Combination treatment of chemoresistant cancers

Abstract

To provide compositions and methods for treatment of chemoresistant cancer (breast cancer).SOLUTION: Provided are methods that include administering to a subject in need a therapeutically effective amount of a chemotherapeutic agent and a ROR-1 antagonist. Further provided are pharmaceutical compositions including a chemotherapeutic agent, a ROR-1 antagonist and a pharmaceutically acceptable excipient. In embodiments, the chemotherapeutic agent is paclitaxel and the ROR-1 antagonist is cirmtuzumab.SELECTED DRAWING: Figure 5A

Description

[Technical field]

[0001] This application claims priority to U.S. Provisional Patent Application No. 62 / 641,035, filed March 9, 2018, which is hereby incorporated by reference in its entirety for all purposes.

[0002] Reference to a "Sequence Listing," a table, or a Computer Program Listing Appendix submitted as an ASCII file

[0003] The sequence listing in file 048537-605001WO_SEQUENCE_LISTING_ST25.TXT was created on March 8, 2019, and is 3,371 bytes, machine format IBM-PC, MS-Windows operating system. The sequence listing is incorporated herein by reference.

[0004] STATEMENT REGARDING CLAIMS TO INVETIONS MADE UNDER FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant No. CA081534 awarded by the National Institutes of Health. The Government has certain rights in this invention. [Background technology]

[0005] Advances in chemotherapy and endocrine therapy have reduced breast cancer mortality, but 20% of patients still experience recurrence and ultimately succumb to the disease (Early Breast Cancer Trialists' Collaborative et al., 2012). One model to explain this is hypothesized to involve cancer stem cells (CSCs), which are relatively resistant to chemotherapy, have the ability to self-renew, can repopulate tumors, and can metastasize to distant sites (Brooks et al., 2015; Wahl and Spike, 2017). If so, therapies targeting CSCs may also improve treatment outcomes and patient survival.

[0006] Studies have identified characteristics that distinguish CSCs from other cancer cells. CSCs have the unique ability to form non-adherent cell spheroids and engraft in immune-deficient mice (Al-Hajj et al., 2003; Creighton et al., 2009). Such cells have gene expression signatures that reflect their relatively high capacity for self-renewal and / or drug resistance (Creighton et al., 2009). Notable is the activation of the Hippo-YAP pathway, which induces genetic changes that contribute to self-renewal, resistance to chemotherapy, and / or metastatic potential (Chan et al., 2008; Cordenonsi et al., 2011; Maugeri-Sacca and De Maria, 2016; Moroish et al., 2015).

[0007] Another hallmark of CSCs is the enhanced expression of B-lymphoma-Mo-MLV insertion region 1 homolog (BMI1); high levels of BMI1 are associated with breast cancers with a basal-like phenotype, which is associated with poor patient survival (Wang et al., 2012). BMI1 can promote CSC self-renewal and oncogenic initiation capacity (Kreso et al., 2014; Paranjape et al., 2014; Wu et al., 2011). In addition, BMI1 can enhance the expression of genes encoding ATP-binding cassette (ABC) transporters, which enhance resistance to chemotherapy (Su et al., 2015; Wu et al., 2011).

[0008] Breast CSCs also have phenotypic features that distinguish them from other neoplastic cells. CSCs have unique expression of aldehyde dehydrogenase 1 (ALDH1) and generally express CD2, CD49f, CD133 and / or CD44, with low levels of CD24 (CD24 low) or in conjunction with CD47 (Al-Hajj et al., 2003; Ginestier et al., 2007; Kaur et al., 2016). However, such CSC-associated surface proteins are not restricted to neoplastic cells. An exception is type I orphan receptor tyrosine kinase-like ROR1, which is expressed by many cancers but not by normal postpartum tissues (Zhang et al., 2012b). Breast cancers containing high levels of ROR1+ cells tend to be poorly differentiated and express markers associated with epithelial-mesenchymal transition (EMT) (Cui et al., 2013). High levels of ROR1 expression are associated with shorter post-treatment disease-free or overall survival in patients with triple-negative breast cancer (Zhang et al., 2012a; Chien et al., 2016). Conversely, silencing ROR1 attenuates the expression of genes associated with EMT and impairs cancer cell migration / invasion in vitro and metastasis in vivo, revealing an association between ROR1 and CSC-associated features and / or poor prognosis ( Cui et al., 2013 ).

[0009] Previous studies have revealed that ROR1 is a receptor for Wnt5a (Fukuda et al., 2008), and Wnt5a can induce non-canonical Wnt signaling in chronic lymphocytic leukemia (CLL), leading to activation of Rho-GTPase and enhanced tumor cell proliferation and survival (Yu et al., 2015). Rho proteins, including RhoA, Rac1, and cdc42, are expressed at higher levels in breast cancer compared to non-neoplastic breast tissues (Fritz et al., 1999). Activation of Rho GTPase can confer carcinogenesis and enhance resistance to chemotherapy (Hein et al., 2016). Furthermore, Wnt-induced activation of Rho-GTPase can promote YAP / TAZ activation in HEK293A cells (Park et al., 2015). However, it is unknown whether aberrant expression of ROR1 contributes to the activation of Rho-GTPase signaling, YAP / TAZ activation, or BMI1 in breast cancer cells, or whether ROR1-dependent signaling enhances drug resistance and / or tumor cell self-renewal.

Prior Art Documents

Non-Patent Documents

[0010]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Non-Patent Document 9

Non - Patent Document 10

Non - Patent Document 11

Non - Patent Document 12

Non - Patent Document 13

Non-Patent Document 14

Non-Patent Document 15

Non-Patent Document 16

Non-Patent Document 17

Non-Patent Document 18

Non-Patent Document 19

Non-Patent Document 20

Non - Patent Document 21

Non - Patent Document 22

Non - Patent Document 23

[0011] Solutions to these and other problems in the art are provided herein. [Means for solving the problem]

[0012] (Summary of the invention) In an embodiment, a method of treating chemotherapy-resistant cancer in a subject in need thereof is provided, the method comprising administering to the subject a therapeutically effective amount of a chemotherapeutic agent and a therapeutically effective amount of a tyrosine kinase-like orphan receptor 1 (ROR1) antagonist, thereby treating the chemotherapy-resistant cancer in the subject.

[0013] In an embodiment, a method of treating breast cancer in a subject in need thereof is provided, the method comprising administering to the subject a therapeutically effective amount of a chemotherapeutic agent and a therapeutically effective amount of a tyrosine kinase-like orphan receptor 1 (ROR1) antagonist, thereby treating chemotherapy-resistant breast cancer in the subject.

[0014] In an aspect, a pharmaceutical composition is provided that includes: (i) a chemotherapeutic agent selected from the group consisting of a plant alkaloid, an antitumor antibiotic, and a topoisomerase inhibitor; (ii) a ROR-1 antagonist; and (iii) a pharmaceutically acceptable excipient.

[0015] In an aspect, a pharmaceutical composition is provided that includes (i) a chemotherapeutic agent selected from the group consisting of a plant alkaloid, an antitumor antibiotic, and a topoisomerase inhibitor, (ii) an anti-ROR-1 antibody, and (iii) a pharmaceutically acceptable excipient, wherein the chemotherapeutic agent and the anti-ROR-1 antibody are present in a combined synergistic amount, and the combined synergistic amount is effective to treat breast cancer in a subject in need thereof. [Brief description of the drawings]

[0016] [Figure 1A] Figure 1 shows the expression of ROR1 and CSC-related genes before and after chemotherapy. Enrichment plots of Rac1 / RhoA / cdc42 signaling pathway, Hippo-YAP target genes, and BMI1 target genes on ROR1Hi tumors (N=61) versus ROR1Low tumors (N=61) from patients prior to treatment in the GSE87455 dataset. [Figure 1B] Figure 1 shows expression of ROR1 and CSC-related genes before and after chemotherapy. ROR1 or ALDH1A1 expression levels in breast cancer patient samples before ("pre") or after ("post") chemotherapy (post, pre, N=57). Lines indicate median expression levels of genes in pre- vs. post-treatment subgroups. [Figure 1C]Figure 1 shows the expression of ROR1 and CSC-related genes before and after chemotherapy. Enrichment plot of genes activated by Rac1 / RhoA / cdc42 signaling on post-treatment samples (N=57) versus corresponding pre-treatment samples (N=57) in the GSE87455 dataset. [Figure 1D] Figure 1 shows the expression of ROR1 and CSC-related genes before and after chemotherapy. Immunoblot analysis for the proteins shown on the right using lysates prepared from breast cancer tissues of treatment-naive patients. Probing for β-actin served as a protein loading control. Numbers under each lane represent the ratio of band density for each protein to that of β-actin, normalized with respect to the ratio indicated for patient 1. [Figure 1E] Figure 1 shows the expression of ROR1 and CSC-related genes before and after chemotherapy.Pearson correlation analysis for ROR1 vs. TAZ or ROR1 vs. BMI1 in breast cancer biopsies obtained from patients before treatment. [Figure 1F] Figure 1 shows the expression of ROR1 and CSC-related genes before and after chemotherapy. Representative images of breast cancer tissues stained with anti-ROR1 mAb, 4A5. Scale bar: 25 μM. [Figure 1G] Figure 1 shows the expression of ROR1 and CSC-related genes before and after chemotherapy. Immunohistochemical staining of ROR1 in breast biopsy specimens obtained from patients before (pre) or after (post) treatment with docetaxel / epirubicin ± cyclophosphamide. P values ​​were determined using Fisher's exact test. [Figure 2A] Figure 1 shows that ROR1+ breast cancer cells are enriched for cells with phenotypic and functional characteristics of breast CSCs following paclitaxel treatment. The graph depicts the mean tumor growth over time (±SEM) for animals that received no treatment (square data points, N=7) or paclitaxel on the days indicated by the arrows (circle data points, N=5). [Figure 2B]Figure 1 shows that ROR1+ breast cancer cells are enriched for cells with phenotypic and functional characteristics of breast CSCs after paclitaxel treatment. Lysates from PDX4 or PDX5 isolated from untreated mice (-) or from mice treated with paclitaxel (+), as shown above, were tested for ROR1 or 13-actin, the latter serving as a protein loading control. The numbers under each lane are the ratio of band density of ROR1 to 13-actin, normalized to the band density for PDX isolated from untreated mice. [Figure 2C] Figure 1 shows that ROR1+ breast cancer cells are enriched for cells with phenotypic and functional features of breast CSCs following paclitaxel treatment. The histogram depicts the mean number ± SEM of PDX4 or PDX5 derived spheroids excised from untreated mice (open bars, N=3) or paclitaxel-treated mice (black bars, N=3). Representative photomicrographs on the left of the histogram depict spheroids of PDX excised from untreated mice or from mice receiving paclitaxel, as shown on the left border. Scale bar: 100 μm. [Figure 2D] Figure 1 shows that ROR1+ breast cancer cells are enriched for cells with phenotypic and functional features of breast CSCs following paclitaxel treatment. Histograms depict the average number of infiltrating cells from PDX4 or PDX5 excised from untreated mice (open bars, N=3) or paclitaxel-treated mice (black bars, N=3) ± SEM. Representative photomicrographs to the left of the histograms depict infiltrating cells in PDXs excised from untreated mice or from mice receiving paclitaxel, as shown on the left border. Scale bar: 100 μm. [Figure 2E]Figure 1 shows that ROR1+ breast cancer cells are enriched for cells with phenotypic and functional characteristics of breast CSCs after paclitaxel treatment. Tumor cells were isolated from PDX4 or PDX5 mice, shown in the left border, that received no treatment (untreated) or were treated with paclitaxel (paclitaxel). Tumors isolated from each PDX were re-implanted into mice (N=5) and tumor incidence was recorded. The left panel provides representative pictures of tumors isolated from untreated mice or from mice that received paclitaxel. The frequency and potential assessment of tumorigenic cells is provided in the right panel using extreme limiting dilution analysis (ELDA) software. [Figure 3A] Figure 1 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Immunoblot analysis for the proteins shown on the right using lysates prepared from Hs578T cells (parental) or Hs578T knocked out for ROR1 (ROR1- / -) stimulated with Wnt5a for the times indicated above. Numbers under each lane represent the ratio of band density for each protein to that of 13-actin, normalized with respect to cells treated without Wnt5a. [Figure 3B] Figure 1 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Immunoblot analysis for the proteins shown on the right using lysates of Hs578T cells treated with isotype control IgG (hIgG) or cirmtuzumab and then stimulated with Wnt5a for the times indicated above. Numbers below each lane represent the ratio of band density per protein to that of 13-actin, normalized with respect to hIgG-treated cells without Wnt5a. [Figure 3C]Figure 3: Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Immunoblot analysis for the proteins indicated on the right border using lysates from parental or ROR1- / - Hs578T cells treated without (-) or with (+) Wnt5a as indicated above. Numbers under each lane are as in 3A. [Figure 3D] Figure 2: Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Photomicrographs of parental (top row) or ROR1- / - Hs578T cells (bottom row) treated without or with Wnt5a, then stained for YAP / TAZ and DAPI as shown above, and then examined using confocal microscopy. Scale bar: 20 μm. Histograms to the right of the photomicrographs provide the average percentage of YAP / TAZ located within the nucleus of cells in each field (N=10, ±SEM). [Figure 3E] Figure 3: Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Immunoblot analysis for the proteins indicated on the right using lysates prepared from Hs578T cells cultured with cirumtuzumab or hIgG and then treated without or with Wnt5a as indicated above. Numbers under each lane are as in 3B. [Figure 3F] Figure 1 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Photomicrographs of Hs578T cells cultured overnight with cirumtuzumab or hIgG (shown on the left), then treated for 4 hours without or with Wnt5a (shown below), then stained for YAP / TAZ and DAPI (shown above) and then examined using confocal microscopy. Scale bar: 20 μm. Histograms on the right of the photomicrographs provide the average percentage of YAP / TAZ located within the nucleus of cells in each field (N=10, ±SEM). [Figure 3G]Figure 2: Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Immunoblot analysis for the proteins indicated on the right using lysates of parental or ROR1- / - Hs578T (shown below) treated with Wnt5a for the times indicated above. Numbers below each lane are the ratios of band densities of BMI1 vs. 13-actin, pAKT vs. total AKT, or ROR1 vs. 13-actin normalized to the band densities of samples collected at time 0. [Figure 3H] Figure 3 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Immunoblot analysis for the proteins shown on the right using lysates of Hs578T treated with control siRNA or AKT-specific siRNA (AKT-siRNA) as shown above. Numbers under each lane are as in 3G. [Figure 3I] Figure 3 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Immunoblot analysis for the proteins indicated on the right border using lysates of Hs578T treated overnight with hIgG or cirumtuzumab as indicated above, and then without or with Wnt5a. Numbers under each lane are as in 3G. [Figure 3J] Figure 3 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Immunoblot analysis for the proteins indicated on the right border using lysates of Hs578T treated overnight with hIgG or cirumutuzumab, then with Wnt5a for the times indicated above. Numbers under each lane are as in 3G. [Figure 3K] 1 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Histograms depict the mean number ± SEM of spheroids derived from parental or ROR1- / - Hs578T treated in triplicate without or with Wnt5a. [Figure 3L]Figure 2 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Histograms depict the mean number of invading cells ± SEM from parental or ROR1- / - Hs578T treated in triplicate without or with Wnt5a. [Figure 3M] Figure 2 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Percentage viable cells of parental or ROR1- / - Hs578T cultured in medium supplemented without or with Wnt5a (as indicated in legend) and then treated with paclitaxel at the concentrations indicated below. Data points represent the mean percentage of viable cells ± SEM for triplicate wells. [Figure 3N] Figure 2 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. The bar graph depicts the mean number of spheroids ± SEM derived from Hs578T cells incubated overnight with hIgG or cirumtuzumab and then treated with or without Wnt5a in three separate culture wells. Open bars indicate the number of spheroids detected during the first passage (1st) and closed bars provide the number of spheroids at the second passage (2nd) in three separate culture wells ± SEM. [Figure 3O] Figure 2 shows that Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1.The bar graph depicts the mean number of invading cells ± SEM from Hs578T cells incubated overnight with hIgG or cirumutuzumab and then treated with or without Wnt5a in three separate culture wells. [Figure 3P] Figure 3: Wnt5a induces ROR1-dependent activation of Rho-GTPases, YAP / TAZ and BMI1. Percent viable cells of Hs578T cultured in medium containing hIgG or sirumtuzumab supplemented without or with Wnt5a (as indicated in legend) and then treated with paclitaxel at the concentrations indicated below. Data points represent the mean percent viable cells ± SEM for triplicate wells. [Figure 4A] Sirmutuzumab suppresses Hippo-YAP and BMI1 activation and inhibits breast cancer PDX engraftment, self-renewal and metastasis. Line graphs depict the mean tumor growth of PDX4 or PDX5 over time for animals that received no treatment (data points are represented by squares) or were treated with silmutuzumab (data points are represented by circles) on the days indicated by the black arrows (±SEM, N=6-8). Using Student's t-test, one asterisk indicates P<0.05 and two asterisks indicate P<0.01. [Figure 4B] Sirmutuzumab suppresses Hippo-YAP and BMI1 activation and inhibits breast cancer PDX engraftment, self-renewal and metastasis. Bar graphs provide the mean weight of tumors excised from mice in each group described in FIG. 1A (±SEM, N=6-8). [Figure 4C] Sirmutuzumab suppresses Hippo-YAP and BMI1 activation and inhibits breast cancer PDX engraftment, self-renewal and metastasis. HE staining of lung tissue from representative tumor-bearing mice implanted with PDX5 cells and treated with control hIgG or irmutuzumab shown on the left. Dotted circles highlight metastatic foci. Scale bar: 100 μm. Scatter plots show the mean number of metastatic foci found in the lungs of each animal by treatment group (± SEM, N=6). [Figure 4D] Sirmutuzumab suppresses Hippo-YAP and BMI1 activation and inhibits breast cancer PDX engraftment, self-renewal and metastasis. Enrichment plots of genes associated with Rho-GTPase, Hippo-YAP or BMI1 activation in PDXs derived from PDX4 in mice treated with control hIgG vs. Sirmutuzumab, or upregulated in CD44+ / CD24Low cells (CD44+ / CD24Low UP) as assessed via RNAseq (GSE108632). [Figure 4E]Sirmutuzumab suppresses Hippo-YAP and BMI1 activation and inhibits breast cancer PDX engraftment, self-renewal and metastasis. Immunoblot analysis for the proteins shown on the right using lysates prepared from PDX4 or PDX5 (shown below) excised from mice treated with control hIgG or sirmutuzumab as shown above. The numbers under each row are the ratios of band densities of activated vs. total GTPase, pAKT vs. total AKT, BMI1, ABCG2, TAZ / YAP, CTGF vs. 13-actin or ROR1 vs. 13-actin normalized to the band density of the initial control sample. [Figure 4F] Sirmutuzumab suppresses Hippo-YAP and BMI1 activation and inhibits breast cancer PDX engraftment, self-renewal and metastasis. Representative contour plots showing relative expression of CD44 and CD24 on tumor cells isolated from PDX4 removed from mice treated with hIgG or sirmutuzumab. Scatter plots show the average ratio of CD44+ / CD24Low found in PDX4 tumors from each group (N=6). [Figure 4G] Figure 1 shows that Sirmutuzumab suppresses Hippo-YAP and BMI1 activation and inhibits breast cancer PDX engraftment, self-renewal and metastasis. The table provides the number of mice that developed tumors (numerator) versus the number of mice that were transplanted with cells from PDX4 or PDX5 (shown in the left column) (denominator), which were removed from mice treated with hIgG or cirumtuzumab (shown in the second column). In these experiments, mice received varying numbers of tumor cells (shown in the horizontal column under "Cell Number"). The frequency of tumorigenic cells calculated using ELDA software is provided in the second column from the right. P values ​​indicate significant differences between tumorigenic frequencies of tumor cells recovered from hIgG- versus cirumtuzumab-treated mice. [Figure 5A]Figure 1 shows that cirumtuzumab and paclitaxel have complementary activities against breast cancer PDXs. Line graphs depict the mean tumor growth of PDX4 or PDX5 over time in mice that were untreated (control, data points represented by squares) or treated with cirumtuzumab (data points represented by circles) on the days indicated by black arrows, paclitaxel (data points represented by up-pointing triangles) or both (data points represented by down-pointing triangles) on the days indicated by red arrows (±SEM, N=8-10). [Figure 5B] Figure 1 shows that cirumtuzumab and paclitaxel have complementary activities against breast cancer PDXs. Immunoblot analysis of the proteins shown on the right using lysates prepared from PDX4 isolated from untreated (control) or treated with cirumtuzumab, paclitaxel, or both mice as shown above. Numbers under each row are the band density ratios as in 4E. [Figure 5C] Figure 1 shows that cirumtuzumab and paclitaxel have complementary activities against breast cancer PDXs. The table provides the number of mice that developed PDXs (numerator) versus the number of mice that were implanted with cells derived from PDX4 or PDX5 (shown in the top row) removed from mice treated with hIgG, cirumtuzumab, paclitaxel, or cirumtuzumab and paclitaxel (shown in the leftmost column). In these experiments, mice received varying numbers of tumor cells (shown in the row under the PDX name). The bottom panel provides pictures of representative tumors that developed in mice implanted with tumor cells derived from PDX4 removed from untreated or cirumtuzumab and / or paclitaxel-treated mice shown on the right. [Figure 6A]Figure 1 shows that ROR1Hi breast cancers have higher levels of genes associated with Rho-GTPase, Hippo-YAP, or BMI1 activation than ROR1Low breast cancers. Enrichment plot of genes associated with Rac1 / RhoA / cdc42, Hippo-YAP, and BMI1 activation for ROR1Low and ROR1Hi sample groups (N=25) from GSE21974. SIZE is the number of genes included in the analysis. NES (normalized enrichment score) accounts for differences in gene set size and can be used to compare analysis results across gene sets. FDRq-val (false positive rate q-value) is the estimated probability that a gene set with a given NES represents a false positive. Each gene set is considered significant if its false positive rate (FDR) is less than 0.25. The central portion of the plot indicates where members of the gene set appear in the ranked list of genes. [Figure 6B] Figure 1 shows that ROR1Hi breast cancers have higher levels of genes associated with activation of Rho-GTPase, Hippo-YAP or BMI1 than ROR1Low breast cancers. ROR1 or ALDH1A1 expression levels in matched breast cancer patient samples before ("pre") or after ("post") chemotherapy (Post, Pre, N=25). Lines indicate median expression levels of genes in pre vs. post treatment groups. [Figure 7A]Figure 1: ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel or form xenografts than ROR1Low breast cancers. Gating strategy for primary tumor cells isolated from each PDX. Single cell suspensions were made from excised tumor nodules and stained with propidium iodide (PI), calcein violet or fluorescein diacetate (FDA) and a fluorochrome-conjugated mAb specific for EpCAM or an irrelevant antigen (control). Gating was done on cells with appropriate forward light scatter (FSC) and side scatter (SSC) characteristics (left). Dead cells labeled with PI were excluded and gated on live cells stained with calcein violet (middle). Cells were also stained with a fluorochrome-conjugated mAb and therefore gated on human breast cancer cells stained with a mAb specific for EpCAM (right). [Figure 7B] Figure 1 shows that ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel, or form xenografts than ROR1Low breast cancers. Cells from each PDX were stained for ROR1 with 4A5 or control mAb, and for ALDOFLUOR without (-) or with (+) the ALDH1 inhibitor, DEAB, shown above each column of histograms. The open boxes in each contour plot in the top row indicate the gates used to define cells with ALDH1 activity, and the percentages are shown. The open boxes to the left of the contour plots depict the gates used to identify cells that indeed lack ALDH1 activity. The bottom row contains histograms depicting the fluorescence of cells that were negative (left) or positive (right) for ALDH1 activity. The right panel provides the staining intensity for ROR1 in ALDH1+ vs. ALDH1Neg cells from each of the five different PDX tumors. [Figure 7C]Figure 1 shows that ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel, or form xenografts than ROR1Low breast cancers. Cells from each PDX were stained with CD44, CD24, 4A5, or control mAb. Histograms depict the fluorescence of gated CD44+ / CD24Low or CD44+ / CD24+ cells, shaded histograms depict the fluorescence of cells stained with isotype control mAb, and open histograms depict the fluorescence of cells stained with 4A5. The right panel provides ROR1 staining intensity of CD44+CD24Low vs. CD44+CD24+ cells from each of the five different PDXs. The numbers in each plot provide the mean fluorescence intensity ratio (MFIR) for ROR1, which is derived by dividing the mean fluorescence intensity (MFI) of cells labeled with anti-ROR1 mAb by the MFI of cells labeled with control antibody. [Figure 7D] Figure 1 shows that ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel or form xenografts than ROR1Low breast cancers. Tissue sections of PDX1-5 were stained with 4A5 for detection of ROR1 by IHC. Scale bar: 15 μm. [Figure 7E] Figure 1 shows that ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel, or form xenografts than ROR1Low breast cancers. PDX tumors were tested for ROR1 or BMI1 via immunoblot analysis. [Figure 7F]Figure 1 shows that ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel, or form xenografts than ROR1Low breast cancers. Confocal microscopy examining ROR1 or YAP / TAZ on single tumor cells isolated from PDX tumors. Scale bar: 20 μm. Right bar graph provides the average percentage of nuclear YAP / TAZ in cells isolated from each PDX. [Figure 7G] Figure 1 shows that ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel, or form xenografts than ROR1Low breast cancers. Photomicrographs of spheroids generated by cells isolated from each of the PDXs. Scale bar: 100 μm. Bar graphs depict the average number of spheroids ± SEM formed by cells from each PDX in triplicate wells. [Figure 7H] Figure 1: ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel or form xenografts than ROR1Low breast cancers. Representative photomicrographs of invasive cells derived from isolated tumor cells of each PDX. To the right of the photomicrographs are bar graphs depicting the mean relative percentage (±SEM) of tumor cells that migrated into Matrigel from each tumor cell population in three independent experiments, each normalized to the percentage of tumor cells from PDX5 that migrated into Matrigel. Scale bar: 10 μm. A single asterisk represents P<0.05 using Dunnett's multiple comparison test, ** means P<0.01, and *** represents P<0.001. [Figure 7I]Figure 1 shows that ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel, or form xenografts than ROR1Low breast cancers. Single cell suspensions were generated from each PDX removed from untreated (untreated) or paclitaxel-treated PDX-implanted mice. ROR1 enzyme activity was tested through flow cytometry. (I) Open histograms depict the fluorescence intensity of cells stained with anti-ROR1. Shaded histograms depict the fluorescence intensity of cells stained with control antibody. Numbers in each histogram depict the percentage of ROR1+ cells. [Figure 7J] Figure 1 shows that ROR1Hi breast cancer expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel, or form xenografts than ROR1Low breast cancer. Single cell suspensions were generated from each PDX removed from untreated or paclitaxel-treated PDX-implanted mice. ALDH1 enzyme activity was tested through flow cytometry. DEAB, an inhibitor of ALDH1 enzyme activity, was used to identify cells with ALDH1 activity. The open box to the right of the contour plot depicts the gate used to identify cells that were positive for ALDH1 activity. The numbers in each histogram depict the percentage of ALDH1+ cells. [Figure 7K] Figure 1 shows that ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel, or form xenografts than ROR1Low breast cancers. Strategy for sorting ROR1+ versus ROR1Neg cells. Open boxes indicate the gates used to select ROR1Neg (left) or ROR1+ (right) cells. [Figure 7L]Figure 1 shows that ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade Matrigel, or form xenografts than ROR1Low breast cancers. Photomicrographs of spheroids formed from ROR1+ or ROR1Neg cells isolated from each of the PDXs shown above. Scale bar: 100 μm. Bar graphs on the right depict the average number of spheroids ± SEM formed by each of the cell preparations in three separate cultures as shown below the histograms. [Figure 7M] Figure 1 shows that ROR1Hi breast cancers expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade matrigel or form xenografts than ROR1Low breast cancers. Photomicrographs of matrigel-invading cells derived from ROR1+ or ROR1Neg cells isolated from different PDXs as indicated above. Scale bar: 10 μm. Bar graphs on the right depict the average relative invasion (± SEM) of cells into matrigel per cell preparation in three independent experiments, normalized to the average relative invasion of cells from PDX5. [Figure 7N] Figure 1 shows that ROR1Hi breast cancer expressed higher levels of markers associated with CSCs and had a greater ability to form spheroids, invade matrigel, or form xenografts than ROR1Low breast cancer. Tumor incidence in animals implanted with ROR1+ or ROR1Neg cells isolated from each of the various breast cancer PDXs. The frequency and probability estimates of tumorigenic cells were calculated using ELDA software. ND indicates not done. [Figure 8A] Figure 1 shows that enhanced BMI1 expression induced by Wnt5a is dependent on AKT activation. BMI1 mRNA levels in Hs578T cells treated with 100 ng / ml Wnt5a at the indicated time points were examined by quantitative PCR (qPCR). Data shown were the mean expression levels of BMI1 in triplicates and compared to time 0 samples normalized for GAPDH. Error bars indicate SEM. [Figure 8B] Figure 1 shows that enhanced BMI1 expression induced by Wnt5a is dependent on AKT activation. Hs578T cells were cultured in serum-free medium, pretreated with or without MK-2206 for 3 hours, and then stimulated with or without 100 ng / ml Wnt5a for 6 hours. BMI1, pAKT, and AKT were examined in these samples through immunoblot analysis. The numbers under the row for AKT provide the ratio of band density of pAKT to AKT normalized to the band density of the sample treated with Wnt5a for 0 minutes. β-actin served as a protein loading control. The numbers under the row for BMI1 provide the ratio of band density of BMI1 to β-actin normalized with respect to the band density of the sample treated with Wnt5a for 0 minutes. [Figure 9A] FIG. 1 shows that treatment with cirumtuzumab was able to inhibit YAP / TAZ activity and BMI1 expression in vitro and suppress tumor growth in vivo. Lysates from PDX1-PDX5 were examined for expression of Wnt5a, shown on the right border. β-actin served as a loading control. [Figure 9B] FIG. 1 shows that treatment with cirumutuzumab was able to inhibit YAP / TAZ activity and BMI1 expression in vitro and suppress tumor growth in vivo. Single cell suspensions isolated from PDX4 or PDX5 treated with 50 μg / ml cirumutuzumab or control antibody for 4 hours were examined for YAP / TAZ through confocal microscopy. The right bar graph provides the average percentage of nuclear YAP / TAZ in cells in each field. Scale bar: 20 μm. [Figure 9C] Fig. 1 shows that treatment with cirumutuzumab was able to inhibit YAP / TAZ activity and BMI1 expression in vitro and suppress tumor growth in vivo. Lysates from PDX4 or PDX5 treated with 50 μg / ml cirumutuzumab antibody or control antibody for the indicated times were probed for BMI1, ROR1 or 13-actin via immunoblot analysis. [Figure 9D]Figure 1 shows that treatment with cirumutuzumab was able to inhibit YAP / TAZ activity and BMI1 expression in vitro and suppress tumor growth in vivo. Representative photomicrographs of spheroids formed from isolated tumor cells of different PDXs treated with 50 μg / ml of control antibody or cirumutuzumab. The bar graph in the right panel depicts the mean number of spheroids ± SEM formed from tumor cells of PDX4 or PDX5 treated with cirumutuzumab or control antibody in three separate culture wells for each treatment. [Figure 9E] FIG. 1 shows that treatment with cirumtuzumab was able to inhibit YAP / TAZ activity and BMI1 expression in vitro and suppress tumor growth in vivo. Representative photomicrographs of invaded cells derived from isolated tumor cells of different PDXs treated with 50 μg / ml of control antibody or cirumtuzumab. To the right of the photomicrographs are bar graphs depicting the mean number of invaded cells ± SEM for each of the cell preparations in three independent experiments. Scale bar: 10 μm. [Figure 9F] Figure 1: Treatment with cirumtuzumab was able to inhibit YAP / TAZ activity and BMI1 expression in vitro and suppress tumor growth in vivo. 1x106 cells from each PDX sample in 50μl were mixed with an equal volume of matrigel and then injected into the mammary pad of female Rag2- / -γc- / - mice. Tumor growth was monitored over time for 42 or 48 days. Representative pictures of each PDX removed at day 42 (PDX5) or 48 (PDX4). Scale bar: 1cm. [Figure 10] FIG. 1 shows that treatment with sirumtuzumab enhanced the sensitivity of breast cancer cells to paclitaxel. Single cell suspensions of PDX4 or PDX5 samples were treated with sirumtuzumab or control antibody for 24 hours with or without increasing concentrations of paclitaxel. Data are presented as the mean (±SEM) percent viable cells of triplicate samples from each of the treatments as determined by flow cytometry analysis. A single asterisk indicates P<0.05 and ** indicates P<0.01 as determined by Student's t-test. [Figure 11]Figure 1 shows line graphs depicting mean tumor growth (±SEM, n=6-8) over time for PDX3, PDX4 and PDX5, respectively, for animals that received no treatment (square data points) or were treated with cirmtuzumab on the days indicated by the arrows (circle data points). One asterisk indicates P<0.05 and two asterisks indicate P<0.01 using Student's t-test. [Figure 12] Figure 1 shows photomicrographs of spheroids formed from ROR1 HI or ROR1 Neg cells isolated from each of the PDXs shown above. Scale bar: 100 μm. Bar graphs on the right depict the mean number of spheroids ± SEM formed by each of the cell preparations in three separate cultures as shown below the histograms. [Figure 13] Photomicrographs of Matrigel invaded cells from ROR1 HI or ROR1 Low cells isolated from the different PDXs shown above. Scale bar: 10 μm. Bar graphs on the right depict the average invaded cells (± SEM) into Matrigel per field for 10-20 fields of each of the cell preparations in three independent cultures. [Figure 14] Figure 1 shows tumor incidence in animals implanted with ROR1 Hi or ROR1 Low cells isolated from each of the various breast cancer PDXs. The frequency and probability estimates of tumorigenic cells were calculated using ELDA software. ND indicates not done. [Figure 15] Figure 1 shows ROR1 or ALDH1A1, Wnt5a expression levels in matched breast cancer patient samples before ("pre") or after ("post") chemotherapy (post, pre, N=57, GSE87455). [Figure 16] Figure 2 shows ROR1, ALDH1A1 or Wnt5a expression levels in matched breast cancer patient samples before ("pre") or after ("post") chemotherapy (Post, Pre, N=25, GSE21974). Lines indicate median expression levels of genes in pre vs. post treatment groups. [Figure 17]Gene set enrichment (GSE) analysis for genes associated with CD44+ / CD24Low MS, ETM, activation of Rac1 / RhoA / cdc42, Hippo-YAP, BMI1 for ROR1 Low and ROR1 Hi sample groups (N=25) or in breast cancer biopsies from patients undergoing neoadjuvant chemotherapy (N=25) versus matched pre-treatment samples (N=25) in the GSE21974 database. SIZE is the number of genes included in the analysis. NES (normalized enrichment score) accounts for differences in gene set size and can be used to compare analysis results across gene sets. NOM p-val (nominal p-value) is the statistical significance of the enrichment score unadjusted for gene set size or multiple gene set testing, and FDR q-val (false discovery rate q-value) is the estimated probability that a gene set with a given NES represents a false positive. Each gene set is considered significant if its false discovery rate (FDR) is less than 0.25. [Figure 18] 1×106 cells from each PDX sample in 50 μl were mixed with an equal volume of Matrigel and then injected into the mammary pads of female Rag2− / − γc− / − mice 2 days (PDX5) or 48 days (PDX4). Tumor growth was monitored over time for 42 or 48 days. Scale bar: 1 cm. [Figure 19] FIG. 19 shows a bar graph providing the average weight of tumors excised from mice in each group described in FIG. 18 (±SEM, N=5-8). [Figure 20] FIG. 13 shows enrichment plots of genes associated with EMT in PDXs derived from PDX4 in mice treated with control hIgG vs. cirumtuzumab as assessed through RNAseq (GSE108632). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] I. Definition While various embodiments and aspects of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments and aspects are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be used in practicing the invention.

