Multifunctional natural killer (NK) cell engagers binding to nkp46 and CD123
Patent Information
- Application Number
- JP2025005123
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-10-18
- Filing Date
- 2025-01-15
- Publication Date
- 2025-11-17
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The prior art is difficult to effectively treat or prevent acute myeloid leukemia (AML) and myeloid muscle cell syndrome (MDS), and existing NK cell activators have side effects such as cytokine release syndrome.
A multifunctional binding protein is developed that contains the first and second antigen binding domains (ABDs), as well as all or part of the immunoglobulin Fc region or variants thereof, the first ABD specifically binds human CD123, the second ABD specifically binds human NKp46, and all or part of the Fc region binds human Fc-γ receptor.
The binding protein can effectively activate NK cells, enhance its killing ability to AML cells, reduce the risk of cytokine release syndrome, and provide a new, easy-to-manufacturing and management treatment.
Smart Images

Figure 00000100_0000 
Figure 00000100_0001 
Figure 00000100_0002
Abstract
Description
[Technical field]
[0001] The present disclosure relates to a multifunctional binding protein comprising a first and a second antigen binding domain (ABD) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the first ABD specifically binds to human CD123, the second ABD specifically binds to human NKp46, and all or a portion of the immunoglobulin Fc region or a variant thereof binds to a human Fc-gamma receptor.
[0002] The disclosure also relates to methods of making said binding proteins, compositions thereof, and their uses, including the treatment or prevention of proliferative disorders, including acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS). [Background technology]
[0003] Acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS) are heterogeneous clonal neoplastic diseases that are believed to arise from subpopulations of leukemic stem cells, tend to be resistant to conventional chemotherapy, and may also be responsible for disease relapse.
[0004] Natural killer (NK) cells are a subpopulation of lymphocytes involved in non-conventional immunity. NK cells provide an effective immune surveillance mechanism that can eliminate unwanted cells such as tumor cells or virus-infected cells. The characteristics and biological properties of NK cells include the expression of surface antigens including CD16, CD56, and / or CD57, the absence of α / β or γ / δ TCR complexes on the cell surface, the ability to bind and kill cells without MHC restriction, especially cells that do not express "self" MHC / HLA antigens by activating specific cytolytic enzymes, the ability to kill tumor cells or other diseased cells that express ligands for NK activating receptors, and the ability to release protein molecules called cytokines that stimulate the immune response.
[0005] Interest has also focused on natural killer (NK) cells due to their potential anti-tumor properties. Summary of the Invention [Problem to be solved by the invention]
[0006] There remains a pressing need for active agents to treat or prevent proliferative disorders such as acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS).
[0007] Additionally, there is a need for novel NK engagers that have therapeutic efficacy.
[0008] There is also a need for new compounds that are easier to manufacture and / or administer, without or with reduced side effects, and in particular, new compounds that have no or reduced risk of cytokine release syndrome in patients (e.g., no or reduced IL-6-associated cytokine release). [Means for solving the problem]
[0009] In one embodiment, the present disclosure relates to a binding protein comprising a first and a second antigen binding domain (ABD) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein said ABDs each comprise an immunoglobulin heavy chain variable domain (V H ) and immunoglobulin light chain variable domain (V L ), including V H and V L Each of the three complementarity determining regions (CDR-1 to CDR-3); (i) the first ABD specifically binds to human CD123, and - V comprising CDR-H1, H2, and H3 corresponding to the amino acid sequences of SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 4 to 6, respectively H1 , and - V comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 10 to 12, respectively L1 Includes; (ii) the second ABD specifically binds human NKp46, and - the amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; The amino acid sequences of SEQ ID NOs: 22 to 24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25, and 26, respectively; V with corresponding CDR-H1, 2, and 3 H2 , and - the amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NOs: 30 to 32, respectively; The amino acid sequences of SEQ ID NOs: 33 to 35, respectively; The amino acid sequences of SEQ ID NOs: 36 to 38, respectively; or to the amino acid sequences of SEQ ID NOs: 39, 31, and 40, respectively; V with corresponding CDR-L1, 2, and 3 L2 Including, All or a portion of the immunoglobulin Fc region or a variant thereof binds to a human Fc-gamma receptor.
[0010] In certain embodiments, the binding protein comprises three polypeptide chains (I), (II), and (III) that form two ABDs defined as follows: V 1A -C 1A - Hinge 1-(C H 2-C H 3) A (I) V 1B -C 1B - Hinge 2 - (C H 2-C H 3) B -L1-V2A -C 2A - Hinge 3 (II) V 2B -C 2B (III) During the ceremony: V 1A and V 1B is the bond pair V1(V H1 / V L1 ) to form; V 2A and V 2B is the bond pair V2(V H2 / V L2 ) to form; C 1A and C 1B is compared with C1(C H 1 / C L ) and C 2A and C 2B is compared to C2 (C H 1 / C L ) and C H 1 is immunoglobulin heavy chain constant domain 1, C L is an immunoglobulin light chain constant domain; Hinge 1, Hinge 2, and Hinge 3 are the same or different and correspond to all or a portion of an immunoglobulin hinge region; (C H 2-C H 3) A and (C H 2-C H 3) B may be identical or different, and may be an immunoglobulin heavy chain constant domain 2 (C H 2) and immunoglobulin heavy chain constant domain 3 (C H 3) Including; L1 is an amino acid linker.
[0011] In certain embodiments, C 1B is the immunoglobulin heavy chain constant domain 1 (C H 1) and;C 2A is the immunoglobulin heavy chain constant domain 1 (C H 1) and;C Lis an immunoglobulin kappa light chain constant domain (C κ ) is equivalent to (C H 2-C H 3) A corresponds to the amino acid sequence of SEQ ID NO: 69; H 2-C H 3) B hinge 1 corresponds to the amino acid sequence of SEQ ID NO: 74; hinge 2 corresponds to the amino acid sequence of SEQ ID NO: 75; hinge 3 corresponds to the amino acid sequence of SEQ ID NO: 77; and L1 corresponds to the amino acid sequence of SEQ ID NO: 76.
[0012] In certain embodiments, residue N297 of the Fc region or a variant thereof according to EU numbering comprises an N-linked glycosylation.
[0013] In a specific embodiment, all or a portion of the Fc region or a variant thereof binds to a human CD16A (FcγRIII) polypeptide.
[0014] In certain embodiments, the binding protein comprises at least two polypeptide chains linked by at least one disulfide bridge.
[0015] In certain embodiments, the polypeptide chains (I) and (II) are 1A and hinge 2, and / or polypeptide chains (II) and (III) are linked by at least one disulfide bridge between hinge 3 and C 2B are linked by at least one disulfide bridge between them.
[0016] In certain embodiments, V 1A is V L1 and V 1B is V H1 In certain embodiments, V 2A is V H2 and V 2B is V L2 It is.
[0017] In certain embodiments, (a) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:7; CDR-L2 comprising the amino acid sequence of SEQ ID NO:8; CDR-L3 comprising the amino acid sequence of SEQ ID NO:9; V H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 13; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 14; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 15; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 27; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 28; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 29; (b) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:7; CDR-L2 comprising the amino acid sequence of SEQ ID NO:8; CDR-L3 comprising the amino acid sequence of SEQ ID NO:9; V H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 17; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 18; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 30; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 31; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 32; (c) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:7; CDR-L2 comprising the amino acid sequence of SEQ ID NO:8; CDR-L3 comprising the amino acid sequence of SEQ ID NO:9; V H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 19; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 20; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 21; L2comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 33; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 34; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 35; (d) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:7; CDR-L2 comprising the amino acid sequence of SEQ ID NO:8; CDR-L3 comprising the amino acid sequence of SEQ ID NO:9; V H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 36; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 37; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 38; (e) V H1 CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2 R-H2; comprising CDR-H3 comprising the amino acid sequence of SEQ ID NO:3; V L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:7; CDR-L2 comprising the amino acid sequence of SEQ ID NO:8; CDR-L3 comprising the amino acid sequence of SEQ ID NO:9; V H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 25; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 26; L2 (f) V comprises a CDR-L1 having the amino acid sequence of SEQ ID NO: 39; a CDR-L2 having the amino acid sequence of SEQ ID NO: 31; a CDR-L3 having the amino acid sequence of SEQ ID NO: 40; H1 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 13; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 14; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 15; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 27; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 28; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 29; (g) V H1 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 17; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 18; L2 (h) V comprises a CDR-L1 having the amino acid sequence of SEQ ID NO: 30; a CDR-L2 having the amino acid sequence of SEQ ID NO: 31; a CDR-L3 having the amino acid sequence of SEQ ID NO: 32; H1 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 19; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 20; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 21; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 33; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 34; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 35; (i) V H1 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 36; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 37; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 38; or (j)V H1 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 25; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 26; L2 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:39; CDR-L2 comprising the amino acid sequence of SEQ ID NO:31; and CDR-L3 comprising the amino acid sequence of SEQ ID NO:40.
[0018] In certain embodiments, (a) V H1 and V L1 corresponds to the amino acid sequences of SEQ ID NOs: 41 and 43, respectively, or to the amino acid sequences of SEQ ID NOs: 42 and 44, respectively; and / or (b)V H2 and V L2to the amino acid sequences of SEQ ID NOs: 45 and 53, respectively; to the amino acid sequences of SEQ ID NOs: 46 and 54, respectively; to the amino acid sequences of SEQ ID NOs: 47 and 55, respectively; to the amino acid sequences of SEQ ID NOs: 48 and 56, respectively; to the amino acid sequences of SEQ ID NOs: 49 and 57, respectively; to the amino acid sequences of SEQ ID NOs: 50 and 58, respectively; to the amino acid sequences of SEQ ID NOs: 51 and 59, respectively; or to the amino acid sequences of SEQ ID NOs: 52 and 60, respectively.
[0019] In certain embodiments: (a)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO: 45; L2 comprises the amino acid sequence of SEQ ID NO:53; (b)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO: 46; L2 comprises the amino acid sequence of SEQ ID NO:54; (c)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO: 47; L2 comprises the amino acid sequence of SEQ ID NO:55; (d)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO: 48; L2 comprises the amino acid sequence of SEQ ID NO:56; (e)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO: 49; L2 comprises the amino acid sequence of SEQ ID NO:57; (f)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO:50; L2 comprises the amino acid sequence of SEQ ID NO:58; (g)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO:51; L2 comprises the amino acid sequence of SEQ ID NO:59; (h)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO:52; L2 comprises the amino acid sequence of SEQ ID NO:60; (i)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO: 45; L2 comprises the amino acid sequence of SEQ ID NO:53; (j)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO: 46; L2 comprises the amino acid sequence of SEQ ID NO:54; (k)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO: 47; L2 comprises the amino acid sequence of SEQ ID NO:55; (l)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2comprises the amino acid sequence of SEQ ID NO: 48; L2 comprises the amino acid sequence of SEQ ID NO:56; (m)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO: 49; L2 comprises the amino acid sequence of SEQ ID NO:57; (n)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO:50; L2 comprises the amino acid sequence of SEQ ID NO:58. (o)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO:51; L2 comprises the amino acid sequence of SEQ ID NO:59; (p)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO:52; L2 comprises the amino acid sequence of SEQ ID NO:60.
[0020] In certain embodiments, polypeptide (I) comprises the amino acid sequence of SEQ ID NO:64; polypeptide (II) comprises the amino acid sequence of SEQ ID NO:65; and polypeptide (III) comprises the amino acid sequence of SEQ ID NO:66.
[0021] In a particular embodiment, polypeptide (I) consists of the amino acid sequence of SEQ ID NO:64; polypeptide (II) consists of the amino acid sequence of SEQ ID NO:65; and polypeptide (III) consists of the amino acid sequence of SEQ ID NO:66.
[0022] In one embodiment, the present disclosure relates to a pharmaceutical composition comprising the binding protein defined above and a pharma- ceutically acceptable carrier.
[0023] In one embodiment, the present disclosure relates to an isolated nucleic acid molecule comprising a nucleotide sequence encoding the binding protein defined above.
[0024] In one embodiment, the present disclosure relates to an expression vector comprising the nucleic acid molecule defined above.
[0025] In one embodiment, the present disclosure relates to an isolated cell comprising the nucleic acid molecule defined above.
[0026] In one embodiment, the present disclosure relates to an isolated cell comprising the expression vector defined above. In certain embodiments, the host cell is a mammalian cell.
[0027] In one embodiment, the present disclosure relates to a method for producing a binding protein as defined above, comprising: (a) introducing an expression vector as defined above into a host cell; (b) culturing the host cell under suitable conditions for expressing the binding protein; and (c) optionally recovering the expressed binding protein.
[0028] In one embodiment, the present disclosure relates to an isolated nucleic acid molecule comprising a nucleotide sequence encoding a binding protein as defined above, and characterized in that it comprises a first and a second antigen binding domain (ABD), and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein said ABDs each comprise an immunoglobulin heavy chain variable domain (V H ) and immunoglobulin light chain variable domain (V L ), including V H and V L Each of the above sequences contains three complementarity determining regions (CDR-1 to CDR-3): (i) the first ABD specifically binds to human CD123, and - V comprising CDR-H1, H2, and H3 corresponding to the amino acid sequences of SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 4 to 6, respectively H1 , and - V comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 10 to 12, respectively L1 Includes; (ii) the second ABD specifically binds human NKp46, and The amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; The amino acid sequences of SEQ ID NOs: 22 to 24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25, and 26, respectively; V with corresponding CDR-H1, 2, and 3 H2 , and The amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NO:30 to SEQ ID NO:32, respectively; The amino acid sequences of SEQ ID NO:33 to SEQ ID NO:35, respectively; The amino acid sequences of SEQ ID NO:36 to SEQ ID NO:38, respectively; or to the amino acid sequences of SEQ ID NO:39, SEQ ID NO:31, and SEQ ID NO:40, respectively; V with corresponding CDR-L1, 2, and 3 L2 Includes: All or a portion of the immunoglobulin Fc region or a variant thereof binds to a human Fc-gamma receptor.
[0029] In one embodiment, the present disclosure relates to an expression vector comprising a nucleic acid molecule comprising a nucleotide sequence encoding one or more polypeptide chains of the binding protein defined above.
[0030] In one embodiment, the present disclosure relates to an isolated cell comprising the nucleic acid molecule defined above.
[0031] In one embodiment, the present disclosure relates to an isolated cell comprising the expression vector defined above.
[0032] In one embodiment, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for expressing a plurality of recombinant polypeptides, including (i) a polypeptide comprising the amino acid sequence of SEQ ID NO:64, (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO:65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO:66; (b) optionally recovering the expressed recombinant polypeptide. The present invention relates to a method comprising the steps of:
[0033] In one embodiment, the present disclosure relates to a method of treating or preventing hematological cancer, comprising administering to a subject in need of said treatment or prevention a pharmaceutical composition as defined above.
[0034] In one embodiment, the present disclosure relates to a method of treating or preventing myelodysplastic syndrome (MDS) or a lymphoproliferative disorder, comprising administering to a subject in need of said treatment or prevention a pharmaceutical composition as defined above.
[0035] In one embodiment, the present disclosure relates to a method of treating or preventing acute myeloid leukemia (AML), comprising administering to a subject in need of said treatment or prevention a pharmaceutical composition as defined above.
[0036] In one embodiment, the present disclosure relates to a method of treating or preventing CD64 positive and CD64 negative acute myeloid leukemia (AML), comprising administering to a subject in need of said treatment or prevention a pharmaceutical composition as defined above.
[0037] In one embodiment, the disclosure provides a method of treating or preventing CD64 positive acute myeloid leukemia (AML), comprising administering to a subject in need of said treatment or prevention a binding protein comprising a first and a second antigen binding domain (ABD) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the first ABD is a human CD64 positive antigen binding domain (ABD). 123, the second ABD specifically binds human NKp46, and all or a portion of an immunoglobulin Fc region or variant thereof binds to a human Fc-gamma receptor.
[0038] Unless otherwise specified, the binding proteins of the present disclosure are oriented with the amino terminal orientation ("N-terminal end" or "N-term") on the left and the carboxyl terminal orientation ("C-terminal end" or "C-term") on the right, in accordance with standard usage and convention. [Brief description of the drawings]
[0039] [Figure 1] Three-dimensional schematic of the F25 format, a variant of the bispecific F5 format that contains one human NKp46 binding site and one human CD123 binding site. In Figure 1, the C-terminus of the polypeptide is on the left and the N-terminus is on the right. [Figure 2A] Figures 2A-2D show two-dimensional schematic diagrams of the F25, F5, F26, and F6 formats, each containing the relevant domains per polypeptide chain. In Figures 2A-2D, the C-terminus of the polypeptide is on the left and the N-terminus is on the right. The human NKp46 binding domain is formed by the VH / VL pair on the left. The human CD123 binding domain is formed by the VH / VL pair on the right. Figure 2A shows a two-dimensional schematic diagram of the F25 format. This diagram represents the claimed "NKp46-CD123_F25" binding protein. [Figure 2B]Figures 2A-2D show two-dimensional schematic diagrams of the F25, F5, F26, and F6 formats, each containing relevant domains per polypeptide chain. In Figures 2A-2D, the C-terminus of the polypeptide is on the left and the N-terminus is on the right. The human NKp46 binding domain is formed by the VH / VL pair on the left. The human CD123 binding domain is formed by the VH / VL pair on the right. Figure 2B shows a two-dimensional schematic diagram of the F5 format. When compared to F25, F5 differs in that the CL and CH pairs of the NKp46 binding domain are exchanged with a third polypeptide chain containing a CH1 domain and a VL domain. [Figure 2C] Figures 2A-2D show two-dimensional schematic diagrams of the F25, F5, F26, and F6 formats, each containing the relevant domains per polypeptide chain. In Figures 2A-2D, the C-terminus of the polypeptide is on the left and the N-terminus is on the right. The human NKp46 binding domain is formed by the VH / VL pair on the left. The human CD123 binding domain is formed by the VH / VL pair on the right. Figure 2C shows a two-dimensional schematic diagram of the F26 format. This F26 differs from F25 of Figure 2A in that it contains an Fc silent N297S mutation on each CH2 domain. [Figure 2D] Figures 2A-2D show two-dimensional schematic diagrams of the F25, F5, F26, and F6 formats, each containing the relevant domains per polypeptide chain. In Figures 2A-2D, the C-terminus of the polypeptide is on the left and the N-terminus is on the right. The human NKp46 binding domain is formed by the VH / VL pair on the left. The human CD123 binding domain is formed by the VH / VL pair on the right. Figure 2D shows a two-dimensional schematic diagram of the F6 format. This F6 differs from F5 of Figure 2B in that it contains an Fc silent N297S mutation on each CH2 domain. [Figure 2E] FIG. 2 shows a detailed two-dimensional view of a variant of the F25 format, which corresponds to that of FIG. 2A. [Diagram 3]Figure 3 shows a candidate mechanism of action of NK cell engagers (NKCEs) for killing after joint engagement of tumor cells expressing CD123 (i.e., AML cell lines; i.e., MOLM-13) and NK cells expressing NKp46 and Fcγ receptors (CD16a). Reproduced and adapted from Gauthier, L. et al. (Multifunctional natural killer cell engagers targeting NKp46 trigger protective tumor immunity, Cell 177, 1701-1713 (2019)). [Figure 4A] Figures 4A-B report the in vitro cytotoxicity of the NKp46-CD123_F25 binding protein of the present disclosure against an AML cell line (MOLM-13) or primary AML blast cells, respectively. Figure 4A shows the in vitro cytotoxicity of the NKp46-CD123_F25 binding protein of the present disclosure and a negative isotype control variant of format F25 that binds only to NKp46 (NKp46-IC_F25) against an AML cell line (MOLM-13). Figure 4B reproduces the same experiment with ex vivo patient samples, where the cytotoxicity of NKp46-CD123_F25, NKp46-IC_F25, an anti-CD123 ADCC enhancing antibody with no specificity for NKp46 (Reference 1), and a negative isotype control Fc-optimized antibody with increased ADCC activity and no specificity for NKp46 or CD123 (IC-hIgG1-ADCC-enh) is assessed against primary AML blast cells. [Figure 4B]Figures 4A-B report the in vitro cytotoxicity of the NKp46-CD123_F25 binding protein of the present disclosure against an AML cell line (MOLM-13) or primary AML blast cells, respectively. Figure 4A shows the in vitro cytotoxicity of the NKp46-CD123_F25 binding protein of the present disclosure and a negative isotype control variant of format F25 that binds only to NKp46 (NKp46-IC_F25) against an AML cell line (MOLM-13). Figure 4B reproduces the same experiment with ex vivo patient samples, where the cytotoxicity of NKp46-CD123_F25, NKp46-IC_F25, an anti-CD123 ADCC enhancing antibody with no specificity for NKp46 (Reference 1), and a negative isotype control Fc-optimized antibody with increased ADCC activity and no specificity for NKp46 or CD123 (IC-hIgG1-ADCC-enh) is assessed against primary AML blast cells. [Diagram 5] Provided are in vitro cytotoxicity data (EC50 data) using fresh healthy donor NK cells against MOLM-13 AML cell line for the disclosed NKp46-CD123_F25 binding protein, which can activate human NK cells by engaging both NKp46 and CD16a and induce ADCC activity through its Fc-competent format (F25), and the NKp46-CD123_F6 binding protein, which activates human NK cells by engaging only NKp46 but not CD16a and induces reduced ADCC activity through its Fc-silent format (F6). [Figure 6A]Figures 6A-B top panels report the in vitro cytotoxicity of the disclosed NKp46-CD123_F25 binding protein, an anti-CD123 ADCC enhancing antibody with no binding for NKp46 (Reference 1), and a negative isotype control Fc-optimized antibody with increased ADCC activity and no specificity for NKp46 or CD123 (IC_hIgG1-ADCC-enh) against various AML cell lines. The AML cell lines tested were: THP-1, a cell line expressing CD64(+) and CD32(+) (Figure 6A); MOLM-13, a cell line expressing no CD64(-) but CD32(+) (Figure 6A); THP-1 CD64KO, a cell line knocked out for CD64(-) and expressing CD32(+) (Figure 6B); and THP-1 CD32KO, a cell line expressing CD64(+) and knocked out for CD32(-) (Figure 6B). The bottom panels of Figures 6A and 6B report the phenotype of the malignant AML cell lines and subclones, as well as the expression of CD123, CD64, CD32a / b by flow cytometry analysis. Also shown is background staining of AML cells with mouse-IgG2a (IC_mouse IgG2a) and mouse-IgG1 (IC_mouse IgG1) isotype controls. [Figure 6B]Figures 6A-B top panels report the in vitro cytotoxicity of the disclosed NKp46-CD123_F25 binding protein, an anti-CD123 ADCC enhancing antibody with no binding for NKp46 (Reference 1), and a negative isotype control Fc-optimized antibody with increased ADCC activity and no specificity for NKp46 or CD123 (IC_hIgG1-ADCC-enh) against various AML cell lines. The AML cell lines tested were: THP-1, a cell line expressing CD64(+) and CD32(+) (Figure 6A); MOLM-13, a cell line expressing no CD64(-) but CD32(+) (Figure 6A); THP-1 CD64KO, a cell line knocked out for CD64(-) and expressing CD32(+) (Figure 6B); and THP-1 CD32KO, a cell line expressing CD64(+) and knocked out for CD32(-) (Figure 6B). The bottom panels of Figures 6A and 6B report the phenotype of the malignant AML cell lines and subclones, as well as the expression of CD123, CD64, CD32a / b by flow cytometry analysis. Also shown is background staining of AML cells with mouse-IgG2a (IC_mouse IgG2a) and mouse-IgG1 (IC_mouse IgG1) isotype controls. [Figure 7A] Figures 7A-7B report the ex vivo induction of NK degranulation measured by the percentage of CD107a positive NK cells on primary AML blasts from two different donors. Primary AML blasts from donor #1 are CD64(+) (Figure 7A) and primary AML blasts from donor #2 are CD64(-) (Figure 7B). The binding proteins tested were the NKp46-CD123_F25 binding protein of the present disclosure, an anti-CD123 ADCC enhancing antibody with no specificity for NKp46 (Reference 1), a negative isotype control variant of format F25 that does not bind CD123 but binds NKp46 and CD16a (NKp46-IC_F25), and a negative isotype control Fc-optimized antibody with increased ADCC activity and no specificity for NKp46 or CD123 (IC_hIgG1-ADCC-enh). [Figure 7B] Figures 7A-7B report the ex vivo induction of NK degranulation measured by the percentage of CD107a positive NK cells on primary AML blasts from two different donors. Primary AML blasts from donor #1 are CD64(+) (Figure 7A) and primary AML blasts from donor #2 are CD64(-) (Figure 7B). The binding proteins tested were the NKp46-CD123_F25 binding protein of the present disclosure, an anti-CD123 ADCC enhancing antibody with no specificity for NKp46 (Reference 1), a negative isotype control variant of format F25 that does not bind CD123 but binds NKp46 and CD16a (NKp46-IC_F25), and a negative isotype control Fc-optimized antibody with increased ADCC activity and no specificity for NKp46 or CD123 (IC_hIgG1-ADCC-enh). [Figure 8] We report dose-dependent antitumor activity by the muNKp46-huCD123_F25 binding protein (containing anti-mouse NKp46 and anti-human CD123 binding domains, also known as moNKp46-huCD123) against MOLM-13 human cells in a severe combined immunodeficiency (SCID) mouse model. [Figure 9] Figures 9A-C report CD123 positive basophil depletion for up to 28 days following administration of NKp46-CD123_F25 binding protein of the present disclosure in non-human primates (M1, M2, M3, M4, and M6) at 3000 μg / kg or 3 mg / kg (Figure 9A), at 3 μg / kg (Figure 9B), and at 0.5 μg / kg (Figure 9C). [Figure 10]10A-10B report the in vitro cytotoxicity of two NKp46-CD123 NKCE Fc competent binding proteins (NKp46-CD123_F25 of the present disclosure, and NKp46-CD123_F5), as well as a control variant of format F5 that binds CD123 and CD16a but not NKp46 (CD123-IC_F5), against two AML cell lines, MOLM-13 (FIG. 10A) and THP-1 (FIG. 10B), in the presence of an NK cell healthy donor sample (D648). [Figure 11] The left panel reports CD123 positive basophil depletion in healthy donor PBMCs (N = 10) induced in vitro by treatment with NKp46-CD123_F25 (CD123-NKCE; dose range 0.001-10 µg / mL), NKCE isotype control NKp46-IC_F25 (IC-NKCE; does not bind CD123 but binds NKp46 and CD16a) (dose range 0.001-10 µg / mL), or CD3-CD123 bispecific T cell engager (CD123-TCE tool; 0.001-0.1 µg / mL). The middle panel reports NKp46-CD123_F25 maximal depletion activity at the highest dose tested (10 µg / mL, 68 nM). The right panel reports the EC50 (pM) for CD123 positive basophil depletion calculated from the NKp46-CD123_F25 dose response on PBMC of six healthy