 tttcttgatc atgaaaacgc caacaaaatt ctgaatcggc caaagaggta taattcaggt 60 aaattggaag agtttgttca agggaacctt gagagagaat gtatggaaga aaagtgtagt 120 tttgaagaag cagtattcac tttggaggac tttgtcggtg actggaggca aaccgctggt 180 tataatctcg accaagtact ggaacagggc ggggtaagtt ccctctttca gaatttgggt 240 gtaagcgtca caccaatcca gcggattgtg ttgtctggag agaacggact caaaattgac 300 atccatgtta tcattccata tgaaggtctc agtggagacc aaatggggca gatcgagaag 360 attttcaagg tagtttaccc agtcgacgat caccacttca aagtcattct ccactatggc 420 acacttgtta tcgacggagt aactcctaat atgattgatt actttggtcg cccgtatgag 480 ggcatcgcag tgtttgatgg caaaaagatc accgtaacag gaacgttgtg gaatgggaac 540 aagataatcg acgagagatt gataaatcca gacgggtcac tcctgttcag ggttacaatt 600 aacggcgtca caggatggag actctgtgaa cgaatactgg ccacaaattt ttcactcctg 660 aagcaggccg gagacgtgga ggaaaaccca gggcccgtga gcaagggcga ggagctgttc 720 accggggtgg tgcccatcct ggtcgagctg gacggcgacg taaacggcca caagttcagc 780 gtgtccggcg agggcgaggg cgatgccacc tacggcaagc tgaccctgaa gttcatctgc 840 accaccggca agctgcccgt gccctggccc accctcgtga ccaccctgac ctacggcgtg 900 cagtgcttca gccgctaccc cgaccacatg aagcagcacg acttcttcaa gtccgccatg 960 cccgaaggct acgtccagga gcgcaccatc ttctcaagg acgacggca ctacagacc 1020 cgcgccgagg tgaagttcga gggcgacacc ctggtgacc gcatcgagct gaagggcatc 1080 gacttcaagg aggacggcaa catcctgggg cacaagctgg agtacacta cacagccac 1140 aacgtctata tcatggccga caagcagaag aacggcatca aggtgaactt caagccgc 1200 cacacatcg aggacggcag cgtgcagctc gccgaccact accagcagaa caccccatc 1260 ggcgacggcc ccgtgctgct gcccgacac cactacctga gcacccagcc cgccctgagc 1320 aaagacccca acgagaagcg cgatcacatg gtcctgctgg agttcgtgac cgccgccggg 1380 atcactctcg gcatggacga gctgtacaag gaggaggaa gcccgaagaa gagagaaag 1440 gtcta 1446 <210> 276 <211> 1446 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 276 ttacaccttc ctcttcttct tggggctgcc gccgcccttg tacagctcgt ccatgcccag 60 ggtgatgccg gcggcggtca cgaactccag cagcaccatg tggtccctct tctcgttggg 120 gtccttgctc agggcgctct gggtgctcag gtagtggttg tcgggcagca gcacggggcc 180 gtcgccgatg ggggtgttct gctggtagtg gtcggccagc tgcacgctgc cgtcctcgat 240 gttgtgcctg atcttgaagt tcaccttgat gccgttcttc tgcttgtcgg ccatgatgta 300 cacgttgtgg ctgttgtagt tgtactccag cttgtggccc aggatgttgc cgtcctcctt 360 gaagtcgatg cccttcagct cgatcctgtt caccagggtg tcgccctcga acttcacctc 420 ggccctggtc ttgtagttgc cgtcgtcctt gaagaagatg gtcctctcct gcacgtagcc 480 ctcgggcatg gcgctcttga agaagtcgtg ctgcttcatg tggtcggggt acctgctgaa 540 gcactgcacg ccgtaggtca gggtggtcac cagggtgggc cagggcacgg gcagcttgcc 600 ggtggtgcag atgaacttca gggtcagctt gccgtaggtg gcgtcgccct cgccctcgcc 660 gctcacgctg aacttgtggc cgttcacgtc gccgtccagc tccaccagga tgggcaccac 720 gccggtgaac agctcctcgc ccttgctcac ggggccgggg ttctcctcca cgtcgccggc 780 ctgcttcagc aggctgaagt tggtggccag gatcctctcg cacagcctcc agccggtcac 840 gccgttgatg gtcaccctga acagcaggct gccgtcgggg ttgatcagcc tctcgtcgat 900 gatcttgttg ccgttccaca gggtgccggt cacggtgatc ttcttgccgt cgaacacggc 960 gatgccctcg tagggcctgc cgaagtagtc gatcatgttg ggggtcacgc cgtcgatcac 1020 cagggtgccg tagtgcagga tcaccttgaa gtggtggtcg tccacggggt acaccacctt 1080 gaaaatcttc tcgatctggc ccatctggtc gccgctcagg ccctcgtagg ggatgatcac 1140 gtggatgtcg atcttcaggc cgttctcgcc gctcagcacg atcctctgga tgggggtcac 1200 gctcacgccc aggttctgga acaggctgct cacgccgccc tgctccagca cctggtccag 1260 gttgtagccg gcggtctgcc tccagtcgcc cacgaagtcc tccagggtga acacggcctc 1320 ctcgaagctg cacttctcct