[0018] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including, without limitation, patents, patent applications, articles, books, handbooks, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose.

[0019] Abbreviations used herein have their conventional meaning within the chemical and biological arts. The chemical structures and formulas depicted herein are constructed according to standard rules of chemical valency known in the chemical arts.

[0020] When a substituent is specified by its conventional chemical formula written from left to right, the substituent equally encompasses the chemically identical substituted moieties that would result from writing the structure from right to left, e.g., -CH 2 O-OCH 2 - is equivalent to

[0021] The term "alkyl," by itself or as part of another substituent, means, unless otherwise stated, a linear (i.e., unbranched) or branched acyclic carbon chain (or carbons), or combinations thereof, which may be fully saturated, monounsaturated or polyunsaturated, and which can include divalent and polyvalent groups, having the indicated number of carbon atoms (i.e., C 1 ~C 10means 1-10 carbons). Examples of saturated hydrocarbon groups include, but are not limited to, groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, (cyclohexyl)methyl, and homologs and isomers such as n-pentyl, n-hexyl, n-heptyl, n-octyl, and the like. Unsaturated alkyl groups are groups that have one or more double or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and the higher homologs and isomers. An alkoxy is an alkyl that is attached to the remainder of the molecule through an oxygen linker (-O-). The alkyl moiety may be an alkenyl moiety. The alkyl moiety may be an alkynyl moiety. The alkyl moiety may be fully saturated. The alkenyl may contain more than one double bond and / or one or more triple bonds in addition to one or more double bonds. The alkynyl may contain more than one triple bond and / or one or more double bonds in addition to one or more triple bonds.

[0022] The term "alkylene," by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from alkyl, -CH 2 CH 2 CH 2 CH 2 Examples include, but are not limited to, -. Typically, alkyl(ene) groups have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred in the present invention. A "lower alkyl" or "lower alkylene" is a shorter chain alkyl or alkylene group, generally having 8 or fewer carbon atoms. The term "alkenylene," by itself or as part of another substituent, means a divalent radical derived from an alkene, unless otherwise stated.

[0023] The term "heteroalkyl," alone or in combination with another term, means, unless otherwise stated, a stable linear or branched acyclic chain or combination thereof that contains at least one carbon atom and at least one heteroatom (e.g., O, N, P, Si, and S), where the nitrogen and sulfur atoms may be optionally oxidized and the nitrogen heteroatom may be optionally quaternized. The heteroatom (e.g., O, N, P, S, and Si) may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. An example is -CH 2 -CH 2 -O-CH 3 , -CH 2 -CH 2 -NH-CH 3 , -CH 2 -CH 2 -N(CH 3 )-CH 3 , -CH 2 -S-CH 2 -CH 3 , -CH 2 -CH 2 , -S(O)-CH 3 , -CH 2 -CH 2 -S(O) 2 -CH 3 , -CH=CH-O-CH 3 , -Si(CH 3 ) 3 , -CH 2 -CH=N-OCH 3 , -CH=CH-N(CH 3 )-CH 3 , -O-CH 3 , -O-CH 2 -CH 3 For example, -CH 2 -NH-OCH 3 and -CH 2 -O-Si(CH 3 ) 3and up to two or three heteroatoms may be consecutive, such as: A heteroalkyl moiety may contain one heteroatom (e.g., O, N, S, Si, or P). A heteroalkyl moiety may contain two optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may contain three optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may contain four optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may contain five optionally different heteroatoms (e.g., O, N, S, Si, or P). A heteroalkyl moiety may contain up to eight optionally different heteroatoms (e.g., O, N, S, Si, or P). The term "heteroalkenyl", alone or in combination with another term, means a heteroalkyl containing at least one double bond, unless otherwise stated. Heteroalkenyl may optionally include more than one double bond and / or one or more triple bonds in addition to one or more double bonds. The term "heteroalkynyl", alone or in combination with another term, means, unless otherwise stated, a heteroalkyl containing at least one triple bond. Heteroalkynyl may optionally include more than one triple bond and / or one or more double bonds in addition to one or more triple bonds.

[0024] Similarly, the term "heteroalkylene," by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from heteroalkyl, -CH 2 -CH 2 -S-CH 2 -CH 2 - and -CH 2 -S-CH 2 -CH 2 -NH-CH 2Exemplary heteroalkylene groups include, but are not limited to, -. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, a group of the formula -C(O) 2 R'- is -C(O) 2 R'-mo-R'C(O) 2 As mentioned above, heteroalkyl groups as used herein include -C(O)R', -C(O)NR', ​​-NR'R'', -OR', -SR' and / or -SO. 2 It includes groups that are attached to the remainder of the molecule through a heteroatom, such as -R'. When "heteroalkyl" is recited followed by a description of a specific heteroalkyl group, such as -NR'R" or the like, it is understood that the terms heteroalkyl and -NR'R" are not redundant and are not mutually exclusive. Rather, the specific heteroalkyl group is recited to add clarity. Thus, the term "heteroalkyl" should not be construed herein as excluding a specific heteroalkyl group, such as -NR'R" or the like.

[0025] The terms "cycloalkyl" and "heterocycloalkyl", alone or in combination with other terms, mean, unless otherwise stated, non-aromatic cyclic versions of "alkyl" and "heteroalkyl", respectively, in which the carbons making up the ring(s) are not necessarily bonded to hydrogen, with all carbon valences participating in bonds other than with hydrogen atoms. Furthermore, in heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, 3-hydroxy-cyclobut-3-enyl-1,2,dione, 1H-1,2,4-triazolyl-5(4H)-one, 4H-1,2,4-triazolyl, and the like. Examples of heterocycloalkyl include, but are not limited to, 1-(1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl, 2-piperazinyl, and the like. "Cycloalkylene" and "heterocycloalkylene", alone or as part of another substituent, refer to a divalent radical derived from a cycloalkyl and a heterocycloalkyl, respectively. A heterocycloalkyl moiety may contain one ring heteroatom (e.g., O, N, S, Si, or P). A heterocycloalkyl moiety may contain two optionally different ring heteroatoms (e.g., O, N, S, Si, or P). A heterocycloalkyl moiety may contain three optionally different ring heteroatoms (e.g., O, N, S, Si, or P). A heterocycloalkyl moiety may contain four, optionally different, ring heteroatoms (e.g., O, N, S, Si, or P). A heterocycloalkyl moiety may contain five, optionally different, ring heteroatoms (e.g., O, N, S, Si, or P). A heterocycloalkyl moiety may contain up to eight, optionally different, ring heteroatoms (e.g., O, N, S, Si, or P).

[0026] The terms "halo" or "halogen," alone or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom. Additionally, terms such as "haloalkyl" are intended to include monohaloalkyl and polyhaloalkyl. For example, the term "halo(C 1 ~C 4 )Alkyl" includes, but is not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the like.

[0027] The term "acyl," unless otherwise stated, means -C(O)R, where R is substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

[0028] The term "aryl", unless otherwise stated, refers to a polyunsaturated aromatic hydrocarbon substituent moiety, which can be a single ring or multiple rings (preferably 1-3 rings) that are fused together (i.e., fused ring aryl) or covalently linked together. Fused ring aryl refers to multiple rings fused together, where at least one between the fusions is an aryl ring. The term "heteroaryl" refers to an aryl group (or ring) that contains at least one heteroatom, such as N, O, or S, where the nitrogen and sulfur atoms are optionally oxidized and the nitrogen atom is optionally quaternized. Thus, the term "heteroaryl" includes fused ring heteroaryl groups (i.e., multiple rings fused together, where at least one of the fused rings is a heteroaromatic ring). 5,6-fused ring heteroarylene refers to two rings fused together, where one ring has 5 members and the other ring has 6 members, and at least one ring is a heteroaryl ring. Similarly, a 6,6-fused ring heteroarylene refers to two rings fused together, one ring having 6 members and the other ring having 6 members, and at least one ring being a heteroaryl ring. Additionally, a 6,5-fused ring heteroarylene refers to two rings fused together, one ring having 6 members and the other ring having 5 members, and at least one ring being a heteroaryl ring. The heteroaryl group can be bonded to the rest of the molecule through a carbon or heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, Includes 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl and 6-quinolyl.Substituents for each of the above aryl and heteroaryl ring systems are selected from the group of acceptable substitutents described below. "Arylene" and "heteroarylene," alone or as part of another substituent, refer to a divalent radical derived from an aryl and heteroaryl, respectively. Non-limiting examples of aryl and heteroaryl groups include pyridinyl, pyrimidinyl, thiophenyl, thienyl, furanyl, indolyl, benzoxadiazolyl, benzodioxolyl, benzodioxanyl, thianaphthalyl, pyrrolopyridinyl, indazolyl, quinolinyl, quinoxalinyl, pyridopyrazinyl, chirazolinonyl, benzisoxazolyl, imidazopyridinyl, benzofuranyl, benzothienyl, benzothiophenyl, phenyl, naphthyl, biphenyl, The heteroaryl moieties include pyrrolyl, pyrazolyl, imidazolyl, pyrazinyl, oxazolyl, isoxazolyl, thiazolyl, furylthienyl, pyridyl, pyrimidyl, benzothiazolyl, purinyl, benzimidazolyl, isoquinolyl, thiadiazolyl, oxadiazolyl, pyrrolyl, diazolyl, triazolyl, tetrazolyl, benzothiadiazolyl, isothiazolyl, pyrazolopyrimidinyl, pyrrolopyrimidinyl, benzotriazolyl, benzoxazolyl, or quinolyl. The above examples may be substituted or unsubstituted, and the divalent radicals of each of the above heteroaryl examples are non-limiting examples of heteroarylene. The heteroaryl moiety may contain one ring heteroatom (e.g., O, N, or S). The heteroaryl moiety may contain two optionally different ring heteroatoms (e.g., O, N, or S). The heteroaryl moiety may contain three optionally different ring heteroatoms (e.g., O, N, or S). The heteroaryl moiety may contain four optionally different ring heteroatoms (e.g., O, N, or S). The heteroaryl moiety may contain five optionally different ring heteroatoms (e.g., O, N, or S). The aryl moiety may have a single ring. The aryl moiety may have two optionally different rings. The aryl moiety may have three optionally different rings. The aryl moiety may have four optionally different rings. The heteroaryl moiety may have one ring. The heteroaryl moiety may have two optionally different rings.The heteroaryl moiety may have three, optionally different rings. The heteroaryl moiety may have four, optionally different rings. The heteroaryl moiety may have five, optionally different rings.

[0029] A fused ring heterocycloalkyl-aryl is an aryl fused to a heterocycloalkyl. A fused ring heterocycloalkyl-heteroaryl is a heteroaryl fused to a heterocycloalkyl. A fused ring heterocycloalkyl-cycloalkyl is a heterocycloalkyl fused to a cycloalkyl. A fused ring heterocycloalkyl-heterocycloalkyl is a heterocycloalkyl fused to another heterocycloalkyl. A fused ring heterocycloalkyl-aryl, a fused ring heterocycloalkyl-heteroaryl, a fused ring heterocycloalkyl-cycloalkyl, or a fused ring heterocycloalkyl-heterocycloalkyl can each independently be unsubstituted or substituted with one or more of the substitution moieties described herein.

[0030] The term "oxo," as used herein, means an oxygen that is double bonded to a carbon atom.

[0031] The term "alkylsulfonyl" as used herein refers to a group of the formula -S(O 2 )-R', where R' is a substituted or unsubstituted alkyl group as defined above. R' has a specified number of carbons (e.g., "C 1 ~C 4 The alkyl group may have a substituent such as "alkylsulfonyl."

[0032] Each of the above terms (e.g., "alkyl," "heteroalkyl," "cycloalkyl," "heterocycloalkyl," "aryl" and "heteroaryl") includes both substituted and unsubstituted forms of the indicated radical. Preferred substitution moieties for each type of radical are provided below.

[0033] Substituent moieties for alkyl and heteroalkyl groups (including groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) include, but are not limited to, -OR', ═O, ═NR', ═N-OR', -NR'R", -SR', -halogen, -SiR'R"R"', -OC(O)R', -C(O)R', -CO 2 R', -CONR'R", -OC(O)NR'R", -NR"C(O)R', -NR'-C(O)NR"R"', -NR"C(O) 2 R', -NR-C(NR'R"R"')=NR"", -NR-C(NR'R")=NR"', -S(O)R', -S(O) 2 R', -S(O) 2 NR'R", -NRSO 2 R', -NR'NR"R"', -ONR'R", -NR'C=(O)NR"NR"'R"", -CN, -NO 2 can be one or more of a variety of groups selected from a number ranging from 0 to (2m'+1), where m' is the total number of carbon atoms in such group. R, R', R", R"' and R"" each preferably independently represent hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl (e.g., aryl substituted with 1-3 halogens), substituted or unsubstituted heteroaryl, substituted or unsubstituted alkyl, alkoxy or thioalkoxy, or arylalkyl groups. When a compound of the invention includes more than one R group, for example, each of the R groups is independently selected to be R', R", R"', and R"" groups, respectively, when more than one of these groups is present. When R' and R" are attached to the same nitrogen atom, R' and R" can be combined with the nitrogen atom to form a 4-, 5-, 6-, or 7-membered ring. For example, -NR'R" includes, but is not limited to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substitute moieties, one of skill in the art will appreciate that the term "alkyl" can also include haloalkyl (e.g., -CF 3 and -CH 2 CF 3) and acyl (e.g., -C(O)CH 3 , -C(O)CF 3 , -C(O)CH 2 OCH 3 It is understood that groups that contain carbon atoms bonded to groups other than hydrogen groups, such as, for example, aryl, aryloxy ...

[0034] Similar to the substituents described for the alkyl groups, the substituents for the aryl and heteroaryl groups are varied and include, for example, -OR', -NR'R", -SR', -halogen, -SiR'R"R"', -OC(O)R', -C(O)R', -CO 2 R', -CONR'R", -OC(O)NR'R", -NR"C(O)R', -NR'-C(O)NR"R"', -NR"C(O) 2 R', -NR-C(NR'R"R"')=NR"", -NR-C(NR'R")=NR"', -S(O)R', -S(O) 2 R', -S(O) 2 NR'R", -NRSO 2 R', -NR'NR"R"', -ONR'R", -NR'C=(O)NR"NR"'R"", -CN, -NO 2 , -R', -N 3 , -CH(Ph) 2 , Fluoro(C 1 ~C 4 ) alkoxy and fluoro(C 1 ~C 4 ) to zero up to the total number of open valences on the aromatic ring system, with R', R", R'" and R"" preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. When a compound of the invention includes more than one R group, for example, each of the R groups is independently selected as are R', R", R'' and R"" groups, respectively, when more than one of these groups is present.

[0035] Two or more substitution moieties may be optionally bonded to form an aryl, heteroaryl, cycloalkyl or heterocycloalkyl group. Such so-called ring-forming substitution moieties are typically, but not necessarily, found bonded to a cyclic base structure. In an embodiment, the ring-forming substitution moieties are bonded to adjacent members of the base structure. For example, two ring-forming substitution moieties bonded to adjacent members of a cyclic base structure create a fused ring structure. In another embodiment, the ring-forming substitution moieties are bonded to a single member of the base structure. For example, two ring-forming substitution moieties bonded to a single member of a cyclic base structure create a spiro ring structure. In yet another embodiment, the ring-forming substitution moieties are bonded to non-adjacent members of the base structure.

