T-cell tropism anticancer vaccine to symbiotic virus
Patent Information
- Application Number
- JP2024213945
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-10-02
- Filing Date
- 2024-12-06
- Publication Date
- 2025-10-06
AI Technical Summary
The prior art is difficult to effectively explain the association between skin cancer and β-HPV in immunosuppressed patients, and traditional treatments are costly and have heavy public health burdens.
The immune response of T cells to symbiotic human papillomavirus (HPV) is enhanced by using multi-antigenic peptide tablets and active vaccines, thereby reducing the risk of skin cancer.
It significantly improves the immune response of the host to symbiotic HPV, reduces the risk of skin cancer, and reduces the cost of treatment.
Smart Images

Figure 00000050_0000 
Figure 00000050_0001 
Figure 00000050_0002
Abstract
Description
[Technical field]
[0001] Claiming priority This application is a continuation of U.S. patent application Ser. No. 62 / 772,443, filed Nov. 28, 2018. No. 62 / 831,691 filed on April 9, 2019, and No. 62 / 831,691 filed on January 1, 2019. This application claims the benefit of U.S. Pat. No. 62 / 909,698, filed on October 2, 2013. The entirety of the foregoing is hereby incorporated by reference. Herein incorporated by reference.
[0002] Government-sponsored research or development This invention was made with government support under Grant No. OD021353 awarded by the National Institutes of Health. The Government has certain rights in this invention.
[0003] Treating skin cancer by boosting T cell immunity against commensal HPV present in the skin Immune-based approaches to treatment and prevention. [Background technology]
[0004] Non-melanoma skin cancers, including squamous cell carcinoma (SCC) and basal cell carcinoma (BCC), are the most common. It is a common type of cancer 8 Ultraviolet (UV) radiation is a preventable cause of skin cancer, Incidence of skin cancer in the United States doubled from 1992 to 2012 9 . Skin cancer causes significant morbidity, including ulceration and disfigurement. Additionally, the mortality rate of SCC is higher in immunosuppressed patients, including solid organ transplant recipients (OTRs). The mortality rate for melanoma in 10~12 In addition to those side effects, my current skin Cancer treatments represent a public health burden in the United States, with a combined annual cost of over $1 billion. Represents an increase13 . Summary of the Invention [Problem to be solved by the invention]
[0005] Immunosuppression increases the risk of virally-driven cancers 1 Among these, non-melanoma Primary skin cancer is associated with beta-human papillomavirus (β-HPV), particularly in immunosuppressants. In immunosuppressed patients, risk of skin cancer increases >100-fold 2~5 However, Previous studies have established a causative role for low-risk HPV in skin cancer. Here, we demonstrate that anti-papillomavirus immunity prevents the development of skin cancer in immunocompetent hosts. This loss of immunity, rather than the oncogenic effect of commensal HPV, is likely the cause of death in immunosuppressed patients. by demonstrating that this is the reason for the significantly increased risk of skin cancer in In a clinical study, we investigated the effect of IFN-α on the immune-suppressed patients with pulmonary embolism. Anatomical distribution of skin cancers in different HPV strains differs significantly from those of HPV-caused warts They found that the distribution of skin cancer in immunocompetent patients was consistent with that of skin cancer in immunocompetent patients. The distribution pattern indicates that ultraviolet (UV) radiation was the major cause of cancer in both populations. The effect of papillomaviruses on carcinogen-induced skin cancer was investigated. To experimentally investigate this, we used mouse papillomavirus type 1 (MmuPV1)-containing Immunocompetent wild-type (Wt) C57BL / 6, FVB and SKH-1 mice were treated with Knee formation 6、7 T cells transferred from naturally immunized or immunized mice against MmuPV1 Colonized mice with cell-mediated adaptive immunity were compared with their uninfected counterparts. This provided significant protection against chemical and UV-induced skin carcinogenesis.25 RNA and DNA in situ hybridization for commensal β-HPV in , and increased viral activity and load in human skin cancer cells compared with adjacent normal skin. Finally, the β-HPV E7 peptide was found to be highly resistant to immunization with normal human skin. Isolated CD8 + Our findings highlight the beneficial effects of commensal viruses. This will uncover the mechanisms by which HPV infection can be prevented and boost T cell immunity against the commensal HPV that resides on all of our skin. By doing so, we are able to develop an immune-based approach to treat and prevent skin cancer. Establish the foundation. [Means for solving the problem]
[0006] Thus, as used herein, (i) a protein derived from a commensal human papillomavirus (ii) a plurality of antigen peptides each comprising a sequence of 9 to 30 amino acids derived from (iii) preferably a virus-like particle, multiple antigenic proteins from commensal human papillomaviruses in the fetus, and / or (iv) (a) a 9-30 amino acid sequence derived from a protein derived from a commensal human papillomavirus; (b) a plurality of antigenic peptides each containing a sequence of a symbiotic human papillomavirus (HPV) a plurality of nucleic acids encoding a plurality of antigenic proteins from the strain; and optionally Compositions are provided that include a T cell adjuvant that increases T cell responses to tides. In some embodiments, the commensal human papillomavirus is a low-risk alpha-HPV, β-HPV, γ-HPV and / or μ-HPV strains, e.g., commensal human papillomavirus (HPV) The HPVs are the low-risk α-HPV, β-HPV, γ-HPV and and / or μ-HPV strains.
[0007] In some embodiments, the multiple antigenic peptides include one or more of E1, E2, Includes peptides derived from the E4, E5, E6 or E7 proteins.
[0008] In some embodiments, the multiple antigenic peptides are multiple commensal human papillomavirus (HPV) peptides. The present invention includes peptides derived from proteins derived from Lus.
[0009] In some embodiments, the composition comprises, for example, multiple copies of each unique sequence. The present invention includes at least 200 peptides, each having a unique sequence, including peptides of the same sequence.
[0010] In some embodiments, the composition expresses multiple proteins or antigenic peptides. One or more viral vectors engineered to transmit the virus, e.g., a recombinant retrovirus. from viruses, adenoviruses, adeno-associated viruses, alphaviruses and lentiviruses The viral vector includes a viral vector selected from the group consisting of:
[0011] In some embodiments, the T cell adjuvant is a nanoparticle that enhances T cell responses. , poly-ICLC (carboxymethylcellulose, polyinosinic acid-polycytidylic acid, and poly-L-lysine double-stranded RNA), imiquimod, CpG oligodeoxynucleotides and formulations (IC31, QB10), AS04 (3-O-desacyl-4'-monophospho AS01 (aluminum salt formulated with mesophilic lipid A (MPL)), AS02 (MPL and and saponin QS-21), MPLA, STING agonists, other TLR agonists, Candida albicans skin test antigen (Candin), GM-CS F, Fms-like tyrosine kinase-3 ligand (Flt3L), and / or IFA ( In some embodiments, the adjuvant comprises one or more of the following: In the present invention, the T cell adjuvant is topical resiquimod, and / or imiquimod, and / or or topical 5-fluorouracil, and / or topical calcipotriene (calcipotriene all), for example in combination with 5-fluorouracil.
[0012] As used herein, the present invention relates to a method for treating or reducing the risk of developing skin cancer in a subject. A method for reducing the incidence of inflammatory bowel disease, comprising administering to a subject an effective amount of a composition described herein. Additionally, methods for treating or at risk of developing skin cancer in a subject are provided. Also provided are compositions described herein for use in methods for reducing
[0013] In some embodiments, the subject is diagnosed with an increased risk of developing skin cancer. or due to, for example, aging, or acquired immune deficiency, primary immune deficiency, or organ transplantation. The result is immunocompromised.
[0014] Unless otherwise defined, all technical and scientific terms used herein are defined as It has the same meaning as commonly understood by a person skilled in the art to which the present invention belongs. Methods and materials for use are described herein but are not limited to those publicly known in the art. Other suitable methods and materials known in the art may also be used. The materials, methods and examples are merely illustrative. By way of example only and not by way of limitation, all references made herein are to All publications, patent applications, patents, sequences, database entries, and other references contained herein are the property of their respective owners. is incorporated by reference in its entirety. In the case of conflict, the present specification, including definitions, will control. will be done.
[0015] Other features and advantages of the invention will become apparent from the following detailed description and drawings, as well as from the claims. It will be clear from the range. [Brief description of the drawings]
[0016] [Figure 1A-I]MmuPV1 skin colonization protects animals against chemical carcinogenesis of the skin. A-C, Skin tumor outcomes for DMBA-TPA-treated MmuPV1-colonized wild-type (Wt) C57BL / 6J mice (MmuPV1 / DMBA-TPA, n=12), DMBA-TPA-treated mock-infected (- / DMBA-TPA, n=10), and MmuPV1-colonized mice (MmuPV1 / -, n=10) are assessed by (A) tumor latency, (B) tumor counts per mouse over time, and (C) tumor burden at the end of the carcinogenesis protocol. D, Percentage of Wt FVB mice with wart development on the back skin immediately after MmuPV1 infection and subgroups with persistent warts are shown. E, T cells (test T cells) from skin-draining lymph nodes of MmuPV1-colonized immune mice are transferred into mice with persistent warts. Changes in skin wart burden are documented 2 weeks after adoptive T cell transfer. Control T cells represent naive T cells found in the spleens of uninfected Wt FVB mice. F-I, Development of skin tumors in DMBA-TPA-treated MmuPV1-colonized Wt FVB mice (MmuPV1 / DMBA-TPA, n=10) compared to DMBA-TPA-treated mock-infected (- / DMBA-TPA, n=10) and MmuPV1-colonized mice (MmuPV1 / -, n=10). (F) Time to tumor onset, (G) number of skin tumors over time, (H) tumor burden at the end of the study, and (I) representative images of mice in the DMBA-TPA-treated cohort are shown. (J) Mice that rejected their skin warts after receiving T cells from MmuPV1-colonized immunized mice (test T cells in e; n=3) were compared to wart-bearing non-immunized mice (n=3) after treatment with DMBA-TPA. Note that non-immunized mice developed invasive skin cancers at 8 weeks (mouse 4), 15 weeks (mouse 5) and 20 weeks (mouse 6) after DMBA-TPA treatment (red circles). Mice were shaved to allow better visualization of skin tumors. Scale bar: 1 cm, error bars represent mean + SD; *p<0.05, **p<0.01, ***p<0.0001. [Figure 1J] As mentioned above. [Figure 2A-G]MmuPV1 skin colonization protects immunocompetent SKH-1 mice against UV carcinogenesis. A-C, SKH-1 mice colonized with MmuPV1 in the back skin and free of warts (i.e., immune) were subjected to a DMBA-UV carcinogenesis protocol. (A) Time to tumor onset, (B) tumor counts per mouse over time, and (C) number of tumors developed in each mouse over the course of the carcinogenesis protocol are compared between DMBA-UV-treated MmuPV1-colonized SKH-1 mice (MmuPV1 / DMBA-UV, n=10), DMBA-TPA-treated mock-infected mice (- / DMBA-UV, n=10), and MmuPV1-colonized mice (MmuPV1 / -, n=10). D, Representative images of mice in the DMBA-UV-treated group are shown (scale bar: 1 cm). Note the similarity of DMBA-UV-induced skin tumors specific in the - / DMBA-UV cohort to actinic keratosis and SCC in humans. E, Representative images of CD8+ T cells in the skin of MmuPV1 / DMBA-UV and - / DMBA-UV mice at the end of the carcinogenesis protocol are shown (dashed line highlights epidermal basement membrane, scale bar: 100 μm). F, CD8+ T cell infiltration in MmuPV1 / DMBA-UV and - / DMBA-UV skin was quantified in 10 random high power fields (hpf) per skin and averaged across mice in each group. G, The ratio of CD8+ T cells within the epithelial compartment (i.e., CD8+ TR M cells) to total T cell counts in each high magnification image was calculated across MmuPV1 / DMBA-UV and - / DMBA-UV skin samples and represented as a graph. Stained cells were counted blindly. Each dot represents one high magnification image. Error bars represent mean + SD; *p<0.05, **p<0.005, ***p<0.001, ns: not significant. [Figure 3A-D]The significant decrease in β-HPV activity from normal skin to skin cancer, and the presence of β-HPV-specific cytotoxic T cells in normal human skin, point to a strong selective pressure by antiviral immunity against malignant cells harboring active HPV. A, RNA in situ hybridization for β-HPV (RNAish) using a pool of probes specific for 25 β-HPV types is used to detect β-HPV transcripts (red dots) in human skin cancers (Table 2). Warts serve as positive controls and show the greatest amount of β-HPV activity. Hypertrophic actinic keratoses occurring in association with warts (HAK in warts) are another example of β-HPV active lesions found in the skin of immunosuppressed patients. Representative RNAish-stained sections of SCC from immunosuppressed and immunocompetent patients are shown. Insets highlight representative areas of cancer / warts, and their adjacent normal skin (scale bar: 100 μm). B, RNAish signal was quantified in paired samples of skin cancer and adjacent normal skin across skin cancer sections collected from immunosuppressed (n=38) and immunocompetent patients (n=32, skin cancer characteristics are listed in Table 3). C and D, Representative flow plot (C) and quantification of activated CD69+ and CD137+CD69+ cytotoxic T lymphocytes (D) isolated from human facial skin and used in peptide stimulation assays are shown. The percentage of CD8+ T cells in each quadrant is listed in the flow plot. T cells from eight facial skin samples (six males and two females) are used in this assay (mean age: 75 years, age range: 60-89 years). Note that the β-HPV peptide pool used in this assay is a collection of E7 peptides from five β-HPV types (HPV5, 8, 9, 20 and 38), with HPV16 representing a pool of HPV16 E7 peptides (Table 4). PMA / ionomycin stimulation is used as a positive control. Error bars represent the mean + SD; *p<0.05, **p<0.01, ns: not significant. [Figure 4A]Differential anatomical distribution of warts versus skin cancer in immunosuppressed and immunocompetent patients. A, Mapping warts from immunosuppressed patients and skin cancers from immunosuppressed