Method for treating pancreatic cancer

Abstract

To satisfy the need for chemo-therapeutic agents that overcome the PDA biophysical barrier to produce effective biodistribution into tumor tissues, have the requisite pharmacodynamic properties and combine synergistically with other chemo-therapeutic agents for the treatment of pancreatic cancer.SOLUTION: A method for treating pancreatic cancer in a subject in need thereof comprising, administering to the subject an effective amount of a tubulin polymerization inhibitor compound is described herein. More particularly, a method for treating pancreatic ductal adenocarcinoma in a subject in need thereof comprising, administering to the subject an effective amount of a substituted reverse pyrimidine tubulin polymerization inhibitor compound alone or in combination with other chemo-therapeutic agents is described herein.SELECTED DRAWING: None

Description

[Technical field]

[0001] Described herein is a method for treating pancreatic cancer in a subject in need thereof, comprising administering to the subject an effective amount of a tubulin polymerization inhibitor compound.More specifically, described herein is a method for treating pancreatic ductal adenocarcinoma in a subject in need thereof, comprising administering to the subject an effective amount of a substituted inverted pyrimidine tubulin polymerization inhibitor compound, alone or in combination with other chemotherapeutic agents. [Background technology]

[0002] An estimated 55,440 Americans were diagnosed with pancreatic cancer in 2018, making it the fifth leading cause of cancer-related mortality. These figures are expected to increase over the next decade. Pancreatic ductal adenocarcinoma (PDA) is a highly chemotherapy-resistant cancer that is responsible for over 45,000 deaths annually and accounts for approximately 93% of pancreatic tumors. Despite several major advances in recent years, PDA remains a primarily incurable cancer with a median survival of less than six months and a five-year survival rate of only 8.7%. Several factors contribute to this poor prognosis. Most patients (85%) present with progressive disease that precludes one effective intervention: surgical resection. However, even among patients with localized disease who undergo surgery, the 5- and 10-year survival rates are only 25% and 8%, respectively, due to high recurrence rates (A. Richter et al., World J Surg 27, 324, Mar 2003). For these remaining 85% of patients, and for those with recurrent disease, few treatments are available. Gemcitabine, the national standard of care therapy, has been shown to modestly extend survival by several weeks, primarily improving quality of life indicators (HA Burris, 3rd et al., J Clin Oncol 15, 2403, Jun 1997). The only other FDA-approved drug for advanced PDA is Tarceva, which, when combined with gemcitabine, provides an average of just 10 days of additional benefit. Despite over 60 clinical trials of various agents and combinations (HQ Xiong, K. Carr, JL Abbruzzese, Drugs 66, 1059, 2006), no other effective therapies have been identified.

[0003] One of the most striking features of PDA is the presence of an expansive desmoplastic stroma that orchestrates the local microenvironment resulting in high interstitial fluid pressure, reduced vascularity, and reduced tissue perfusion and diffusion. Consequently, drug delivery to pancreatic tumors is less efficient than to normal tissue, contributing to the widespread primary chemoresistance that characterizes the disease. The widespread resistance of PDA to cytotoxic therapies is due, in part, to this biophysical impediment to drug delivery. Preclinical testing of chemotherapeutic agents in KPC (KrasLSL.G12D / +; p53R172H / +; PdxCretg / +) genetically engineered mouse models suggests that drug development efforts for PDA should emphasize agents with long half-lives and high therapeutic indices (the concentration range between efficacy and toxicity) as a means to improve drug exposure. Similarly, drug stability and retention within tumor cells should also be considered in the design of new regimens for PDA.

[0004] Unfortunately, most traditional cytotoxic agents are rapidly cleared from the circulation, are acutely toxic to normal proliferating tissues, are rapidly metabolized, or are actively excreted from tumor cells. An instructive counterexample is nab-paclitaxel (Abraxane, Celgene), an FDA-approved albumin-bound form of the microtubule-stabilizing agent paclitaxel, combined with gemcitabine for patients with metastatic pancreatic cancer. Nab-paclitaxel has a terminal half-life of 27 hours in the circulation and is less toxic than unmodified paclitaxel. The success of this regimen helped establish the importance of pharmacology in pancreatic cancer drug development and demonstrated the benefits of combining gemcitabine (a deoxycytidine analog) with a microtubule-targeting agent. Thus, there remains a need for chemotherapeutic agents that overcome the biophysical obstacles of PDA to result in effective biodistribution to tumor tissue, possess the necessary pharmacodynamic properties, and can be synergistically combined with other chemotherapeutic agents for the treatment of pancreatic cancer. Summary of the Invention

[0005] Compound 1, designated 5-fluoro-2-(6-fluoro-2-methyl-1H-benzo[d]imidazol-1-yl)-N4-[4-(trifluoromethyl)phenyl]pyrimidine-4,6-diamine having the structure of formula (I), or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, is a small molecule anti-cancer agent useful for inhibiting tubulin polymerization and BMI-1 protein function (see WO2014 / 081906).

[0006] [ka] Formula (I) Compound 1 demonstrated pharmacological properties including a long circulating half-life and lack of P-glycoprotein (PGP) substrate activity and effective biodistribution to tumor tissues. Additionally, compound 1 was shown to induce mitotic arrest and apoptosis in multiple PDA cell lines.

[0007] Mechanistic studies have shown, without being limited to any one particular theory, that compound 1 functions as a microtubule polymerization inhibitor. Furthermore, compound 1 synergistically combines with standard clinical regimens, such as gemcitabine and / or nab-paclitaxel, to improve efficacy in patient-derived xenograft models (PDX), resulting in potent and durable cancer regression. Additionally, compound 1 has shown efficacy in combination with gemcitabine in a highly chemotherapy-resistant genetically engineered KPC PDA mouse model. These data and the demonstrated safety profile as an anticancer agent in clinical development demonstrate a clear rationale for the development of compound 1 in combination with standard of care chemotherapy for PDA. explanation One embodiment described herein includes a method of treating pancreatic cancer in a subject in need thereof, comprising administering to the subject an effective amount of compound 1, 5-fluoro-2-(6-fluoro-2-methyl-1H-benzo[d]imidazol-1-yl)-N4-[4-(trifluoromethyl)phenyl]pyrimidine-4,6-diamine, having the structure of formula (I), or a pharma- ceutically acceptable salt or pharmaceutical composition thereof.

[0008] [ka] Formula (I) Another embodiment includes a method of treating pancreatic ductal adenocarcinoma in a subject in need thereof, comprising administering to the subject an effective amount of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof.

[0009] One embodiment described herein includes a method of treating pancreatic cancer in a subject in need thereof, comprising administering to the subject an effective amount of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, in combination with an effective amount of one or more chemotherapeutic agents. Another embodiment includes a method of treating pancreatic ductal adenocarcinoma in a subject in need thereof, comprising administering to the subject an effective amount of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, in combination with an effective amount of one or more chemotherapeutic agents. One embodiment described herein includes a method of treating pancreatic ductal adenocarcinoma in a subject in need thereof, comprising administering to the subject an effective amount of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, in combination with an effective amount of either gemcitabine and / or nab-paclitaxel. Another embodiment includes a method of treating pancreatic ductal adenocarcinoma in a subject in need thereof, comprising administering to the subject an effective amount of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, in combination with an effective amount of either gemcitabine and / or nab-paclitaxel. [Brief description of the drawings]

