Chiral control

Abstract

To provide chirally controlled oligonucleotides which are of high crude purity and of high diastereomeric purity, and chirally controlled oligonucleotide compositions.SOLUTION: Provided is a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides of at least one type, wherein each type is defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone X-moieties.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application Nos. 61 / 671,655, filed July 13, 2012, 61 / 671,656, filed July 13, 2012, 61 / 671,722, filed July 14, 2012, and 61 / 671,724, filed July 14, 2012, the entire contents of each of which are incorporated herein by reference.

[0002] Technical Field Oligonucleotides are useful in therapeutic, diagnostic, research and nanomaterial applications. Background technology The therapeutic use of natural nucleic acids (such as unmodified DNA or RNA) can be limited, for example, due to extracellular and intracellular nucleases and / or their low cell permeability and low cellular distribution.In addition, in vitro studies have found that the properties of antisense oligonucleotides, such as binding affinity, specific binding sequence to complementary RNA (Cosstick and Eckstein, 1985; LaPlanche et al., 1986; Latimer et al., 1989; Hacia et al., 1994; Mesmaeker et al., 1995) and nuclease stability, can be affected by the absolute stereochemical configuration of phosphorus atom (Cook et al., U.S. Patent Publication No. 005599797).Therefore, there is a need for new and improved oligonucleotide compositions. Summary of the Invention

[0003] The present invention encompasses the recognition that there is a need for chiral controlled oligonucleotide compositions and novel methods for their synthesis. The present invention encompasses the identification of the source of certain problems in conventional approaches to chiral oligonucleotide synthesis, including problems that prevent the synthesis of all chiral controlled compositions, particularly compositions containing multiple oligonucleotide types.

[0004] In some embodiments, the present invention provides chiral controlled oligonucleotide compositions.

[0005] In some embodiments, the present invention provides methods for making chiral controlled oligonucleotides and chiral controlled oligonucleotide compositions.

[0006] In some embodiments, the present invention provides methods of using chiral controlled oligonucleotides and chiral controlled oligonucleotide compositions.

[0007] All publications and patents cited in this application are incorporated herein by reference in their entirety.

[0008] definition Aliphatic: As used herein, the terms "aliphatic" or "aliphatic group" refer to a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more units of unsaturation, or a monocyclic or polycyclic hydrocarbon that is fully saturated or contains one or more units of unsaturation, but is not aromatic (also referred to herein as "carbocycle," "alicyclic," or "cycloalkyl"). In some embodiments, an aliphatic group contains 1-50 aliphatic carbon atoms. Unless otherwise specified, an aliphatic group contains 1-10 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-6 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-5 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-4 aliphatic carbon atoms. In still other embodiments, an aliphatic group contains 1-3 aliphatic carbon atoms, and in yet other embodiments, an aliphatic group contains 1-2 aliphatic carbon atoms. In some embodiments, "alicyclic" (or "carbocycle" or "cycloalkyl") refers to a monocyclic or bicyclic C3-C6 ring that is fully saturated or contains one or more unsaturated units, but is not aromatic, with one point of attachment to another molecule. 10refers to a hydrocarbon. In some embodiments, "alicyclic" (or "carbocycle" or "cycloalkyl") refers to a monocyclic C3-C6 hydrocarbon that is fully saturated or contains one or more units of unsaturation, but is not aromatic, with one point of attachment to another molecule. Suitable aliphatic groups include, but are not limited to, straight-chain or branched-chain, substituted or unsubstituted alkyl, alkenyl, alkynyl, and composites thereof, such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0009] Alkylene: The term "alkylene" refers to a divalent alkyl group. An "alkylene chain" is a polymethylene group, i.e., -(CH2) n -, where n is a positive integer, preferably 1 to 6, 1 to 4, 1 to 3, 1 to 2, or 2 to 3. A substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms have been replaced with a substituent. Suitable substituents include those described below for substituted aliphatic groups.

[0010] Alkenylene: The term "alkenylene" refers to a divalent alkenyl group. A substituted alkenylene group is a polymethylene group containing at least one double bond in which one or more hydrogen atoms have been replaced with a substituent. Suitable substituents include those described below for substituted aliphatic groups.

[0011] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human, at any stage of development. In some embodiments, "animal" refers to a non-human animal, at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, the animal may be a transgenic animal, a genetically modified animal, and / or a clone.

[0012] Approximately: As used herein, the word "approximately" or "about" when describing a number is generally intended to include numbers within a range of 5%, 10%, 15%, or 20% in either direction (greater or less) of that number, unless otherwise stated or otherwise apparent from the context (unless such number is less than 0% or more than 100% of its possible values). In some embodiments, the use of the word "about" when describing dosage means ±5 mg / kg / day.

[0013] Aryl: The term "aryl," used alone or as part of a larger moiety as in "aralkyl," "aralkoxy," or "aryloxyalkyl," refers to monocyclic and bicyclic ring structures in which at least one ring of the structure is aromatic and each ring of the structure contains 3 to 7 ring members, with a total of 5 to 14 ring members. The term "aryl" may be used interchangeably with the term "aryl ring." In certain embodiments of the present invention, "aryl" refers to aromatic ring structures, including but not limited to, phenyl, biphenyl, naphthyl, anthracyl, and the like, which may bear one or more substituents. Groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, are also included within the scope of the term "aryl" herein.

[0014] Characteristic portion: As used herein, the phrase "characteristic portion" of a protein or polypeptide includes a stretch of amino acids, or a set of stretches of amino acids, that, taken together, are characteristic of the protein or polypeptide. Each such stretch will generally contain at least two amino acids. Moreover, one of skill in the art will recognize that at least 5, 10, 15, 20, or more amino acids are usually required to be characteristic of a protein. Generally, a characteristic portion shares at least one functional characteristic with the related intact protein, in addition to the specific sequence homology described above.