and immunocompetent patients. Note that the localization of skin cancers in immunocompetent and immunosuppressed patients closely match each other and are almost entirely restricted to areas of chronic sun damage (CSD) > intermittent sun damage (ISD) of the skin. Warts show an anatomical preference away from sun exposure. B, Graph showing anatomical distribution. [Figure 4B] As mentioned above. [Figure 5A-B] T cell-deficient mice infected with MmuPV1 in the dorsal skin demonstrate a confluent pattern of wart development. A, Significant wart burden in CD4- / -;CD8- / - mice (right) compared to no warts in Wt mice (left) following MmuPV1 infection of the dorsal / back skin (10 weeks post-infection; scale bar: 1 cm). B, MmuPV1-induced warts in CD4- / -;CD8- / - mice stained with H&E (left), MmuPV1 L2 RNAish (middle) and negative control RNAish probes (right; scale bar: 1 mm). [Figure 6A-B]MmuPV1 DNA was detected in all skin samples biopsied throughout the dorsal skin of Wt animals after MmuPV1 infection, indicating viral colonization. A, Representative images of the dorsal skin of a C57BL / 6J mouse on the day of MmuPV1 infection and 21 days post-infection are shown. Positive PCR bands in all corresponding sections of skin are shown. Also shown is a typical C57BL / 6J mouse 5 weeks post-infection with no evidence of skin warts. B, Representative images demonstrate the dorsal skin of an FVB mouse on the day of infection and 31 days post-infection. Positive bands in all corresponding sections of skin are shown. PCR bands for MmuPV1 are marked by arrows (PCR amplicon size: 339 bp). C, Left, Representative images of the dorsal skin of a wild-type C57BL / 6J mouse on the day of MmuPV1 infection and 21 days post-infection. Center, L1 PCR of MmuPV1 in 20 segments of dorsal skin. The L1 PCR band of MmuPV1 is marked by an arrow; PCR amplicon size: 339 bp. PCR primers, forward: GAGCTCTTTGTTACTGTTGTC (SEQ ID NO: 1); reverse: ATCCTCTCTTTCCTTGGGC (SEQ ID NO: 2). M, molecular weight size marker; N, negative control; P1-P3, positive controls. Right, typical wild-type C57BL / 6J mouse 5 weeks after infection, highlighting the absence of warts, which was the case for 100% of mice. Scale bar: 1 cm. [Figure 6C] As mentioned above. [Figure 7A-C] Memory T cells transferred from Wt MmuPV1-colonized mice to T cell-deficient mice reduce wart burden upon MmuPV1 infection but have no effect on SCC cell lines growing in T cell recipient animals. A, Schematic of T cell transfer experiment. B, Representative images of warts in the back skin of mice 3 weeks after MmuPV1 infection are shown. Flow cytometry demonstrates the presence of CD4+ and CD8+ T cells in the peripheral blood of recipient mice, indicating successful adoptive T cell transfer. C, Growth of subcutaneously injected SCC cells is monitored in Wt, CD4- / -;CD8- / - and CD4- / -;CD8- / - mice that received T cells from MmuPV1-immunized donors. [Figure 8A-E]Evidence of viral colonization and T cell homing to the epithelium of MmuPV1-infected mice is seen at the end of the chemical carcinogenesis protocol. A and B, PCR for MmuPV1 L1 is used to detect viral DNA isolated from skin of (A) C57BL / 6J(B6) and (B) FVB mice >6 months after infection. C and D, Anti-MmuPV1 seroconversion is assessed in DMBA-TPA-treated cohorts of (C) C57BL / 6J and (D) FVB mice. (E), Representative images of CD3 / CD45 stained skin from MmuPV1 / DMBA-TPA FVB mice compared to sham / DMBA-TPA controls at the end of the chemical carcinogenesis protocol. Arrows indicate T cells in the epidermis; dashed line highlights epidermal basement membrane. (F), CD45+ leukocytes were quantified in skin sections of MmuPV1 / DMBA-TPA and sham / DMBA-TPA FVB mice across 10 randomly selected HPF images of normal skin per mouse and averaged across mice in each group (two-tailed unpaired T-test; n=8 per group). Each dot represents leukocyte counts in one high-magnification image. g, h, Homing of T cells to the epidermis in MmuPV1 / DMBA-TPA skin compared to sham DMBA-TPA control skin of wild-type FVB mice. (G), Representative images of CD8 / CD3- and CD4 / CD3-stained skin sections. Arrows indicate epidermal CD8+TRM cells; dashed line highlights epidermal basement membrane. (H), Ratio of epidermal CD8+TRM and CD4+TRM cells to total CD3+T cells in skin per HPF image (two-tailed unpaired T-test). T cells were counted in up to 10 randomly selected HPF images of normal skin per mouse. Each dot represents one high magnification image. n=10 (MmuPV1 / DMBA-TPA); n=9 (sham / DMBA-TPA). (I) Representative skin tumors from MmuPV1 / DMBA-TPA and sham / DMBA-TPA wild-type FVB mice stained with keratin 6 (K6; a marker for epidermal hyperplasia) and Ki67 (a proliferation marker). The dashed line highlights the epidermal basement membrane in the skin.(J), PCR amplification of wild-type (A) and mutant (T) regions of the Hras gene in DNA from MmuPV1 / DMBA-TPA and mock / DMBA-TPA tumors and skin, and untreated skin from wild-type FVB mice (band size, 110 bp). An A to T mutation in Hras codon 61 highlights DMBA-TPA-induced skin tumors in MmuPV1 / DMBA-TPA and mock / DMBA-TPA wild-type FVB cohorts. Scale bar: 100 μm, error bars represent mean + SD; *p<0.05, **p<0.01, ***p<0.0001, ns: not significant. [Figure 8F] As mentioned above. [Figure 8G] As mentioned above. [Figure 8H] As mentioned above. [Figure 8I] As mentioned above. [Figure 8J] As mentioned above. [Figure 9]Carcinogen-induced skin tumors in mice lack viral activity seen in warts. H&E and MmuPV1 RNAish images of warts from MmuPV1-infected CD4- / -;CD8- / - mice, skin tumors from MmuPV1-colonized DMBA-TPA-treated Wt mice, and normal skin are shown. Note the dense RNAish signal in the warts from T cell-deficient mice. After termination of DMBA-TPA treatment, positive MmuPV1 RNAish signal is detected in normal skin of Wt mice. There is minimal MmuPV1 RNAish signal in skin tumors from the same mice. [Figure S7A-B] MmuPV1 RNAish of MmuPV1-infected mice reveals active virus in both immunized and non-immunized mice. A, Representative images of SKH-1 mice with no evidence of disease after infection (immunized), and mice with visible warts after infection of the dorsal skin (non-immunized) are shown (scale bar: 1 cm). B, RNAish of viral L2 protein in skin from immunized and non-immunized mice harvested 3 weeks after MmuPV1 infection shows abundant viral activity in normal skin and in MmuPV1-induced warts. Insets highlight areas of active virus in normal skin of immunized mice, and in warts of non-immunized mice (scale bar: 100 μm). [Figure 10A-B]Immunization of MmuPV1-infected SKH-1 mice with MmuPV1 vaccine protects against UV-induced carcinogenesis. A, Top, Representative images of SKH-1 mice with no evidence of disease after infection (immune) and SKH-1 mice with visible warts after infection of the back skin with MmuPV1 (non-immune). Bottom, RNA ISH of MmuPV1 L2 on skin from immunized and non-immunized mice collected 3 weeks after infection with MmuPV1 to detect viral activity in normal skin and MmuPV1-induced warts. Insets highlight active virus in normal skin of immunized mice, and in warts of non-immunized mice. B, Macroscopic images of SKH-1 mice 3 months after infection of the back skin with MmuPV1. SKH-1 mice with spontaneous immunity to the virus (no warts) were treated once with an immunosuppressive dose of UVB (300 mJ cm-2); images of mice 3 weeks after UV treatment are shown. Arrows point to newly developed warts in UV-treated skin. C, Histological images of warts (circles) stained with H&E and MmuPV1 RNA ISH. Magnified insets highlight MmuPV1-induced cytotoxic changes in the H&E images and confluent positive MmuPV1 RNA ISH signals in the warts. D, Macroscopic images of MmuPV1-infected SKH-1 mice that continue to bear warts (arrows) before MmuPV1 vaccination, 4 weeks after vaccination, and at the end of the UV carcinogenesis protocol. Nine wart-bearing mice were treated intraperitoneally with MmuPV1 live viral particles three times over a 2-week period. After 4 weeks, mice were subjected to the UV carcinogenesis protocol. Mice with acquired antiviral immunity (n=5) are compared to non-immunized mice with persistent warts (n=4). E, Skin tumor burden in vaccinated immunized mice (n=5) and non-immunized mice (n=4) treated with the UV carcinogenesis protocol. In mice with a confluent pattern of skin tumors, counts represent individual lesions before their coalescence. Two-tailed Mann-Whitney U test; data are mean ± sd. F, Representative images of CD3 / CD45 stained skin from MmuPV1 / DMBA-UV SKH-1 mice compared with sham / DMBA-UV controls at the end of the UV carcinogenesis protocol. Arrows indicate T cells in the epidermis; dashed line highlights the epidermal basement membrane.G-I, Skin-infiltrating total CD45+ leukocytes (G), CD3+CD45+ T cells (H) and CD3-CD45+ leukocytes (I) quantified in CD3 / CD45 stained skin sections of MmuPV1 / DMBA-UV (n=10) and sham / DMBA-UV (n=9) SKH-1 mice across 10 randomly selected HPF images of each skin sample, as well as averaged across mice in each group. Each dot represents one high magnification image. Note the trend towards increased T cells and decreased CD3- inflammatory cells in MmuPV1 / DMBA-UV skin compared to sham / DMBA-UV controls. J, Representative image of CD3 / CD45 stained cells in skin tumors of MmuPV1 / DMBA-UV SKH-1 mice compared to sham / DMBA-UV controls at the end of the UV carcinogenesis protocol. Enlarged inset highlights immune cells in the tumor parenchyma. K-M, Tumor-infiltrating total CD45+ leukocytes (K), CD3+CD45+ T cells (L) and CD3-CD45+ leukocytes (M) quantified in CD3 / CD45 stained sections of MmuPV1 / DMBA-UV and sham / DMBA-UV SKH-1 mice across HPF images of each tumor and averaged across mice in each group (n=12 early stage skin tumors per group). Each dot represents one high magnification image. Stained cells were counted blindly. Two-tailed unpaired T-test, data are mean+sd. (G-I, K-M). Scale bars, mice, 1 cm (A, B, D); tissue, 100 μm (A, C, F, J). [Figure 10C] As mentioned above. [Figure 10D] As mentioned above. [Figure 10E] As mentioned above. [Figure 10F-J] As mentioned above. [Figure 10K-M] As mentioned above. [Figure 11A]CD8+ T cell immunity is required to protect MmuPV1-colonized mice from UV carcinogenesis, and MmuPV1 colonization protects Xpc- / - mice from UV carcinogenesis. A, Representative images of CD8+ T cells in skin tumors of MmuPV1 / DMBA-UV SKH-1 mice compared to sham / DMBA-UV controls at the end of the UV carcinogenesis protocol. Magnified insets highlight T cells in the tumor parenchyma. B-D, Tumor-infiltrating CD3+ (B), CD8+ (C), and CD4+ (D) T cells quantified in CD8 / CD3- and CD4 / CD3-stained tumors of MmuPV1 / DMBA-UV and sham / DMBA-UV SKH-1 mice across HPF images of each tumor, as well as averaged across mice in each group (n=12 early skin tumors per group). Each dot represents one high magnification image. e, f, CD4+ T cell infiltration in MmuPV1 / DMBA-UV and mock / DMBA-UV SKH-1 skin. E, Representative images of CD4 / CD3 stained skin sections. Arrows represent epidermal CD4+ TRM cells; dashed lines highlight epidermal basement membrane. F, Quantification of CD4+ T cells per high-magnification image of skin. Ten randomly selected HPF images of skin per mouse in each group are included. Each dot represents one high-magnification image. n=10 (MmuPV1 / DMBA-UV); n=9 (sham / DMBA-UV). Two-tailed unpaired T-test, data are mean+sd. (B–D, F). G, Schematic representation of anti-CD8 or IgG antibody treatment combined with UV carcinogenesis protocol. Four weeks after MmuPV1 or mock (VLP) infection, mice began treatment with anti-CD8 or IgG isotype control antibodies (arrows). One day after the first treatment with antibody, the dorsal skin of SKH-1 mice was treated once with 50 μg DMBA (dark gray triangles). Seven days later, mice started UVB treatment (100 mJ cm-2) three times a week (light gray triangles). H, Flow cytometric analysis of spleen and skin of MmuPV1 / DMBA-UV mice treated with anti-CD8 or IgG antibodies to evaluate the efficiency of CD8+ T cell depletion 6 weeks after treatment with DMBA. The percentage of CD8+ T cells is shown in each plot.I, Skin tumor burden in MmuPV1-colonized mice treated with IgG control (MmuPV1+IgG; n=10) or anti-CD8 antibody (MmuPV1+anti-CD8; n=10), and mock (VLP)-infected mice treated with IgG control (sham (VLP)+IgG; n=7) or anti-CD8 antibody (sham (VLP)+anti-CD8; n=7) after DMBA-UV treatment. Two-tailed Mann-Whitney U test; *P<0.05, NS, not significant. Data are mean ± sd. J, Representative images of mice in the four treatment groups. Due to large skin tumors in MmuPV1-colonized CD8+ T cell-depleted mice, the UV carcinogenesis study was terminated 18 weeks after DMBA treatment. K, L, XPC- / - (XPCKO) mice were infected with MmuPV1 (n=15) or mock-infected (n=13) in their dorsal skin and subjected to the UV carcinogenesis protocol. Skin tumor results are shown as time to development of first skin tumor (K) and time to development of first invasive skin cancer (L) (log-rank test). Note that all Xpc- / - mice in the study were immune to MmuPV1 (i.e., did not develop warts). M, Representative images of Xpc- / - mice at the end of the 30-week UV carcinogenesis protocol. Premalignant tumors (papillomas) and invasive skin cancers are highlighted with yellow and red circles, respectively. Mice were shaved for UV treatment and visualization of skin tumors. N, Representative H&E stained histological images of papillomas and invasive skin cancers in MmuPV1 / DMBA-UV in sham / DMBA-UV Xpc- / - mice. Insets show cellular atypia in sham / DMBA-UV skin cancers (scale bar, 50 μm). Stained cells were counted blindly. Scale bars, mouse, 1 cm (j, m); tissue, 100 μm (a, e, n). [Figure 11B-G] As mentioned above. [Figure 11H-J] As mentioned above. [Figure 11K] As mentioned above. [Fig. 11M-N] As mentioned above. [Figure 12A-E]DMBA-UV-induced epidermal dysplasia in uninfected SKH-1 mice is blocked in MmuPV1-colonized animals. A, Representative low- and high-magnification images of MmuPV1-colonized and uninfected SKH-1 skin following completion of the DMBA-UV carcinogenesis protocol are shown. Note the significant hyperplasia and dyskeratinization in uninfected SKH-1 skin in the absence of MmuPV1-colonized skin. B, Epidermal thickness is quantified across 10 randomly selected images of skin from SKH-1 mice in the MmuPV1 / DMBA-UV and - / DMBA-UV cohorts. C and D, CD4+ T cell infiltration in MmuPV1-colonized and uninfected SKH-1 skin is shown by (c) representative images of CD4 / CD3-stained skin sections, and (d) quantification of CD4+ T cells per high-magnification image of skin. Ten random high-magnification images of skin from each mouse in each group are included in this graph. E, PCR of MmuPV1 on skin DNA samples is used to determine MmuPV1 skin colonization at the end of DMBA-UV treatment. Arrows point to the PCR product of MmuPV1 (size: 339 bp). Scale bar: 100 μm, error bars represent mean + SD; ***p<0.001, ns: not significant. [Figure 13] Common binding sites for RNAish and DNAish probes