[0036] Two of the substitution moieties on adjacent atoms of the aryl or heteroaryl ring are optionally represented by the formula -TC(O)-(CRR') q -U-, where T and U are independently -NR-, -O-, -CRR'- or a single bond, and q is an integer from 0 to 3. Alternatively, two of the substitution moieties on adjacent atoms of the aryl or heteroaryl ring may optionally form a ring of the formula -A-(CH 2 ) r A and B may be independently replaced by -CRR'-, -O-, -NR-, -S-, -S(O)-, -S(O) 2 -, -S(O) 2 NR'- or a single bond, where r is an integer from 1 to 4. One of the single bonds of the new ring so formed may optionally be replaced with a double bond. Alternatively, two of the replacement moieties on adjacent atoms of the aryl or heteroaryl ring may optionally be of the formula -(CRR')s-X'-(C"R"R"') d -, s and d are independently integers of 0 to 3, and X' is -O-, -NR'-, -S-, -S(O)-, -S(O) 2 -, -S(O) 2It is NR'-. The substitution moieties R, R', R" and R"' are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.

[0037] As used herein, the term "heteroatom" or "ring heteroatom" is meant to include oxygen (O), nitrogen (N), sulfur (S), phosphorus (P) and silicon (Si).

[0038] "Substituent," as used herein, refers to the following moieties: (A) Oxo, halogen, -CF 3 , -CN, -OH, -NH 2 , -COOH, -CONH 2 , -NO 2 , -SH, -SO 3 H, -SO 4 H, -SO 2 NH 2 , -NHNH 2 , -ONH 2 , -NHC=(O)NHNH 2 , -NHC=(O)NH 2 , -NHSO 2 H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF 3 , -OCHF 2 , unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and (B)(i) oxo, halogen, -CF 3 , -CN, -OH, -NH 2 , -COOH, -CONH 2 , -NO 2 , -SH, -SO 3 H, -SO 4 H, -SO 2 NH 2 , -NHNH 2 , -ONH 2 , -NHC=(O)NHNH 2, -NHC=(O)NH 2 , -NHSO 2 H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF 3 , -OCHF 2 , unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and (ii)(a) oxo, halogen, -CF 3 , -CN, -OH, -NH 2 , -COOH, -CONH 2 , -NO 2 , -SH, -SO 3 H, -SO 4 H, -SO 2 NH 2 , -NHNH 2 , -ONH 2 , -NHC=(O)NHNH 2 , -NHC=(O)NH 2 , -NHSO 2 H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF 3 , -OCHF 2 , unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and (b) Oxo, halogen, -CF 3 , -CN, -OH, -NH 2 , -COOH, -CONH 2 , -NO 2 , -SH, -SO 3 H, -SO 4 H, -SO 2 NH 2 , -NHNH 2 , -ONH 2 , -NHC=(O)NHNH 2 , -NHC=(O)NH 2 , -NHSO 2 H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -OCF 3 , -OCHF 2, alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl substituted with at least one substitution component selected from unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, and unsubstituted heteroaryl. Alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl substituted with at least one substituent selected from Alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl substituted with at least one substituent selected from means a group selected from

[0039] "Size-limited substitution moiety" or "size-limited substituent" as used herein means a group selected from any of the substitution moieties described above for "substituent", each substituted or unsubstituted alkyl being a substituted or unsubstituted C 1 ~C 20 each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2- to 20-membered heteroalkyl; and each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C 3 ~C 8 each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3- to 8-membered heterocycloalkyl; each substituted or unsubstituted aryl is a substituted or unsubstituted C 6 ~C 10 aryl, and each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5-10 membered heteroaryl.

[0040] A "lower substituted moiety" or "lower substituent" as used herein means a group selected from any of the substituted moieties described above for "substituent", and each substituted or unsubstituted alkyl is a substituted or unsubstituted C 1 ~C 8 each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2-8 membered heteroalkyl; and each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3 ~C 7 each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3- to 7-membered heterocycloalkyl; each substituted or unsubstituted aryl is a substituted or unsubstituted C 6 ~C 10 aryl, and each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5- to 9-membered heteroaryl.

[0041] In some embodiments, each of the substituents described in the compounds herein is substituted with at least one substituent. More specifically, in some embodiments, each of the substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene and / or substituted heteroarylene described in the compounds herein is substituted with at least one substituent. In other embodiments, at least one or all of these groups are substituted with at least one size-limiting substituent. In other embodiments, at least one or all of these groups are substituted with at least one lower substituent.

[0042] In other embodiments of the compounds herein, each substituted or unsubstituted alkyl is a substituted or unsubstituted C 1 ~C 20 each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2- to 20-membered heteroalkyl; each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C 3 ~C 8 each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3- to 8-membered heterocycloalkyl; each substituted or unsubstituted aryl is a substituted or unsubstituted C 6 ~C 10 In some embodiments of the compounds herein, each substituted or unsubstituted alkylene is a substituted or unsubstituted C 1~C 20 each substituted or unsubstituted heteroalkylene is a substituted or unsubstituted 2- to 20-membered heteroalkylene; each substituted or unsubstituted cycloalkylene is a substituted or unsubstituted C 3 ~C 8 each substituted or unsubstituted heterocycloalkylene is a substituted or unsubstituted 3- to 8-membered heterocycloalkylene; each substituted or unsubstituted arylene is a substituted or unsubstituted C 6 ~C 10 arylene, and / or each substituted or unsubstituted heteroarylene is a substituted or unsubstituted 5- to 10-membered heteroarylene.

[0043] In some embodiments, each substituted or unsubstituted alkyl is a substituted or unsubstituted C 1 ~C 8 each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2-8 membered heteroalkyl; and each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C 3 ~C 7 each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3- to 7-membered heterocycloalkyl; each substituted or unsubstituted aryl is a substituted or unsubstituted C 6 ~C 10 In some embodiments, each substituted or unsubstituted alkylene is a substituted or unsubstituted aryl, and / or each substituted or unsubstituted heteroaryl is a substituted or unsubstituted 5-9 membered heteroaryl. 1 ~C 8 each substituted or unsubstituted heteroalkylene is a substituted or unsubstituted 2-8 membered heteroalkylene; each substituted or unsubstituted cycloalkylene is a substituted or unsubstituted C 3 ~C 7 each substituted or unsubstituted heterocycloalkylene is a substituted or unsubstituted 3- to 7-membered heterocycloalkylene; each substituted or unsubstituted arylene is a substituted or unsubstituted C 6 ~C 10and / or each substituted or unsubstituted heteroarylene is a substituted or unsubstituted 5- to 9-membered heteroarylene. In some embodiments, the compound is a species shown in the Examples section below, in a Figure or in a Table.

[0044] Thus, the compounds of the present invention may exist as salts, such as with pharma- ceutically acceptable acids. The present invention includes such salts. Examples of such salts include hydrochlorides, hydrobromides, sulfates, methanesulfonic acids, nitrates, maleates, acetates, citrates, fumarates, tartrates (e.g., (+) tartrates, (-) tartrates or mixtures thereof, including racemic mixtures), succinates, benzoates, and salts with amino acids, such as glutamic acid. These salts may be prepared by methods known to those skilled in the art.

[0045] The neutral forms of the compounds are preferably regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner. The parent form of the compound differs from the various salt forms in certain physical properties, such as solubility in polar solvents.

[0046] Provided herein are agents (e.g., compounds, drugs, therapeutic agents) that may be in the form of prodrugs. Prodrugs of the compounds described herein are compounds that readily undergo chemical changes under selected physiological conditions to provide the final agent (e.g., compounds, drugs, therapeutic agents). Additionally, prodrugs can be converted to agents (e.g., compounds, drugs, therapeutic agents) by chemical or biochemical methods in an ex vivo environment. Prodrugs described herein include compounds that readily undergo chemical changes under selected physiological conditions to provide agents (e.g., compounds, drugs, therapeutic agents) to a biological system (e.g., in a subject).

[0047] Certain compounds of the present invention can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, solvated forms are equivalent to unsolvated forms and are included within the scope of the present invention. Certain compounds of the present invention can exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated by the present invention and are intended to be within the scope of the present invention.

[0048] As used herein, the term "salt" refers to an acid or base salt of a compound used in the method of the present invention. Illustrative examples of acceptable salts are mineral acid (hydrochloric acid, hydrobromic acid, phosphoric acid, etc.) salts, organic acid (acetic acid, propionic acid, glutamic acid, citric acid, etc.) salts, and quaternary ammonium (methyl iodide, ethyl iodide, etc.) salts.

[0049] Certain compounds of the present invention have asymmetric carbon atoms (optical or enantiomeric centers) or double bonds; enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisomeric forms and individual isomers that may be defined in terms of absolute stereochemistry as (R)- or (S)-, or (D)- or (L)- for amino acids, are encompassed within the scope of the present invention. The compounds of the present invention do not include compounds known in the art to be too unstable to synthesize and / or isolate. The present invention is intended to include compounds in racemic and optically pure form. Optically active (R)- and (S)-, or (D)- and (L)-isomers may be prepared using enantiomeric synthons or enantiomeric reagents or resolved using conventional techniques. When the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, it is intended that the compounds include both E and Z geometric isomers, unless otherwise specified.

[0050] As used herein, the term "isomers" refers to compounds that have the same number and kinds of atoms, and therefore the same molecular weight, but differ with respect to the structural or stereochemical arrangement of the atoms.

[0051] The term "tautomer," as used herein, refers to one of two or more structural isomers that exist in equilibrium and are readily converted from one isomeric form to another.

[0052] It will be apparent to one of ordinary skill in the art that certain compounds of the present invention may exist in tautomeric forms, with all such tautomeric forms of the compounds being within the scope of the present invention.

[0053] Unless otherwise stated, structures depicted herein are also intended to include all stereochemical forms of the structure; i.e., the R and S configurations for every asymmetric center. Therefore, single stereochemical isomers as well as enantiomeric and diastereomeric mixtures of the present compounds are within the scope of the invention.

[0054] Unless otherwise stated, structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, a hydrogen is replaced by deuterium or tritium, or a carbon is replaced by 13 C- or 14 Compounds having the present structure except for the replacement with a C-enriched carbon are within the scope of this invention.

[0055] The compounds of the present invention may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may contain, for example, tritium ( 3 H), Iodine-125( 125 I) or carbon 14 ( 14 The compounds may be radiolabeled with a radioactive isotope, such as C. All isotopic variations of the compounds of the present invention, whether radioactive or not, are encompassed within the scope of the present invention.

[0056] "Analog" and "analogue" are used interchangeably and according to their plain and ordinary meaning within chemistry and biology to refer to a chemical compound that is structurally similar to another compound (i.e., a so-called "reference" compound) but differs in composition, e.g., in the replacement of one atom by an atom of a different element, or in the absolute stereochemistry of one or more chiral centers of the reference compound, including the presence or replacement of a particular functional group by another functional group, or isomers thereof. Thus, an analog is a compound that is similar or comparable in function and appearance to the reference compound, but not in structure or origin.

[0057] The terms "a" or "an" as used herein means one or more. Additionally, the phrase "substituted with a[n]" as used herein means that the specified group may be substituted with one or more of any or all of its specified substitution moieties. For example, a group such as "an" alkyl or heteroalkyl group may be substituted with "an" unsubstituted C. 1 ~C 20 When "substituted with alkyl, or unsubstituted 2- to 20-membered heteroalkyl," the group is substituted with one or more unsubstituted C 1 ~C 20 It may contain alkyl and / or one or more unsubstituted 2-20 membered heteroalkyl.

[0058] The description of the compounds of the present invention is limited by the principles of chemical bonding known to those skilled in the art.Therefore, when a group may be substituted by one or more of several substitution moieties, such substitution moieties are selected according to the principles of chemical bonding to give compounds that are not inherently unstable and / or that are known to those skilled in the art to be potentially unstable under ambient conditions, such as aqueous, neutral, and some known physiological conditions.For example, heterocycloalkyl or heteroaryl are bonded to the rest of the molecule through ring heteroatoms according to the principles of chemical bonding known to those skilled in the art, thereby avoiding inherently unstable compounds.

[0059] The term "antibody" is used according to its commonly known meaning in the art. Antibodies exist, for example, as intact immunoglobulins or as a number of well-characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests antibodies below the disulfide bonds in the hinge region to produce F(ab)' 2 , which itself is connected to V by a disulfide bond. H -C H1 The resulting dimer is a Fab dimer bound to a light chain, F(ab)'. 2 is reduced under mild conditions to cleave the disulfide bond in the hinge region, thereby forming F(ab)' 2 The dimer is converted to a Fab' monomer, which is essentially a Fab with part of the hinge region (Fundamental Immunology (ed. Paul, 3rd ed., 1993)). Although various antibody fragments have been defined in terms of the digestion of an intact antibody, one skilled in the art will recognize that such fragments can be synthesized de novo, either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, also includes antibody fragments produced by the modification of whole antibodies or antibody fragments synthesized de novo using recombinant DNA methodology (e.g., single chain Fv) or antibody fragments identified using a phage display library (e.g., McCafferty et al., Nature 348:552-554 (1990)).

[0060] The term "antibody" refers to a polypeptide encoded by an immunoglobulin gene or functional fragment thereof which specifically binds to and recognizes an antigen. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD, and IgE, respectively.

[0061] The phrases "specifically (or selectively) bind" to an antibody or "specifically (or selectively) immunoreactive with," when referring to a protein or peptide, often refer to a binding reaction that determines the presence of the protein in a heterogeneous population of proteins and biologics. Thus, under specified immunoassay conditions, a particular antibody will bind to a particular protein at least twice background, and more typically 10-100 times background or more. Specific binding to an antibody under such conditions requires that the antibody be selected for its specificity for a particular protein. For example, polyclonal antibodies can be selected to obtain only a subset of antibodies that are specifically immunoreactive with a selected antigen and not with other proteins. This selection may be accomplished by subtracting out antibodies that cross-react with other molecules. A variety of immunoassay formats may be used to select antibodies that are specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Using Antibodies, A Laboratory Manual (1998) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).

[0062] An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical paired polypeptide chains, each pair having one "light" (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The N-terminus of each chain defines a variable region of about 100-110 or more amino acids that are primarily responsible for antigen recognition. The terms "variable heavy chain", "V H " or "VH" refers to the variable region of an immunoglobulin heavy chain, including Fv, scFv, dsFv, or Fab; L " or "VL" refers to the variable region of an immunoglobulin light chain, including Fv, scFv, dsFv or Fab.

[0063] Examples of antibody functional fragments include, but are not limited to, complete antibody molecules, antibody fragments such as Fv, single chain Fv (scFv), complementarity determining regions (CDRs), VL (light chain variable region), VH (heavy chain variable region), Fab, F(ab)2', and any combination thereof, or any other functional portion of an immunoglobulin peptide capable of binding to a target antigen (see, for example, FUNDAMENTAL IMMUNOLOGY (Paul, ed., 4th ed., 2001)). As will be appreciated by those skilled in the art, various antibody fragments can be obtained in a variety of ways, for example, by digestion of intact antibodies with enzymes such as pepsin; or by de novo synthesis. Antibody fragments are often synthesized de novo, either chemically or by using recombinant DNA methods. Thus, the term antibody, as used herein, also includes antibody fragments produced by the modification of whole antibodies or antibody fragments synthesized de novo using recombinant DNA methodologies (e.g., single-chain Fvs) or antibody fragments identified using phage display libraries (see, e.g., McCafferty et al., (1990) Nature 348:552). The term "antibody" also includes bivalent or bispecific molecules, diabodies, triabodies and tetrabodies. Bivalent or bispecific molecules are described, for example, in Kostelny et al. (1992) J. Immunol. 148:1547, Pack and Pluckthun (1992) Biochemistry 31:1579, Hollinger et al. (1993) PNAS.USA 90:6444, Gruber et al. (1994) J Immunol. 152:5368, Zhu et al. (1997) Protein Sci. 6:781, Hu et al. (1996) Cancer Res. 56:3055, Adams et al. (1993) Cancer Res. 53:4026 and McCartney et al. (1995) Protein Eng. 8:301.

[0064] A "chimeric antibody" is an antibody molecule in which (a) the constant region or a portion thereof has been altered, replaced or exchanged so that the antigen binding site (variable region) is linked to a constant region of a different or altered class of effector function and / or species, or an entirely different molecule that confers new properties to the chimeric antibody, such as an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region or a portion thereof has been altered, replaced or exchanged with a variable region having a different or altered antigen specificity. Preferred antibodies of and for use in accordance with the invention include humanized and / or chimeric monoclonal antibodies.

[0065] "Contacting" is used according to its plain and ordinary meaning to refer to the process of bringing at least two different species (e.g., chemical compounds, including biological molecules or cells) into sufficient proximity to react, interact, or be in physical contact. However, it should be recognized that the resulting reaction product may be produced directly from the reaction between the added reagents or from an intermediate from one or more of the added reagents that may be produced in the reaction mixture.

[0066] The term "contacting" can include reacting, interacting, or having two species in physical contact, which can be a compound described herein and a protein or enzyme. In some embodiments, contacting includes allowing a compound described herein to interact with a protein or enzyme involved in a signal transduction pathway.

[0067] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.See, for example, Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed., J.Wiley&Sons (New York, NY 1994); Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold Springs Harbor, NY 1989). Any method, device and material similar or equivalent to the method, device and material described herein can be used to carry out the present invention. The following definitions are provided to facilitate understanding of certain terms frequently used herein and are not intended to limit the scope of the present disclosure.

[0068] As may be used herein, the terms "nucleic acid," "nucleic acid molecule," "nucleic acid oligomer," "oligonucleotide," "nucleic acid sequence," "nucleic acid fragment," and "polynucleotide" are used interchangeably and are intended to include, but are not limited to, a polymeric form of nucleotides covalently linked together that may be of various lengths, deoxyribonucleotides or ribonucleotides, or analogs, derivatives, or modifications thereof. Different polynucleotides may have different three-dimensional structures and may perform different functions, known or unknown. Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, intergenic DNA (including, but not limited to, heterochromatic DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA sequences, isolated RNA sequences, nucleic acid probes, and primers. Polynucleotides useful in the methods of the present disclosure may include naturally occurring nucleic acid sequences and variants thereof, artificial nucleic acid sequences, or combinations of such sequences.

[0069] A polynucleotide is typically composed of a specific sequence of the four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (uracil (U) is substituted for thymine (T) when the polynucleotide is RNA). Thus, the term "polynucleotide sequence" is the alphabetical representation of a polynucleotide molecule, or the term may apply to the polynucleotide molecule itself. This alphabetical representation can be entered into a database in a computer with a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. A polynucleotide may optionally include one or more non-standard nucleotides, nucleotide analogs, and / or modified nucleotides.

[0070] An amino acid residue in a protein "matches" a given residue if it occupies the same essential structural position as the given residue in the protein.

[0071] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those that are subsequently modified, such as hydroxyproline, γ-carboxyglutamic acid, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an α carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, such as homoserine, norleucine, methionine sulfoxide, and methionine methylsulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a structure that differs from the general chemical structure of an amino acid, but functions in a manner similar to a naturally occurring amino acid. The terms "non-naturally occurring amino acid" and "unnatural amino acid" refer to amino acid analogs, synthetic amino acids, and amino acid mimetics that are not found in nature.

[0072] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may also be referred to by their commonly accepted one-letter codes.

[0073] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, which in embodiments may be conjugated to a moiety not composed of amino acids. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of a corresponding naturally occurring amino acid, as well as to naturally occurring and non-naturally occurring amino acid polymers. A "fusion protein" refers to a chimeric protein encoding two or more separate protein sequences that are recombinantly expressed as a single moiety.

[0074] The terms "peptidyl" and "peptidyl moiety" refer to a monovalent peptide.

[0075] "Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to a particular nucleic acid sequence, "conservatively modified variants" refers to nucleic acids that code for identical or essentially identical amino acid sequences. Due to the degeneracy of the genetic code, some nucleic acid sequences code for any given protein. For example, the codons GCA, GCC, GCG, and GCU all code for the amino acid alanine. Thus, at every position where alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one type of conservatively modified variation. Every nucleic acid sequence herein that codes for a polypeptide also describes all possible silent variations of that nucleic acid. Those skilled in the art will recognize that each codon in a nucleic acid (except AUG, which is usually the only codon for methionine, and TGG, which is usually the only codon for tryptophan) can be altered to produce a functionally identical molecule. Thus, each silent variation of a nucleic acid that codes for a polypeptide is implicit in each described sequence.

[0076] With respect to amino acid sequences, one of skill in the art will recognize that individual substitutions, deletions, or additions to a nucleic acid, peptide, polypeptide, or protein sequence that alter, add, or delete a single amino acid, or a small percentage of amino acids in the encoded sequence, are "conservatively modified variants," in which the alteration replaces an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to, and do not exclude, polymorphic variants, interspecies homologs, and alleles of the present disclosure.

[0077] The following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) Cysteine ​​(C), Methionine (M) (See, for example, Creighton, Proteins (1984)).

[0078] The term "numbered with respect to" or "corresponding to", when used in the context of numbering a given amino acid or polypeptide sequence, refers to the numbering of residues in a specified reference sequence when the given amino acid or polynucleotide sequence is compared to the reference sequence. An amino acid residue in a protein "corresponds to" a given residue if it occupies the same essential structural position in the protein as the given residue. A person skilled in the art will readily recognize the identity and position of a residue that corresponds to a particular position of a protein (e.g., ROR-1) in other proteins with different numbering systems. For example, by performing a simple sequence alignment with a protein (e.g., ROR-1), the identity and position of a residue that corresponds to a particular position of the protein is identified in other protein sequences that align to the protein.

[0079] "Percent sequence identity" is determined by comparing two optimally aligned sequences over a comparison window, where the portion of the polynucleotide or polypeptide sequence in the comparison window may contain additions or deletions (i.e., gaps) as compared to the reference sequence (which contains no additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where an identical nucleic acid base or amino acid residue is present in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percent sequence identity.

[0080] The term "identical" or percent "identity", in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of the same amino acid residues or nucleotides (i.e., about 60% identity over a specified region, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity, when compared and aligned for maximum correspondence over a comparison window or specified region) as measured using the BLAST or BLAST 2.0 sequence comparison algorithm with default parameters as described below, or by manual alignment and visual inspection (see, e.g., the NCBI web site http: / / www.ncbi.nlm.nih.gov / BLAST / or the like). Such sequences are then said to be "substantially identical". This definition may also refer to or apply to the complement of a test sequence. This definition also includes sequences that have deletions and / or additions, as well as sequences that have substitutions. As described below, preferred algorithms can account for gaps, etc. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.

[0081] An amino acid or nucleotide base "position" is designated by a number that sequentially identifies each amino acid (or nucleotide base) in the reference sequence based on its position relative to the N-terminus (or 5'-terminus). Due to deletions, insertions, truncations, fusions, etc., which must be taken into account when determining optimal alignment, in general, the amino acid residue number in a test sequence, determined by simple counting from the N-terminus, is not necessarily the same as the number of its corresponding position in the reference sequence. For example, if a variant has a deletion compared to an aligned reference sequence, there is no amino acid in the variant that corresponds to the position at the site of the deletion in the reference sequence. If there is an insertion in the aligned reference sequence, the insertion does not correspond to a numbered amino acid position in the reference sequence. In the case of truncations or fusions, there can be stretches of amino acids in either the reference or aligned sequence that do not correspond to any amino acid in the corresponding sequence.

[0082] As used herein, the term "abnormal" means different from normal. When used to describe enzyme activity or protein function, abnormal refers to activity or function that is higher or lower than the average of normal control or normal non-disease control samples. Abnormal activity may refer to an amount of activity that results in disease, and restoring the abnormal activity to a normal or non-disease associated amount (e.g., by administering a compound or using a method described herein) reduces the disease or one or more disease symptoms.

[0083] In sequence comparison, typically, one sequence serves as a reference sequence, with which test sequences are compared.When using sequence comparison algorithm, test and reference sequences are input into computer, sequence coordinates are designated if necessary, and sequence algorithm program parameters are designated.Default program parameters can be used, or alternative parameters can be designated.Then, sequence comparison algorithm calculates the percent sequence identity of test sequences compared to reference sequences based on program parameters.

[0084] A "comparison window," as used herein, includes reference to a segment of either the full length sequence or a number of contiguous positions selected from the group consisting of 20 to 600, about 50 to about 200, or about 100 to about 150 amino acids or nucleotides, in which a sequence is compared to a reference sequence for the same number of contiguous positions, for example, after the two sequences have been optimally aligned. Methods for aligning sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be carried out, for example, by the local homology algorithm of Smith and Waterman (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, by the similarity search method of Pearson and Lipman (1988) Proc. Nat'l. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection (see, for example, Ausubel et al., Current Protocols in Molecular Biology (1995 supplement)).

[0085] Examples of algorithms suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402 and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (website at ncbi.nlm.nih.gov / ). This algorithm first identifies high-scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, either of which, when aligned with a word of the same length in a database sequence, matches or meets a certain positive threshold score T. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. The cumulative score is calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of the word hits in each direction reduces the cumulative alignment score by an amount X from its maximum achieved value; it is stopped when the cumulative score falls to zero or below due to the accumulation of one or more negative-scoring residue alignments; or when the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands.For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3 and an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignment (B) 50, expectation (E) 10, M=5, N=-4, and a comparison of both strands.

[0086] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides an indication of the probability that a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered to be similar to a reference sequence if the minimum sum probability in a comparison of the test nucleic acid with the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.

[0087] An indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by a first nucleic acid is immunologically cross-reactive with an antibody raised against the polypeptide encoded by a second nucleic acid, as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, e.g., where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below. Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.