ccatgcactc cctctccagg ttgccctgca cgaactcctc 1380 cagcttgccg ctgttgtacc tcttgggcct gttcaggatc ttgttggcgt tctcgtggtc 1440 caggaa 1446 <210> 277 <211> 3570 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Description of Artificial Sequence: Synthetic polynucleotide" <400> 277 ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc 60 cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg 120 gccaactcca tcactagggg ttcctagatc tcttaggtca gtgaagagaa gaacaaaaag cagcatatta cagttagttg tcttcatcaa tctttaaata tgttgtgtgg tttttctctc cctgtttcca cagtttttct tgatcatgaa aacgccaaca aaattctgaa tcggccaaag aggtataatt caggtaatt ggaagagttt gttcaaggga accttgagag agaatgtatg gaagaaaagt gtagttttga agaagcacga gaagtttttg aaaacactga aagaacaact gaatttgga agcagtatgt tgatggagat cagtgtgagt ccaatccatg tttaaatggc ggcagttgca aggatgacat taattcctat gaatgttggt gtccctttgg atttgaagga aagaactgtg aattagtgt aacatgtaac attagaatg gcagatgcga gcagttttgt aaaaatagtg ctgataacaa ggtggtttgc tcctgtactg agggatatcg acttgcagaa aaccagaagt cctgtgaacc agcagtgcca tttccatgtg gaagagtttc tgtttcacaa acttctaagc tcacccgtgc tgagactgtt ttcctgatg tggactgt aaattctact 780 gaagctgaaa ccattttgga taaccact caaagcaccc atcatttta tgactcact 840 cgggttgttg gtggagaaga tgccaaacca ggtcaatcc cttggcaggt tgttttgaat 900 ggtaaagttg atgcattctg tggaggctct atcgttaatg aaaaatggat tgtactgct 960 gcccactgtg ttgaactgg tgttaaaatt acagttgtcg caggtgaaca taatattgag 1020 gagacagaac atacagagca aaagcgaat gtgattcgaa ttattccctca ccacaacac 1080 aatgcagcta ttaatagta siaccatgac attgccctc tggaactgga cgaaccctta 1140 gtgctaaca gctacgttac acctatttgc attgctgaca aggaatacac gaacatctc 1200 ctcaaatttg gatctggcta tgtaagtggc tgggagag tctccacaa agggagatca 1260 gctttagttc ttcagtacct tagagttcca cttgttgacc gagccacatg tcttctatct 1320 acaaagttca ccatctataa caacatgttc tgtgctggct tccatgaagg aggtagagat 1380 tcatgtcaag gagatagtgg gggaccccat gttactgaag tggaagggac cagtttctta 1440 actggaatta ttagctgggg tgaagagtgt gcaatgaaag gcaaatatgg aatatatacc 1500 aaggtatccc ggtatgtcaa ctggattaag gaaaaaacaa agctcactta acctcgactg 1560 tgccttctag ttgccagcca tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg 1620 aaggtgccac tcccactgtc ctttcctaat aaaatgagga aattgcatcg cattgtctga 1680 gtaggtgtca ttctattctg gggggtgggg tggggcagga cagcaagggg gaggattggg 1740 aagacaatag caggcatgct ggggatgcgg tgggctctat ggcttctgag gcggaaagaa 1800 ccagctgggg ctctaggggg tatccccaaa aaacctccca cacctccccc tgaacctgaa 1860 acataaaatg aatgcaattg ttgttgttaa cttgtttatt gcagcttata atggttacaa 1920 fathers fathers atttcacaaa fathers ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgt tagtgagct tagtcttttc ttttatccaa ttcacgtagc gagagacctt cgtatagatg ccatattcc ccttcatcgc acattcctcc ccccaactta ttatcccggt caagaactt gttccttcga cttcagtgac gtgtggtcca cctgaatcac cttggcatga gtcgcgaccg ccctcgtgaa acccagcaca aaacatgtta ttgtaaatcg taaatttcgt ggacagaaga caggtcgctc tatcgaccaa cgggacgcgc aaatattgca gacgagggc tgatcgacct ttgtggaga cccgccccca cccactcaca tatccgctcc caaatttcaa gaagatattt gtatattctt tatcggctat acaaatcggg gtaacatagg agttaagtac ggtggctcg tccagctcca ggagggctat atcatggttg tacttgttta tagcggcatt ataattgtga tggggtatga tcctgataac attccttttc tgttcagtat gctcagtttc ttcaatgttg tgttcgccag ccacgaccgt 2580 aatcttaacc cccgtctcga cacagtgtgc ggccgttaca atccactttt cattgactat 2640 ggagccccca caaaacgcgt cgacttttcc gttgagcacc acctgccatg gaaattggcc 2700 aggtttagc...