donors. [Figure 12] Figure 1 shows in vitro IL-1β, TNF-α, IFN-γ (denoted as INFg in the graph), and IL-6 cytokine release by healthy donor PBMCs (N=10) following treatment with NKp46-CD123_F25 at doses of 0.1, 1, and 10 μg / mL, NKCE isotype control NKp46-IC_F25 (which does not bind CD123 but binds NKp46 and CD16a), or a bispecific T cell engager tool (TCE tool) co-targeting CD123 and CD3 binding sites at a dose of 0.1 μg / mL. [Figure 13-1]13A-13F show individual IL-6 and IL-10 plasma concentration versus time profiles in correlation with NKp46-CD123_F25 binding protein concentrations at 3000 μg / kg (FIGS. 13A and 13B), 3 μg / kg (FIGS. 13C and 13D), 0.5 μg / kg (FIG. 13E), and less than 0.5 μg / kg (FIG. 13F) for six male cynomolgus monkeys (M1-M6). [Figure 13-2] Continued from Figure 13-1. [Figure 13-3] Continued from Figure 13-2. [Figure 14-1] FIG. 14A presents the cytotoxicity of the NKp46-CD123_F25 binding protein of the present disclosure against AML blasts from patients expressing (#AML5, #AML6) or not expressing (#AML1, #AML2) CD64, in comparison with an anti-CD123 ADCC enhancing antibody with no specificity for NKp46 (Reference 1) and a negative isotype control Fc-optimized antibody with enhanced ADCC activity and no specificity for NKp46 or CD123 (IC-hIgG1-ADCC-enh). Malignant cells from AML patients were used as targets and purified healthy donor NK cells were used as effectors. Results are shown for all healthy donor NK cells tested. FIG. 14B reports the phenotype of the malignant AML cells from the patients used in FIG. 14A, showing the expression of CD33, CD123, CD32a / b, and CD64 by flow cytometry analysis. [Figure 14-2] Continued from Figure 14-1. [Figure 15]Figure 15A is a comparison of the cytotoxicity of NKCE targeting CD123 on tumor cells and not engaging NK cells (IC-CD123_F6), or engaging NK cells by CD16a only (IC-CD123_F25) or NKp46 only (NKp46-CD123_F6), or co-engaging NKp46+CD16 (NKp46-CD123_F25). MOLM-13 cells were used as target cells and purified resting healthy donor NK cells as effectors. Two NK donors are shown. Figure 15B reports the cytotoxicity of the NKp46-CD123_F25 binding protein of the present disclosure against the AML cell line MOLM-13, compared to a negative isotype control NKCE molecule not bound to CD123 (NKp46-IC_F25). Results are shown for five healthy NK cell donors. [Figure 16] Figure 16A is a flow cytometry analysis of NK and malignant cells from AML patients (AML#8-#10). The top panel shows expression of CD123 on AML blasts (gated on the CD33 positive population); the middle panel shows expression of CD64 on CD123 positive AML blasts (CD64 in black and isotype control in grey staining); the bottom panel shows expression of NKp46 and CD16a on NK cells from NK AML samples. FIG. 16B is an analysis of CD107a / b expression by NK cells after overnight treatment with NKp46-CD123_F25 (CD123-NKCE), an anti-CD123 ADCC enhancing antibody with no specificity for NKp46 (reference 1, or CD123-IgG1+ in the graph), a control isotype NKp46-IC_F25 (600 and 120 ng / mL) that does not bind CD123 but binds NKp46 and CD16a (IC-NKCE), and an IgG1 isotype control (600 ng / ml) (IC-IgG1+) on PBMCs from AML patient samples that express CD64 on the cell surface of blasts (AML#8 and #9) and that do not express CD64 (AML#10). [Figure 17-1]In an experimental setting using NK cells with or without co-culture with MOLM-13 cells (NK+MOLM-13 vs. NK alone), the percentage of marker expression (CD107, CD69, TNF-α, IFN-γ, and MIP-1β) by NK cells treated with increasing concentrations of NKp46-CD123_F25 compared to controls that engage only NKp46 and CD16 (NKp46-IC_F25) is shown. Results are shown for three NK cell donors. [Figure 17-2] Continued from Figure 17-1. [Figure 18] Figure 1 shows the activity of the surrogate muNKp46-huCD123_F25 bispecific antibody (also known as moNKp46-huCD123) against disseminated human AML, MOLM-13, in SCID mice. MOLM-13 cells were injected intravenously on day 0 with a single dose. Treatment was administered by intraperitoneal route on day 1 after tumor implantation. An isotype control antibody (muNKp46-IC) that binds muNKp46 and mouse FcγR but not huCD123 was administered at 0.5 mg / kg. muNKp46-huCD123_F25 and reference-1 were administered at 5, 0.5, 0.25, and 0.05 mg / kg. The control group was left untreated. The graph shows Kaplan-Meier curves for animals treated with muNKp46-huCD123_F25 bispecific antibody, Reference-1, and control at 5, 0.5, 0.25, and 0.05 mg / kg. ***: p<0.001 vs. control; **: p<0.01 vs. control; *: p<0.05 vs. control; ###: p<0.001 vs. Reference-1; #: p<0.05 vs. Reference-1. n=5-10 mice / group. [Figure 19]The effect of NK depletion on the in vivo efficacy of the surrogate muNKp46-huCD123_F25 bispecific antibody in SCID mice bearing disseminated human MOLM-13 tumor cells is evaluated. NK depletion was induced by two intraperitoneal administrations of anti-asialo GM1 serum, one day before and five days after tumor cell implantation. MOLM-13 cells were injected intravenously on day 0 in a single dose. Treatment was administered intraperitoneally on day 1 after tumor implantation. Controls were also evaluated, including an isotype control antibody that binds muNKp46 and mouse FcγR but not huCD123 (muNKp46-IC), and a second isotype control antibody that binds huCD123 and mouse FcγR but not mouse NKp46 (IC-huCD123). The graph shows Kaplan-Meier curves for animals treated with muNKp46-huCD123_F25 bispecific antibody and controls (muNKp46-IC, IC-huCD123) at 0.5, 0.25 and 0.05 mg / kg. n=10 mice / group. ***: p<0.001 vs. control; **: p<0.01 vs. control; ###: p<0.001 vs. same treatment + NK depletion; #: p<0.05 vs. same treatment + NK depletion. [Figure 20]FIG. 20A shows depletion of CD123 positive basophils from blood in monkeys M3 and M4 treated with a low dose of 3 μg / kg as a single 1-hour IV injection. Blood samples were collected before administration and 24 hours after the start of infusion and analyzed by flow cytometry. CD123 positive basophils are shown in the gate. FIG. 20B shows the number of circulating CD123 positive basophils (open symbols) and total CD123 positive leukocytes (filled symbols) during the study in monkeys M1 (orange) and M2 (purple) treated with 3 mg / kg as a single 1-hour IV injection, and monkeys M3 (red) and M4 (blue) treated with 3 μg / kg as a single 1-hour IV injection. FIG. 20C reports cytokine production in cynomolgus monkeys treated with high and low doses of 3 mg / kg and 3 μg / kg, respectively, as a single 1-hour IV injection. Plasma IL-6 and IL-10 concentrations are shown before administration (0) and 1.5, 5, and 24 hours after the start of treatment. Figure 20D reports plasma NKp46-CD123_F25 (CD123-NKCE) concentrations monitored 1.5, 5, 24, 48, 72, 168, 240, 336, 504, and 672 hours (i.e., 0.04, 0.06, 0.21, 1, 2, 3, 7, 10, 14, 21, and 28 days) after the start of a 1-hour infusion in cynomolgus monkeys treated with high and low doses of 3 mg / kg and 3 μg / kg. The lower limit of quantification (LLOQ; 0.25 ng / mL) is indicated by a horizontal dashed line. [Figure 21]Figure 21A shows the toxicokinetics (TK) of NKp46-CD123_F25 (CD123-NKCE) molecules in male monkey M5 treated weekly for 4 weeks (days 1, 8, 15, and 22) with a dose of 3 mg / kg / dose. Plasma CD123-NKCE concentrations were determined pre-dose and 1, 1.5, 5, 24, and / or 72 hours after the start of the 1-h infusion on days 1, 8, 15, and pre-dose and 1, 1.5, 5, 24, and 168 hours after the start of the last 4 1-h infusion on day 22. Values below the lower limit of quantification (LLOQ: 0.25 ng / mL) are not reported on the graph. The days of infusion are indicated by vertical dashed lines. Figure 21B shows the analysis of interleukin-6 production in monkey M5 treated weekly for 4 weeks with a high dose of 3 mg / kg / dose. Plasma IL-6 concentrations were monitored pre-dose and 1, 1.5, 5, and 24 hours after the start of the 1-hour infusion on days 1, 8, and 15, and pre-dose and 1, 1.5, 5, 24, and 168 hours after the start of the fourth and final 1-hour infusion on day 22. Figure 21C quantifies the number of circulating CD123 positive basophils (open symbols) and total CD123 positive leukocytes (filled symbols) in the blood (left panel) or bone marrow (right panel) up to the time of study for monkey M5 treated at a dose of 3 mg / kg / week. [Figure 22-1] THP1 cytotoxic activity is visually demonstrated by assaying human peripheral blood mononuclear cells (PBMCs) from two healthy donors (HD).NK cells and THP1 GFP target cells were incubated in the presence of NKp46-CD123_F25 or its isotype control IC-CD123_F6, which engages CD123 and induces reduced ADCC activity due to its Fc-silent format (F6) at 0.1, 1, 10, and 100 ng / mL. [Figure 22-2] Continued from Figure 22-1. [Figure 22-3] Continued from Figure 22-2. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0040] The present disclosure provides multifunctional binding proteins that can bind one surface biomarker on immune NK cells, namely NKp46, and one antigen of interest on tumor target cells, namely CD123, and redirect NK cells to lyse target cells expressing the CD123 surface biomarker. The multifunctional binding proteins of the present disclosure further comprise all or a portion of an Fc region or variant thereof that binds to an Fc-gamma receptor (FcγR), in particular an activating Fc-gamma receptor (FcγR), such as FcγRIIIa, also known as CD16a.
[0041] Additionally, the exemplified multifunctional binding proteins of the present disclosure have a dimeric Fc domain that contains N-linked glycosylation and provide beneficial immune enhancing activity by binding to activating Fc-gamma receptors (FcγR), such as the receptor CD16a.
[0042] The inventors provide experimental evidence that by engaging NKp46, FcγRs such as CD16a, and the cell surface biomarker CD123, optimal NK cell modulation, and in particular NK cell activation, can be achieved with a better safety profile both in vitro in the AML cell lines MOLM-13 and THP1, and ex vivo in primary samples from AML patients (e.g. peripheral blood lymphocytes from AML patients).
[0043] Importantly, the in vitro cytotoxic activity of the NKp46-CD123 binding protein of the present disclosure, characterized by a format reported herein as "F25" and containing a central fragment crystallizable (Fc) region that retains binding to human CD16 polypeptide, was reproduced ex vivo.
[0044] Thus, the inventors provide experimental support for the therapeutic properties of a bispecific NKp46 / CD16-CD123 binding protein, particularly for use in treating and preventing AML and other proliferative disorders.
[0045] The inventors further provide experimental evidence that the NKp46-CD123 binding protein activates NK cells in primary samples from AML patients, regardless of their CD64 expression status.
[0046] Therefore, engagement of NK cells via binding to the cell surface marker NKp46 / CD16 proves to be a robust and reproducible strategy for therapeutic use.
[0047] I. Definition As used herein, the "CD123" marker or "cluster of differentiation 123", also known as "interleukin 3 receptor, alpha (IL3RA)" or "IL3R", "IL3RX", "IL3RY", "IL3RAY", "hlL-3Ra", represents the interleukin 3-specific subunit of the heterodimeric cytokine receptor. Functional interleukin 3 receptors are heterodimers that contain a specific alpha chain (IL-3A; CD123) and an IL-3 receptor beta chain (βθ; CD131) that are shared with receptors for granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin 5 (IL-5). CD123 is a type I integral transmembrane protein with a derived molecular weight of about 43 kDa, containing an extracellular domain involved in IL-3 binding, a transmembrane domain, and a short cytoplasmic tail of about 50 amino acids. The extracellular domain is composed of two regions: an N-terminal region of about 100 amino acids whose sequence shows similarity to the equivalent regions of the GM-CSF and IL-5 receptor alpha chains; and a region proximal to the transmembrane domain that contains four conserved cysteine residues, a motif common to other members of this cytokine receptor family. The IL-3 binding domain contains a cytokine receptor motif (CRM) of about 200 amino acid residues composed of two Ig-like fold domains. The extracellular domain of CD123 is highly glycosylated, with N-glycosylation essential for both ligand binding and receptor signaling. The protein family brings together three members: IL3RA (CD123A), CSF2RA, and IL5RA. The overall structure is well conserved between the three members, but the sequence homology is very low. One 300 amino acid long isoform of CD123 has been discovered so far, but only on the RNA level, accessible on the Getentry database by accession number ACM241 16.1. The reference sequence of the full-length human CD123 protein (including the signal peptide) is available from the NCBI database under the accession number NP_002174.1 and under the Uniprot accession number P26951. The extracellular domain of human CD123 (ECD) consists of the amino acid sequence of SEQ ID NO: 86. Interleukin-3 receptor alpha chain (IL-3Ra) is a tumor antigen that is overexpressed in various hematological neoplasms. Most AML blasts express surface CD123, and this expression does not vary with AML subtype. It has been reported that higher expression of CD123 on AML at diagnosis is associated with poorer prognosis. CD123 expression has been reported in other hematological malignancies, including myelodysplasia, systemic mastocytosis, blastic plasmacytoid dendritic cell neoplasm (BPDCN), ALL, and hairy cell leukemia.
[0048] As used herein, "natural killer" or "NK cells" refers to a subpopulation of lymphocytes involved in non-conventional immunity. NK cells can be identified by certain characteristics and biological properties, such as the expression of certain surface antigens, including CD16, CD56, and / or CD57, NKp46 for human NK cells, the absence of alpha / beta or gamma / delta TCR complexes on the cell surface, the ability to bind to and kill cells that fail to express "self" MHC / HLA antigens by activation of specific cytolytic mechanisms, the ability to kill tumor cells or other diseased cells that express ligands for NK activating receptors, and the ability to release protein molecules called cytokines that stimulate or inhibit immune responses. Any of these characteristics and activities can be used to identify NK cells, using methods well known in the art. Any subpopulation of NK cells is also encompassed by the term NK cells. Within the context of this specification, "active" NK cells refer to biologically active NK cells, including NK cells that have the ability to lyse target cells or enhance the immune function of other cells. NK cells can be obtained by a variety of techniques known in the art, such as isolation from blood samples, cytapheresis, tissue or cell collection, etc. Protocols useful for assays involving NK cells can be found in Natural Killer Cells Protocols (edited by Campbell KS and Colonna M) Human Press. pp. 219-238 (2000).
[0049] As used herein, the "NKp46" marker or "natural cytotoxicity triggering receptor 1" (also known as "CD335" or "NKP46" or "NK-p46" or "LY94") refers to a protein or polypeptide encoded by the Ncr1 gene. A reference sequence for the full-length human NKp46 protein is available from the NCBI database under accession number NP_004820. The human NKp46 extracellular domain (ECD) corresponds to the amino acid sequence of SEQ ID NO: 84. The human NKp46 mRNA sequence is set forth in NCBI accession number NM_004829.
[0050] The term "Fc-gamma receptor" or "FcγR" or "Fc gamma receptor" as used herein can refer to both activating and inhibitory FcγR. Fc gamma receptors (FcγR) are cellular receptors for the Fc region of immunoglobulin G (IgG). By binding complexed IgG, FcγR can link the adaptive and innate immune systems, including ADCC-mediated immune responses, by regulating cellular immune effector functions. In humans, six classical FcγRs have been reported currently: one high affinity receptor (FcγRI) and five low-to-medium affinity FcγRs (FcγRIIA, -B, and -C, FcγRIIIA and -B). All FcγRs bind to the same region on IgG Fc, but with different affinities, high (FcgRI) and low (FcgRII and FcgRIII). At the functional level, most FcγRs are activating receptors that can induce the above-mentioned cellular responses, including ADCC-mediated immune responses. FcγRI, FcγRIIa, FcγRIIc, and FcγRIIIa are activating receptors characterized by intracellular immunoreceptor tyrosine-based activation motifs (ITAMs), whereas FcγRIIb is inhibitory, since it has an inhibitory motif (ITIM). Unless otherwise specified, the term FcγR refers to FcγRI (CD64), FcγRIIA (CD32a), FcγRIIIa (CD16a), and FcγRIIIb (CD16b), preferably FcγRII. These include activating receptors such as Ia (CD16a).
[0051] The term "FcγRIIIa (CD16a)" or "FcγRIIIa" or "CD16a" or "CD16" or "cluster of differentiation 16" as used herein may refer to a 50-65 kDa cell surface molecule expressed on mast cells, macrophages, and natural killer cells as a transmembrane receptor. FcγRIIIa is an activating receptor that contains an immunoreceptor tyrosine-based activation motif (ITAM) within the associated FcR γ-chain. ITAMs are essential for receptor expression, surface assembly, and signal transduction. CD16a is a low affinity receptor for IgG and is the key receptor mediating ADCC (antibody-dependent cell-mediated cytotoxicity) by NK cells. The high affinity receptor CD16a is preferentially found on NK cells and monocytes, where it induces antibody-dependent cellular cytotoxicity (ADCC) upon IgG binding.
[0052] The term "FcγRII CD32", "FcγRII", "FCGR2", "CD32a", "CD32A", "CD32", or "cluster of differentiation 32" as used herein is a surface receptor glycoprotein belonging to the Ig gene superfamily. CD32A is expressed on all myeloid cells, but not on lymphocytes. CD32 has low affinity for the Fc region of the monomeric form of IgG antibodies, but high affinity for IgG immune complexes. CD32 has two major functions: cellular response regulation, and immune complex uptake. Cellular responses regulated by CD32 include phagocytosis, cytokine stimulation, and endocytic trafficking. Dysregulated CD32 is associated with various forms of autoimmunity, including systemic lupus erythematosus. In humans, there are three major CD32 subtypes: CD32A, CD32B, and CD32C. CD32A and CD32C are involved in the activation of cellular responses, while CD32B is inhibitory and balances the activating properties of CD32A. CD32A is an activating subtype of CD32 that can be found on a variety of immune cells. In particular, CD32A (FcγRIIA) mediates effector functions of granulocytes, monocytes, B cells, platelets, and dendritic cells through its low binding affinity for aggregated IgG. Upon binding to IgG immune complexes, cytosolic ITAMs can promote phagocytic activity and cytokine secretion in neutrophils and macrophages.
[0053] As used herein, the term "hFcγRICD64," "hFcγRI," "CD64," or "cluster of differentiation 64" is a surface receptor that is constitutively expressed only on monocytes and macrophages, but is upregulated on granulocytes upon cytokine stimulation.
[0054] As used herein, the terms "format 5" or "F5", "format 25" or "F25", "format F6" or "F6", and "format 26" or "F26" refer to specific binding protein configurations of bispecific or multispecific antibodies specifically designed to engineer multiple antigen-binding domains into a single antibody molecule. The multifunctional binding proteins of the present disclosure, including NKp46-binding domain and CD123-binding domain, are produced based on the F25 format, as illustrated in Figures 1 and 2. F25 and format F26 are different from formats F5 and F6, respectively, in that they have one C between the second and third polypeptide chains. H 1 / C L Pair is C L / C H They differ in that they are swapped to form a pair. The F5 and F6 formats have been previously described in WO2017114694, which is incorporated herein by reference.
[0055] As used herein, the term "bispecific binding protein" refers to a binding protein that specifically binds to two different antigen targets (e.g., human NKp46 and human CD123) via two different antigen binding domains (ABDs).
[0056] As used herein, the term "specifically binds to" or "specifically binds to" refers to binding to an antigen (e.g., human NKp46 and / or human CD123) that contains an epitope with at least about 1×10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M, 1×10 -11 M, 1×10 -12 It refers to the ability of an antigen-binding domain (ABD) to bind with a Kd of or greater than M and / or to bind an epitope with an affinity that is at least two-fold greater than the affinity for a non-specific antigen.
[0057] As used herein, the term "specifically binds to a human NK46 polypeptide" may refer to specific binding towards a polypeptide comprising the amino acid sequence of SEQ ID NO:84.
[0058] As used herein, the term "specifically for a human CD123 polypeptide" may refer to specific binding towards a polypeptide comprising the amino acid sequence of SEQ ID NO:86.
[0059] As used herein, the term "binds to a human Fc-gamma receptor polypeptide" can refer to binding towards a polypeptide comprising the amino acid sequence of SEQ ID NO:87 or SEQ ID NO:88.
[0060] Competitive binding assays and other methods of determining specific binding are described further below and are well known in the art. Phrases such as "specifically binds to" or "with specificity for" are used interchangeably. The terms are not to be construed to refer exclusively to antibodies, polypeptides, and / or multi-chain polypeptides that actually bind to the recited target / binding partner, nor to antibodies, polypeptides, and / or multi-chain polypeptides that are provided in unbound form but that retain specificity for the recited target. Binding specificity is measured by the affinity constant KA (or K A ) and the dissociation constant KD (or K D ) can be quantitatively determined.
[0061] The term "affinity", concentration (EC50) or equilibrium dissociation constant (KD) as used herein refers to the strength of binding of an antibody or polypeptide to an epitope. The affinity of an antibody is given by a specific type of equilibrium constant, the dissociation constant KD, defined as [Ab] x [Ag] / [Ab-Ag], where [Ab-Ag] is the molar concentration of the antibody-antigen complex, [Ab] is the molar concentration of unbound antibody, and [Ag] is the molar concentration of unbound antigen. The affinity constant KA is defined by 1 / KD. Preferred methods for determining the affinity of mAbs can be found in Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1988), Coligan et al., eds., Current Protocols in Immunology, Greene Publishing Assoc. and Wiley Interscience, NY (1992, 1993), and Muller, Meth. Enzymol. 92:589-601 (1983), which are incorporated herein by reference in their entireties. One preferred standard method well known in the art for determining the affinity of mAbs is the use of surface plasmon resonance (SPR) screening (e.g., by analysis with a BIAcore™ SPR analyzer). In a non-limiting manner, a K of less than 50 nM as determined by SPR and under physiological conditions (e.g., at a pH ranging from 6 to 8 under standard buffer conditions) is used. D can usually be considered to exhibit binding specificity for antigen-antigen binding domain (ABD) interactions. By way of example, and according to some specific exemplified embodiments, the binding proteins reported herein include: - K<10 nM as determined by SPR under physiological conditions D Especially for K values less than 0.5 nM D an antigen-binding domain that specifically binds to human CD123; - K<50 nM as determined by SPR under physiological conditions DEspecially for K values less than 20 nM D and an antigen-binding domain that specifically binds to human NKp46. Includes.
[0062] As used herein, the term "and / or" is a grammatical link that is to be interpreted as including the possibility of one or more of the cases to which it connects. For example, the phrase "such native sequence proteins can be produced using standard recombinant and / or synthetic methods" indicates that the native sequence protein can be produced using standard recombinant and synthetic methods, or the native sequence protein can be produced using standard recombinant methods, or the native sequence protein can be produced using synthetic methods.
[0063] As used herein, "treat" refers to the therapeutic use (i.e., to a subject with a given disease) and means of arresting, alleviating, inhibiting the progression of one or more symptoms of such disorder or condition.Thus, treatment refers not only to treatment that leads to a complete cure of the disease, but also to treatment that slows down the progression of the disease and / or extends the survival time of the subject.
[0064] As used herein, "preventing" refers to prophylactic use (ie, in subjects susceptible to developing a given disease) and includes the treatment of relapsed AML patients.
[0065] The term "therapeutically effective amount" of a multifunctional binding protein or pharmaceutical composition thereof as used herein means an amount of the antibody-like multifunctional binding protein sufficient to treat said cancer disease at a reasonable benefit / risk ratio applicable to any medical treatment. However, it will be understood that the total daily usage of the polypeptides and compositions of the present disclosure will be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend on a variety of factors, including the disorder to be treated and the severity of the disorder; the activity of the specific polypeptide used; the specific composition used, the age, weight, health, sex, and diet of the patient; the time of administration, the route of administration, and the rate of excretion of the specific polypeptide used; the duration of treatment; drugs used in combination with or concurrently with the specific polypeptide used; and similar factors well known in the medical art. For example, it is well known within the art to start administering a compound at a level lower than that required to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved.
[0066] As used herein, the terms "subject" or "individual" or "patient" are used interchangeably and can include human or non-human mammals, rodents or non-rodents. The terms include, but are not limited to, mammals, such as humans, including males, females, and children, other primates (monkeys), pigs, rodents, such as mice and rats, rabbits, guinea pigs, hamsters, cows, horses, cats, dogs, sheep, and goats.
[0067] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a pharma- ceutically acceptable carrier" encompasses a plurality of pharma- ceutically acceptable carriers, including mixtures thereof.
[0068] Thus, as used herein, "plurality" can include "two" or "two or more."
[0069] As used herein, an "antibody" or "immunoglobulin" refers to an antibody having two heavy chains linked to each other by disulfide bonds and each heavy chain linked to a light chain by a disulfide bond. It may refer to a natural or conventional antibody in which the light chain is linked to the host. There are two types of light chain, lambda (λ) and kappa (κ). There are five main heavy chain classes (or isotypes) that determine the functional activity of the antibody molecule: IgM, IgD, IgG, IgA, and IgE. Each chain contains different sequence domains. The light chain is made up of two domains or regions, the variable domain (V L ) and the constant domain (C L Heavy chains generally contain four domains: a variable domain (V H ) and three constant domains (C H 1. C H 2, and C H 3. Collectively, C H In particular, classes IgG, IgA, and IgD contain three heavy chain constant region domains, which are H 1. C H 2, and C H 3; and the IgM and IgE classes are composed of four heavy chain constant region domains, C H 1. C H 2. C H 3, and C H The variable regions of both the light (VL) and heavy (VH) chains determine the binding recognition and specificity to the antigen. The constant region domains of the light (CL) and heavy (CH) chains confer important biological properties such as antibody chain binding, secretion, transplacental mobility, complement binding, and binding to Fc receptors (FcR). The Fv fragment is the N-terminal portion of the antigen-binding fragment (Fab) of an immunoglobulin and consists of one light chain and one heavy chain variable portion.
[0070] As used herein, when referring generally to "IgG" or "immunoglobulin G," IgG1, IgG2, IgG3, and IgG4 are included, unless otherwise specified. In particular, IgG is IgG1.
[0071] The term "antibody-like" or "immunoglobulin-like" polypeptide as used herein may also refer to non-conventional or synthetic antigen-binding polypeptides or binding proteins, including single domain antibodies and fragments thereof, particularly the variable heavy chains of single domain antibodies, and chimeric, humanized, bispecific, or multimeric antibodies.
[0072] As used herein, the term "multifunctional binding protein" encompasses a multi-chain protein, including but not limited to, at least one first variable region (e.g., a first immunoglobulin heavy chain variable domain (V)) that specifically binds to a human CD123 polypeptide. H ) and / or an immunoglobulin light chain variable domain (V L )) and at least one second variable region (e.g., a second immunoglobulin heavy chain variable domain (V H ) and / or an immunoglobulin light chain variable domain (V L )) include antibody-like polypeptide or protein formats. Not particularly limited to a particular type of construct, one general embodiment is specifically considered throughout the specification: the polypeptide constructs reported in WO2015197593 and WO2017114694 (each of which is incorporated herein by reference). In particular, the multifunctional binding proteins reported in, for example, WO2015197593 and WO2017114694 can include any construct comprising one or more polypeptide chains.
[0073] As used herein, the term "humanized" in "humanized antibody" refers to a polypeptide (i.e., an antibody or antibody-like polypeptide) that is wholly or partially of non-human origin and that has been modified to avoid or minimize an immune response in humans by replacing certain amino acids, particularly in the framework regions of the heavy and light chains. The constant domains of a humanized antibody are most often derived from human C H and C LDomain. Numerous methods for humanizing antibody sequences are known in the art; see, for example, the review by Almagro and Fransson (2008) Front Biosci. vol. 13:1619-1633. One commonly used method is CDR grafting or antibody reconstruction, which involves the grafting of the CDR sequences of a donor antibody, typically a murine antibody, into the framework scaffold of a human antibody of different specificity.