[0088] The term "isolated," as applied to a nucleic acid or protein, means essentially free of other cellular components with which the nucleic acid or protein is naturally associated. The nucleic acid or protein can be, for example, homogeneous, and can be in a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified.

[0089] "Selective" or "selectivity" of a compound or the like refers to the ability of a compound to distinguish between molecular targets (eg, a compound having selectivity for HMT SUV39H1 and / or HMT G9a).

[0090] "Specific," "specifically," "specificity," or the like, of a compound refers to the ability of the compound to cause a particular effect, such as inhibition, on a particular molecular target with minimal or no effect on other proteins in the cell (e.g., a compound with specificity for ROR-1 will exhibit inhibition of the activity of ROR-1, while the same compound will exhibit little or no inhibition of other ROR proteins, such as ROR2).

[0091] The phrases "specifically (or selectively) bind" or "specifically (or selectively) immunoreactive" with an antibody, when referring to a protein or peptide, refer to a binding reaction that is determinative of the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under the designated immunoassay conditions, a given antibody will bind to a particular protein at least twice as much as background and will not substantially bind in significant amounts to other proteins present in the sample. Typically, a specific or selective reaction will be at least twice the background signal or noise, and more typically will be 10-100 times or more above background.

[0092] As used herein, a "cell" refers to a cell that performs metabolic or other functions sufficient to preserve or replicate its genomic DNA. Cells can be identified by methods well known in the art, including, for example, the presence of an intact membrane, staining with certain dyes, the ability to produce progeny, or, in the case of gametes, the ability to combine with a second gamete to produce viable progeny. Cells may include prokaryotic and eukaryotic cells. Prokaryotic cells include, but are not limited to, bacteria. Eukaryotic cells include, but are not limited to, yeast cells and cells derived from plants and animals, such as mammals, insects (e.g., spodoptera), and human cells. Cells can be useful if they are naturally non-adherent or have been treated, for example, by trypsinization, so as not to adhere to surfaces.

[0093] A "stem cell" is a cell characterized by the ability to self-renew through mitotic cell division and the potential to differentiate into tissues or organs. Among mammalian stem cells, embryonic stem cells (ES cells) and somatic stem cells (e.g., HSCs) can be distinguished. Embryonic stem cells are present in placental cysts to give rise to embryonic tissues, while somatic stem cells are present in adult tissues for the purpose of tissue regeneration and repair. As provided herein, "neural stem cells" refer to stem cells that can self-renew through mitotic cell division and differentiate into neural cells (e.g., glial cells, neurons, astrocytes, oligodendrocytes).

[0094] "B cell" or "B lymphocyte" refers to its standard usage in the art. B cells are lymphocytes, a type of white blood cell (leukocyte), that mature into plasma cells ("mature B cells"), which produce antibodies. "Immature B cells" are cells that can mature into mature B cells. Generally, pro-B cells undergo immunoglobulin heavy chain rearrangement to become pro-B pre-B cells, which further undergo immunoglobulin light chain rearrangement to become immature B cells. Immature B cells include T1 and T2 B cells.

[0095] As used herein, a "T cell" or "T lymphocyte" is a type of lymphocyte (a subtype of white blood cells) that plays a central role in cellular immunity. A "T cell" or "T lymphocyte" can be distinguished from other lymphocytes, such as B cells and natural killer cells, by the presence of a T cell receptor on the cell surface. T cells include, for example, natural killer T (NKT) cells, cytotoxic T lymphocytes (CTL), regulatory T (Treg) cells, and T helper cells. Different types of T cells can be distinguished by the use of T cell detection agents.

[0096] "Memory T cells" are T cells that have previously encountered and responded to their cognate antigen during a previous infection, cancer encounter, or previous vaccination. Upon a second encounter with the cognate antigen, memory T cells can regenerate (divide) and mount a faster and stronger immune response than the immune system that originally responded to the pathogen.

[0097] "Regulatory T cells" or "suppressor T cells" are lymphocytes that modulate the immune system, maintain tolerance to self-antigens, and prevent autoimmune diseases.

[0098] As defined herein, the terms "inhibit", "inhibit", "inhibiting" and the like, with respect to protein-inhibitor interactions, refer to negatively affecting (e.g., decreasing) the activity or function of a protein compared to the activity or function of the protein in the absence of the inhibitor. In embodiments, inhibition refers to negatively affecting (e.g., decreasing) the concentration or level of a protein compared to the concentration or level of the protein in the absence of the inhibitor. In embodiments, inhibition refers to reducing a disease or a symptom of a disease. In embodiments, inhibition refers to reducing the activity of a particular protein target. Thus, inhibition includes, at least in part, partially or fully blocking a stimulus, reducing, preventing, or delaying activation, or inactivating, desensitizing, or downregulating a signaling or enzymatic activity or amount of a protein. In embodiments, inhibition refers to reducing the activity of a target protein resulting from a direct interaction (e.g., an inhibitor binds to the target protein). In embodiments, inhibition refers to reducing the activity of a target protein from an indirect interaction (e.g., an inhibitor binds to a protein that activates the target protein, thereby preventing target protein activation). A "ROR1 inhibitor" is a compound that negatively affects (e.g., decreases) the activity or function of ROR1 compared to the activity or function of ROR1 in the absence of the inhibitor. The terms "ROR1 inhibitor" and "ROR1 antagonist" are used interchangeably throughout and have the same meaning as defined herein.

[0099] The terms "inhibitor", "repressor", or "antagonist" or "down-regulator" interchangeably refer to a substance that can detectably reduce the expression or activity of a given gene or protein. Antagonists can reduce expression or activity by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to a control without the antagonist. In certain instances, expression or activity is two-thirds, one-half, one-third, one-quarter, one-fifth, one-tenth or more lower than the expression or activity in the absence of the antagonist.

[0100] The term "disease" or "condition" refers to a condition that is treated or a health condition of a patient or subject that can be treated with the compounds or methods provided herein. The disease may be cancer. The disease may be an autoimmune disease. The disease may be an inflammatory disease. The disease may be an infectious disease. In some further examples, "cancer" refers to human cancers and carcinomas, including solid and lymphatic cancers, sarcomas, adenocarcinomas, lymphomas, leukemias, etc., kidney, breast, lung, bladder, colon, ovarian, prostate, pancreatic, stomach, brain, head and neck, skin, uterus, testes, gliomas, esophageal and liver cancers, including hepatocellular carcinoma, lymphomas, including B acute lymphoblastic lymphoma, non-Hodgkin's lymphoma (e.g., Burkitt's, small cell and large cell lymphoma), Hodgkin's lymphoma, leukemia (including AML, ALL and CML), or multiple myeloma.

[0101] As used herein, the term "inflammatory disease" refers to a disease or condition characterized by abnormal inflammation (e.g., increased levels of inflammation compared to a control, such as a healthy individual, who is not afflicted with the disease). Examples of inflammatory diseases include autoimmune diseases, arthritis, rheumatoid arthritis, psoriatic arthritis, juvenile idiopathic arthritis, multiple sclerosis, systemic lupus erythematosus (SLE), myasthenia gravis, juvenile onset diabetes, diabetes mellitus type 1, Guillain-Barre syndrome, Hashimoto's encephalitis, Hashimoto's thyroiditis, ankylosing spondylitis, psoriasis, Sjogren's syndrome, vasculitis, glomerulonephritis, autoimmune thyroiditis, Behcet's disease, Crohn's disease. , ulcerative colitis, bullous pemphigoid, sarcoidosis, ichthyosis, Graves' ophthalmopathy, inflammatory bowel disease, Addison's disease, vitiligo, asthma, allergic asthma, acne vulgaris, celiac disease, chronic prostatitis, inflammatory bowel disease, pelvic inflammatory disease, reperfusion injury, ischemia-reperfusion injury, stroke, sarcoidosis, transplant rejection, interstitial cystitis, atherosclerosis, scleroderma and atopic dermatitis.

[0102] As used herein, the term "cancer" refers to any type of cancer, neoplasm, or malignant tumor found in a mammal (e.g., human), including leukemia, lymphoma, carcinoma, and sarcoma. Exemplary cancers that may be treated with the compounds or methods provided herein include brain cancer, glioma, glioblastoma, neuroblastoma, prostate cancer, colorectal cancer, pancreatic cancer, medulloblastoma, melanoma, cervical cancer, gastric cancer, ovarian cancer, lung cancer, head cancer, Hodgkin's disease, and non-Hodgkin's lymphoma. Exemplary cancers that may be treated with the compounds or methods provided herein include thyroid, endocrine system, brain, breast, cervix, colon, head and neck, liver, kidney, lung, ovary, pancreas, rectum, stomach, and uterine cancer. Additional examples include thyroid cancer, cholangiocarcinoma, pancreatic adenocarcinoma, skin cutaneous melanoma, colon adenocarcinoma, rectal adenocarcinoma, gastric adenocarcinoma, esophageal cancer, head and neck squamous cell carcinoma, invasive breast carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, non-small cell lung carcinoma, mesothelioma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocythemia, primary macroglobulinemia, primary brain tumors, malignant pancreatic insulinoma, malignant carcinoid, bladder cancer, premalignant skin lesions, testicular cancer, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical carcinoma, neoplasms of the endocrine or exocrine pancreas, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid carcinoma, hepatocellular carcinoma, or prostate cancer.

[0103] As used herein, the terms "metastasis," "metastatic," and "metastatic cancer" are used interchangeably and refer to the spread of a proliferative disease or disorder, e.g., cancer, from one organ or another non-adjacent organ or part of the body. "Metastatic cancer" is also referred to as "Stage IV cancer." Cancer begins at the site of origin, e.g., the breast, which is called the primary tumor, e.g., primary breast cancer. Some cancer cells in the primary tumor or site of origin acquire the ability to penetrate and invade the surrounding normal tissue in the local area and / or penetrate the walls of the lymphatic or vascular system to circulate through the system to other parts and tissues of the body. A second clinically detectable tumor that forms from cancer cells of the primary tumor is called a metastatic or secondary tumor. When cancer cells metastasize, the metastatic tumor and its cells are presumed to be similar to the cells of the first tumor. Thus, if lung cancer metastasizes to the breast, the secondary tumor at the breast site will consist of abnormal lung cells rather than abnormal breast cells. The secondary tumor in the breast is called metastatic lung cancer. Thus, the term metastatic cancer refers to a disease in which a subject has or has had a primary tumor and has one or more secondary tumors.The term non-metastatic cancer or a subject with a non-metastatic cancer refers to a disease in which a subject has a primary tumor but does not have one or more secondary tumors.For example, metastatic lung cancer refers to a disease in a subject who has or has a history of a primary lung tumor and has one or more secondary tumors at a second location or multiple locations, for example, in the breast.

[0104] As used herein, a "chemotherapeutic agent" refers to a molecule (e.g., a compound, a peptide, a protein, a nucleic acid, 0103) used to treat cancer through the destruction or inhibition of cancer cells or tissues. A chemotherapeutic agent may be selective for a particular cancer or a particular tissue. In embodiments, the chemotherapeutic agent herein may be an epigenetic inhibitor and a multikinase inhibitor.

[0105] 15 (Abbott), HTI-286 (i.e., SPA-110, trifluoroacetate salt (Wyeth), D-82317 (Zentaris), D-82318 (Zentaris), SC-12983 (NCI), resverastatin phosphate sodium, BPR-OY-007 (National Health Research Institutes), and SSR-250411 (Sanofi)), steroids (e.g., dexamethasone), finasteride, aromatase inhibitors, gonadotropin releasing hormone agonists (GnRH) such as goserelin or leuprolide, corticosteroids (e.g., prednisone), progestins (e.g., hydroxyprogesterone caproate, megestrol acetate, medroxyprogesterone acetate), estrogens (e.g., diethylstilbestrol, ethinyl estradiol), antiestrogens (e.g., tamoxifen), androgens (e.g., testosterone propionate, fluoxymesterone), antiandrogens (e.g., flutamide), immunostimulants (e.g., bacillariscalmette-Guerin (BCG), levamisole, interleukin-2, alpha interferon, etc.), monoclonal antibodies (e.g., anti-CD20, anti-HER2, anti-CD52, anti-HLA-DR and anti-VEGF monoclonal antibodies), immunotoxins (e.g., anti-CD33 monoclonal antibody-calicheamicin conjugate, anti-CD22 monoclonal antibody-Pseudomonas aeruginosa exotoxin conjugate, etc.), radioimmunotherapy (e.g., 111 In, 90 Y or 131I-conjugated anti-CD20 monoclonal antibodies, etc.), triptolide, homoharringtonine, dactinomycin, doxorubicin, epirubicin, topotecan, itraconazole, vindesine, cerivastatin, vincristine, deoxyadenosine, sertraline, pitavastatin, irinotecan, clofazimine, 5-nonyloxytryptamine, vemurafenib, dabrafenib, erlotinib, gefitinib, EGFR inhibitors anti-cancer drugs, epidermal growth factor receptor (EGFR) targeted therapies or therapeutic agents (e.g., gefitinib (Iressa™), erlotinib (Tarceva™), cetuximab (Erbitux™), lapatinib (Tykerb™), panitumumab (Vectibix™), vandetanib (Caprelsa™), afatinib / BIBW2992, CI-1033 / canertinib, neratinib / HKI-272, These include, but are not limited to, CP-724714, TAK-285, AST-1306, ARRY334543, ARRY-380, AG-1478, dacomitinib / PF299804, OSI-420 / desmethyl erlotinib, AZD8931, AEE788, pelitinib / EKB-569, CUDC-101, WZ8040, WZ4002, WZ3146, AG-490, XL647, PD153035, BMS-599626), sorafenib, imatinib, sunitinib, dasatinib, or the like.

[0106] "ROR1 antagonist" refers to a compound (e.g., a compound described herein) that reduces the activity of ROR1 when compared to a control, such as no compound or a compound known to be inactive.

[0107] The terms "cirmutuzumab," "UC-961," and "99961.1" are used interchangeably herein to refer to a humanized monoclonal antibody capable of binding to the extracellular domain of human receptor tyrosine kinase-like orphan receptor 1 (ROR1). In embodiments, cirmutuzumab is any one of the antibodies or fragments thereof disclosed in U.S. Patent Application No. 14 / 422,519, which is incorporated herein by reference in its entirety for all purposes.

[0108] The term "paclitaxel," also known as taxol or its congeners, refers to the compound identified by CAS Registry Number 33069-62-4 in its ordinary and accustomed sense.

[0109] The term "docetaxel," also known as "DTX," "DXL," "Taxotere," and "Docecad" or the like, refers to the compound identified by CAS Registry Number 114977-28-5, given its ordinary and accustomed meaning.

[0110] The term "epirubicin," also known as "Ellence" or the like, refers to the compound identified by CAS Registry Number 56420-45-2 in its ordinary and accustomed sense.

[0111] The term "doxorubicin," also known as "adriamycin" or its congeners, refers to the compound identified by CAS Registry Number 23214-92-8 in its ordinary and accustomed sense.

[0112] The term "treat" or "treatment" refers to any evidence of successful treatment or amelioration of an injury, disease, condition, or disease, including any objective or subjective parameter, such as reduction; alleviation; reducing symptoms or making the injury, condition, or state more tolerable to the patient; slowing the rate of degeneration or decline; not making the end point of degeneration debilitating; improving the physical or mental well-being of the patient. Treatment or amelioration of symptoms can be based on objective or subjective parameters, including the results of a physical exam, a neuropsychiatric exam, and / or a psychiatric evaluation. The term "treat" and conjugations thereof may include prevention of an injury, condition, state, or disease. In an embodiment, treating is preventing. In an embodiment, treating does not include preventing.

[0113] As used herein (and as is well understood in the art), "treating" or "treatment" broadly includes any approach to obtain beneficial or desired results of a condition of interest, including clinical results. Beneficial or desired clinical results may include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, whether partial or total, detectable or undetectable, reduction in the extent of the disease, stabilizing (i.e., not worsening) the state of the disease, preventing the spread or spread of the disease, delaying or slowing the progression of the disease, remission or alleviation of the disease state, reducing and pacifying the recurrence of the disease. In other words, "treatment" as used herein includes any cure, amelioration, or prevention of the disease. Treatment may prevent the onset of the disease; inhibit the spread of the disease; relieve symptoms of the disease (e.g., eye pain, seeing halos around lights, red eyes, very high eye pressure), completely or partially eliminate the underlying cause of the disease, shorten the duration of the disease, or a combination of these.

[0114] As used herein, "treating" or "treatment" includes preventive treatment. The treatment method includes administering a therapeutically effective amount of an active agent to a subject. The administration step may consist of a single administration or may include a series of administrations. The length of the treatment period depends on various factors, such as the severity of the condition, the age of the patient, the concentration of the active agent, the activity of the composition used in the treatment, or a combination thereof. It is also recognized that the effective dosage of the agent used for treatment or prevention may increase or decrease during a particular treatment or prevention regimen. Changes in dosage may occur and be evident by standard diagnostic assays known in the art. In some cases, chronic administration may be required. For example, the composition is administered to the subject in an amount and for a period sufficient to treat the patient. In an embodiment, the treating or treatment is not a preventive treatment.

[0115] The term "preventing" refers to reducing the occurrence of disease symptoms in a patient. As noted above, prevention may be complete (no detectable symptoms) or partial, with fewer symptoms observed than would likely occur in the absence of treatment.

[0116] "Patient" or "subject in need thereof" refers to a living organism suffering from or prone to a disease or condition that can be treated by administration of the pharmaceutical compositions provided herein. Non-limiting examples include humans, other mammals, cows, rats, mice, dogs, monkeys, goats, sheep, cows, deer, and other non-mammals. In some embodiments, the patient is a human.

[0117] An "effective amount" is an amount sufficient for the compound to achieve a stated purpose (e.g., achieve the effect for which the compound is administered, treat a disease, reduce enzyme activity, enhance enzyme activity, reduce a signal transduction pathway, or reduce one or more symptoms of a disease or condition) compared to the absence of the compound. An example of an "effective amount" is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which amount could also be referred to as a "therapeutically effective amount". A "reduction" of a symptom or symptoms (and grammatical equivalents of this phrase) means a decrease in the severity or frequency of a symptom or the elimination of a symptom. A "prophylactically effective amount" of a drug is an amount of a drug that, when administered to a subject, has an intended prophylactic effect, e.g., prevents or delays the onset (or recurrence) of an injury, disease, pathology, or condition, or reduces the likelihood of the onset (or recurrence) of an injury, disease, pathology, or condition or its symptoms. A complete prophylactic effect does not necessarily occur by administration of one dose, but may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. "Activity-reducing amount", as used herein, refers to the amount of antagonist required to reduce the activity of an enzyme compared to the absence of the antagonist. "Function-disrupting amount", as used herein, refers to the amount of antagonist required to destroy the function of an enzyme or protein compared to the absence of the antagonist. The exact amount will depend on the purpose of the treatment and can be ascertained by one of skill in the art using known techniques (see, for example, Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, ed., Lippincott, Williams & Wilkins).

[0118] For any compound described herein, the therapeutically effective amount can be initially determined from cell culture assays. The target concentration will be the concentration of active compound that is capable of achieving the methods described herein, as measured using methods described herein or known in the art.

[0119] As is well known in the art, therapeutically effective amounts for use in humans can also be determined from animal models.For example, human doses can be formulated to achieve concentrations that have been found to be effective in animals.Dosages in humans can be adjusted by monitoring compound efficacy and adjusting dosage upwards or downwards, as described above.Adjusting dosages to achieve maximum efficacy in humans based on the above and other methods is well within the capabilities of those skilled in the art.

[0120] The term "therapeutically effective amount" as used herein refers to an amount of a therapeutic agent sufficient to ameliorate a disorder, as described above. For example, for a given parameter, a therapeutically effective amount indicates at least a 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90% or at least a 100% increase or decrease. The therapeutic efficacy can also be expressed as a "fold" increase or decrease. For example, a therapeutically effective amount can have at least a 1.2-fold, 1.5-fold, 2-fold, 5-fold or more effect over the control.

[0121] Dosage may vary depending on the patient's requirements and the compound used. The dosage administered to a patient, in the context of this disclosure, should be sufficient to produce an effective therapeutic response in the patient over time. The size of the dose will also be determined by the existence, nature and extent of any adverse side effects. Determining the dosage appropriate for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with relatively small dosages that are less than the optimum dosage of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under the circumstances is reached. Dosage and intervals can be individually adjusted to provide a level of the administered compound that is effective for the particular clinical indication being treated. This will provide a treatment regime commensurate with the severity of the individual's disease state.

[0122] As used herein, the term "administering" refers to oral administration, administration as a suppository, topical contact, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or implantation of a sustained release device, such as a mini-osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal or transdermal). Parenteral administration includes, for example, intravenous, intramuscular, intraarteriolar, intradermal, subcutaneous, intraperitoneal, intraventricular and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, and the like. In embodiments, administration does not include administration of any active agent other than the listed active agents.

[0123] By "co-administered" is meant that the compositions described herein are administered simultaneously, immediately before, or immediately after the administration of one or more additional therapies. The compounds provided herein can be administered alone or simultaneously to a patient. Co-administration is meant to include simultaneous or sequential administration of individual or combinations of compounds (more than one compound). Thus, the preparations can also be combined with other active agents (e.g., to reduce metabolic degradation) if desired. The compositions of the present disclosure can be delivered transdermally by topical routes or formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.

[0124] A "control" sample or value refers to a sample that serves as a reference, usually a known reference, for comparison with a test sample. For example, a test sample can be taken from a test condition, e.g., in the presence of a test compound, and compared to a sample from a known condition, e.g., in the absence of a test compound (negative control) or in the presence of a known compound (positive control). A control can also represent an average value collected from several tests or results. A person skilled in the art will recognize that a control can be designed for the evaluation of any number of parameters. For example, a control can be devised to compare the efficacy of treatment based on pharmacological data (e.g., half-life) or therapeutic treatment (e.g., comparison of side effects). A person skilled in the art will understand which control is valuable in a given situation and can analyze data based on comparison with the control value. Controls are also valuable for determining the significance of data. For example, if the values ​​for a given parameter are widely different in the controls, the variation of the test sample is not considered significant.

[0125] A cancer model organism, as used herein, refers to an organism that displays a phenotype indicative of cancer or the activity of a carcinogenic factor within the organism. The term cancer is defined above. A wide variety of organisms can serve as cancer model organisms, including, for example, cancer cells and mammalian organisms such as rodents (e.g., mice or rats) and primates (e.g., humans). A cancer cell line is broadly understood by those skilled in the art as a cell that displays a phenotype or genotype similar to an in vivo cancer. As used herein, a cancer cell line includes cell lines derived from animals (e.g., mice) and humans.

[0126] As defined herein, the terms "activation," "activate," "activating," "activator," and the like refer to a protein-inhibitor interaction, positively affecting (e.g., increasing) the activity or function of a protein compared to the activity or function of the protein in the absence of the activator. In embodiments, activation refers to positively affecting (e.g., increasing) the concentration or level of a protein compared to the concentration or level of the protein in the absence of the activator. The term may refer to activation, or activating, sensitizing, or upregulating signaling or enzymatic activity or the amount of a protein that is decreased in a disease. Thus, activation may include at least partially, partially, or completely increasing stimulation, increasing or enabling activation, or activating, sensitizing, or upregulating the amount of a protein associated with signaling or enzymatic activity or a disease (e.g., a protein that is decreased in a disease compared to a non-disease control). Activation may include at least partially, partially, or completely increasing stimulation, increasing or enabling activation, or activating, sensitizing, or upregulating signaling or enzymatic activity or the amount of a protein.

[0127] The terms "agonist," "activator," "upregulator," and the like, refer to a substance that can detectably increase the expression or activity of a given gene or protein. An agonist can increase expression or activity by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to a control in the absence of the agonist. In certain instances, expression or activity is 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more over the expression or activity in the absence of the agonist.

[0128] The term "expression" includes any step involved in the production of a polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion. Expression can be detected using conventional techniques for detecting proteins (e.g., ELISA, Western blotting, flow cytometry, immunofluorescence, immunohistochemistry, etc.).

[0129] The term "modulator" refers to a composition that increases or decreases the level of a target molecule or the function of a target molecule or the physical state of a molecular target compared to the absence of the modulator. In some embodiments, a ROR1-associated disease modulator is a compound that reduces the severity of one or more symptoms of a disease associated with ROR1 (e.g., cancer, an inflammatory disease, an autoimmune disease, or an infectious disease). A ROR1 modulator is a compound that increases or decreases the activity or function or the level of activity or the level of function of ROR1.

[0130] The term "modulate" is used according to its plain and ordinary meaning and refers to the act of changing or altering one or more properties. "Modulation" refers to the process of changing or altering one or more properties. For example, when applied to the effect of a modulator on a target protein, modulating means altering the property or function of the target molecule or the amount of the target molecule by increasing or decreasing it.

[0131] The term "associated" or "associated with" in the context of a substance or substance activity or function associated with a disease (e.g., a protein-associated disease, a cancer associated with ROR1 activity, a ROR1-associated cancer, a ROR1-associated disease (e.g., cancer, an inflammatory disease, an autoimmune disease, or an infectious disease)) means that the disease (e.g., a cancer, an inflammatory disease, an autoimmune disease, or an infectious disease) or a symptom of the disease is caused (in whole or in part) by the substance or substance activity or function. For example, a cancer associated with ROR1 activity or function may be a cancer that results (in whole or in part) from aberrant ROR1 function (e.g., enzymatic activity, protein-protein interaction, signaling pathway), or a cancer in which a particular symptom of the disease is caused (in whole or in part) by aberrant ROR1 activity or function. As used herein, something that is described as associated with a disease may be a target for the treatment of the disease if it is a causative agent. For example, a cancer or ROR1-associated disease (e.g., cancer, inflammatory disease, autoimmune disease, or infectious disease) associated with ROR1 activity or function may be treated with a ROR1 modulator or ROR1 inhibitor if increased ROR1 activity or function (e.g., signal transduction pathway activity) causes the disease (e.g., cancer, inflammatory disease, autoimmune disease, or infectious disease). For example, an inflammatory disease or ROR1-associated inflammatory disease associated with ROR1 activity or function may be treated with a ROR1 modulator or ROR1 inhibitor if increased ROR1 activity or function (e.g., signal transduction pathway activity) causes the disease.