in human studies are shown using the HPV9 genome as an example. [Figure 14A-B]β-HPV RNAish is validated with a positive control (wart) and quantitative real-time PCR (qRT-PCR) in RNAish positive and negative human samples. A, H&E and RNAish staining of a wart from a 63 year old immunosuppressed woman is shown. Note the absence of positive signal (red dots) throughout the wart. B, β-HPV RNAish of a skin cancer from an 87 year old immunosuppressed woman is shown, including staining of positive and negative control probes. Detection of β-HPV by RNAish correlates with qRT-PCR positivity for HPV5 and 9 E6 protein transcripts in the same skin cancer. Normal skin from an 18 year old immunocompetent African American woman is stained with a β-HPV RNAish probe. The lack of RNAish signal (red) in this sample correlates with undetectable HPV5, 9 or 15 E6 protein transcripts in qRT-PCR of the same sample. Scale bar: 100 μm. [Figure 15A-C] Immunosuppressed patients have higher β-HPV viral activity in their skin lesions compared to immunocompetent patients. A, β-HPV RNAish signal counts are compared between skin cancer cells of immunosuppressed (n=38) and immunocompetent patients (n=32). B, Clinical images of skin cancer surgical sites show the skin cancer (red arrow), its adjacent normal skin (green arrow), and normal skin away from the cancer site (blue arrow). C, Quantification of β-HPV RNAish signal in high magnification images across immunosuppressed lesions, immunocompetent lesions, and normal facial skin away from the cancer site is shown in the graph. Skin lesions include β-HPV RNAish signal counts from skin cancer and adjacent normal skin images (dots corresponding to cancer images are colored maroon, dots for adjacent normal skin images are green). Thirty normal facial skin samples (blue dots) from immunocompetent patients are included in the study (18 males and 12 females, mean age: 71 years, range: 39-94 years). *p<0.05, **p<0.005, ns: not significant. [Figure 16A-B]β-HPV viral activity is significantly increased in basal keratinocytes of immunosuppressed patients. A, Representative low and high magnification images of normal skin samples of β-HPV RNAish staining from immunosuppressed and immunocompetent patients are shown. Note the density and size of the evident RNAish signal in basal keratinocytes of immunosuppressed patients. B, The density of β-HPV RNAish signal in basal keratinocytes is quantified across 38 immunosuppressed and 32 immunocompetent skin samples. Scale bar: 50 μm, *p<0.05. [Figure 17] We use β-HPV DNA in situ hybridization (DNAish) to detect β-HPV viral load in skin. Compared to β-HPV RNAish, which marks viral transcripts, β-HPV DNAish is a novel tool to detect viral load at subcellular resolution in skin keratinocytes. [Figure 18A-C] β-HPV viral load is significantly reduced in skin cancer cells compared to their adjacent normal skin in immunocompetent patients. A, Representative DNAish of warts, hypertrophic actinic keratosis associated with warts (HAK in warts), and SCC in immunosuppressed and immunocompetent patients. B and C, Quantification of DNAish signal of β-HPV in paired samples of skin cancer and adjacent normal skin from (B) immunosuppressed patients (n=10) and (C) immunocompetent patients (n=10) are represented as graphs. Scale bar: 100 μm, *p<0.05, **p<0.01. [Figure 19A-C]Compared to immunocompetent patients, there are significantly fewer T cells and TRM cells infiltrating skin cancer and adjacent normal skin in immunosuppressed patients. A, Representative images of CD3 / CD103 stained SCC from immunosuppressed and immunocompetent patients (the same cancers are shown for β-HPV RNA ISH and DNA ISH staining in Fig. 3A and Fig. 18A). Enlarged inset highlights CD103+ TRM cells in the cancer and adjacent normal skin. Scale bar, 100 μm. B, C, CD3 / CD8 / CD103 stained sections of skin cancer were used to quantify tumor-infiltrating CD3+ T cells, CD103+ CD3+ TRM cells, CD8+ T cells, and CD103+ CD8+ TRM cells in the skin cancer parenchyma (b), and in adjacent normal skin of immunosuppressed (S) versus immunocompetent (C) patients. Note that most T cells in normal skin reside in the dermis. Stained cells were blindly counted in 10 randomly selected HPF images of skin cancer and adjacent normal skin from each tissue section and averaged across samples in each group; including 37 immunosuppressed and 32 immunocompetent samples of skin cancer (skin cancer characteristics are listed in Table 3). Each dot represents the average T cell count in the high magnification image from each sample. Two-tailed unpaired T-test, data are mean + sd. D, Cytotoxic degranulation of CD8+ T lymphocytes after exposure to β-HPV peptides. T cells isolated from normal facial skin of an adult were exposed to β-HPV E7 peptide (far left), HPV16 E7 peptide (middle left), PMA / ionomycin (positive control; middle right) and vehicle (negative control; far right). Representative flow cytometry plots are shown. The percentage of CD107a+CD8+ T cells is shown in each plot. Data represent two independent sets of experiments with similar results. [Figure 19D] As mentioned above. [Figure 20A]DAMP molecules are upregulated during wart and skin cancer development. A, Principal component analysis (PCA) of gene expression profiles obtained from MmuPV1-induced warts (n=4; blue triangles), MmuPV1-infected skin (n=4; pink squares) or mock-infected skin (n=4; grey circles), and MmuPV1-infected tumors (n=4; red squares) or mock-infected tumors (n=4; black circles) of SKH-1 mice. Note that DMBA-UV-induced skin tumors from MmuPV1-infected mice are indistinguishable from skin tumors from mock-infected mice, but both have very distinct transcriptional profiles compared to MmuPV1-induced warts. B, C, Volcano plots of differentially expressed genes in MmuPV1 vs. mock-infected skin (b; n=4 per group), and in skin tumors and warts (n=12) vs. MmuPV1 and mock-infected skin (c; n=8). Gm5416 is also known as Csta3. P values were calculated using the DESeq2 R package (v.2.1.6.3) and the resulting P values were adjusted using the Benjamini-Hochberg method to control the false discovery rate. 20 genes upregulated in skin tumors and warts compared to MmuPV1 and mock-infected skin are shown in the table on the left. D-F, Analysis of immune gene expression in human skin lesions based on mouse RNA-seq data. D, Representative macroscopic and H&E stained histological images of SCC, wart, seborrheic keratosis (SK) and unaffected human skin. Scale bar, 500 μm. E, Relative gene expression in SCC (n=7) and warts (n=5) compared to normal skin (n=8). F, Normalized relative gene expression in SCC (n=7), warts (n=5) and seborrheic keratosis (n=5) compared for several DAMP genes. The average relative gene expression in normal skin was used for normalization. GAPDH is used as the reference gene. Two-tailed Mann-Whitney U test; *p<0.05, **p<0.01, NS, not significant; data are mean+sd (e, f). [Figure 20B] As mentioned above. [Figure 20C] As mentioned above. [Figure 20D] As mentioned above. [Figure 20E] As mentioned above. [Figure 20F] As mentioned above. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0017] In particular, low-risk beta (β) human papillomaviruses (HPVs) are It has been found in more than 80% of SCCs 2~5 Hence the possibility of skin cancer A viral cause has been proposed 14 β-HPV is the cause of benign persistent warts. It is present, together with other dermatotropic low-risk HPV species, in immunocompetent adults as a normal bacterial cyst. Ubiquitous in the skin 3、4、15、16 In contrast to high-risk α-HPV, cutaneous No major β-HPV subtypes have been identified in cancer 14 , β-HPV genome is Rarely integrated into the DNA of cancer cells 5 In addition, transcriptome analysis has We simultaneously examined papillomavirus gene expression in SCCs from immunocompetent and immunosuppressed patients. Not determined 4 In skin cancers positive for β-HPV, the virus in tumor cells The load is less than one copy per cell. 14 In addition, actinic keratosis (a precursor to SCC) The prevalence of β-HPV DNA in cytoplasmic leukemia (CL) was higher than in SCC in immunocompetent patients, HPV is mostly found in the superficial layers of skin cancer, not in the basal proliferative regions. 17、18 .child These findings are a "hit and run" approach to explain the role of HPV in skin carcinogenesis. "The theory is that the virus promotes the initiation of skin cancer but then plays a role in tumor maintenance. Lost in Between 5、19 .
[0018] The findings reported herein implicate commensal HPV in the development of non-melanoma skin cancer. Clinical studies reveal novel roles of immunosuppression in the anatomical distribution of skin cancer. demonstrated that the sclerotinib had no effect on the sclerotinib concentration, which is closely related to the area of greatest sun damage. HPV-induced warts include most sun-damaged and sun-damaged skin. Differential localization of skin cancer away from light-protected skin suggests that commensal HPV may be a risk factor for immunosuppressed patients These results suggest that UV radiation alone or in combination with UV does not initiate skin cancer in humans. The MmuPV1 colonization model allows the expression of papillomaviruses and Using this model, we have demonstrated that Mmu PV1-colonized immunocompetent mice were shown to be more susceptible to chemical and Furthermore, we show that the IL-16 expression level in 10 mice is associated with increased IL-16 expression and protection from UV-induced skin cancer. T cell immunity protects MmuPV1-colonized mice from carcinogen-induced skin tumors Finally, we demonstrate that viral R Our innovative approach to NA and DNA detection identifies antiviral T cells in the skin β-HPV virus in malignant keratinocytes evades cellular immunity and forms cancer Reveal negative selection for activity and loading.
[0019] These findings provide a novel explanation for the role of low-risk commensal HPV in the development of skin cancer. Supporting the extremely low prevalence of warts in immunocompetent adults 24 HPV-infected proliferating cells It emphasizes the ability of a functional immune system to target and eliminate HPV. Similarly, anti-HPV immunity may help prevent warts. Symbiosis in pre-cancerous cells that share antigenic / immunogenic properties and are effectively eliminated Recognition of HPV stops the development of skin cancer. This protective immunity is not seen in immunosuppressed patients. This has led to a marked increase in skin cancer, warts and HPV viral load in this population. Thus, the increased risk of skin cancer in immunosuppressed individuals is likely due to HPV-induced It represents a loss of protective antiviral immunity rather than an increased susceptibility to skin cancer. vinegar.
[0020] The different anatomical distribution of skin cancers and warts may explain the risk of skin cancer in immunosuppressed patients. These findings point to UV exposure as the primary determinant. SCC transcriptomes, demonstrating indistinguishable patterns of maturation genes in patient SCCs. Supported by scriptome analysis 25 Coexisting HPV mutations play a significant role in the development of SCC When demonstrating a virulent contribution, immunosuppressed patients had fewer UV-induced mutations and / or This is expected to result in a distinct pattern of genes in the skin. It is completely resistant to high-risk oncogenic viruses such as mouse cell polyomavirus (MCPyV). This is in contrast to the highly mutated MCPyV-negative Merkel cells induced by UV. causes Merkel cell carcinoma with a lower mutational burden compared to Merkel cell carcinoma 26、27 These The observations, together with the low HPV load and lack of its transcriptional activity in skin cancer, 4、14 , This provides ample evidence that the contribution of commensal HPV to the development of skin cancer is negligible.
[0021] Experimental studies on MmuPV1 in Wt mice reveal that it is a cutaneous infection in immunocompetent hosts. Demonstrating a protective role of commensal papillomaviruses against cancer. MmuPV1-induced warts Suppression of IL-1 has been shown to be T cell mediated. 22、28 Here, we consider the virus Specific T cells protect MmuPV1-colonized mice from carcinogen-induced skin cancer Interestingly, MmuPV1 colonization SK H-1 mice were also protected from UV-induced epidermal dysplasia, which is thought to be due to the highly modified solar These results suggest a role for commensal HPV in maintaining homeostasis in injured human skin. obtain 29 Previous studies in animal models of HPV skin infection have shown that HPV is a driver of skin cancer. He has implicated HPV as a causative agent of warts. Cell-autonomous growth effects of PV are evident 30 However, the E6 / 7 virus Use of animals with isolated transgenic expression of proteins 31 , immunodeficient mice 30 , or immunosuppressive doses of UV 23、32、33 due to the lack of a physiological immune response. Published studies to fully investigate the role of low-risk commensal papillomaviruses in skin carcinogenesis These studies have hindered translational research into the role of the virome in human disease. The importance of using intact infectious virus and antiviral immune responses to reach critical conclusions Emphasize.
[0022] CD8 to β-HPV peptides in normal adult skin + Evidence of T cell responsiveness This supports a role for HPV-specific adaptive immune responses to normal bacterial pockets in the skin. Without wishing to be bound by theory, β-HPV activity in skin cancer compared to normal skin Together with the loss of β-HPV and viral load, commensal β-HPV mediates the proliferation of aberrantly dividing keratinocytes. They are believed to function as immunogenic tags in the detection of viruses that contain active viruses. It is involved in the cytotoxic T cell response against any proliferative lesion caused by inflammatory cells. Therefore, a T cell-based vaccine against β-HPV could potentially stimulate antiviral immunity in the skin. This could provide an innovative approach to boosting high-risk populations, particularly pre-transcriptional In OTR, it may help prevent warts and skin cancer. Recent B cell-based HPV vaccine blocks infection of epithelial cells by high-risk alpha HPVs 3 4 In contrast, the goal of the beta-HPV vaccine is to prevent the development of warts and skin cancer. In addition, by enhancing cell-mediated antiviral immunity in the colonized skin, The aim is to take advantage of the beneficial effects of HPV colonization. Unlike peptides from PV 3、4、15、16 The high-risk HPV16 peptide is did not induce any response from T cells present in the skin, which may play a role in orchestrating antitumor immune responses. The importance of commensal HPV in skin cancer and the use of this immunity for the prevention and treatment of skin cancer. Based on these data, we now propose that commensal viruses Drugs that may help protect our immune system against cancer development, even in immunocompetent populations I understood that it was.