[0074] For chimeric antibodies, humanization typically involves modification of the framework regions of the variable region sequences. It includes. In certain cases, it is desirable to change individual CDR amino acid residues, for example to remove glycosylation sites, deamidation sites, or undesired cysteine residues, but amino acid residues that are part of the CDR are typically not changed in conjunction with humanization. N-linked glycosylation occurs by attachment of an oligosaccharide chain to an asparagine residue in the tripeptide sequence Asn-X-Ser or Asn-X-Thr, where X can be any amino acid except Pro. Removal of N-glycosylation sites can be achieved by mutating the Asn or Ser / Thr residue to a different residue, especially by conservative substitution. Deamidation of asparagine and glutamine residues can occur depending on factors such as pH and surface exposure. Asparagine residues are particularly susceptible to deamidation when present primarily in the sequence Asn-Gly, and to a lesser extent in other dipeptide sequences such as Asn-Ala. Thus, where such deamidation sites, particularly Asn-Gly, are present within a CDR sequence, it is desirable to remove the site, typically by a conservative substitution that removes one of the involved residues, and substitutions of the CDR sequences that remove one of the involved residues are intended to be encompassed by the claimed multifunctional binding proteins.
[0075] The term "conservative amino acid substitution" as used herein refers to a substitution in which an amino acid residue is replaced by an amino acid residue having a side chain with similar physicochemical properties. Families of amino acid residues with similar side chains are known in the art, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan). When an amino acid belongs to two different classes (i.e., tyrosine and phenylalanine), both can be accepted. For reference, the following classification will be followed throughout this specification unless otherwise stated.
[0076] [Table 1]
[0077] The term "domain" as used herein may be any region of a protein, usually defined based on sequence homology or identity, that is associated with a particular structural or functional entity. Thus, the term "region" as used in the context of this disclosure is broader in that it may include additional regions beyond the corresponding domain.
[0078] As used herein, the term "linker region," "linker peptide," "linker polypeptide," "amino acid linker," or "linker" refers to any amino acid sequence suitable for covalently linking two polypeptide domains, e.g., two antigen-binding domains, to one another and / or an Fc region to one or more variable regions, e.g., one or more antigen-binding domains. Although the term is not limited to a particular size or polypeptide length, such amino acid linkers are generally less than 50 amino acids in length, preferably less than 30 amino acids in length, e.g., 20 amino acids or less in length, e.g., 15 amino acids or less in length. Such an amino acid linker can optionally comprise all or a portion of an immunoglobulin polypeptide chain, such as all or a portion of an immunoglobulin hinge region. Alternatively, the amino acid linker can comprise a polypeptide sequence that is not derived from an immunoglobulin hinge region or from an immunoglobulin heavy or light polypeptide chain.
[0079] Thus, as used herein, an immunoglobulin hinge region or fragment thereof is considered a particular type of linker, which is derived from an immunoglobulin polypeptide chain.
[0080] The term "hinge region" or "hinge" as used herein generally refers to the flexible region, carried by the corresponding heavy chain polypeptide, that separates the Fc and Fab portions of a particular isotype of immunoglobulin, more particularly, the IgG, IgA, or IgD isotype. Such hinge regions are known in the art to depend on the immunoglobulin isotype under consideration. Thus, for naturally occurring IgG, IgA, and IgD isotypes, the hinge region is generally located at the C H 1 domain and C HThe hinge region separates the two domains and is usually cleaved by papain digestion. On the other hand, the region corresponding to the hinge in IgM and IgE heavy chains is usually formed by an additional constant domain that is less flexible. In addition, the hinge region may contain one or more cysteines that are involved in interchain disulfide bonds. The hinge region may also contain, where applicable, C H In addition to the FcγR binding site that the two domains have, the hinge region may contain one or more binding sites to Fcγ receptors. In addition, the hinge region may contain one or more post-translational modifications, such as one or more glycosylation residues, depending on the isotype considered. Thus, it will be easily understood that the reference to the term "hinge" throughout this specification is not limited to a specific set of hinge sequences or to a specific position on the structure. Unless otherwise indicated, the hinge region considered in more detail includes all or part of an isotype selected from: IgG isotype, IgA isotype, and IgD isotype; in particular, the hinge from an immunoglobulin belonging to the IgG isotype.
[0081] As used herein, the term "CH domain" or "CH domain" refers to a H The terms "domain" or "constant domain" may be used interchangeably and may refer to one or more of any heavy chain immunoglobulin constant domains. H The domains may be partially disordered in isolated form (e.g., the light chain (C L ) when not associated with the constant domain of H 1 domain) natively folds as an immunoglobulin-like domain. Therefore, unless otherwise indicated, the term H 1 domain, C H 2 domain, C H 3 domains; or any combination thereof.
[0082] As used herein, the term "CH1 domain" or "CH2 domain" refers to a HThe terms "constant domain 1" or "constant domain 1" may be used interchangeably and may refer to the corresponding heavy chain immunoglobulin constant domain 1.
[0083] As used herein, the term "CH2 domain" or "CH2 domain" refers to a H "Constant domain 2" or "constant domain 2" may be used interchangeably and may refer to the corresponding heavy chain immunoglobulin constant domain 2.
[0084] As used herein, the term "CH3 domain" or "CH3 domain" refers to a H "Constant domain 3" or "constant domain 3" may be used interchangeably and may refer to the corresponding heavy chain immunoglobulin constant domain 3.
[0085] Thus, as used herein, (C H 2-C H 3) A and (C H 2-C H 3) B The term "C H 2-C H 3" is the immunoglobulin heavy chain constant domain 2 (C H 2) And and immunoglobulin heavy chain constant domain 3 (C H 3).
[0086] As used herein, the term "CL domain" or "CL domain" refers to a L The terms "domain" and "domains" can be used interchangeably and can refer to the corresponding light chain immunoglobulin constant domains. Thus, unless otherwise indicated, the terms refer to the kappa (κ or λ) constant domains of immunoglobulin light chains, including all known subtypes (e.g., λ1, λ2, λ3, and λ7). K ) or lambda (λ) class C L In particular, the C L If the domain is of the kappa class, it is referred to herein as Cκ or C K or C k Also called a domain.
[0087] As used herein, the term "C H 1 / C L )" or "Paired C(C H 1 / C L ) refers to one constant heavy chain domain and one constant light chain domain (e.g., the kappa (κ) or κ-type constant heavy chain domain of the immunoglobulin light chain) that are bound to each other by a covalent or non-covalent bond, preferably a non-covalent bond; thus forming a heterodimer. K ) or lambda (λ) class). Thus, unless otherwise stated, when the paired constant chain domains are not present on the same polypeptide chain, the term can encompass all possible combinations. Thus, preferably, the corresponding C H 1 and C L The domain is a stable pair C (C H 1 / C L ) will be selected to be complementary to each other so as to form
[0088] Advantageously, the binding protein comprises multiple paired C domains, for example one "paired C1 (C H 1 / C L )" and one "C2 (C H 1 / C L )"), each C H 1 and C L The domain is complementary to C H 1 Domain and C L The complementary C domain is selected to form a H 1 and C L Examples of domains have been previously described in WO2006064136 or WO2012089814 or WO2015197593A1.
[0089] Unless otherwise indicated, the term "vs. C1 (C H 1 / C L )" or "C2 (C H 1 / C L ) are identical or different constant heavy 1 domains (C H1), and the same or different constant light chain domains (C L ) may refer to the different constant pair domains (C1 and C2) formed by the pair C1 (C H 1 / C L )" or "C2 (C H 1 / CL) are identical constant weight 1 domains (C H 1) and the same constant light chain domain (C L ) may refer to the different constant pair domains (C1 and C2).
[0090] As used herein, the term "Fc region" or "fragment crystallizable region" or alternatively "Fc portion" includes all or a portion of an "Fc domain," which accordingly includes the immunoglobulin hinge region (which naturally has the first binding site for FcγR), the C domain, and / or the C domain. H 2 domain (which inherently has a second binding site for FcγR), and a C domain of an immunoglobulin (e.g., of an IgG, IgA, or IgD immunoglobulin). H 3 domains and / or, where applicable, the C domains of immunoglobulins (e.g., for IgM and IgE) H The Fc region may comprise all or part of the four domains. H 2 domain and C HThe term includes all or part of the three domains, and optionally all or part of the immunoglobulin hinge region. Thus, the term can refer to molecules, whether in monomeric or multimeric form, including the sequence of non-antigen-binding fragments derived from the digestion of antibodies or generated by other means, and can contain the hinge region. The original immunoglobulin source of native Fc is particularly of human origin and can be of any immunoglobulin, although IgG1 is preferred. Native Fc molecules are composed of monomeric polypeptides linked by covalent bonds (i.e., disulfide bonds) and by non-covalent bonds into dimeric or multimeric forms. The number of intermolecular disulfide bonds between the monomeric subunits of native Fc molecules varies according to class (e.g., IgG, IgA, and IgE) or subclass (e.g., IgG1, IgG2, IgGG3, IgGA1, and IgE2). The number of Fc residues ranges from 1 to 13, depending on the type of antibody (IgGA and IgGA2). One example of a native Fc is the disulfide-bonded dimer derived from papain digestion of IgG. The term "native Fc" as used herein is a generic name for the monomeric, dimeric, and multimeric forms. Thus, under this terminology, the "Fc region" refers to the C H 2-C H 3 (For example, (C H 2-C H 3) A Or (C H 2-C H 3) B , or a binding pair thereof), and optionally may comprise or consist of all or a portion of an immunoglobulin hinge region that contains a binding site for a human FcγR. Unless otherwise specified, the term "Fc region" may refer to a native Fc region or a variant Fc region.
[0091] The term "Fc variant" as used herein refers to a molecule or sequence that has been modified from a native Fc but still contains a binding site for the receptor, FcRn (neonatal Fc receptor). Exemplary Fc variants and their interactions with the receptor are known in the art. Thus, the term "Fc variant" can include a molecule or sequence that has been humanized from a native non-human Fc. Additionally, a native Fc contains regions that can be removed because they provide structural features or biological activities that are not required for the antibody-like binding proteins of the present invention. Thus, the term "Fc variant" includes molecules or sequences that lack one or more native Fc sites or residues or that have been modified in one or more Fc sites or residues that affect or are involved in: (1) disulfide bond formation, (2) incompatibility with a selected host cell, (3) N-terminal heterogeneity upon expression in a selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to Fc receptors other than the salvage receptor, or (7) antibody-dependent cellular cytotoxicity (ADCC).
[0092] Fragment crystallizable (Fc) regions (e.g., native or variant) according to the present disclosure retain the ability to bind to human Fc-gamma receptor polypeptides (Fcγ) that are typically present on native Fc regions through the binding of an antibody Fc hinge region. As a reference, the overall structures of IgG1, IgG2, and IgG4 are similar, with over 90% sequence homology, with the major differences being the hinge and C regions that form the primary binding site to FcγR. H The hinge region also functions as a flexible linker between the Fab and Fc portions.
[0093] An Fc region having one or more amino acid modifications (e.g., substitutions, deletions, insertions) in one or more portions that increase the affinity and avidity of the variant Fc region for FcγRs, including activating and inhibitory FcγRs, is further considered an Fc region. In some embodiments, the one or more amino acid modifications increase the affinity of the Fc region for FcγRIIIA and / or FcγRIIA. In another embodiment, the variant Fc region further specifically binds FcγRIIB with a lower affinity than it binds to the Fc region of a reference parent antibody (e.g., an antibody having the same amino acid sequence except for the one or more amino acid modifications in the Fc region). Thus, native and variant Fc regions contemplated herein generally comprise a domain capable of binding to human CD16 (i.e., CD16-binding domain, i ... H 2 domains), for example a human Fc domain containing an N-linked glycosylation at amino acid residue N297 (according to EU numbering).
[0094] Thus, the term "Fc competent" as used herein refers to a binding protein that can specifically bind to an FcγR, particularly an activating FcγR, in particular one selected from FcγRI (CD64a), FcγRIIa (CD32a), and FcγRIIIa (CD16a), and more particularly FcγRIIIa (CD16a).
[0095] Several other modifications have been reported that directly affect FcγR binding, including modifications at residue 297 (according to EU numbering) or elsewhere in the lower hinge region. Examples include mutations at residues 234 and 235 (according to the EU numbering system) in the .
[0096] As used herein, the term "Fc silent" refers to a binding protein having an Fc region, wherein the Fc region lacks a binding site for FcγR; in particular, FcγRI, FcγRIIa, and FcγRIIIa, more particularly FcγRIIIa (CD16a) (e.g., the Fc region is a binding protein that lacks a binding site for FcγR; in particular, FcγRI, FcγRIIa, and FcγRIIIa, more particularly FcγRIIIa (CD16a)). H 2 domain and lacks the hinge region that contains the binding site).
[0097] As used herein, the term "variable" in "variable domain" refers to a specific portion of the associated binding protein that differs widely in sequence between antibodies and is used for the specific recognition and binding of a particular antibody to its specific target. However, variability is not uniformly distributed throughout the variable domain of an antibody. In both the light chain variable domain and the heavy chain variable domain, variability is concentrated in three parts called complementarity determining regions (CDRs; i.e., CDR1, CDR2, and CDR3) (also known as hypervariable regions). The more highly conserved parts of the variable domain are called framework (FR) regions or sequences.
[0098] As used herein, the term "VH domain" or "V H "Domain" can be used interchangeably and can refer to the corresponding heavy chain immunoglobulin variable domain.
[0099] As used herein, the term "VL domain" or "V L "Domain" may be used interchangeably and may refer to the corresponding light chain immunoglobulin variable domain.
[0100] A VH domain or a VL domain is referred to herein as a "VH domain" or "VL domain" when it is linked to a first antigen-binding domain (ABD) or to a second antigen-binding domain, respectively. H 1" and "V L 1" or "V H 2" and "V L It is also called "2".
[0101] The terms "binding pair V (VH / VL)", "V H / V L "V H / V L ) vs. "V L / V H "Vs" or "(V L / V H The terms "antigen binding pair" and "antigen binding domain" can be used interchangeably. Heavy and light chain variable domains can pair in juxtaposition to form an antigen-binding domain (ABD). Each binding pair is H and V L Unless otherwise indicated, these terms refer to which immunoglobulin variable region is a V H Area or V L It does not specify which region and which ABD will specifically bind to proteins (eg, NKp46 and CD123) expressed on the surface of immune effector cells or target cells.
[0102] The term "hypervariable region" as used herein refers to the amino acid residues of an antibody which are responsible for antigen binding. The term may be interchanged with the term "complementarity determining region" or "CDR".
[0103] Thus, as used herein, "complementarity determining region" or "CDR" refers to the amino acid sequences that together define the binding affinity and specificity of the natural Fv region of a natural immunoglobulin binding site. Each of the light and heavy chains of an immunoglobulin has three CDRs, designated CDR-L1, CDR-L2, CDR-L3, and CDR-H1, CDR-H2, CDR-H3, respectively. Thus, a conventional antibody antigen-binding domain contains six CDRs, including a set of CDRs from each of the heavy and light chain variable regions. Also, as used herein, "framework region" (FR) refers to the amino acid sequences inserted between the CDRs, i.e., the portions of the immunoglobulin light and heavy chain variable regions that are relatively conserved among different immunoglobulins within a single species. The light and heavy chains of an immunoglobulin The heavy chains each have four FRs, designated FR-L1, FR-L2, FR-L3, FR-L4, and FR-H1, FR-H2, FR-H3, FR-H4, respectively. Thus, the light chain variable domain is designated as (FR-L1)-(CDR-L1)-(FR-L2)-(CDR-L2)-(FR-L3)-(CDR-L3)-(FR-L4) and the heavy chain variable domain is designated as (FR-H1)-(CDR-H1)-(FR-H2)-(CDR-H2)-(FR-H3)-(CDR-H)-(FR4-H3).
[0104] The hypervariable region generally comprises amino acid residues from a "complementarity determining region" or "CDR" (e.g., residues 24-34 (L1), 50-56 (L2), and 89-97 (L3) in the light chain variable domain, and 31-35 (H1), 50-65 (H2), and 95-102 (H3) in the heavy chain variable domain; Kabat et al. 1991) and / or residues from a "hypervariable loop" (e.g., residues 26-32 (L1), 50-52 (L2), and 91-96 (L3) in the light chain variable domain, and 26-32 (H1), 53-55 (H2), and 96-101 (H3) in the heavy chain variable domain; Chothia and Lesk, J. Mol. Biol 1987; 196:901-917). Numbering of amino acid residues within this region is performed by the method described in Kabat et al., supra. Thus, phrases such as "Kabat position," "variable domain residue numbering according to Kabat," and "according to Kabat" herein refer to the numbering system for the heavy chain variable domain or the light chain variable domain. Using the Kabat numbering system, the actual linear amino acid sequence of a peptide may contain fewer or additional amino acids corresponding to a shortening of, or an insertion into, a FR or CDR of the variable domain. For example, a heavy chain variable domain may contain a single amino acid insertion after residue 52 of CDR H2 (residue 52a according to Kabat) and residues inserted after heavy chain FR residue 82 (e.g., residues 82a, 82b, and 82c, etc., according to Kabat). The Kabat numbering of residues is determined for a given antibody by alignment of the region of homology of the sequence of the antibody with the "standard" Kabat numbering sequence.
[0105] In some cases, the CDRs are as defined by EU, Kabat, Chotia, or IMGT numbering. The correspondence between these classifications is known in the art by reference to IMGT®, or the International ImMunoGeneTics Information System® (CNRS and Montpellier University), and as further detailed in Lefranc (Biomolecules; 2014; vol. 4, pp. 1102-1139) and Dondelinger (Frontiers in Immunology; 2018; vol. 9, pp. 2278).
[0106] Unless otherwise indicated, residue numbering will be considered herein by reference to the EU, Kabat, Chotia, or IMGT numbering conventions. In case of discrepancies regarding the exact position of hypervariable regions in a reference sequence, the Kabat numbering convention will prevail. In case of discrepancies regarding the exact position of constant regions in a reference sequence, the EU numbering convention will prevail.
[0107] The term "cytotoxicity" as used herein refers to a quality of a compound, e.g., a multifunctional binding protein according to the present disclosure, that is toxic to tumor cells. Cytotoxicity is induced by various mechanisms of action and can be divided into cell-mediated cytotoxicity, apoptosis, antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), or complement-dependent cytotoxicity (CDC).
[0108] As used herein, the term "antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to refers to a mechanism of cell-mediated immune defense whereby effector cells of the immune system actively lyse target cells whose membrane surface antigens are bound by specific antibodies or the multifunctional binding proteins of the present disclosure.
[0109] The terms "proliferative disorder", "hyperproliferative disorder", and / or "cancer" as used herein refer to solid tumors, such as breast, respiratory tract, brain, reproductive organs, gastrointestinal tract, urinary tract, eye, liver, skin, head and neck, thyroid, parathyroid, and distant metastases thereof, as well as tumors of hematopoietic and lymphatic tissues, such as blood cancers, including lymphomas, myelomas, and leukemias, including, but not limited to, acute myeloid leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and hairy cell leukemia.
[0110] As used herein, "acute myeloid leukemia (AML)" is a clonal disorder that clinically manifests as an increased proliferation of heterogeneous and undifferentiated myeloid blasts. Without wishing to be bound by theory, the leukemia hierarchy is maintained by a small population of LSCs (leukemic stem cells) (AML-LSCs), which have distinct capacities for self-renewal and can differentiate into leukemic precursors. The precursors generate numerous leukemic blasts that are easily detectable in patients at the time of diagnosis, and then relapse and ultimately lead to death. AML-LSCs are commonly reported as quiescent cells, in contrast to rapidly dividing clonogenic precursors.
[0111] Within the context of AML, the term "relapse" is specifically defined as the recurrence of AML after complete remission. In that sense, "complete remission" or "CR" is defined as: 9 cells / L), hemoglobin level 10 g / dL, and platelet count (100 × 10 9 normal values for red blood cell count (>5% / L) and independence from red blood cell transfusions; less than 5% blast cells, no blast clusters or collections, and absence of Auer rods on bone marrow examination; and normal maturation of blood cells (morphology; myelogramme) and absence of extramedullary leukemia.
[0112] As used herein, "myelodysplastic syndromes" ("MDS") (previously known as preleukemias) are a collection of hematological conditions involving the ineffective production (or dysplasia) of myeloid classes of blood cells. It represents a spectrum of clonal hematopoietic stem cell disorders characterized by progressive bone marrow failure and an increased risk of progression to acute myeloid leukemia ("AML"). The International Prognostic Scoring System ("IPSS") is widely used to identify patients with at-risk characteristics based on the severity of their cytopenias, bone marrow blast percentages, and cytogenetic abnormalities.
[0113] As used herein, "a pharma- ceutically acceptable carrier" is intended to include any and all carriers (e.g., any solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like). It is compatible with pharmaceutical administration, particularly parenteral administration. The use of such media and agents for pharma- ceutical active substances is known. Except where any conventional media or agent is incompatible with the active compound, such media may be used in the compositions of the present disclosure. For example, preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Although non-inclusive, pharma- ceutical acceptable carriers include, but are not limited to, 0.01-0.1 M (e.g., 0.05 M) phosphate buffer or 0.8% saline. Other common parenteral vehicles include sodium phosphate solutions, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers, such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antibacterial agents, antioxidants, chelating agents, and inert gases. More specifically, pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (if water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In such cases, the compositions must be sterile and should be fluid to the extent that easy syringeability exists. The compositions should be stable under the conditions of manufacture and storage and, in embodiments, will be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In certain embodiments, isotonic agents, for example, sugars, polyalcohols, for example, mannitol, sorbitol, or sodium chloride, are included in the composition. Prolonged absorption of the injectable composition can be achieved by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
[0114] As used herein, and unless otherwise indicated, the term "at least one" can include "one or more" or even "two or more" (or "plurality"). For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 109, 109, 109, 108, 109, 110, 1 4, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more than 100.
[0115] As used herein, and unless otherwise indicated, the term "less than" may encompass all values from 0 to the corresponding threshold value, for example, less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 109, 109, 108, 109, 110, 111, 112, 113, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or less than 100.
[0116] The term "cell" as used herein may encompass any prokaryotic or eukaryotic cell. Particularly contemplated cell types are those suitable for producing and / or manipulating recombinant antibodies, or fragments or polypeptide chains thereof. Although non-inclusive, such cells are selected from the group consisting of: bacterial cells, yeast cells, mammalian cells, non-mammalian cells, insect cells, and plant cells.
[0117] The terms "host cell", "host cell line" and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells", including the primary transformed cell and progeny derived therefrom, regardless of the number of passages. Progeny may not be completely identical in nucleic acid content to the parent cell and may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for the originally transformed cell are included herein. Host cells are any type of cell line that can be used to produce the binding proteins of the present disclosure. Thus, host cells include cultured cells, such as mammalian cultured cells, such as CHO cells, HEK cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, or hybridoma cells, bacterial cells, yeast cells, insect cells, and plant cells, to name just a few.
[0118] By "isolated" nucleic acid molecule or polynucleotide is intended a nucleic acid molecule, DNA, or RNA that has been removed from its natural environment. For example, a recombinant polynucleotide encoding a polypeptide contained in a vector is considered isolated for the purposes of this disclosure. Further examples of isolated polynucleotides include recombinant polynucleotides maintained in heterologous host cells, or polynucleotides that have been purified (partially or substantially) in solution. Isolated polynucleotides include polynucleotide molecules that are contained in cells that normally contain the polynucleotide molecule, but the polynucleotide molecule is present extrachromosomally or at a chromosomal location that differs from its natural chromosomal location. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the disclosure, as well as positive and negative strand forms, and double-stranded forms. Isolated polynucleotides or nucleic acids according to the disclosure further include such molecules that are synthetically produced. In addition, polynucleotides or nucleic acids can include or include regulatory elements, such as promoters, ribosome binding sites, or transcription terminators.
[0119] The term "vector" or "expression vector" is intended to mean a vehicle by which a nucleic acid, particularly a DNA or RNA sequence (e.g., a foreign gene), can be introduced into a host cell to transform the host and promote expression (e.g., transcription and translation) of the introduced sequence.
[0120] II. Binding Proteins In one embodiment, the present disclosure provides: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide; (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide; and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-γ receptor. The present invention relates to a binding protein comprising:
[0121] In some embodiments, the binding protein is: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide and comprising at least one CDR selected from SEQ ID NO:1 to SEQ ID NO:12, or a variant thereof having one or more conservative substitutions; (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide; and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide The present invention is characterized by comprising:
[0122] In some embodiments, the present disclosure provides: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide; (ii) a second antigen-binding domain (ABD) that comprises a variable region that specifically binds to a human NKp46 polypeptide and comprises at least one CDR selected from SEQ ID NO: 13 to SEQ ID NO: 40, or a variant thereof having one or more conservative substitutions; and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide The present invention relates to a binding protein comprising:
[0123] In some embodiments, the binding protein is: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide and comprising at least one CDR selected from SEQ ID NO:1 to SEQ ID NO:12, or a variant thereof having one or more conservative substitutions; (ii) a second antigen-binding domain (ABD) that comprises a variable region that specifically binds to a human NKp46 polypeptide and comprises at least one CDR selected from SEQ ID NO: 13 to SEQ ID NO: 40, or a variant thereof having one or more conservative substitutions; and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide The present invention is characterized by comprising:
[0124] In some embodiments, the binding protein is: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide and comprising three CDRs selected from SEQ ID NO: 1 to SEQ ID NO: 12, or a variant thereof having one or more conservative substitutions; (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide and comprising three CDRs selected from SEQ ID NO: 13 to SEQ ID NO: 40, or a variant thereof having one or more conservative substitutions; and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide The present invention is characterized by comprising:
[0125] In some embodiments, the binding protein is: (i) a variable region that specifically binds to a human CD123 polypeptide and that is an immunoglobulin heavy chain variable region (V H ) and immunoglobulin light chain variable region (V L ), including V H and V L each of the antigen-binding domains includes a first antigen-binding domain (ABD) having three complementarity determining regions (CDR-1 to CDR-3, respectively); (ii) a variable region that specifically binds to a human NKp46 polypeptide and an immunoglobulin light chain variable region (V L ), including V H and V L each of the antigen-binding domains includes three complementarity determining regions (CDR-1 to CDR-3), and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide The present invention is characterized by comprising:
[0126] In some embodiments, the binding protein is: (i) An immunoglobulin that contains a variable region that specifically binds to a human CD123 polypeptide and has three complementarity determining regions, at least one of which is selected from SEQ ID NO: 1 to SEQ ID NO: 6. IgE heavy chain variable region (V H ), and an immunoglobulin light chain variable region (V) having three complementarity determining regions, at least one of which is selected from SEQ ID NO: 7 to SEQ ID NO: 12. L ) a first antigen-binding domain (ABD); (ii) an immunoglobulin heavy chain variable region (V) that contains a variable region that specifically binds to a human NKp46 polypeptide and has three complementarity determining regions, at least one of which is selected from SEQ ID NO: 13 to SEQ ID NO: 26; H ), and an immunoglobulin light chain variable region (V) having three complementarity determining regions, at least one of which is selected from SEQ ID NO: 27 to SEQ ID NO: 40. L a second antigen-binding domain (ABD) comprising: (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide The present invention is characterized by comprising:
[0127] In some embodiments, the binding protein is: (i) an immunoglobulin heavy chain variable region (VCH) that contains a variable region that specifically binds to a human CD123 polypeptide and has three complementarity determining regions, at least two of which are selected from SEQ ID NO: 1 to SEQ ID NO: 6; H ), and an immunoglobulin light chain variable region (V) having three complementarity determining regions, at least two of which are selected from SEQ ID NO: 7 to SEQ ID NO: 12. L ) a first antigen-binding domain (ABD); (ii) an immunoglobulin heavy chain variable region (V) that contains a variable region that specifically binds to a human NKp46 polypeptide and has three complementarity determining regions, at least two of which are selected from SEQ ID NO: 13 to SEQ ID NO: 26; H), and an immunoglobulin light chain variable region (V) having three complementarity determining regions, at least two of which are selected from SEQ ID NO: 27 to SEQ ID NO: 40. L a second antigen-binding domain (ABD) comprising: (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide The present invention is characterized by comprising:
[0128] In some embodiments, the binding protein is: (i) an immunoglobulin heavy chain variable region (V) that contains a variable region that specifically binds to a human CD123 polypeptide and has three complementarity determining regions selected from SEQ ID NO: 1 to SEQ ID NO: 6; H ), and an immunoglobulin light chain variable region (V) having three complementarity determining regions selected from SEQ ID NO: 7 to SEQ ID NO: 12. L ) a first antigen-binding domain (ABD); (ii) an immunoglobulin heavy chain variable region (V) that contains a variable region that specifically binds to a human NKp46 polypeptide and has three complementarity determining regions selected from SEQ ID NO: 13 to SEQ ID NO: 26; H ), and an immunoglobulin light chain variable region (V) having three complementarity determining regions selected from SEQ ID NO: 27 to SEQ ID NO: 40. L a second antigen-binding domain (ABD) comprising: (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide The present invention is characterized by comprising:
[0129] In some embodiments, the binding protein comprises an immunoglobulin heavy chain variable domain (VHV) comprising CDRs H1, H2, and H3 that specifically bind to human CD123 and correspond to the amino acid sequences of SEQ ID NO:1 to SEQ ID NO:3, respectively, or correspond to the amino acid sequences of SEQ ID NO:4 to SEQ ID NO:6, respectively. H ) is included.