[0132] As used herein, the term "signal transduction pathway" refers to a series of interactions between cellular and optionally extracellular components (e.g., proteins, nucleic acids, small molecules, ions, lipids) that transmit a change in one component to one or more other components, which in turn may transmit the change to additional components, which may optionally be propagated to other signal transduction pathway components. For example, binding of ROR1 to a compound described herein may decrease the level of a product of a ROR1-catalyzed reaction or the level of a downstream derivative of that product, or binding may decrease the interaction between the ROR1 enzyme or ROR1 reaction product and a downstream effector or signal transduction pathway component, resulting in altered cell growth, proliferation, or survival.

[0133] As used herein, the term "about" refers to a range of values ​​including the specified value, which one of ordinary skill in the art would consider to be reasonably similar to the specified value. In embodiments, about refers to within a standard deviation using measurements generally accepted in the art. In embodiments, about refers to a range extending to + / - 10% of the specified value. In embodiments, about includes the specified value.

[0134] As used herein, a "synergistic amount" refers to the sum of a first amount (e.g., an amount of a compound provided herein) and a second amount (e.g., a therapeutic agent) that results in a synergistic effect (an effect that is greater than an additive effect). Thus, the terms "synergism," "synergism," "synergistic," "combined synergistic amount," and "synergistic therapeutic effect," as used interchangeably herein, refer to a measured effect of compounds administered in combination, which measured effect is greater than the sum of the individual effects of each of the compounds provided herein administered alone as a single agent.

[0135] In embodiments, a synergistic amount is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.1, 10.2, 10.3, 10.4, 10.5, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7 .9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, It may be 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%.In embodiments, a synergistic amount is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.1, 10.2, 10.3, 10.4, 10.5, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7 .9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, It may be 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%.

[0136] As used herein, the term "EC50" or "half maximal effective concentration" refers to the concentration of a molecule (e.g., an antibody, chimeric antigen receptor, or bispecific antibody) that can induce a response that is halfway between the baseline response and the maximum response after a specified exposure time. In embodiments, the EC50 is the concentration of a molecule (e.g., an antibody, chimeric antigen receptor, or bispecific antibody) that produces 50% of the maximum possible effect of that molecule.

[0137] II. Method The methods provided herein are useful, inter alia, for the treatment of cancer. In embodiments, the methods and compositions described herein provide effective treatment for chemotherapy-resistant cancers expressing ROR-1. Applicants have surprisingly discovered that expression of ROR-1 increases in cancer cells following chemotherapy treatment. Furthermore, Applicants have demonstrated that ROR-1 expression enhances the ability of cancer cells to metastasize and survive chemotherapy treatment, resulting in chemotherapy resistance. Applicants have described herein the mechanism by which co-administration of a ROR-1 antagonist (e.g., ROR-1 antibody) and a chemotherapy drug (e.g., paclitaxel) is more effective than treatment with either alone, thus effectively treating cancer (e.g., breast cancer).

[0138] In an aspect, a method of treating chemotherapy-resistant cancer in a subject in need thereof is provided by administering to the subject a therapeutically effective amount of a chemotherapeutic agent and a therapeutically effective amount of a tyrosine kinase-like orphan receptor 1 (ROR-1) antagonist, thereby treating the chemotherapy-resistant cancer in the subject.

[0139] In another aspect, a method of treating breast cancer is provided comprising administering to a subject in need thereof a therapeutically effective amount of a chemotherapeutic agent and a therapeutically effective amount of a tyrosine kinase-like orphan receptor 1 (ROR-1) antagonist, thereby treating breast cancer in the subject. In an embodiment, the breast cancer is chemotherapy-resistant breast cancer.

[0140] The term "ROR-1" as used herein refers to either recombinant or naturally occurring forms of tyrosine kinase-like orphan receptor 1 (ROR-1) or variants or homologues thereof that maintain ROR-1 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to ROR-1). In some aspects, the variants or homologues have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 contiguous amino acid portion) compared to a naturally occurring ROR-1 protein. In embodiments, the ROR-1 protein is substantially identical to or a variant or homologue having substantial identity to the protein identified by Accession No. NP_005003.1.

[0141] In the example where the ROR-1 antagonist is an antibody, the antibody specifically binds to the ROR-1 polypeptide.Thus, in an embodiment, the ROR-1 antagonist is an anti-ROR-1 antibody.In an embodiment, the anti-ROR-1 antibody is a humanized antibody.

[0142] An anti-ROR-1 antibody may comprise amino acid sequences (e.g., CDRs) that allow it to bind to a portion of a ROR-1 polypeptide or a fragment thereof. Thus, in embodiments, the antibody comprises a humanized heavy chain variable region and a humanized light chain variable region, the humanized heavy chain variable region comprising the sequences set forth in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, and the humanized light chain variable region comprising the sequences set forth in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[0143] In an embodiment, the antibody is cirumtuzumab. As defined herein, cirumtuzumab is also referred to as UC-961 or 99961.1, and these terms are used interchangeably throughout. The development and structure of cirumtuzumab are disclosed in U.S. Patent Application No. 14 / 422,519, which is incorporated herein by reference in its entirety for all purposes. In an embodiment, cirumtuzumab (i.e., 99961.1, UC-961) comprises a humanized heavy chain variable region and a humanized light chain variable region, the humanized heavy chain variable region comprising the sequences set forth in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, and the humanized light chain variable region comprising the sequences set forth in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[0144] In embodiments, the antibody comprises a humanized heavy chain variable region and a humanized light chain variable region, wherein the humanized heavy chain variable region comprises the sequences set forth in SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and the humanized light chain variable region comprises the sequences set forth in SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12. An antibody comprising the amino acid sequences (i.e., CDRs) set forth in SEQ ID NO:7, 8, 9, 10, 11, 12 may be referred to herein as antibody D10. The development and use of antibody D10 is disclosed in U.S. Patent No. 9,217,040, which is incorporated by reference in its entirety for all purposes.

[0145] In embodiments, the antibody binds to amino acids 130-160 of ROR-1 or a fragment thereof. In embodiments, the antibody binds to a peptide containing a glutamic acid at a position corresponding to position 138 of ROR-1. In embodiments, the antibody specifically binds to an Ig-like region at the 3' or middle of the extracellular domain of the ROR-1 protein. In embodiments, the antibody binds to the 3' end of the Ig-like region of the extracellular domain of the ROR-1 protein from positions 1-147.

[0146] In embodiments, the antibody inhibits metastasis. In embodiments, the antibody is an antibody fragment. In embodiments, the antibody is human. In embodiments, the antibody is humanized. In embodiments, the antibody is a chimeric antibody. In embodiments, the antibody is a single chain antibody.

[0147] In an embodiment, the antibody has a binding affinity of about 500 pM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 550 pM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 600 pM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 650 pM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 700 pM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 750 pM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 800 pM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 850 pM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 900 pM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 950 pM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 1 nM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 1 nM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 1.5 nM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 2 nM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 2.5 nM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 3 nM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 3.5 nM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 4 nM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 4.5 nM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 5 nM to about 6 nM. In an embodiment, the antibody has a binding affinity of about 5.5 nM to about 6 nM.

[0148] In an embodiment, the antibody has a binding affinity of 500 pM to 6 nM. In an embodiment, the antibody has a binding affinity of 550 pM to 6 nM. In an embodiment, the antibody has a binding affinity of 600 pM to 6 nM. In an embodiment, the antibody has a binding affinity of 650 pM to 6 nM. In an embodiment, the antibody has a binding affinity of 700 pM to 6 nM. In an embodiment, the antibody has a binding affinity of 750 pM to 6 nM. In an embodiment, the antibody has a binding affinity of 800 pM to 6 nM. In an embodiment, the antibody has a binding affinity of 850 pM to 6 nM. In an embodiment, the antibody has a binding affinity of 900 pM to 6 nM. In an embodiment, the antibody has a binding affinity of 950 pM to 6 nM. In an embodiment, the antibody has a binding affinity of 1 nM to 6 nM. In an embodiment, the antibody has a binding affinity of 1 nM to 6 nM. In an embodiment, the antibody has a binding affinity of 1.5 nM to 6 nM. In an embodiment, the antibody has a binding affinity of 2 nM to 6 nM. In an embodiment, the antibody has a binding affinity of 2.5 nM to 6 nM. In an embodiment, the antibody has a binding affinity of 3 nM to 6 nM. In an embodiment, the antibody has a binding affinity of 3.5 nM to 6 nM. In an embodiment, the antibody has a binding affinity of 4 nM to 6 nM. In an embodiment, the antibody has a binding affinity of 4.5 nM to 6 nM. In an embodiment, the antibody has a binding affinity of 5 nM to 6 nM. In an embodiment, the antibody has a binding affinity of 5.5 nM to 6 nM.

[0149] In an embodiment, the antibody has a binding affinity of about 500 pM to about 5.5 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 5 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 4.5 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 4 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 3.5 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 3 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 3.5 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 3 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 2.5 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 2 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 1.5 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 1 nM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 950 pM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 900 pM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 850 pM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 800 pM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 750 pM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 700 pM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 650 pM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 600 pM. In an embodiment, the antibody has a binding affinity of about 500 pM to about 550 pM.

[0150] In an embodiment, the antibody has a binding affinity of 500 pM to 5.5 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 5 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 4.5 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 4 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 3.5 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 3 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 3.5 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 3 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 2.5 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 2 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 1.5 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 1 nM. In an embodiment, the antibody has a binding affinity of 500 pM to 950 pM. In an embodiment, the antibody has a binding affinity of 500 pM to 900 pM. In an embodiment, the antibody has a binding affinity of 500 pM to 850 pM. In an embodiment, the antibody has a binding affinity of 500 pM to 800 pM. In an embodiment, the antibody has a binding affinity of 500 pM to 750 pM. In an embodiment, the antibody has a binding affinity of 500 pM to 700 pM. In an embodiment, the antibody has a binding affinity of 500 pM to 650 pM. In an embodiment, the antibody has a binding affinity of 500 pM to 600 pM. In an embodiment, the antibody has a binding affinity of 500 pM to 550 pM.

[0151] In embodiments, the antibody has a binding affinity of about 500 pM. In embodiments, the antibody has a binding affinity of about 500 pM. In embodiments, the antibody has a binding affinity of about 550 pM. In embodiments, the antibody has a binding affinity of about 550 pM. In embodiments, the antibody has a binding affinity of about 600 pM. In embodiments, the antibody has a binding affinity of about 600 pM. In embodiments, the antibody has a binding affinity of about 650 pM. In embodiments, the antibody has a binding affinity of about 650 pM. In embodiments, the antibody has a binding affinity of about 700 pM. In embodiments, the antibody has a binding affinity of about 700 pM. In embodiments, the antibody has a binding affinity of about 750 pM. In embodiments, the antibody has a binding affinity of about 750 pM. In embodiments, the antibody has a binding affinity of about 800 pM. In embodiments, the antibody has a binding affinity of about 800 pM. In embodiments, the antibody has a binding affinity of about 850 pM. In embodiments, the antibody has a binding affinity of 850 pM. In embodiments, the antibody has a binding affinity of about 900 pM. In embodiments, the antibody has a binding affinity of 900 pM. In embodiments, the antibody has a binding affinity of about 950 pM. In embodiments, the antibody has a binding affinity of 950 pM. In embodiments, the antibody has a binding affinity of about 1 nM. In embodiments, the antibody has a binding affinity of about 1 nM. In embodiments, the antibody has a binding affinity of 1 nM. In embodiments, the antibody has a binding affinity of about 1.5 nM. In embodiments, the antibody has a binding affinity of 1.5 nM. In embodiments, the antibody has a binding affinity of about 2 nM. In embodiments, the antibody has a binding affinity of 2 nM. In embodiments, the antibody has a binding affinity of about 2.5 nM. In embodiments, the antibody has a binding affinity of 2.5 nM. In embodiments, the antibody has a binding affinity of about 3 nM. In embodiments, the antibody has a binding affinity of 3 nM. In embodiments, the antibody has a binding affinity of about 3.5 nM. In embodiments, the antibody has a binding affinity of 3.5 nM. In embodiments, the antibody has a binding affinity of about 4 nM. In embodiments, the antibody has a binding affinity of 4 nM. In embodiments, the antibody has a binding affinity of about 4.5 nM. In embodiments, the antibody has a binding affinity of 4.5 nM. In embodiments, the antibody has a binding affinity of about 5 nM.In embodiments, the antibody has a binding affinity of 5 nM. In embodiments, the antibody has a binding affinity of about 5.5 nM. In embodiments, the antibody has a binding affinity of 5.5 nM. In embodiments, the antibody has a binding affinity of about 6 nM. In embodiments, the antibody has a binding affinity of 6 nM.

[0152] In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 40 nM (e.g., 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5, 0.25, 0.1 nM). D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 40 nM (e.g., 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.5, 0.25, 0.1 nM). D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 35 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 35 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 30 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 30 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 25 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 25 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 20 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 20 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 15 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 15 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 10 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 10 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 9 nM. DIn embodiments, the antibody binds to the ROR-1 protein with a K of less than 9 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 8 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 8 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 7 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 7 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 6 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 6 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 5 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 5 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 4 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 4 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 3 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 3 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 2 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 2 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 1 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 1 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 0.5 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 0.5 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 0.25 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 0.25 nM.D In embodiments, the antibody binds to the ROR-1 protein with a K of less than about 0.1 nM. D In embodiments, the antibody binds to the ROR-1 protein with a K of less than 0.1 nM. D Combine with.

[0153] In embodiments, the antibody is cirumutuzumab, also referred to herein as 99961.1 or UC-961. In embodiments, the antibody is D10.

[0154] In an embodiment, the chemotherapeutic agent and the ROR-1 antagonist are administered in a combined synergistic amount. In an embodiment, the chemotherapeutic agent and the anti-ROR-1 antibody are administered in a combined synergistic amount. As used herein, a "combined synergistic amount" refers to the sum of a first amount (e.g., the amount of the chemotherapeutic agent) and a second amount (e.g., the amount of the ROR-1 antagonist) that results in a synergistic effect (i.e., an effect that is greater than additive). Thus, the terms "synergy," "synergistic," "synergistic," "combined synergistic amount," and "synergistic therapeutic effect," which are used interchangeably herein, refer to a measured effect of compounds administered in combination, which is greater than the sum of the individual effects of each compound administered alone as a single agent.

[0155] In embodiments, a synergistic amount is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.1, 10.2, 10.3, 10.4, 10.5, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7 .9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%.In embodiments, a synergistic amount is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.1, 10.2, 10.3, 10.4, 10.5, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7 .9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%.

[0156] The synergistic effect may be a cell (e.g., cancer cell) division reducing effect and / or a ROR-1 activity reducing effect. In embodiments, the synergy between the chemotherapeutic agent and the ROR-1 antagonist is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 3.10, 3.11, 3.12, 3.13, 3.14, 3.15, 3.16, 3.17, 3.18, 3.19, 3.20, 3.21, 3.22, 3.23, 3.24, 3.25, 3.26, 3.27, 3.28, 3.29, 3.30, 3.31, 3.32, 3.33, 3.34, 3.35, 3.36, 3.37, 3.38, 3.39, 3.40, 3.41, 3.42, 3.43, 3.44, 3.45, 3.46, 3.47, 3.48, 3.49, 3.50, 3.51, 3.52 1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8. 1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 5 95, 96, 97, 98, 99, or 100% greater decrease (e.g., decrease in cell (e.g., cancer cell) division or decrease in ROR-1 activity).In embodiments, the synergy between a chemotherapeutic agent and a ROR-1 antagonist is greater than the sum of the inhibition of cell (e.g., cancer cell) division and / or ROR-1 protein by 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.5, 9.6, 9.7 ,2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7. 3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% greater inhibition.

[0157] The synergy may be in the form of breast cancer (i.e., breast cancer treatment synergy), lymphoma (i.e., lymphoma treatment synergy), leukemia (i.e., leukemia treatment synergy), myeloma (i.e., myeloma treatment synergy), AML (i.e., AML treatment synergy), B-ALL (i.e., B-ALL treatment synergy), T-ALL (i.e., T-ALL treatment synergy), renal cell carcinoma (i.e., renal cell carcinoma treatment synergy), colon cancer (i.e., colon cancer treatment synergy), effect), colorectal cancer (i.e., synergy in the treatment of colorectal cancer), squamous cell carcinoma (i.e., synergy in the treatment of squamous cell carcinoma), melanoma (i.e., synergy in the treatment of melanoma), gastric cancer (i.e., synergy in the treatment of gastric cancer), brain cancer (i.e., synergy in the treatment of brain cancer), lung cancer (i.e., synergy in the treatment of lung cancer), pancreatic cancer (i.e., synergy in the treatment of pancreatic cancer), cervical cancer (i.e., synergy in the treatment of cervical cancer), ovarian cancer (i.e., i.e., synergy in the treatment of ovarian cancer), liver cancer (i.e., synergy in the treatment of liver cancer), bladder cancer (i.e., synergy in the treatment of bladder cancer), prostate cancer (i.e., synergy in the treatment of prostate cancer), testicular cancer (i.e., synergy in the treatment of testicular cancer), thyroid cancer (i.e., synergy in the treatment of thyroid cancer), head and neck cancer (i.e., synergy in the treatment of head and neck cancer), uterine cancer (i.e., synergy in the treatment of uterine cancer), adenocarcinoma (i.e., synergy in the treatment of adenocarcinoma), adrenal The effect may be a cancer treatment effect, such as a cancer (i.e., synergy in the treatment of adrenal cancer), chronic lymphocytic leukemia (i.e., synergy in the treatment of chronic lymphocytic leukemia), small lymphocytic lymphoma (i.e., synergy in the treatment of small lymphocytic lymphoma), marginal cell B-cell lymphoma (i.e., synergy in the treatment of marginal cell B-cell lymphoma), Burkitt's lymphoma (i.e., synergy in the treatment of Burkitt's lymphoma), or B-cell leukemia (i.e., synergy in the treatment of B-cell leukemia).

[0158] The chemotherapeutic agent and the ROR-1 antagonist may be administered in combination, simultaneously (e.g., as a mixture), separately but simultaneously (e.g., via separate intravenous lines), or sequentially (e.g., one agent is administered first, followed by the second agent). Thus, the term combination is used to refer to the concomitant, simultaneous, or sequential administration of the chemotherapeutic agent and the ROR-1 antagonist.

[0159] In embodiments, the chemotherapeutic agent and the ROR-1 antagonist are administered simultaneously or sequentially. In embodiments, the chemotherapeutic agent and the ROR-1 antagonist are administered simultaneously. In embodiments, the chemotherapeutic agent and the ROR-1 antagonist are administered sequentially. During the course of treatment, the chemotherapeutic agent and the ROR-1 antagonist may sometimes be administered sequentially and other times simultaneously.

[0160] In embodiments, when the chemotherapeutic agent and the ROR-1 antagonist are administered sequentially, the ROR-1 antagonist is administered at a first time point and the chemotherapeutic agent is administered at a second time point, the first time point preceding the second time point. Alternatively, in embodiments, when the chemotherapeutic agent and the ROR-1 antagonist are administered sequentially, the chemotherapeutic agent is administered at a first time point and the ROR-1 antagonist is administered at a second time point, the first time point preceding the second time point.

[0161] In embodiments, the chemotherapeutic agent and the anti-ROR-1 antibody are administered simultaneously or sequentially. In embodiments, the chemotherapeutic agent and the anti-ROR-1 antibody are administered simultaneously. In embodiments, the chemotherapeutic agent and the anti-ROR-1 antibody are administered sequentially. During the course of treatment, the chemotherapeutic agent and the anti-ROR-1 antibody may sometimes be administered sequentially and other times simultaneously.

[0162] In embodiments, when the chemotherapeutic agent and the anti-ROR-1 antibody are administered sequentially, the anti-ROR-1 antibody is administered at a first time point and the chemotherapeutic agent is administered at a second time point, the first time point preceding the second time point. Alternatively, in embodiments, when the chemotherapeutic agent and the anti-ROR-1 antibody are administered sequentially, the chemotherapeutic agent is administered at a first time point and the anti-ROR-1 antibody is administered at a second time point, the first time point preceding the second time point.

[0163] The course of treatment is best determined individually, depending on the specific characteristics of the subject and the type of treatment selected. Treatments such as those disclosed herein can be administered to the subject daily, twice daily, every other week, monthly, or any other applicable basis that is therapeutically effective. Treatments can be administered alone or in combination with any other treatments disclosed herein or known in the art. Additional treatments can be administered simultaneously with the first treatment, at different times, or on entirely different therapeutic schedules (e.g., the first treatment can be daily, and the additional treatments weekly).

[0164] In instances where the chemotherapeutic agent and the ROR-1 antagonist are administered simultaneously, the chemotherapeutic agent and the ROR-1 antagonist may be administered as a mixture, and thus, in embodiments, are mixed prior to administration of the chemotherapeutic agent and the ROR-1 antagonist.

[0165] In embodiments, the chemotherapeutic agent is administered in an amount of about 5 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, or 15 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of about 5 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of about 6 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of about 7 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of about 8 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of about 9 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of 10 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of about 11 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of about 12 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of about 13 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of about 14 mg / kg. In embodiments, the chemotherapeutic agent is administered in an amount of about 13.4 mg / kg. In a further embodiment, the chemotherapeutic agent is paclitaxel.

[0166] In embodiments, the ROR-1 antagonist is administered in an amount of about 1 mg / kg, 2 mg / kg, 3 mg / kg, 5 mg / kg or 10 mg / kg. In embodiments, the ROR-1 antagonist is administered in an amount of about 1 mg / kg. In embodiments, the ROR-1 antagonist is administered in an amount of 1 mg / kg. In embodiments, the ROR-1 antagonist is administered in an amount of about 2 mg / kg. In embodiments, the ROR-1 antagonist is administered in an amount of 2 mg / kg. In embodiments, the ROR-1 antagonist is administered in an amount of about 3 mg / kg. In embodiments, the ROR-1 antagonist is administered in an amount of 3 mg / kg. In embodiments, the ROR-1 antagonist is administered in an amount of about 5 mg / kg. In embodiments, the ROR-1 antagonist is administered in an amount of 5 mg / kg. In embodiments, the ROR-1 antagonist is administered in an amount of about 10 mg / kg. In an embodiment, the ROR-1 antagonist is administered in an amount of 10 mg / kg.

[0167] In an embodiment, the chemotherapy agent is administered in an amount of about 13 mg / kg and the ROR-1 antagonist is administered at about 2 mg / kg. In an embodiment, the chemotherapy agent is administered in an amount of 14 mg / kg and the ROR-1 antagonist is administered at 2 mg / kg. In an embodiment, the chemotherapy agent is administered in an amount of 13.4 mg / kg and the ROR-1 antagonist is administered at 2 mg / kg. In an embodiment, the chemotherapy agent is administered in an amount of about 13 mg / kg and the ROR-1 antagonist is administered at about 1 mg / kg. In an embodiment, the chemotherapy agent is administered in an amount of 14 mg / kg and the ROR-1 antagonist is administered at 1 mg / kg. In an embodiment, the chemotherapy agent is administered in an amount of 13.4 mg / kg and the ROR-1 antagonist is administered at 1 mg / kg.

[0168] In embodiments, the chemotherapeutic agent is administered daily for at least 14 days (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45, or 50 days). In embodiments, the chemotherapeutic agent is administered daily for at least 15 days. In embodiments, the chemotherapeutic agent is administered daily for at least 16 days. In embodiments, the chemotherapeutic agent is administered daily for at least 17 days. In embodiments, the chemotherapeutic agent is administered daily for at least 18 days. In embodiments, the chemotherapeutic agent is administered daily for at least 19 days. In embodiments, the chemotherapeutic agent is administered daily for at least 20 days. In embodiments, the chemotherapeutic agent is administered daily for at least 21 days. In embodiments, the chemotherapeutic agent is administered daily for at least 22 days. In embodiments, the chemotherapeutic agent is administered daily for at least 23 days. In embodiments, the chemotherapeutic agent is administered daily for at least 24 days. In embodiments, the chemotherapy agent is administered daily for at least 25 days. In embodiments, the chemotherapy agent is administered daily for at least 26 days. In embodiments, the chemotherapy agent is administered daily for at least 27 days. In embodiments, the chemotherapy agent is administered daily for at least 28 days. In embodiments, the chemotherapy agent is administered daily for at least 29 days. In embodiments, the chemotherapy agent is administered daily for at least 30 days. In embodiments, the chemotherapy agent is administered daily for at least 31 days. In embodiments, the chemotherapy agent is administered daily for at least 32 days. In embodiments, the chemotherapy agent is administered daily for at least 33 days. In embodiments, the chemotherapy agent is administered daily for at least 34 days. In embodiments, the chemotherapy agent is administered daily for at least 35 days. In embodiments, the chemotherapy agent is administered daily for at least 40 days. In embodiments, the chemotherapy agent is administered daily for at least 45 days. In embodiments, the chemotherapy agent is administered daily for at least 50 days.

[0169] In embodiments, the chemotherapy agent is administered daily for about 28 days.In embodiments, the chemotherapy agent is administered daily for about 28 days.

