Primer set for specifically amplifying at least part of base sequence complementary to 23s rrna of enterobacteriales bacteria, and detection method for enterobacteriales using the same

Abstract

To provide a technique for detecting Enterobacterales bacteria, which are potential contributors to infectious diseases.SOLUTION: Provided are: a primer set comprising an oligonucleotide represented by a specific base sequence, characterized by specifically amplifying at least a part of a base sequence complementary to a 23S rRNA of Enterobacteriales bacteria; and a detection method for Enterobacteriales using the primer set.SELECTED DRAWING: Figure 3

Description

[Technical field]

[0001] The present invention relates to a primer set that specifically amplifies at least a portion of a base sequence complementary to the 23S rRNA of Enterobacteriaceae bacteria that may cause infectious diseases, and a method for detecting enterobacteria using the same. [Background technology]

[0002] Enterobacteriaceae has been shown to be involved in various human diseases, and the quantification of the number of bacteria is an important indicator for evaluating the relationship between health and disease. In 2016, Enterobacteriaceae was reorganized based on the results of bacterial genome analysis, and a new classification at the order level, "Enterobacterales," was proposed, which is a higher classification than the family level, "Enterobacteriaceae" (Non-Patent Document 1).

[0003] In the new organization of Enterobacterales, in addition to Enterobacteriaceae, six new families (Budviciaceae, Erwiniaceae, Hafniaceae, Morganellaceae, Pectobacteriaceae, Yersiniaceae) were established, and some of the bacteria previously classified as Enterobacteriaceae were reclassified into the newly established families. In addition, scientific names were changed and new species were added. With this reorganization, the notation Enterobacterales has come to be used in academic papers (Non-Patent Documents 2, 3). The reorganization of Enterobacterales has been ongoing since 2016, and as of June 2022, Enterobacterales is composed of nine families (Figure 1).

[0004] For these reasons, it has become urgent to establish a PCR-based method for quantifying bacteria that targets Enterobacterales in line with current classification, but no quantitative primer sets have been reported to date. [Prior art documents]

Non-Patent Literature

[0005]

Non-Patent Literature 1

Non-Patent Literature 2

Non-Patent Literature 3

Summary of the Invention

[0006] An objective of the present invention is to provide a technique for detecting Enterobacterales bacteria that may cause infectious diseases. [Means for solving the problem]

[0007] As a result of intensive research aimed at solving the above problems, the present inventors discovered that a primer having a specific base sequence can be used to detect bacteria belonging to the order Enterobacteriaceae, and thus completed the present invention.

[0008] In other words, the present invention is a primer set characterized by specifically amplifying at least a portion of a base sequence complementary to 23S rRNA of Enterobacteriaceae bacteria, which is composed of oligonucleotides represented by the base sequences set forth in SEQ ID NOs: 1 and 2.

[0009] The present invention also relates to a method for producing a pharmaceutical composition comprising the steps of: (1) Extracting RNA from a sample (2) A step of preparing a base sequence complementary to the RNA extracted in (1). (3) carrying out an amplification reaction using the primer set and the base sequence prepared in (2) (4) Step to check for amplification The method for detecting Enterobacteriaceae is characterized by comprising:

[0010] Furthermore, the present invention relates to a detection kit for Enterobacteriale bacteria, comprising the above-mentioned primer set. Effect of the Invention

[0011] The primer set of the present invention can specifically amplify at least a portion of a nucleotide sequence complementary to 23S rRNA of Enterobacteriaceae bacteria that can cause infectious diseases.

[0012] Therefore, the present invention is suitable for detecting Enterobacteriaceae bacteria that may cause infectious diseases. [Brief description of the drawings]

[0013] [Figure 1] Figure 1 shows the evolution of the classification of Enterobacteriaceae ((A) is the classification before the reorganization, (B) is the classification after the reorganization from 2016 to 2022). [Diagram 2] FIG. 2 is a diagram in which the Ct value of each primer set in Example 1 is plotted on the ordinate and the number of test bacteria (DAPI) on the abscissa. [Diagram 3] FIG. 3 is a diagram in which the Ct value of the primer set (o-EnbacF / o-EnbacR) in Example 2 is plotted on the ordinate against the number of test bacteria (DAPI) on the abscissa. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] The primer set of the present invention specifically amplifies at least a part of a nucleotide sequence complementary to 23S rRNA of bacteria of the order Enterobacteriale, preferably a sequence flanked by two primers, which is composed of oligonucleotides having the nucleotide sequences shown in SEQ ID NOs: 1 and 2. Examples of bacteria of the order Enterobacteriale include bacteria belonging to nine families, namely, Enterobacteriaceae family such as Escherichia coli, Erwiniaceae family such as Erwinia amylovora, Pectobacteriaceae family such as Pectobacterium carotovorum, Yersiniaceae family such as Yersinia pestis, Hafniaceae family such as Hafnia alvei, Morganellaceae family such as Morganella morganii, Budviciaceae family such as Budvicia aquatica, Bruguierivoracaceae family such as Bruguierivorax albus, and Thorselliaceae family such as Thorsellia kenyensis. Here, specific amplification means that the base sequence complementary to the 23S rRNA of bacteria other than Enterobacteriaceae is not amplified, and for example, the base sequence complementary to the 23S rRNA of closely related species such as bacteria of the order Pasteurellales and Vibrionales is not amplified. Note that, according to the primer set of the present invention, the base sequence complementary to the 23S rRNA of Enterobacteriaceae bacteria is amplified at a concentration of, for example, 1 cell / ml or more, preferably 1 cell / ml to 10 cell / ml in blood. 4 cells / ml, and 10 for feces 4 cells / g or more, preferably 10 4 cells / g~10 9 It can be specifically amplified at 1000x the number of cells / g.