[0130] According to some specific embodiments of this first general object, the binding protein comprises an immunoglobulin light chain variable domain (VLCD) comprising a first ABD that specifically binds to human CD123 and that comprises CDRs-L1, L2, and L3 corresponding to the amino acid sequences of SEQ ID NO:7 to SEQ ID NO:9, respectively, or corresponding to the amino acid sequences of SEQ ID NO:10 to SEQ ID NO:12, respectively. L )of The present invention is characterized by including:
[0131] According to some particular embodiments of this first general object, the binding protein comprises an immunoglobulin heavy chain variable domain (VHCV) comprising CDRs H1, H2, and H3 that specifically bind to human NKp46 and correspond to the amino acid sequences of SEQ ID NO: 13 to SEQ ID NO: 15, respectively. H ) is included.
[0132] According to some particular embodiments of this first general object, the binding protein comprises an immunoglobulin heavy chain variable domain (VHCV) comprising CDRs H1, H2, and H3 that specifically bind to human NKp46 and correspond to the amino acid sequences of SEQ ID NO: 16 to SEQ ID NO: 18, respectively. H ) is included.
[0133] According to some particular embodiments of this first general object, the binding protein comprises an immunoglobulin heavy chain variable domain (VHCV) comprising CDRs H1, H2, and H3 that specifically bind to human NKp46 and correspond to the amino acid sequences of SEQ ID NO:19 to SEQ ID NO:21, respectively. H ) is included.
[0134] According to some particular embodiments of this first general object, the binding protein comprises an immunoglobulin heavy chain variable domain (VHCV) comprising CDRs H1, H2, and H3 that specifically bind to human NKp46 and correspond to the amino acid sequences of SEQ ID NO:22 to SEQ ID NO:24, respectively. H ) is included.
[0135] According to some particular embodiments of this first general object, the binding protein comprises an immunoglobulin heavy chain variable domain (VHCV) that specifically binds human NKp46 and includes CDRs-H1, H2, and H3 corresponding to the amino acid sequences of SEQ ID NO: 16, SEQ ID NO: 25, and SEQ ID NO: 26, respectively. H ) is included.
[0136] According to some particular embodiments of this first general object, the binding protein comprises an immunoglobulin light chain variable domain (VLCD) comprising CDRs L1, L2, and L3 that specifically bind to human NKp46 and correspond to the amino acid sequences of SEQ ID NO:27 to SEQ ID NO:29, respectively. L ) is included.
[0137] According to some particular embodiments of this first general object, the binding protein comprises an immunoglobulin light chain variable domain (VLCD) comprising CDRs L1, L2, and L3 that specifically bind to human NKp46 and correspond to the amino acid sequences of SEQ ID NO:30 to SEQ ID NO:32, respectively. L ) is included.
[0138] According to some particular embodiments of this first general object, the binding protein comprises an immunoglobulin light chain variable domain (VLCD) comprising CDRs L1, L2, and L3 that specifically bind to human NKp46 and correspond to the amino acid sequences of SEQ ID NO:33 to SEQ ID NO:35, respectively. L ) is included.
[0139] According to some particular embodiments of this first general object, the binding protein comprises an immunoglobulin light chain variable domain (VLCD) comprising CDRs L1, L2, and L3 that specifically bind to human NKp46 and correspond to the amino acid sequences of SEQ ID NO:36 to SEQ ID NO:38, respectively. L ) is included.
[0140] According to some particular embodiments of this first general object, the binding protein is an immunoglobulin having a second ABD that specifically binds human NKp46 and comprises CDRs-L1, L2, and L3 that correspond to the amino acid sequences of SEQ ID NO:39, SEQ ID NO:31, and SEQ ID NO:40, respectively. Immunoglobulin light chain variable domain (V L ) is included.
[0141] According to one embodiment, the present disclosure relates to a binding protein comprising a first and a second antigen binding domain (ABD) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the ABDs each comprise an immunoglobulin heavy chain variable domain (VcV). H ) and immunoglobulin light chain variable domain (V L ), including V H and V L Each of the above sequences contains three complementarity determining regions (CDR-1 to CDR-3): (i) the first ABD specifically binds to human CD123, and - V comprising CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 3, respectively, or corresponding to the amino acid sequences of SEQ ID NO: 4 to SEQ ID NO: 6, respectively H1 , and - V comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NO: 7 to SEQ ID NO: 9, respectively, or corresponding to the amino acid sequences of SEQ ID NO: 10 to SEQ ID NO: 12, respectively L1 Includes; (ii) the second ABD specifically binds human NKp46, and The amino acid sequences of SEQ ID NO:13 to SEQ ID NO:15, respectively; The amino acid sequences of SEQ ID NO:16 to SEQ ID NO:18, respectively; The amino acid sequences of SEQ ID NO:19 to SEQ ID NO:21, respectively; The amino acid sequences of SEQ ID NO:22 to SEQ ID NO:24, respectively; or to the amino acid sequences of SEQ ID NO:16, SEQ ID NO:25, and SEQ ID NO:26, respectively; V with corresponding CDR-H1, 2, and 3H2 , and The amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NO:30 to SEQ ID NO:32, respectively; The amino acid sequences of SEQ ID NO:33 to SEQ ID NO:35, respectively; The amino acid sequences of SEQ ID NO:36 to SEQ ID NO:38, respectively; or to the amino acid sequences of SEQ ID NO:39, SEQ ID NO:31, and SEQ ID NO:40, respectively; V with corresponding CDR-L1, 2, and 3 L2 Includes: All or a portion of the immunoglobulin Fc region or a variant thereof binds to a human Fc-gamma receptor.
[0142] A person skilled in the art will readily appreciate that the above-mentioned binding proteins may consist of one single polypeptide chain, or may be multimeric binding proteins, thus comprising multiple (two or more) polypeptide chains.
[0143] According to certain embodiments, the binding protein is a multimeric binding protein, wherein the two antigen-binding domains are, at least in part, carried by different polypeptide chains.
[0144] Optionally, when the binding protein comprises multiple polypeptide chains (e.g., two or three polypeptide chains), some of these polypeptide chains are covalently linked. When two polypeptide chains are covalently linked, the covalent linker is advantageously selected from a disulfide bridge or any other covalent linker, including a peptide bond that crosslinks one polypeptide chain with another, and / or a linker peptide that crosslinks one polypeptide chain with another.
[0145] According to certain embodiments, the binding protein is characterized in that it comprises three polypeptide chains (I), (II) and (III) forming two ABDs: V1A -C 1A -L3-(C H 2-C H 3) A (I) V 1B -C 1B -L4-(C H 2-C H 3) B -L1-V 2A -C 2A -L2(II) V 2B -C 2B (III) During the ceremony: V 1A and V 1B is the bond pair V1(V H1 / V L1 ) to form; V 2A and V 2B is the bond pair V2(V H2 / V L2 ) to form; C 1A and C 1B is compared with C1(C H 1 / C L ) and C 2A and C 2B is compared to C2 (C H 1 / C L ) and C H 1 is immunoglobulin heavy chain constant domain 1, C L is an immunoglobulin light chain constant domain; (C H 2-C H 3) A and (C H 2-C H 3) B may be identical or different, and may be an immunoglobulin heavy chain constant domain 2 (C H 2) and immunoglobulin heavy chain constant domain 3 (C H 3) Including; L1, L2, L3, L4 are optional independent amino acid linkers, which may be the same or different.
[0146] In some embodiments, (CH 2-C H 3) A and (C H 2-C H 3) B Each has at least one identical C H 2 domain, e.g., C corresponding to the amino acid sequence of SEQ ID NO: 71 H Contains 2 domains.
[0147] In some embodiments, (C H 2-C H 3) A and (C H 2-C H 3) B may be the same or different and comprise a polypeptide sequence selected from the amino acid sequence of SEQ ID NO:69 or SEQ ID NO:70.
[0148] In some embodiments, portions of L1, L2, L3, and L4 may be the same or different and may include all or a portion of an amino acid sequence selected from SEQ ID NO:74 to SEQ ID NO:79; for example, one or more than four consecutive amino acids of an amino acid sequence selected from SEQ ID NO:74 to SEQ ID NO:79.
[0149] According to certain embodiments, portions of L1, L2, L3, and L4 may be the same or different and may comprise all or a portion of an immunoglobulin hinge region, e.g., selected from amino acid sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78, and / or SEQ ID NO:79; for example, an immunoglobulin hinge region, e.g., four or more consecutive amino acids of an immunoglobulin hinge region, e.g., selected from amino acid sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78, and / or SEQ ID NO:79.
[0150] According to some more particular embodiments, L2, L3, and L4 may be the same or different and may comprise all or a portion of an immunoglobulin hinge region, e.g., selected from sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78, and / or SEQ ID NO:79; for example, four or more than four consecutive amino acids of an immunoglobulin hinge region, e.g., selected from sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78, and / or SEQ ID NO:79.
[0151] According to some more particular embodiments, L2, L3, and L4 may be the same or different and may comprise all or a portion of an immunoglobulin hinge region, e.g., selected from sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78, and / or SEQ ID NO:79 (e.g., four or more consecutive amino acids of an immunoglobulin hinge region, e.g., selected from sequences SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:78, and / or SEQ ID NO:79), and L1 may comprise all or a portion of a linker corresponding to the amino acid sequence of SEQ ID NO:76.
[0152] According to certain embodiments, the binding protein is characterized in that it comprises three polypeptide chains (I), (II) and (III) that form two ABDs as defined below: death: V 1A -C 1A -L3-(C H 2-C H 3) A (I) V 1B -C 1B -L4-(C H 2-C H 3) B -L1-V 2A -C 2A -L2(II) V 2B -C 2B (III) During the ceremony: V 1A and V 1Bis a binding pair V1 (V H1 / V L1 ) to form; V 2A and V 2B The binding pair V2 (V H2 / V L2 ) to form; C 1A and C 1B is compared with C1(C H 1 / C L ) and C 2A and C 2B is compared to C2 (C H 1 / C L ) and C H 1 is immunoglobulin heavy chain constant domain 1, C L is an immunoglobulin light chain constant domain; (C H 2-C H 3) A and (C H 2-C H 3) B may be identical or different, and may be an immunoglobulin heavy chain constant domain 2 (C H 2) and immunoglobulin heavy chain constant domain 3 (C H 3) Including; L1, L2, L3, L4 are optional independent amino acid linkers, which may be the same or different.
[0153] In one embodiment, the binding protein is characterized in that it comprises three polypeptide chains (I), (II), and (III) that form two ABDs defined as follows: V 1A -C 1A - Hinge 1-(C H 2-C H 3) A (I) V 1B -C 1B - Hinge 2 - (C H 2-C H 3) B -L1-V 2A -C2A - Hinge 3 (II) V 2B -C 2B (III) During the ceremony: V 1A and V 1B is the bond pair V1(V H1 / V L1 ) to form; V 2A and V 2B is the bond pair V2(V H2 / V L2 ) to form; C 1A and C 1B is compared with C1(C H 1 / C L ) and C 2A and C 2B is compared with C2 (C H 1 / C L ) and C H 1 is immunoglobulin heavy chain constant domain 1, C L is an immunoglobulin light chain constant domain; Hinge 1, Hinge 2, and Hinge 3 are the same or different and correspond to all or a portion of an immunoglobulin hinge region; (C H 2-C H 3) A and (C H 2-C H 3) B may be identical or different, and may be an immunoglobulin heavy chain constant domain 2 (C H 2) and immunoglobulin heavy chain constant domain 3 (C H 3) Including; L1 is an amino acid linker.
[0154] In one embodiment, the binding protein is characterized in that it comprises three polypeptide chains (I), (II), and (III) that form two ABDs defined as follows: V 1A -C 1A - Hinge 1-(C H 2-C H 3)A (I) V 1B -C 1B - Hinge 2 - (C H 2-C H 3) B -L1-V 2A -C 2A - Hinge 3 (II) V 2B -C 2B (III) During the ceremony: V 1A and V 1B is a binding pair V1 (V H1 / V L1 ) to form; V 2A and V 2B The binding pair V2 (V H2 / V L2 ) to form; C 1A and C 1B is compared with C1(C H 1 / C L ) and C 2A and C 2B is compared with C2 (C H 1 / C L ) and C H 1 is immunoglobulin heavy chain constant domain 1, C L is an immunoglobulin light chain constant domain; Hinge 1, Hinge 2, and Hinge 3 are the same or different and correspond to all or a portion of an immunoglobulin hinge region; (C H 2-C H 3) A and (C H 2-C H 3) B may be identical or different, and may be an immunoglobulin heavy chain constant domain 2 (C H 2) and immunoglobulin heavy chain constant domain 3 (C H 3) Including; L1 is an amino acid linker.
[0155] In some embodiments of the binding protein, the polypeptide chains (I), (II), and (III) are: C 1A C L Includes domain; C 1B C H Contains 1 domain; C 2A C H Contains 1 domain; C 2B C L Include domain It is characterized by:
[0156] In some embodiments of the binding protein, the polypeptide chains (I), (II), and (III) are: C 1A C H Contains 1 domain; C 1B C L Includes domain; C 2A C L Includes domain; C 2B C H Contains 1 domain It is characterized by:
[0157] According to some of these particular embodiments of the binding protein, the polypeptide chains (I), (II) and (III) are: C 1A C H1 Includes domain; C 1B C L Includes domain; C 2A C H1 Includes domain; C 2B C L Include domain It is characterized by:
[0158] According to some of these particular embodiments of the binding protein, the polypeptide chains (I), (II) and (III) are: C 1A C L Includes domain; C 1B C H1 Includes domain; C 2A C L Includes domain; C 2B C H1 Include domain It is characterized by:
[0159] In some embodiments, C 1A , C 1B , C 2A , and C 2B Forming C L and C H The domains may be the same or different. Thus, in some embodiments of the binding protein, the polypeptide chains (I), (II), and (III) are: - C 1A and C 2A are identical and C L Includes domain; - C 1A and C 2B are identical and C L Includes domain; - C 1B and C 2A are identical and C L Contains the domain; or - C 1B and C 2B are identical and C L Include domain It is characterized by:
[0160] In some embodiments of the binding protein, the polypeptide chains (I), (II), and (III) is: - C 1A and C 2A are identical and C HContains 1 domain; - C 1A and C 2B are identical and C H Contains 1 domain; - C 1B and C 2A are identical and C H Contains one domain; or - C 1B and C 2B are identical and C H Contains 1 domain It is characterized by:
[0161] In some embodiments of the polypeptide chains (I), (II), and (III): 1A is V H and V 1B is V L It is.
[0162] In some embodiments of the polypeptide chains (I), (II), and (III): 1A is V L and V 1B is V H It is.
[0163] In some embodiments of the polypeptide chains (I), (II), and (III): 2A is V H and V 2B is V L It is.
[0164] In some embodiments of the polypeptide chains (I), (II), and (III): 2A is V L and V 2B is V H It is.
[0165] In some embodiments of the polypeptide chains (I), (II), and (III): 1A is V H and V 1B is V L And;V 2A is VH and V 2B is V L It is.
[0166] In some embodiments of the polypeptide chains (I), (II), and (III): 1A is V L and V 1B is VH; V 2A is V H and V 2B is V L It is.
[0167] In some embodiments of the polypeptide chains (I), (II), and (III): 1A is V H and V 1B is V L And;V 2A is V L and V 2B is V H It is.
[0168] In some embodiments of the polypeptide chains (I), (II), and (III): 1A is V L and V 1B is V H And;V 2A is V L and V 2B is V H It is.
[0169] In some embodiments of the binding protein, V 1A is V L1 and V 1B is V H1 And;V 2A is V H2 and V 2B is V L2 It is.
[0170] In some embodiments of the binding protein, V 1A is V L1 and V 1B is V H1 It is.
[0171] In some embodiments of the binding protein, V 2A is V H2 and V 2B is V L2 It is.
[0172] In some embodiments of the binding protein, the polypeptide chains (I), (II), and (III) are: C 1B is the immunoglobulin heavy chain constant domain 1 (C H 1) and; C 2A is the immunoglobulin heavy chain constant domain 1 (C H 1) and; C L corresponds to the immunoglobulin kappa light chain constant domain (Cκ); (C H 2-C H 3) A corresponds to the amino acid sequence of SEQ ID NO:69; (C H 2-C H 3) B corresponds to the amino acid sequence of SEQ ID NO: 70; L2 or hinge 1 corresponds to the amino acid sequence of SEQ ID NO:74; L3 or hinge 2 corresponds to the amino acid sequence of SEQ ID NO: 75; L4 or hinge 3 corresponds to the amino acid sequence of SEQ ID NO: 77 It is characterized by:
[0173] L1 corresponds to the amino acid sequence of SEQ ID NO:76.
[0174] In some embodiments of the binding protein, the polypeptide chains (I), (II), and (III) are: C 1B is the immunoglobulin heavy chain constant domain 1 (C H 1) and; C 2A is the immunoglobulin heavy chain constant domain 1 (C H 1) and; C Lcorresponds to the immunoglobulin kappa light chain constant domain (Cκ); (C H 2-C H 3) A corresponds to the amino acid sequence of SEQ ID NO:69; (C H 2-C H 3) B corresponds to the amino acid sequence of SEQ ID NO: 70; Hinge 1 corresponds to the amino acid sequence of SEQ ID NO:74; Hinge 2 corresponds to the amino acid sequence of SEQ ID NO: 75; Hinge 3 corresponds to the amino acid sequence of SEQ ID NO: 77; L1 corresponds to the amino acid sequence of SEQ ID NO: 76 It is characterized by:
[0175] In some embodiments of the binding protein: (a)V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:7; CDR-L2 comprising the amino acid sequence of SEQ ID NO:8; CDR-L3 comprising the amino acid sequence of SEQ ID NO:9; V H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 13; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 14; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 15; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO:27; a CDR-L2 comprising the amino acid sequence of SEQ ID NO:28; a CDR-L3 comprising the amino acid sequence of SEQ ID NO:29; (b)V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:7; CDR-L2 comprising the amino acid sequence of SEQ ID NO:8; CDR-L3 comprising the amino acid sequence of SEQ ID NO:9; V H2comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 17; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 18; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 30; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 31; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 32; (c)V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:7; CDR-L2 comprising the amino acid sequence of SEQ ID NO:8; CDR-L3 comprising the amino acid sequence of SEQ ID NO:9; V H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 19; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 20; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 21; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 33; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 34; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 35; (d)V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:7; CDR-L2 comprising the amino acid sequence of SEQ ID NO:8; CDR-L3 comprising the amino acid sequence of SEQ ID NO:9; V H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 36; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 37; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 38; (e)V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:7; CDR-L2 comprising the amino acid sequence of SEQ ID NO:8; CDR-L3 comprising the amino acid sequence of SEQ ID NO:9; V H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 25; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 26; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 39; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 31; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 40; (f)V H1 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 13; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 14; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 15; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO:27; a CDR-L2 comprising the amino acid sequence of SEQ ID NO:28; a CDR-L3 comprising the amino acid sequence of SEQ ID NO:29; (g)V H1 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 17; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 18; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 30; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 31; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 32; (h)VH1 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 19; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 20; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 21; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 33; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 34; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 35; (i)V H1 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 36; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 37; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 38; (j)V H1 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; CDR-H2 comprising the amino acid sequence of SEQ ID NO: 25; CDR-H3 comprising the amino acid sequence of SEQ ID NO: 26; L2comprises CDR-L1 comprising the amino acid sequence of SEQ ID NO:39; CDR-L2 comprising the amino acid sequence of SEQ ID NO:31; and CDR-L3 comprising the amino acid sequence of SEQ ID NO:40.
[0176] In some embodiments of the binding protein: (a)V H1 and V L1 corresponds to the amino acid sequences of SEQ ID NOs: 41 and 43, respectively, or to the amino acid sequences of SEQ ID NOs: 42 and 44, respectively; and / or (b)V H2 and V L2 teeth, to the amino acid sequences of SEQ ID NOs: 45 and 53, respectively; to the amino acid sequences of SEQ ID NOs: 46 and 54, respectively; to the amino acid sequences of SEQ ID NOs: 47 and 55, respectively; to the amino acid sequences of SEQ ID NOs: 48 and 56, respectively; to the amino acid sequences of SEQ ID NOs: 49 and 57, respectively; to the amino acid sequences of SEQ ID NOs: 50 and 58, respectively; to the amino acid sequences of SEQ ID NOs: 51 and 59, respectively; or The amino acid sequences of SEQ ID NOs: 52 and 60, respectively. Equivalent.
[0177] In some embodiments of the binding protein: (a)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO: 45; L2 comprises the amino acid sequence of SEQ ID NO:53; (b)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO: 46; L2 comprises the amino acid sequence of SEQ ID NO:54; (c)V H1comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO: 47; L2 comprises the amino acid sequence of SEQ ID NO:55; (d)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO: 48; L2 comprises the amino acid sequence of SEQ ID NO:56; (e)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO: 49; L2 comprises the amino acid sequence of SEQ ID NO:57; (f)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO:50; L2 comprises the amino acid sequence of SEQ ID NO:58; (g)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO:51; L2 comprises the amino acid sequence of SEQ ID NO:59; (h)V H1 comprises the amino acid sequence of SEQ ID NO: 41; L1 comprises the amino acid sequence of SEQ ID NO: 43; H2 comprises the amino acid sequence of SEQ ID NO:52; L2 comprises the amino acid sequence of SEQ ID NO:60; (i)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO: 45; L2comprises the amino acid sequence of SEQ ID NO:53; (j)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO: 46; L2 comprises the amino acid sequence of SEQ ID NO:54; (k)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO: 47; L2 comprises the amino acid sequence of SEQ ID NO:55; (l)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO: 48; L2 is SEQ ID NO:5 6 amino acid sequence; (m)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO: 49; L2 comprises the amino acid sequence of SEQ ID NO:57; (n)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO:50; L2 comprises the amino acid sequence of SEQ ID NO:58. (o)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1 comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO:51; L2 comprises the amino acid sequence of SEQ ID NO:59; (p)V H1 comprises the amino acid sequence of SEQ ID NO: 42; L1comprises the amino acid sequence of SEQ ID NO: 44; H2 comprises the amino acid sequence of SEQ ID NO:52; L2 comprises the amino acid sequence of SEQ ID NO:60.
[0178] In some embodiments, the binding protein comprises at least two polypeptide chains linked by at least one disulfide bridge.
[0179] In some embodiments of the binding protein, the polypeptide chains (I), (II), and (III) are characterized in that: polypeptide chain (I) is covalently linked to polypeptide chain (II), in particular covalently linked to polypeptide chain (II) by one or more disulfide bonds.
[0180] According to some of these particular embodiments of the binding protein, the polypeptide chains (I), (II) and (III) are characterized in that: the polypeptide chain (II) is covalently linked to the polypeptide chain (III) by one or more disulfide bonds.
[0181] In some embodiments, the polypeptide chains (I) and (II) are 1A and hinge 2, and / or polypeptide chains (II) and (III) are linked by at least one disulfide bridge between hinge 3 and C 2B are linked by at least one disulfide bridge between them.
[0182] In some embodiments, the binding protein comprises an Fc region or a variant thereof (e.g., (C H 2-C H 3) A or (C H 2-C H 3) B or Hinge 1-(C H 2-C H 3) A or Hinge 2-(C H2-C H 3) B ) has an N-linked glycosylation at residue N297 according to EU numbering H It is characterized by containing two heavy chain constant domains.
[0183] In some embodiments, the binding protein is characterized in that residue N297 of the Fc region or variant thereof comprises an N-linked glycosylation, according to EU numbering.
[0184] In some embodiments, the binding protein is characterized in that all or a portion of the Fc region or a variant thereof binds to a human Fc-gamma receptor polypeptide, hi some embodiments, the binding protein is characterized in that all or a portion of the Fc region or a variant thereof binds to a human CD16A (FcγRIII) polypeptide.
[0185] In one embodiment, the binding protein is: - a polypeptide comprising the amino acid sequence of SEQ ID NO: 61, a polypeptide comprising the amino acid sequence of SEQ ID NO: 62, and a polypeptide comprising the amino acid sequence of SEQ ID NO: 63, or variants thereof having at least 80% sequence identity; or - a polypeptide comprising the amino acid sequence of SEQ ID NO: 64, a polypeptide comprising the amino acid sequence of SEQ ID NO: 65 and a polypeptide comprising the amino acid sequence of SEQ ID NO: 66, or variants thereof with at least 80% sequence identity; and / or - a polypeptide comprising the amino acid sequence of SEQ ID NO: 61 or 64, a polypeptide comprising the amino acid sequence of SEQ ID NO: 62 or 65, and a polypeptide comprising the amino acid sequence of SEQ ID NO: 63 or 66, or a variant thereof having at least 80% sequence identity. Includes.
[0186] In some embodiments, the binding protein is: - a polypeptide comprising the amino acid sequence SEQ ID NO:61, a polypeptide comprising the amino acid sequence SEQ ID NO:62, and a polypeptide comprising the amino acid sequence SEQ ID NO:63, or variants thereof having at least 80% sequence identity; or - a polypeptide comprising the amino acid sequence of SEQ ID NO: 64, a polypeptide comprising the amino acid sequence of SEQ ID NO: 65 and a polypeptide comprising the amino acid sequence of SEQ ID NO: 66, or a variant thereof having at least 80% sequence identity thereto; Includes.
[0187] In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO:61, a polypeptide comprising the sequence SEQ ID NO:62, and a polypeptide comprising the amino acid sequence of SEQ ID NO:63, or variants thereof with at least 80% sequence identity.
[0188] In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO:64, a polypeptide comprising the amino acid sequence of SEQ ID NO:65, and a polypeptide comprising the amino acid sequence of SEQ ID NO:66, or variants thereof with at least 80% sequence identity.
[0189] In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO:61, a polypeptide comprising the amino acid sequence of SEQ ID NO:62, and a polypeptide comprising the amino acid sequence of SEQ ID NO:63, or variants thereof with at least 90% sequence identity.
[0190] In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO:64, a polypeptide comprising the amino acid sequence of SEQ ID NO:65, and a polypeptide comprising the amino acid sequence of SEQ ID NO:66, or variants thereof with at least 90% sequence identity.
[0191] In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO:61, a polypeptide comprising the amino acid sequence of SEQ ID NO:62, and a polypeptide comprising the amino acid sequence of SEQ ID NO:63, or variants thereof with at least 95% sequence identity.
[0192] In some embodiments, the binding protein comprises: a polypeptide comprising the amino acid sequence of SEQ ID NO:64, a polypeptide comprising the amino acid sequence of SEQ ID NO:65, and a polypeptide comprising the amino acid sequence of SEQ ID NO:66, or variants thereof with at least 95% sequence identity.
[0193] In some embodiments, the binding protein comprises: a polypeptide (I) comprising the amino acid sequence of SEQ ID NO: 61, a polypeptide (II) comprising the amino acid sequence of SEQ ID NO: 62, and a polypeptide comprising the sequence The polypeptide (III) includes the amino acid sequence of number 63.