[0010] [Figure 1a] 1 is a graph showing relative Aspc1 cell viability over time after treatment with vehicle or Compound 1 (0.1 μM or 1.0 μM). The results show that Compound 1 exhibits a dose- and time-dependent decrease in human PDA cell viability compared to vehicle. [Figure 1b] Representative histograms showing DNA content measured by flow cytometry of 7-AAD fluorescence from Aspc1 cells treated with vehicle or compound 1 (0.1 μM or 1.0 μM). [Figure 1c] Graph showing the percentage of Aspc1 cells in G0 / G1, S and G2 / M phases 24 hours after treatment with vehicle (DMSO), Compound 1 (0.1 μM, 1.0 μM) or 0.1 μM nocodazole (NOC, positive control). [Figure 1d]1b, 1c, and 1d are plots showing the percentage of Aspc1 cells in mitosis (PH3+ / 4N DNA content) following 24 hour treatment with DMSO, Compound 1 (0.1 μM or 1.0 μM), or 0.1 μM nocodazole (NOC). Figures 1b, 1c, and 1d show that Compound 1 exhibits dose- and time-dependent effects of cell cycle arrest in human PDA cells. [Figure 2a] Representative histograms showing DNA content as measured by DAPI fluorescence in Aspc1 cells treated with vehicle or Compound 1 (1.0 μM) at 24, 48 and 72 hours. [Figure 2b] 2A and 2B are graphs showing the percentage of Aspc1 cells with >4N DNA content after treatment with DMSO or Compound 1 (0.1 μM or 1.0 μM) at 24, 48, and 72 hours. Figures 2a and 2b show that Compound 1 shows a dose- and time-dependent increase in the amount of human PDA cells affected by ploidy. [Figure 3a] Representative flow cytometry scatter plots showing induction of apoptosis in Aspc1 cells following treatment with DMSO for 24 hours or with 1.0 μM compound 1 for 72 hours. Unfixed cells were stained with active caspase 3 and DAPI to distinguish live cells (bottom left) from early apoptotic (top left), late apoptotic (top right) and necrotic (bottom right). [Figure 3b] 3A and 3B are graphs showing total apoptotic Aspc1 cells (active caspase 3+) quantified for DMSO or compound at 24, 48 and 72 hours.Compared to vehicle, Compound 1 shows a time-dependent increase in cellular biomarkers, indicating a corresponding increase in cellular apoptosis. [Figure 4a] 4A-4C are graphs showing plasma levels of Compound 1 in mice measured by mass spectrometry at baseline or 2, 4, 7, 24, or 48 hours after a single oral dose of Compound 1 (10 mg / kg). Figure 4a shows that Compound 1 has a long plasma half-life, penetrates the CNS, and distributes to brain tissue. [Figure 4b]Figure 4b is a plot showing the ratio of CC50 values ​​for treatment of MDCK-P-gp versus MDCK-WT cells with compound 1, compound 2, chlorpromazine, puromycin, vinblastine, doxorubicin, paclitaxel, and vincristine. Figure 4b shows that compound 1, compound 2, and chlorpromazine do not function as PGP substrates, in comparison to other chemotherapeutic agents that cause cell cycle arrest. [Figure 5a] 5a shows the concentration of Compound 1 in plasma, quadriceps and PDA tissue from KPC mice 24 hours after a single oral dose of Compound 1 (10 mg / kg) alone or in combination with gemcitabine (100 mg / kg). Figure 5a shows that the improved efficacy of the combination is not due to a pharmacokinetic drug-drug interaction. [Figure 5b] Western blot of cyclin B1 on tumors from KPC mice treated with 10 mg / kg of Compound 1. Tumor biopsies (Bx) were obtained 48 hours before the first dose and compared with samples obtained at necropsy (nx) 24 hours after the third dose. [Figure 5c] Graph quantifying cyclin B1 (CycB1) from Figure 5b normalized to vinculin (Vinc). Figure 5a shows that compound 1 is distributed in PDA tissues, and Figures 5b and 5c show that compound 1 shows a consistent reduction in cyclin B1 compared to vinculin, suggesting a reduction in mitotic progression of PDA cells induced by reduction in cyclin B1 compared to vinculin-induced apoptosis. [Figure 6a] 1 is a plot showing body weight over time in KPC mice treated with a combination of Compound 1 and gemcitabine. [Figure 6b] 1 is a plot showing survival over time of KPC mice treated with vehicle (VEH), gemcitabine (GEM, 100 mg / kg twice weekly), Compound 1 (Cpd1, 17 mg / kg twice weekly) or a combination of Compound 1 and gemcitabine (Cpd / GEM). [Figure 6c]1 is a plot showing calculations of tumor growth rate calculated from longitudinal tumor volumes in KPC mice treated with vehicle (VEH), gemcitabine (GEM), compound 1 (Cpd1), or a combination of compound 1 and gemcitabine (Cpd / GEM). [Figure 6d] Plot showing immunohistochemistry quantification of phosphorylated histone H3 (PH3) cells showing the average positive cells per 40x field across 10 fields per tumor after necropsy of KPC mice treated with vehicle (VEH), gemcitabine (GEM), compound 1 (Cpd1) or a combination of compound 1 and gemcitabine (Cpd / GEM). [Figure 6e] Plots showing immunohistochemistry quantification of phosphorylated cleaved caspase 3 (CC3) cells showing the average positive cells per 40x field across 10 fields per tumor after necropsy of KPC mice treated with vehicle (VEH), gemcitabine (GEM), compound 1 (Cpd1) or the combination of compound 1 and gemcitabine (Cpd1 / GEM). Figures 6a, 6b, 6c, 6d and 6e show that compound 1 in combination with gemcitabine synergistically increases overall survival in the KPC mouse model. Thus, Figure 6a shows that compound 1 in combination with gemcitabine maintains the relative body weight of KPC mice. Figure 6b shows that compound 1 in combination with gemcitabine synergistically increases overall survival while simultaneously reducing tumor volume compared to each agent alone, compared to vehicle, gemcitabine alone or compound 1 alone. Figures 6c, 6d and 6e show that compound 1 in combination with gemcitabine shows an overall reduction in the proliferation rate of PDA cells and specific cellular biomarkers compared to vehicle, gemcitabine alone or compound 1 alone. [Figure 7a] FIG. 1 is a plot showing tumor volumes measured by 3D high resolution ultrasound in KPC mice treated with vehicle (veh) or compound 1 (Cpd1). [Figure 7b]7A and 7B are plots showing tumor volumes measured by 3D high-resolution ultrasound in KPC mice treated with vehicle (veh) or the combination of Compound 1 and gemcitabine (Cpd1 / gem). Figure 7a shows that Compound 1 exhibits a time-dependent reduction in KPC mouse model PDA tumor volume compared to vehicle, and Figure 7b shows that Compound 1 in combination with gemcitabine exhibits a further time-dependent reduction in KPC mouse PDA tumor volume compared to gemcitabine alone or Compound 1 alone. [Figure 8a] 1 is a plot showing tumor growth as measured by percent volume change over 7 days in KPC mice treated with vehicle (VEH), compound 1 (Cpd1), gemcitabine (GEM) or a combination of compound 1 and gemcitabine (Cpd1 / GEM). [Figure 8b] 8A and 8B are plots showing the percentage of mice with liver metastases in KPC mice treated with vehicle (V), compound 1 (Cpd1+V), gemcitabine (G), or a combination of compound 1 and gemcitabine (Cpd1+G). Figure 8a shows that compound 1 in combination with gemcitabine exhibits reduced KPC mouse PDA tumor growth compared to vehicle, gemcitabine alone, or compound 1 alone, and Figure 8b shows that compound 1 in combination with gemcitabine exhibits reduced KPC mouse PDA-driven liver metastases compared to vehicle and gemcitabine alone. [Figure 9a] 13 is an image showing stained tumor sections from KPC mice treated with gemcitabine (GEM). [Figure 9b] 9A and 9B are images showing stained tumor sections from KPC mice treated with a combination of compound 1 and gemcitabine (Cpd1 / GEM). Figure 9a shows the gemcitabine-induced apoptotic cell population, and Figure 9b shows the apoptotic cell population induced by compound 1 in combination with gemcitabine. Here, compound 1 in combination with gemcitabine shows a significant increase in apoptotic cell population, suggesting a synergistic increase in apoptosis induction. [Figure 10a]Figure 10a is a series of western blots showing BMI-1 levels in Aspc1, MiaPaCa-2 and Panc1 cells treated for 24 hours with vehicle (VEH), 0.1 μM nocodazole (NOC), 0.1 μM compound 1 (0.1) or 1.0 μM compound 1 (1.0) compared to vinculin (VINC) loaded controls. Figure 10b shows that compound 1 shows a consistent decrease in BMI-1 protein expression in various cell types compared to vehicle and vinculin expression. [Figure 10b] 10b shows the relative viability of J1002VEH and J1002TAM cells treated with vehicle (VEH), 0.1 μM compound 1 (Cpd1) or 1.0 μM compound 1 (Cpd1) for 96 hours. Figure 10b shows that compared to vehicle and the presence of J1002, compound 1 shows a dose- and time-dependent decrease in cell viability that is dependent on BMI-1 protein expression. [Figure 10c] 10c is a graph showing dose response curves of J1002VEH and J1002TAM cells treated for 72 hours with Compound 1. Figure 10c shows that Compound 1 exhibits sub-μM activity in reducing BMI-1 protein expression in the presence of J1002 compared to vehicle-treated cells. [Figure 10d] Graph showing representative DNA histograms of J1002VEH cells treated with vehicle (VEH) or 1.0 μM compound 1 (Cpd1) for 24 hours. [Figure 10e] 1 is a graph showing the percentage of J1002VEH cells in G0 / G1, S and G2 / M phases 24 hours after treatment with vehicle (VEH) or 1.0 μM Compound 1 (Cpd1). [Figure 10f] Graph showing representative DNA histograms of J1002TAM cells treated with vehicle (VEH) or 1.0 μM compound 1 (Cpd1) for 24 hours. [Figure 10g]Graphs showing the percentage of J1002 TAM cells in G0 / G1, S and G2 / M phases 24 hours after treatment with vehicle (VEH) or 1.0 μM Compound 1 (Cpd1). Figures 10d, 10e, 10f and 10g show that Compound 1 shows a dose- and time-dependent increase in the amount of BMI-1-dependent cells affected by ploidy compared to vehicle and the presence of J1002, so the data collectively suggest that Compound 1 induces BMI-1 hyperphosphorylation indirectly as a result of mitotic arrest. [Figure 11a] 13 is a plot showing differentially expressed genes as measured by RNA-seq in Aspc1 cells treated with DMSO or 1 μM compound 1 (Cpd1) integrated over 8, 16 and 24 hour time points. [Figure 11b] Western blots showing free tubulin from Aspc1 cells treated with vehicle (VEH), 3.0 μM compound 1 (Cpd1), 1.0 μM colchicine (COL) or 1.0 μM paclitaxel (TAX) for 2 hours. After treatment, cell lysates were fractionated by centrifugation to separate free tubulin from microtubules. LSP = low speed pellet (1,000×g, 5 min), HSP = high speed pellet (100,000×g, 1 hr), HSS = high speed supernatant (100,000×g, 1 hr). Figures 11a and 11b show that compound 1 shows a significant increase in fold change in preventing tubulin formation compared to vehicle, COL (carboplatin) and TAX (tamoxifen). [Figure 11c] Images showing tubulin and DAPI in Aspc1 cells treated with vehicle (VEH) for 24 hours. [Figure 11d] 11C and 11D are images showing tubulin and DAPI in Aspc1 cells treated with Compound 1 (Cpd1) for 24 hours. Figures 11c and 11d show that Compound 1 shows a significant decrease in tubulin formation compared to vehicle. [Figure 11e]FIG. 1 is a graph showing a time course tubulin polymerization assay of cells treated with vehicle (DMS), tamoxifen (TAX), carboplatin (COL) and compound 1 (0.12 μM, 0.37 μM, 1.11 μM, 3.33 μM and 10 μM). [Figure 11f] Figure 11e is a graph showing the fluorescence units / minute shown in Figure 11e and 11f show that Compound 1 exhibits a dose-dependent reduction in tubulin polymerization compared to vehicle, COL (carboplatin) and TAX (tamoxifen), so collectively the data suggests that Compound 1 directly inhibits microtubule formation. [Figure 12a] FIG. 1 is a graph showing the mean tumor volume over time of patient-derived subcutaneous xenografts derived from human PDA treated with vehicle (veh), gemcitabine (gem), nab-paclitaxel (nabP), a combination of gemcitabine and nab-paclitaxel (gm / nabP), compound 1 (Cpd1), a combination of compound 1 and gemcitabine (Cpd1 / gem), a combination of compound 1 and nab-paclitaxel (Cpd1 / nabP), and a combination of compound 1, gemcitabine, and nab-paclitaxel (Cpd1 / gem / nabP). [Figure 12b] FIG. 1 is a graph showing body weight over time for mice treated with vehicle (veh), gemcitabine (gem), nab-paclitaxel (nabP), a combination of gemcitabine and nab-paclitaxel (gm / nabP), compound 1 (Cpd1), a combination of compound 1 and gemcitabine (Cpd1 / gem), a combination of compound 1 and nab-paclitaxel (Cpd1 / nabP), and a combination of compound 1, gemcitabine, and nab-paclitaxel (Cpd1 / gem / nabP). [Figure 12c] 1 is a graph showing the growth and decay constants of tumors treated with gemcitabine (gem), nab-paclitaxel (nabP) and compound 1 (Cpd1). [Figure 12d]Plots showing tumor response of mice treated with vehicle (veh), gemcitabine (gem), nab-paclitaxel (nabP), gemcitabine and nab-paclitaxel combination (gm / nabP), compound 1 (Cpd1), compound 1 and gemcitabine combination (Cpd1 / gem), compound 1 and nab-paclitaxel combination (Cpd1 / nabP), and compound 1 and gemcitabine and nab-paclitaxel combination (Cpd1 / gem / nabP). Figures 12a, 12b, 12c, and 12d show that compound 1 in either or both of the dual combination with nab-paclitaxel and the triple combination with gemcitabine and nab-paclitaxel synergistically reduces tumor volume and overall tumor growth in a human-derived xenograft model of PDA. Thus, Figure 12a shows that compound 1 in either or both of the dual combination with nab-paclitaxel and the triple combination with gemcitabine and nab-paclitaxel synergistically reduces tumor volume compared to vehicle, gemcitabine alone, compound 1 alone, nab-paclitaxel alone, gemcitabine combined with nab-paclitaxel and gemcitabine combined with compound 1. Figure 12b shows that compound 1 combined with nab-paclitaxel and compound 1 combined with both gemcitabine and nab-paclitaxel synergistically maintains the relative body weight of KPC mice compared to vehicle, gemcitabine alone, compound 1 alone, nab-paclitaxel alone, gemcitabine combined with nab-paclitaxel and gemcitabine combined with compound 1. FIG. 12c shows that compound 1 in combination with either or both of gemcitabine and nab-paclitaxel significantly reduces the overall tumor growth rate while increasing the rate of tumor volume decay compared to the presence or absence of either gemcitabine, compound 1, and nab-paclitaxel.FIG. 12d shows that compound 1 in combination with either or both of gemcitabine and nab-paclitaxel significantly reduces initial tumor volume compared to the presence or absence of either gemcitabine, compound 1 and nab-paclitaxel. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] definition The term "about" as used herein means a range around a given value, where the resulting value is substantially the same as the value explicitly recited. In one embodiment, "about" means within 25% of a given value or range. For example, the expression "about 70% by weight" includes at least all values ​​between 52% and 88% by weight. In another embodiment, the term "about" means within 10% of a given value or range. For example, the expression "about 70% by weight" includes at least all values ​​between 63% and 77% by weight. In another embodiment, the term "about" means within 7% of a given value or range. For example, the expression "about 70% by weight" includes at least all values ​​between 65% and 75% by weight.

[0012] Concentrations, amounts, cell numbers, percentages, and other numerical values ​​may be presented herein in a range format. It should be understood that such range formats are used merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values ​​expressly recited as range limits, but also to include all individual numerical values ​​or subranges subsumed within the range, as if each numerical value and subrange were expressly recited. As used herein, the terms "therapy" and "therapy" can refer to any protocols, methods, compositions, formulations, and / or agents that can be used to prevent, treat, manage, or ameliorate a condition or disorder, or one or more symptoms thereof (e.g., pancreatic cancer, or one or more symptoms or conditions associated therewith).

[0013] In certain embodiments, the terms "therapy" and "therapy" refer to drug therapies such as chemotherapy, adjunctive therapy, radiation, surgery, biological therapy, supportive therapy, antiviral therapy, and / or other therapies useful for treating, managing, preventing, or ameliorating a condition or disorder or one or more symptoms thereof (e.g., pancreatic cancer, or one or more symptoms or conditions associated therewith). In certain embodiments, the terms "therapy" refer to therapies other than Compound 1, or a pharmaceutically acceptable salt or pharmaceutical composition thereof. In specific embodiments, "additional therapy" and "additional therapeutics" refer to therapies other than treatment with Compound 1, or a pharmaceutically acceptable salt or pharmaceutical composition thereof. In specific embodiments, therapy includes the use of Compound 1 as an adjunctive therapy. For example, Compound 1 is used in combination with drug therapies such as chemotherapy, biological therapy, surgery, supportive therapy, antiviral therapy, and / or other therapies useful for treating, managing, preventing, or ameliorating a condition or disorder or one or more symptoms thereof (e.g., pancreatic cancer, or one or more symptoms or conditions associated therewith).

[0014] As used herein, the term "human infant" refers to a human from newborn to 1 year of age. As used herein, the term "human infant" refers to a human between the ages of 1 and 3. As used herein, the term "human child" refers to a human between the ages of 1 and 18. As used herein, the term "adult human" refers to humans aged 18 years or older. As used herein, the term "middle-aged human" refers to a human between the ages of 30 and 64.

[0015] As used herein, the term "elderly human" refers to a human aged 65 years or older. As used herein, the term "subject" refers to an individual to whom the therapy described herein is administered. In a specific embodiment, the individual is a human. As used herein, the term "pancreatic cancer" generally refers to the pancreatic cancers described herein. In a specific embodiment, the generic term pancreatic cancer can refer to pancreatic ductal adenocarcinoma (PDA) without specifically using the term pancreatic ductal adenocarcinoma.