[0015] Forward primer: o-EnbacF (SEQ ID NO: 1): AGATGCAGTGTACCCGCGGCA Reverse primer: o-EnbacR (SEQ ID NO: 2): GCACCTGCTCGMGCCGTCAC

[0016] Each of the above-mentioned primers can be obtained by a conventional DNA synthesis method well known to those skilled in the art, for example, using a DNA synthesizer, or by requesting synthesis from a DNA synthesis company such as Sigma-Aldrich Japan or Life Technologies Japan.

[0017] The primer set of the present invention explained above can be used in a method for detecting bacteria belonging to the order Enterobacteriaceae (hereinafter referred to as the "detection method of the present invention").

[0018] Specifically, detection of Enterobacteriaceae bacteria involves the following steps (1) to (4). (1) Extracting RNA from a sample (2) A step of preparing a base sequence complementary to the RNA extracted in (1). (3) carrying out an amplification reaction using the primer set (set forth in SEQ ID NOs: 1 and 2) and the base sequence prepared in (2); (4) Step to check for amplification This is done by including

[0019] The sample used in step (1) of the detection method of the present invention is not particularly limited, and examples thereof include blood, feces, sputum, urine, organs, lavage fluid, tissues, and cells. Among these samples, blood and feces are preferred.

[0020] The method for extracting RNA from the sample is not particularly limited, but examples thereof include an extraction method using an organic solvent such as phenol, chloroform, or benzyl chloride, a method of physically disrupting bacterial cells by shaking with glass beads, a method of directly adding an alkali, a method using heat treatment, or a protease treatment method. In addition, a commercially available RNA extraction kit may be used to extract RNA from a sample. Among these methods, a method including a protease treatment is preferred because it requires a short time for RNA extraction and has a high extraction efficiency.

[0021] Specifically, when blood or feces is used as a sample, RNA can be extracted based on the hot phenol method (reference: Matsuda, Kazunori et al. "Sensitive quantitative detection of commensal bacteria by rRNA-targeted reverse transcription-PCR." Applied and environmental microbiology vol. 73,1 (2007): 32-9.). In addition, the step of preparing a base sequence complementary to the extracted RNA can be performed by a known method using reverse transcriptase.

[0022] In step (3) of the detection method of the present invention, the amplification reaction using the primer that specifically amplifies at least a part of the base sequence complementary to the 23S rRNA of the Enterobacteriale bacteria and the base sequence prepared in (2) can be, for example, an amplification reaction using known primers such as PCR. Among these amplification reactions, PCR is preferable. Furthermore, these amplification reactions can be performed under known conditions. Furthermore, these amplification reactions can be performed using a commercially available PCR kit or the like. Furthermore, steps (2) and (3) can be performed in combination by RT-PCR.

[0023] Specifically, when quantitative RT-PCR is used as the amplification reaction, the extracted RNA is used as a template and an RT reaction is carried out using a commercially available RT-PCR kit or the like at 40 to 60°C for 20 to 40 minutes and at 80 to 95°C for 10 to 20 minutes, followed by 40 to 60 cycles of PCR reaction, each cycle consisting of 90 to 98°C for 10 to 30 seconds, 50 to 70°C for 10 to 30 seconds, and 70 to 80°C for 20 to 40 seconds.

[0024] In step (4) of the detection method of the present invention, the presence or absence of amplification can be confirmed by a known method such as agarose gel electrophoresis. If this amplification is present, it can be determined that the sample contains bacteria of the order Enterobacteriale.