[0194] In some embodiments, the binding protein is: - a polypeptide (I) consisting of the amino acid sequence of SEQ ID NO: 61; - a polypeptide (II) consisting of the amino acid sequence of SEQ ID NO: 62; and - a polypeptide consisting of the amino acid sequence of SEQ ID NO: 63 (III) Includes.
[0195] In some embodiments, the binding protein comprises: a polypeptide (I) comprising the amino acid sequence of SEQ ID NO:64, a polypeptide (II) comprising the amino acid sequence of SEQ ID NO:65, and a polypeptide (III) comprising the amino acid sequence of SEQ ID NO:66.
[0196] In some embodiments, the binding protein is: - a polypeptide (I) consisting of the amino acid sequence of SEQ ID NO: 64; - a polypeptide (II) consisting of the amino acid sequence of SEQ ID NO: 65; and - a polypeptide consisting of the amino acid sequence of SEQ ID NO: 66 (III) Includes.
[0197] In some variants of these embodiments, the binding protein comprises a polypeptide sequence derived from an immunoglobulin chain (particularly an IgG type immunoglobulin) and / or an amino acid sequence selected from any one of SEQ ID NO:1 to SEQ ID NO:79, which may accordingly include any variant sequence with conservative substitutions and / or any variant having a certain percent sequence identity with a reference sequence; especially a reference sequence derived from an immunoglobulin chain.
[0198] In some embodiments, the binding protein comprises a polypeptide sequence derived from an immunoglobulin chain of the IgG type, in particular of the IgG1, IgG2, IgG3, or IgG4 type, preferably of the IgG1 type.
[0199] Variants of Fc and constant region, as well as non-CDR polypeptide sequences derived from the variable region, as contemplated herein, may consist of Fc and constant region, as well as non-CDR polypeptide sequences that have at least 80% sequence identity to a reference polypeptide sequence; more particularly, that have at least 90% sequence identity to a reference polypeptide sequence; preferably, that have at least 95% sequence identity to a reference polypeptide sequence.
[0200] Additionally, it will be understood herein that where a variant of a polypeptide sequence comprises a CDR polypeptide sequence (e.g., CDR1, CDR2, and CDR3 from either one of the VH or VL domains), the variant has no modifications on that CDR polypeptide sequence.
[0201] In some embodiments, the binding protein comprises an amino acid sequence that has at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs:67-73.
[0202] In some embodiments, the binding protein comprises an amino acid sequence that has at least 90% sequence identity to an amino acid sequence selected from SEQ ID NOs: 67-73.
[0203] In some embodiments, the binding protein comprises an amino acid sequence that has at least 95% sequence identity to an amino acid sequence selected from SEQ ID NOs:67-73.
[0204] In some embodiments, the binding protein comprises an Fc region having at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 69-73, or a variant thereof.
[0205] In some embodiments, the binding protein comprises an Fc region having at least 90% sequence identity to an amino acid sequence selected from SEQ ID NOs: 69-73, or a variant thereof.
[0206] In some embodiments, the binding protein comprises an Fc region having at least 95% sequence identity to an amino acid sequence selected from SEQ ID NOs: 69-73, or a variant thereof.
[0207] In some embodiments, the binding protein has at least 80% sequence identity to an amino acid sequence selected from SEQ ID NO: 69 or 70. H 2-C H or alternatively, a C3 domain Fc region or variant thereof having at least 80% sequence identity with the amino acid sequence of SEQ ID NO:71. H or alternatively, a C2 domain Fc region or variant thereof that has at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 72 or 73. H It comprises a three-domain Fc region or a variant thereof.
[0208] In some embodiments, the binding protein has at least 90% sequence identity to an amino acid sequence selected from SEQ ID NO: 69 or 70. H 2-CH or alternatively, a C3 domain Fc region or variant thereof having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 71. H or alternatively, a C2 domain Fc region or variant thereof having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 72 or 73. H It comprises a three-domain Fc region or a variant thereof.
[0209] In some embodiments, the binding protein has at least 95% sequence identity to an amino acid sequence selected from SEQ ID NO: 69 or 70. H 2-C H or alternatively, a C3 domain Fc region or variant thereof having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 71. H or alternatively, a C2 domain Fc region or variant thereof that has at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 72 or 73. H It comprises a three-domain Fc region or a variant thereof.
[0210] Preferably, the multispecific binding proteins of the present disclosure are bispecific binding proteins.
[0211] The present disclosure further relates to a pharmaceutical composition comprising the binding protein defined above and a pharma- ceutically acceptable carrier.
[0212] Thus, in one embodiment, the disclosure relates to a pharmaceutical composition comprising a binding protein and a pharma- ceutically acceptable carrier, wherein said binding protein is: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin fragment crystallizable (Fc) region or a variant thereof that binds to a human Fc-gamma receptor polypeptide. Includes.
[0213] Thus, in one embodiment, the present disclosure relates to a pharmaceutical composition comprising a binding protein as defined above, and a pharma- ceutically acceptable carrier, said binding protein comprising a first and a second antigen binding domain (ABD), and all or a portion of an immunoglobulin Fc region or a variant thereof, each of said ABDs comprising an immunoglobulin heavy chain variable domain (V H ) and immunoglobulin light chain variable domain (V L ), including V H and V L each contains three complementarity determining regions (CDR-1 to CDR-3); (i) the first ABD specifically binds to human CD123, and - V comprising CDR-H1, H2, and H3 corresponding to the amino acid sequences of SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 4 to 6, respectively H1 , and - V comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 10 to 12, respectively L1 Includes; (ii) the second ABD specifically binds human NKp46, and - the amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; The amino acid sequences of SEQ ID NOs: 22 to 24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25, and 26, respectively; V with corresponding CDR-H1, 2, and 3 H2 , and - the amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NOs: 30 to 32, respectively; The amino acid sequences of SEQ ID NOs: 33 to 35, respectively; The amino acid sequences of SEQ ID NOs: 36 to 38, respectively; or to the amino acid sequences of SEQ ID NOs: 39, 31, and 40, respectively; V with corresponding CDR-L1, 2, and 3 L2 Including, All or a portion of an immunoglobulin Fc region or a variant thereof binds to a human Fc-gamma receptor.
[0214] Preferably, the binding proteins according to the present disclosure, and pharmaceutical compositions thereof, are sterile and suitable for parenteral use.
[0215] III. Medical Use The disclosed binding proteins and compositions thereof are particularly suitable for use as medicaments. Methods for the preparation and use of such medicaments are further disclosed herein.
[0216] Therefore, in one embodiment, the present disclosure provides: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin fragment crystallizable (Fc) region that binds to a human Fc-gamma receptor polypeptide. It relates to binding proteins for use as drugs.
[0217] In accordance with some particular embodiments of this third general object, the present disclosure provides: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin fragment crystallizable (Fc) region that binds to a human Fc-gamma receptor polypeptide. The present invention relates to a binding protein for use in a method for treating or preventing cancer.
[0218] In accordance with some particular embodiments of this third general object, the present disclosure provides: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin fragment crystallizable (Fc) region that binds to a human Fc-gamma receptor polypeptide. The present invention relates to a binding protein for use in a method for treating or preventing hematological cancers.
[0219] In accordance with some particular embodiments of this third general object, the present disclosure provides: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin fragment crystallizable (Fc) region that binds to a human Fc-gamma receptor polypeptide. The present invention relates to a binding protein for use in a method for the treatment or prevention of myelodysplastic syndromes (MDS) or of lymphoproliferative disorders.
[0220] In accordance with some particular embodiments of this third general object, the present disclosure provides: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin fragment crystallizable (Fc) region that binds to a human Fc-gamma receptor polypeptide. and relates to a binding protein for use in a method for treating or preventing acute myeloid leukemia (AML).
[0221] In accordance with some particular embodiments of this third general object, the present disclosure provides: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin fragment crystallizable (Fc) region that binds to a human Fc-gamma receptor polypeptide. and relates to binding proteins for use in methods of treating or preventing CD64 positive and CD64 negative acute myeloid leukemia (AML).
[0222] In some embodiments, the present disclosure relates to a binding protein comprising a first and a second antigen binding domain (ABD) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the ABDs each comprise an immunoglobulin heavy chain variable domain (V H ) and immunoglobulin light chain variable domain (V L ), including V H and V L each contains three complementarity determining regions (CDR-1 to CDR-3); (i) the first ABD specifically binds to human CD123, and - V comprising CDR-H1, H2, and H3 corresponding to the amino acid sequences of SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 4 to 6, respectively H1 , and - V comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 10 to 12, respectively L1 Includes; (ii) the second ABD specifically binds human NKp46, and - the amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; The amino acid sequences of SEQ ID NOs: 22 to 24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25, and 26, respectively; V with corresponding CDR-H1, 2, and 3 H2 , and - the amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NOs: 30 to 32, respectively; The amino acid sequences of SEQ ID NOs: 33 to 35, respectively; The amino acid sequences of SEQ ID NOs: 36 to 38, respectively; or to the amino acid sequences of SEQ ID NOs: 39, 31, and 40, respectively; V with corresponding CDR-L1, 2, and 3 L2 Including, All or part of an immunoglobulin Fc region, or a variant thereof, binds to a human Fc-gamma receptor; and is used as a drug.
[0223] In some embodiments, the present disclosure relates to a binding protein comprising a first and a second antigen binding domain (ABD) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the ABDs each comprise an immunoglobulin heavy chain variable domain (V H ) and immunoglobulin light chain variable domain (V L ), including V H and V L each contains three complementarity determining regions (CDR-1 to CDR-3); (i) the first ABD specifically binds to human CD123, and - V comprising CDR-H1, H2, and H3 corresponding to the amino acid sequences of SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 4 to 6, respectively H1 , and - V comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 10 to 12, respectively L1 Includes; (ii) the second ABD specifically binds human NKp46, and - the amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; The amino acid sequences of SEQ ID NOs: 22 to 24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25, and 26, respectively; V with corresponding CDR-H1, 2, and 3 H2 , and - the amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NOs: 30 to 32, respectively; The amino acid sequences of SEQ ID NOs: 33 to 35, respectively; The amino acid sequences of SEQ ID NOs: 36 to 38, respectively; or to the amino acid sequences of SEQ ID NOs: 39, 31, and 40, respectively; V with corresponding CDR-L1, 2, and 3 L2 Including, All or a portion of an immunoglobulin Fc region, or a variant thereof, binds to a human Fc-gamma receptor; and is used in a method for treating or preventing cancer.
[0224] According to some particular embodiments of this third main object, the present disclosure relates to a binding protein comprising first and second antigen binding domains (ABDs) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the ABDs each comprise an immunoglobulin heavy chain variable domain (VcV). H ) and immunoglobulin light chain variable domain (V L ), including V H and V L each contains three complementarity determining regions (CDR-1 to CDR-3); (i) the first ABD specifically binds to human CD123, and - V comprising CDR-H1, H2 and H3 corresponding to the amino acid sequences SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences SEQ ID NOs: 4 to 6, respectively H1 , and - V comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 10 to 12, respectively L1 Including, (ii) the second ABD specifically binds human NKp46, and - the amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; The amino acid sequences of SEQ ID NOs: 22 to 24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25, and 26, respectively; V with corresponding CDR-H1, 2, and 3 H2 , and - the amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NOs: 30 to 32, respectively; The amino acid sequences of SEQ ID NOs: 33 to 35, respectively; The amino acid sequences of SEQ ID NOs: 36 to 38, respectively; or to the amino acid sequences of SEQ ID NOs: 39, 31, and 40, respectively; V with corresponding CDR-L1, 2, and 3 L2 Including, All or a portion of an immunoglobulin Fc region, or a variant thereof, binds to a human Fc-gamma receptor; and is used in a method for treating or preventing a blood cancer.
[0225] According to some particular embodiments of this third main object, the present disclosure relates to a binding protein comprising first and second antigen binding domains (ABDs) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the ABDs each comprise an immunoglobulin heavy chain variable domain (VcV). H ) and immunoglobulin light chain variable domain (V L ), including V H and V L each contains three complementarity determining regions (CDR-1 to CDR-3); (i) the first ABD specifically binds to human CD123, and - V comprising CDR-H1, H2, and H3 corresponding to the amino acid sequences of SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 4 to 6, respectively H1 , and - V comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 10 to 12, respectively L1 Including, (ii) the second ABD specifically binds human NKp46, and - the amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; The amino acid sequences of SEQ ID NOs: 22 to 24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25, and 26, respectively; V with corresponding CDR-H1, 2, and 3 H2 , and - the amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NOs: 30 to 32, respectively; The amino acid sequences of SEQ ID NOs: 33 to 35, respectively; The amino acid sequences of SEQ ID NOs: 36 to 38, respectively; or to the amino acid sequences of SEQ ID NOs: 39, 31, and 40, respectively; V with corresponding CDR-L1, 2, and 3 L2 Including, All or a portion of an immunoglobulin Fc region or a variant thereof binds to a human Fc-gamma receptor; and is used in a method for treating or preventing myelodysplastic syndromes (MDS) or lymphoproliferative disorders.
[0226] According to some particular embodiments of this third main object, the present disclosure relates to a binding protein comprising first and second antigen binding domains (ABDs) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the ABDs each comprise an immunoglobulin heavy chain variable domain (VcV). H ) and immunoglobulin light chain variable domain (V L ), including V H and V L each contains three complementarity determining regions (CDR-1 to CDR-3); (i) the first ABD specifically binds to human CD123, and - V comprising CDR-H1, H2, and H3 corresponding to the amino acid sequences of SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 4 to 6, respectively H1 , and - V comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences SEQ ID NOs: 10 to 12, respectively L1 Including, (ii) the second ABD specifically binds human NKp46, and The amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; The amino acid sequences of SEQ ID NOs: 22 to 24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25, and 26, respectively; V with corresponding CDR-H1, 2, and 3 H2 , and The amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NOs: 30 to 32, respectively; The amino acid sequences of SEQ ID NOs: 33 to 35, respectively; The amino acid sequences of SEQ ID NOs: 36 to 38, respectively; or to the amino acid sequences of SEQ ID NOs: 39, 31, and 40, respectively; V with corresponding CDR-L1, 2, and 3L2 Including, All or a portion of an immunoglobulin Fc region or a variant thereof binds to a human Fc-gamma receptor; and is used in a method for treating or preventing acute myeloid leukemia (AML).
[0227] According to some particular embodiments of this third main object, the present disclosure relates to a binding protein comprising first and second antigen binding domains (ABDs) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the ABDs each comprise an immunoglobulin heavy chain variable domain (VcV). H ) and immunoglobulin light chain variable domain (V L ), including V H and V L each contains three complementarity determining regions (CDR-1 to CDR-3); (i) the first ABD specifically binds to human CD123, and - V comprising CDR-H1, H2, and H3 corresponding to the amino acid sequences of SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 4 to 6, respectively H1 , and - V comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 10 to 12, respectively L1 Including, (ii) the second ABD specifically binds human NKp46, and - the amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; The amino acid sequences of SEQ ID NOs: 22 to 24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25 and 26, respectively; V with corresponding CDR-H1, 2, and 3 H2 , and - the amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NOs: 30 to 32, respectively; The amino acid sequences of SEQ ID NOs: 33 to 35, respectively; The amino acid sequences of SEQ ID NOs: 36 to 38, respectively; or to the amino acid sequences of SEQ ID NOs: 39, 31 and 40, respectively; V with corresponding CDR-L1, 2, and 3 L2 Including, All or part of the immunoglobulin Fc region or its variants bind to human Fc-gamma receptors; CD64 positive and CD64 negative acute myeloid leukemia (AML) The present invention is used in a method for treating or preventing
[0228] The present disclosure further relates to the use of the above-mentioned binding proteins for the preparation of a medicament.
[0229] The present disclosure further relates to the use of the above-mentioned binding proteins as pharmaceutical agents.
[0230] The present disclosure further relates to the use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of cancer.
[0231] The present disclosure further relates to the use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of cancers characterized by tumor cells expressing CD123 on their surface.
[0232] The present disclosure further relates to the use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of cancers characterized by tumor cells expressing CD123 and CD64 on their surface.
[0233] The present disclosure further relates to the use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of hematological cancer.
[0234] The present disclosure further relates to the use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of hematological cancers characterized by tumor cells expressing CD123 on their surface.
[0235] The present disclosure further relates to the use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of hematological cancers characterized by tumor cells expressing CD123 and CD64 on their surface.
[0236] The present disclosure further relates to the use of said binding proteins for the preparation of a medicament for the treatment or prevention of myelodysplastic syndromes (MDS) or of lymphoproliferative disorders.
[0237] The present disclosure further relates to the use of said binding proteins for the preparation of a medicament for the treatment or prevention of acute myeloid leukemia (AML).
[0238] The present disclosure further relates to the use of the above-mentioned binding proteins for the preparation of a medicament for the treatment or prevention of CD64-positive and CD64-negative acute myeloid leukemia (AML).
[0239] In one embodiment, provided is a method of treating a cancer characterized by tumor cells that express CD123 and CD64 on their surface, comprising administering to an individual having such a cancer a binding protein comprising: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide.
[0240] In one embodiment, provided is a method of treating a CD123-expressing tumor (e.g., hematological malignancy, AML) in an individual susceptible to having tumor cells that express CD64 on their surface, comprising administering to the individual: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (ii i) administering a binding protein comprising all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide.
[0241] In one embodiment, provided is a method of treating a hematological malignancy (e.g., AML) in an individual, comprising administering to the individual: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) a binding protein comprising all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide.
[0242] In another embodiment, provided is a method of treating a hematological malignancy (e.g., AML) in an individual comprising: (a) assessing or determining whether malignant cells (e.g., AML cells) from the individual express CD64 on their surface; and (b) if the individual is determined to have malignant cells (e.g., AML cells) that express CD64 on their surface (e.g., at a predetermined level), administering to the individual a binding protein comprising: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds a human Fc-gamma receptor polypeptide.
[0243] In another embodiment, provided is a method of depleting malignant cells and / or directing NK cell-mediated cytotoxicity to CD64-expressing malignant cells in an individual (e.g., an individual with AML), comprising administering to an individual having malignant cells (e.g., AML cells) that express CD64 on their surface a binding protein comprising: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide.
[0244] In another embodiment, provided is a method of causing NK cells to eliminate malignant cells that express both CD123 and CD64, the method comprising contacting the malignant cells (e.g., AML cells) in the presence of NK cells with a binding protein comprising: (i) a first antigen binding domain (ABD) comprising a variable region that binds a human CD123 polypeptide, (ii) a second antigen binding domain (ABD) comprising a variable region that binds a human NKp46 polypeptide, and (iii) all or a portion of an Fc region or a variant thereof that binds a human Fc-gamma receptor polypeptide.
[0245] Evaluating the expression of CD64 by, e.g., on the surface of, malignant cells (e.g., AML cells) can be performed by any suitable method. Usually, a biological sample from an individual, e.g., a blood sample or a suitable biopsy, can be obtained and evaluated, and the expression of CD64 on tumor cells can be determined using assays such as immunohistochemistry (IHC) assays, fluorescence-activated cell sorting (FACS) assays, e.g., quantitative FACS, ELISA, immunoblotting (e.g., Western blotting, dot blotting, or in-cell Western blotting), and other immunoassays. Anti-CD64 antibodies for use in such assays are available in the art.
[0246] IV. Means for Producing Binding Proteins Further disclosed herein are means for producing the binding proteins of the present disclosure in vitro. As used herein, a "binding protein of the present disclosure" refers to a first and second antigen-binding "A multifunctional binding protein comprising a first ABD and a second ABD that specifically binds human CD123, a second ABD that specifically binds human NKp46, and a multifunctional binding protein comprising a first ABD and a second ABD that specifically binds human NKp46, and a first ABD and a second ABD that specifically binds human NKp46, and a multifunctional binding protein comprising ...
[0247] More specifically, the means provided may refer to the production of a binding protein comprising a first and a second antigen binding domain (ABD), and all or a portion of an immunoglobulin Fc region or a variant thereof, said ABDs each comprising an immunoglobulin heavy chain variable domain (VH) and an immunoglobulin light chain variable domain (VL), each of the VH and VL comprising three complementarity determining regions (CDR-1 through CDR-3); (i) the first ABD specifically binds to human CD123, and - VH1 comprising CDR-H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 4 to 6, respectively, and - VL1 comprising CDR-L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 10 to 12, respectively Including, (ii) the second ABD specifically binds human NKp46, and - the amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; The amino acid sequences of SEQ ID NOs: 22 to 24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25, and 26, respectively; VH2 containing the corresponding CDR-H1, 2, and 3, and - the amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NOs: 30 to 32, respectively; The amino acid sequences of SEQ ID NOs: 33 to 35, respectively; The amino acid sequences of SEQ ID NOs: 36 to 38, respectively; or Amino acid sequences SEQ ID NOs: 39, 31, and 40, respectively; VL2 containing the corresponding CDR-L1, 2, and 3 Including, All or a portion of the immunoglobulin Fc region or a variant thereof binds to a human Fc-gamma receptor.
[0248] Thus, in one embodiment, the present disclosure relates to an isolated nucleic acid molecule comprising a nucleotide sequence encoding a binding protein of the present disclosure.
[0249] Thus, in one embodiment, the present disclosure relates to an expression vector comprising a nucleic acid molecule comprising a nucleotide sequence encoding a binding protein of the present disclosure.
[0250] Thus, in one embodiment, the present disclosure relates to an isolated cell comprising a nucleic acid molecule of the present disclosure.
[0251] Therefore, in one embodiment, the present disclosure relates to an isolated cell comprising an expression vector of the present disclosure.
[0252] According to a particular embodiment, the cell is a eukaryotic cell, in particular an insect cell or a mammalian cell. In one embodiment, the cell is a mammalian cell and the expression vector is a mammalian expression vector.
[0253] Thus, in one embodiment, the disclosure relates to a method of producing a binding protein of the disclosure, comprising the steps of producing a binding protein comprising: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide.
[0254] According to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for expressing one or more recombinant polypeptides comprising: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, and / or (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and / or (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide; (b) optionally recovering the expressed recombinant polypeptide. The present invention relates to a method comprising the steps of:
[0255] According to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for expressing one or more recombinant polypeptides comprising: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide; (b) optionally recovering the expressed recombinant polypeptide. The present invention relates to a method comprising the steps of:
[0256] According to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for expressing a plurality of recombinant polypeptides comprising: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide; (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide; and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide; (b) optionally recovering the expressed recombinant polypeptide. The present invention relates to a method comprising the steps of:
[0257] According to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for expressing a plurality of recombinant polypeptides, including (i) a polypeptide comprising the amino acid sequence of SEQ ID NO: 61 or 64, (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 62 or 65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 63 or 66; (b) optionally recovering the expressed recombinant polypeptide. The present invention relates to a method comprising the steps of:
[0258] According to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for expressing a plurality of recombinant polypeptides, including (i) a polypeptide comprising the amino acid sequence of SEQ ID NO:64, (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO:65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO:66; (b) optionally recovering the expressed recombinant polypeptide. The present invention relates to a method comprising the steps of:
[0259] According to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for co-expressing a plurality of recombinant polypeptides, including (i) a polypeptide comprising the amino acid sequence of SEQ ID NO: 61 or 64, (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 62 or 65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 63 or 66; (b) optionally recovering the co-expressed recombinant polypeptide; The present invention relates to a method comprising the steps of:
[0260] According to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for co-expressing a plurality of recombinant polypeptides, including (i) a polypeptide comprising the amino acid sequence of SEQ ID NO:64, (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO:65, and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO:66; (b) optionally recovering the expressed recombinant polypeptide. The present invention relates to a method comprising the steps of:
[0261] According to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for expressing a plurality of recombinant polypeptides comprising (i) a first polypeptide chain (I), (ii) a second polypeptide chain (II), and (iii) a third polypeptide (III) that form two antigen binding domains (ABDs), one ABD that specifically binds to a human CD123 polypeptide and another ABD that specifically binds to a human NKp46 polypeptide, wherein the three polypeptide chains (I), (II), and (III) are characterized in that they consist of: 1A -C 1A -L3-(C H 2-C H 3) A (I) V1B -C 1B -L4-(C H 2-C H 3) B -L1-V 2A -C 2A -L2(II) V 2B -C 2B (III) During the ceremony: V 1A and V 1B is the bond pair V1(V H1 / V L1 ) to form; V 2A and V 2B is the bond pair V2(V H2 / V L2 ) to form; C 1A and C 1B is compared with C1(C H 1 / C L ) and C 2A and C 2B is compared with C2 (C H 1 / C L ) and C H 1 is immunoglobulin heavy chain constant domain 1, C L is an immunoglobulin light chain constant domain; (C H 2-C H 3) A and (C H 2-C H 3) B may be identical or different, and may be an immunoglobulin heavy chain constant domain 2 (C H 2) and immunoglobulin heavy chain constant domain 3 (C H 3) Including; L1, L2, L3, L4 are optional independent amino acid linkers, which may be the same or different; (b) optionally recovering the expressed polypeptide chains (I), (II), and (III); The present invention relates to a method comprising the steps of:
[0262] According to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for co-expressing a plurality of recombinant polypeptides comprising (i) a first polypeptide chain (I), (ii) a second polypeptide chain (II), and (iii) a third polypeptide chain (III), which form two antigen binding domains (ABDs), one ABD that specifically binds to a human CD123 polypeptide and another ABD that specifically binds to a human NKp46 polypeptide; The three polypeptide chains (I), (II) and (III) are characterized in that they consist of: V 1A -C 1A -L3-(C H 2-C H 3) A (I) V 1B -C 1B -L4-(C H 2-C H 3) B -L1-V 2A -C 2A -L2(II) V 2B -C 2B (III) During the ceremony: V 1A and V 1B is the bond pair V1(V H1 / V L1 ) to form; V 2A and V 2B is the bond pair V2(V H2 / V L2 ) to form; C 1A and C 1B is compared with C1(C H 1 / C L ) and C 2A and C 2B is compared to C2 (C H 1 / C L ) and C H 1 is immunoglobulin heavy chain constant domain 1, C L is an immunoglobulin light chain constant domain; (C H 2-C H 3) A and (C H 2-C H 3) B may be identical or different, and may be an immunoglobulin heavy chain constant domain 2 (C H 2) and immunoglobulin heavy chain constant domain 3 (C H 3) Including; L1, L2, L3, L4 are optional independent amino acid linkers, which may be the same or different; (b) optionally recovering the co-expressed polypeptide chains (I), (II), and (III); The present invention relates to a method comprising the steps of:
[0263] Thus, according to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for expressing a plurality of recombinant polypeptides comprising: (i) a first polypeptide chain (I) comprising the amino acid sequence of SEQ ID NO: 61 or 64, (ii) a second polypeptide chain (II) comprising the amino acid sequence of SEQ ID NO: 62 or 65, and (iii) a third polypeptide chain (III) comprising the amino acid sequence of SEQ ID NO: 63 or 66; (b) optionally recovering the expressed polypeptide chains (I), (II), and (III); The present invention relates to a method comprising the steps of:
[0264] Thus, according to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) culturing a host cell under conditions suitable for co-expressing a plurality of recombinant polypeptides comprising: (i) a first polypeptide chain (I) comprising the amino acid sequence of SEQ ID NO: 61 or 64, (ii) a second polypeptide chain (II) comprising the amino acid sequence of SEQ ID NO: 62 or 65, and (iii) a third polypeptide chain (III) comprising the amino acid sequence of SEQ ID NO: 63 or 66; (b) optionally recovering the co-expressed polypeptide chains (I), (II), and (III); The present invention relates to a method comprising the steps of:
[0265] The method of producing a binding protein of the present disclosure, such as those defined above, may further comprise the prior step of providing a host cell with a nucleic acid, particularly an isolated nucleic acid (i.e. a recombinant nucleic acid), encoding all or part of said binding protein. In particular, such a step may comprise or consist of transfecting said host cell with a nucleic acid, particularly an isolated nucleic acid, encoding all or part of said binding protein.