[0016] In the context of administering Compound 1 to a subject with pancreatic cancer, the term "effective amount" as used herein refers to a dose of Compound 1 that produces a beneficial or therapeutic effect.In a specific embodiment, an "effective amount" of Compound 1 refers to an amount of Compound 1 that is sufficient to achieve at least one, two, three, four or more of the following beneficial or therapeutic effects: (i) inhibition of pancreatic cancer; (ii) regression of pancreatic cancer; (iii) eradication, removal or complete remission of pancreatic cancer; (iv) prevention of the onset or development of one or more symptoms associated with pancreatic cancer; (v) reduction or amelioration of the severity of one or more symptoms associated with pancreatic cancer; (vi) reduction in the number of one or more symptoms associated with pancreatic cancer; (vii) improving the severity of one or more symptoms associated with pancreatic cancer; (viii) reducing the duration of one or more symptoms associated with pancreatic cancer; (ix) preventing the growth or recurrence of one or more symptoms associated with pancreatic cancer; (x) reducing mortality; (xi) increasing the survival rate of a subject; (xii) increasing recurrence-free survival; (xiii) increasing the number of subjects with pancreatic cancer in remission; (xiv) reducing hospitalization of a subject; (xv) reducing the length of hospitalization; (xvi) reducing the rate of hospitalization; (xvii) increasing survival of a subject; (xviii) reducing the number of subjects with pancreatic cancer in remission. (xix) increasing symptomatic survival; (xx) increasing the duration of remission of pancreatic cancer in a subject; (xx) improving quality of life (QOL) as assessed by methods known in the art, such as, for example, a QOL questionnaire; (xxi) decreasing proliferation by administration of Compound 1 prior to treatment with another chemotherapeutic agent; (xxii) decreasing proliferation by administration of Compound 1 after treatment with another chemotherapeutic agent; (xxiii) decreasing proliferation in combination therapy by administration of Compound 1 with another chemotherapeutic agent; (xxiv) additive anti-proliferative effect in combination therapy by administration of Compound 1 with another chemotherapeutic agent; (xxv) synergistic anti-proliferative effect in combination therapy by administration of Compound 1 with another chemotherapeutic agent; (xxvi) decreasing proliferation by administration of Compound 1 prior to radiation therapy; (xxvii) decreasing proliferation by administration of Compound 1 after radiation therapy; (xxviii) decreasing proliferation by administration of Compound 1 in combination therapy with radiation; (xxix) decreasing proliferation by administration of Compound 1 prior to treatment with surgery; (xxx) decreasing proliferation by administration of Compound 1 in combination therapy with surgery;(xxxi) an improved or improved therapeutic effect of administration of Compound 1 in conjunction with symptomatic treatment; (xxxii) a reduction in the plasma concentration of BMI-1 in a subject with pancreatic cancer; (xxxiii) a reduction in circulating proliferating cells in the plasma of a subject with pancreatic cancer; (xxxiv) a change (e.g., a decrease or increase) in the plasma concentration of a pancreatic cancer biomarker (e.g., BMI-1, tubulin polymerization, apoptosis marker or tissue, etc.) in a subject with pancreatic cancer; (xxxv) a reduction in the concentration of BMI-1 in a biological sample (e.g., plasma, serum, urine or any other biological fluid) from a subject with pancreatic cancer; (xxxvi) a reduction in the concentration of BMI-1 in a biological sample (e.g., plasma, serum, urine or any other biological fluid) from a subject with pancreatic cancer using conventional methods available to one of skill in the art, such as magnetic resonance imaging (MRI), dynamic contrast-enhanced MRI (DCE-MRI), X-ray, computed tomography (CT) scan, positron emission tomography (PET) scan, 7-AAD fluorescence or DAPI fluorescence. (xxxvii) the number of proliferating cells is decreased after administration of the therapy described herein, as measured by conventional methods available to those of skill in the art, such as magnetic resonance imaging (MRI), dynamic contrast-enhanced MRI (DCE-MRI), X-ray, computed tomography (CT) scan, positron emission tomography (PET) scan, 7-AAD fluorescence or DAPI fluorescence; (xxxviii) the number of proliferating cells does not increase or increases less than expected after administration of the therapy described herein, as measured by conventional methods available to those of skill in the art, such as magnetic resonance imaging (MRI), dynamic contrast-enhanced MRI (DCE-MRI), X-ray, computed tomography (CT) scan, positron emission tomography (PET) scan, 7-AAD fluorescence or DAPI fluorescence;

[0017] The term "in 24 hours" as used herein refers to the period during which the condition is maintained.For example, the effective amount of Compound 1 is identified when the average plasma concentration of Compound 1 is achieved and maintained for the majority of 24 hours.In other words, the average plasma concentration of Compound 1 can be reached for a suitable time, which may be longer or shorter than 24 hours. As used herein, the term "therapy described herein" refers to a method of using Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, as an inhibitor of BMI-1 function by targeting inhibition of tubulin polymerization in the treatment or amelioration of pancreatic cancer in a subject in need thereof, comprising administering an effective amount of Compound 1 to the subject. In one embodiment, pancreatic cancer is pancreatic ductal adenocarcinoma.In another embodiment of the therapy described herein, the method of using compound 1 or its pharmacologic acceptable salt or pharmaceutical composition includes combination with other chemotherapeutic agents that have synergistic antiproliferative activity.In one embodiment, the other chemotherapeutic agent inhibits the functional activity of BMI-1.In another embodiment, the other chemotherapeutic agent inhibits tubulin polymerization.

[0018] As used herein, the term "pharmaceutically acceptable salts" refers to salts prepared from pharma- ceutically acceptable non-toxic acids or bases, including inorganic acids and bases, and organic acids and bases; see, e.g., Remington's Pharmaceutical Sciences, 18 th eds., Mack Publishing, Easton PA (1990) or Remington: The Science and Practice of Pharmacy, 19 th eds., Mack Publishing, Easton PA (1995). The term "compound 1" as used herein generally refers to 5-fluoro-2-(6-fluoro-2-methyl-1H-benzo[d]imidazol-1-yl)-N4-[4-(trifluoromethyl)phenyl]pyrimidine-4,6-diamine compound and its pharma- ceutically acceptable salts. "Compound 1" can be substantially pure (e.g., about 90%, about 95%, about 98%, about 99% or about 99.9% pure). In various embodiments, the term "compound 1" refers to compound 109, disclosed in International Publication No. WO2014 / 081906, the entirety of which is incorporated herein by reference.

[0019] How to use As described herein, compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, is an inhibitor of tubulin polymerization and BMI-1 function for use in treating or ameliorating pancreatic cancer in a subject in need thereof, comprising administering to the subject an effective amount of compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof. In one embodiment, the pancreatic cancer is pancreatic ductal adenocarcinoma. In another embodiment, the method of using compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition includes the combination of compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition with one or more other chemotherapeutic agents, and the combination shows synergistic antiproliferative activity.In one embodiment, the other chemotherapeutic agent inhibits the functional activity of BMI-1.In another embodiment, the other chemotherapeutic agent inhibits tubulin polymerization.However, there are no known or approved inhibitors of either or both of the functional activity or tubulin polymerization of BMI-1 for use in the treatment of pancreatic cancer.Therefore, the potent and selective activity, favorable pharmaceutical properties and extensive clinical experience suggest that compound 1 is a useful agent for the treatment of pancreatic cancer.

[0020] In one aspect, described herein are methods of inhibiting or reducing tubulin polymerization and BMI-1 function to induce cell cycle arrest in proliferating cells or cell lines. In another aspect, a method of inhibiting or reducing tubulin polymerization and BMI-1 function to induce cell cycle arrest in a proliferating cell or cell line comprises contacting a proliferating cell or cell line with compound 1 or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, the proliferating cell or cell line being naive or having been shown to be susceptible to inhibition or reduction of tubulin polymerization and BMI-1 function. In another embodiment, non-limiting examples of such cells or cell lines are selected from HL-60, HeLa, HT1080, HCT116, HEK293, NCI H460, U-87MG, ASPC-1, PL-45, HPAF-2, PC-3, MDA-MB-231, MDA-MB-468, A431, SNU-1, AGS, Kato III, A549, Calu-6, A375, SY5Y, SKOV3, Capan-1, sNF96.2, TIVE-L1, TIVE-L2, LNCaP cells, etc. In a more specific embodiment, the cell or cell line can be a pancreatic cancer cell.

[0021] In one aspect, a method for inhibiting or reducing tubulin polymerization and BMI-1 function in a subject having pancreatic cancer in need thereof comprises administering to the subject an effective amount of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, as described herein. In a specific embodiment, the subject is diagnosed with pancreatic cancer, which can be treated by inhibiting or reducing tubulin polymerization and BMI-1 function. In specific embodiments, the methods of inhibiting or reducing tubulin polymerization and BMI-1 function described herein inhibit or reduce tubulin polymerization and BMI-1 function by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 80%, 85%, 90%, 95% or 100% compared to tubulin polymerization and BMI-1 function prior to administration of Compound 1 to the subject, as assessed by methods well known in the art.

[0022] In specific embodiments, the methods of inhibiting or reducing tubulin polymerization and BMI-1 function described herein inhibit or reduce tubulin polymerization and BMI-1 function by about 5% to about 20%, 10% to 30%, 15% to 40%, 15% to 50%, 20% to 30%, 20% to 40%, 20% to 50%, 30% to 60%, 30% to 70%, 30% to 80%, 30% to 90%, 30% to 95%, 30% to 99%, or about 40% to about 100%, or any range therebetween, as compared to tubulin polymerization and BMI-1 function prior to administration of Compound 1 to the subject, as assessed by methods well known in the art.

[0023] In specific embodiments, the methods of inhibiting or reducing tubulin polymerization and BMI-1 function described herein inhibit proliferation by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 80%, 85%, 90%, 95% or 100% or reduce an in vitro or in vivo proliferated cell or cell line population by the percentages described above, as compared to an in vitro or in vivo proliferated cell or cell line population prior to administration of Compound 1 to the subject, as assessed by methods well known in the art.

[0024] In specific embodiments, the methods of inhibiting or reducing tubulin polymerization and BMI-1 function described herein inhibit proliferation or reduce an in vitro or in vivo proliferated cell or cell line population by about 5% to about 20%, 10% to 30%, 15% to 40%, 15% to 50%, 20% to 30%, 20% to 40%, 20% to 50%, 30% to 60%, 30% to 70%, 30% to 80%, 30% to 90%, 30% to 95%, 30% to 99%, or about 40% to about 100%, or any range therebetween, as compared to the in vitro or in vivo proliferated cell or cell line population prior to administration of Compound 1 to the subject, as assessed by methods well known in the art. In various embodiments, the methods of inhibiting or reducing tubulin polymerization and BMI-1 function described herein reduce the plasma concentration of BMI-1 in a subject as assessed by methods well known in the art, e.g., ELISA. In one aspect, a method for preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering an amount of compound 1 effective to inhibit or reduce tubulin polymerization and BMI-1 function in the subject, as described herein.

[0025] In specific embodiments, the methods of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof as described herein inhibit or reduce tubulin polymerization and BMI-1 function by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 80%, 85%, 90%, 95% or 100% compared to tubulin polymerization and BMI-1 function prior to administration of Compound 1 to the subject, as assessed by methods well known in the art. In specific embodiments, the methods of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof as described herein inhibit or reduce tubulin polymerization and BMI-1 function by about 5% to about 20%, 10% to 30%, 15% to 40%, 15% to 50%, 20% to 30%, 20% to 40%, 20% to 50%, 30% to 60%, 30% to 70%, 30% to 80%, 30% to 90%, 30% to 95%, 30% to 99%, or about 40% to about 100%, or any range therebetween, as compared to tubulin polymerization and BMI-1 function prior to administration of Compound 1 to the subject, as assessed by methods well known in the art.

[0026] In various embodiments, the methods of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof as described herein reduce the concentration of BMI-1 in the subject as assessed by methods well known in the art, e.g., ELISA. In one aspect, a method for preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering an amount of Compound 1 effective to inhibit proliferation or reduce the in vitro or in vivo proliferating cell or cell line population in the subject, as described herein. In specific embodiments, the methods of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof as described herein inhibit proliferation by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 80%, 85%, 90%, 95% or 100% or reduce the proliferation of an in vitro or in vivo proliferated cell or cell line population in a subject by said percentages compared to proliferation prior to administration of Compound 1 to the subject or to the subject's in vitro or in vivo proliferated cell or cell line population as assessed by methods well known in the art.

[0027] In specific embodiments, the methods of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof as described herein inhibit proliferation or reduce proliferation of an in vitro or in vivo proliferated cell or cell line population of a subject by about 5% to about 20%, 10% to 30%, 15% to 40%, 15% to 50%, 20% to 30%, 20% to 40%, 20% to 50%, 30% to 60%, 30% to 70%, 30% to 80%, 30% to 90%, 30% to 95%, 30% to 99%, or about 40% to about 100%, or any range therebetween, as compared to proliferation prior to administration of Compound 1 to the subject or to an in vitro or in vivo proliferated cell or cell line population of the subject, as assessed by methods well known in the art.

[0028] In various embodiments, as described herein, the methods of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof inhibit the proliferation or reduce the in vitro or in vivo proliferating cell or cell line population in the subject as assessed by methods well known in the art, e.g., ELISA. In one embodiment, a method of preventing, treating, or ameliorating pancreatic cancer in a subject in need thereof comprises administering to a subject in need thereof an amount of Compound 1, as described herein, effective to inhibit proliferation or reduce the subject's in vitro or in vivo proliferative cell or cell line population in combination with another therapy (e.g., one or more additional therapies that do not include Compound 1 or that include a different anti-proliferative agent). Such methods may include administering Compound 1 prior to, concurrently with, or after administration of the additional therapy. In certain embodiments, such methods have an additive or synergistic effect.

[0029] In a specific embodiment, provided herein is a method of preventing, treating, or ameliorating pancreatic cancer in a subject in need thereof, comprising administering to a subject in need thereof an effective amount of Compound 1 and an effective amount of another therapy. Specific examples of cancers that can be prevented, treated or ameliorated in accordance with the methods provided herein include, but are not limited to, pancreatic cancer, such as, but not limited to, pancreatic ductal adenocarcinoma. In certain embodiments, the pancreatic cancer that can be prevented, treated, or ameliorated in accordance with the methods provided herein is selected from pancreatic ductal adenocarcinoma. In one aspect, provided herein is a method of preventing, treating, or ameliorating pancreatic cancer, comprising: (a) administering one or more doses of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, to a subject in need thereof; and (b) monitoring the concentration of certain biomarkers before and / or after step (a).

[0030] In specific embodiments, the monitoring step (b) is performed before and / or after administration of a certain number of doses (e.g., 1, 2, 4, 6, 8, 10, 12, 14, 15 or 29 doses or more; 2-4, 2-8, 2-20, or 2-30 doses) or a certain period of time (e.g., 1, 2, 3, 4, 5, 6 or 7 days; or 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 45, 48 or 50 weeks) of Compound 1 or a pharma- ceutically acceptable salt thereof or pharmaceutical composition. In a specific embodiment, one or more of these monitoring parameters are detected prior to administration of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, to a subject. In a specific embodiment, a decrease in proliferation of an in vitro or in vivo grown cell or cell line population following administration of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, indicates that the course of treatment is effective in preventing, treating or ameliorating pancreatic cancer.

[0031] In specific embodiments, changes in the proliferation of an in vitro or in vivo grown cell or cell line population following administration of Compound 1, or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition thereof, may indicate that the dosage, frequency and / or duration of administration of Compound 1, or a pharma- ceutically acceptable salt thereof, or a pharmaceutical composition thereof, may be adjusted (e.g., increased, decreased or maintained). In a specific embodiment, the concentration of a particular biomarker in a subject's biological sample is monitored before, during and / or after a course of treatment for pancreatic cancer that includes administration of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, to the subject.