[0025] According to the detection method of the present invention described above, bacteria of the order Enterobacteriale can be rapidly detected in a total of about 6 hours, consisting of about 3 hours for RNA extraction and about 3 hours for amplification reaction. In particular, the detection method of the present invention can detect bacteria of the order Enterobacteriale with high sensitivity. Specifically, when the sample is blood, it is possible to detect 1 cell of bacteria of the order Enterobacteriale in 1 ml of blood. Also, when the sample is feces, it is possible to detect 10 cells of bacteria of the order Enterobacteriale in 1 g of feces. 4 It is possible to detect Enterobacteriaceae in cells.

[0026] Furthermore, in order to carry out the detection method of the present invention, a detection kit for Enterobacteriale bacteria containing the primer set of the present invention can be used. This kit may further contain a reagent such as an enzyme reagent that can amplify at least a part of a base sequence complementary to 23S rRNA of Enterobacteriale bacteria using the primer set of the present invention, and RNA of a positive control bacterium. The enzyme reagent may be a combination of a nucleic acid synthesizing enzyme such as a template-dependent DNA polymerase, a substrate for nucleic acid synthesis such as dNTP, and the like.

[0027] As described above, the primer set of the present invention specifically amplifies a base sequence complementary to the 23S rRNA of Enterobacteriaceae bacteria, and therefore, it goes without saying that this primer set can also be used in detection kits for other pathogens, etc. EXAMPLES

[0028] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples in any way.

[0029] Example 1 Detection of Enterobacteriaceae bacteria: <Test Method> (1) Strains used and RNA extraction from the strains The strains used and the culture conditions for each strain are shown in Table 1 (in the table, the storage numbers are T The strains marked with are type strains (standard strains). 2 × 10 8Total RNA equivalent to the number of cells / ml of bacteria was extracted (Matsuda, Kazunori et al. “Establishment of an analytical system for the human fecal microbiota, based on reverse transcription-quantitative PCR targeting of multicopy rRNA molecules.” Applied and environmental microbiology vol. 75,7 (2009): 1961-9.) and used in the following experiments.

[0030] [Table 1-1] [Table 1-2]

[0031] (2) Design of Enterobacterales-specific primer set The Enterobacterales-specific primer set was designed by obtaining the 23S rRNA base sequences of 95 Enterobacterales species as target sequences and 16 closely related species as non-target sequences (total of 111 species) from a public database, aligning them using Clustal X software (Thompson, JD et al. “CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.” Nucleic acids research vol. 22,22 (1994): 4673-80.), and then designing multiple primer sets to include the conserved region of the target sequence, Enterobacterales (Table 2: SEQ ID NOs: 1 to 18 in the order listed in the table). The newly designed primer set was confirmed to not cross over with the rRNA gene sequences of other bacteria using NCBI Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ).

[0032] [Table 2] In the table, M is A and C, R is A and G, S is C and G, and Y is C and T.

[0033] The detection sensitivity of these primer sets was examined. Standard strain Escherichia coli ATCC 11775 T The detection sensitivity of the Enterobacterales-specific primer set was examined using RNA from 1 × 10 4 cells to 1 × 10 -1The RNA was serially diluted 10-fold with RNase-free water (AmbionTM, Thermo Fisher Scientific Inc.) to correspond to 1000 cells, and quantitative RT-PCR was performed using the diluted RNA as a template. The enzyme reagent kit used for quantitative RT-PCR was OneStep TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Inc.). For fluorescence detection, a QuantStudio 12K Flex Real-Time PCR System (Thermo Fisher Scientific Inc.) was used, and the reverse transcription reaction was performed at 42°C for 30 minutes and 95°C for 10 seconds, followed by 40 cycles of 95°C for 10 seconds, 60°C for 20 seconds, and 72°C for 34 seconds. The resulting C T From the correlation between the value and the number of bacteria, the lower limit of the number of bacteria that allows quantitative analysis was determined (quantitative RT-PCR was performed in triplicate). The results are shown in Table 3, and a plot of these is shown in Figure 2. An approximation curve was also created from this plot, and the equation and correlation coefficient (R 2 ) are shown in Table 4.

[0034] [Table 3]

[0035] [Table 4]

[0036] From the above results, the detection sensitivity of each primer was compared, and in the reaction of primer set o-EnbacF / R of No. 1, the Ct value (cycle number) at which a certain amount of amplified product was reached was the smallest, and the correlation coefficient (the closer to 1, the better) and the slope value (the closer to -3.32, the better) were also good, suggesting high reliability as a calibration curve. On the other hand, in the reaction of primer sets of No. 2 to 9, the Ct value at which a certain amount of amplified product was reached was large, and the correlation coefficient and slope value were also not favorable. Therefore, the primer set of o-EnbacF / R was used in the following examples. This study revealed that even primers prepared by the same method have a significant difference in sensitivity. It is thought that this is due to the structure of the template RNA at the amplification or annealing site and the compatibility with the enzyme, and it was found that sensitivity verification is necessary when preparing primers.