[0023] In summary, we are on alert for cytotoxic immunity against any proliferative lesions in the skin. By taking advantage of the new and advantageous role of commensal HPV in protecting the skin against cancer, Given the emergence of diverse viromes in the skin, 35 , immunocompetent individuals and to identify the composition of viral communities present on the skin in immunosuppressed individuals; and To determine how these viruses contribute to human health and disease is important.
[0024] T cell-based vaccine against beta-HPV Cancer-causing viruses such as high-risk alpha-HPV (α-HPV) Current vaccines against HIV first induce viral infection in target tissues (e.g., the cervix). It is designed to activate B cells, which leads to the production of antiviral antibodies that prevent infection. However, we have recently demonstrated that HIV-1 virions colonize target tissues immediately after birth in all individuals. (e.g. low-risk beta-type HPV colonization of the skin) Commensal viruses may Induce antiviral T cell immunity capable of eliminating any proliferative lesions, including viruses. and thus play a protective role against cancers caused by carcinogens (e.g., skin cancer). In other words, they found that it can help prevent warts (skin lesions caused by HPV). In adult individuals who are immune to HPV, HPV infection acts as a tag in skin cells, warts caused by HPV or skin cancer caused by carcinogens In any of these settings, T cells are put on alert as soon as cells begin to proliferate abnormally. Therefore, the boost in T cell immunity by T cell-directed vaccines is likely to be due to the increased immunity of the target tissue. This enhances the protective effect of commensal viruses without eliminating their dormant colonization. As used herein, the antibodies used to induce a T cell-based immune response against β-HPV are The composition can be used to treat skin cancer, thereby reducing the risk of the subject developing skin cancer. It does not prevent or eliminate infection, but rather suppresses the virus present in all cells. Boosting T cell detection and elimination of early cancer clones using To achieve this, vaccines are designed to induce T cell immunity against commensal viruses that already infect tissues. Current high-risk HPV vaccines for the prevention of cervical and head and neck cancers include: This means preventing infection in the first place, and minimally in individuals already infected with the virus. It has the effectiveness.
[0025] Antigenic peptides In some embodiments, the composition comprises a commensal human papillomavirus, such as Low-risk dermatotropic α-HPV, β-HPV, γ-HPV, and and / or proteins from μ-HPV strains, e.g., E1, E2, E6 or E7 proteins derived from a protein (i.e., containing consecutive amino acids derived therefrom, i.e., fragments ) a plurality of antigenic peptides. In some embodiments, the composition comprises a cancer-associated HPV types, e.g., peptides derived from high-risk HPVs such as HPV16 or 18 See, for example, Ma et al., J Virol. 2014 May 2014, incorporated herein by reference. ; 88(9): 4786-4797;Doorbar et al., Rev Med Virol. 2015 Mar; 25(Suppl Suppl 1): 2-23;Doorbar et al., The biology and life-cycle of human papillomaviruses. cine 2012; 30(Suppl 5): F55-F70; de Villiers, Virology 2013; 445(1-2): 2-10; See U.S. Pat. No. 8,652,482. Other commensal HPV types may be used; Table A is illustrative but not exhaustive. Here is a list.
[0026] [Table 1-1]
[0027] [Table 1-2]
[0028] The peptides can be derived from any antigenic protein in the virus, and some In embodiments, the peptide is derived from an E1, E2, E4, E5, E6, or E7 protein. Sequences for these proteins from many symbiotic strains have been provided. In some embodiments, the number of stimulants is at least 50, 100, 150, 200, 250, 3 00, 350, 400, 450, 500 or more different peptides (i.e. In some embodiments, peptides having different sequences are included in the composition. At least 50, 100, 150, 200, 250, or more of each virus strain Composition of 300, 350, 400, 450, 500 or more different peptides The peptides are derived from two or more viral strains.
[0029] In some embodiments, the peptides are optimized for MHC1 / MHCII presentation. length, e.g., 9-30 amino acids, e.g., 12-25, 12-18, 12-16 , 13-16, 14-16 or 15 amino acids. Bioinformatically identified and / or encompasses the entire protein to predict Synthetic long overlapping peptides generated using a moving window of overlapping peptides, e.g. For example, it may be a 15 amino acid peptide with a 10 amino acid overlap (optimal antisense (Similar to the "gene walk" method used to identify oligonucleotides.) In some embodiments, overlapping synthetic long peptides (SLPs) are used (Zom et al. I., Cancer Immunol Res. 2014 Aug;2(8):756-64). The composition may comprise one or more (e.g. The peptide may include multiple peptides derived from different (e.g., multiple) viral strains. is preferably a synthetic peptide, and methods for synthesizing peptides are known in the art. These techniques are well known and include liquid phase techniques and solid phase peptide synthesis (SPPS). Petrou and Sarigiannis, Ch. 1 - Peptide synthesis: Methods, trends, and challenge es, In: Editor(s): Sotirios Koutsopoulos, Peptide Applications in Biomedicine, B iotechnology and Bioengineering, Woodhead Publishing, 2018, pages 1-21; and Ch See Andrudu et al., Molecules 2013, 18, 4373-4388.
[0030] Antigen Protein In some embodiments, the composition comprises a plurality of proteins, e.g., those listed in Table A. Commensal human papillomaviruses, such as low-risk α-HPV, β-HPV, E1, E2, E6, or E7 proteins from HPV, γ-HPV, and / or μ-HPV strains The protein may include a virus-like particle containing the protein (see, for example, Yang et al., Virus Res. 231, 148-165 (2017);Hancock et al., Therapeutic HPV vaccines. Best Pract Res C lin Obstet Gynaecol 47, 59-72 (Feb. 2018);Joh et al., Exp Mol Pathol.;93(3):416 -21 (2012)).
[0031] Nucleic Acid-Based Vaccines In some embodiments, the composition comprises a probiotic human parasite, such as those listed in Table A. HPVs, e.g. low-risk alpha-HPV, beta-HPV, gamma-HPV and / or or a protein from a μ-HPV strain, such as the E1, E2, E6 or E7 protein A protein derived from (i.e., a sequence of consecutive amino acids derived therefrom, i.e., including a fragment thereof) Multiple DNA plasmids containing nucleotide sequences expressing proteins or antigenic peptides Virus R can include a vector and / or an RNA replicon (e.g., Yang et al., Virus R es 231, 148-165 (2017);Hancock et al., Therapeutic HPV vaccines. Best Pract Res (See Clin Obstet Gynaecol 47, 59-72 (2018)).
[0032] Live Vector-Based Vaccines In some embodiments, the composition comprises a probiotic human parasite, such as those listed in Table A. HPVs, e.g. low-risk alpha-HPV, beta-HPV, gamma-HPV and / or or a protein from a μ-HPV strain, such as the E1, E2, E6 or E7 protein A protein derived from (i.e., a sequence of consecutive amino acids derived therefrom, i.e., including a fragment thereof) The vectors may include multiple viral vectors engineered to express a protein or antigenic peptide. (e.g., Yang et al., Virus Res 231, 148-165 (2017); Hancock et al., Therapeutic HPV vaccines. Best Pract Res Clin Obstet Gynaecol 47, 59-72 (2018) Please refer to.
[0033] Viral vectors for use in the present methods and compositions include recombinant retroviruses. Viruses, adenoviruses, adeno-associated viruses, alphaviruses and lentiviruses Examples include:
[0034] A preferred viral vector system useful for delivery of nucleic acids in the present methods is the adeno-associated viral vector system. AAV is a small, non-enveloped virus with a capsid of 25 nm. Viruses known or shown to be related to the wild-type virus No disease. AAV has a single-stranded DNA (ssDNA) genome. AAV is a long-term They have been shown to exhibit episomal transgene expression and AAVs have been shown to be capable of infecting multiple tissues, including the brain. In particular, we have demonstrated excellent transgene expression in neurons. The vector containing the AV can be packaged and can integrate. The space for sex DNA is limited to about 4.7 kb. Tratschin et al., Mol. Cell. Biology 5:3251-3260 (1985) to produce DNA. A variety of nucleic acids can be introduced into cells using AAV vectors. (e.g., Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6 466-6470 (1984);Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985);Wondisfo rd et al., Mol. Endocrinol. 2:32-39 (1988);Tratschin et al., J. Virol. 51:611-6 19 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993). There are many alternative AAV variants (>100 cloned). AAV variants have been identified based on desirable properties. For example, AAV9 has It has been shown to efficiently cross the blood-brain barrier. In addition, the AAV capsid contains biotin. Transduction efficiency and other aspects of AAV vector development, including modified AAV vectors, directed molecular evolution, and self-complementary AAV genomes, are being investigated. In some embodiments, the genomic DNA can be engineered to increase selectivity and selectivity. In this study, AAV1 was used.
[0035] Alternatively, retroviral vectors and adeno-associated viral vectors can be used in vivo. can be used as a recombinant gene delivery system for the transfer of exogenous genes, particularly to humans. These vectors provide highly efficient delivery of genes into cells, and the transferred nucleic acid , which stably integrates into the host chromosomal DNA and produces only replication-defective retroviruses The development of specialized cell lines (called "packaging cells") has paved the way for the retroviral delivery of recombinant human genomic DNA for gene therapy. Increasing the utility of viruses, defective retroviruses have been used for gene transfer for gene therapy purposes. (For review, see Miller, Blood 76:271 (1990) (See, for example, ). Replication-defective retroviruses are unable to package into virions. This can be accomplished by infecting target cells with the use of a helper virus by standard techniques. It can be used to produce recombinant retroviruses and in vitro. Protocols for infecting cells with such viruses in vitro or in vivo are described in Ausu bel, et al., eds., Current Protocols in Molecular Biology, Greene Publishing Ass. ociates, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, etc., which are well known to those skilled in the art. Ecotropic and amphotropic retroviral systems include pWE and pEM. Examples of suitable packaging virus lines for preparing both the rovirus system include Ψ Crip, ΨCre, Ψ2 and ΨAm. Retroviruses are a family of viruses that transmit various genes. The gene can be introduced in vitro and / or in vivo into many different cell types, including epithelial cells. (e.g., Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464;Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018;Armentano et al. (1990) Proc. N atl. Acad. Sci. USA 87:6141-6145;Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043;Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381;Chow dhury et al. (1991) Science 254:1802-1805;van Beusechem et al. (1992) Proc. Nat l. Acad. Sci. USA 89:7640-7644;Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895;Hwu et al. (1993) J Immunol. 150:4104-4115; U.S. Pat. No. 4,868,116; U.S. Pat. 80,286; WO 89 / 07136; WO 89 / No. WO 89 / 05345; and WO 2006 / 02468; (See Brochure No. 92 / 07573).
[0036] Another viral gene delivery system useful in the present methods utilizes adenovirus-derived vectors. The adenoviral genome encodes and expresses a gene product of interest, but does not express the normal It can be engineered to be inactivated in terms of its ability to replicate in a lytic viral life cycle. For example, Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al. , Science 252:431-434 (1991); and Rosenfeld et al., Cell 68:143-155 (1992). Please refer to the adenovirus strain Ad type 5 dl324 or other strains of adenovirus (e.g. Suitable adenoviral vectors derived from Ad2, Ad3, Ad7, etc. are known to those skilled in the art. In certain circumstances, recombinant adenoviruses are capable of infecting non-dividing cells. and can be used to infect a wide range of cell types, including epithelial cells. (Rosenfeld et al., (1992), supra). are relatively stable, amenable to purification and concentration, and, as noted above, have a broad spectrum of infections. In addition, the introduced adenoviral DNA can be modified to affect (and the foreign DNA they contain) do not integrate into the genome of the host cell, Remain episomal, thereby allowing the introduced DNA to be integrated into the host genome (e.g., When integrated into retroviral DNA, it results in in situ insertional mutagenesis. This avoids potential problems that may occur when the adenovirus genome is used for foreign DNA. The carrying capacity of is large (up to 8 kilobases) compared to other gene delivery vectors (Berkner et al. al., supra; Haj-Ahmand and Graham, J. Virol. 57:267 (1986)).
[0037] Alphaviruses can also be used. Alphaviruses have a broad host range. It is an enveloped single-stranded RNA virus that is used in gene therapy protocols. When expressed, alphaviruses can provide high levels of transient gene expression Exemplary alphaviruses include Semliki Forest virus (SFV), Sindbis virus (SIN) and Venezuelan equine encephalitis (VEE), which All have been genetically engineered to provide highly efficient replication-deficient and responsive expression vectors. Alphaviruses exhibit significant neurotropism and therefore may be involved in the pathogenesis of CNS-related diseases. It is useful. For example, Lundstrom, Viruses. 2009 Jun; 1(1): 13-25; s. 2014 Jun;6(6): 2392-2415;Lundstrom, Curr Gene Ther. 2001 May;1(1):19-29;Ra See yner et al., Rev Med Virol. 2002 Sep-Oct;12(5):279-96.
[0038] Commensal HPV vaccine strategy A probiotic HPV vaccine strategy is being developed to prevent the development of cancer, as well as to treat actinic keratosis, inflammation, and psoriasis. Treat early stage SCC with active virus, including in situ SCC and early invasive SCC To optimally boost antiviral T cell immunity in the skin for the treatment of Provided herein are live and live-attenuated HPV vaccines for use in patients. To generate and grow live low-risk HPV in culture to generate cutins. Describe the platform.