[0032] The dosage, frequency and / or duration of administration of Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition may be altered according to the results of the growth of in vitro or in vivo grown cell or cell line population. Alternatively, changes in these monitoring parameters (e.g., the concentration of a particular biomarker) may indicate that a course of treatment comprising administration of Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition is effective in preventing, treating or ameliorating pancreatic cancer. The concentration of a particular biomarker in a subject can be detected by any technique known to those skilled in the art. In certain embodiments, the method of detecting the concentration of a particular biomarker in a subject includes obtaining a biological sample (e.g., tissue or body fluid sample) from a subject, detecting the concentration of the biomarker in the biological sample (e.g., plasma, serum, urine or any other biological fluid) that has been subjected to a certain type of processing (e.g., centrifugation), and detecting by using immunological techniques, such as ELISA.

[0033] In specific embodiments, the ELISA assays described herein can be used to detect the concentration of a biomarker in a biological sample (e.g., plasma, serum, urine, or any other biological fluid) that has been subjected to a particular type of processing (e.g., centrifugation). Other techniques known in the art that can be used to detect the concentration of a biomarker in a biological sample include multiplex assays or proteomic assays. In a specific embodiment, the method of preventing, treating or ameliorating pancreatic cancer provided herein reduces or manages one, two or more symptoms associated with pancreatic cancer. The reduction or management of one, two or more symptoms of pancreatic cancer can be used as a clinical endpoint of the effectiveness of compound 1 or its pharmacologic acceptable salt or pharmaceutical composition for preventing, treating or ameliorating pancreatic cancer. In some embodiments, the method of preventing, treating or ameliorating pancreatic cancer provided herein reduces the duration and / or severity of one or more symptoms associated with pancreatic cancer. In some embodiments, the method of preventing, treating or ameliorating pancreatic cancer provided herein inhibits the onset, progression and / or recurrence of one or more symptoms associated with pancreatic cancer. In some embodiments, the method of treating pancreatic cancer provided herein reduces the number of symptoms associated with pancreatic cancer.

[0034] In certain embodiments, the methods of preventing, treating, or ameliorating pancreatic cancer provided herein lengthen or delay the G1 / S or late G1 / S phase of the cell cycle (i.e., the period from the late checkpoint (rest or pre-DNA synthesis phase) to the early DNA synthesis phase). In other embodiments, the methods of preventing, treating, or ameliorating pancreatic cancer provided herein lengthen or delay the S or G2 / M phase of the cell cycle (the period from the DNA synthesis phase to the early mitotic phase). In some embodiments, the method of preventing, treating or ameliorating pancreatic cancer provided herein reduces, improves or alleviates the severity of pancreatic cancer and / or one or more symptoms thereof.In other embodiments, the method of preventing, treating or ameliorating pancreatic cancer provided herein reduces the hospitalization (e.g., frequency of hospitalization or duration of hospitalization) of subjects diagnosed with pancreatic cancer.

[0035] In certain embodiments, the method provided herein increases the survival of the subject diagnosed with pancreatic cancer.In specific embodiments, the method provided herein increases the survival of the subject diagnosed with pancreatic cancer by about 6 months or more, about 7 months or more, about 8 months or more, about 9 months or more, or about 12 months or more. In certain embodiments, the method of preventing, treating or improving pancreatic cancer provided herein inhibits or reduces the progression of pancreatic cancer or one or more symptoms associated therewith.In specific embodiments, the method of preventing, treating or improving pancreatic cancer provided herein enhances or improves the therapeutic effect of another therapy (e.g., anticancer drug, radiation, drug therapy such as chemotherapy, antiandrogen therapy or surgery).In certain embodiments, the method of preventing, treating or improving pancreatic cancer provided herein comprises the use of compound 1 or its pharmacologic acceptable salt or pharmaceutical composition as adjunctive therapy.

[0036] In certain embodiments, the method of preventing, treating or improving pancreatic cancer provided herein reduces the mortality rate of subjects diagnosed with pancreatic cancer.In certain embodiments, the method of preventing, treating or improving pancreatic cancer provided herein increases the number of subjects in remission or reduces hospitalization rate.In other embodiments, the method of preventing, treating or improving pancreatic cancer provided herein prevents the occurrence, development or progression of one or more symptoms associated with pancreatic cancer. In certain embodiments, the method of preventing, treating or improving pancreatic cancer provided herein increases the symptom-free survival of pancreatic cancer subjects.In some embodiments, the method of preventing, treating or improving pancreatic cancer provided herein does not cure pancreatic cancer in a subject, but prevents the progression or worsening of the disease.In some embodiments, the method of preventing, treating or improving pancreatic cancer provided herein improves the quality of life of a subject.

[0037] In certain embodiments, the methods provided herein for preventing, treating or ameliorating pancreatic cancer increase the cancer-free survival rate of subjects diagnosed with cancer. In some embodiments, the methods provided herein for preventing, treating or ameliorating pancreatic cancer increase recurrence-free survival. In certain embodiments, the methods provided herein for preventing, treating or ameliorating pancreatic cancer increase the number of subjects in remission. In other embodiments, the methods provided herein for preventing, treating or ameliorating pancreatic cancer extend the duration of remission of a subject. Treatment population In some embodiments, the subject treated for pancreatic cancer according to the methods provided herein is a human who has pancreatic cancer or has been diagnosed with pancreatic cancer.In other embodiments, the subject treated for pancreatic cancer according to the methods provided herein is a human who is susceptible to or susceptible to pancreatic cancer.In some embodiments, the subject treated for pancreatic cancer according to the methods provided herein is a human who is at risk of developing pancreatic cancer.

[0038] In one embodiment, the subject treated for pancreatic cancer according to the methods provided herein is a human infant. In another embodiment, the subject treated for pancreatic cancer according to the methods provided herein is a human toddler. In another embodiment, the subject treated for pancreatic cancer according to the methods provided herein is a human child. In another embodiment, the subject treated for pancreatic cancer according to the methods provided herein is a human adult. In another embodiment, the subject treated for pancreatic cancer according to the methods provided herein is a middle-aged human. In another embodiment, the subject treated for pancreatic cancer according to the methods provided herein is an elderly human. In certain embodiments, the subject who is treated for cancer according to the methods provided herein has pancreatic cancer that has metastasized to other parts of the body, such as bone, lung and liver.In certain embodiments, the subject who is treated for pancreatic cancer according to the methods provided herein is in remission from pancreatic cancer.In some embodiments, the subject who is treated for pancreatic cancer according to the methods provided herein has had a recurrence of pancreatic cancer.In certain embodiments, the subject who is treated for pancreatic cancer according to the methods provided herein is experiencing a recurrence of one or more symptoms associated with pancreatic cancer.

[0039] In certain embodiments, a subject treated for pancreatic cancer according to the methods provided herein is a human between about 1 and about 5 years of age, between about 5 and about 10 years of age, between about 10 and about 18 years of age, between about 18 and about 30 years of age, between about 25 and about 35 years of age, between about 35 and about 45 years of age, between about 40 and about 55 years of age, between about 50 and about 65 years of age, between about 60 and about 75 years of age, between about 70 and about 85 years of age, between about 80 and about 90 years of age, between about 90 and about 95 years of age, or between about 95 and about 100 years of age, or any age in between.

[0040] In a specific embodiment, the subject treated for pancreatic cancer according to the methods provided herein is a human aged 18 years or older. In a particular embodiment, the subject treated for pancreatic cancer according to the methods provided herein is a human child aged 1 to 18 years. In certain embodiments, the subject treated for pancreatic cancer according to the methods provided herein is a human aged 12 to 18 years. In certain embodiments, the subject is a male human. In another embodiment, the subject is a female human. In one embodiment, the subject is a female human who is not pregnant or breastfeeding. In one embodiment, the subject is a female who is pregnant or may be pregnant or breastfeeding. In certain embodiments, the subject of the pancreatic cancer treatment according to the methods provided herein is an immunocompromised or immunosuppressed human.In certain embodiments, the subject of the pancreatic cancer treatment according to the methods provided herein is an immunosuppressive therapy or a human who has recovered from it.In certain embodiments, the subject of the pancreatic cancer treatment according to the methods provided herein is a human who has pancreatic cancer or is at risk of developing pancreatic cancer.In certain embodiments, the subject of the pancreatic cancer treatment according to the methods provided herein is a human who has undergone, will undergo, or has undergone surgery, drug therapy such as chemotherapy, hormonal therapy, and / or radiation therapy.

[0041] In some embodiments, a subject treated for pancreatic cancer according to the methods provided herein is administered Compound 1 or a pharmacologic acceptable salt or pharmaceutical composition thereof, or combination therapy, before any adverse effects or intolerance to a therapy other than Compound 1 occurs. In some embodiments, a subject treated for pancreatic cancer according to the methods provided herein is a refractory subject. In certain embodiments, a refractory subject is a subject that is refractory to standard therapy (e.g., drug therapy such as surgery, radiation and / or chemotherapy). In certain embodiments, a subject with pancreatic cancer is refractory to a therapy if the pancreatic cancer has not been significantly eradicated and / or one or more symptoms have not been significantly alleviated. The determination of whether a subject is refractory can be performed either in vivo or in vitro by any method known in the art for assaying the effectiveness of a treatment for pancreatic cancer, using the art-accepted meaning of "refractory" in this context.

[0042] In some embodiments, the subject of the pancreatic cancer treatment according to the methods provided herein is a human who has proven refractory to therapies other than treatment with compound 1 or its pharmacologic acceptable salt or pharmaceutical composition, but is no longer undergoing these therapies.In certain embodiments, the subject of the pancreatic cancer treatment according to the methods provided herein is a human who has already undergone one or more conventional anticancer therapies, such as surgery, drug therapy such as chemotherapy, antiandrogen therapy, or radiation.In particular, the subject is a subject who is refractory, a subject who is too young for conventional therapy, or a subject whose pancreatic cancer has recurred despite treatment with existing therapy. In some embodiments, the subject treated for pancreatic cancer according to the methods provided herein is a human who is susceptible to adverse reactions to conventional therapy.In some embodiments, the subject treated for pancreatic cancer according to the methods provided herein is a human who has not undergone therapy, such as drug therapy, surgery, antiandrogen therapy, or radiation therapy, before administration of Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition.In other embodiments, the subject treated for pancreatic cancer according to the methods provided herein is a human who has undergone therapy before administration of Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition.In some embodiments, the subject treated for pancreatic cancer according to the methods provided herein is a human who has experienced adverse side effects to previous therapy, or whose previous therapy has been discontinued due to unacceptable levels of toxicity to humans.

[0043] Dosage and Administration Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition may be administered to a subject in need thereof by various routes in an amount that produces a beneficial or therapeutic effect according to the method of preventing, treating or ameliorating pancreatic cancer provided herein. Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition may be orally administered to a subject in need thereof according to the method of preventing, treating or ameliorating pancreatic cancer provided herein. Oral administration of Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition may facilitate a subject in need of such treatment to comply with a regimen of administration of Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition. Thus, in a specific embodiment, Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition is orally administered to a subject in need thereof. In another embodiment, Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition provided herein may be orally administered without or with food or water.

[0044] Other administration routes include, but are not limited to, intravenous, intradermal, intrathecal, intramuscular, subcutaneous, intranasal, inhalation, transdermal, topical, transmucosal, intracranial, epidural and intrasynovial.In one embodiment, compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition is administered systemically (e.g., parenterally) to the subject in need thereof.In one embodiment, compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition is administered via a route (e.g., orally) that allows compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition to cross the blood-brain barrier. Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, and the one or more additional therapies may be administered by the same or different routes of administration according to the methods of preventing, treating, or ameliorating pancreatic cancer provided herein, including administering Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, in combination with one or more additional therapies.

[0045] According to the method of preventing, treating or ameliorating pancreatic cancer provided herein, the dosage and frequency of administration of Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition administered to a subject in need thereof is effective while minimizing any side effects.The exact dosage and frequency of administration of Compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition can be determined by practitioners, taking into account factors related to the subject in need of treatment. Factors that can be considered include the severity of disease state, the overall health of the subject, the age, weight and sex of the subject, diet, time and frequency of administration, drug combination, reaction sensitivity and resistance / response to therapy.The dosage and frequency of administration of compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition can be adjusted over time to provide an effective amount of compound 1 or its pharmaceutically acceptable salt or pharmaceutical composition or to maintain desired effect.

[0046] As described herein, the method of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof provided herein comprises administering to the subject an effective amount of Compound 1 or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, wherein the effective amount is a dose administered to the subject twice per week on different days, the second dose of one week following by the third day of the first dose, and the first dose of the following week following by the fourth day of the second dose of the previous week. In a specific embodiment, the effective amount is the dose administered to a subject, which can be increased or decreased depending on the subject's response.

[0047] In a specific embodiment, a method for preventing, treating, or ameliorating pancreatic cancer in a subject in need thereof comprises administering to the subject an effective amount of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, wherein the effective amount is a dose selected from the range of about 50 mg to about 200 mg, about 100 mg to about 200 mg, about 150 mg to about 200 mg, etc., or any range of doses therebetween, administered orally twice weekly. In a specific embodiment, a method for preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering to the subject an effective amount of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, wherein the effective amount is a dose selected from about 50 mg, about 100 mg, about 150 mg, or about 200 mg, or any range therebetween, administered orally twice weekly. In a specific embodiment, a method for preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering to the subject an effective amount of Compound 1, or a pharma- ceutically acceptable salt or pharmaceutical composition thereof, wherein the effective amount is a dose of about 50 mg administered orally twice weekly.

[0048] In some embodiments, a method for preventing, treating, or ameliorating pancreatic cancer in a subject in need thereof comprises administering to the subject an effective amount of Compound 1 or a pharmaceutical composition thereof, wherein the effective amount is mg per square meter (mg / m 2 The dosage is expressed as mg / m 2For example, multiply the animal conversion factor by the animal dose in mg per kilogram (mg / kg) to get the human dose equivalent in mg / m 2 The dose of Compound 1 can be determined by obtaining a dose of about 0.1 mg / m2. For regulatory purposes, the following conversion factors can be used: mouse=3, hamster=4.1, rat=6, guinea pig=7.7 (based on Freireich et al., Cancer Chemother. Rep. 50(4):219-244 (1966)). Using the height and weight of a human, the body surface area of ​​a human can be calculated by applying Boyd's body surface area formula. In a specific embodiment, a method for preventing, treating, or ameliorating pancreatic cancer in a subject in need thereof comprises administering to the subject an effective amount of Compound 1 or a pharmaceutical composition thereof, wherein the effective amount is about 0.1 mg / m2. 2 ~about 1000mg / m 2 or any range therebetween.