[0170] In an embodiment, the ROR-1 antagonist is administered once over a period of about 28 days.In an embodiment, the ROR-1 antagonist is administered once over a period of about 28 days.

[0171] In embodiments, the chemotherapeutic agent is administered intravenously.In embodiments, the ROR-1 antagonist is administered intravenously.

[0172] In embodiments, the subject is a mammal, hi embodiments, the subject is a human.

[0173] In an embodiment, the method includes detecting the level of ROR-1 in the subject prior to administration. For detecting the level of ROR-1 in the subject, any method commonly used in the art for detecting proteins in biological samples is contemplated. For detecting the level of ROR-1, any suitable biological sample from the subject may be used. Without limitation, biological samples include tissue-derived samples, blood-derived samples, saliva-derived samples, urine-derived samples, serum-derived samples, or plasma-derived samples.

[0174] Methods for detecting and confirming levels of ROR-1 (e.g., ROR-1 protein or ROR-1 RNA) include conventional molecular biology, microbiology, and recombinant DNA techniques within the art. Such techniques are fully explained in the literature (see, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, 2nd ed., 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Animal Cell Culture, edited by R.I. Freshney, 1986).

[0175] The term "detect" as provided herein includes "detecting the level of ROR-1", "detecting the level of expression of ROR-1 protein" or "detecting the level of expression of ROR-1 RNA", and includes methods and techniques well known in the art. For example, capture arrays for expression profiling may be used to determine the expression level of protein or RNA. Capture arrays use high affinity capture reagents such as conventional antibodies, single domains, engineered scaffolds, peptides, nucleic acid aptamers or complementary nucleic acids (e.g., RNA or DNA) to bind and detect specific target ligands in a high throughput manner. Antibody arrays have the necessary properties of specificity and acceptable background, and some are commercially available (BD Biosciences, San Jose, CA; Clontech, Mountain View, CA; BioRad; Sigma, St. Louis, MO). Antibodies for capture arrays are generated by conventional immunization (polyclonal sera and hybridomas) or after selection from phage or ribosome display libraries, usually as recombinant fragments expressed in E. coli (Cambridge Antibody Technology, Cambridge, UK; Biolnvent, Lund, Sweden; Affitech, Walnut Creek, CA; Biosite, San Diego, CA). In addition to conventional antibodies, Fab and scFv fragments, single V domains from camelids or engineered human equivalents (Domantis, Waltham, MA) are optionally useful in arrays.

[0176] Protein analytes that bind to the antibody array are detected directly or indirectly, for example via a secondary antibody. Direct labeling is used for the comparison of different samples of different colors. If pairs of antibodies directed against the same protein ligand are available, sandwich immunoassays offer high specificity and sensitivity and are therefore the method of choice for low abundance proteins such as cytokines, and also the possibility of detecting protein modifications. Label-free detection methods, including mass spectrometry, surface plasmon resonance and atomic force microscopy, avoid ligand modification. What is required from any method is optimal sensitivity and specificity, with low background giving high signal to noise. Since analyte concentrations span a wide range, sensitivity must be appropriately tailored. Serial dilution of the sample or the use of antibodies with different affinities are solutions to this problem. Proteins of interest are often low-abundance proteins in body fluids and extracts, such as cytokines or low expression products in cells, requiring detection in the pg range or even lower.

[0177] An alternative to arrays of capture molecules are arrays created through molecular imprinting techniques, in which peptides (e.g., from the C-terminal region of a protein) are used as templates to generate structurally complementary, sequence-specific cavities in a polymerizable matrix, which can then specifically capture (denatured) proteins with the appropriate primary amino acid sequence (ProteinPrint™, Aspira Biosystems, Burlingame, Calif.).

[0178] Another method that is useful in diagnostics and expression profiling is the ProteinChip® array (Ciphergen, Fremont, Calif.), in which a solid-phase chromatographic surface binds proteins with similar charge or hydrophobicity characteristics from a mixture such as plasma or a tumor extract, and detects the retained proteins using SELDI-TOF mass spectrometry.

[0179] Large-scale functional chips have been constructed by immobilizing a large number of purified proteins and have been used to assay a wide range of biochemical functions, such as protein interactions with other proteins, drug-target interactions, enzyme-substrates, etc. Generally, large-scale functional chips require expression libraries cloned into E. coli, yeast or similar, from which expressed proteins are then purified and immobilized, e.g., via His tags. Cell-free protein transcription / translation is a viable alternative to the synthesis of proteins that do not express well in bacteria or other in vivo systems.

[0180] In embodiments, the estimation comprises contacting a biological sample from the subject with an anti-ROR-1 antibody and detecting binding of the anti-ROR-1 antibody to ROR-1 in the biological sample. In embodiments, the estimation comprises contacting the subject with an anti-ROR-1 antibody and detecting binding of the anti-ROR-1 antibody to ROR-1 in the subject. In embodiments, the antibody is any one of the anti-ROR-1 antibodies disclosed in U.S. Patent Application No. 9,217,040, which is hereby incorporated by reference in its entirety for all purposes.

[0181] "Standard control" as referred to herein refers to a sample that serves as a reference, usually a known reference, for comparison with a test sample. For example, a test sample can be taken from a patient suspected of having cancer and compared with a sample from a known cancer patient or a known normal (non-disease) individual. A control can also represent an average value collected from a population of similar individuals, e.g., cancer patients or healthy individuals with similar medical background, age, weight, etc. A control value can also be obtained from a sample previously obtained from the same individual, e.g., before disease or before treatment. Those skilled in the art will recognize that a control can be designed for the evaluation of any number of parameters.

[0182] One of skill in the art will understand which controls are useful in a given situation and can analyze data based on comparison to control values. Controls are also valuable in determining the significance of data. For example, if values ​​representing a given parameter are widely different in the controls, the variation in the test sample is not considered significant. In some examples of the disclosed methods, when the expression level of ROR-1 is assessed, the level is compared to a control expression level of ROR-1. By control expression level is meant the expression level of ROR-1 from a sample or subject lacking cancer, a sample or subject at a selected stage of cancer or cancer condition, or in the absence of a particular variable, such as a therapeutic agent (e.g., a chemotherapeutic agent). Alternatively, the control level comprises a known amount of ROR-1. Such a known amount correlates with the average level of subjects lacking cancer, at a selected stage of cancer or cancer condition, or in the absence of a particular variable, such as a therapeutic agent. The control level also includes the expression level of ROR-1 from one or more selected samples or subjects described herein. For example, the control level includes an assessment of the expression level of ROR-1 in a sample from a subject lacking cancer, at a selected stage of cancer or cancer condition, or who has never been treated for cancer. Another exemplary control level includes assessment of expression levels of ROR-1 in samples taken from multiple subjects who are cancer-free, have a selected stage of cancer, or have not been treated for cancer.

[0183] When the control level includes the expression level of ROR-1 in a sample or subject in the absence of a chemotherapeutic agent, the control sample or subject is optionally the same sample or subject tested before or after treatment with a chemotherapeutic agent, or a selected sample or subject in the absence of a therapeutic agent. Alternatively, the control level is an average expression level calculated from several subjects without a particular disease. The control level also includes a known control level or a value known in the art.

[0184] In embodiments, the method further comprises selecting a subject expressing an increased level of ROR-1 compared to a standard control prior to administration of a therapeutically effective amount of a chemotherapeutic agent and a therapeutically effective amount of a ROR-1 antagonist. In embodiments, the method further comprises selecting a subject expressing an increased level of ROR-1 compared to a standard control prior to administration. The selected subject may be treated for cancer (e.g., breast cancer). In some embodiments, the subject is not treated for cancer (e.g., breast cancer). The subject may be part of a plurality of subjects participating in a clinical trial. If the subject is part of a clinical trial, the selection is based at least in part on the determination of the expression level of ROR-1 provided herein. In embodiments, the subject is currently undergoing or has been undergoing chemotherapy. In embodiments, the chemotherapy-resistant cancer is chemotherapy-resistant breast cancer. In embodiments, the subject is currently undergoing chemotherapy. In embodiments, the subject has undergone chemotherapy. In further embodiments, the standard control is a level of ROR-1 detected before the patient undergoes chemotherapy.

[0185] In embodiments, the chemotherapeutic agent is a plant alkaloid, an antitumor antibiotic, or a topoisomerase inhibitor. In embodiments, the chemotherapeutic agent is a plant alkaloid. In embodiments, the chemotherapeutic agent is an antitumor antibiotic. In embodiments, the chemotherapeutic agent is a topoisomerase inhibitor. In embodiments, the chemotherapeutic agent is paclitaxel or docetaxel. In embodiments, the chemotherapeutic agent is paclitaxel. In embodiments, the chemotherapeutic agent is docetaxel. In embodiments, the chemotherapeutic agent is doxorubicin or epirubicin. In embodiments, the chemotherapeutic agent is doxorubicin. In embodiments, the chemotherapeutic agent is epirubicin.

[0186] In an embodiment, the chemotherapeutic agent is not a BTK antagonist. In an embodiment, the chemotherapeutic agent is not CAL101, R406, or ibrutinib. In an embodiment, the chemotherapeutic agent is not ibrutinib.

[0187] In an embodiment, the ROR-1 antagonist is an antibody or a small molecule. In an embodiment, the ROR-1 antagonist is an antibody. In an embodiment, the ROR-1 antagonist is a small molecule. In an embodiment, the ROR-1 antagonist is an anti-ROR-1 antibody.

[0188] In one embodiment, the chemotherapy resistant cancer is breast cancer, the chemotherapy agent is paclitaxel, the ROR-1 antagonist is cirumtuzumab, and the selected subject has undergone chemotherapy.

[0189] III. Pharmaceutical Compositions Compositions comprising a chemotherapeutic agent and a ROR-1 antagonist provided herein, including this embodiment, are further contemplated as pharmaceutical compositions. Thus, in an aspect, a pharmaceutical composition is provided that comprises (i) a chemotherapeutic agent selected from the group consisting of a plant alkaloid, an antitumor antibiotic, and a topoisomerase inhibitor, (ii) a ROR-1 antagonist, and (iii) a pharmaceutically acceptable excipient.

[0190] In another aspect, a pharmaceutical composition is provided comprising: (i) a chemotherapeutic agent selected from the group consisting of a plant alkaloid, an antitumor antibiotic, and a topoisomerase inhibitor; (ii) an anti-ROR-1 antibody; and (iii) a pharmaceutically acceptable excipient, wherein the chemotherapeutic agent and the anti-ROR-1 antibody are present in a combined synergistic amount, and the combined synergistic amount is effective to treat breast cancer in a subject in need thereof.

[0191] The chemotherapeutic agent and ROR-1 antagonist included in the pharmaceutical composition provided herein may be any one of the chemotherapeutic agents and / or ROR-1 antagonists described herein, including this embodiment. For example, the chemotherapeutic agent may be paclitaxel, and the ROR-1 antagonist may be cirumtuzumab. Similarly, the pharmaceutical composition provided herein may be formulated such that the administered amount of the chemotherapeutic agent and ROR-1 antagonist is any one of the amounts described herein. For example, paclitaxel may be present in an amount such that administration of the composition results in a dosage of 13.4 mg / kg, and cirumtuzumab may be present in an amount that results in a dosage of about 2 mg / kg.

[0192] Thus, in an embodiment, the chemotherapeutic agent is a plant alkaloid. In an embodiment, the chemotherapeutic agent is paclitaxel. In an embodiment, the ROR-1 antagonist is an antibody or a small molecule. In an embodiment, the ROR-1 antagonist is an antibody. In an embodiment, the ROR-1 antagonist is a small molecule. In an embodiment, the ROR-1 antagonist is an anti-ROR-1 antibody. In an embodiment, the antibody comprises a humanized heavy chain variable region and a humanized light chain variable region, the humanized heavy chain variable region comprising the sequences set forth in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, and the humanized light chain variable region comprising the sequences set forth in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. In an embodiment, the antibody is cirumtuzumab.

[0193] The provided compositions are particularly suitable for formulation and administration in vitro or in vivo. Suitable carriers and excipients and their formulation are described in Remington: The Science and Practice of Pharmacy, 21st Edition, edited by David B. Troy, Lippicott Williams & Wilkins (2005). Pharmaceutically acceptable carrier means a material that is not biologically or otherwise undesirable, i.e., a material that is administered to a subject without causing undesirable biological effects and interacting in a deleterious manner with other components of the pharmaceutical composition in which it is contained. When administered to a subject, the carrier is optionally selected to minimize the degradation of the active ingredient and minimize adverse side effects in the subject.

[0194] The pharmaceutical compositions provided herein include compositions in which the active ingredient (e.g., the compositions described herein, including the embodiments or examples) is contained in a therapeutically effective amount, i.e., in an amount effective to achieve its intended purpose. The actual amount effective for a particular application will depend, among other things, on the condition being treated. When administered in a method for treating a disease, the recombinant proteins described herein will contain an amount of active ingredient effective to achieve the desired result, e.g., to modulate the activity of a target molecule and / or to reduce, eliminate, or slow the progression of disease symptoms. Determination of a therapeutically effective amount of a compound of the present invention is well within the capabilities of one of ordinary skill in the art, especially in light of the detailed disclosure herein.

[0195] The compositions provided may contain a single agent or more than one agent. Compositions for administration will generally contain an agent that is dissolved in a pharma- ceutically acceptable carrier as described herein, preferably an aqueous carrier. A variety of aqueous carriers can be used, such as buffered saline, etc. These solutions are sterile and generally free of undesirable matter. These compositions can be sterilized by conventional, well-known sterilization techniques. The compositions may contain pharma- ceutical acceptable auxiliary substances necessary to approximate physiological conditions, such as pH adjusting and buffering agents, toxicity adjusting agents, and the like, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. The concentration of active agent in these formulations can vary widely and will be selected primarily based on fluid volumes, viscosities, body weight, etc., according to the particular mode of administration selected and the needs of the subject.

[0196] Solutions of the active compounds as free bases or pharma- ceutically acceptable salts can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose.Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils.Under normal conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms.

[0197] The pharmaceutical compositions can be delivered via intranasal or inhalable solutions, or sprays, aerosols or inhalants. Nasal solutions can be aqueous solutions designed to be administered to the nostrils in drops or sprays. Nasal solutions can be prepared to resemble nasal secretions in many respects. Thus, aqueous nasal solutions are usually isotonic and slightly buffered to maintain a pH of 5.5 to 6.5. Additionally, antimicrobial preservatives may be included in the formulation if necessary, similar to those used in ophthalmic preparations and appropriate drug stabilizers. A variety of commercially available nasal preparations are known and may include, for example, antibiotics and antihistamines.

[0198] Oral formulations may contain excipients such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations, or powders. In some embodiments, oral pharmaceutical compositions may contain an inert diluent or an assimilable edible carrier, or may be enclosed in hard or soft shell gelatin capsules, or may be compressed into tablets, or may be taken directly with dietary food. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of the active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 75%, or preferably between 25 to 60%, of the weight of the unit. The amount of active compound in such compositions is such that a suitable dosage will be obtained.

[0199] For parenteral administration in aqueous solution, for example, the solution should be appropriately buffered and the liquid diluent should first be made isotonic with sufficient saline or glucose. Aqueous solutions, particularly sterile aqueous solvents, are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. For example, one dosage could be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous infusion or injected at the proposed infusion site.

[0200] Sterile injections can be prepared by incorporating the active compound or construct in the required amount in a suitable solvent, followed by sterilization filtration.Generally, dispersions are prepared by incorporating various sterilized active ingredients into a sterile medium that contains a basic dispersion medium.Vacuum drying and freeze-drying techniques produce powders of active ingredients plus any additional desired ingredients, and can be used to prepare sterile powders for reconstitution of sterile injections.The preparation of more concentrated or highly concentrated solutions for direct injection is also envisioned.DMSO can be used as a solvent for extremely rapid penetration, delivering high concentrations of active agents to a small area.

[0201] The preparation of the compound can be presented in a unit-dose or multi-dose sealed container, such as ampoules and vials.Therefore, the composition can be in unit dosage form.In such form, the preparation is divided into unit dosages that contain appropriate amounts of active ingredients.Therefore, the composition can be administered in various unit dosage forms according to the method of administration.For example, the unit dosage forms suitable for oral administration include, but are not limited to, powder, tablet, pill, capsule and troche.

[0202] The dosage and frequency (single or multiple administrations) administered to a mammal can vary depending on a variety of factors, such as whether the mammal is suffering from another disease, its route of administration; the size, age, sex, health, weight, body mass index and diet of the recipient; the nature and extent of symptoms of the disease being treated (e.g., cancer symptoms and the severity of such symptoms), the type of concomitant therapy, complications from the disease being treated or other health-related problems. Other treatment regimens or drugs can be used in conjunction with the methods and compounds of the present invention. Adjustment and manipulation of established dosages (e.g., frequency and duration) are well within the capabilities of one of ordinary skill in the art.

[0203] For any composition described herein (e.g., cell-penetrating conjugates provided), a therapeutically effective amount can be initially determined from cell culture assays. The target concentration will be the concentration of active compound that can achieve the methods described herein, as measured using methods described herein or known in the art. As is well known in the art, effective amounts for use in humans can also be determined from animal models. For example, a dose for humans can be formulated to achieve a concentration found to be effective in animals. Dosages in humans can be adjusted by monitoring efficacy and adjusting dosages upward or downward, as described above. Based on the above and other methods, it is well within the capabilities of one of ordinary skill in the art to adjust dosages to achieve maximum efficacy in humans.

[0204] Dosage may vary depending on the requirements of the patient and the compound being used. The dose administered to the patient, in the context of the present invention, should be sufficient to produce a beneficial therapeutic response in the patient over time. The size of the dose will also be determined by the existence, nature and extent of any adverse side effects. Determination of the appropriate dosage for a particular situation is within the skill of one of ordinary skill in the art. Generally, treatment is initiated with smaller dosages that are less than the optimum dose of the compound. Dosage is then increased by small increments until the optimum effect under the circumstances is reached.

[0205] Dosage amount and interval can be adjusted individually to provide levels of the compound administered that are effective for the particular clinical indication being treated, thereby providing a treatment regime commensurate with the severity of the individual's disease state.

[0206] Utilizing the teachings provided herein, one can design an effective prophylactic or therapeutic treatment regimen that does not cause substantial toxicity, yet is effective in treating the clinical symptoms exhibited by a particular patient. This regimen should include careful selection of an active compound by considering factors such as the potency of the compound, relative bioavailability, patient weight, the presence and severity of adverse side effects, desirability, and the like.

[0207] "Pharmaceutically acceptable excipients" and "pharmacologically acceptable carriers" refer to substances that aid in the administration and absorption of active agents by a subject and can be included in the compositions of the present invention without causing significant adverse toxicological effects to the patient. Non-limiting examples of pharma-ceutically acceptable excipients include water, NaCl, normal saline, lactated Ringer's solution, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coating agents, sweeteners, flavorings, salt solutions (such as Ringer's solution), alcohols, oils, carbohydrates such as gelatin, lactose, amylose or starch, fatty acid esters, hydroxymethylcellulose, polyvinylpyrrolidine, and colors, and the like. Such preparations can be sterilized and, if necessary, mixed with auxiliary substances such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring agents and / or aromatic substances, and the like, that do not adversely react with the compounds of the present invention. Those of skill in the art will recognize that other pharmaceutical excipients are useful in the present invention.

[0208] The term "pharmaceutically acceptable salts" refers to salts derived from a variety of organic and inorganic counterions well known in the art, including, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, etc., as well as, where the molecule contains a basic functionality, salts of organic or inorganic acids such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate, etc.

[0209] The term "preparation" is intended to include formulation of the active compound with an encapsulating material as a carrier, where the active ingredient is surrounded by a carrier with or without other carriers, thus providing a capsule in which the carrier is associated with the active ingredient. Also included are cachets and lozenges. Tablets, powders, capsules, pills, cachets and lozenges can be used as solid dosage forms suitable for oral administration.

[0210] In embodiments, the pharmaceutical composition comprises paclitaxel, cirumtuzumab, and a pharma- ceutically acceptable excipient. In embodiments, the pharmaceutical composition comprises docetaxel, cirumtuzumab, and a pharma- ceutically acceptable excipient. In embodiments, the pharmaceutical composition comprises doxorubicin, cirumtuzumab, and a pharma- ceutically acceptable excipient. In embodiments, the pharmaceutical composition comprises epirubicin, cirumtuzumab, and a pharma- ceutically acceptable excipient.

[0211] In an embodiment, the pharmaceutical composition comprises an amount of paclitaxel equivalent to a dose of 13.4 mg / kg and an amount of cirumtuzumab equivalent to a dose of 1 mg / kg. In an embodiment, the pharmaceutical composition comprises an amount of paclitaxel equivalent to a dose of 13.4 mg / kg and an amount of cirumtuzumab equivalent to a dose of 2 mg / kg. In an embodiment, the pharmaceutical composition comprises an amount of paclitaxel equivalent to a dose of 13.4 mg / kg and an amount of cirumtuzumab equivalent to a dose of 3 mg / kg. In an embodiment, the pharmaceutical composition comprises an amount of paclitaxel equivalent to a dose of 13.4 mg / kg and an amount of cirumtuzumab equivalent to a dose of 5 mg / kg. In an embodiment, the pharmaceutical composition comprises an amount of paclitaxel equivalent to a dose of 13.4 mg / kg and an amount of cirumtuzumab equivalent to a dose of 10 mg / kg.

[0212] In an embodiment, a method of treating cancer in a subject in need thereof comprises administering to the subject a therapeutically effective amount of an antimitotic agent and a ROR-1 antagonist. In an embodiment, a method of treating cancer in a patient with chemotherapy-resistant cancer comprises administering to the subject a therapeutically effective amount of an antimitotic agent and a ROR-1 antagonist. In an embodiment, a method of treating cancer in a subject in need thereof comprises administering to the subject a therapeutically effective amount of a ROR-1 antibody, the subject expressing an elevated level of ROR-1 compared to a standard control. In an embodiment, the antimitotic agent is paclitaxel. In an embodiment, the ROR-1 antagonist is cirumutuzumab. In an embodiment, the cancer is breast cancer. In an embodiment, the pharmaceutical composition comprises an antimitotic agent and a ROR-1 antibody, the antimitotic agent and the ROR-1 antibody being present in a combined synergistic amount, the combined synergistic amount being effective to treat cancer in a subject in need thereof.

[0213] It is understood that the examples and embodiments described herein are for illustrative purposes only, and that various modifications or changes in light thereof will be suggested to those skilled in the art and are to be included within the spirit and scope of this application and the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes. EXAMPLES

[0214] [Example 1] Sirmutuzumab selectively targets ROR1+ breast cancer stem cells that are resistant to cancer chemotherapy We examined transcriptome data of primary breast cancer specimens collected from patients before and after chemotherapy. We also examined the effect of chemotherapy on breast cancer patient-derived xenografts (PDXs) in immune-deficient mice to evaluate whether ROR1+ breast cancer cells have activated Rho-GTPase, Hippo-YAP or BMI1 and / or features of breast CSCs. Finally, we examined whether the humanized anti-ROR1 antibody cirumutuzumab has activity against breast cancer PDXs, either alone or in combination with paclitaxel.

[0215] Examination of breast cancer transcriptome data revealed that tumors with high levels of ROR1 had higher expression of genes associated with activation of Rho-GTPases, Hippo-YAP, or BMI1. Tumor cell expression of such genes and ROR1 was increased after chemotherapy. Wnt5a induced ROR1-dependent activation of Rho-GTPases, YAP / TAZ, AKT, and BMI1 in Hs578T or breast cancer patient-derived xenografts (PDXs) and increased the ability of tumor cells to invade Matrigel, form spheroids, or survive treatment with paclitaxel; these effects could be inhibited by the anti-ROR1 mAb sirumtuzumab, which inhibits CD44 + / CD24 Low Sirmutuzumab also suppressed the expression of genes upregulated in breast cancer stem cells (CSCs) and genes associated with activation of Rho-GTPases, Hippo-YAP, or BMI1. - / - γc - / - It also impaired the ability of breast cancer cells to engraft or cause metastases in mice. Finally, the combination of cirumutuzumab and paclitaxel was more effective at eradicating breast cancer PDXs than either drug alone, indicating that cirumutuzumab may improve outcomes for patients with advanced breast cancer.

[0216] Expression of ROR1 and other genes before and after chemotherapy We searched the PubMed Gene Expression Omnibus (GEO) database (GSE87455) (Kimbung et al., 2018) for HER2-negative breast tumor biopsies prior to treatment. We separated the data for each specimen (N=122) into two subgroups based on their relative expression of ROR1. Samples with ROR1 transcripts above the median level had ROR1 Hi (N=61), and tumor samples with low ROR1 were named ROR1 Low Gene set enrichment (GSE) analysis revealed that ROR1 Low Compared with tumors, ROR1 HiTumors as a group were found to express higher levels of genes associated with activation of Rho-GTPases (Liberzon et al., 2011; Schaefer et al., 2009), Hippo-YAP (Li et al., 2017) or BMI1 (Wiederschain et al., 2007) (Figure 1A). Low Compared with tumors, ROR1 Hi Breast cancers also had higher levels of embryonic stem cell-associated genes whose promoters are bound and activated by embryonic stem cell-identical NOS target regulators, including Oct4 or a subset of NOS activating targets (NOS TFs) that encode transcriptional regulators in embryonic stem cells (Table 1) (Ben-Porath et al., 2008). Finally, ROR1 Hi Breast cancer is non-CD44 + / CD24 Low or CD44 relative to the levels in all tumor cells + / CD24 Low The samples in the GEO database (GSE21974) (Stickeler et al., 2011) also had higher levels of genes that were differentially upregulated in mammosphere (MS)-forming cells (Creighton et al., 2009). Hi and ROR1 Low Separation into subgroups revealed similar associations ( Fig. 6A ).