[0039] This preventive cancer vaccine uses a "good" virus to prevent and treat skin cancer. It has the advantage of widespread colonization in the skin. It is the only T cell with proven efficacy. The vaccine strategy based on this is the use of a live attenuated varicella zoster virus vaccine to prevent shingles. : Zostavax (Sullivan et al., Current opinion in immunology. 2019;59:25-3 0. Epub 2019 / 04 / 11). In the case of Zostavax, the varicella zoster virus of the target virus Herpes is the cause of chicken pox and shingles, and therefore attenuated viruses are the most effective vaccines against chicken pox. Vaccines based on T cells against commensal HPV should be developed for species safety. The Chin strategy targets low-risk papillomaviruses, which are normal bacterial sacs in humans. Therefore, in addition to benign skin warts, only in adult individuals and in severely immunosuppressed patients There is no evidence that these viruses cause any serious illness. A pylomavirus vaccine is a vaccine that can efficiently infect cells and has a viral antiviral effect. The original peptide is expressed by T cells in the major histocompatibility complex (HMC) while evading neutralizing antibodies. Since it can be effectively delivered to the skin, it is an ideal platform for skin cancer prevention.
[0040] Live HPV vaccine: An in vitro culture system can be used to grow skin-tropic HPV. V can be obtained using known methods, for example, by isolating it from warts of adult immunosuppressed patients. Next, the purified virus (Kreider et al., Virology. 1990;177 (1):415-7) were cultured with human primary keratinocytes (low passage human foreskin keratinocytes rather than immortalized cell lines). Latinocytes (HKF) (Bienkowska-Haba et al., PLoS Pathog. 2018;14(3):e1006846 Epub 2018 / 03 / 02;Ozbun et al., Curr Protoc Microbiol. 2014;34:14B 3 1-8. Epub 2014 / 08 / 02;Anacker et al., Journal of visualized experiments : JoVE. 2012(60). Epub 2012 / 03 / 08))) into an organotypic raft culture model. The difficulty in transferring the HPV genome to the lining of the body is due to the fact that HPV binds to the basement membrane and keratinocytes. Preferentially binds to extracellular matrix (ECM) secreted by the endothelium in vivo and in vitro. This can be solved by using the ECM-to-cell infection method (Richards et al., 2003). t al., Viruses. 2014;6(12):4856-79). This was done by seeding cells onto the surface of collagen gel. Seed and then place this on a stainless steel grid to create an air-medium interface. The gel is then transferred to the culture medium. This potential allows for the use of live commensal HPV in our prophylactic cancer vaccines.
[0041] Live attenuated HPV vaccine: A live attenuated HPV vaccine is also available. Prevents Notch signaling that drives keratinocyte differentiation and cell cycle arrest (Tan et al., Proceedings of the National Academy of Science s of the United States of America. 2012;109(23):E1473-80. Epub 2012 / 05 / 024). Details Specifically, E6 binds to Mastermind-like (MA), a member of the Notch transcription complex. It binds to the C-terminal domain of the ML1 protein (ibid.), which is involved in keratinocyte differentiation. This allows the suppression of HPV infection, maintaining a favorable cellular environment for low-risk HPV replication and preventing the development of warts. As a result, the LXXLL domain of MAML-1 binds to the symbiotic HPV. Mutations in the gene encoding the E6 protein have been shown to render the virus safe for use in vaccines. This allows the development of toxic viruses. Protein E6 contains four zinc-binding domains. , each of which possesses two CxxC motifs (Nomine et al., Mol Cell. 2006; 21(5):665-78. Epub 2006 / 03 / 02). In detail, the N-terminal domain is involved in the binding of the E6 protein. It has been suggested that this is the site of attachment (Id.). In some embodiments, the virus contains E In the amino-terminal domain of the 6 protein, a CxxC motif is inserted into the Sxx- containing one or more mutations in the S motif to prevent binding to MAML-1 and in human tissues In fact, these specific A cysteine-to-serine mutation prevents zinc ion binding to the zinc-binding domain, This interferes with the protein's ability to bind.
[0042] HPV binds to the LXXLL consensus sequence of target proteins, such as MAML-1 It has also been shown that the virulence factor β-lactamase inhibitor ... In some embodiments, the virus contains an LXXLL binding motif. (see, e.g., Brimer et al., PLoS Pathog. 2017 Dec; 13(12): e1006781) ), e.g., the amino-terminal E6 zinc-binding domain and the carboxy-terminal zinc-binding domain (Vande Pol and Klingelhutz, Virology, 2013, 445(1-2):115-137) or 8S Contains one or more of the following mutations: 9A10T, I128T, or Δ146-151 (White et al., J Virol. 2012 Dec; 86(24): 13174-13186).
[0043] Commensal HPV clinical isolates are those that maintain their pathogenicity to cause the development of warts. They are attenuated as described above so that they can complete their entire life cycle without Prior to introducing the HPV clinical isolate into an in vitro culture system, the attenuated mutant is The desired mutations are generated using nucleotide-directed site-specific mutagenesis. The oligonucleotides were cloned into plasmids or bacterial artificial chromosomes (BACs). The HPV genome was introduced into the nucleosomes using an organotypic raft culture model, as previously described. (Meyers et al., Journal of Virology. 2002;76(10):47 23-33. Epub 2002 / 04 / 23). The recombinant viral genome was introduced into primary human keratinocytes. After transfection, the cells differentiate and grow in organotypic culture, which supports the entire HPV life cycle. Use the model to grow.
[0044] T cell adjuvants The composition may also include an adjuvant to increase T cell responses. et al., Vaccine (2012) 30:7541-6 and Swaminathan et al., Vaccine (2016) 34:110- For example, nanoparticles that enhance T cell responses can be included, as described in Ru. Panagioti et al., Front. Immunol., 16 February 2018; doi.org / 10.3389 / fimmu.2 Alternatively or additionally, poly-ICLC (carboxymethyl cellulose, polyinosinic acid-polycytidylic acid, and poly-L-lysine double-stranded RNA ), imiquimod, resiquimod (R-848), CpG oligodeoxynucleotides and Formulations (IC31, QB10), AS04 (3-O-desacyl-4'-monophosphoryl AS01 (aluminum salt formulated with MPL), AS02 (MPL and suppository NINQS-21), MPLA, STING agonists, other TLR agonists, Candida · Candida albicans skin test antigen (Candin), GM-CSF, F ms-like tyrosine kinase-3 ligand (Flt3L) and / or IFA (incomplete Adjuvants including Freund's adjuvant may also be used. In the form of topical imiquimod and / or topical imiquimod in combination with 5-fluorouracil topical 5-fluorouracil and / or topical calcipotriene (calcipotriol) For example, as described in Cunningham et al., J Clin Invest. 2017;127(1):106-116, Acts as an adjuvant for vaccines (this is common in these topical agents) (This is particularly applicable to subjects with precancerous skin lesions that are treated with d Willem, Journal for ImmunoTherapy of Cancer 4:56 (2016); Coffman et al., Immun ity. 2010 Oct 29; 33(4): 492-503;Martins et al., EBioMedicine 3:67-78, 2016; and Del Giudice, Seminars in Immunology, 2018, doi.org / 10.1016 / j.smim.2018.05.00 Please refer to 1.
[0045] composition A pharmaceutical composition typically includes a pharma- ceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a saline, solvent, dispersion, or mixture that is compatible with administration of a pharmaceutical agent. These include media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like.
[0046] A pharmaceutical composition is typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, intratumoral, intramuscular, or or subcutaneous administration.
[0047] Methods for formulating suitable pharmaceutical compositions are known in the art and are described, for example, in Remi ngton: The Science and Practice of Pharmacy, 21st ed., 2005; and Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY) For example, they can be used for parenteral, intradermal, intramuscular or subcutaneous application. The solutions or suspensions used may contain the following components: water for injection, saline solution, insoluble Volatile oils, polyethylene glycol, glycerin, propylene glycol or other synthetic A sterile diluent such as a solvent; an antibacterial agent such as benzyl alcohol or methylparaben; antioxidants such as benzoic acid or sodium bisulfite; buffers such as acetate, citrate or phosphate, and sodium chloride or is a drug for adjusting isotonicity such as dextrose. pH is adjusted by adding hydrochloric acid or sodium hydroxide. Parenteral preparations can be formulated with acids or bases such as ammonium chloride. Made of plastic and enclosed in ampoules, disposable syringes or multi-dose vials It is possible.
[0048] Pharmaceutical compositions suitable for injectable use may be prepared in sterile aqueous solutions (where water soluble), or in sterile It can include dispersions and sterile powders for the extemporaneous preparation of injection solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL (trade name), (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS) In all cases, the compositions must be sterile and easily accessible. It must be liquid enough to be syringable. This is because, under the conditions of manufacture and storage, It must be stable at room temperature and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier may be, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol), and their preferred The mixture may be a solvent or dispersion medium. Suitable fluidity may be, for example, lecithin, Maintaining the required particle size in the case of dispersions by use of a coating of Prevention of microbial action can be achieved by the use of surfactants. The antibacterial and antifungal agents include parabens, chlorobutanol, phenoxyethanol, and benzoyl peroxide. This can be achieved by using ethanol, ascorbic acid, thimerosal, etc. In the present invention, isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, chloride, etc. It is preferred to include sodium in the composition. A delay agent, such as aluminum monostearate and gelatin, is included in the composition. This can be caused by:
[0049] Sterile injectable solutions can be prepared by mixing the active compounds in the required amount in an appropriate solvent, optionally as listed above. by incorporating it with one or a combination of the above ingredients and then sterilizing it by filtration. Generally, dispersions can be prepared by incorporating the active compound into a basic dispersion medium and any necessary By incorporating the compound into a sterile vehicle containing other ingredients from those listed above. In the case of a sterile powder for preparing a sterile injectable solution, The preferred method is to extract the active ingredient, and any additional ingredients, from a previously sterile filtered solution thereof. Vacuum drying and freeze drying yield powders of the desired ingredients.
[0050] In one embodiment, the therapeutic compound is adapted for rapid elimination from the body. The compositions are formulated with carriers that protect the target organism, including, for example, implants and microencapsulated delivery systems. It is a sustained release formulation that contains ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen. Use biodegradable, biocompatible polymers such as poly(vinyl chloride), poly(orthoesters), and poly(lactic acid). Such formulations can be prepared using standard techniques, or For example, Alza Corporation and Nova Pharmaceutic Liposomal suspensions (anti-cellular antigens) are commercially available from ALS, Inc. (including liposomes targeted to selected cells by monoclonal antibodies against These can be used as acceptable carriers by methods known to those skilled in the art, for example, It can be prepared according to the method described in US Pat. No. 4,522,811.
[0051] The pharmaceutical compositions may be included in a container, pack, or dispenser together with instructions for administration. It can be rare.
[0052] subject The vaccine compositions described herein are useful in treating immunocompetent subjects and those who are T-HPV resistant. Cellular immunity is reduced, leading to multiple skin warts and cancers (viral-loaded) with poor prognosis Boosting immunity to skin cancer in immunosuppressed or immunocompromised patients who are prone to developing the disease In some embodiments, the subject has cancer. In some embodiments, the subject does not have skin cancer (e.g., does not have skin cancer). , a high risk of developing skin cancer, e.g., non-melanoma, e.g., squamous cell carcinoma of the skin (i.e. For example, a subject may be at risk for skin cancer. Family history, personal history of excess sun exposure / sunburn, fair skin, sunny or high altitude climates habitat, exposure to radiation or carcinogens such as arsenic, moles, precancerous skin lesions, Patients may have a family or personal history of skin cancer.
[0053] In some embodiments, the subject is a patient suffering from, e.g., an organ transplant, an acquired immune deficiency, e.g., The patient may be immunosuppressed due to HIV / AIDS or a primary human immunodeficiency. In some embodiments, the subject is immunosuppressed due to aging. The compositions are useful in aging individuals, as aging is associated with immunosenescence. Therefore, even normally aging individuals may benefit from vaccines that boost their antiviral immunity. Thus, in some embodiments, the subject is an aging and For example, at least 50, 55, 60, 65, 70, 75, 80, 85 or 90 years of age It is.
[0054] Subjects that can be treated using the present methods include mammals, e.g., human and non-human animal subjects. Includes.
[0055] Methods for inducing anti-cancer immunity The composition is used to treat skin cancers, e.g., non-melanomas, e.g., skin cancers, to induce anti-cancer immunity. The method can be used to reduce the risk of developing squamous cell carcinoma of the One or more doses of the vaccine composition described herein are administered to a subject, e.g., a subject in need thereof. This includes administering it to elephants.
[0056] The compositions are administered in effective amounts. An "effective amount" is an amount that produces a beneficial effect or desired result. For example, an effective amount is an amount that achieves a desired therapeutic effect, e.g., , for treating a disease or for reducing the risk of developing a disease or a symptom of a disease The effective amount is the amount required for administration at one time (also referred to as a therapeutically effective amount or a prophylactically effective amount, respectively). Alternatively, multiple administrations, applications or dosages may be administered. The effective amount (i.e., effective dosage) will depend on the therapeutic compound selected. Dosing from once or multiple times per day to once or multiple times per week, including every other day Those skilled in the art will appreciate that, including but not limited to, the severity of the disease or disorder, including previous treatments, the overall health and / or age of the subject, and other diseases present. Certain factors influence the dosage and timing required to effectively treat a subject. It is understood that the therapeutically effective amount of the therapeutic compounds described herein may have a therapeutic effect on the Treatment of the elephant may include a single treatment or a series of treatments. For example, the method may include a first dose, followed by a later time point, e.g., 1, 2, 4, 6, 8, 12, 18, 24 or 52 weeks This may include administering a second dose (e.g., a "booster" dose) after a period of time.
[0057] The dosage, toxicity and therapeutic efficacy of a therapeutic composition can be determined, for example, by the LD50 (the dose to 50% of the population) Determine the dose that is lethal in 50% of the population and the ED50 (the dose that is therapeutically effective in 50% of the population) This can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio between toxic and therapeutic effects is the therapeutic index, which can be expressed as the ratio LD50 / ED50. Compositions that exhibit a high therapeutic index are preferred. Compositions that exhibit toxic side effects may be used, but care must be taken to minimize and reduce side effects. do not have.
[0058] Data obtained from cell culture assays and animal studies are used to guide the development of dosage forms for human use. A range of dosages can be used in the formulation. The dosage of such compounds is preferably Dosages typically fall within a range of circulating concentrations that include the ED50 with little or no toxicity. It may vary within this range depending on the dosage form used and the route of administration utilized. For any composition used in the methods described above, a therapeutically effective dose is first administered to cells The dose can be estimated from culture assays. The dose may also be formulated in animal models. Such information can be used to more accurately determine useful doses in humans. do.