[0049] In one aspect, a method for preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering an effective amount of Compound 1 or a pharmaceutical composition thereof to the subject, where the effective amount is a dosage that achieves a target mean plasma concentration of Compound 1 in a subject having pancreatic cancer or in an animal model having a pre-established pancreatic cancer. In a specific embodiment, a method of preventing, treating, or ameliorating pancreatic cancer in a subject in need thereof comprises administering to the subject an effective amount of Compound 1, or a pharmaceutical composition thereof, wherein the effective amount is a dosage that achieves an average plasma concentration of Compound 1 at 24 hours in a range of about 3 hr μg / mL to about 70 hr μg / mL, about 3 hr μg / mL to about 60 hr μg / mL, about 3 hr μg / mL to about 50 hr μg / mL, about 3 hr μg / mL to about 40 hr μg / mL, about 3 hr μg / mL to about 30 hr μg / mL, about 3 hr μg / mL to about 20 hr μg / mL, about 3 hr μg / mL to about 10 hr μg / mL, etc., or any range therebetween, in a subject having pancreatic cancer or in an animal model having pre-established pancreatic cancer.

[0050] In a specific embodiment, a method of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering to the subject an effective amount of Compound 1 or a pharmaceutical composition thereof, wherein an effective amount is a dosage that achieves an average plasma concentration of Compound 1 at 24 hours of about 3 hr μg / mL, about 10 hr μg / mL, about 20 hr μg / mL, about 30 hr μg / mL, about 40 hr μg / mL, about 50 hr μg / mL, about 60 hr μg / mL, about 70 hr μg / mL, etc., or any range therebetween, in a subject with pancreatic cancer or in an animal model with pre-established pancreatic cancer. To achieve such plasma concentrations, doses of Compound 1 or pharmaceutical compositions thereof as described herein may be administered. In certain embodiments, subsequent doses of Compound 1 or pharmaceutical compositions thereof may be adjusted accordingly based on the average plasma concentration of Compound 1 achieved with the doses of Compound 1 or pharmaceutical compositions thereof administered to the subject.

[0051] In a specific embodiment, a method for preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering to the subject an effective amount of Compound 1 or a pharmaceutical composition thereof, where the effective amount is a dosage that achieves a reduction in the target mean plasma concentration of one or more biomarkers in a subject having pancreatic cancer or in an animal model having a pre-established pancreatic cancer. In certain embodiments, a method for preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering to the subject an effective amount of Compound 1 or a pharmaceutical composition thereof, wherein the effective amount is a dosage that achieves a desired tissue-to-mean plasma concentration ratio of Compound 1 or a pharmaceutical composition thereof in a subject having pancreatic cancer or in an animal model having pre-established pancreatic cancer, e.g., as determined by any imaging technique known in the art.

[0052] In some embodiments, the method of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering an effective amount of compound 1 or its pharmaceutical composition to the subject, where the effective amount may or may not be the same for each dose.In certain embodiments, a first (i.e., initial) dose of compound 1 or its pharmaceutical composition is administered to a subject in need thereof for a first period, then a second (i.e., loading) dose of compound 1 or its pharmaceutical composition is administered to the subject for a second period, and then a third (i.e., maintenance) dose of compound 1 or its pharmaceutical composition is administered to the subject for a second period.The first dose may be greater than the second dose, or the first dose may be less than the second dose.In a similar manner, the third dose of compound 1 or its pharmaceutical composition may be greater or less than the second dose, and may be greater or less than the first dose.

[0053] In some embodiments, the dosage amounts described herein refer to the total amount administered; i.e., if more than one compound is administered, in some embodiments the dosage amount corresponds to the total amount administered. In specific embodiments, the oral composition contains about 5% to about 95% Compound 1 by weight. The period during which compound 1 or a pharmaceutical composition thereof is administered to a subject in need thereof according to the method for preventing, treating or ameliorating pancreatic cancer in a subject in need thereof is determined by cancer-free survival or relief from symptoms.In certain embodiments, the method for treating pancreatic cancer provided herein comprises administering compound 1 or a pharmaceutical composition thereof for a period of time until the severity and / or number of one or more symptoms associated with pancreatic cancer are reduced. In some embodiments, the method of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering Compound 1 or a pharmaceutical composition thereof for up to 48 weeks. In other embodiments, the method of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering Compound 1 or a pharmaceutical composition thereof for up to 4 weeks, 8 weeks, 12 weeks, 16 weeks, 20 weeks, 24 weeks, 26 weeks (0.5 years), 52 weeks (1 year), 78 weeks (1.5 years), 104 weeks (2 years), or 130 weeks (2.5 years) or more.

[0054] In certain embodiments, the method of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering Compound 1 or a pharmaceutical composition thereof indefinitely. In some embodiments, the method of treating pancreatic cancer provided herein comprises administering Compound 1 or a pharmaceutical composition thereof for a period of time, and then resuming administration of Compound 1 or a pharmaceutical composition thereof after a rest period (i.e., a period during which Compound 1 or a pharmaceutical composition thereof is not administered). In a specific embodiment, the method for preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering compound 1 or a pharmaceutical composition thereof in a cycle, such as a 1-week cycle, a 2-week cycle, a 3-week cycle, a 4-week cycle, a 5-week cycle, a 6-week cycle, a 8-week cycle, a 9-week cycle, a 10-week cycle, an 11-week cycle or a 12-week cycle. In such a cycle, compound 1 or a pharmaceutical composition thereof can be administered once a week or twice a week. In a specific embodiment of a weekly cycle, compound 1 or a pharmaceutical composition thereof can be administered twice a week. In a specific embodiment of such a weekly cycle, compound 1 or a pharmaceutical composition thereof can be administered once a day.

[0055] In particular embodiments, the duration of administration of Compound 1 or a pharmaceutical composition thereof may be dictated by one or more monitored parameters, for example, the concentration of a particular biomarker. In certain embodiments, the duration of administration of Compound 1 or a pharmaceutical composition thereof may be adjusted based on one or more monitored parameters, e.g., the concentration of a biomarker. In certain embodiments, Compound 1 or a pharmaceutical composition thereof is administered to a subject in need thereof before, with, or after a meal (e.g., breakfast, lunch, or dinner) according to the methods of preventing, treating, or ameliorating pancreatic cancer in a subject in need thereof. In a specific embodiment, Compound 1 or a pharmaceutical composition thereof is administered to a subject in need thereof in the morning (e.g., 5:00 a.m. to 12:00 p.m.) according to the methods of treating pancreatic cancer provided herein.

[0056] In certain embodiments, Compound 1 or a pharmaceutical composition thereof is administered to a subject in need thereof at midday (i.e., 12:00 PM) according to the methods of preventing, treating, or ameliorating pancreatic cancer in a subject in need thereof. In particular embodiments, Compound 1 or a pharmaceutical composition thereof is administered to a subject in need thereof in the afternoon (i.e., 12:00 PM to 5:00 PM), in the evening (e.g., 5:00 PM to bedtime), and / or before bedtime according to the methods of treating pancreatic cancer provided herein. In a specific embodiment, a dose of Compound 1 or a pharmaceutical composition thereof is administered to a subject once daily and twice weekly. Combination therapy Provided herein is a combination therapy for the treatment of pancreatic cancer, comprising administering to a subject in need thereof compound 1 or a pharmaceutical composition thereof in combination with one or more additional therapies.In a specific embodiment, provided herein is a combination therapy for the treatment of pancreatic cancer, comprising administering to a subject in need thereof an effective amount of compound 1 or a pharmaceutical composition thereof in combination with an effective amount of another therapy.

[0057] As used herein, the term "combination" refers to administration of Compound 1 or a pharmaceutical composition thereof prior to, concurrently with, or after administration of one or more additional therapies (e.g., agents, surgery, or radiation) for use in the treatment of pancreatic cancer. The use of the term "combination" does not limit the order in which one or more therapeutic agents and one or more additional therapies are administered to a subject. In specific embodiments, the time interval between administration of Compound 1 or a pharmaceutical composition thereof and administration of the one or more additional therapies can be about 1-5 minutes, 1-30 minutes, 30-60 minutes, 1 hour, 1-2 hours, 2-6 hours, 2-12 hours, 12-24 hours, 1-2 days, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 26 weeks, 52 weeks, 11-15 weeks, 15-20 weeks, 20-30 weeks, 30-40 weeks, 40-50 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 1 year, 2 years, or any period in between. In certain embodiments, Compound 1 or a pharmaceutical composition thereof and the one or more additional therapies are administered less than 1 day, less than 1 week, less than 2 weeks, less than 3 weeks, less than 4 weeks, less than 1 month, less than 2 months, less than 3 months, less than 6 months, less than 1 year, less than 2 years, or less than 5 years apart.

[0058] In some embodiments, the combination therapy provided herein comprises administering compound 1 or its pharmaceutical composition daily, and administering one or more additional therapies once a week, once every two weeks, once every three weeks, once every four weeks, once a month, once every two months (e.g., about 8 weeks), once every three months (e.g., about 12 weeks) or once every four months (e.g., about 16 weeks).In certain embodiments, compound 1 or its pharmaceutical composition and one or more additional therapies are administered to the subject in a cyclical manner.Cycling therapy comprises administering compound 1 or its pharmaceutical composition for a certain period of time, then administering one or more additional therapies for a certain period of time, and repeating this sequential administration. In certain embodiments, cycling therapy may also include a rest period during which Compound 1 or a pharmaceutical composition thereof or an additional therapy is not administered for a period of time (e.g., 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 10 weeks, 20 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 2 years, or 3 years). In one embodiment, the number of cycles administered is 1 to 12 cycles, 2 to 10 cycles, or 2 to 8 cycles.

[0059] In some embodiments, the method of preventing, treating or ameliorating pancreatic cancer in a subject in need thereof comprises administering Compound 1 or a pharmaceutical composition thereof as a single agent for a period of time before administering Compound 1 or a pharmaceutical composition thereof in combination with an additional therapy. In certain embodiments, the method of treating pancreatic cancer provided herein comprises administering the additional therapy alone for a period of time before administering Compound 1 or a pharmaceutical composition thereof in combination with an additional therapy. In some embodiments, administration of Compound 1 or a pharmaceutical composition thereof and one or more additional therapies according to the methods provided herein has an additive effect compared to administration of Compound 1 or a pharmaceutical composition thereof or the one or more additional therapies alone. In some embodiments, administration of Compound 1 or a pharmaceutical composition thereof and one or more additional therapies according to the methods provided herein has a synergistic effect compared to administration of Compound 1 or a pharmaceutical composition thereof or the one or more additional therapies alone.

[0060] As used herein, the term "synergistic" refers to the effect of administering Compound 1 or a pharmaceutical composition thereof in combination with one or more additional therapies (e.g., agents), where the combination is more effective than the additive effects of any two or more single therapies (e.g., agents). In specific embodiments, the synergistic effect of the combination therapy allows for the use of lower dosages (i.e., suboptimal doses) of Compound 1 or a pharmaceutical composition thereof, or an additional therapy, and / or less frequent administration of Compound 1 or a pharmaceutical composition thereof, or an additional therapy to a subject. In certain embodiments, the ability to utilize lower dosages of Compound 1 or a pharmaceutical composition thereof, or an additional therapy, and / or administer Compound 1 or a pharmaceutical composition thereof, or said additional therapy less frequently, reduces the toxicity associated with administration of Compound 1 or a pharmaceutical composition thereof, or each of said additional therapies, to a subject without reducing the effectiveness of Compound 1 or a pharmaceutical composition thereof, or each of said additional therapies, in treating pancreatic cancer.

[0061] In some embodiments, the synergistic effect results in improved efficacy of compound 1 or its pharmaceutical composition and each of the above additional therapies in the treatment of pancreatic cancer.In some embodiments, the synergistic effect of the combination of compound 1 or its pharmaceutical composition with one or more additional therapies avoids or reduces the adverse or undesirable side effects associated with the use of any single therapy. The combination of compound 1 or its pharmaceutical composition and one or more additional therapies can be administered to a subject in the same pharmaceutical composition. Alternatively, compound 1 or its pharmaceutical composition and one or more additional therapies can be administered to a subject simultaneously in separate pharmaceutical compositions. Compound 1 or its pharmaceutical composition and one or more additional therapies can be administered to a subject sequentially in separate pharmaceutical compositions. Compound 1 or its pharmaceutical composition and one or more additional therapies can also be administered to a subject by the same or different administration routes.

[0062] The combination therapy provided herein comprises administering Compound 1 or its pharmaceutical composition to a subject in need thereof in combination with conventional or known therapy for treating pancreatic cancer.Other therapies for pancreatic cancer or associated conditions are intended to control or alleviate one or more symptoms.Thus, in some embodiments, the combination therapy provided herein comprises administering painkillers or other therapies intended to alleviate or control one or more symptoms associated with pancreatic cancer or associated conditions to a subject in need thereof. Specific examples of anti-cancer agents that may be used in combination with Compound 1 or a pharmaceutical composition thereof for treating pancreatic cancer include hormonal agents (e.g., aromatase inhibitors, selective estrogen receptor modulators (SERMs) and estrogen receptor antagonists), chemotherapeutic agents (e.g., microtubule disassembly blockers, antimetabolites, topoisomerase inhibitors and DNA crosslinking or damaging agents), angiogenesis inhibitors (e.g., VEGF antagonists, receptor antagonists, integrin antagonists, vascular targeting agents (VTAs) / vascular disrupting agents (VDAs)), radiation therapy and conventional surgery.