[0266] Thus, according to certain embodiments, the present disclosure provides a method of producing a binding protein, comprising: (a) providing a host cell containing a nucleic acid encoding all or a portion of the binding protein; (b) culturing the host cell under conditions suitable for expressing one or more recombinant polypeptides comprising: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, and / or (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, and / or (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide; (c) optionally recovering the expressed recombinant polypeptide. The present invention relates to a method comprising the steps of:
[0267] In one embodiment, a method for producing a binding protein of the present disclosure comprises: (a) providing one or more nucleic acids encoding a first polypeptide chain (I), a second polypeptide chain (II), and a third polypeptide chain (III); (b) transfecting a host cell with one or more nucleic acids; (c) culturing the host cell under conditions suitable for expressing (or co-expressing) said polypeptide chains; (d) optionally recovering the expressed (or co-expressed) polypeptide chains (I), (II), and (III); Includes.
[0268] In one embodiment, a method for producing a binding protein of the present disclosure comprises: (a) providing one or more nucleic acids encoding a first polypeptide chain (I) comprising the amino acid sequence of SEQ ID NO: 61 or 64, a second polypeptide chain (II) comprising the amino acid sequence of SEQ ID NO: 62 or 65, and a third polypeptide chain (III) comprising the amino acid sequence of SEQ ID NO: 63 or 66; (b) transfecting a host cell with one or more nucleic acids; (c) culturing the host cell under conditions suitable for expressing (or co-expressing) said polypeptide chains; (d) optionally recovering the expressed (or co-expressed) polypeptide chains (I), (II), and (III); Includes.
[0269] In certain embodiments, a method for producing a binding protein of the present disclosure comprises: (a) providing a first nucleic acid encoding a first polypeptide chain according to any of the amino acid sequences of SEQ ID NOs: 61 or 64, a second nucleic acid encoding a second polypeptide chain according to any of the amino acid sequences of SEQ ID NOs: 62 or 65, and a third nucleic acid encoding a third polypeptide chain according to any of the amino acid sequences of SEQ ID NOs: 63 or 66; (b) expressing the first, second, and third nucleic acids in one or more host cells to produce binding proteins comprising the first, second, and third polypeptide chains, respectively; (c) optionally loading the produced protein onto an affinity purification support, optionally a Protein A support, and recovering bound protein; Includes.
[0270] Thus, it will be readily understood by one of skill in the art that such methods of producing the binding proteins of the disclosure may include the production and assembly of some or all of the above-described polypeptides, polypeptide chains, and / or regions (e.g., variable regions and Fc regions or variants thereof) in one or more host cells as part of an in vitro production method.
[0271] Alternatively, the method may involve the production of some or all of the above polypeptides, polypeptide chains, and / or regions in one or more host cells, and their assembly outside the host cell. Thus, the steps that bring the polypeptides, polypeptide chains, and / or regions into contact can be accomplished simultaneously or sequentially.
[0272] According to some embodiments, one or more of the regions may be present in different polypeptide chains or fragments thereof.
[0273] As a reference, the "F25" format of the binding protein described in the Examples section herein has four predicted interchain disulfide bridges: - one disulfide bridge linking a cysteine in the CL domain of polypeptide (I) to the first cysteine in the hinge region of polypeptide chain (II); - two disulfide bridges linking two cysteines in the hinge regions of polypeptide chains (I) and (II); - one disulfide bridge linking the C-terminal cysteine of the CL domain of polypeptide chain (III) to the C-terminal cysteine on polypeptide chain (II).
[0274] In some embodiments, the disclosure relates to a method of producing a binding protein of the disclosure, comprising the steps of bringing into contact all or a portion of: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, said variable region comprising at least one complementarity determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NOs: 1-12; (ii) a second antigen binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, said variable region comprising at least one complementarity determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NOs: 13-40; and (iii) an Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide, in particular that binds to a human CD16a Fc-gamma receptor polypeptide.
[0275] In some embodiments, the disclosure relates to a method of producing a binding protein of the disclosure, comprising the steps of contacting: (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, the variable region comprising at least one complementarity determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NOs: 1-6, and at least one complementarity determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NOs: 7-12; (ii) a second antigen binding domain (ABD) comprising a suitable variable region that specifically binds to a human NKp46 polypeptide, the variable region comprising at least one complementarity determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NOs: 13-26, and at least one complementarity determining region (CDR) selected from the group of amino acid sequences consisting of SEQ ID NOs: 27-40; and (iii) all or a portion of an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide, in particular that binds to a human CD16a Fc-gamma receptor polypeptide.
[0276] In some embodiments, the disclosure provides a method of producing a binding protein of the disclosure, comprising: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, the variable region comprising at least two complementarity determining regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs: 1-6, and at least two complementarity determining regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs: 7-12; (ii) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, the variable region comprising at least two complementarity determining regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs: 13-26; R), and a second antigen-binding domain (ABD) comprising a variable region comprising at least two complementarity determining regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs: 27 to 40, and (iii) an immunoglobulin Fc region or a variant thereof that binds to a human Fc-γ receptor polypeptide, in particular to a human CD16 Fc-γ receptor polypeptide.
[0277] In some embodiments, the disclosure relates to a method of producing a binding protein related to the disclosure, the method comprising the steps of bringing into contact all or a portion of: (i) a first antigen-binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, the variable region comprising three complementarity determining regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs: 1-6, and three complementarity determining regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs: 7-12; (ii) a second antigen-binding domain (ABD) comprising a variable region that specifically binds to a human NKp46 polypeptide, the variable region comprising three complementarity determining regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs: 13-26, and three complementarity determining regions (CDRs) selected from the group of amino acid sequences consisting of SEQ ID NOs: 27-40; and (iii) an immunoglobulin Fc region or a variant thereof that binds to a human Fc-gamma receptor polypeptide, in particular that binds to a human CD16 Fc-gamma receptor polypeptide.
[0278] In some embodiments, the disclosure relates to a method of producing a binding protein associated with the disclosure, comprising the steps of bringing into contact (i) a first antigen binding domain (ABD) comprising a variable region that specifically binds to a human CD123 polypeptide, (ii) a second antigen binding domain (ABD) comprising a suitable variable region that specifically binds to a human NKp46 polypeptide, and (iii) all or a portion of an immunoglobulin Fc region or variant thereof that binds to a human Fc-gamma receptor polypeptide, in particular that binds to a human CD16 Fc-gamma receptor polypeptide; wherein the step of bringing into contact comprises bringing into contact a plurality of polypeptide chains selected from the amino acid sequences of SEQ ID NOs: 61-66.
[0279] All or part of said antigen binding domain and immunoglobulin Fc region or variants thereof are expressed in vitro by recombinant means in an isolated cell or cell population, in particular in a eukaryotic cell, preferably in a mammalian cell or insect cell. Most preferably, the expression system relates to a mammalian cell.
[0280] According to an alternative embodiment, the antigen binding domain and a portion of the Fc region or variant thereof are expressed in a first population of isolated cells, while the other portion of the antigen binding domain and the Fc region or variant thereof are expressed in a second population of isolated cells.
[0281] According to an alternative embodiment, all of the antigen binding domains and immunoglobulin Fc regions or variants thereof are expressed in the same population of isolated cells and then recovered, such that contact is provided during or after completion of the recovery step.
[0282] Therefore, a method for producing a binding protein includes: (a) expressing at least one of said first antigen-binding domain and / or said second antigen-binding domain and / or said all or part of an immunoglobulin Fc region or variant thereof in an isolated cell or population of cells, most preferably in a mammalian cell; (b) recovering said first antigen-binding domain and / or said second antigen-binding domain and / or said all or a portion of an Fc region or variant thereof; may include.
[0283] According to one of said preferred embodiments, the present disclosure relates to a method for producing a binding protein related to the present disclosure, comprising: (a) expressing at least one of said first antigen-binding domain and / or said second antigen-binding domain and / or said all or part of an Fc region or variant thereof in an isolated cell or population of cells, most preferably in a mammalian cell; (b) recovering said first antigen-binding domain and / or said second antigen-binding domain and / or said all or a portion of an Fc region or variant thereof; (c) effecting contact of said first antigen-binding domain and / or said second antigen-binding domain and / or said all or part of an Fc region or variant thereof; wherein step (b) and step (c) are accomplished simultaneously or sequentially.
[0284] Preferably, the method for producing a binding protein comprises: (a) expressing the first antigen-binding domain and the second antigen-binding domain and all or a portion of an immunoglobulin Fc region or variant thereof in an isolated cell; (b) recovering the first antigen-binding domain and the second antigen-binding domain and all or a portion of an immunoglobulin Fc region or variant thereof; and (c) bringing into contact said first antigen-binding domain and said second antigen-binding domain and said all or part of an immunoglobulin Fc region or variant thereof, wherein step (b) and step (c) are accomplished simultaneously or sequentially.
[0285] Advantageously, when said first antigen binding domain and said second antigen binding domain and said all or part of an immunoglobulin Fc region or variant thereof are expressed in the same isolated cell or cell population and / or the same cell culture, contact is brought into contact during the recovery step to produce the binding protein.
[0286] Alternatively, if said first antigen binding domain and / or said second antigen binding domain and / or said all or part of an immunoglobulin Fc region or variant thereof are expressed in different isolated cells or cell populations, contacting is effected after the recovering step.
[0287] The recovery step can consist of any method known in the art. Although not exhaustive, recovery of an expressed polypeptide (e.g., one or more expressed polypeptide chains) having an antigen binding domain and all or a portion of an Fc region or variant thereof can be accomplished by the following steps: (b1) recovering the isolated cells or cell cultures thereof; (b2) optionally subjecting the isolated cells or cell cultures thereof to centrifugation, depth filtration, membrane filtration, ultrafiltration, and / or diafiltration. may include. [Sequence List Free Text]
[0288] In the protein sequence notation used herein, the left-hand direction is the amino terminal direction ("N-terminus") and the right-hand direction is the carboxyl-terminal direction ("C-terminus"), in accordance with standard usage and convention.
[0289] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] EXAMPLES
[0290] material and method A.1. NKp46-CD123 NKCE expression by transient transfection of EXPI-293F™ cells. The sequences encoding each polypeptide chain of the NKp46-CD123_F25 binding protein of the present disclosure were inserted into the pTT-5 vector between the HindIII and BamHI restriction sites. The three vectors (manufactured as endotoxin-free midipreps) were used to co-transfect EXPI-293F cells (Life Technologies) in the presence of PEI (37°C, 5% CO2, 150 rpm). The cells were used to transfect 1x10 cells per ml (EXPI293 medium, Gibco) in culture flasks. 6The cells were seeded at a cell density of 1000 x 1000 cells / ml. As a reference, for the NKp46-CD123_F25 binding protein, we used DNA ratios of 0.1 μg / ml (polypeptide chain I), 0.4 μg / ml (polypeptide chain II), or 0.8 μg / ml (polypeptide chain III). Valproic acid (final concentration 0.5 mM), glucose (4 g / L), and tryptone N1 (0.5%) were added. The supernatant was collected after 6 days and passed through a Stericup filter with 0.22 μm pores.
[0291] A.2. Purification of NKCE. The disclosed NKp46-CD123_F25 binding protein was purified from the harvested supernatant using rProtein A Sepharose Fast Flow (GE Healthcare, reference 17-1279-03). Subsequent Cation Ion Exchange Chromatography (CIEX) purification was performed after dialysis of the sample with Na2HPO4 / KH2PO4 50mM pH 6.2 phosphate buffer. The sample was filtered through a 0.22 μm device before injection into two "in series" columns HiTrap SP-HP 1mL from GE Healthcare (reference 17-1151-01). The starting and elution buffers were Na2HPO4 / KH2PO4 50mM pH 6.2 and Na2HPO4 / KH2PO4 25mM pH 6.2; 1M NaCl, respectively. Elution was performed with a linear gradient of 0% to 50% (elution buffer) in 100 CV. The peak of interest was finally dialyzed against PBS1X overnight at 4° C. under stirring.
[0292] A.3. Biological Samples Healthy human buffy coats were provided by the Etablissement Francais du Sang (EFS, Marseille; AC-2019-3428). Peripheral mononuclear cells (PBMCs) were isolated from the buffy coats by using Ficoll density gradient centrifugation. Human NK cells were isolated from the buffy coats by StemCell or Milteny The antibodies were purified from PBMCs by using a bead-based negative selection kit.
[0293] Patient-derived acute myeloid leukemia (AML) samples were provided by the Institut Paoli-Calmettes (Marseille, SA-IPH-MImAbs Contract).
[0294] A.4. Cell lines CD123 expressing acute myeloid leukemia (AML) cell lines: MOLM-13 and THP-1 were purchased from ATCC. Cells were cultured in complete RPMI medium (RPMI-1640 containing 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1x non-essential amino acids). 25 mM HEPES was added to the medium for THP-1 cells.
[0295] THP-1 CD64KO and THP-1 CD32KO cells were generated by CRISPR / Cas endonuclease. THP-1 cells were cultured in RPMI-1640, 10% SVF, 2 mM L-Glu, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids. To generate CD64-deficient THP-1 cells, 6 Cells were nucleofected (Neon Transfection System, 100ul tip, 1700V, 20ms, 1 pulse) with two sgRNAs (CD64.1: CUUGAGGUGUCAUGCGUGGA (SEQ ID NO: 80); CD64.2: AAGCAUCCGCUACACAUCAGC (SEQ ID NO: 81); Synthego) at a CAS9:sgRNA ratio of 1:9 (Alt-R™ SpCas9 Nuclease 3NLS, Integrated DNA Technology). Lack of CD64 expression was monitored by flow cytometry and cells were sorted or subcloned.
[0296] 2.5.10 to generate CD32 knockout (KO) THP-1 cells 6Cells were nucleofected (Neon Transfection System, 100 μL tip, 1700V, 20 ms, 1 pulse) (Alt-R™ SpCas9 Nuclease 3NLS, Integrated DNA Technology) with a set of sgRNAs (CD32A: AUGUAUGUCCCAGAAACCUG; CD32B: AAGCAAUAUGACCCCAAGGCU (Integrated DNA Technologies)) at a CAS9:sgRNA ratio of 1:9. Only THP-1 CD32KO cells were cell sorted. Following cell sorting, the absence of CD32 expression was monitored by flow cytometry.
[0297] A.5. NK Cell-Based Cytotoxicity Assay For AML blasts derived from patient samples, target cells were 51 The cells were loaded with Cr (for MOLM-13, THP-1 or THP-1 CD64KO, THP-1 CD32KO cells) or CalceinAM (Life technologies, ref: C3100MP or equivalent). Test antibodies, labeled target cells, and fresh or overnight rested human NK cells from healthy donors were added consecutively into each well of a round-bottom 96-well plate to obtain a ratio of 10:1 (E:T). After 4 h of co-incubation, the supernatants were transferred to Lumaplates ( 51 Cr) or flat-bottom culture plates (for Calcein AM).
[0298] 51 For Cr-based cytotoxicity assays, 51 Cr was dosed using a TopCount NXT™ (Microplate Scintillation and Luminescence Counter; Per Radioactivity was measured by counting γ-emission for 60 s per well and the results were expressed in cpm = counts per minute.
[0299] For Calcein-based cytotoxicity assay, CalceinAM released from dead target cells was dosed by measuring the relative fluorescence units (RFU) by Luminometer (EnSpire® Multimode Plate Reader (Perkinelmer): fluorescence emission at λ=516 nm after excitation at λ=495 nm).
[0300] For analytical purposes, the percent specific lysis was calculated using the following formula:
number
[0301] EC of each antibody 50 was determined by drawing an appropriate non-linear regression curve (selection of the "log(agonist) vs. response-variable slope (4 parameters)" model) by using Graphpad Prism Software.
[0302] Phenotyping of AML cells Expression of CD32, CD64, and CD123 on AML samples derived from patient blood and on AML cell lines was examined using anti-human CD33-BB515 (BD Biosciences 564588 Clone WM53), anti-human CD45-Viogreen (Miltenyi 130-096-906 Clone 5B1), anti-human CD123-AF647 (BD Biosciences 563599 Clone 9F5), anti-human CD32-PE (Beckman Coulter IM1935 Clone 1B1 ...45-Viogreen (Miltenyi 130-096-906 Clone 5B1), anti-human CD45-Viogreen (Miltenyi 130-096-90 2E1), anti-human CD64-PE (Beckman Coulter IM3601U Antibody staining was controlled by flow cytometry using anti-human CD123-PE (Biolegend 306006 Clone 6H6), cognate isotype control antibodies mIgG1-PE (IC-1; BD Biosciences 555749 Clone MOPC-21), and mIgG2a-PE (IC-2a; Beckman Coulter A09142 Clone 7T4-1F5). Target cells were saturated with normal mouse serum diluted 1 / 10e in staining buffer (SB) and then mixed with the dye-coupled antibodies. Cells were fixed in BD Cellfix diluted 1 / 10e in H2O for 30 min after staining and analyzed by flow cytometry on a FACS Canto II. FSC-A, FSC-H, SSC-A, SSC-H, FL2-A, FL4-A and FL7-A or FSC-A, FSC-H, SSC-A, SSC-H, FL1-A, FL2-A, FL3-A, FL5-A and FL8-A (for AML samples derived from patient blood) parameters were recorded and analysis was performed by FlowJo software. Phenotyping results are shown in Figure 6A, Figure 6B and Figure 14B.
[0303] A.6. NK cell degranulation assay with AML samples To test NK cell activation as in Figure 7, test antibodies, AML blasts, and autologous NK cells from AML patients were added sequentially into each well of a round-bottom 96-well plate. After overnight co-incubation with the NKp46-CD123_F25 binding protein of the present disclosure, anti-human CD107a and CD107b antibodies were added into each well for 4 hours. Cells were then washed and incubated with the following mixtures: viability, APC cup. Cells were stained with the following markers: Ring anti-human CD45, BB515-coupled anti-human CD33, PeCy7-coupled anti-human CD56, and BV510-coupled anti-human CD3. Cells were then washed, fixed, and analyzed by flow cytometry. The data obtained were analyzed using Flowjo software to analyze live CD45 + CD33 - CD56+ CD3 - NK cell degranulation was analyzed by analyzing the expression of CD107 on NK cells identified as NK cells.
[0304] To examine NK cell activation and cytokine / chemokine production towards MOLM-13 cells via the NKp46-CD123_F25 binding protein as in FIG. 17, flow cytometry analysis was performed using the following antibody markers: CD69, CD107a / b, IFNα, TNFα, MIP1β.
[0305] First, purified primary human NK cells from three separate donors were co-incubated with or without MOLM-13 cells at a 1:1 ratio in the presence of increasing concentrations of NKp46-CD123_F25 or control (NKp46-IC_F25, and no antibody) for 4 hours at 37° C. (seeded at 50,000 cells / well; U-bottom 96-well plates). Concomitantly, BD GolgiSTOP™ was added to experimental and control samples at a final dilution of 1 / 6000 in each well. A positive control for NK cell activation was performed by using 125 ng / mL final PMA and 1 μg / mL final IONO added to 50,000 resting NK cells per well (data not shown).
[0306] After 4 hr incubation, cells were washed in staining buffer (PBS with 0.2% BSA, 2 mM EDTA, and 0.02% sodium azide) and stained with the following extracellular antibody mixture: anti-human CD3-Pacific Blue, anti-human CD56-Pe-Vio770, anti-human CD69-FITC, anti-human CD107a (LAMP-1)-APC, and anti-human CD107b-APC according to the manufacturer's recommended incubation and dilution ratios. After fixation and permeabilization steps, intracellular staining was performed with the following intracellular antibody mixture: anti-human IFNγ-BV605, anti-human TNFα-BUV395, and anti-human MIP1β-PE. To remove aggregates, the antibody mixture was centrifuged at 16,000 g for 10 min at 4° C., washed, and resuspended in sample buffer.
[0307] Flow cytometry was performed on an LSR Fortessa™ X-20 with BD FACSDiva acquisition software measuring FSC-A, FSC-H, SSC-A, SSC-H, FL-1, FL-3, FL-6, FL-7, FL-9, FL-13, and FL-16 parameters. All data was analyzed with FlowJo software.
[0308] Marker percentages of NK cell samples were analyzed using GraphPad Prism. Top activation values corresponded to the maximum activation observed. Median effective concentration (EC 50 ) values were calculated using a four-parameter logistic nonlinear regression model corresponding to the following equation:
number
[0309] The calculated bottom activation, calculated top activation, slope, and 95% confidence interval (CI) values were calculated using the same model as the EC 50 It was calculated as:
[0310] These parameters were analyzed using activation markers (CD69, CD107a / b), cytokines, and The concentrations of IFNα, TNFα, and chemokine (MIP1β) were calculated separately.
[0311] A.7. Human Recombinant Proteins, Cloning, Production, and Purification (SPR) The sequence encoding the extracellular domain (ECD) of human NKp46 (Gln22-Asn255, NCBI reference: NM_004829.5) was inserted into the SLX192 vector (Selexis) between HindIII and XbaI restriction sites. A C-terminal 6xHis tag was added for purification. The following primers were used for PCR of human PBMC: 5'TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCCTGC 3' and 5'CCGCCCCGACTCTAGATCAATGGTGATGGTGGTGATGATTCTGGGCAGTGTGATCCC 3'. The sequence of the amplicon was checked. The vector was then used to transfect a CHO cell line to select clones producing the protein. Proteins were purified from culture supernatants with Ni-NTA beads (Qiagen, #1018244) and subjected to S200 size exclusion chromatography to ensure removal of aggregates prior to characterization of binding kinetics by surface plasmon resonance (SPR).The polypeptide sequence from recombinant human NKp46 is reported herein as SEQ ID NO:84; it contains a portion of the extracellular domain of NKp46.
[0312] The sequence encoding the ECD of cynomolgus NKp46 (Gln17-Asn254, NP_001271509.1) was cloned into the SLX192 vector between the HindIII and XbaI restriction sites. A C-terminal Flag-M2 tag was added for purification. The primers used to amplify the predicted sequence from cynomolgus PBMC were: 5'TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCGTGC 3' and 5'CCGCCCCGACTCTAGATCACTTGTCATCGTCATCTTTGTAATCATTCTGGGCAGTGTGGTCC 3'. After sequence confirmation, the vector was used to transfect CHO-K1SV cell line and the resulting cell clones were selected. The recombinant cynomolgus monkey NKp46-FlagM2 protein sequence is reported herein as SEQ ID NO: 85; it contains a portion of the extracellular domain of NKp46 (GenBank number: CAC41080.1). The first three batches (150602CCe batch 1, 150618CCe batch 2, and 150715CCe batch 3) were purified by M2 affinity chromatography. The beads were incubated overnight with the supernatant containing the recombinant protein. The beads were then washed with PBS1x, and elution was performed with 150ng / μl of eluted peptide in PBS1x. The protein was then dialyzed against PBS1x. The next batches (161003CDe batch 1 and 161116CDe batch 2) were purified by affinity chromatography by coupling the anti-NKp46 antibody HUX1-M-H46-17E1 to AminoLink Coupling Resin according to the manufacturer's instructions (GE Healthcare, #20381, batch QB213815). The beads were then incubated overnight with the supernatant containing the recombinant protein. The beads were then washed with PBS 1x and elution was performed with glycine 0.1M pH 2.5. The protein was then dialyzed against TBS buffer pH 7.5, concentrated and preparative size exclusion chromatography was performed on a Superdex 200 Increase 10 / 300 GL column.
[0313] Recombinant human CD123 from ACRO Biosystems (catalog no. ILA-H52H6), recombinant human Fc gamma RIIIA / CD16a (V176) (Biotechne, catalog no. 4325-FC) and recombinant human Fc gamma RIIIA / CD16a (V176F) (Biotechne, catalog no. 8894-FC) were additionally used.
[0314] A.8. Analytical procedure for determining the antigen-binding properties of multispecific binding proteins by surface plasmon resonance. A Biacore T200 instrument (Cytiva, Uppsala, Cat. No. 28975001) was used with a Series S CM5 sensor chip (Cytiva, Uppsala, Cat. No. 29149603).
[0315] For binding kinetics measurements with NKp46 and CD123, HBS-EP+ buffer (Cytiva, Uppsala, Cat. No. BR1006-69) was added to 100 mL 10x HBS-EP+ buffer was prepared by mixing with 900 mL of purified water. Affinity capture of bispecific Ab samples was achieved using a human antibody capture kit (Cytiva, Uppsala, Catalog No. BR1008-39). Anti-Fc capture antibodies were diluted 1:20 in running buffer and coupled to a CM5 chip (Cytiva, Uppsala, Catalog No. 29149603) using standard amine coupling to yield approximately 8000 response units (RU) using an amine coupling kit (Cytiva, Uppsala, Catalog No. BR-100-50). Seven serial 1:1 dilutions of human NKp46 (Innate Pharma) or human CD123 (ACRO Biosystems) in HBS-EP+ assay buffer were prepared to concentrations of 1.56 nmol / L, 3.13 nmol / L, 6.25 nmol / L, 12.5 nmol / L, 25 nmol / L, 50 nmol / L, and 100 nmol / L. Bispecific antibodies were diluted with HBS-EP+ buffer to a concentration of 0.06 μg / mL and used in the experiments at this concentration. Antibodies were captured for 90 seconds at a flow rate of 10 μL / min to obtain a maximum response (Rmax) value of approximately 30 RU. Measurements were performed in multi-cycle kinetic experiments for both antigens. In each multi-cycle experiment, antibodies were captured via anti-human Fc antibodies immobilized on a series S CM5 sensor chip (Human Antibody Capture Kit, Cytiva, Uppsala, Cat. No. BR1008-39). Human and cynomolgus NKp46 (Innate Pharma) or human CD123 (ACRO Biosystems), diluted in HBS-EP+ buffer, were injected in a 1:1 dilution series from 1.56 nmol / L to 100 nmol / L at a flow rate of 30 μL / min for 240 s followed by a dissociation phase of 1200 s. All analyte concentrations were run in duplicate with multiple buffer blanks for double referencing. Regeneration of the capture surface was performed with regeneration solution (3 mol / L MgCl2) at 30 μL / min for 60 s.Binding kinetics data were evaluated for all other antibodies using a 1:1 binding model with mass transport limitation by Biacore T200 Evaluation Software version 3.0 (Cytiva, Uppsala).
[0316] For binding affinity measurements of CD16a, HBS-EP+ buffer (Cytiva, Uppsala, Cat. No. BR1006-69) was prepared by mixing 100 mL 10x HBS-EP+ buffer with 900 mL purified water. Affinity capture of human CD16a protein was achieved using a His capture kit (Cytiva, Uppsala, Cat. No. 28995056). Anti-His capture antibody was diluted 1:20 in running buffer and coupled to a CM5 chip (Cytiva, Uppsala, Cat. No. 29149603) using standard amine coupling to obtain approximately 8000 response units (RU) using an amine coupling kit (Cytiva, Uppsala, Cat. No. BR-100-50). Ten 1:1 dilutions of bispecific antibodies in HBS-EP+ assay buffer were prepared at concentrations of 5.8 nmol / L, 11.7 nmol / L, 23.4 nmol / L, 46.8 nmol / L, 93.75 nmol / L, 187.5 nmol / L, 375 nmol / L, 750 nmol / L, 1500 nmol / L, and 3000 nmol / L. CD16a(V / F) protein was diluted to a concentration of 0.1 ng / mL in HBS-EP+ buffer and used at this concentration in the experiments. CD16a(V176) and CD16a(V176F) were Capture was performed on flow cells 2 and 4 for 30 seconds at a flow rate of 10 μL / min, respectively, resulting in a maximum response (Rmax) value of approximately 30 RU. Measurements were performed by multi-cycle kinetic experiments. In each multi-cycle experiment, CD16a was captured via an anti-His antibody immobilized on a series S CM5 sensor chip (Human Antibody Capture Kit, Cytiva, Uppsala, Cat. No. BR1008-39). Bispecific antibodies diluted in HBS-EP+ buffer were injected in a 1:1 dilution series from 5.8 nmol / L to 3000 nmol / L at a flow rate of 30 μL / min for 120 seconds, followed by a dissociation phase of 120 seconds. All analyte concentrations were run in duplicate with multiple buffer blanks for double referencing. Regeneration of the capture surface was performed by two consecutive injections of regeneration solution (10 mmol / L glycine, pH 1.5) at 30 μL / min for 30 seconds. The binding affinities (KD values) of the bispecific antibodies to human CD16a were evaluated by Biacore T200 Evaluation Software version 3.0 (Cytiva, Uppsala) using steady-state fits of the SPR responses for the measured antibody concentrations.