[0059] The method includes, for example, administering to a subject having skin cancer a therapeutic agent that is known in the art for skin cancer. One or more known treatments or treatments to reduce the risk of developing skin cancer For example, the compositions described herein may be administered in combination with a fluorescein isoform for actinic keratosis. Combination treatments with field treatments (to reduce the risk of developing skin cancer), e.g. For example, topical 5-fluorouracil, topical imiquimod, topical calcipotriene plus 5-fluorouracil These are olouracil, ingenol mebutate and photodynamic therapy. In this embodiment, these agents act to inhibit the immune system while the composition boosts antigen recognition by T cells. Boosting innate signaling in subjects with skin cancer following surgery (e.g., Mohs surgery, excision surgery, curettage and electrocoagulation (electrosurgery), cryosurgery) surgery or laser surgery; radiation therapy; photodynamic therapy; local drug therapy (e.g., local - Fluorouracil, topical imiquimod, topical calcipotriene plus 5-fluorouracil or ingenol mebutate); or systemic drug therapy (e.g., cemiplimab-r wlc, e.g., for subjects with metastatic squamous cell carcinoma of the skin), in combination with the method. can be used. EXAMPLES
[0060] The invention is further described in the following examples which are set forth in the claims. They are not intended to limit the scope of the invention.
[0061] method The following materials and methods were used in the examples below.
[0062] Human studies Participants in clinical studies will be screened for the presence of HIV / AIDS by reviewing their medical records and their archived Access to Skin Cancer and the High-Risk Skin Cancer Clinic at Massachusetts General Hospital Patients consented to donating wart biopsy samples for research in the field. Normal human skin samples were obtained through the Mohs Surgery Clinic at Massachusetts General Hospital. Lesional and normal skin samples were obtained for (a) immune cell or RNA isolation; and (b) fixed in formalin and embedded in paraffin for histological assays. .
[0063] animal research All mice were cultured at the Massachusetts General Hospital and University of Louisville animal facilities. The mice were housed under pathogen-free conditions in accordance with animal care regulations. Six to eight week old female C57BL / 6J (T he Jackson Laboratory, Bar Harbor, ME, Phylogenetic Coordination 000664), FVB (Charles River, Wilmington, M A, lineage code: 207) and SKH-1 Elite (Charles River , strain code: 477) was used in the immune competent arm of this study. CD4 - / - ;CD8 - / - Mice were used as T cell deficient hosts (David G. Provided by Dr. DeNardo; CD8 - / - The Jackson Labora MmuPV1-infected mice were cultured at the University of Louisville Animal Health Center. Animals were kept in a biological containment unit in accordance with animal care regulations at the facility.
[0064] statistical analysis Two-tailed Fisher's exact test was used to assess the anatomical distribution of skin cancer and warts. The Pearson χ2 test was used as a significance test for the other categorical variables. A two-tailed Mann-Whitney U test was used for tumor counts and T cell activation assays. A two-tailed paired t-test was used to compare the mean mean of skin cancers and their adjacent normal Used to compare RNAish and DNAish signal counts between skin Two-tailed unpaired T-tests were performed to compare epidermal thickness, immunostained T cell counts, and normal and normal skin lesions. Used for RNAish signal counts compared to normal human skin, and other continuous variables. The log-rank test was used as a significance test for the time to tumor onset outcomes. P values less than 0.05 were considered significant. All bar graphs are shown as mean + standard deviation show.
[0065] MmuPV1 inoculation MmuPV1 virus stocks were prepared in B6.C cells according to a previously described protocol. g-Foxn1 nu / Foxn1 nu Prepared from MmuPV1-induced nasal and oral papillomas in mice Made. 36 Wt and CD4 - / - ;CD8 - / - The skin on the back of the mouse was cut with an electric razor. The skin was then shaved and waxed using a nail file. The skin barrier is then damaged by passing it through the skin 10 to 20 times, causing minute abnormalities and causing skin erythema. 20 μl of the virus inoculum was dispensed onto the injured skin and spread evenly. Viral inoculation was performed using the dorsal inoculation of T cell-deficient FVB mice for all infected mice. The skin was allowed to develop confluent warts. Mock-infected mice were then inoculated with 20 μl of sterile saline. Vaseline gauze (McKesson, San Francisco, CA) was used. A, catalog number 61-20056) and cut it to fit the wound, then apply a standard band-aid. Meloxicam (Boehringer Inge) at 0.5 mg / kg was administered under lheim Vetmedica, St. Joseph, MO) administered subcutaneously for analgesia. The band-aid was removed after 48 hours, and 200 μl of sterile saline was injected. , and subcutaneously injected into any lethargic mouse.
[0066] PCR detection of MmuPV1 in mouse skin To confirm the colonization of the skin after skin infection with MmuPV1, At the end of the protocol, DNA was purified using the DNeasy Blood & Tissue kit ( from skin biopsies using Qiagen, Hilden, Germany, Cat. No. 69506) PCR amplification of the MmuPV1 L1 protein was performed according to a previously described method. (primers are listed in the table below). 1
[0067] [Table 2]
[0068] Development of warts Ten weeks after viral or mock infection, mice were monitored for the development of warts. As previously described 37 Mice with warts that persisted for >2 months were classified as “persistent” We classified these mice as having “non-immune” warts. They were excluded from the chemical and UV carcinogenicity studies. Mice that showed either were classified as "immune" and enrolled in carcinogenesis studies.
[0069] T cell isolation and transplantation MumPV1 colonies that did not develop warts or showed spontaneous regression of warts up to 10 weeks after infection Ronnie-formed FVB mice (immunized mice) were used as T cell donors. CD4 from lymph nodes + and CD8 + Single cell suspensions of T cells were isolated using EasySep ( Target) Mouse T cell isolation kit (Stemcell Technologies, Vancomycin) The solution was prepared using 200 μl of sterile 100% ethanol (Ouvée, Canada, Catalog No. 19851). One million T cells in saline were injected into the tail of a wart-bearing (non-immunized) Wt FVB mouse. Recipient mice were monitored for resolution of their skin warts. MmuPV1 specificity of T cells from MmuPV1-colonized immunized mice To assess the efficacy of CD4+ T cells in mice, we used CD4+ T cells sorted from skin-draining lymph nodes. + oh and CD8 + T cells were cultured in recipient mice using CD4 - / - ;CD8 - / - Mouse Donor mice were transplanted with 2 μg of CD45-APC (BioLeg) 3 min before harvest. The patient was given an intravenous injection of 100 mg of 10 ... At the time of harvest, single cell suspensions of skin-draining lymph nodes were prepared using a 100% immunization assay to remove any circulating naive T cells. CD3e-PE-Cy7 (Biolegend, Cat. No. 100320), CD 4-APC-Cy7 (Biolegend, Cat. No. 100414), CD8α-F ITC (Biolegend, Cat. No. 100706, Table 5), and CD62L- Stained with PerCP / Cy5.5 (Biolegend, Cat. No. 104432, Table 5) Sorted CD45 - CD3 + CD4 + CD62 Low and CD45 - CD3 + CD8 + CD62 Low Donor memory T cells 38 200 μl sterile saline 129,600 cells per mouse in 6:1 CD4 + :CD8 + (comparison) and CD4 - / - ;CD8 - / - Mice were intravenously injected with MumPV1-specific T cells. As a group of Wt FVB mice, we isolated a population of T cells that would not respond to MmuPV1. To increase the number of infected mice, they were vaccinated against an unrelated virus (mouse parvovirus type 1). This group of T cell donors received 4 injections of T cells into the skin of their backs 30 days and 3 days before collection. 200 μl of sterile saline delivered by subcutaneous injection (50 μl per vaccination site) 50 μg of polyinosinic-polycytidylic acid (Poly(I:C), Sigma) in 1 μl Aldrich, St. Louis, MO, Catalog No. P1530) into mouse parvus The subjects were vaccinated with a cocktail of dimethyl serovar IgE and dimethyl serovar VLPs. Dissolved in DMSO and 100% EtOH (Sigma-Alrich, 200 μl of 5% Imiquimod (Sigma-Aldrich, Cat. No. 276855) diluted in 100 mL of 100% DMSO (Sigma-Aldrich, Cat. No. 276855) Aldrich, Cat. No. 1338313) was applied topically after each vaccination. T cell recipients and T cell-deficient CD4 - / - ;CD8 - / - Mouse and Wt FVB mice were treated with parvovirus vaccine plus topical imiquimod. Mice receiving T cells derived from the HIV-1 strain were infected with MmuPV1 2 days after T cell transfer. MmuPV1-T cell recipients, T cell-deficient CD4 - / - ;CD8 - / - and Another subgroup of Wt mice received an injection of the SCC cell line into their right flank to induce tumor development. The mice were monitored for tumor growth (Figure 7A). The incidence of warts in the MmuPV1-infected cohort and tumor cohort were monitored for 2 months. The SCC development in recipient mice was closely monitored. To examine presence / absence, peripheral blood was collected from mice 3 weeks after T cell transfer. Two to three drops of blood per mouse via the submandibular vein were then lysed in 10 ml of RBC lysis buffer (Bi olegend, Cat. No. 420301) and CD3e-PE-Cy7, C D4-APC-Cy7 and CD8α-FITC staining and analyzed by flow cytometry. I looked it up.
[0070] [Table 3]
[0071] Chemical Carcinogenesis Protocol In accordance with the evidence of infection and MmuPV1 immunity, C57BL / 6J and FVB mice All animals were shaved and, after 7 days, the skin on their backs was The skin was then treated with 100 μg of 7,12-dimethylbenzanthracene ( DMBA) (Sigma Aldrich, Cat. No. D3254) After one week, the mice were treated with 12-O-tetradecanoylphorbol dissolved in 200 μl of acetone. -13-acetate (TPA) (Sigma Aldrich, Cat. No. P1585 ) was started (three times a week for 30 weeks in the C57BL / 6J cohort, and (2x per week for 20 weeks in the FVB and FVB cohorts). Tumors were counted weekly and photographs were collected every other week. Final tumor burden was determined by measuring the tumor volume on the skin on the back of the animals. The risk of developing skin lesions was determined based on the total number of visible skin lesions that occurred during the study.
[0072] UV Carcinogenesis Protocol In accordance with the evidence of infection and MmuPV1 immunity, SKH-1 mice were able to express the skin carcinogenic protozoan Mice received 50 μl of acetone in 200 μl of acetone on the skin of their backs (Figure 11G). One week later, SKH-1 mice received a single dose of 100 g of DMBA. Regularly calibrated using the Onal Light IL1400A digital lux meter VP Black-Ray® Lamp UVB (VWR, Radnor, PA, Narrowband ultraviolet B (UVB) was administered three times a week for 25 weeks. Mice received 100 mJ of UV light at each UV treatment. / cm 2 This is the average tanning ability of a fair-skinned individual (Fitzpatrick The erythema dose for the skin types 2-3 of the 1980s and 2000s was considered to be less than that of the 40-60% erythema dose for the skin types 2-3 of the 1980s and 2000s in midday in Florida during the summer. Close to 0 minutes of sun exposure. 39、40 Throughout the carcinogenesis protocol, tumors were cultured weekly. Counts and photographs were collected every two weeks. Final tumor burden was determined as palpable tumor mass developed on the skin on the backs of the animals. The clinical outcome was determined based on the total number of skin lesions.
[0073] Histology and immunofluorescence staining Dorsal skin samples were collected and reconstituted with 4% paraformaldehyde (PFA, Sigma Ald The tissue was fixed overnight at 4°C in ethanol (rich, Catalog No. P6148). The tissue was dehydrated in PBS, processed, and embedded in paraffin. 5 μm sections of the paraffin-embedded tissue were cut. The sections were then deparaffinized and stained with hematoxylin and eosin (H&E). For the determination of chromatin density, rehydrated tissue sections were diluted with 0.2% v / v Triton X-100 (The rmo Fisher Scientific, Waltham, MA, Cat. No. B The cells were permeabilized with 1x PBS supplemented with 1x PBS (P151) for 5 min. Antigen retrieval was performed using antigen demasking. Catalysis solution (Vector Laboratories, Burlingame, CA) Log No. H-3300) in a Cuisinart pressure cooker at high pressure for 20 minutes. Slides were then stained with 0.1% v / v Tween 20 (Sigma-Aldrich The sections were washed three times for 3 minutes in 1x PBS supplemented with 1x PBS (catalog no. P1379). The pieces were then washed with 5% m / v bovine serum albumin (Fisher Scientific, Hamburg, Germany). pton, NH, Cat. No. BP1600) and 5% v / v goat serum (Sigma The slides were blocked with 1:5 Fibroblast Growth Protein (Aldrich, Cat. No. G9023). 00 rat anti-CD3, and 1:500 rabbit anti-CD4 or 1:400 rabbit anti-CD5. The slides were stained overnight at 4°C with either CD8a or CD8b (Table 5). The next day, the slides were washed as above. Cleaned and incubated with 1:200 goat anti-rat PE and 1:500 goat anti-rabbit FITC. After washing as above, the slides were washed with 1: 4000 DAPI (Invitrogen, Carlsbad, CA, Cat. No. D The slides were incubated with 3571) for 5 min at room temperature and then washed as above. The peptides were then purified using Prolong Gold Antifade reagent (Invitrogen, Catalog After staining, each section was mounted in a 3D microscope (log number P36930). Ten randomly selected images were acquired at a total magnification of 200x. + , CD4 + and CD8 + Blind manual counting of cells was performed using the ZEN Blue "event The positive cells were counted using the "Pollution Detection Tool" (Zeiss, Oberkochen, Germany). , by comparing the fluorescence intensity with the background minimized using ZEN. The analysis was performed by dividing each image into epithelial compartments (i.e., epidermis and hair follicles) or Double-positive cells in the dermis (e.g., CD3 + CD4 + ) and CD3 + Total cells It was based on numbers.
[0074] Serology Using previously described methods 41 , anti-MmuPV1 specific antibodies in mouse serum, Detection was by enzyme-linked immunosorbent assay (ELISA).