[0063] Non-limiting examples of hormonal agents that can be used in combination with Compound 1 or its pharmaceutical composition for treating pancreatic cancer include aromatase inhibitors, SERMs, and estrogen receptor antagonists. Hormonal agents that are aromatase inhibitors can be steroidal or non-steroidal. Non-limiting examples of non-steroidal hormonal agents include letrozole, anastrozole, aminoglutethimide, fadrozole, and vorozole. Non-limiting examples of steroidal hormonal agents include aromasin (exemestane), formestane, and testolactone. Non-limiting examples of hormonal agents that are SERMs include tamoxifen (branded / marketed as Nolvadex®), afimoxifene, arzoxifene, bazedoxifene, clomiphene, femarel, lasofoxifene, ormeloxifene, raloxifene, and toremifene. Non-limiting examples of hormonal agents that are estrogen receptor antagonists include fulvestrant. Other hormonal agents include, but are not limited to, abiraterone and lonaprisan.

[0064] Non-limiting examples of chemotherapeutic agents that may be used in combination with Compound 1 or a pharmaceutical composition thereof to treat cancer include microtubule disruption blockers, antimetabolites, topoisomerase inhibitors and DNA crosslinking or damaging agents. Chemotherapeutic agents that are microtubule disassembly blockers include, but are not limited to, taxanes (e.g., paclitaxel (branded / sold as TAXOL®), docetaxel, nab-paclitaxel (nanoparticle albumin-bound paclitaxel, branded / sold as ABRAXANE®), larotaxel, ortataxel, and tesetaxel); epothilones (e.g., ixabepilone); and vincalkaloids (e.g., vinorelbine, vinblastine, vindesine, and vincristine (branded / sold as ONCOVIN®)).

[0065] Chemotherapeutic agents that are antimetabolites include, but are not limited to, folate antimetabolites (e.g., methotrexate, aminopterin, pemetrexed, raltitrexed); purine antimetabolites (e.g., cladribine, clofarabine, fludarabine, mercaptopurine, pentostatin, thioguanine); pyrimidine antimetabolites (e.g., 5-fluorouracil, capcitabine, gemcitabine (GEMZAR®), cytarabine, decitabine, floxuridine, tegafur); and deoxyribonucleotide antimetabolites (e.g., hydroxyurea). Chemotherapeutic agents that are topoisomerase inhibitors include, but are not limited to, class I (camptotheca) topoisomerase inhibitors (e.g., topotecan (trademarked / marketed as HYCAMTIN®), irinotecan, rubitecan, and belotecan); class II (podophyllum) topoisomerase inhibitors (e.g., etoposide or VP-16, and teniposide); anthracyclines (e.g., doxorubicin, epirubicin, doxil, aclarubicin, amrubicin, daunorubicin, idarubicin, pirarubicin, valrubicin, and zorubicin); and anthracenediones (e.g., mitoxantrone and pixantrone).

[0066] Chemotherapeutic agents that are DNA crosslinking agents (or DNA damaging agents) include alkylating agents (e.g., cyclophosphamide, mechlorethamine, ifosfamide (branded / sold as IFEX®), trofosfamide, chlorambucil, melphalan, prednimustine, bendamustine, uramustine, estramustine, carmustine (branded / sold as BiCNU®), lomustine, semustine, fotemustine, nimustine, ranimustine, streptozocin, busulfan, mannosulfan, treosulfan, carboquone, N,N',N'-triethylenethiophosphatase, thiourea ... alkylating agents (e.g., carboplatin (branded / sold as PARAPLATIN®), cisplatin, oxaliplatin, nedaplatin, triplatin tetranitrate, satraplatin, picoplatin); non-classical DNA cross-linking agents (e.g., procarbazine, dacarbazine, temozolomide (branded / sold as TEMODAR®), altretamine, mitobronitol); and intercalating agents (e.g., actinomycin, bleomycin, mitomycin, and plicamycin).

[0067] Non-limiting examples of angiogenesis inhibitors that may be used in combination with Compound 1 or a pharmaceutical composition thereof for treating pancreatic cancer include VEGF antagonists, receptor antagonists, integrin antagonists (e.g., vitaxin, cilengitide, and S247), and VTA / VDAs (e.g., fosbretabulin). VEGF antagonists include, but are not limited to, anti-VEGF antibodies (e.g., bevacizumab (branded / sold as AVASTIN®) and ranibizumab (branded / sold as LUCENTIS®)), VEGF traps (e.g., aflibercept), VEGF antisense or siRNA or miRNA, and aptamers (e.g., pegaptanib (branded / sold as MACUGEN®). Angiogenesis inhibitors that are receptor antagonists include antibodies (e.g., ramucizumab ... lumab), and kinase inhibitors (e.g., sunitinib, sorafenib, cediranib, panzopanib, vandetanib, axitinib, and AG-013958), such as tyrosine kinase inhibitors. Other non-limiting examples of angiogenesis inhibitors include ATN-224, anecortave acetate (trademarked / sold as RETAANE®), microtubule depolymerization inhibitors, such as combretastatin A4 prodrugs, and proteins or protein fragments, such as collagen 18 (endostatin).

[0068] Non-limiting examples of other therapies that may be administered to a subject in combination with Compound 1 or a pharmaceutical composition thereof for treating pancreatic cancer include: (1) Statins, e.g., lovastatin (e.g., trademarked / marketed as MEVACOR®); (2) mTOR inhibitors, such as sirolimus, also known as rapamycin (e.g., trademarked / commercially available as RAPAMUNE®), temsirolimus (e.g., trademarked / commercially available as TORISEL®), everolimus (e.g., trademarked / commercially available as AFINITOR®), and deforolimus; (3) Farnesyltransferase inhibitors, e.g., tipifarnib (e.g., trademarked / marketed as ZARNESTRA®); (4) antifibrotic agents, such as pirfenidone;

[0069] (5) Pegylated interferon, for example, PEG-interferon alpha-2b; (6) CNS stimulants, e.g., methylphenidate (branded / marketed as RITALIN®); (7) HER-2 antagonists, such as anti-HER-2 antibodies (e.g., trastuzumab) and kinase inhibitors (e.g., lapatinib); (8) IGF-1 antagonists, such as anti-IGF-1 antibodies (e.g., AVE1642 and IMC-A11) or IGF-1 kinase inhibitors; (9) EGFR / HER-1 antagonists, such as anti-EGFR antibodies (e.g., cetuximab, panitumamab) or EGFR kinase inhibitors (e.g., erlotinib (e.g., trademarked / marketed as TARCEVA®), gefitinib); (10) SRC antagonists, such as bosutinib; (11) Cyclin-dependent kinase (CDK) inhibitors, such as seliciclib; (12) Janus kinase 2 inhibitors, such as lestaurtinib; (13) Proteasome inhibitors, such as bortezomib; (14) Phosphodiesterase inhibitors, such as anagrelide; (15) Inosine monophosphate dehydrogenase inhibitors, such as tiazofurin;

[0070] (16) Lipoxygenase inhibitors, for example, masoprocol; (17) Endothelin antagonists; (18) Retinoid receptor antagonists, such as tretinoin or alitretinoin; (19) Immune modulators, e.g., lenalidomide, pomalidomide or thalidomide (e.g., trademarked / commercially available as THALIDOMID®); (20) Kinase (e.g., tyrosine kinase) inhibitors, such as imatinib (e.g., trademarked / commercially available as GLEEVEC®), dasatinib, erlotinib, nilotinib, gefitinib, sorafenib, sunitinib (e.g., trademarked / commercially available as SUTENT®), lapatinib, AEE788 or TG100801; (21) Nonsteroidal anti-inflammatory agents, such as celecoxib (branded / sold as CELEBREX®); (22) Human granulocyte colony-stimulating factor (G-CSF), e.g., filgrastim (branded / sold as NEUPOGEN®); (23) Folinic acid or leucovorin calcium;

[0071] (24) Integrin antagonists, such as integrin α5β1-antagonists (e.g., JSM6427); (25) Nuclear factor kappa beta (NF-κβ) antagonists, such as OT-551, which is also an antioxidant; (26) hedgehog inhibitors, e.g., CUR61414, cyclopamine, GDC-0449, or anti-hedgehog antibodies; (27) Histone deacetylase (HDAC) inhibitors, such as SAHA (also known as vorinostat (trademarked / commercially available as ZOLINZA®)), PCI-24781, SB939, CHR-3996, CRA-024781, ITF2357, JNJ-26481585 or PCI-24781; (28) Retinoids, e.g., isotretinoin (e.g., trademarked / commercially available as ACCUTANE®); (29) hepatocyte growth factor / scatter factor (HGF / SF) antagonists, such as HGF / SF monoclonal antibodies (e.g., AMG102); (30) Synthetic chemicals, e.g., antineoplastons; (31) Antidiabetic drugs, e.g., rosiglitazone maleate (e.g., trademarked / marketed as AVANDIA®); (32) Antimalarials and amebicide, e.g., chloroquine (e.g., trademarked / marketed as ARALEN®); (33) Synthetic bradykinins, e.g., RMP-7; (34) Platelet-derived growth factor receptor inhibitors, such as SU-101; (35) FIk-1 / KDR / VEGFR2, FGFR1 and PDGFRbeta receptor tyrosine kinase inhibitors, such as SU5416 and SU6668; (36) Anti-inflammatory agents, e.g., sulfasalazine (e.g., trademarked / sold as AZULFIDINE®); and (37)TGF-beta antisense therapy.

[0072] Non-limiting examples of other therapies that may be administered to a subject in combination with Compound 1 or a pharmaceutical composition thereof for treating pancreatic cancer include synthetic nonapeptide analogs of naturally occurring gonadotropin releasing hormone, such as leuprolide acetate (branded / sold as LUPRON®); nonsteroidal antiandrogens, such as flutamide (branded / sold as ELUEXIN®) or nilutamide (branded / sold as NILANDRON®); nonsteroidal androgens, such as cyclosporine (CD-138), ... steroid hormones, such as progesterone; antifungals, such as ketoconazole (branded / sold as NIZORAL); glucocorticoids, such as prednisone; estramustine sodium phosphate (branded / sold as EMCYT); and bisphosphonates, such as pamidronate, alendronate and risedronate.

[0073] Further specific examples of therapies that may be used in combination with Compound 1 or a pharmaceutical composition thereof for treating pancreatic cancer include, but are not limited to, agents related to cancer immunotherapy (e.g., cytokines, interleukins, and cancer vaccines). Specific examples of agents that reduce side effects associated with pancreatic cancer that may be used as combination therapy with Compound 1 or a pharmaceutical composition thereof include, but are not limited to, antiemetic agents, such as ondansetron hydrochloride (branded / sold as ZOFRAN®), granisetron hydrochloride (labeled / sold as KYTRIL®), lorazepam (labeled / sold as ATIVAN®), and dexamethasone (labeled / sold as DECADRON®).

[0074] In certain embodiments, the combination therapy provided herein for treating pancreatic cancer includes administering Compound 1 or a pharmaceutical composition thereof in combination with one or more agents used to treat and / or manage side effects, such as bleeding (usually transient and mild nosebleeds), arterial and venous thrombosis, hypertension, delayed wound healing, asymptomatic proteinuria, nasal septum perforation, reversible posterior leukoencephalopathy syndrome associated with hypertension, mental confusion, ataxia, headache, hoarseness, nausea, vomiting, diarrhea, rash, subungual hemorrhage, myelodysplastic syndrome, bone marrow suppression, fatigue, hypothyroidism, QT interval prolongation, or heart failure. In certain embodiments, Compound 1 or a pharmaceutical composition thereof is not used in combination with a drug that is primarily metabolized by CYP2D6 (e.g., an antidepressant (e.g., a non-tricyclic antidepressant, selective serotonin reuptake inhibitor, etc.), an antipsychotic, a beta-adrenergic receptor blocker, or certain types of antiarrhythmic drugs) to treat pancreatic cancer.

[0075] kit Provided herein is a pharmaceutical pack or kit that includes one or more containers filled with Compound 1 or a pharmaceutical composition thereof.Furthermore, one or more other therapies or other suitable agents useful for treating pancreatic cancer can also be included in the pharmaceutical pack or kit.Also provided herein is a pharmaceutical pack or kit that includes one or more containers filled with one or more of the components of the pharmaceutical composition described herein.A notice in the form prescribed by a government agency that regulates the manufacture, use or sale of pharmaceuticals or biological substances may be associated with such kit, and this notice reflects the approval by the agency for manufacture, use or sale for human administration.

[0076] All documents referenced in this specification, whether or not the documents cited herein are specifically and individually indicated as incorporated by reference, are incorporated by reference into this application for all purposes to the same extent as if each individual reference was fully set forth herein. The subject matter of the claims is now fully described, and it will be understood by those skilled in the art that the same may be practiced within a wide range of equivalents without affecting the scope or embodiment of the subject matter described herein, and it is intended that the appended claims be construed to include all such equivalents. EXAMPLES

[0077] The following examples are intended to illustrate various methods of the present invention, but are not intended to limit the scope of the invention in any way. Materials and methods used in the following examples were either available from commercial sources or obtained by methods known to those skilled in the art according to known procedures or procedures described in the references indicated. Compound 1 was prepared according to the procedures described in International Publication WO2014 / 081906. Compound 2 refers to 6-(5,6-difluoro-2-methyl-1H-benzo[d]imidazol-1-yl)-N-(4-(trifluoromethyl)phenyl)pyrazin-2-amine, a known inhibitor of BMI-1 function, and was prepared according to the procedures described in International Publication WO2015 / 076800.

[0078] Cell lines, cell cultures and viability assays Authenticated human cell lines were purchased from ATCC and utilized within 30 cumulative passages of initial purchase. Mouse KPC lines were generated and used within 30 cumulative passages. J1002 cells were generated from KPBBR mice and used within 15 cumulative passages. All cell lines were consistently tested negative for mycoplasma throughout the experimental period using a MycoAlert mycoplasma detection kit (Lonza; LT07-318). Cells were maintained under standard conditions of 37°C and 5% CO2 and grown in DMEM (Life Technologies, 12430-054) supplemented with penicillin and streptomycin (Corning, 30-003-CI) and 10% FBS (Life Technologies, 10438-034).