[0317] A.9. Antitumor activity against injected MOLM-13 human AML in SCID mice. The efficacy of muNKp46-huCD123_F25 mouse surrogate version of NKp46-CD123_F25 was evaluated in severe combined immunodeficiency (SCID) mice transplanted with scattered human MOLM-13 cells. This surrogate differs from NKp46-CD123_F25 in the arm targeting NKp46 protein (because it targets mouse protein instead of human protein) and is similar to NKp46-CD123_F25 in the other arm (human CD123 binding arm and human IgG1 competent Fc domain that can bind all activating mouse FcγR, recruit mouse effector cells, and induce ADCC by mouse NK cells).
[0318] The activity of muNKp46-huCD123_F25 was compared to an anti-CD123 ADCC enhancing antibody (Reference-1) that binds to mouse FcγR and can recruit mouse effector cells. The activity of muNKp46-huCD123_F25 was also compared to the isotype control binding of muNKp46 and to mouse FcγR that does not bind huCD123 (muNKp46-IC).
[0319] Mice were inoculated with tumor cells (5 × 10 6 Treatment was administered by intraperitoneal route on day 1 after tumor implantation.
[0320] In the first experiment (FIG. 8), mice were randomized into four groups (n=10 mice in the treatment group and 20 mice in the control group) on day 1 after tumor implantation. muNKp46-huCD123_F25 was administered at 0.5, 0.25, and 0.05 mg / kg after intravenous parenteral administration on day 1.
[0321] In the second experiment (Figure 18), muNKp46-IC was administered at 0.5 mg / kg. muNKp46-huCD123_F25 and reference-1 were administered at 5, 0.5, 0.25, and 0.05 mg / kg. The control group was left untreated.
[0322] In the third experiment (Figure 19), mice were randomized into four groups (untreated control; untreated control + anti-asialo GM1; NKCE control; or NKCE + anti-asialo GM1). Experimental groups received the NK cell depleting antibody, anti-asialo GM1, one day prior to tumor implantation (day -1) and on day 5 after tumor implantation. Treatment (vehicle or NKCE) was administered intraperitoneally at a single dose of 0.5 mg / kg on day 1 after tumor implantation. NKCE was administered intraperitoneally at a single dose of 0.5 mg / kg on day 1 after tumor implantation. NKCE was administered intraperitoneally at a single dose of 0.5 mg / kg, including Nkp46-CD123_F25, muNKp46-IC, an isotype control antibody that binds huCD123, and murine FcγR (but not murine NKp46) (IC-huCD123 ) was included.
[0323] Mice were checked to note any adverse clinical reactions. Individual mice were weighed daily until the end of the experiment (day 70). When moribund, mice were euthanized according to predefined criteria to avoid animal suffering. Clinical signs related to pathology considered significant were: quadriplegia, ascites, palpable internal tumor masses, morbidity, or weight loss of 20% or more.
[0324] Primary efficacy endpoints were 1-day median survival time (MST), percent life expectancy extension (ILS%), and long-term survivorship rate.
[0325] The individual days of death (if any) for each mouse were reported. MST was determined for each group and the proportion ILS was calculated and expressed as a percentage: ILS%=100×(TC) / C Where T = MST of the treatment group, C = MST of the control group.
[0326] For the purposes of this example, a dose was considered therapeutically active if the ILS% was greater than 25% and highly active if the ILS% was greater than 50% (Johnson JI, Decker S, Zaharevitz D, Rubinstein LV, Venditti JM, Schepartz S, Kalyandrug S, et al. Relationships between drug activity in NCI preclinical in vitro and in vivo models and "Early clinical trials." Br.J.Cancer. May 2001; Volume 84 (Issue 10): Pages 1424-31).
[0327] Long-term survivorship is defined as the number of mice whose survival time is at least twice the MST of the control group, expressed as a percentage based on the total number of mice in the group.
[0328] A.10. Antitumor Activity in Non-Human Primates (NHP) A qualified flow cytometry panel was used to evaluate cynomolgus blood samples, phenotyping and counts of basophils, and total CD123 immune cells in monkeys. The panel consisted of antibodies against antigens CD45 (clone D058-1283), CD14 (clone REA599), CD203c (clone NP4D6), CD193 (clone 5E8), IgE (clone REA1049), CD123 (clone CD123), CD33 (clone AC104.3E3), and the viability marker Zombie Nir (Biolegend 423106). 100 μL of whole blood samples collected during 3K-EDTA anticoagulation vacuum sampling were lysed in lysis solution (Biocytex). CP025) for 10 min, followed by a centrifugation step at 300g for 5 min at room temperature with DPBS (Sigma D8537). The resuspended cells were stained with antibodies and viability markers for 10 min at room temperature. A third centrifugation step was performed to remove unfixed antibodies. The cells were resuspended in 250 μL of fixation solution (Biocytex CP026) and incubated for 1 h at room temperature. 100 μL of Flow count beads (Beckman A91346) were added into the cell tube and acquired with a Gallios Beckman coulter instrument equipped with 3 lasers and 10 colors.
[0329] A.11. In vitro effects on CD123+ normal blood cells and relevant cytokine release in human peripheral blood mononuclear cells (PBMCs) PBMCs from healthy human donors (N=10) were cultured at 190 °C in 96-well U-bottom plates (Ultra low binding Costar ref#CLS7007). They were seeded in μL complete culture medium (500,000 cells per well) and incubated with serial dilutions of CD123-NKCE, IC-NKCE control, and CD123-TCE molecules for 20 h at 37°C in the presence of 5% CO2. Basophil populations, defined as live TCRαβ negative, CD14 negative, and IgE receptor positive cells, were analyzed by flow cytometry, and absolute concentrations of cytokines released into the supernatant were analyzed by Mesoscale Discovery (MSD) assay.
[0330] Flow cytometry assay The cell pellet was suspended in cold 50 μL Stain Buffer (AutoMACS Running Buffer Miltenyi Ref#130-091-221) completed with 1 μL FcR Blocking Reagent, Human (Miltenyi Ref#130-059-901). A mixture of PBMC subset-specific labeled antibodies and viability reagents was added to the PBMC suspension according to the supplier's recommendations. As a Fluorescence Minus One (FMO) control, an additional point was performed by labeling PBMCs with the same mixture in which each labeled antibody was replaced by its corresponding isotype control. The cells with the mixed antibodies were incubated for 1 hour at 4° C. in the dark. The cell suspension was then centrifuged twice for 5 minutes at 300 g at 4° C., the supernatant was discarded and 200 μL of Stain Buffer was added between each centrifugation. The cells were analyzed using a MACSQuant® Analyser, Miltenyi flow cytometer. Analysis of raw data (fcs-files) exported from the flow cytometer was performed using VenturiOne® software (AppliedCytometry inc.). Populations were gated from forward scatter / side scatter dot plots, and single cells and further viable cells were gated with Iodure Propidium viable negative gate. Gates were set according to FMO controls.
[0331] Cytokine MSD assay Cell supernatants were collected and diluted in MSD buffer according to the purchaser's recommendations. Diluted samples or pre-diluted multi-analyte calibrator samples were added into the pre-coated plate provided in the kit. After adding a solution of detection antibodies conjugated with electrochemiluminescent labels (MSD SULFO-TAG), the plate was incubated for 2 hours at room temperature. The plate was then loaded into the MSD instrument with the addition of MSD buffer that provides the appropriate chemical environment for electrochemiluminescence (ECL), where the captured labels emit light due to a voltage applied to the plate electrodes. The instrument measures the intensity of the emitted light to provide a quantitative measurement of each analyte in the sample.
[0332] Analysis of the raw data exported from the MSD instrument was performed using Excel software. The concentrations of IL-6, IL-1b, IFNγ, and TNFα were determined from the ECL signals by back-fitting to a calibration curve established by a 4-parameter logistic model weighted by 1 / Y2.
[0333] A.12. Determination of cytokine release in non-human primate (NHP) plasma An ECLIA (Electrochemoluminescence Assay) method using the Mesoscale (MSD) Proinflammatory Panel 1 (NHP) kit (ref. K15056D) was developed and demonstrated to quantify IL-2, IFN-γ, IL-6, and IL-10 in monkey K3-EDTA plasma. This is a quantitative sandwich enzyme immunoassay using anti-human IL-2, IL-6, IL10, and IFN-γ antibodies immobilized on the working electrode surface, and ruthenium anti-human IL-2, IL-6, IL-10, and IFN-γ antibodies. 50.0 μL of diluted sample was coated with human anti-human IL-2, IL-6, IL-10, and IFN-γ antibodies, and then incubated at 4°C for 10 min at 4°C for 1 h. The eluate was dispensed into 96-well microplates that had been pre-filtered. After an overnight incubation period at room temperature and three steps of washing, 25.0 μL of sulfotag-conjugated anti-human IL-2, IL-6, IL-10, and IFN-γ antibodies were added. After three steps of washing, 150 μL of read buffer (2×) was added, which provides the appropriate chemical environment for electrochemiluminescence. The instrument measured the intensity of the luminescence to provide a quantitative measurement of the analyte in the sample. The analysis was performed in duplicate.
[0334] Pharmacokinetic and pharmacodynamic studies in non-human primates CD123NKCE solutions for administration were prepared extemporaneously by dilution of the stock solution in vehicle and kept at room temperature before and during administration. To avoid adsorption, polypropylene, polycarbonate, or PETG containers were used for dilution and the containers were coated with a solution of NaCl 0.9% containing 100 ppm of PS80 before use. The tubing used for each intravenous administration (syringe / winged needle) was coated with a solution of NaCl 0.9% containing 100 ppm of PS80 by continuous flushing.
[0335] The animals were identified as M1 and M2 for males dosed at 0.1 mg / kg / dose, F3 and F4 for females dosed at 0.1 mg / kg / dose, M5 and M6 for males dosed at 3 mg / kg / dose, and F7 and F8 for females dosed at 0.1 mg / kg / dose. Dosing was performed on days 1, 8, 15, and 22. Late onset potential toxicity and / or reversibility of potential toxicity was evaluated 1 week (day 29) and up to 4 weeks (day 50) after the last (4th) dose. M2, F4, M6, and F8 were euthanized on day 29 and necropsy was performed.
[0336] The parameters evaluated for each treated animal were: - In blood Preliminary test (before administration) Day 1, 1.5, 5, 24, and 72 hours after the start of infusion Day 8, 24 hours after start of infusion Day 15, 1.5 and 24 hours after the start of the infusion Day 22, 24 hours after start of infusion Day 29 (1 week after last dose; all animals) Day 50 (4 weeks after last dose; recovery animals). - In bone marrow Preliminary test (before administration) Day 9 Day 29 (1 week after last dose; all animals) Day 50 (4 weeks after last dose; recovery animals)
[0337] Blood samples (continuous sampling) were collected from the brachial or saphenous vein into K3-EDTA polypropylene tubes. Blood samples were placed on wet ice and centrifuged. The obtained plasma samples were frozen at -80°C until their analysis. CD123-NKCE concentrations were determined in plasma using a proprietary immunoassay method in which CD123-NKCE was captured by biotin-coupled CD123 recombinant protein and revealed by monkey-absorbed alexa-goat anti-human IgG (Lower Limit of Quantitation (LLOQ) value of 0.250ng / mL).
[0338] result B.1.NKp46-CD123_F25 binding protein The F25 format, or variants thereof, is shown in Figures 1 and 2 and comprises three polypeptide chains. The NKp46-CD123_F25 binding protein is a human It comprises three polypeptide chains comprising a CD123 binding domain and a human NKp46 binding domain, each of which comprises a hypervariable region comprising the polypeptide sequences SEQ ID NOs: 1, 2, 3, 7, 8, 9 and SEQ ID NOs: 13, 14, 15, 27, 28, 29.
[0339] Each polypeptide chain (I, II, and III) is expressed with a signal (or "leader") sequence that is cleaved intracellularly prior to assembly.
[0340] The first polypeptide chain (or "polypeptide chain (I)" or "Fragment I" or "Fragment 1") comprises, from N-terminus to C-terminus, the V corresponding to the amino acid sequence of SEQ ID NO:43. L (CD123 binding) domain, naturally occurring C from human IgG1 K (or Cκ) domain, a modified human IgG1 hinge region ("DKTHTCPPCP"), in which residue D (position according to EU numbering) corresponds to the human C K The Fc region or variant thereof may further comprise a C H 2-C H It is derived from a natural human IgG1 antibody that contains 3 domains. Disulfide bridges potentially form extracellularly with a second polypeptide chain ("chain II") that contains a natural cysteine.
[0341] The second polypeptide chain ("polypeptide chain (II)" or "fragment II" or "fragment 2") comprises, from N-terminus to C-terminus, the V corresponding to the amino acid sequence of SEQ ID NO:41. H (CD123 binding) domain, naturally occurring C from human IgG1 H 1 domain, an unmodified human IgG1 hinge region ("EPKSCDKTHTCPPCP"), and C H 2-C H The Fc region of human IgG1 or a variant thereof includes C3 domains, H The last residues of the 3 domains are removed to create a small four amino acid "STGS" linker, V corresponding to the amino acid sequence of SEQ ID NO:45. H (NKp46-binding) domain, C of the first polypeptide chain H A second naturally occurring C domain identical to H 1 domain and the C-terminal hinge sequence from human IgG1.
[0342] The third polypeptide chain ("polypeptide chain (III)" or "fragment III" or "fragment 3") has a V corresponding to the amino acid sequence of SEQ ID NO:53. L (NKp46 binding) domain, and a cysteine-terminated C K Includes the domain.
[0343] C of the Fc portion of the NKp46-CD123_F25 binding protein of the present disclosure H The 2 domain is glycosylated at position N297 to ensure binding to CD16 (FcγR).
[0344] Overall, the NKp46-CD123_F25 binding protein contains four predicted interchain disulfide bridges: (i) the C-terminal C of the first polypeptide chain K one disulfide bridge linking the cysteine to the first hinge cysteine of the second polypeptide chain; (ii) two disulfide bridges formed by two cysteines in the hinge regions of the first and second polypeptide chains; (iii) replacing the last C-terminal cysteine of the second polypeptide chain with the C-terminal C H One disulfide bridge links one domain Includes.
[0345] The results relating to binding, in vitro activity, ex vivo activity, and in vivo activity, and safety profile set forth in Sections B3-B11 were obtained with the NKp46-CD123_F25 binding protein of the disclosure comprising polypeptides (I), (II), and (III); polypeptide (I) consists of the amino acid sequence of SEQ ID NO:64, polypeptide (II) consists of the amino acid sequence of SEQ ID NO:65, and polypeptide (III) consists of the amino acid sequence of SEQ ID NO:66.
[0346] B.3. Characterization of NKp46-CD123_F25 binding protein constructs binding to human Fc-γ receptors by SPR The NKp46-CD123_F25 binding protein (NKp46-CD123_F25) was tested by SPR to confirm its affinity towards a set of human Fcγ receptors, including CD64 and two variants of the CD16a receptor.
[0347] [Table 3]
[0348] Human CD16a-V receptor or CD16a V refers to a polypeptide construct that comprises a fragment of the CD16 human receptor that binds to the Fc region of a native antibody, mediates antibody-dependent cellular cytotoxicity, and has a valine (V) at position 158, which is also reported in the literature as the allotype CD16a V158.
[0349] Human CD16a-F receptor or CD16a F refers to a polypeptide construct that comprises a fragment of the CD16 human receptor that binds to the Fc region of a native antibody, mediates antibody-dependent cellular cytotoxicity, and has a phenylalanine (F) at position 158, which is also reported in the literature as the allotype CD16a F158.
[0350] The conclusion of this experiment is that the constant region that constitutes NKp46-CD123_F25 retains affinity towards multiple human Fc-gamma receptors, including human CD16 and human CD64.
[0351] B.4. Characterization of the NKp46-CD123_F25 binding protein bound to NKp46 and CD123 by SPR The same experiments were performed with human and monkey versions of NKp46, and the results are summarized in the following two tables (Tables 1 and 2).
[0352] [Table 4]
[0353] [Table 5]
[0354] The conclusion of this experiment is that NKp46 associated with the present disclosure (NKp46-CD123_F25) - The CD123_F25 binding protein retains affinity for the NKp46 and CD123 targets, this applies to both the human and monkey isoforms.
[0355] B.5. NKp46-CD123_F25 binding protein induces AML cytotoxicity Figure 4 reports the in vitro cytotoxicity against MOLM-13 AML cells (Figure 4A). The same experiment was reproduced against ex vivo patient blast samples as target cells (Figure 4B). Cytotoxicity was evaluated as a function of the NKp46-CD123_F25 binding protein (NKp46-CD123_F25) concentration tested in the experiment.
[0356] Overall, the experiments show that NKp46-CD123_F25 is responsible for dose-dependent cytotoxicity in both in vitro and ex vivo test samples. For similar concentrations, the observed cytotoxicity is also higher than that observed with an ADCC-enhancing anti-CD123 antibody (Reference-1) that has no specificity for NKp46. Conversely, a negative control variant of format F25 (NKp46-IC_F25), which only binds NKp46, shows little cytotoxicity under the test conditions. Therefore, the experiments support the synergistic effect of dual binding towards both CD123 and NKp46 in the Fc-competent construct (F25), leading to cytotoxicity against CD123-positive tumor cells.
[0357] Figure 5 shows the EC 50 We provide data based on the enhanced in vitro cytotoxicity (EC 50A decrease in cytotoxicity (transformation of CD16a into a decrease in CD16b) is observed with the NKp46-CD123_F25 binding protein (NKp46-CD123_F25). In contrast, the F6 control lacking N-glycosylation on residue 297 (NKp46-CD123_F6) results in a decrease in cytotoxicity because it activates NK cells by engaging only NKp46 and not CD16a. Therefore, this second experiment provides evidence of the synergistic effect observed through the binding and activation of NKp46 and CD16a NK cell markers.
[0358] Thus, specific lysis is demonstrated against CD123 positive MOLM-13 AML cells in the presence of human NK cells by NKp46-CD123_F25 and by an ADCC enhancing anti-CD123 antibody with no specificity for NKp46 (Reference-1). 50 Values are established based on the variability of cell lysis across binder concentrations, and the results are presented below.
[0359] [Table 6]
[0360] It is therefore shown that the NKp46-CD123_F25 binding protein (NKp46-CD123_F25) exhibits a cytotoxic activity that is at least equal to or superior to the anti-CD123 ADCC enhancing antibody (Reference-1).
[0361] Reference-1 is a fully humanized monoclonal antibody indicated for the treatment of AML, which binds the interleukin 3 receptor (IL3Rα; also known as CD123) It targets the alpha chain of and is optimized for enhanced activation of antibody-dependent cell-mediated cytotoxicity (ADCC) via natural killer cells.
[0362] B.6. CD64 expression on AML does not affect NKCE cytotoxic activity but negatively influences reference-1 activity To further document and compare the activity of NKp46-CD123_F25 and Reference-1 antibodies, cytotoxicity experiments were performed using various AML cell lines expressing CD123 as targets. Surprisingly, despite THP-1 and MOLM-13 cells expressing comparable levels of CD123 on the cell surface, Reference-1 antibody efficiently killed MOLM-13 cells but had no activity against THP-1 cells (Figure 6A top panel). Contrary to Reference-1 antibody, NKp46-CD123_F25 demonstrated comparable killing activity on both AML cell lines (Figure 6A top panel). Figure 6A bottom panel shows that MOLM-13 and THP-1 cells differ in the expression of CD32a / b and CD64 FcγR on the cell surface as analyzed by flow cytometry. MOLM-13 cells have significantly lower levels of CD64 and also lower levels of CD32a / b than THP-1 cells (Figure 6A, bottom panel). CD64 (FcγRI) is a high affinity receptor for human IgG expressed on healthy monocytes and macrophages and was found to be expressed on AML blasts in approximately one-third of patients with presumed CD64-positive acute myeloid leukemia. To investigate the role of CD64 expression on cytotoxicity for NK cell engagers (NKCEs) in comparison to the humanized monoclonal antibody Reference-1, expression of CD32a / b and CD64 was selectively knocked down in THP-1 cells.
[0363] Killing experiments performed on THP-1 subclones expressing CD32a / b but not CD64 or CD64 but not CD32a / b (Figure 6B) demonstrated that CD64 expression on THP-1 was responsible for the inhibition of Ref-1 ADCC activity, since killing of this antibody was only restored in subclones inactivated for CD64 expression. Thus, these results indicate that cis capture of antibody Fc by FcγR, CD64, on the surface of AML cells interferes with ADCC, possibly by competing with binding of CD16a to NK cells.
[0364] Interestingly, compared to Reference-1, NKp46-CD123_F25 demonstrated consistent killing activity against all AML cell lines and all THP-1 subclones, whatever the CD64 expression status, highlighting that the NKp46-CD123_F25 binding protein associated with the present disclosure is more effective at inducing NK cell-mediated cytotoxicity of AML blasts.
[0365] Figures 14A-B confirm that reference-1 activity is negatively affected by expression of CD64 on AML cells.
[0366] Figure 14A reports NKp46-CD123_F25 and Reference-1 mediated cytotoxicity of primary malignant AML blasts from four representative patients (AML#1, #2, #5, and #6; N=8) assessed ex vivo using healthy donor NK cells as effectors. As observed with MOLM-13 and THP-1 cell lines, Reference-1 antibody mediated killing of CD64 negative patient samples (AML#1 and #2; Figure 14A) but was hardly active against blasts from CD64 positive AML patient samples (AML#5 and #6; Figure 14A). Thus, AML#5-AML#6 (Reference 1 non-responders) have higher levels of staining for CD32 and CD64 than AML#1 and AML#2 (Reference 1 responders) (Figure 14B right panel compares the peak shifts of CD64 and CD32 from controls in both groups). (Compared).
[0367] In contrast, trifunctional NKp46-NKCE targeting CD123 had a strong antitumor effect on both CD64-positive and CD64-negative AML patient samples (Figure 14). Figures 6 and 14 demonstrate that CD123-NKp46_F25 was equally potent against parental THP-1 cell line, THP-1 subclones, and MOLM-13 cells, regardless of FcγR expression status, and more specifically, CD64 expression on the target cells. Furthermore, trifunctional NKCE molecules also exhibited killing activity against all primary malignant AML cells, promoting significant antitumor activity in CD64-positive AML patient samples (AML#5 and 6) where reference 1 was completely inactive (Figure 14A).
[0368] For experiments with MOLM-13 cells, the trifunctional molecule (CD123-NKp46_F25) was more potent than bispecific reagents that separately activate NKp46 (CD123-NKp46_F6) or CD16a (CD123-IC_F25) (Figure 15A). This was due to the potent killing activity (geometric mean EC 504.2 [95% CI: 2.7, 6.3] pM, mean observed maximum specific lysis 71 ± 5%), demonstrating good consistency between healthy NK cell donors (Figure 15B).
[0369] B.7. NK Cell Activation in Autologous Primary AML Samples by NK Cell Engagers The properties of the NKp46-CD123_F25 binding protein of the present disclosure (NKp46-CD123_F25) in inducing NK degranulation against primary CD64(+) or CD64(-) AML blasts were established in FIG. 7 by measuring the percentage of CD107 positive NK cells.
[0370] Overall, this experiment provides evidence that the NKp46-CD123_F25 binding protein of the present disclosure can activate NK cells in primary samples from AML patients, e.g., in an autologous assay with primary blast and NK cells from the same patient.
[0371] These results were further summarized by a dedicated autologous NK cell activation assay with two additional AML patient samples without (sample 10) and with (samples 8 and 9) CD64 expression (Figure 16A). Again, NKp46-CD123-NKCE mediated autologous activation of NK cells (see shift in CD107 staining) against the patient's own malignant cells, regardless of CD64 expression status in the blasts, whereas reference 1 was only active against the CD64 negative sample (sample 10) (Figure 16B).
[0372] Thus, this experiment supports the ability of the disclosed NKp46-CD123_F25 binding protein to activate NK cells ex vivo in the context of both CD64(+) and CD64(-) AML cells.
[0373] Moreover, in this autologous assay, the NKp46-CD123_F25 binding protein of the present disclosure is able to engage NK cells in the presence of CD64(+) cells at concentrations much lower than those observed in the presence of Reference 1.
[0374] In addition, the average EC 50 also quantified NKp46-CD123_F25 and reference 1 in a blast killing assay using six NK healthy donors against four AML samples (two CD64(+), and two CD64(-)) and the results are reproduced here below.
[0375] [Table 7]
[0376] Overall, these experiments again demonstrate that the blast killing activity of the NKp46-CD123_F25 binding protein associated with the present disclosure is superior to the Reference 1 antibody, even for CD64(-) AML samples, with Reference 1 being inactive against CD64(+) AML blasts.
[0377] B.8. NKp46-CD123 NK cell engagers induce antitumor activity against injected MOLM-13 human AML in a SCID mouse model Figure 8 reports dose-dependent antitumor activity by muNKp46-huCD123_F25 binding protein (muNKp46-huCD123_F25) inducing 50% mouse survival at 0.5 mg / kg 70 days after tumor implantation using a SCID mouse model. More specifically, the treated control group showed an MST of 27.5 days and 5% long-term survivors.
[0378] The X-axis indicates the number of days after tumor implantation, consisting of intravenous injection of human MOLM-13, including a single compound administration by intraperitoneal (ip) route on day 1. The Y-axis indicates the percentage of survival based on 10 mice for the treatment group and 20 mice for the control group. *** indicates p-value <0.001 versus the control group.
[0379] The group treated with muNKp46-huCD123_F25 at 0.5 mg / kg showed a MST of 66 days, a 140% increase in lifespan, and 50% long-term survivors, with muNKp46-huCD123_F25 at 0.5 mg / kg being statistically significantly more active than the control group (p less than 0.0001). For the 0.25 mg / kg dose, the group showed a MST of 36 days, a 31% increase in lifespan, and 10% long-term survivors, with muNKp46-huCD123_F25 induction at 0.25 mg / kg not statistically different from the control group. For the 0.05 mg / kg dose, the group showed a MST of 33 days, a 20% increase in lifespan, and no long-term survivors, with muNKp46-huCD123_F25 at 0.05 mg / kg not statistically different from the control group.
[0380] The NKp46-CD123_F25 binding protein associated with the present disclosure demonstrated robust dose-dependent anti-tumor in vitro activity at 0.5 mg / kg. The results are summarized in Table 3 below:
[0381] [Table 8]
[0382] Therefore, this confirms that NK cell engagers are effective for the in vivo treatment of proliferative disorders in animal models.
[0383] In addition, to further evaluate efficacy, the experiment described above and reported in Figure 8 was repeated, but with an additional dose group including muNKp46-huCD123_F25 NKCE or control at 5 mg / kg, as well as reference 1. The results are shown in Figure 18.
[0384] Consistent with the study in Figure 8, in the study in Figure 18, the surrogate muNKp46-huCD123_F25 induced statistically significant activity in the human MOLM-13 sporadic model at doses of 5, 0.5, 0.25, and 0.05 mg / kg. ILS compared to control was 100% and 60% long-term survivors for the 5, 0.5, and 0.25 mg / kg doses, and ILS was 30% and 10% long-term survivors for the 0.05 mg / kg dose.
[0385] Reference 1 induced statistically significant activity at a dose of 5 mg / kg in the human MOLM-13 sporadic model. ILS was 70% and 40% long-term survivors. Reference 1 was not active at doses of 0.5, 0.25, and 0.05 mg / kg.
[0386] muNKp46-huCD123_F25 was statistically significantly more active than reference 1 at doses of 0.5 and 0.25 mg / kg.