[0217] The GSE87455 dataset contained data on tumor tissue (N=57) obtained before (pre) and after (post) chemotherapy, which consisted of four cycles of epirubicin plus docetaxel and bevacizumab. Differences in gene expression between matched post- and pre-treatment samples included ROR1 Hi Against ROR1 Low Of the 34,694 genes analyzed, we found that ROR1 was significantly higher in post-treatment biopsies compared to its matched pre-treatment biopsy or in Low ROR1 compared with tumor HiWe identified the 1,000 most highly and 1,000 least highly expressed genes in tumors. After chemotherapy, 365 of the 1,000 most highly expressed transcripts were ROR1. Low ROR1 compared to cancer Hi Among the 1,000 most highly expressed in cancer (e.g., ALDH1A1), only three are ROR1 Hi ROR1 compared with tumor Low ROR1 was among the 1,000 most highly expressed by tumors (p<0.0001, Fisher's exact test). Similarly, 190 of the 1,000 most low-expressed transcripts after chemotherapy were also ROR1. Low ROR1 compared with tumor Hi ROR1 is among the 1,000 most underexpressed genes in breast cancer. Hi ROR1 compared to cancer Low None of these transcripts were underexpressed by the tumors (p<0.0001, Fisher's exact test).

[0218] We noted that 43 (76%) of the 57 post-treatment cancer biopsies described in GSE87455 expressed higher levels of ROR1 than their matched pre-treatment biopsies, and 48 (84%) expressed higher levels of ALDH1A1 than their matched pre-treatment biopsies (Figure 1B). Similar findings were observed for samples described in GSE21457 (Figure 6B). Furthermore, post-treatment cancer cells had higher levels of genes associated with activation of Rho-GTPases, Hippo-YAP, or BMI1 than pre-treatment specimens (Figure 1C). Furthermore, ROR1 Hi As noted for the tumors, post-treatment breast cancer cells were either embryonic stem cells or CD44 + / CD24 Low They expressed higher levels of genes associated with CSCs (Table 1). + / CD24 Low Genes that were expressed at lower levels in CSCs or in MS-forming cells compared to levels in non-CSCs or the total tumor population were underexpressed in post-treatment samples (Table 1) (Creighton et al., 2009), including ROR1. HiROR1 compared to tumors Low ROR1 was highly expressed in the breast CSCs and / or in the BRCA1 / BRCA2 / BRCA3 / BRCA4 / BRCA5 / BRCA6 / BRCA7 / BRCA8 samples (Table 1). Taken together, these data indicate that ROR1 is a marker for breast CSCs and / or that ROR1 Hi This suggests that tumor cells have a selective advantage when treated with chemotherapy.

[0219] Expression of ROR1, TAZ and BMI1 before and after chemotherapy Because TAZ accumulates upon Hippo-YAP activation (Park et al., 2015), we examined primary cancers from treatment-naive patients (N=23) for ROR1, TAZ, and BMI1 via immunoblot. As noted (Zhang et al., 2012a), >60% of primary breast cancers had detectable ROR1 (Figure 1D and Table 2). Furthermore, expression of ROR1 correlated with expression of TAZ (Figure 1E and Table 2, Pearson R=0.56, P<0.01, N=23) or BMI1 (Figures 1D and 1E and Table 2, Pearson R=0.99, P<0.0001, N=23).

[0220] We obtained formalin-fixed paraffin-embedded pre- and post-treatment biopsies from patients (N=22) with invasive ductal carcinoma who were treated with docetaxel, epirubicin, and / or cyclophosphamide and examined for ROR1 via immunohistochemistry. Of 22 matched specimens, 14 (64%) had increased ROR1 after treatment and 7 (32%) had unchanged levels of ROR1 (Figures 1F-1G, Table 3). Only one of the post-treatment specimens had lower levels of ROR1 than the pre-treatment sample (Table 3). These findings corroborate those obtained by examining the transcriptomic data, indicating that cancers are generally enriched for ROR1+ cells after chemotherapy.

[0221] ROR1 + Breast cancer cells have characteristics of breast CSCs The present inventors have identified Rag2 - / - γc - / -We established breast cancer PDXs in mice (Table 4). PDXs retain the heterogeneity commonly found in primary tumors, and the tumors typically harbor a small percentage of cells with CSC characteristics. For example, only 0.6% or 6.5% of tumor cells in PDX1 or PDX4, respectively, had detectable ALDH1 enzyme activity (Table 4). Nevertheless, such tumor cells, as well as tumor cells that co-expressed CD44 and low levels of CD24, expressed higher levels of ROR1 than cancer cells of the same tumors that were ALDEFLUOR negative or CD44 and CD24 negative (Figures 7A-7C). The PDXs with the highest levels of ROR1 (PDX4 and PDX5) also had the highest levels of CSC markers and BMI1 (Figures 7D-7E). Furthermore, PDXs with high levels of ROR1 had significantly higher levels of nuclear YAP / TAZ than cancer cells in the same PDXs with low to undetectable ROR1 as assessed by confocal microscopy ( Figure 7F , P < 0.05).

[0222] We found that PDXs with a high percentage of ROR1+ cells formed significantly greater numbers of spheroids than PDXs with relatively few ROR1+ cells (Figure 7G). Furthermore, tumor cells from PDXs with a high percentage of ROR1+ cells were more invasive in Matrigel than tumor cells from PDXs with fewer ROR1+ cells (Figure 7H).

[0223] We cloned equal numbers of tumor cells from each PDX into Rag2 - / - γc - / - The tumors were then transplanted into mice and monitored for engraftment. Tumors formed using cells from PDXs with a high percentage of ROR1+ cells (e.g., PDX4 or PDX5) grew faster than tumors grown from PDXs with fewer ROR1+ cells (e.g., PDX1 or PDX2, Figure 2A). 3Upon reaching the ROR1+ cell count, mice were treated with 13.4 mg / kg paclitaxel for 5 consecutive days and tumor regression was observed (Figure 2A). We noted that tumors derived from PDXs with a high percentage of ROR1+ cells (e.g., PDX4 or PDX5) regrew soon after treatment, in contrast to tumors derived from PDXs with fewer ROR1+ cells (e.g., PDX1 or PDX2, Figure 2A).

[0224] We resected tumors from PDX4 or PDX5 and found that the remaining tumors from mice treated with paclitaxel had a higher percentage of ROR1+ cells than matched tumors or the initial PDX from mice that did not receive paclitaxel (Figure 2B and Figure 7I, PDX4: 61.7% ± 7.0% vs. 4.5% ± 1.1%, PDX5: 56.4% ± 6.4% vs. 8.5% ± 5.8%). As noted in a previous study (Samanta et al., 2014), tumors from mice treated with paclitaxel also had a higher percentage of ALDH1-expressing cells than matched tumors or the initial PDX from untreated mice (Figure 7J). Finally, tumors from mice treated with paclitaxel were less likely to form spheroids, invade matrigel, or express Rag2 compared to matched tumors or the initial PDX from untreated mice. - / - γc - / - The results were enriched for cells that could regenerate into mice (Figures 2C-2E).

[0225] We isolated ROR1+ and ROR1+ from PDX4 or PDX5 through flow cytometry using 4A5, a mAb that binds to an epitope of ROR1 distinct from the epitope recognized by sirumtuzumab. Neg Breast cancer cells were isolated (Figure 7K). ROR1+ cells were ROR1 Neg They formed significantly larger numbers of spheroids than ROR1 cells. Neg The cells formed few or no spheroids (Figure 7L). Furthermore, ROR1+ cells were significantly more potent than ROR1+ cells in the same tumor. Neg were significantly more invasive in Matrigel than in cancer cells ( Fig. 7M ).

[0226] Tumorigenicity assays were performed using limited numbers of tumor cells derived from PDX4 or PDX5. 500 ROR1+ cells from each PDX were able to establish secondary PDXs in the majority of mice (Figure 7N). In contrast, the same number of ROR1 Neg The cells did not form tumors in all but a few animals (Figure 7N). Similarly, as noted in previous studies (Al-Hajj et al., 2003; Ginestier et al., 2007), the ALDH1+ or CD44+ / CD24+ cells isolated from these PDXs were not associated with tumor formation. Low The cells also showed the same ALDH1 Neg or had a significantly greater ability to form secondary PDX than CD44+ / CD24+ cells (Table 5).

[0227] Sirmutuzumab inhibits Wnt5a-induced ROR1-dependent activation of Rho-GTPases, Hippo-YAP, and BMI1 We lost the expression of ROR1 through CRISPR / Cas9 in the prototype breast cancer cell line Hs578T (Figure 3A). Exogenous Wnt5a was able to induce activation of Rac1, RhoA, and cdc42 within 10 minutes in wild-type Hs578T cells (wt-Hs578T), but not in ROR1-deficient Hs578T cells (Figure 3B). - / - Hs578T cells (ROR1 - / - In addition, treatment with sirumtuzumab, but not with human IgG (hIgG) of irrelevant specificity, inhibited the ability of exogenous Wnt5a to induce activation of Rac1, RhoA, or cdc42 in wt-Hs578T cells (Fig. 3A). Treatment with Wnt5a also enhanced the expression and nuclear translocation of YAP / TAZ, but not ROR1, in wt-Hs578T cells. - / - There was no enhancement in Hs578T (Figures 3C and 3D).

[0228] Treatment with sirumtuzumab also inhibited the ability of exogenous Wnt5a to induce YAP / TAZ expression or nuclear translocation in wt-Hs578T cells (Figures 3E and 3F).

[0229] Treatment with exogenous Wnt5a for 2 h enhanced BMI1 protein expression, but not BMI1 mRNA expression, and downregulated ROR1 expression in wt-Hs578T cells. - / - BMI1 protein expression was not enhanced in Hs578T cells (Figure 3G and Figure 8A), suggesting that Wnt5a upregulates BMI1 in a posttranscriptional manner. Consistent with this ROR1-dependent effect of Wnt5a, we noted that cirumutuzumab could inhibit the ability of Wnt5a to enhance BMI1 expression in wt-Hs578T (Figure 3G).

[0230] We investigated whether treatment of Hs578T with Wnt5a could induce AKT phosphorylation, which was previously shown to inhibit the proteasomal degradation of BMI1 and promote its accumulation ( Kim et al., 2011 ). Wnt5a induced AKT phosphorylation in wt-Hs578T cells, but not ROR1 phosphorylation. - / - In Hs578T cells, however, Wnt5a did not induce ROR1 signaling (Figure 3G). In contrast, treatment of wt-Hs578T cells with AKT-specific small interfering RNA or a small molecule inhibitor of AKT (MK-2206) impaired the ability of Wnt5a to induce AKT activation and enhanced BMI1 expression (Figures 3H and 8B). Treatment with sirumutuzumab also inhibited the ability of Wnt5a to induce AKT activation or BMI1 expression (Figures 3I-3J), suggesting that these Wnt5a effects are dependent on ROR1 signaling.

[0231] Functionally, ROR1 - / - Hs578T cells formed significantly fewer spheroids than wt-Hs578T cells (Fig. 3K). Moreover, treatment with exogenous Wnt5a could enhance the invasion of wt-Hs578T cells, but not ROR1. - / - Hs578T could not (Fig. 3L). - / -Hs578T cells were more sensitive to treatment with paclitaxel than wt-Hs578T cells. Furthermore, exogenous Wnt5a could enhance the resistance of wt-Hs578T to paclitaxel, whereas ROR1 - / - This was not possible with Hs578T (Fig. 3M).

[0232] Sirmutuzumab inhibited the ability of exogenous Wnt5a to enhance wt-Hs578T to form spheroids (Figure 3N) or invade Matrigel (Figure 3O). Furthermore, treatment with sirumtuzumab enhanced the sensitivity of wt-Hs578T to paclitaxel and inhibited the ability of Wnt5a to enhance the resistance of wt-Hs578T to paclitaxel, whereas treatment with nonspecific hIgG failed to do so (Figure 3P).

[0233] Sirmutuzumab inhibits engraftment of breast cancer PDXs We investigated the activity of cirumutuzumab on primary breast cancer cells that expressed variable levels of Wnt5a (Figure 9A). Tumor cells isolated from each PDX were treated with 50 μg / ml cirumutuzumab for 4 hours before confocal microscopy. This revealed that primary breast cancer cells treated with cirumutuzumab had significantly less nuclear YAP / TAZ than tumor cells from the same PDX treated with control hIgG (Figure 9B).

[0234] A time course study revealed that sirmutuzumab, but not non-specific hIgG, was able to reduce BMI1 expression within 6 hours (Figure 9C). Sirmutuzumab also inhibited the ability of breast cancer PDXs to form spheroids or invade Matrigel (Figures 9D-9E). Biweekly intravenous infusion of sirmutuzumab (at 10 mg / kg) significantly suppressed PDX tumor development and growth (Figures 4A-4B and Figure 9F). Furthermore, the difference noted in the number of lung metastases between sirmutuzumab-treated (N=0 / mouse) versus control-treated (N=2 / mouse) animals was statistically significant (P<0.05, Student's t-test).

[0235] We examined the transcriptomes of tumors excised from cirumtuzumab-treated mice (N=4) versus control Ig-treated mice (N=4) and performed a GSE analysis (GSE108632) on the RNA-seq data. Tumor cells isolated from PDXs of cirumtuzumab-treated mice showed significantly higher activation of Rho-GTPases, Hippo-YAP, or BMI1, or CD44+ / CD2 ... Low Expression of genes associated with tumor cells was significantly lower (Figure 4D). PDX from cirumtuzumab-treated mice also had lower levels of ROR1 by immunoblot analysis, reduced levels of genes associated with Rho-GTPase activation, and lower levels of genes targeted by Hippo-YAP (e.g., CTGF) or BMI1 (e.g., ABCG2) than PDX from control-treated mice (Figure 4E). Tumors from cirumtuzumab-treated mice contained more cells bearing markers of CSCs (e.g., CD44+ / CD24+) than tumors from control hIgG-treated mice. Low The proportion of CD44+ / CD24 Low Expression of genes normally expressed at high levels by tumor cells was also low ( Fig. 4F ).

[0236] We isolated tumor cells from PDXs from mice treated with cirumutuzumab or control hIgG and identified Rag2 - / - γc - / - Their relative ability to form secondary PDX in mice was examined. Tumor cells from PDXs derived from cirumtuzumab-treated mice were significantly less effective at engrafting in mice than tumor cells from the same PDXs derived from control-treated animals (Figure 4G). Collectively, these data indicate that treatment with cirumtuzumab can inhibit the growth and self-renewal of breast CSCs.

[0237] Paclitaxel and sirmtuzumab achieve greater tumor clearance than each alone We treated equal numbers of tumor cells from PDX4 or PDX5 with 50 μg / ml of cirumutuzumab or control hIgG overnight, then cultured the cells in triplicate in separate wells with increasing concentrations of paclitaxel. Treatment with cirumutuzumab significantly enhanced the sensitivity of breast cancer cells to the cytotoxic effects of paclitaxel (e.g., IC50 for PDX4: 14±1 μM with cirumutuzumab vs. 23±1 μM with non-specific hIgG, P<0.001, Student's t-test, FIG. 10).

[0238] We treated PDX4- or PDX5-bearing mice with cirumutuzumab (10 mg / kg), paclitaxel (13.4 mg / kg) (Desai et al., 2006), or a combination of cirumutuzumab and paclitaxel. Treatment with cirumutuzumab and paclitaxel was significantly more effective in reducing tumor burden than treatment with either cirumutuzumab or paclitaxel alone (Figure 5A), and each of cirumutuzumab and paclitaxel inhibited tumor growth compared to that of control-treated animals. Tumor cells isolated from PDXs of mice treated with cirumtuzumab and paclitaxel showed reduced levels of ROR1, reduced activation of Rho-GTPase and AKT, reduced levels of YAP / TAZ, lower expression levels of Hippo-YAP target genes (e.g., CTGF), lower levels of BMI1, and lower expression levels of BMI1 target genes (e.g., ABCG2) than tumor cells treated with paclitaxel alone (Figure 5B). These data indicate that the combination of cirumtuzumab and paclitaxel had complementary antitumor activity.

[0239] We isolated tumor cells from PDXs that relapsed after treatment and examined their ability to re-engraft in immune-deficient mice. We found that tumor cells from PDXs derived from mice treated with single-agent paclitaxel readily gave rise to secondary PDXs. However, tumor cells recovered from mice treated with cirumtuzumab were less potent at giving rise to secondary PDXs than even tumor cells recovered from control IgG-treated animals. On the other hand, none of the mice engrafted with tumor cells isolated from mice treated with cirumtuzumab and paclitaxel gave rise to detectable tumors (Figure 5C).

[0240] Tumor recurrence following treatment with chemotherapy can be driven by a subpopulation of CSCs, which are relatively resistant to standard chemotherapy and have self-renewal and / or tumor-initiating capabilities (Brooks et al., 2015; Wahl and Spike, 2017). Consistent with this notion, we observed that residual breast cancer cells after conventional chemotherapy expressed more CSC markers and genes associated with CSCs (e.g., Hippo-YAP or BMI1 target genes) than matched tumor samples obtained before chemotherapy. Previous studies have noted that PDXs isolated from paclitaxel-treated animals are enriched for cells with breast CSC characteristics (Bhola et al., 2013; Samanta et al., 2014). We found that breast cancers were also enriched for ROR1+ cells after chemotherapy, implying that ROR1 is a marker for CSCs, which may be selected and / or induced by chemotherapy (Wahl and Spike, 2017).

[0241] The possibility that ROR1 may serve as a marker for breast CSC cells was demonstrated in an analysis of gene expression data from breast cancer patients with biopsies prior to treatment. Hi Breast cancer is ROR1 Low We found that ROR1+ cancer cells express higher levels of ALDH1A1 and other genes associated with CSCs than breast cancer. Furthermore, sorted ROR1+ cancer cells from the same tumors express higher levels of ALDH1A1 and other genes associated with CSCs than ROR1+ cancer cells from the same tumors. NegROR1+ tumor cells expressed higher levels of CSC-related genes than ROR1 cells derived from the same tumor. Neg They had a greater ability to form spheroids, invade Matrigel, and engraft in immune-deficient mice than tumor cells. Collectively, these studies indicate that ROR1 is a marker for breast CSCs.

[0242] ROR1 is not only a marker for CSCs, but also apparently plays a functional role in maintaining CSCs. We found that the expression of genes related to Rho-GTPase activation is increased in breast cancer cells expressing ROR1, and Wnt5a can enhance Rho-GTPase activation in a ROR1-dependent manner. Previous studies have found that Rho-GTPase signaling is altered in human breast tumors, and elevated expression and activation of Rho-GTPase correlates with tumor progression, metastasis, and poor prognosis (Fritz et al., 1999; McHenry and Vargo-Gogola, 2010). Furthermore, activation of Rac1 may promote breast cancer cell survival in response to hyperfractionated radiation treatment (Hein et al., 2016).

[0243] ROR1 also contributes to the activation of the Hippo-YAP pathway. YAP / TAZ is a key mediator of the Hippo-YAP pathway, which can promote stemness in embryonic or induced pluripotent stem cells, as well as promote tumorigenesis by increasing cancer cell migration and invasiveness, resistance to chemotherapy, and the ability to form distant metastases (Bartucci et al., 2015; Chan et al., 2008; Hiemer et al., 2014; Mo et al., 2014; Moroishi et al., 2015; Tamm et al., 2011). Previous studies have found that Rho-GTPase signaling may instruct the Hippo-YAP pathway to sustain human embryonic stem cell survival and self-renewal (Ohgushi et al., 2015). Furthermore, co-expression of ROR1 with FZD2 or FZD5 induced significant YAP dephosphorylation and TAZ accumulation, activating Hippo-YAP signaling in HEK293A cells (Park et al., 2015).Similarly, we found that ROR1 was associated with the expression and nuclear localization of TAZ in primary breast cancer cells, and Wnt5a could enhance the nuclear accumulation of YAP / TAZ in a ROR1-dependent manner.

[0244] The levels of BMI1 in primary breast cancer specimens also correlated with the levels of ROR1. Wnt5a could induce a ROR1-dependent increase in breast cancer cell expression of BMI1 within 2 hours. The rapid induction of BMI1 suggests that Wnt5a / ROR1 signaling enhances the post-transcriptional stability of BMI1, which appears to be dependent on the activation of AKT. Activated AKT can phosphorylate BMI1 at three highly conserved serine residues to reduce BMI1 protein turnover (Murga et al., 2002; Nacerddine et al., 2012; Voncken et al., 2005). Consistent with this view, we found that silencing AKT inhibited the ability of Wnt5a to induce BMI1 in ROR1+ breast cancer cells.

[0245] Since postnatal expression of ROR1 appears to be virtually restricted to cancer cells (Zhang et al., 2012a), ROR1 is an attractive target for anticancer therapy. Sirmutuzumab is a humanized mAb specific for ROR1 that is undergoing clinical evaluation in patients with CLL (Choi et al., 2015). Previous studies have found that cirumtuzumab can inhibit the proliferation and migration of ROR1+ CLL cells in response to Wnt5a (Yu et al., 2016). Here, we show that cirumtuzumab inhibits the activation of Rho-GTPases and upregulates the expression of genes targeted by Hippo-YAP or BMI1, or CD44+ / CD24 Low We show that cirumutuzumab can suppress the expression of genes upregulated in breast CSCs, revealing that cirumutuzumab may inhibit signaling required for CSC maintenance and migration. Consistent with this view, we found that cirumutuzumab can suppress the ability of ROR1+ mammary tumor cells to engraft or form distant metastases in immune-deficient mice. Furthermore, we found that cirumutuzumab can enhance the sensitivity of ROR1+ tumor cells to treatment with paclitaxel in vitro, likely due to its ability to inhibit the activation of YAP / TAZ or BMI1 target genes, which previous studies have shown can contribute to drug resistance (Kreso et al., 2014; Wu et al., 2011).

[0246] Functional differences between CSC and non-CSC cells can affect response to therapy and tendency to relapse after treatment (Wahl and Spike, 2017; Wang et al., 2015). This may explain why the combination treatment of cirumutuzumab and paclitaxel in vivo had greater activity against established PDX than each therapy alone. Thus, combination therapies, one directed against CSCs (e.g., cirumutuzumab) and one directed against non-CSCs (e.g., paclitaxel), may have synergistic therapeutic activity and potentially confer improved treatment outcomes and survival for breast cancer patients.

[0247] Experimental model and subject details Breast cancer specimens. Fresh frozen breast tissues examined for ROR1, TAZ, or BMI1 expression were obtained from Peking University Shenzhen Hospital, China, with the consent of the hospital authorities and patients, who provided signed informed consent. All protocols were approved by the Shenzhen Medical Ethics Committee of Peking University Shenzhen Hospital. Forty-four matched formalin-fixed paraffin-embedded (FFPE) tumor tissues were derived from 22 patients newly diagnosed with invasive ductal adenocarcinoma at Sun Yat-sen University Cancer Center, China, from September 2005 to January 2015. All patients underwent core needle biopsy or excision biopsy before neoadjuvant chemotherapy. After chemotherapy, all patients underwent surgical procedures. We examined matched formalin-fixed paraffin-embedded tissues from each patient before and after neoadjuvant chemotherapy. Neoadjuvant chemotherapy consisted of docetaxel, and / or doxorubicin, and / or cyclophosphamide. All protocols were approved by the Medical Ethics Committee of Sun Yat-sen University Cancer Center. Primary breast tumor specimens used to generate patient-derived xenografts were collected from patients who provided signed informed consent in accordance with the Declaration of Helsinki and under a protocol approved by the UC San Diego Institutional Review Board (HRPP#090401).

[0248] Patient-derived xenografts. Female Rag2 mice, 4-8 weeks old - / - γc - / -Mice were used in this study in accordance with the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals. The UC San Diego School of Medicine Animal Care and Use Committee approved the study protocol. Mice were housed in a laminar flow cabinet in a specific pathogen-free environment and fed ad libitum. PDXs were established using freshly mechanically minced breast cancer specimens. Primary tumor tissues from these PDX models at early passages (P1–P5) were mechanically minced and enzymatically and mechanically dissociated using a GentleMACS Dissociator (Miltenyi Biotec) according to the manufacturer's instructions. Red blood cells were removed through density gradient centrifugation in Percoll™ Plus (GE Healthcare Life Sciences, CC-17-5442-01).

[0249] Tumorigenicity assay. Cells were suspended in mammary epithelial growth medium (MEGM) and mixed with Matrigel (BD Biosciences, San Diego, CA) at a 1:1 ratio, then transfected with Rag2 - / - γc - / - The tumors were implanted into the mammary pads of mice. Mice were monitored weekly for tumor growth. Tumors were excised 10 days after treatment with 13.4 mg / kg paclitaxel via intravenous injection for 5 consecutive days, and tumor cells were examined for ROR1 expression. To examine metastasis, lungs of 6 mice from each treatment group were harvested 42 or 48 days after implantation, and the tissues were fixed in 10% formalin before embedding in paraffin. Each paraffin block was cut into 200 μm sections. Tumor lesions were scored in a blinded fashion by a board-certified pathologist. To examine whether cirumutuzumab alone or in combination with paclitaxel impairs the engraftment of primary breast tumor cells, 1 × 10 5 Single cells were cultured at 4-6 weeks of age in Rag2 cells. - / - γc - / - The mice were injected into the mammary pads. The tumor size was 300 mm 3Upon reaching this threshold, 13.4 mg / kg paclitaxel was injected intravenously for 5 consecutive days or / and 10 mg / kg cirmtuzumab was injected intravenously on days 0, 7, and then every other week. The control group was injected with hIgG instead of cirmtuzumab. Tumor volume (v) was determined using the formula v = (length) x (width)2 x 0.4.