[0079] For growth curves, cells were plated in 96-well plates (Corning, 3603) and allowed to seed overnight. As viability measurements were an end-point method, duplicate plates were plated at each time point. The next day, cells were treated with Compound 1 at the indicated concentrations and with DMSO at the highest working concentration (always <0.003%). Cells were treated for 96 h and viability was determined every 24 h using AlamarBlue reagent (BioRad, BUF012B). Briefly, 10 μL of AlamarBlue was added to each well (100 μL), mixed briefly and incubated at 37 °C and 5% CO 2 The cells were incubated at 4°C for 4 hours. After incubation, fluorescence was measured on a Promega multimode microplate reader. For analysis, background levels were subtracted from the raw results, which were then normalized and expressed as fold change compared to DMSO-treated cells on day 0. All assays were performed in at least triplicate, with 4–8 technical replicates per treatment group and per experiment. (Figure 1a and Figure 10b)

[0080] For dose response curves, cells were plated in 96-well plates (Corning, 3603) and allowed to seed overnight. The next day, cells were treated with compound 1. Dose response curves started at 10 μM, decreased in 3-fold increments, and ended with DMSO at the highest concentration used (always below 0.03%). Cells were treated for 72 hours, and then viability was determined using AlamarBlue reagent (BioRad, BUF012B). Briefly, 10 μL of AlamarBlue was added to each well (100 μL), mixed briefly, and incubated at 37° C. and 5% CO. 2 The cells were incubated at 4°C for 4 hours. After incubation, fluorescence was measured on a Promega multimode microplate reader. For analysis, background levels were subtracted from the raw results, which were then normalized and expressed as a percentage of DMSO-treated cells. All assays were performed in at least triplicate, with 4–8 technical replicates per experiment (Figure 10c).

[0081] Cell cycle analysis After 16 hours, cells were seeded in 12-well or 6-well plates such that the cells were approximately 30-50% confluent. Cells were then treated with either DMSO (<0.003%), compound 1 (100 nM or 1 μM), or 100 nM nocodazole (Sigma, M1404) for 24 hours. After treatment, cells were harvested and fixed in 70% ice-cold ethanol for a minimum of 1 hour. After fixation, cells were resuspended in PBS + 2% FBS + 3 μM DAPI (BioLegend, 422801) or 0.25 μg 7-AAD (BD Pharmingen, 559925) and analyzed on a MACSQuant® Analyzer 10 (Miltenyi Biotec) or BD LSR II™. For cell cycle analysis time course experiments, cells were prepared as above, except that cells were treated for 24, 48 or 72 hours. Data were analyzed using FlowJo software. The G2 / M population percentage was identified using the univariate cell cycle platform generated by FlowJo software. The >4N population percentage was determined by gating on the 4N population of DMSO-treated cells (Figure 1b, Figure 1c, Figure 2a, Figure 2b, Figure 10e, and Figure 10g).

[0082] Intracellular protein flow cytometry For phosphorylated histone H3 (PH3) staining, cells were fixed and permeabilized with eBioscience Foxp3 / Transcription Factor Staining Buffer Set (ThermoFisher, 00-5523-00) according to the manufacturer's instructions. Cells were blocked with Fc Block (BD Biosciences, 564220) and stained with 5 μL of PH3 (Ser10) antibody (BioLegend, 650805) per million cells (45 min, room temperature, in the dark). Samples were analyzed on a BD Fortessa™ and analyzed by FlowJo software. (Figure 1d and Figure 3a)

[0083] For active caspase 3 (ActCasp3) staining, the Caspase 3 (Activated) FITC Staining Kit (Abcam, ab65613) was used according to the manufacturer's instructions. After approximately 16 hours, cells were seeded in 12-well plates such that the cells were approximately 50-60% confluent. Cells were then treated with the indicated concentrations of drugs or DMSO vehicle for 24 hours, at which point cells were harvested, stained with FITC-DEVD-FMK (1 μL / sample, 1 hour, room temperature, in the dark), washed, and then stained with DAPI and analyzed. Samples were analyzed on a BD LSR II™ and analyzed by FlowJo software. (Figure 3a and Figure 3b)

[0084] Western blotting Western blotting was performed on lysates isolated from treated cells. Cells were lysed using RIPA buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% deoxycholate) supplemented with cOmplete™ EDTA-free protease inhibitor cocktail (Sigma, 11836170001) and Halt™ phosphatase inhibitor cocktail (ThermoFisher, 78420). Lysates were quantified using the Pierce BCA Protein Assay Kit (ThermoFisher, 23227), diluted in SDS sample buffer, separated by SDS-PAGE (15-30 μg / sample) and transferred to PVDF membranes. Membranes were blocked with 5% w / v nonfat dry milk in TBS-T (0.1% Tween 20) and primary antibodies were incubated overnight at 4° C. and diluted in 5% BSA in TBS-T at the indicated concentrations. HRP-conjugated secondary antibodies were incubated in blocking buffer for 1 h at room temperature and then detected using Super Digital-ECL™ substrate solution (Kindle Biosciences, R1002). (Figures 5b, 10a and 11b) Western blot antibodies; Bmi1: Cell Signaling, #5856, 1:1000 Vinculin: Cell Signaling, #4650S, 1:1000 Beta-Tubulin: Cell Signaling, #2146S, 1:1000

[0085] P-glycoprotein substrate activity experiments MDCKII-mdr1 and MDCKII-wt cells were purchased from the Netherlands Cancer Institute, NKI-AVL. Cells were cultured in Dulbecco's modified essential medium (DMEM) supplemented with 10% FBS and 1% penicillin-streptomycin and used at passages 3–9. Cells were seeded at a density of 3 × 103 cells / well in 96-well tissue culture-treated plates. Four hours after allowing cells to attach, cells were treated with test compounds in the presence or absence of the P-glycoprotein inhibitor Valspodar. Plates were incubated at 37 °C and 5% CO 2 The cells were incubated at 4°C for 72 h and ATP was measured fluorescently using CellTiter-Glo® reagent (Promega) (Figure 4b).

[0086] RNA sequencing Approximately 1.75 μg of total RNA per sample was poly-A pulled down to enrich for mRNA. This was then used as input for the Illumina TruSeq RNA prep kit. Samples were prepared for the Illumina HiSeq4000 platform using the Beckmann-Coulter Roboter and SPRIworks Fragment Library Kit I. PCR was performed using the KAPA PCR Amplification Kit. Libraries were then sequenced at the Columubia Genome Center to generate 30 million 100 bp long single-end reads. (Figure 11a)

[0087] RNA-seq analysis Reads were mapped to the human reference genome (NCM1 / Build 37.2) using the STAR aligner (version 2.4.2) (Dobin A, Davis CA, Schlesinger F, et al. STAR: Ultrafast Universal RNA-Seq Aligner, Bioinformatics 2013;29:15-21) and analyzed using the summarizeOverlaps function from the R package “GenomicAlignments” (Lawrence M, Huber W, Pages H, et al. Software for computing and annotating genomic ranges, PLoS Computational Biology) using gene annotation information from the R package “TxDb.Hsapiens.UCSC.hg19.knownGene” (Carlson M, Maintainer BP. TxDb.Hsapiens.UCSC.hg19.knownGene: Annotation Package for TxDb Object(s). 2015). 2013;9:e1003118) and quantified at the gene level. RNA-seq data were deposited in GEO (ID: GSE118441). (Figure 11a)

[0088] Differentially expressed genes (DEGs) Differential gene expression analyses between the indicated conditions were performed using the voom-limma framework, which implements the R package "limma" (Ritchie ME, Phipson B, Wu D, et al. Limma powers differential expression analyses for RNA-sequencing and microarray studies, Nucleic Acids Research 2015;43:e47). The overall effect of Compound 1 treatment compared to DMSO was assessed using a multivariate design that considered both treatments and time points.

[0089] Gene set enrichment We used the R implementation of single-sample GSEA: gene set variation analysis with default parameters (Hanzelmann S, Castelo R, Guinney J. GSVA: gene set variation analysis for microarray and RNA-seq data, BMC Bioinformatics 2013;14:7). Raw counts from RNA sequencing were normalized to account for different library sizes and variance was stabilized by fitting the variance to a negative binomial distribution as implemented in the DESeq2 R package (Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2, Genome Biol 2014;15:550). Gene sets were retrieved from the MSigDb v6.0 modules HALLMARK, C2 canonical pathway and C6 oncogenic signatures (Subramanian A, Tamayo P, Mootha VK, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles, Proc Natl Acad Sci USA 2005;102:15545-50 and Liberzon A, Subramanian A, Pinchback R, et al. Molecular signatures database (MSigDB) 3.0, Bioinformatics 2011;27:1739-40).Differential enrichment analysis of these gene sets between DMSO and compound 1 treatments was performed using the limma R package (Ritchie ME, Phipson B, Wu D, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies, Nucleic Acids Res 2015;43:e47), and a false discovery rate (FDR) of <0.1 was considered significant. Single-sample enrichment results of select pathways were shown in a heatmap using the pheatmap R package (http: / / CRAN R-project org / package= pheatmap R package version 2017;1:2). (Fig. 11a). Gene set signatures

[0090] [Table 1]

[0091] Cell-free tubulin polymerization assay The assay was performed using a Fluorescence-Based Tubulin Polymerization Assay Kit from Cytoskeleton (#BK011P) using >99% pure tubulin from pig brain, following the manufacturer's recommendations. All drugs used were dissolved in DMSO and then diluted to 10x final concentration in ultrapure water. The final percentage of DMSO was kept constant for all samples. Tubulin was incubated in 80 mM PIPES pH 6.9, 2.0 mM MgCl 2, resuspended at 2 mg / mL in 0.5 mM EGTA, 1.0 mM GTP, 15% glycerol and 10 μM fluorescent reporter. All drug samples (10x) were added in duplicate to a pre-warmed half-area 96-well plate (Corning Costar, 3686) and then warmed to 37°C for 1 min. Tubulin (50 μL / well) was then added to all wells and the plate was placed in a plate reader pre-warmed to 37°C. The plate was mixed by moderate orbital shaking for 5 s and fluorescence was measured every 60 s for 90 min in a BioTek Synergy 2 plate reader (Ex: 340-360 + / - 20 nm, Em: 410-460 nm + / - 20 nm). Polymerization rates (fluorescence units / min) were determined by measuring the maximum slope (by linear regression) of the linear portion of the growth phase of the polymerization curve. (Figure 11e and Figure 11f)

[0092] Analysis of free tubulin content Free heterodimeric tubulin was separated from tubulin incorporated into microtubules using the Microtubule / Tubulin In Vivo Biochemical Assay Kit (Cytoskeleton, #BK038) following the manufacturer's recommendations. After approximately 16 h, cells were seeded in 12-well plates such that they were approximately 50-60% confluent. Cells were treated with the indicated concentrations of drugs or DMSO vehicle for 2 h, at which point cells were washed once with PBS and harvested. All steps of this assay were performed at 37 °C to preserve microtubule masses. Cells were lysed in Cytoskeleton's Lysis and Microtubule Stabilization Buffer (LMS01) supplemented with 0.1 mM GTP, 1.0 mM ATP and 1x protease inhibitor cocktail (#PIC02). Samples were centrifuged at 1,000 x g for 5 min at 37 °C. The supernatant was carefully collected for ultracentrifugation and the low speed pellet (LSP) was suspended in SDS sample buffer (SDS01), frozen at -20°C, and then analyzed by Western blot. The low speed supernatant was centrifuged at 100,000 x g for 60 min at 37°C. The supernatant (high speed supernatant, HSS) was carefully collected, resuspended in SDS sample buffer, frozen at -20°C, and then analyzed by Western blot. The pellet (high speed pellet, HSP) was first dissolved in 1x microtubule depolymerization buffer (BUF01) for 15 min, resuspended in SDS sample buffer, frozen at -20°C, and then analyzed by Western blot. (Figure 11b)

[0093] immunocytochemistry Cells were seeded on glass coverslips in 12-well plates. Coverslips were prepared by soaking in 1N HCl (60°C, 6 h), washing with 70% ethanol, and coating with poly-l-lysine (Sigma, P5899) according to the manufacturer's instructions. The next day, cells were seeded so that they were approximately 50% confluent. Cells were then treated with vehicle (DMSO, <0.003%) or 1 μM compound 1 and incubated for 24 h. After treatment, cells were washed with TBS and free tubulin was removed by centrifugation with Brinkley buffer 1980 (80 mM PIPES pH 6.8, 1 mM MgCl2) supplemented with 4 mM EGTA and 0.5% Triton-X. 2 After extraction, cells were extracted (30 s) with Cytoskeleton buffer (10 mM MES pH 6.1, 138 mM KCl, 3 mM MgCl) supplemented with 0.32 M sucrose. 2 Cells were fixed in 4% formaldehyde diluted in TBS-T (0.1% Triton-X) + 2% BSA + 22.52 mg / mL glycine for 20 min. After fixation, cells were washed with TBS and then blocked for 30 min with TBS-T (0.1% Triton-X) + 2% BSA + 22.52 mg / mL glycine. Beta-tubulin antibody was incubated overnight at 4°C (Abcam179513, 1:1000) followed by secondary antibody incubation at room temperature for 1 h with goat anti-rabbit 594 secondary antibody (Life Technologies, A11012) at 1:500. All washes were performed in TBS-T and all blocking and antibody incubations were performed in TBS-T (0.1% Triton-X) + 2% BSA + 22.52 mg / mL glycine. After staining, cells were incubated with 300 nM DAPI (BioLegend, 422801) for 5 min, washed, and mounted in ProLong Diamond anti-brown mounting medium (Invitrogen, P36965). Slides were left to dry at room temperature for 24 h and then stored in the dark at 4 °C until images were obtained.