[0075] RNA and DNA in situ hybridization RNAish and DNAish are RNAscope® probes and primers. The protocol (Supplementary Table 2; DNA probes bind to viral DNA at the same RNA probe binding site). Generated using the sense strand of A; Advanced Cell Diagnostics s, California, USA) and formalin-fixed paraffin-embedded (FFP) E) Human and mouse tissue sections. 42 We use HybEZ(TM) hive RNAscope® Assay Hybridization System Briefly, 5 μm thick sections were cut and then incubated for 1 h. The pieces were baked in a dry oven at 60°C for 1 hour and immediately deparaffinized in xylene. Epitope retrieval was performed by soaking the slides in RNAs. cope® 1X Target Inactivation Reagent (Advanced Cell Diagno This was done by placing the plate in a 30-mL stics (catalog number 322000) at 102°C for 15 minutes. The protease treatment was then performed using RNAscope® Protease. -ZePlus (Advanced Cell Diagnostics, Catalog No. 32 2331) to the sections, and then incubated in a HybEZ™ Oven II (A Advanced Cell Diagnostics, Catalog No. 321720 Incubate at 40°C for 30 min. After cross-hybridization, sections were stained with Fast RED reagent (RNAscope (registered trademark) 2.5 HD Detection Reagent-RED, Advanced Cell Diagnos The tissue was stained with 50% hematoxylin plus 0.0% tetracycline (Tics, Cat. No. 322360). 2% ammonia water was used as a counterstain. Positive and negative probes were Appropriate controls were used in the assay to ensure proper detection. We used positive and negative As a control, the endogenous housekeeping gene peptidyl prolyl isomerase B (PP IB, Advanced Cell Diagnostics, Catalog Number 31390 1) and the bacterial gene dapB (Advanced Cell Diagnostics We used a probe for the 310043 (Cat. No. 310043). Evaluate the RNAish and DNAish red signals under a microscope at 400x magnification. Ten representative areas of skin cancer and normal skin from each slide were Imaged at 0x magnification and positive RNAish / DNAish signals and keratinocytes. Nuclei were counted in each image in a blinded manner.
[0076] qRT-PCR RNA samples were purified in Allprotect (Qiagen, Cat. No. 76405). Extracted from human tissue stored at 4°C, flash frozen samples were stored at -80°C. The pieces (approximately 50-100 mg) were washed using 1x sterile PBS and cut into 5 mm tissue. The tube containing the eLyser beads was then filled with 600 μl of RLT and βME. was added to the sample and beads. The tissue was homogenized by mechanical manipulation for 5 min. The liquid was transferred to a new tube to which 1 ml of TRIzol was added. Mix the solutions using the standard Thermo Fisher protocol for The supernatant was collected and diluted with 0.2 ml of chloroform / 1 ml of T RIzol was added. The mixture was centrifuged and the supernatant was collected. For RNA extraction, We used the Allprep DNA / RNA Mini Kit (Qiagen, catalog no. 80 The supernatant was then loaded onto an Allprep DNA spin column and filtered. The flow-through was mixed with one volume of 70% ethanol. This solution was mixed and digested with DNase. The RNA is applied to an RNAeasy spin column following standard purification procedures, including NADH. Quantify 1 μg of RNA using Nodrop and SuperScript III Reverse transcription using the RT kit (ThermoFisher, cat. no. 18080044) For the transcription reaction, 1 μg of RNA was used in 0.25 mg / ml random plate. 10 mM dNTP mix and nuclease-free HO for a total of 1 The sample was incubated at 65°C for 5 minutes. 1 strand buffer, 0.1M DTT, 400U / μl RNaseOUT and supers A mixture of 200 U of crypt III was added to the nucleotide mixture. The material was incubated in a thermocycler. The program was 5 min at 25°C, 50°C for 1 h. After PCR, the cDNA samples were diluted with Ultra Dilute 1:9 using Pure™ DNase / RNase-Free distilled water. 3 μl of the 1:9 dilution was used in a total of 10 μl qPCR reaction. For the forward and reverse primers, 0.5 μl of 10 μM concentration was used. The marker was purchased from IDT. 43 5 μl SYBR® Green Master The mix was diluted with 1 μl of UltraPure™ DNase / RNase- Free distilled water was used. qPCR was performed using a LightCycler 480 II (Roche, Basel, Switzerland, product number 05015278001). The T-PCR products were electrophoresed on a 1% agarose gel at 120 V for 60 min. This was verified by
[0077] Human T cell isolation and peptide stimulation T cells were isolated from human skin as previously described. 44 In brief, Morse Discarded normal facial skin samples generated as part of surgical repair were obtained. Subcutaneous adipose tissue The human facial skin tissue was removed and the remaining tissue was minced. Small pieces of tissue were % DNase-I (Sigma-Aldrich) and 0.2% collagenase-I (Fisher Scientific) at 37°C for 2 h. The cells were then collected through a 40 μm cell strainer and diluted with 20% FBS. , 1% penicillin / streptomycin, 1% glutamine, 0.00035% 2- Mercaptoethanol and 50 U / ml of human IL-2 recombinant (BioLegend Human skin T cells were incubated in RPMI 1640 containing 100% DMSO. The cells were seeded with a pool of five β-HPV E7 peptides (HPV5 / 8 / 9 / 20 / 38, 5 μg / mL of each peptide, custom peptide, JPT, Berlin; Germany), a pool of HPV16 E7 peptides (5 μg / mL of each peptide, P epMix™ HPV 16 (Protein E7), JPT, product code PM-HPV 16-E7) or 50 ng / ml phorbol 12-myristate 13-acetate (P MA) plus 500 ng / ml ionomycin (Ion). , as a 15-mer with 11 amino acids overlapping across the entire length of the E7 protein After 24 hours of peptide exposure, cells were harvested and assayed for surface markers for T cell activation. The cells were stained with antibodies against Car (Table 5) and analyzed by flow cytometry (BD LSRFortes Flow data were analyzed using FlowJo software, Ash land, and OR were used for analysis.
[0078] [Example 1] Immunity to commensal papillomavirus protects against skin cancer To investigate whether dermatotropic HPV contributes to the development of skin cancer, we A clinical study to map the anatomical location of skin cancers and warts from human immunosuppressed participants 86% of HPV-induced warts occur on sun-protected (SP) skin and 4 of 74 skin cancers occurred in intermittently sun-damaged (ISD) skin One case (55%) occurred in chronically sun-damaged skin of the head and neck (Tables 1A-B and In contrast, the anatomical distribution of skin cancer in immunosuppressed patients was consistent with that of the immune response. The results were consistent with those of patients with HIV infection (Tables 1A-B and Figures 4A-B). The absence of increased skin cancer predisposition in anatomical sites with verruca development suggests that UV is immunosuppressive. These results suggest that IFN-γ was the predominant skin cancer initiator in patients with IFN-γ.
[0079] [Table 4]
[0080] [Table 5]
[0081] To determine the effect of papillomaviruses on carcinogen-induced skin cancer We used mouse papillomavirus (MmuPV1), which is a HPV-associated skin tumor It has recently emerged as a robust tool in the study of skin diseases. 6、7 We are the back of the animal. developed a method to infect the skin of mice with MmuPV1, which is a T cell-deficient CD4 - / - ;C D8 - / - This resulted in the development of confluent warts in the skin on the backs of mice, but the immune system In immunocompetent Wt animals, the immunization did not result in skin lesions (Figure 5A-B). Infection of BL / 6 mice with MmuPV1 resulted in no development of warts in 100% of animals. , resulting in extensive colonization of the skin on their backs (Fig. 6A). Two months after infection, MmuPV1-infected and mock-infected mice were treated with dimethylbenzanthracene (DMBA) ) once, and 12-O-tetradecanoylphorbol-13-acetate (TPA) once. A standard cutaneous chemical carcinogenesis protocol was administered to the skin of the back three times a week for 30 weeks. Attached to the call 20 Surprisingly, animals colonized with MmuPV1 showed non- showed a significant delay in the development of carcinogen-induced skin tumors compared to infected mice (p=0. 0020; Fig. 1A). In addition, MmuPV1-colonized mice showed significantly less DMBA-induced tumors (p<0.05 starting 22 weeks after DMBA; Fig. 1B) and were significantly greater than those in uninfected mice. In comparison, the study ended with significantly less tumor burden (p<0.0001; Figures 1C, 6C). MmuPV1-infected Wt C57BL / 6J mice that did not receive DMBA-TPA were The patient remained skin tumor / wart-free during the 2-week follow-up period (Figure 1A-C).
[0082] More susceptible to chemical skin cancer 20 Skin cancer in FVB mice To investigate the effect of papillomavirus on IL-1, we used the Wt FVB mice were infected in the dorsal skin and complete skin colonization was achieved (Figure 6B). 23% of infected mice showed complete immunity immediately after infection. Seventy-seven percent developed warts on the skin of their backs 5 weeks after infection (Figure 1D). After 10 weeks, the warts had completely disappeared in 58% of wart-bearing FVB mice, indicating that antiviral therapy was effective. 42% of animals had persistent warts with no change in their wart count. The skin drainage area of MmuPV1-immunized mice (i.e., without warts) was significantly increased (Fig. 1D). T cells transferred from lymph nodes immunized mice with persistent warts and promoted adoptive T cell transfer. This resulted in the rejection of the warts 2 weeks after transplantation (Figure 1E). To examine whether these T cells were MmuPV1-specific, we Wart-prone CD4 - / - ;CD8 - / - mice and subsequently onto the skin on their backs. MmuPV1 infection was performed (Figure 7A). D4 - / - ;CD8 - / - Mice were T cell-depleted CD4 - / - ;CD8 - / - Mouse and CD4 T cells from Wt mice treated with parvovirus vaccine - / - ; CD8 - / - MmuPV mice developed fewer warts after infection compared to control mice (Figure 7B). In contrast to their protective effect against 1-induced warts in MmuPV1-immunized mice The derived T cells are CD4 - / - ;CD8 - / - Affects SCC tumor growth in mice (Figure 7C).
[0083] MmuPV1-colonized Wt has innate and adaptive immunity against MmuPV1 FVB mice were treated once with DMBA, followed one week later by TPA twice a week for 20 min. Similar to C57BL / 6J animals, mice were colonized with MmuPV1. Wt FVB mice were protected from chemical carcinogenesis and showed a significant delay in the development of skin tumors. MmuPV1-colonized mice showed a significant increase in pulmonary function over time (p<0.0001; Fig. 1f). They developed fewer tumors (p<0.05 starting 7 weeks after DMBA; Fig. 1g), and they had significantly lower tumor burden at the end of the study (p<0.01; Fig. 1h and i). Therefore, 7,12-dimethylbenzanthracene (DMBA) and 12-O-tetradecane MmuPV1 colonies receiving canoylphorbol-13-acetate (TPA) for 20 weeks Immune FVB mice were protected from chemical carcinogenesis compared with mock-infected mice. Moreover, mice with acquired immunity after T cell transfer were also protected from chemical carcinogenesis (Figure 1J We found that at the end of the DMBA-TPA protocol, MmuPV1 colony-forming Wt Normal skin of C57BL / 6J and FVB mice (Fig. 8A and B) and In the blood, anti-MmuPV1 L1, E6, and E7 antibodies (Fig. 8C and D), M muPV1 viral DNA was detected. Importantly, MmuPV1-colonized mice The CD8 + Memory T (T RM ) vs. total CD3 + T cell ratio As shown in Fig. 1, CD8 expression in the epithelial compartment of the skin was significantly higher in mice infected with IFN-γ. + T cell homing MmuPV1-colonized mice showed an increased IL-1 expression level (p = 0.0004, Figure 5E-H). DMBA-TPA-induced skin tumors in mice showed similar growth and development patterns to those in mock-infected mice. The mutants showed the same phenotypic and mutational characteristics and lacked MmuPV1 viral transcripts (Fig. 8I–J, 9). We found that CD4 + Role of T cell population We did not detect any significant changes in the retrieval timepoint (Fig. 8E and F). Detecting MmuPV1 RNA in normal skin of MmuPV1-colonized mice These findings support the conclusion that MmuPV1-colonized skin Protective effect of anti-MmuPV1 T cell immunity in suppressing carcinogen-induced tumors Demonstrate.
[0084] To determine the effect of papillomavirus colonization on UV carcinogenesis, we We developed hairless SKH-1 mice that are immunocompetent and develop skin tumors in response to UV irradiation. I researched it. 21 After MmuPV1 infection, abundant MmuPV1 L2 RNA was detected 3 weeks after infection. Later, the skin of immunized mice (i.e., no warts developed) as well as immediate anti-MmuPV1 immunization The virus was detected in the skin and warts of animals lacking MmuPV1 infection (Fig. 7A). MmuPV received a single immunosuppressive dose of ultraviolet B (UVB; 300 mJ cm-2) months later. 1 Infected mice8 developed warts9 and showed long-term persistence of MmuPV1 colonization in the skin. To avoid immunosuppressive UV exposure, MmuPV1 and mock-infected mice were The mice were treated with DMB before being treated with UVB (100 mJ cm-2) three times a week for 25 weeks. A. Two months after infection of the back skin with MmuPV1, a patient with persistent warts was treated with MmuPV1 for one week. A small subset of SKH-1 mice (Wang et al., PLoS Pathog. 11, e1005243 (2015)) were vaccinated intraperitoneally with live MmuPV1 virus particles three times over a two-week period. After 4 weeks, 5 of 9 mice had undergone invasive surgery, as evidenced by persistent rejection of their warts. Immunity to MmuPV1 was generated in a manner similar to that shown in Fig. 10D. Immune mice developed significantly fewer skin tumors compared with non-immune mice (P = 0.0159; Figure 10D-E). Furthermore, the total numbers of T cells and CD8+ T cells were The IL-1 expression level was significantly increased in skin tumors of MmuPV1-colonized mice (Fig. 10F–M, 1 1A-C). Skin- and tumor-infiltrating CD3-CD45+ leukocytes and CD4+ T cells Levels did not differ between the two groups (Figs. 10F-M, 11D-F).
[0085] CD mediates antitumor immunity induced by papillomavirus skin colonization To determine the role of 8+ T cells, SKH-1 mice were infected with MmuPV1. or mock infected with MmuPV1 virus-like particles (mock (VLP)). In addition to the UV carcinogenesis protocol, mice infected with sham (VLP) were treated with anti-CD8 antibody. induced CD8+ T cell depletion mediated by IgG (Fig. 11G-H). Treated MmuPV1-colonized SKH-1 mice developed T cell depletion IgG and anti-PV1 colonized mice compared to those infected with mock (VLPs) Compared to both CD8 antibody-treated and control groups, significantly fewer tumors developed (Figures 11I-J). Consistent with our findings in other immunocompetent strains of mice, MmuPV1-colonized Xpc − / − mice are deficient in the ability to relapse (Sands et al. , Nature 377, 162-165 (1995)) were protected against skin cancer compared to their mock-infected controls. This was done (Figures 11K-N).