Claims

1. 1. A bidirectional nucleic acid construct comprising: a) a first segment comprising a coding sequence for an agent, such as a polypeptide; and b) a second segment comprising the reverse complement of the coding sequence of the agent; wherein said construct does not comprise a promoter driving expression of said agent, such as a polypeptide.

2. 1. A bidirectional nucleic acid construct comprising: a) a first segment comprising a coding sequence for a first agent, such as a first polypeptide; and b) a second segment comprising the reverse complement of the coding sequence for a second agent, such as a second polypeptide. wherein said construct does not comprise a promoter driving expression of said agent(s).

3. 3. The bidirectional nucleic acid construct of claim 1 or 2, wherein the second segment is 3' of the first segment.

4. 4. The bidirectional nucleic acid construct of claim 1, wherein the coding sequence of the reverse complement in the second segment adopts a different codon usage than that of the first coding sequence of the first segment.

5. 5. The bidirectional nucleic acid construct of claim 1, wherein the second segment comprises a nucleotide sequence having at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, or about 99% complementarity to the coding sequence in the first segment.

6. The bidirectional nucleic acid construct of any one of claims 1 to 5, wherein the coding sequence of the second segment encodes the polypeptide using one or more alternative codons for one or more amino acids encoded by the coding sequence in the first segment.

7. The bidirectional nucleic acid construct of any one of claims 1 to 6, wherein the second segment comprises the reverse complement of the coding sequence of the first segment, or a fragment thereof.

8. The reverse complement is a. is not substantially complementary to the coding sequence of the first segment; b. is not substantially complementary to a fragment of the coding sequence of the first segment; c. highly complementary to the coding sequence of the first segment; d. highly complementary to a fragment of the coding sequence of the first segment; e. at least 60% identical to the reverse complement of the coding sequence of the first segment; f. at least 70% identical to the reverse complement of the coding sequence of the first segment; f. at least 90% identical to the reverse complement of the coding sequence of the first segment; g. 50-80% identical to the reverse complement of the coding sequence of the first segment, and / or h. 60-100% identical to the reverse complement of the coding sequence of the first segment; The bidirectional nucleic acid construct of claim 7.

9. The bidirectional nucleic acid construct according to any one of claims 1 to 8, wherein the construct does not comprise homology arms.

10. The bidirectional nucleic acid construct according to any one of claims 1 to 9, wherein the first segment is linked to the second segment by a linker.

11. 11. The bidirectional nucleic acid construct of claim 10, wherein the linker is about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 1500, 2000 nucleotides in length.

12. The bidirectional nucleic acid construct according to any one of claims 1 to 11, wherein each of the first and second segments comprises a polyadenylation sequence, such as a polyadenylation signal sequence or a polyadenylation tail sequence.

13. The bidirectional nucleic acid construct according to any one of claims 1 to 12, wherein the construct comprises a splice acceptor site.