[0250] RNA-Seq. Sample preparation and sequencing. Total RNA was prepared from resected tumor tissue from mice treated with control hIgG or cirumutuzumab using a Triazole RNA extraction protocol followed by purification using RNeasy columns (Qiagen kit). Total RNA was assessed for quality using an Agilent Tapestation. Samples had RNA integrity numbers (RIN) ranging from 9.2 to 9.9. RNA libraries were generated from 1 μg of RNA using Illumina's TruSeq Stranded mRNA Sample Prep Kit according to the manufacturer's instructions, with pruning times varying up to 5 min. RNA libraries were multiplexed and sequenced on an Illumina HiSeq4000 at 50 base pair (bp) single-end reads (SR50) to a depth of approximately 40 million reads per sample. A standard RNA-seq analysis pipeline was applied to the eight samples. Briefly, we removed adapters and trimmed reads of low quality score bases in slow sequencing cycles using Cutadapt, which removes adapter sequences from high-throughput sequencing reads (Marcel, 2011). We then mapped reads to Human Genome Build 38 using STAR aligner (v2.5.2b) (Dobin et al., 2013). We obtained raw gene counts from read alignments and Ensembl gene models (v83) using RSEM (v1.3.0) (Li and Dewey, 2011) (Yates et al., 2016). We normalized read count data using package DEseq2 (Love et al., 2014) and assessed for differential expression variation using package limma (Ritchie et al., 2015). Data have been deposited in the GEO database (GSE108632).

[0251] Gene Set Enrichment Analysis. We performed gene set enrichment analysis (GSEA) on primary microarray data available in the GEO database under accession numbers GSE87455 (Kimbung et al., 2018) and GSE21974. (Stickeler et al., 2011) using GSEA software (Subramanian et al., 2005). We also performed GSEA of RNA-Seq data generated from PDX samples isolated from cirumutuzumab-treated or control mice. Gene expression data from 50 breast cancer samples obtained before (n=25) or after (n=25) chemotherapy treatment (Tx) GSE21974 or from 122 breast cancer samples from the GSE87455 dataset were ranked by their relative expression of ROR1. Among these cases, tumors with ROR1 expression values ​​above the median for all samples were named ROR1Hi, and tumors with ROR1 expression values ​​below the median were named ROR1Low. We ranked genes by their association with breast cancer groups (ROR1Hi vs. ROR1Low) using the GSEA signal-to-noise ratio ranking metric. We focused GSEA on three pathways: Rac1 in the BIOCARTA database, cdc42 in the Pathway Interaction database (Liberzon et al., 2011; Schaefer et al., 2009), and RhoA in the Ingenuity pathway database (IPA®, QIAGEN Redwood City, at website qiagen.com / ingenuity). Each gene set was considered significant if the false positive rate (FDR) was less than 25% (Subramanian et al., 2005). For each gene set tested, the gene set size (SIZE), enrichment score (ES), normalized ES (NES), nominal p-value (NOMp-val), and FDRq-value (FDRq-val) were determined. The FDRq-values ​​were adjusted for gene set size and multiple hypothesis testing.

[0252] Spheroid formation assay. 300–10,000 viable single cells were plated onto ultra-low attachment surface 6-well or 96-well plates (Corning Incorporated Life Sciences, Corning, NY) and cultured in MEGMTM Mammary Epithelial Cell Growth Medium (Lonza, MD) with or without 100 ng / ml recombinant Wnt5a (R&D system) for 1–3 weeks. Spheroids with a size larger than 100 μm were counted using an inverted microscope (Nikon, Melville, NY).

[0253] Flow cytometry analysis. Single cell suspensions were treated with Fc-blocking (Miltenyi Biotec) and then stained with fluorescein-conjugated anti-CD44, phycoerythrin (PE)-conjugated anti-CD24 (Pharmingen), Alexa-647-conjugated 4A5 (Fukuda et al., 2008), and PE-conjugated anti-EpCAM (BD Biosciences). ALDH1 activity was detected as previously described (Zhang et al., 2014). Data were acquired using a FACS-Calibur or FACS-Aria (Becton Dickinson) and analyzed using FlowJo software (Tree Star). Forward light scatter (FSC) and side scatter (SSC) gating were used to exclude cell debris. In addition, we excluded cells stained with propidium iodide (PI, Sigma) and gated on cells stained with calcein violet (Life Technology) for viable cell analysis. Finally, breast cancer epithelial cells could be examined by gating on cells bound to a mAb specific for human EpCAM.

[0254] Cell invasion assay. 5 × 10 cells from primary tumors 4Viable single cells were suspended in MEBM growth medium (Lonza, MD), plated in the invasion chamber (8 μm pore size, BD Biosciences) and cultured overnight with or without cirumutuzumab (50 μg / ml). The lower chamber was filled with serum-free conditioned medium collected from NIH3T3 cells. Invasion assays for cell lines were performed as described (Cui et al., 2013). Cells from the apical side of each insert were scraped. Invaded cells were fixed with 4% paraformaldehyde, stained with Diff-Quick staining kit (IMEB Inc, San Marcos, CA), and visualized under an inverted microscope (Nikon).

[0255] Immunohistochemical staining. For immunohistochemical staining, primary tumors or lung organs excised from mouse xenografts were fixed in formalin. Lung tissue sections were prepared and stained with Hematoxylin & Eosin (H&E), Hematoxylin and / or anti-ROR1 antibody (4A5) as described (Zhang et al., 2012a). Images were collected using a Delta Vision microscope. The levels of ROR1 were scored on the following scale: score 0 indicates that no cancer cells in the sample stained with anti-ROR1 mAb; score 1 indicates low-level binding of the mAb to tumor cells or low-to-moderate levels of binding of the mAb to less than 50% of tumor cells; score 2 indicates moderate levels of staining on more than 50% of tumor cells or high levels of staining on less than 50% of tumor cells; score 3 indicates high levels of staining on more than 50% of tumor cells. All staining was evaluated by a board-certified pathologist.

[0256] Immunofluorescence staining. Cells were cultured to appropriate density on cover slips or spun onto slides by using a cytocentrifuge after various treatments. Cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 in PBS. Cells were washed twice with PBS and then blocked with 1% BSA in PBS for 30 min. Control antibodies or rabbit anti-YAP / TAZ and mouse 4A5 were added in blocking buffer and incubated for 1.5 h. After washing the cells with PBS, the cells were incubated with Alexa Fluor 594-conjugated anti-rabbit secondary antibody or Alexa Fluor 488-conjugated anti-mouse secondary antibody for 1.5 h. Next, the cells were washed again and then mounted onto slides using ProLong Gold antifade reagent with DAPI (Life Technologies). Images were obtained and analyzed by using an Olympus FV1000 confocal microscope. The percentage of nuclear-localized YAP / TAZ was analyzed by intensity measurement with Image J software. Nuclear localized YAP / TAZ is calculated by subtracting the YAP / TAZ signal intensity in the cytosol from the YAP / TAZ signal intensity in the whole cell. The percentage of nuclear YAP / TAZ is calculated by dividing the nuclear localized YAP / TAZ signal by the YAP / TAZ signal for the whole cell.

[0257] BrdU incorporation ELISA. 300–10,000 cells with or without different treatments were plated in 96-well plates and cultured for 3 days. BrdU cell proliferation ELISA (enzyme-linked immunosorbent assay, Roche) was performed according to the manufacturer's instructions. Briefly, BrdU was added to the medium and cells were cultured overnight. Then, cells were fixed, permeabilized in wells of a 96-well plate and incubated with a peroxidase-conjugated antibody specific for BrdU for 2 h. Tetramethylbenzidine (TMB) substrate was used for peroxidase detection. The number of viable cells was calculated using a standard curve derived from different numbers of the same cells measured by BrdU cell proliferation ELISA. The percentage of viable cells was calculated by the number of viable cells with different treatment groups normalized to the number of viable cells without treatment.

[0258] Immunoblot analysis. Cells used for testing proteins through immunoblot analysis were treated overnight with control antibody or cirumtuzumab (50 μg / ml) and then cultured in medium supplemented with or without recombinant Wnt5a (100 ng / ml). Treated cells or tissues were lysed in a buffer containing 1% NP40, 0.1% SDS, 0.5% sodium deoxylate, supplemented with protease inhibitors (Pierce). Size-separated proteins were transferred to membranes, which were then incubated with primary antibodies specific for ROR1, YAP / TAZ, BMI-1, ABCG2, pAKT AKT, β-actin (Cell Signaling Technology), Rac1, RhoA, cdc42 (Cytoskeleton), CTGF (Abcam) or Wnt5a (R&D system). After washing away unbound antibody, the membrane was incubated with horseradish peroxidase-conjugated secondary antibody. Blots were then prepared for enhanced chemiluminescence and autoradiography. Protein concentrations were determined using the bicinchoninic acid protein assay (Pierce).

[0259] Assays for activated RhoA, Rac1, and Cdc42. RhoA and Rac1 activation assay reagents were purchased from Cytoskeleton and used according to the manufacturer's instructions. Briefly, GTP-binding active RhoA, Rac1, or Cdc42 were pulled down with Rhotekin-RBD or PAK-PBD beads, respectively, and then subjected to immunoblot analysis. Total RhoA, Rac1, or Cdc42 was assessed using immunoblots of total cell lysates. The integrated optical density (IOD) of the bands was assessed by densitometry and analyzed using Gel-Pro Analyzer 4.0 software (Media Cybernetics).

[0260] Quantitative PCR. Total RNA was extracted using Trizol (Life Technologies). A 10 μg amount of total RNA was incubated with 10 U of RNase-free DNase I (Life Technologies) for 30 min at 37°C. RNA was further purified using the RNeasy Mini Kit (QIAGEN). Purified total RNA (2 μg) was converted to cDNA using 200 U of Superscript III reverse transcriptase (Life Technologies). Taq2× Master Mix (NEB) was used for PCR according to the manufacturer's protocol.

[0261] CRISPR knockout ROR1. SpCas9 and chimeric guide RNA expression plasmid PX330 (Addgene) were used to generate stable ROR1 knockout cell lines according to a previously described protocol (Zhang et al., 2012a). The CRISPR targeting sequence of ROR1 (CCAGTGCGTGGCAACAAACGGCA) (SEQ ID NO: 5) was designed using the CRISPR Design tool (at website crispr.mit.edu). Cells transfected with ROR1 CRISPR plasmid were stained for ROR1 using 4A5-Alex647, and ROR1-negative cells were isolated and placed in culture. This process was repeated three consecutive times to isolate a population of ROR1 knockout cells.

[0262] Silencing of human AKT. AKT siRNA was purchased from cell signaling. All siRNA transfections were performed in DMEM serum-free medium using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's instructions, and then subjected to different assays.

[0263] Statistical analysis. Data were presented as mean ± standard error of the mean (SEM) unless otherwise indicated. Differences between two groups were determined by unpaired two-tailed Student's t-test. Differences between multiple groups were determined by Dunnett's multiple comparison test. All P values ​​less than 0.05 were considered significant. Analysis for significance was performed using GraphPad Prism 6.0 (GraphPad Software Inc.).

[0264] table

[0265] Table 1. Table 1 below shows ROR1 expression profiles from breast cancer patients prior to chemotherapy. Hi (N=61) vs. ROR1 Low (N=61) Sample and ROR1 Low (N=61) vs. ROR1 Hi Gene set enrichment (GSE) analysis of 10 stem cell gene expression signatures for (N=61) samples or for breast cancer biopsies from patients undergoing neoadjuvant chemotherapy (N=57) versus matched pre-treatment samples (N=57) in the GSE87455 database. An asterisk indicates that the gene set includes ROR1.

[0266] [Table 1]

[0267] Table 2. Table 2 below shows the estrogen receptor and ROR1 expression status of tumors from breast cancer patients. ND indicates not defined.

[0268] [Table 2]

[0269] Table 3. Table 3 below shows the clinical and pathological characteristics of tumors from patients who received neoadjuvant therapy. CR indicates complete response, PR indicates partial response, and ND indicates not defined.

[0270] [Table 3]

[0271] Table 4. Table 4 below shows the clinical and pathological characteristics of the tumors used to generate each PDX, as well as the percentage of CSC marker expression in the tumors.

[0272] [Table 4]

[0273] Table 5. Table 5 below shows the tumor incidence in animals implanted with different subpopulations of cells isolated from breast cancer PDXs.

[0274] [Table 5]

[0275] [Table 6]

[0276] [Table 7]

[0277] [Table 8]

[0278] [Table 9]

[0279] Table 10. Table 10 below shows the tumor incidence in animals implanted with ROR1Hi or ROR1Low cells isolated from each of the various breast cancer PDXs. The frequency and probability estimates of tumorigenic cells were calculated using ELDA software. ND indicates not done.

[0280] [Table 10]

[0281] Table 11. Table 11 below shows gene set enrichment (GSE) analysis for genes related to CD44+ / CD24Low MS, ETM, Rac1 / RhoA / cdc42 activation, Hippo-YAP, BMI1 for ROR1Low and ROR1Hi sample groups (N=25) or for breast cancer biopsies from patients who received neoadjuvant chemotherapy (N=25) versus matched pre-treatment samples in the GSE21974 database (N=25). SIZE is the number of genes included in the analysis. NES (Normalized Enrichment Score) accounts for differences in gene set size and can be used to compare analysis results across gene sets. NOM p-val (nominal p-value) is the statistical significance of the enrichment score that is not adjusted for gene set size or multiple gene set testing, and FDR q-val (false positive rate q-value) is the estimated probability that a gene set with a given NES represents a false positive. Each gene set is considered significant if the false positive rate (FDR) is less than 0.25.

[0282] [Table 11]

[0283] [Table 12] TIFF2025063134000014.tif216163TIFF2025063134000015.tif228162TIFF20250631340 00016.tif232162TIFF2025063134000017.tif228162TIFF2025063134000018.tif206162

[0284] Unofficial sequence listing [ka]

[0285] P embodiment

[0286] P Embodiment 1. A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an antimitotic agent and a ROR1 antagonist.

[0287] P embodiment 2. A method of treating cancer in a patient harboring a chemotherapy-resistant tumor, comprising administering to the subject a therapeutically effective amount of an antimitotic agent and a ROR1 antagonist.

[0288] P embodiment 3. A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a ROR1 antibody, wherein the subject expresses elevated levels of ROR1 compared to a standard control, and wherein the subject has undergone or is undergoing chemotherapy.

[0289] P embodiment 4. The method of P embodiments 1-3, wherein the mitotic inhibitor is paclitaxel.

[0290] P embodiment 5. The method of P embodiments 1-3, wherein the ROR1 antagonist is cirumutuzumab.

[0291] P embodiment 6. The method of P embodiments 1-3, wherein the cancer is breast cancer.

[0292] P embodiment 7. A pharmaceutical composition comprising a pharma- ceutical effective amount of an antimitotic agent and a ROR1 antibody.

[0293] P embodiment 8. The pharmaceutical composition of P embodiment 7, wherein the mitotic inhibitor and the ROR1 antibody are present in a combined synergistic amount, and wherein the combined synergistic amount is effective to treat cancer in a subject in need thereof.

[0294] Embodiment

[0295] Embodiment 1. A method of treating chemotherapy-resistant cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a chemotherapeutic agent and a therapeutically effective amount of a tyrosine kinase-like orphan receptor 1 (ROR-1) antagonist, thereby treating chemotherapy-resistant cancer in the subject.

[0296] Embodiment 2. The method of embodiment 1, comprising detecting a level of ROR-1 in said subject prior to said administering.

[0297] Embodiment 3. The method of embodiment 1 or 2, wherein the subject is undergoing or has undergone chemotherapy.

[0298] Embodiment 4. The method of any one of embodiments 1-3, wherein the chemotherapy-resistant cancer is chemotherapy-resistant breast cancer.

[0299] Embodiment 5. The method of any one of embodiments 1-4, further comprising, prior to said administering, selecting a subject expressing an increased level of ROR-1 as compared to a standard control.

[0300] Embodiment 6. The method of any one of embodiments 1-5, wherein the chemotherapeutic agent is a plant alkaloid, an antitumor antibiotic, or a topoisomerase inhibitor.

[0301] Embodiment 7. The method of any one of embodiments 1-6, wherein the chemotherapeutic agent is paclitaxel or docetaxel.

[0302] Embodiment 8. The method of any one of embodiments 1-6, wherein the chemotherapeutic agent is doxorubicin or epirubicin.

[0303] Embodiment 9. The method of any one of embodiments 1-8, wherein said ROR-1 antagonist is an antibody or a small molecule.

[0304] Embodiment 10. The method of any one of embodiments 1-9, wherein said ROR-1 antagonist is an anti-ROR-1 antibody.

[0305] Embodiment 11. The method of embodiment 10, wherein the antibody comprises a humanized heavy chain variable region and a humanized light chain variable region, wherein the humanized heavy chain variable region comprises the sequences set forth in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, and the humanized light chain variable region comprises the sequences set forth in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[0306] Embodiment 12. The method of embodiment 10 or 11, wherein the antibody is sirumtuzumab.

[0307] Embodiment 13. The method of embodiment 10, wherein the antibody comprises a humanized heavy chain variable region and a humanized light chain variable region, wherein the humanized heavy chain variable region comprises the sequences set forth in SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9, and the humanized light chain variable region comprises the sequences set forth in SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.

[0308] Embodiment 14. The method of any one of embodiments 1-13, wherein said chemotherapeutic agent and said ROR-1 antagonist are administered in a combined synergistic amount.

[0309] Embodiment 15. The chemotherapeutic agent and the method of any one of embodiments 1 to 14.

[0310] Embodiment 16. The method of any one of embodiments 1-15, wherein said ROR-1 antagonist is administered at a first time point and said chemotherapeutic agent is administered at a second time point, said first time point being prior to said second time point.

[0311] Embodiment 17. The method of any one of embodiments 1-16, wherein said chemotherapeutic agent and said ROR-1 antagonist are mixed prior to administration.

[0312] Embodiment 18. The method of any one of embodiments 1-17, wherein the chemotherapeutic agent is paclitaxel.

[0313] Embodiment 19. The method of any one of embodiments 1-18, wherein the chemotherapeutic agent is administered in an amount of about 5 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, or 15 mg / kg.

[0314] Embodiment 20. The method of any one of embodiments 1-19, wherein the chemotherapeutic agent is administered in an amount of about 13 mg / kg.

[0315] Embodiment 21. The method of any one of embodiments 1-20, wherein the chemotherapeutic agent is administered in an amount of 13.4 mg / kg.

[0316] Embodiment 22. The method of any one of embodiments 1-21, wherein the ROR-1 antagonist is administered in an amount of about 1 mg / kg, 2 mg / kg, 3 mg / kg, 5 mg / kg, or 10 mg / kg.

[0317] Embodiment 23. The method of any one of embodiments 1-22, wherein said ROR-1 antagonist is administered in an amount of about 2 mg / kg.

[0318] Embodiment 24. The method of any one of embodiments 1-23, wherein said chemotherapeutic agent is administered in an amount of 13.4 mg / kg and said ROR-1 antagonist is administered at about 2 mg / kg.

[0319] Embodiment 25. The method of any one of embodiments 1-24, wherein the chemotherapy agent is administered daily for at least 14 days.

[0320] Embodiment 26. The method of any one of embodiments 1-25, wherein the chemotherapy agent is administered daily for about 28 days.

[0321] Embodiment 27. The method of any one of embodiments 1-26, wherein said ROR-1 antagonist is administered once over a period of about 28 days.

[0322] Embodiment 28. The method of any one of embodiments 1-27, wherein the chemotherapy agent is administered intravenously.

[0323] Embodiment 29. The method of any one of embodiments 1-28, wherein said ROR-1 antagonist is administered intravenously.

[0324] Embodiment 30. The method of any one of embodiments 1-29, wherein the subject is a mammal.

[0325] Embodiment 31. The method of any one of embodiments 1 to 30, wherein the subject is a human.

[0326] Embodiment 32. A method of treating breast cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a chemotherapeutic agent and a therapeutically effective amount of a tyrosine kinase-like orphan receptor 1 (ROR-1) antagonist, thereby treating chemotherapy-resistant breast cancer in the subject.

[0327] Embodiment 33. A pharmaceutical composition comprising (i) a chemotherapeutic agent selected from the group consisting of a plant alkaloid, an antitumor antibiotic, and a topoisomerase inhibitor, (ii) a ROR-1 antagonist, and (iii) a pharmaceutically acceptable excipient.

[0328] Embodiment 34. A pharmaceutical composition comprising: (i) a chemotherapeutic agent selected from the group consisting of a plant alkaloid, an antitumor antibiotic, and a topoisomerase inhibitor, (ii) an anti-ROR-1 antibody, and (iii) a pharmaceutically acceptable excipient, wherein said chemotherapeutic agent and said anti-ROR-1 antibody are present in a combined synergistic amount, and said combined synergistic amount is effective to treat breast cancer in a subject in need thereof.

[0329] Embodiment 35. The pharmaceutical composition of embodiment 33 or 34, wherein the chemotherapeutic agent is a plant alkaloid.

[0330] Embodiment 36. The pharmaceutical composition of any one of embodiments 33-35, wherein the chemotherapeutic agent is paclitaxel.

[0331] Embodiment 37. The pharmaceutical composition of any one of embodiments 33 to 36, wherein said ROR-1 antagonist is an antibody or a small molecule.

[0332] Embodiment 38. The pharmaceutical composition of any one of embodiments 33 to 37, wherein said ROR-1 antagonist is an anti-ROR-1 antibody.

[0333] Embodiment 39. The pharmaceutical composition of embodiment 38, wherein the antibody comprises a humanized heavy chain variable region and a humanized light chain variable region, wherein the humanized heavy chain variable region comprises the sequences set forth in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, and the humanized light chain variable region comprises the sequences set forth in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[0334] Embodiment 40. The pharmaceutical composition of embodiment 38, wherein the antibody is cirumutuzumab.

[0335] [Sequence table] SEQ ID NOs: 5 and 11, which were skipped when converting from the st.25-compliant sequence listing to the st.26-compliant sequence listing, are shown below. <210> 5 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 5 Ser Gly Ser 1 <210> 11 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 11 Glu Ile Ser 1

Claims

1. 1. A pharmaceutical composition for treating chemotherapy-resistant cancer in a subject in need thereof, comprising a therapeutically effective amount of a chemotherapeutic agent comprising paclitaxel or docetaxel, For said treatment, a therapeutically effective amount of a tyrosine kinase-like orphan receptor 1 (ROR-1) antagonist antibody is administered; the antibody comprises a humanized heavy chain variable region and a humanized light chain variable region; the humanized heavy chain variable region comprises a heavy chain CDR1 set forth in SEQ ID NO: 1, a heavy chain CDR2 set forth in SEQ ID NO: 2, and a heavy chain CDR3 set forth in SEQ ID NO: 3; the humanized light chain variable region comprises a light chain CDR1 set forth in SEQ ID NO:4, a light chain CDR2 set forth in SEQ ID NO:5, and a light chain CDR3 set forth in SEQ ID NO:6; The chemotherapy-resistant cancer is paclitaxel-resistant or docetaxel-resistant and is HER2-negative breast cancer; and The pharmaceutical composition, wherein the subject is undergoing or has undergone chemotherapy.

2. The method of claim 1, wherein the treatment comprises detecting the level of ROR-1 in the subject.

3. 10. The method of claim 1, wherein the treatment is administered to a subject expressing increased levels of ROR-1 compared to a standard control.

4. The composition of claim 1, wherein the ROR-1 antagonist antibody is cirumutuzumab.

5. 10. The method of claim 1, wherein the chemotherapeutic agent and the ROR-1 antagonist antibody are administered simultaneously or sequentially.

6. 2. The composition of claim 1, wherein the ROR-1 antagonist antibody is administered at a first time point and the chemotherapeutic agent is administered at a second time point, the first time point being prior to the second time point.

7. 10. The composition of claim 1, wherein the chemotherapeutic agent and the ROR-1 antagonist antibody are mixed prior to administration.

8. The composition of claim 1 , wherein the chemotherapeutic agent is paclitaxel.

9. 9. The composition of claim 8, wherein the chemotherapeutic agent is administered in an amount of about 5 mg / kg, about 10 mg / kg, about 11 mg / kg, about 12 mg / kg, about 13 mg / kg, about 14 mg / kg, or about 15 mg / kg.

10. 10. The composition of claim 9, wherein the chemotherapeutic agent is administered in an amount of about 13 mg / kg.

11. 10. The method of claim 1, wherein the chemotherapeutic agent is administered in an amount of 13.4 mg / kg.

12. 10. The composition of claim 1, wherein the ROR-1 antagonist antibody is administered in an amount of about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 5 mg / kg, or about 10 mg / kg.

13. 10. The method of claim 1, wherein the ROR-1 antagonist antibody is administered in an amount of about 2 mg / kg.

14. 10. The composition of claim 1, wherein said chemotherapeutic agent is present in an amount of 13.4 mg / kg and said ROR-1 antagonist antibody is present in an amount of about 2 mg / kg.

15. 10. The composition of claim 1, wherein the composition is administered daily for at least 14 days.

16. 10. The composition of claim 1, wherein the composition is administered daily for about 28 days.

17. 10. The method of claim 1, wherein said ROR-1 antagonist antibody is administered once over a period of about 28 days for said treatment.

18. The composition of claim 1 , wherein the composition is administered intravenously.

19. The method of claim 1, wherein the ROR-1 antagonist antibody is administered intravenously for the treatment.

20. The composition of claim 1 , wherein the subject is a mammal.

21. The composition of claim 1 , wherein the composition is suitable for administration to a human.

Images