[0037] Example 2 Examination of primer set specificity: (1) Examination of primer set specificity The specificity of primer set No. 1 (o-EnbacF / o-EnbacR) was examined for 37 Enterobacterales species and 6 closely related species, as well as 21 representative enterobacteria and infectious disease-causing bacteria (total of 64 strains) (Table 5). 8 Quantitative RT-PCR was performed using RNA as a template, the concentration of which was adjusted to correspond to the number of cells / ml of bacteria.

[0038] [Table 5-1] [Table 5-2]

[0039] (2) Examination of detection sensitivity by quantitative RT-PCR The detection sensitivity of Enterobacterales-specific primers was examined under the bacterial count measurement conditions for clinical samples using RNA from the standard strain Escherichia coli. The bacterial count measurement conditions for fecal samples were 1 × 10 RNA from the standard strain per reaction in quantitative RT-PCR. 4 cells to 1 × 10 -1 The bacterial count in blood samples was 1×10 per quantitative RT-PCR reaction. 4 cells to 1 × 10 0 The RNA was serially diluted 10-fold to correspond to 1000 cells, and quantitative RT-PCR was performed using the diluted RNA as a template. The correlation between the obtained CT value and the number of bacteria was examined to determine the lower limit of the number of bacteria that could be quantitatively analyzed (quantitative RT-PCR was performed in triplicate). If the virus can be detected under the above measurement conditions, it can be measured in feces and blood samples.

[0040] (3) Quantification of Enterobacterales in feces by quantitative RT-PCR using a new primer set The number of Enterobacterales bacteria in the feces of 48 perioperative patients was quantified by quantitative RT-PCR using the newly designed primer set. The number of bacteria was calculated by quantitative RT-PCR as described above and in the literature ( Matsuda, Kazunori et al. "Establishment of an analytical system for the human fecal microbiota, based on reverse transcription-quantitative PCR targeting of multicopy rRNA molecules." Applied and environmental microbiology vol. 75,7 (2009): 1961-9.).

[0041] <Result> [Specificity of primer set] The Enterobacterales-specific primer set "o-EnbacF / o-EnbacR" designed in this study showed cross-reactivity only with the 37 targeted Enterobacterales species, but did not show cross-reactivity with six other closely related Enterobacterales species or 21 representative species of bacteria targeted for intestinal flora analysis and infectious disease-causing bacteria (Table 5).

[0042] [Detection sensitivity of primer set] By quantitative RT-PCR using RNA from a standard strain of Escherichia coli, the Enterobacterales-specific primer set "o-EnbacF / o-EnbacR" designed in this study was able to measure the bacterial count of 1×10 4 ~1×10 9 cells / g feces [Figure 3(A), lower limit: 1 × 10 4 cell, 10 per 1g of feces 4 cells], and the bacterial count in blood samples was 1×10 0 ~1×10 4 cells / ml [Figure 3(B), lower limit: 1 × 10 0 cells, equivalent to 1 cell per 1 ml of blood]. Also, a fitted curve was created from this plot, and the equation and correlation coefficient (R 2 ) (Table 6), which was the same as in Example 1.

[0043] [Table 6]

[0044] [Quantification of Enterobacterales in fecal samples by quantitative RT-PCR using a novel primer set] Using the Enterobacterales specific primer set "o-EnbacF / R", the number of Enterobacterales bacteria in the feces of 48 perioperative patients was quantified. 4.5 ~10 9.7The target bacteria were detected at the cells / g level (Tables 7-1 and 7-2). The base sequences of all these RT-PCR amplified products were analyzed and a homology search was performed, confirming that all of them matched with species belonging to the Enterobacterales with a homology rate of 99% or more (Tables 7-1 and 7-2).

[0045] [Table 7-1]

[0046] [Table 7-2] [Industrial Applicability]

[0047] The present invention can be used to detect Enterobacteriaceae bacteria that may cause infectious diseases.

Claims

1. A primer set comprising oligonucleotides having the base sequences set forth in SEQ ID NOs: 1 and 2, which specifically amplifies at least a portion of a base sequence complementary to 23S rRNA of Enterobacteriaceae.

2. The following steps (1) to (4) (1) Extracting RNA from a sample (2) A step of preparing a base sequence complementary to the RNA extracted in (1). (3) A step of carrying out an amplification reaction using the primer set according to claim 1 and the base sequence prepared in (2). (4) Step of confirming the presence or absence of amplification A method for detecting Enterobacteriale bacteria, comprising:

3. A kit for detecting bacteria of the order Enterobacteriaceae, comprising the primer set according to claim 1.

Images