14. 14. The bidirectional nucleic acid construct of claim 13, wherein the construct comprises a first splice acceptor site 5' to the first segment and a second splice acceptor site 3' to the second segment.

15. The bidirectional nucleic acid construct according to any one of claims 1 to 14, wherein the construct is double-stranded, optionally double-stranded DNA.

16. The bidirectional nucleic acid construct according to any one of claims 1 to 15, wherein the construct is single-stranded, optionally single-stranded DNA.

17. The bidirectional nucleic acid construct according to any one of claims 1 to 16, wherein the sequence encoding said polypeptide is codon-optimized.

18. 18. The bidirectional nucleic acid construct according to any one of claims 1 to 17, wherein the construct comprises one or more of the following terminal structures: a hairpin, a loop, an inverted terminal repeat (ITR), or a toroid.

19. The bidirectional nucleic acid construct according to any one of claims 1 to 18, wherein the construct comprises one, two or three inverted terminal repeats (ITRs).

20. The bidirectional nucleic acid construct according to any one of claims 1 to 19, wherein the construct comprises no more than two ITRs.

21. The bidirectional nucleic acid construct according to any one of claims 1 to 20, wherein the polypeptide is a secreted polypeptide.

22. The bidirectional nucleic acid construct according to any one of claims 1 to 20, wherein the polypeptide is an intracellular polypeptide.

23. The bidirectional nucleic acid construct according to any one of claims 2 to 22, wherein the first polypeptide and the second polypeptide are different.

24. The bidirectional nucleic acid construct according to any one of claims 1 to 23, wherein the polypeptide is a variant polypeptide.

25. The bidirectional nucleic acid construct according to any one of claims 1 to 24, wherein the polypeptide is a liver protein.

26. The bidirectional nucleic acid construct according to any one of claims 1 to 24, wherein the polypeptide is a non-liver protein.

27. The bidirectional nucleic acid construct according to any one of claims 1 to 26, wherein the construct is a homology-independent construct.

28. The bidirectional nucleic acid construct according to any one of claims 1 to 27, wherein the polypeptide, when expressed, comprises a heterologous signal peptide.

29. The bidirectional nucleic acid construct according to any one of claims 1 to 28, wherein the nucleic acid encodes a heterologous signal peptide.

30. The bidirectional nucleic acid construct according to any one of claims 1 to 27, wherein the nucleic acid does not encode a signal peptide.

31. The bidirectional nucleic acid construct according to any one of claims 1 to 27, wherein the polypeptide, when expressed, comprises its own signal peptide.

32. The bidirectional nucleic acid construct according to any one of claims 1 to 31, wherein the nucleic acid encodes a heterologous peptide.

33. 33. The bidirectional nucleic acid construct of claim 32, wherein the heterologous peptide is 2A.

34. A vector comprising the construct according to any one of claims 1 to 33.

35. 35. The vector of claim 34, wherein the vector is an adeno-associated virus (AAV) vector.

36. 36. The vector of claim 34 or 35, wherein the AAV comprises a single-stranded genome (ssAAV) or a self-complementary genome (scAAV).

37. 36. The vector of claim 34 or 35, wherein the AAV vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrhlO, AAVLK03, AV10, AAV11, AAV12, rhlO, and hybrids thereof.

38. A viral vector comprising a self-complementary (or double-stranded) nucleic acid construct comprising a nucleotide sequence encoding a polypeptide, wherein the vector does not comprise a promoter that drives expression of the polypeptide.

39. The vector of claim 38 , wherein the vector does not contain homology arms.

40. A lipid nanoparticle comprising a construct according to any one of claims 1 to 33.

41. A host cell comprising a construct according to any one of claims 1 to 33.

42. 42. The host cell of claim 41, wherein the host cell is a liver cell, a muscle cell, or a neuronal cell.

43. 42. The host cell of claim 41, wherein the host cell is a non-dividing cell type.

44. The host cell of any one of claims 41 to 43, wherein the host cell expresses the polypeptide encoded by the construct.

45. The host cell according to any one of claims 41 to 44, wherein the host cell is a hepatocyte.

46. A method for modifying a target locus, comprising providing a cell with a construct according to any one of claims 1 to 33, a vector according to any one of claims 34 to 39, or an LNP according to claim 40.

47. A method for introducing a construct into a cell, the method comprising providing to the cell a construct according to any one of claims 1 to 33, a vector according to any one of claims 34 to 39, or an LNP according to claim 40.