[0086] To avoid highly immunosuppressive UV doses 23 , the skin on the back, 100 mJ / cm 2 UVB Mice were treated with one dose of 50 μg of DMBA one week prior to receiving treatment three times a week for 25 weeks. The onset of skin tumors was not significantly delayed (Fig. 2A), but MmuPV1-colonized SK H-1 mice developed significantly fewer tumors over time (p<0.05 at 17 weeks of DMBA). (Figure 2B) and had significantly less tumor burden at the end of the study compared to uninfected mice. (p<0.005; Fig. 2C and D). Interestingly, The widespread epidermal dysplasia induced by DMBA-UV treatment in the skin was characterized by Mmu were absent in PV1-colonized animals (FIG. 12A). DMBA-UV-induced This block in MmuPV1 colony formation was observed in mice compared to their uninfected counterparts. This was reflected by a reduction in epidermal thickness in the inflammatory mice (Fig. 12B). Analysis showed that at the end of the DMBA-UV protocol, Mmu CD8 in the skin of PV1-colonized mice + T cells and CD8 + T RM Total number of / The ratio of total T cells was significantly increased (p<0.05, Fig. 2e-g). + T thin No significant differences in the total number of cells were observed between the groups (Figure 12C-D). DNA from MmuPV1-colonized mice at the end of the DMBA-UV protocol. was detectable in normal skin (Figure 12E).
[0087] Protective effect of anti-MmuPV1 immunization against carcinogen-induced skin cancer in mice The results suggest that β-HPV in the skin of immunocompetent individuals may play a similar protective role. To investigate this, we investigated the role of the virus in the intracellular localization of the skin. To provide further insight, we examined the E6 / 7 transcripts of 25 β-HPV types in tissue sections. A pool of RNAish probes for β-HPV was used (Figure 13 and Table 2). 16 β-HPV RNAish was detected in warts (positive control) and skin cancers from immunosuppressed patients. We detected β-HPV transcripts in keratinocytes (Figure 14A-B). Normal skin from responsive patients showed no detectable β-HPV RNAish signal. (Fig. 14B). qRT-PCR of E6 validated the β-HPV RNAish results. (Figure 14B).
[0088] [Table 6]
[0089] Next, we investigated the β- HPV RNAish was performed (Table 3).
[0090] [Table 7]
[0091] β-HPV RNA was detected in verrucae and verruca-associated hypertrophic actinic keratoses from immunosuppressed patients. β-HPV RNA expression was detectable in sarcoma, thyroid cancer, and SCC (Fig. 3a). was reduced in cancer cells compared to adjacent normal skin cells from suppressed patients (Figure 3a). β-HPV RNA expression was predominantly observed in cancer cells of SCC from immunocompetent patients. Absent, but low levels of β-HPV RNA expression were detected in adjacent normal skin. β-HPV RNAish signal counts throughout skin cancer compared with adjacent normal skin keratinocytes in immunocompetent and immunosuppressed patients. In comparison, β-HPV RNA expression was significantly reduced in cancer cells (p< 0.001, Figure 3b). Skin cancer cells in immunosuppressed patients were significantly higher than those in immunocompetent patients. Compared to skin cancer cells, they had significantly more viral transcripts (Figure 15A). , skin lesions from immunosuppressed patients, skin lesions from immunocompetent patients and normal facial skin samples had significantly higher β-HPV RNA expression throughout the tissues compared with 5B–C). β-HPV RNA expression was significantly higher in immunosuppressed patients compared to immunocompetent patients. In normal skin, it was detectable in a significantly higher number of basal keratinocytes (Figure 1). 16A–B) To examine the β-HPV viral load at the subcellular level in tissue sections, To this end, we developed a β-HPV ELISA kit that detects the sense strand of the E6 / 7 gene from 25 β-HPV types. A pool of DNA in situ hybridization (DNAish) probes was used to β-HPV DNAish was used to measure the viral DNA of β-HPV in human skin. The intracellular localization of β-HPV DNA was revealed (Figure 17). , High viral load in warts, wart-associated hypertrophic actinic keratoses, and SCCs. The viral load of β-HPV was measured in the adjacent normal skin of immunosuppressed patients (Fig. 18A). The expression of IL-1 in cancer cells was reduced compared to that in skin (p<0.05, FIG. 18B). Reduction in β-HPV viral load in keratinocytes compared with adjacent normal keratinocytes Moreover, the lesions were more pronounced in immunocompetent patients (p<0.01, FIG. 18C). Higher viral activity and load in skin cancers from suppressed patients may be due to a correlation with those from immunocompetent patients. Compared with the samples, these skin cancers had significantly fewer tumor and skin-infiltrating CD8+ correlated with T and CD103+CD8+TRM cells (Figures 19A-C).
[0092] Finally, we demonstrated that normal skin from sun-damaged sites expresses β-HPV-specific T cells. We investigated whether T cells isolated from normal facial skin of immunocompetent adults contained IgG4-associated ... , exposed to peptides derived from the E7 protein of β-type HPV5, 8, 9, 20, and 38 Table 4. CD8 cells derived from skin exposed to 100 μg / mL of ionomycin (PMA / Ion; positive control) + cell damage Cytotoxic T lymphocytes (CTLs) express CD69 + and CD137 + CD 69 + became active, as indicated by a significant increase in CTL (Figure 3C-D, 19D). Consistent with their activation status, we found that β-HPV peptides were significantly more potent than negative controls. More CTL lysis (CD107a + CD8 + T cells) were detected. (FIG. 19D). In contrast to the β-HPV peptide, the high-risk HPV16 E7 peptide It did not activate skin-derived CTLs (Fig. 3C-D and Fig. 19D).
[0093] [Table 8-1]
[0094] [Table 8-2]
[0095] [Table 8-3]
[0096] To further develop a vaccine strategy, we investigated the effect of MmuPV1 colonization on the To vaccinate Wt mice, Mmu was administered together with poly-ICLC adjuvant. Using long overlapping peptides derived from the PV1 E1, E2, E6 and E7 proteins. In conclusion, we have demonstrated that this vaccination reduces the risk of skin cancer in the event of exposure to carcinogens. In addition, we will determine whether high-risk By injecting it subcutaneously into the site of early-stage squamous cell carcinoma in patients, the researchers were able to stimulate the immune response against skin cancer. Induction of β-HPV multipeptide vaccine (HPV 5, 8, 9, 17, 20, 3 8, 50, 75, 80 and 151 from E1, E2, E4, E6 and E7 proteins This study will study the effectiveness of human ovarian cancer treatments, such as the use of ovarian peptides, in preventing cancer. A high-risk population is being investigated for use of the vaccine in solid organ transplant recipients before they undergo transplantation. This will enable clinical trials to investigate vaccine application in patients with HIV / AIDS.
[0097] Abnormal proliferation of keratinocytes results in presentation of papillomavirus antigens to T cells To identify the signaling pathway, we investigated the expression of MmuPV1 in SKH-1 mice, which are involved in the development of skin warts. Infected DMBA-UV-treated skin and tumors, and mock-infected DMBA-UV-treated skin and tumors RNA sequencing (RNA-seq) was performed in the skin and tumor (Figure 20a-C). MmuPV1-induced warts and DMBA-UV-induced tumors compared with control (also from both groups) (both from MmuPV1-infected and mock-infected groups) Among these genes, the damage-associated molecular pattern (DAMP) genes S100a8 and S10 There were several immune-related genes, including 0a9 (Figure 20C). Human SCC and warts In this study, we compared the S The induction of 100 genes was confirmed, where S100A8 and S100A9 genes were normal. was down-regulated compared to skin (Fig. 20D-F).
[0098] [Example 2] Live and live-attenuated HPV vaccines An in vitro culture system is used to grow skin-tropic HPVs. Commensal HPVs, e.g. The virus was then isolated from warts of adult immunosuppressed patients. The purified virus was then transformed into human primary keratinocytes. Tinocytes (low passage rather than immortalized cell lines (Bienkowska-Haba et al., PLoS Pathog. 2018;14(3):e1006846) into an organotypic raft culture model. The difficulty in transferring the HPV genome into cells is due to the fact that HPV binds to basement membranes and keratinocytes. Preferentially in vivo and in vitro, the extracellular matrix (ECM) secreted by This can be solved by using the ECM-to-cell infection method, since the vector binds to ds et al., Viruses. 2014;6(12):4856-79. Epub 2014 / 12 / 1). This is a collagen gel. Seeding of cells onto the surface of a stainless steel sheet followed by application of a stainless steel sheet to create an air-medium interface The procedure involves transferring the gel, along with culture medium, onto a stainless steel grid.
[0099] Co-localization of the E6 protein of symbiotic HPV at the binding site with the LXXLL domain of MAML-1 Mutations in genes that encode for virulence factors have been shown to be important in the development of safe live attenuated viruses for use in vaccines. The complete HPV genome can be generated by the expression of the HPV genome in Escherichia coli. For stable maintenance and for the introduction of mutations into E6 at its binding site to MAML-1 To achieve this, the BAC sequences are inserted into bacterial artificial chromosomes (BACs). The BAC sequences are then inserted into loxP to allow removal of bacterial sequences from the viral genome by Cre recombination Stepwise mutation of the E6 protein (Tan et al., Proceedings of the National Academy of Sciences of the United States of America. 2012;109(23):E147 3-80. Epub 2012 / 05 / 024) for MAML1. The genome is then introduced into human primary keratinocytes. After transfection, the cells We have grown and differentiated HPV-infected mice using an organotypic culture model that supports the entire HPV life cycle and expresses the E6 protein. The effect of each mutation on protein binding to MAML1 is determined.
[0100] References
[0101] [Table 9-1]
[0102] [Table 9-2]
[0103] [Table 9-3]
[0104] [Table 9-4]
[0105] [Table 9-5]
[0106] Other embodiments Although the present invention has been described in conjunction with a detailed description thereof, the foregoing description is illustrative of the scope of the present invention. However, it is intended that the present invention not be limited thereto by the scope of the appended claims. It should be understood that the present invention is defined by the principles of the present invention. Other aspects, advantages, and modifications are described in the following patents: It is within the scope of the claims.
Claims
1. a plurality of (i) antigenic peptides each comprising a sequence of 9 to 30 amino acids derived from one or more E1, E2, E4, E5, E6, or E7 proteins from HPV47, HPV50, HPV55, and / or HPV95 proteins, or (ii) one or more E1, E2, E4, E5, E6, or E7 proteins from live or live-attenuated commensal low-risk HPV47, HPV50, HPV55, and / or HPV95 human papillomavirus strains; and T cell adjuvants that increase T cell responses to said antigenic peptides or one or more of the E1, E2, E4, E5, E6 or E7 proteins. A composition comprising:
2. The composition described in claim 1, wherein the protein is derived from multiple strains of the symbiotic human papillomavirus.
3. The composition described in claim 2, comprising at least 200 proteins each having a unique sequence.
4. The composition described in claim 3, comprising multiple proteins each having a unique sequence.
5. One or more E1, E2, E4, E5, E6 or E7 proteins from a plurality of commensal low-risk HPV47, HPV50, HPV55 and / or HPV95 human papillomavirus strains; and a T cell adjuvant that increases T cell responses to said antigenic peptide or said one or more E1, E2, E4, E5, E6 or E7 proteins; A composition comprising:
6. The composition described in claim 5, wherein the multiple peptides, or the one or more E1, E2, E4, E5, E6 or E7 proteins, are in a virus-like particle. Claim 7: (i) a plurality of antigenic peptides each comprising a sequence of 9 to 30 amino acids derived from one or more E1, E2, E4, E5, E6, or E7 proteins from HPV47, HPV50, HPV55, and / or HPV95, or (ii) a plurality of nucleic acids encoding one or more E1, E2, E4, E5, E6, or E7 proteins from a plurality of commensal low-risk HPV47, HPV50, HPV55, and / or HPV95 human papillomaviruses; and a T cell adjuvant that increases T cell responses to said antigenic peptide or said one or more E1, E2, E4, E5, E6 or E7 proteins; A composition comprising:
8. The composition described in claim 7, comprising one or more viral vectors engineered to express the multiple proteins or antigenic peptides.
9. The composition described in claim 8, wherein the viral vector is selected from the group consisting of recombinant retroviruses, adenoviruses, adeno-associated viruses, alphaviruses and lentiviruses.
10. The composition of any one of claims 1 to 9, wherein the T cell adjuvant comprises one or more of T cell response-enhancing nanoparticles, poly-ICLC (carboxymethylcellulose, polyinosinic-polycytidylic acid, and poly-L-lysine double-stranded RNA), imiquimod, CpG oligodeoxynucleotides and formulations (IC31, QB10), AS04 (aluminum salt formulated with 3-O-desacyl-4'-monophosphoryl lipid A (MPL)), AS01 (MPL and saponin QS-21), MPLA, STING agonists, other TLR agonists, Candida albicans skin test antigen (Candin), GM-CSF, Fms-like tyrosine kinase-3 ligand (Flt3L), and / or IFA (incomplete Freund's adjuvant).
11. The composition of any one of claims 1 to 9, wherein the T cell adjuvant comprises topical resiquimod, or topical imiquimod, or topical 5-fluorouracil, or topical calcipotriene (calcipotriol), or a combination thereof.
12. The composition of claim 11, wherein the T cell adjuvant comprises a combination of topical calcipotriene and 5-fluorouracil.
13. A pharmaceutical composition for treating or reducing the risk of developing skin cancer in a subject, the pharmaceutical composition comprising a composition described in any one of claims 1 to 12.
14. The pharmaceutical composition described in claim 13, wherein the subject has an increased risk of developing skin cancer or is immunocompromised.
15. The pharmaceutical composition described in claim 14, wherein the subject is immunocompromised as a result of aging, acquired immune deficiency, or organ transplantation.
16. A composition according to any one of claims 1 to 12 for use in a method for treating or reducing the risk of developing skin cancer in a subject.
17. The composition for use described in claim 16, wherein the subject has an increased risk of developing skin cancer or is immunocompromised.
18. The composition for use according to claim 17, wherein the subject is immunocompromised as a result of aging, or acquired immune deficiency, or organ transplantation.