[0094] Confocal imaging was performed with an A1 laser scanning confocal attachment (Nikon Instruments, Melville, NY) on an Eclipse Ti microscope stand using a 60x / 1.49 ApoTIRF oil immersion objective and standard laser and filter sets. The pinhole diameter was set at 1 Airy unit and single optical sections were obtained near the basal surface of the cells to maximize detection of microtubules. All imaging conditions were kept constant. Images were visualized, analyzed, and prepared for publication using the Fiji distribution of ImageJ (Schindelin J, Arganda-Carreras I, Frise E, et al. Fiji: an open-source platform for biological-image analysis. Nature Methods 2012;9:676-682). (Fig. 10d and Fig. 10f)

[0095] Animal breeding and genotyping A mixed genetic background engineered model was produced by crossing the following engineered lines: Kras LSL.G12D -Tuveson DA, Shaw AT, Willis NA, et al. Endogenous oncogenic K-ras(G12D) stimulates proliferation and widespread neoplastic and developmental defects, Cancer Cell 2004;5:375-87. Tp53 LSL.R172H -Olive KP, Tuveson DA, Ruhe ZC, et al. Mutant p53 gain of function in two mouse models of Li-Fraumeni syndrome, Cell 2004;119:847-60. Pdx1-Cre tg-Hingorani SR, Petricoin EF, Maitra A, et al. Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse, Cancer Cell 2003;4:437-50. Tp53 Flox -Jonkers J, Meuwissen R, van der Gulden H, et al. Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer, Nat Genet 2001;29:418-25. Kras FSF.G12D -Jackson Laboratory, stock number 008653. Tp53 R172H -Tp53 LSL.R172H This line was generated by crossing the line with Deleter-Cre to induce germline recombination and then crossing out the Cre allele. LSL.R172H Induce recombination of the Lox-STOP-LOX cassette in the allele and harbor a single exogenous LoxP site in intron 1 in germline Tp53 R172H This resulted in the allele. Pdx1-FlpO tg The 6 kb proximal promoter of the -Pdx1-Cre transgene was fused to the start codon of the mammalian codon-optimized thermostable Flp recombinase (FlpO), and then the 5′ end of the FlpO open reading frame was fused to the hGH polyadenylation signal sequence. Bmi1 Flox-Mich JK, Signer RA, Nakada D, et al. Prospective identification of functionally distinct stem cells and neurosphere-initiating cells in adult mouse forebrain, Elife 2014;3:e02669. Rosa26 Cre-ERT2 -Ventura A, Kirsch DG, McLaughlin ME, et al. Restoration of p53 function leads to tumour regression in vivo, Nature 2007;445:661-5. Kras LSL.G12D / + ;p53 LSL.G12D / + ;Pdx1-Cre tg / + (KPC) mice and related mice were used as described in Hingorani SR, Wang L, Multani AS, et al. Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice, Cancer Cell 2005;7:469-83. J1002 cells express Kras FSF.G12D / + ;p53 R172H / + ;Pdx1-FlpO tg / + ;Bmi1 Fl / Fl ;Rosa26 CreERT2 / + The cells were derived from spontaneous pancreatic tumors in (KPFBR) mice that arose after Cerulean treatment (to promote tumor development) but before tamoxifen treatment. Genotyping was performed by Transnetyx (Cordova, TN). Both male and female animals were utilized in the study. Animals were fed a standard chow diet and housed under a 12-hour light / dark cycle.

[0096] Generation of KPFBR primary tumor cell lines Small pieces of tumor (approximately 30 mg) were mechanically dissociated by cutting with sterile scissors in ice-cold tumor digestion buffer (5 mL / sample) for a minimum of 5 min. Tumor digestion buffer consisted of 75 μg / mL DNaseI (ThermoScientific, EN0521), 80 μg / mL Dispase II (ThermoFisher, 17105041) and 1 mg / mL Collagenase V (Sigma Aldrich, C9263) diluted in sterile PBS. After cutting, dissociated tumor was incubated in digestion buffer for 20 min at 37°C. After digestion, 40 mL of ice-cold PBS was used to dilute the digested tumor and the total 45 mL was filtered through a 70 μm sterile mesh filter. Single cell suspensions were spun down (300 x g, 5 min), washed once with PBS, resuspended in serum-free tube medium (SFDM, recipe below) and plated into 1-2 wells of collagen-coated 6-well plates (Corning, 354400). Cells were spread in SFDM on collagen-coated plates and migrated to standard DMEM (10% FBS, 1% penicillin-streptomycin, 1% L-glutamine) and standard tissue culture plates (without collagen).

[0097] SFDM manufacturing method DMEM / F-12 medium (ThermoFisher, 12634010) 1.22 mg / mL nicotinamide (Sigma, N3376) 5mg / mL glucose (Sigma, G6152) 5%ITS+ (BD Biosciences, 354352) 2.5 μg / mL amphotericin B (ThermoFisher, 15290018) 5% Nu-Serum IV (Corning, 392-0321) 25 μg / mL bovine pituitary extract (Sigma, 1476) 20ng / mL EGF (ThermoFisher, PMG8041) 50 nM 3,3',5-Triiodo-L-thyronine (Sigma, 564605) 1 μM dexamethasone (Sigma, D1756) 100ng / mL cholera toxin (Quadratech, 100)

[0098] Evaluation of Bmi1 deletion To evaluate the recombination of the conditional Bmi1 allele in J1002 cells, PCR was performed on DNA isolated by phenol-chloroform-isoamyl alcohol extraction. Cells were digested overnight at 55°C in lysis buffer (10 mM Tris pH 7.5, 10 mM EDTA, 10 mM NaCl and 0.5% Sarkosyl) supplemented with 1 mg / mL proteinase K (New England BioLabs, P8107S). The next day, DNA was isolated by combining the lysate with a mixture of 50% phenol, 48% chloroform and 2% isoamyl alcohol and centrifuging at 16,000 x g for 30 minutes. The upper layer containing DNA was removed, precipitated and washed with 2.5 volumes of 100% ethanol. DNA concentration was measured using a ThermoScientific™ NanoDrop2000 spectrophotometer. PCR reactions were performed using GoTaq® Green Master Mix (Promega, M712B), 1 ng of DNA and 250 nM of each primer. WT ), Bmi1 with loxP site (Bmi1 fl / fl ) and recombinant Bmi1 (Bmi1 Δ Three primers (DN437, DN438, DN946) were used to amplify all of the following in a single reaction. After PCR, the amplified DNA was separated on a 2% agarose gel supplemented with SYBR™ Safe DNA Gel Stain (ThermoFisher, S33102) and visualized using UV light.

[0099] Primer DN437:gctagcattcctggttttgc DN438:ggcacagtgatgaggtgttg DN946:cacgaggtgcttctttcctc Cycling conditions: 1.95℃, 2 minutes 2.95℃, 15 seconds 3.51.4℃, 15 seconds 4.68℃, 45 seconds (Repeat steps 2 to 4 30 times) 5.68℃, 5 minutes 6.4℃, permanent Expected amplification product: Wild-type Bmi1 (Bmi1 WT )=400bp Floxed Bmi1 (Bmi1 fl / fl )=500bp Recombinant Bmi1 (Bmi1 Δ )=300bp

[0100] PDX model intervention study Early passage tumor fragments from the Champions model CTG-1462 were implanted subcutaneously into nu / nu mice, and tumors were then grown to 150-300 mm 3 Mice (n=5 / group) were treated with one of seven groups: vehicle, gemcitabine (50 mg / kg, once weekly, intraperitoneally), nab-paclitaxel (10 mg / kg, intravenously, once weekly x 3), compound 1 (12.5 mg / kg, twice weekly x 4, orally) or full dose combinations of gemcitabine + nab-paclitaxel, gemcitabine + compound 1, nab-paclitaxel + compound 1 or gemcitabine + nab-paclitaxel + compound 1. The endpoint was tumor growth of 1500 mm 3 or 90 days after the study. The length (L) and width (W) diameters of the tumors were measured using digital calipers and the mice were weighed twice weekly. Tumor volumes were calculated as (L × W 2 ) / 2 (Figures 12a and 12b).

[0101] KPC Intervention / Survival Study Tumor formation in KPC mice was monitored by weekly palpation until a mass was detected. After positive palpation, masses were monitored by ultrasound twice weekly until tumors reached a registrable size of 4-7 mm mean diameter. Once registrable, KPC mice were randomly enrolled into treatment groups for the intervention study. Mice were treated with vehicle, compound 1 (17 mg / kg, orally, twice weekly), gemcitabine alone (100 mg / kg, intraperitoneally, twice weekly) or compound 1 + gemcitabine. Mice administered compound 1 also received gemcitabine vehicle (saline, intraperitoneally, twice weekly) at a volume (μL) of 50 × body weight (g). Mice administered gemcitabine also received compound 1 vehicle (0.5% hydroxypropyl methylcellulose with 0.1% Tween 80 (w / v), orally, twice weekly) at a volume (μL) of 5.7 × body weight (g). All drug and vehicle combinations were administered simultaneously.

[0102] Measurement of Compound 1 levels in plasma and tissue samples Plasma and tissue samples used for analysis were immediately frozen on dry ice and stored at -80°C until analysis. Compound 1 concentrations in samples were quantified using high performance liquid chromatography and tandem mass spectrometry (LC-MS / MS). Compound 1 and its internal standard (deuterated Compound 1) were recovered by protein precipitation extraction from the samples. For plasma pharmacokinetic time course studies, standard curves were generated corresponding to concentrations from 0.001 μg / mL to 3.0 μg / mL. The lower limit of quantification (LLOQ) of compound 1 (either version) in plasma was 0.001 μg / mL (Figure 4a).

[0103] For the pharmacokinetic studies evaluating plasma, quadriceps and tumor tissue after a single dose of Compound 1, the assay conditions were as follows ( FIG. 5 a): Plasma: A standard curve was constructed corresponding to concentrations from 0.002 μg / mL to 6.0 μg / mL. The LLOQ for Compound 1 (either version) in plasma was 0.001 μg / mL. Quadriceps: A standard curve was constructed corresponding to concentrations from 0.001 μg / g wet tissue to 3.0 μg / g wet tissue. The LLOQ for Compound 1 (either version) was 0.01 μg / g wet tissue. Tumor tissue: A standard curve was constructed corresponding to concentrations from 0.001 μg / g wet tissue to 3.0 μg / g wet tissue. The LLOQ for Compound 1 (either version) was 0.02 μg / g wet tissue. Ultrasound Ultrasound examination and volumetric quantification of tumors was performed as described in Sastra SA, Olive KP, Quantification of murine pancreatic tumors by high-resolution ultrasound, Methods Mol Biol 2013;980:249-66 (Figures 7a and 7b).

[0104] immunohistochemistry To prepare samples for immunohistochemistry, tissues were first fixed overnight in 10% phosphate-buffered formalin and then stored in 70% ethanol for long-term storage. Fixed tissues were then subjected to a standard dehydration protocol to embed them in paraffin wax blocks. Tissues were sectioned at 5 μm thickness using a Leica RM2235 microtome, mounted on positively charged glass slides and baked at 60° C. for 30 min. To prepare for staining, slides were first deparaffinized with xylene and then rehydrated in a series of ethanol steps before rinsing with distilled water. Antigen retrieval was then performed with an experimentally determined antibody-specific antigen retrieval buffer (usually 10 mM citric acid, pH 6.0 or 10 mM Tris, pH 10.0). The antigen retrieval buffer was heated to boiling in a pressure cooker, at which point the slides were introduced for 5 min. After cooling to room temperature, the slides were immersed in 3% hydrogen peroxide in PBS for 20 min to quench endogenous peroxidase.

[0105] Slides were then blocked in TBS-T (0.1% Tween 20) + 1.5% normal horse serum (Vector Laboratories, S-2000) + 2% Animal Free Blocker (Vector Laboratories, SP-5030) for 1 h at room temperature. Primary antibodies were diluted in blocking solution and incubated overnight at 4 °C at the indicated concentrations. The next day, secondary antibody incubation was performed with ImmPRESS HRP anti-rabbit IgG (peroxidase) polymer detection kit (Vector Laboratories, MP-7401) for 30 min at room temperature. Detection was performed with ImmPACT DAB peroxidase (HRP) substrate (Vector Laboratories, SK-4105), after which slides were counterstained with hematoxylin, dehydrated in xylene, and coverslipped with Permount (Fisher, S70104). (Figure 6d and Figure 6e) IHC antibodies: PH3: Cell Signaling, #9701, 1:100 CC3: Cell Signaling, #9664S, 1:100

Claims

1. A method of treating pancreatic cancer in a subject in need thereof comprising administering to the subject an effective amount of 5-fluoro-2-(6-fluoro-2-methyl-1H-benzo[d]imidazol-1-yl)-N4-[4-(trifluoromethyl)phenyl]pyrimidine-4,6-diamine having the structure of formula (I), or a pharma- ceutically acceptable salt thereof. 【Chemistry 1】 Formula (I)

2. 13. The method of claim 1, further comprising administering to the subject an effective amount of 5-fluoro-2-(6-fluoro-2-methyl-1H-benzo[d]imidazol-1-yl)-N4-[4-(trifluoromethyl)phenyl]pyrimidine-4,6-diamine, or a pharma- ceutically acceptable salt thereof, in combination with an effective amount of one or more chemotherapeutic agents.

3. The method of claim 2, wherein the chemotherapeutic agent is selected from gemcitabine, nab-paclitaxel, and combinations thereof.

4. 2. The method of claim 1, wherein the pancreatic cancer is pancreatic ductal adenocarcinoma.

5. 13. The method of claim 1, further comprising administering to the subject an effective amount of 5-fluoro-2-(6-fluoro-2-methyl-1H-benzo[d]imidazol-1-yl)-N4-[4-(trifluoromethyl)phenyl]pyrimidine-4,6-diamine, or a pharma- ceutically acceptable salt thereof, in the form of a pharmaceutical composition.

Images