48. A method for expressing a polypeptide in a cell, the method comprising providing to the cell a construct according to any one of claims 1 to 33, a vector according to any one of claims 34 to 39, or an LNP according to claim 40.

49. A method for increasing expression of a polypeptide in a cell, the method comprising providing to the cell a construct according to any one of claims 1 to 33, a vector according to any one of claims 34 to 39, or an LNP according to claim 40.

50. The method of any one of claims 46 to 49, wherein the construct, vector or LNP is provided in vivo.

51. The method of any one of claims 46 to 49, wherein the construct, vector or LNP is provided in vitro.

52. 41. An ex vivo method of modifying a target locus comprising providing a cell with a construct according to any one of claims 1 to 33, a vector according to any one of claims 34 to 39, or an LNP according to claim 40.

53. The method of any one of claims 46 to 52, wherein the cells are of a non-dividing cell type.

54. 54. The method of any of claims 46 to 53, further comprising providing said cell with a nuclease, said nuclease capable of introducing site-specific ssDNA or dsDNA breaks.

55. 55. The method of any one of claims 46 to 54, comprising providing the cell with an RNA-guided DNA binding agent and a guide RNA (gRNA).

56. 56. The method of Claim 55, wherein the gRNA is a single gRNA (sgRNA).

57. 57. The method of claim 55 or 56, wherein the construct, the RNA-guided DNA binding agent, and the gRNA are provided to the cell simultaneously.

58. 57. The method of claim 55 or 56, wherein the construct, the RNA-guided DNA binding agent, and the gRNA are provided to the cell sequentially, in any order.

59. 59. The method of Claim 58, wherein the construct is provided to the cell prior to providing the gRNA and RNA-guided DNA binding agent.

60. 59. The method of claim 58, wherein the RNA-guided DNA binding agent, or a combined RNA-guided DNA binding agent and gRNA, is provided to the cell prior to providing the construct.

61. The method of any one of claims 54 to 60, wherein the construct is provided in a vector.

62. The method of any one of claims 54 to 60, wherein the construct is provided in a lipid nanoparticle.

63. The method according to any one of claims 54 to 62, wherein the RNA-guided DNA binding agent is provided as a nucleic acid encoding the RNA-guided DNA binding agent.

64. The method of any one of claims 54 to 62, wherein the RNA-guided DNA binding agent is provided as an mRNA encoding a Cas enzyme or an RNA-guided DNA binding agent.

65. The method of any one of claims 54 to 62, wherein the RNA-guided DNA binding agent is a Cas nuclease, such as a Cas9 nuclease.

66. 66. The method of claim 65, wherein the Cas nuclease is a class 2 Cas nuclease, or a variant thereof.

67. 67. The method of any one of claims 54 to 66, wherein the Cas nuclease is S. pyogenes Cas9, or a variant thereof.

68. The method of any one of claims 54 to 67, wherein the Cas nuclease is a nickase.

69. 69. The method of any one of claims 54 to 68, wherein the locus is the albumin locus.

70. 70. The method of any one of claims 54 to 69, wherein the cells are of a non-dividing cell type.

71. The method of any one of claims 54 to 70, wherein the cell is a liver cell, a neuronal cell, or a muscle cell.

72. A cell produced by the method of any one of claims 46 to 71.

73. 73. The cell of claim 72, wherein the cell is a host cell.

74. 74. The host cell of claim 73, wherein the host cell is a liver cell, a muscle cell, or a neuronal cell.

75. The cell of any one of claims 72 to 74, wherein the host cell is a non-dividing cell type.

76. 76. The cell of any one of claims 72 to 75, wherein the host cell expresses the polypeptide encoded by the construct.

77. The cell according to any one of claims 72 to 76, wherein the host cell is a hepatocyte.

78. The bidirectional nucleic acid construct according to any one of claims 1 to 33, wherein the agent is a therapeutic agent.

79. The bidirectional nucleic acid construct of any one of claims 1 to 33, wherein the agent is any one or more of a functional RNA, an mRNA, or a polypeptide.

80. The bidirectional nucleic acid construct according to any one of claims 1 to 33, wherein the agent is a polypeptide.

81. The bidirectional nucleic acid construct according to any one of claims 1 to 33, wherein the agent is a therapeutic polypeptide.

Images