[0387] The tabular results for Figure 18 are summarized as follows:
[0388] [Table 9]
[0389] In conclusion, the muNKp46-huCD123_F25 surrogate showed dose-dependent activity, with robust activity from 0.25 mg / kg. These data suggest that NKp46 / FcγR may be a potent surrogate for improved in vivo efficacy compared to anti-CD123 antibodies (Reference 1). demonstrated the benefit of co-engaged NK cells in causing
[0390] B.9. NKp46-CD123 NK cell engagers induce antitumor activity in vivo in non-human primates The absence of in vitro proinflammatory cytokine release of NKCE in human PBMCs was further confirmed in two dedicated pharmacokinetic, pharmacodynamic, and safety studies performed in NHPs. Cynomolgus monkeys were selected as a relevant species for preclinical pharmacokinetic, pharmacodynamic, and toxicological studies based on (1) tissue distribution of NKp46 and CD123, which is similar to that in humans (Walzer et al. PNAS; 2007; 104: 3384-3398 and ChiChili et al. Sci Transl Med; 2015; 7: 289), and (2) because the antibodies and Fc fragments that constitute the CD123-NKCE molecule bind to cynomolgus antigens and FcγRs with affinities similar to those for the human molecules shown in Table 4 below. Specifically, CD16a (FcγRIIIA) binds monovalent K for its 158V and 158F isoforms. D were 0.46±0.01 μM and 2.61±0.09 μM, respectively, and the anti-NKp46 and anti-CD123 antibody moieties bound to human NKp46 and human CD123 and exhibited monovalent K D are 16.3±2.9 nM and 0.40±0.04 nM, respectively.
[0391] [Table 10]
[0392] FIG. 9 further shows complete and sustained CD123 positive basophil depletion following infusion of NKp46-CD123_F25 binding protein (NKp46-CD123_F25) associated with the present disclosure at 3 μg / kg for up to 20 days and at 0.5 μg / kg for up to 5 hours in non-human primates.
[0393] Thus, the results demonstrate that previously obtained in vitro, ex vivo, and in vivo results, including those observed in the SCID mouse model, can be extrapolated to non-human primates for NK cell engagers.
[0394] Overall, CD123 positive immune cell depletion is a hallmark of the in vivo activity of the NKp46-CD123_F25 binding protein in non-human primates. Rapid and sustained depletion of CD123 positive basophils was observed, occurring approximately 1.5 hours after the start of infusion and sustained up to day 7, with cell numbers returning to baseline on day 28.
[0395] B.10. Comparison of Fc-competent formats, F5 vs. F25, respectively, in cytotoxicity assays Figures 10A and 10B show that NKp46-CD123_F25 and NKp46-CD123_F5 binding proteins exhibit the same cytotoxic activity against both MOLM-13 and THP-1 AML cell lines by engaging NK cells from a healthy donor (D648).
[0396] The main difference between MOLM-13 and THP-1 cells concerns the expression level of the CD64 marker. MOLM-13 cells do not express CD64(-), whereas THP-1 cells express high levels of CD64(+). Both cells express CD32a.
[0397] Thus, this example reports the variation in specific lysis for three different binding proteins: (i) NKp46-CD123_F5 binding protein in F5 format (NKp46-CD123_F5), (ii) NKp46-CD123_F25 binding protein in F25 format (NKp46-CD123_F25), and (iii) a negative isotype control variant of format F5 that binds only CD123 (CD123IC_F5).
[0398] Overall, the results demonstrate that cytotoxic activity is maintained by two Fc-competent NKp46-CD123 binding proteins in the F5 and F25 formats, whereas the negative controls do not result in detectable cytotoxic activity.
[0399] B.11. NKp46-CD123 NKCE-Induced CD123 Positive Basophil Depletion Is Associated with Lower Cytokine Release When Compared to T Cell Engagement Tools Potent cytotoxicity may be associated with toxicity in patients. To investigate cytokine release from human PBMC induced in vitro by CD123-NKCE, as a predictive assay for potential cytokine release syndrome (CRS) in patients, the following experiment was performed.
[0400] Human PBMCs (N=10 samples) were incubated in a concentration gradient (10 ng / mL) in the presence of NKp46-CD123_F25 (CD123-NKCE; 0.1, 1, or 10 μg / mL doses; 0.68–68 nM), a negative isotype control variant of format F25 that binds only NKp46 (NKp46-IC_F25; 0.1, 1, or 10 μg / mL doses; 0.68–68 nM), or an anti-CD123 T cell engager antibody tool with specificity for CD3 but not NKp46 (CD123-TCE, reference 1; 0.1 μg / mL; 1.6 nM). -3 ~10 1 The mice were cultured for 20 h at 100 μg / mL.
[0401] Among human PBMCs, CD123 is expressed by circulating basophils and plasmacytoid dendritic cells (pDCs). ) are constitutively expressed on a subset of basophils, whereas pDCs express CD123 + Because of its high expression, the percentage of basophil depletion was monitored for each of the treatment groups described above. Figure 11 shows that treatment of human PBMCs with CD123-NKCE reduced the expression of CD123 +The results showed that it promoted a dose-dependent partial depletion of basophils, with a median maximum depletion of 37% [31;50] and a geometric mean EC 50 The value was 38 pM (95% CI [12.9; 401]). In contrast, basophil depletion did not occur to any significant extent in the presence of the F25 binding molecule (NKp46-IC_F25) lacking the CD123 binding site. Supernatants were collected from the human PBMC treatment groups described above to quantify the amount of cytokine release. Figure 12 demonstrates that the in vitro IL-6, and IL-1β proinflammatory cytokine, as well as TNF-α and IFN-γ cytokine release associated with administration of the NKp46-CD123_F25 binding protein (NKp46-CD123_F25) associated with the present disclosure, was much lower than the corresponding IL-6 release associated with administration of a 100-fold lower dose (0.1 μg / ml) of the positive control, Reference 1, known to induce cytokine release syndrome (CRS).
[0402] CD123-NKCE induced much lower levels of cytokine release than CD123-TCE, even at a 42-fold higher concentration.
[0403] Figures 11 and 12 show that treatment of PBMCs with CD123-NKCE inhibits the expression of CD123 + We demonstrate that treatment with CD3-CD123 promoted basophil depletion but induced much lower levels of IL-6, IL-1β, TNF-α, and IFN-γ release than treatment with the CD3-CD123 antibody molecule.
[0404] In conclusion, the NKp46-CD123_F25 binding protein (NKp46-CD123_F25) associated with the present disclosure binds to primary NK cells and binds CD123, which is associated with minimal cytokine release. + It has demonstrated the ability to target and kill primary normal mononuclear blood cells and may have a better benefit / risk profile than TCE for the treatment of AML.
[0405] Regardless of the dose level, and up to a high dose of 3 mg / kg, Figures 13A-13F show that after the start of injections of the NKp46-CD123_F25 binding protein (NKp46-CD123_F25) associated with the present disclosure, very low cytokine release (IL6 and IL10) was observed in all treated animals (male cynomolgus monkeys) without any relevant clinical signs. Neither IL-2 nor IFNγ cytokine release was detected. More specifically, a transient IL6 and IL10 peak is detected after a single intravenous injection of the F25 construct at 3 mg / kg in non-human primates. This transient peak is present for 1-5 hours and returns to baseline within 1 or 2 days.
[0406] Furthermore, very low levels of IL-6 and IL-10 cytokine release were not associated with clinical signs up to doses of 3 mg / kg, indicating that such NK cell engagers have a good safety profile in non-human primates.
[0407] B.12. NKp46-CD123 NK cell engager promotes NK cell activation in vitro that is comparable to cytokine / chemokine production Flow cytometry analysis corresponding to FIG. 17 demonstrates that the NKp46-CD123_F25 binding protein promoted NK cell activation only in the presence of CD123-expressing target cells.
[0408] Primary donor NK cells (N=3) incubated in the presence of NKp46-CD123_F25 upregulated NK cell activation markers, CD107 and CD69, as well as cytokines, TNF-α, IFN-γ, and chemokines, in the presence of MOLM-13 target cells. In turn, higher expression levels of MIP-1β were demonstrated in a dose-dependent manner (FIG. 17, comparing NK alone vs. NK+MOLM-13 conditions).
[0409] Overall, this experiment provides evidence that the disclosed NKp46-CD123_F25 binding protein activates and proportionately promotes cytokine / chemokine production in primary NK cells towards CD123+ AML cells without off-target activation of NK cells.
[0410] B.13. NK cells are an effector lymphocyte subset responsible for the antitumor activity of NKp46-CD123_F25 To test whether the efficacy of NKp46-CD123_F25 was dependent on NK cell antitumor activity against MOLM-13 human AML injected in a SCID mouse model, mice underwent an NK cell depletion regimen during the experimental set-up outlined in B.8.
[0411] The results are shown in Figures 18 and 19, and the corresponding tabulated results are shown in Table 5 below.
[0412] [Table 11]
[0413] The treated control group showed a median survival time (MST) of 29 days and no long-term survivors.
[0414] The muNKp46-IC isotype control showed no activity, an ILS of 7%, and no long-term survivors. No effect of NK depletion was observed in the group treated with the muNKp46-IC isotype control, with no extension of life span and 10% long-term survivors. The IC-huCD123 isotype control was statistically significantly active, with an ILS of 28% and 20% long-term survivors. A statistically significant effect of depletion was observed in the group treated with the IC-huCD123 isotype control, with no extension of life span and no long-term survivors.
[0415] muNKp46-huCD123_F25 was statistically significantly active with 84% ILS and 40% long-term survivors. A statistically significant effect of depletion was observed in the group treated with muNKp46-huCD123_F25 with 14% ILS and no long-term survivors.
[0416] In conclusion, NK depletion did not affect the antitumor activity of muNKp46-huCD123_F25. This has an impact on NK cell proliferation and confirms NK involvement as effector cells in muNKp46-huCD123_F25 NKCE in vivo efficacy.
[0417] B.14.NKp46-CD123 NK cell engagers are safe and effective in NHPs To confirm the safety profile of the Nkp46-CD123 cell engager in the NHP studies performed in Figures 9 and 13, the pharmacokinetics and pharmacodynamics of CD123-NKCE administered by single iv injection at high (3 mg / kg) or low (3 μg / kg and 0.5 μg / kg) doses were examined in male cynomolgus monkeys (two animals at 3 mg / kg and 3 μg / kg doses, respectively, and one animal at 0.5 μg / kg dose).
[0418] Treatment with CD123-NKCE significantly increased CD123 in the blood of all monkeys. + Sustained and complete cell depletion was observed for more than 10 days at 3 mg / kg and 3 μg / kg doses (CD123 in Figures 20A and 20B). + Basophils and total CD123 + Cells) and released very low amounts (<50 pg / mL) of the proinflammatory cytokines IL-6 and IL-10 without any associated clinical signs (FIG. 20C).
[0419] CD123 +A transient and partial depletion of cells was observed in monkeys treated with the lowest dose (0.5 μg / kg, data not shown), with 3 μg / kg considered to be the lowest effective dose in this species. PK profiles of two monkeys treated with the highest dose (3 mg / kg) were compared, occurring 12-14 days after treatment (Figure 20D), and showing no significant depletion of CD123 cells from the blood at later time points. + Cell recovery was indicated by associated anti-drug antibody (ADA) responses (data not shown).
[0420] The preclinical safety profile of CD123-NKCE was further investigated through an exploratory repeated dose toxicity study in which four monkeys (2 / sex / dose) were treated weekly for four weeks at doses of 3 mg / kg / dose or 0.1 mg / kg / dose administered by 1 hour intravenous infusion (Figure 21). In all monkeys (except one monkey, monkey M5, male No. 5; Figure 21), exposure to CD123-NKCE continued for at least two weeks at both doses tested, and the presence of anti-drug antibodies (ADA) was detected from the third dose (day 15) (data not shown) (Table 6).
[0421] Table 6 below shows individual CD123-NKCE plasma concentration values following repeated weekly 1 hour intravenous injections at 0.1 and 3 mg / kg / dose for 4 weeks (days 1, 8, 15, and 22) to cynomolgus monkeys.
[0422] [Table 12]
[0423] A minimal, transient increase in IL-6 concentrations was observed after each weekly administration for both doses (maximum levels in Table 7 of 25 and 160 pg / mL for the 0.1 and 3 mg / kg / dose doses, respectively). Table 7 shows individual IL-6 plasma concentration values following repeated weekly 1-hour intravenous injections of CD123-NKCE at 0.1 and 3 mg / kg / dose for 4 weeks (days 1, 8, 15, and 22) to cynomolgus monkeys.
[0424] [Table 13]
[0425] Notably, in monkey M5 treated with the high dose (3 mg / kg / dose), which did not exhibit an ADA response and was exposed to CD123-NKCE throughout the study, no significant IL-6 release was observed (Figures 21A and 21B), whereas CD123 + The robust PD effect of cell depletion was observed in both the blood and bone marrow of these monkeys (Table 8 and FIG. 21C).
[0426] [Table 14]
[0427] In all other animals, sustained depletion of CD123 expressing cells was observed in the blood 1.5 hours after the first dose and up to 24 hours after the third dose, with rebound (above baseline) observed on days 22 to 29 (Table 8). Furthermore, all treated monkeys showed complete depletion of CD123 positive cells from the bone marrow on day 9 (24 hours after the second dose) for both doses (Table 8; values below the limit of detection on day 9 for most animals), with recovery of the CD123 positive population on day 29 being 1 week after the last dose.
[0428] Whatever the dose, no clinical signs were observed, no changes in weight or temperature were observed, and no effects on ECG were observed potentially due to treatment with CD123-NKCE. No compound-related adverse effects on hematology, coagulation, clinical chemistry, or urinary parameters were observed. None were observed. Microscopic examination of sampled tissues revealed no evidence of organ targeting. All observations noted were considered to be within the background range of variation and unrelated to administration of CD123-NKCE.
[0429] Thus, overall, these results constitute proof-of-principle for the in vivo efficacy of CD123-NKCE without any signs of toxicity.
[0430] B.15. Killing of NKp46-CD123 NK Cell-Engaged Tumor Cells by Healthy Donor NK Cells NKp46-CD123_F25 and its isotype control IC-CD123_F6 were tested in an in vitro tumor cell killing assay by NK cells from two different healthy donors (HD).
[0431] NK cell purification and AML cell lines Human peripheral blood mononuclear cells (PBMCs) from anonymous healthy donors (HDs) were isolated by Ficoll density gradient centrifugation. NK cells were purified from the PBMCs by MACSxpress® Whole Blood NK Cell Isolation Kit (Miltenyi Biotec). NK cells were allowed to rest overnight in RPMI1640 (Gibco) supplemented with 10% SVF (BioWest) and 1% L-glutamine (Gibco).
[0432] THP1 cells (CD123+.CD64+) were selected for this study based on their expression of CD123. Prior to the experiment, THP1 cells were infected with Incucyte® Nuclight Green Lentivirus (Sartorius) to express green fluorescent protein (GFP).
[0433] NK functional assay in the presence of NKp46-CD123_F25 over time NK cells and THP1 GFP target cells were incubated at 37°C at 0.1, 1, 10, and 100 ng / mL in the presence of NKp46-CD123_F25 or its isotype control IC-CD123_F6. The effector:target cell ratio was 1:1. The medium used was the same as that for NK cell cultures. Target cells were monitored by fluorescent imaging over 74 h using an Incucyte Live Cell Analysis system (EssenBioscience). The number of live target cells was quantified using Incucyte S3 software (2020B version).
[0434] conclusion As shown in FIG. 22, NKp46-CD123_F25 at various concentrations (1, 10, and 100 ng / mL) enhances the cytotoxic activity of HD NK cells against THP1 GFP AML cells over time at an effector:target cell ratio of 1:1.
Claims
1. A binding protein comprising first and second antigen binding domains (ABDs) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the ABDs each comprise an immunoglobulin heavy chain variable domain (VH) and an immunoglobulin light chain variable domain (VL), and the VH and VL each comprise three complementarity determining regions (CDR-1 through CDR-3); (i) the first ABD specifically binds to human CD123, and - a VH1 comprising CDRs H1, H2 and H3 corresponding to the amino acid sequences of SEQ ID NOs: 1 to 3, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 4 to 6, respectively, and - VL1 comprising CDRs L1, L2 and L3 corresponding to the amino acid sequences of SEQ ID NOs: 7 to 9, respectively, or corresponding to the amino acid sequences of SEQ ID NOs: 10 to 12, respectively. Including; (ii) the second ABD specifically binds to human NKp46, and: to the amino acid sequences of SEQ ID NOs: 13 to 15, respectively; The amino acid sequences of SEQ ID NOs: 16 to 18, respectively; The amino acid sequences of SEQ ID NOs: 19 to 21, respectively; the amino acid sequences of SEQ ID NOs: 22-24, respectively; or to the amino acid sequences of SEQ ID NOs: 16, 25, and 26, respectively; V containing the corresponding CDR-H1, 2, and 3 H2 , and - to the amino acid sequences of SEQ ID NOs: 27 to 29, respectively; The amino acid sequences of SEQ ID NOs: 30 to 32, respectively; The amino acid sequences of SEQ ID NOs: 33 to 35, respectively; to the amino acid sequences of SEQ ID NOs: 36-38, respectively; or to the amino acid sequences of SEQ ID NOs: 39, 31, and 40, respectively; V containing the corresponding CDR-L1, 2, and 3 L2 Including, All or part of an immunoglobulin Fc region or a variant thereof binds to a human Fc-γ receptor; Binding proteins.
2. It comprises three polypeptide chains (I), (II), and (III) that form two ABDs defined below: V 1A -C 1A - Hinge 1 -(C H 2-C H 3) A (I) V 1B -C 1B - Hinge 2 -(C H 2-C H 3) B -L 1 -V 2A -C 2A - Hinge 3 (II) . 2B 2B (_=) During the ceremony: V 1A and V 1B is the bond pair V 1 (V H1 / V L1 ) to form; V 2A and V 2B is the bond pair V 2 (V H2 / V L2 ) to form; C 1A and C 1B is against C 1 (C H 1 / C L ) and C 2A and C 2B is against C 2 (CH 1 / C L ) and C H 1 is immunoglobulin heavy chain constant domain 1, C L is an immunoglobulin light chain constant domain; hinge 1 , hinge 2 , and hinge 3 are the same or different and correspond to all or part of an immunoglobulin hinge region; (C H 2-C H 3) A and (C H 2-C H 3) B may be the same or different and may be an immunoglobulin heavy chain constant domain 2 (C H 2) and immunoglobulin heavy chain constant domain 3 (C H 3) includes; L 1 is an amino acid linker, The binding protein of claim 1.
3. C 1B is an immunoglobulin heavy chain constant domain 1 (C H 1) and C 2A is an immunoglobulin heavy chain constant domain 1 (C H 1) and C L is an immunoglobulin kappa light chain constant domain (C κ ) is equivalent to; (C H 2-C H 3) A corresponds to the amino acid sequence of SEQ ID NO: 69; (C H 2-C H 3) B corresponds to the amino acid sequence of SEQ ID NO: 70; hinge 1 corresponds to the amino acid sequence of SEQ ID NO: 74; hinge 2 corresponds to the amino acid sequence of SEQ ID NO: 75; hinge 3 corresponds to the amino acid sequence of SEQ ID NO: 77; L 1 corresponds to the amino acid sequence of SEQ ID NO: 76, The binding protein of claim 2.
4. 4. The binding protein of any one of claims 1 to 3, wherein residue N297 of the Fc region or variant thereof according to EU numbering comprises an N-linked glycosylation, and / or all or a portion of the Fc region or variant thereof binds to a human CD16A (FcγRIII) polypeptide.
5. 5. The binding protein according to any one of claims 2 to 4, comprising at least two polypeptide chains linked by at least one disulfide bridge, optionally wherein polypeptide chains (I) and (II) are selected from the group consisting of C 1A and hinge 2 and / or polypeptide chains (II) and (III) are linked by at least one disulfide bridge between them. 3 and C 2B and wherein the binding protein is linked by at least one disulfide bridge between the
6. V 1A is V L1 and V 1B is V H1 and V 2A is V H2 and V 2B is V L2 The binding protein of any one of claims 2 to 5,
7. (a) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 7; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 8; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 9; H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 13; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 14; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 15; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO:27; a CDR-L2 comprising the amino acid sequence of SEQ ID NO:28; a CDR-L3 comprising the amino acid sequence of SEQ ID NO:29; (b) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 7; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 8; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 9; H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 17; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 18; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 30; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 31; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 32; (c) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 7; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 8; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 9; H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 19; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 20; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 21; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 33; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 34; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 35; (d) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 7; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 8; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 9; H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 36; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 37; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 38; (e) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3; L1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 7; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 8; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 9; H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 25; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 26; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 39; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 31; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 40; (f) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 13; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 14; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 15; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO:27; a CDR-L2 comprising the amino acid sequence of SEQ ID NO:28; a CDR-L3 comprising the amino acid sequence of SEQ ID NO:29; (g) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 17; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 18; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 30; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 31; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 32; (h) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 19; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 20; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 21; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 33; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 34; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 35; (i) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; L1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 22; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 23; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 24; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 36; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 37; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 38; or (j) V H1 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 4; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 5; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 6; VL1 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 10; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 11; a CDR-L3 comprising the amino acid sequence of SEQ ID NO: 12; V H2 comprises a CDR-H1 comprising the amino acid sequence of SEQ ID NO: 16; a CDR-H2 comprising the amino acid sequence of SEQ ID NO: 25; a CDR-H3 comprising the amino acid sequence of SEQ ID NO: 26; L2 comprises a CDR-L1 comprising the amino acid sequence of SEQ ID NO: 39; a CDR-L2 comprising the amino acid sequence of SEQ ID NO: 31; and a CDR-L3 comprising the amino acid sequence of SEQ ID NO:
40. The binding protein of any one of claims 1 to 6.
8. (a) V H1 and V L1 correspond to the amino acid sequences of SEQ ID NOs: 41 and 43, respectively, or correspond to the amino acid sequences of SEQ ID NOs: 42 and 44, respectively; and / or (b) V H2 and V L2 teeth, to the amino acid sequences of SEQ ID NOs: 45 and 53, respectively; to the amino acid sequences of SEQ ID NOs: 46 and 54, respectively; to the amino acid sequences of SEQ ID NOs: 47 and 55, respectively; to the amino acid sequences of SEQ ID NOs: 48 and 56, respectively; to the amino acid sequences of SEQ ID NOs: 49 and 57, respectively; to the amino acid sequences of SEQ ID NOs: 50 and 58, respectively; to the amino acid sequences of SEQ ID NOs: 51 and 59, respectively; or The amino acid sequences of SEQ ID NOs: 52 and 60, respectively: Equivalent to The binding protein of any one of claims 1 to 7.
9. (a) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 45; V L2 comprises the amino acid sequence of SEQ ID NO: 53; (b) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 46; V L2 comprises the amino acid sequence of SEQ ID NO: 54; (c) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 47; V L2 comprises the amino acid sequence of SEQ ID NO: 55; (d) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 48; V L2 comprises the amino acid sequence of SEQ ID NO: 56; (e) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 49; V L2 comprises the amino acid sequence of SEQ ID NO: 57; (f) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 50; V L2 comprises the amino acid sequence of SEQ ID NO: 58; (g) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 51; V L2 comprises the amino acid sequence of SEQ ID NO:59; (h) V H1 comprises the amino acid sequence of SEQ ID NO: 41; V L1 comprises the amino acid sequence of SEQ ID NO: 43; V H2 comprises the amino acid sequence of SEQ ID NO: 52; V L2 comprises the amino acid sequence of SEQ ID NO: 60; (i) V H1 comprises the amino acid sequence of SEQ ID NO: 42; V L1 comprises the amino acid sequence of SEQ ID NO: 44; V H2 comprises the amino acid sequence of SEQ ID NO: 45; V L2 comprises the amino acid sequence of SEQ ID NO: 53; (j) V H1 comprises the amino acid sequence of SEQ ID NO: 42; V L1 comprises the amino acid sequence of SEQ ID NO: 44; V H2 comprises the amino acid sequence of SEQ ID NO: 46; V L2 comprises the amino acid sequence of SEQ ID NO: 54; (k) V H1 comprises the amino acid sequence of SEQ ID NO: 42; V L1 comprises the amino acid sequence of SEQ ID NO: 44; V H2 comprises the amino acid sequence of SEQ ID NO: 47; V L2 comprises the amino acid sequence of SEQ ID NO: 55; (l) V H1 comprises the amino acid sequence of SEQ ID NO: 42; V L1 comprises the amino acid sequence of SEQ ID NO: 44; V H2 comprises the amino acid sequence of SEQ ID NO: 48; V L2 comprises the amino acid sequence of SEQ ID NO: 56; (m) V H1 comprises the amino acid sequence of SEQ ID NO: 42; V L1 comprises the amino acid sequence of SEQ ID NO: 44; V H2 comprises the amino acid sequence of SEQ ID NO: 49; V L2 comprises the amino acid sequence of SEQ ID NO: 57; (n) V H1 comprises the amino acid sequence of SEQ ID NO: 42; V L1 comprises the amino acid sequence of SEQ ID NO: 44; V H2 comprises the amino acid sequence of SEQ ID NO: 50; V L2 comprises the amino acid sequence of SEQ ID NO: 58; (o)V H1 comprises the amino acid sequence of SEQ ID NO: 42; V L1 comprises the amino acid sequence of SEQ ID NO: 44; V H2 comprises the amino acid sequence of SEQ ID NO: 51; V L2 comprises the amino acid sequence of SEQ ID NO:59; (p) V H1 comprises the amino acid sequence of SEQ ID NO: 42; V L1 comprises the amino acid sequence of SEQ ID NO: 44; V H2 comprises the amino acid sequence of SEQ ID NO: 52; V L2 comprises the amino acid sequence of SEQ ID NO: 60; The binding protein of claim 8.
10. - polypeptide (I) comprises the amino acid sequence of SEQ ID NO: 64; - polypeptide (II) comprises the amino acid sequence of SEQ ID NO: 65; and - polypeptide (III) comprises the amino acid sequence of SEQ ID NO: 66; The binding protein of any one of claims 2 to 9.
11. The binding protein of any one of claims 1 to 10 for use as a drug.
12. 12. The binding protein of any one of claims 1 to 11 for use in a method for the treatment or prevention of hematological cancer.
13. 13. The binding protein of any one of claims 1 to 12 for use in a method for the treatment or prevention of myelodysplastic syndromes (MDS) or of lymphoproliferative disorders.
14. 14. The binding protein of any one of claims 1 to 13 for use in a method for the treatment or prevention of acute myeloid leukemia (AML), optionally for the treatment or prevention of CD64-positive and CD64-negative acute myeloid leukemia (AML).
15. A pharmaceutical composition comprising the binding protein of any one of claims 1 to 9 and a pharmaceutically acceptable carrier.
16. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the binding protein of any one of claims 1 to 9.
17. An expression vector comprising the nucleic acid molecule of claim 16.
18. 18. An isolated cell comprising the nucleic acid molecule of claim 16 or the expression vector of claim 17, optionally wherein the host cell is a mammalian cell.
19. A method for producing a binding protein according to any one of claims 1 to 9, comprising: (a) culturing a host cell under conditions suitable for expressing a plurality of recombinant polypeptides, the plurality of recombinant polypeptides comprising: (i) a polypeptide comprising the amino acid sequence of SEQ ID NO:64; (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO:65; and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO:66; (b) optionally recovering the expressed recombinant polypeptide; A method comprising:
20. 1. A binding protein for use in treating or preventing CD64-positive acute myeloid leukemia (AML), the binding protein comprising first and second antigen binding domains (ABDs) and all or a portion of an immunoglobulin Fc region or a variant thereof, wherein the first ABD specifically binds to human CD123, the second ABD specifically binds to human NKp46, and all or a portion of the immunoglobulin Fc region or a variant thereof binds to a human Fc-γ receptor.
21. 20. A binding protein according to any one of claims 1 to 9, obtainable by the method according to claim 19.