[0015] Signature Sequence: A "signature sequence" is a sequence that is found in all members of a family of polypeptides or nucleic acids and therefore can be used by those of skill in the art to define the members of that family.

[0016] Characteristic structural element: The term "characteristic structural element" refers to a distinct structural element (e.g., backbone structure, collection of pendant moieties, sequence element, etc.) found in all members of a family of polypeptides, small molecules, or nucleic acids, and thus can be used by those skilled in the art to define the members of that family.

[0017] Equivalent: The term "equivalent" is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit a comparison of the results obtained or the phenomena observed. In some embodiments, equivalent sets of conditions or circumstances are characterized by a plurality of substantially the same characteristics and one or a few altered characteristics. Those skilled in the art will recognize that sets of conditions are equivalent to one another when they are characterized by a sufficient number and type of substantially the same characteristics such that the differences in the results obtained or the phenomena observed under the different sets of conditions or circumstances can justify a reasonable conclusion that the sets of conditions are caused by or exhibit differences in those altered characteristics.

[0018] Dosage regimen: As used herein, a "dosage regimen" or "treatment regimen" refers to a set of unit doses (usually one or more) administered individually to a subject, usually separated by a period of time. In some embodiments, a given therapeutic agent has a required dosing regimen that may include one or more doses. In some embodiments, a dosing regimen includes multiple doses, each separated from the other by a period of equal length; in some embodiments, a dosing regimen includes multiple doses and at least two different periods that separate the separate doses. In some embodiments, all doses within a dosing regimen are the same unit dosage. In some embodiments, different doses within a dosing regimen are different amounts. In some embodiments, a dosing regimen includes a first dose at a first dosage amount, followed by one or more additional doses at a second dosage amount that is different from the first dosage amount. In some embodiments, a dosing regimen includes a first dose at a first dosage amount, followed by one or more additional doses at a second dosage amount that is the same as the first dosage amount.

[0019] Equivalent Agents: Upon reading this disclosure, those skilled in the art will recognize that the scope of agents useful in the context of the present invention is not limited to those specifically mentioned or exemplified herein. Specifically, those skilled in the art will recognize that active agents typically have a structure consisting of a backbone and attached pendant moieties, and will therefore understand that simple modifications of such backbone and / or pendant moieties do not significantly alter the activity of the agent. For example, in some embodiments, replacement of one or more pendant moieties with groups of equivalent three-dimensional structure and / or chemical reactivity properties can produce substituted compounds or moieties equivalent to the parent reference compound or moiety. In some embodiments, addition or removal of one or more pendant moieties can produce substituted compounds equivalent to the parent reference compound. In some embodiments, for example, alteration of the backbone structure by addition or removal of a small number of bonds (usually no more than 5, 4, 3, 2, or 1 bond, and often only a single bond) can produce substituted compounds equivalent to the parent reference compound. In many embodiments, equivalent compounds can be synthesized, for example, by the methods shown in the following general reaction schemes, or modifications thereof, using readily available materials, reagents, and conventional or provided synthetic procedures. Modifications to these reactions that are known per se but not mentioned here can also be employed.

[0020] Equivalent Dosage: The term "equivalent dosage" is used herein to compare dosages of different pharmaceutically active agents that produce the same biological result. Doses of two different agents are considered "equivalent" to one another according to the present invention if they achieve the same level or degree of biological result. In some embodiments, equivalent dosages of different pharmaceuticals used according to the present invention are determined using the in vitro and / or in vivo assays described herein. In some embodiments, one or more lysosomotropic agents used according to the present invention are utilized at a dose equivalent to that of a reference lysosomotropic agent; in some embodiments, such a reference lysosomotropic agent is selected from the group consisting of small molecule allosteric activators (e.g., pyrazolpyrimidines), iminosugars (e.g., isofagomine), antioxidants (e.g., n-acetylcysteine), and regulators of cellular trafficking (e.g., Rab1a polypeptides).

[0021] Heteroaliphatic: The term "heteroaliphatic" refers to an aliphatic group in which one or more units selected from C, CH, CH, or CH are independently replaced by a heteroatom. In some embodiments, a heteroaliphatic group is a heteroalkyl. In some embodiments, a heteroaliphatic group is a heteroalkenyl.

[0022] Heteroaryl: The terms "heteroaryl" and "heteroar-," used alone or as part of a larger moiety, e.g., "heteroaralkyl" or "heteroaralkoxy," refer to groups having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10, or 14 pi electrons shared in the cyclic arrangement; and having 1 to 5 heteroatoms in addition to carbon atoms. The term "heteroatom" refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur and the quaternized form of any basic nitrogen. Heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. As used herein, the terms "heteroaryl" and "heteroar-" also include groups in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocyclyl rings, where the radical or point of attachment is on the aromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzothiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. Heteroaryl groups can be monocyclic or bicyclic. The term "heteroaryl" can be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "aromatic heterocycle," any of which includes optionally substituted rings. The term "heteroaralkyl" refers to an alkyl group substituted by a heteroaryl, where the alkyl and heteroaryl portions independently may be optionally substituted.

[0023] Heteroatom: The term "heteroatom" refers to one or more of oxygen, sulfur, nitrogen, phosphorus, or silicon (any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen; or a heterocycle, such as N (in 3,4-dihydro-2H-pyrrolyl), NH (in pyrrolidinyl), or NR + (including the substitutable nitrogen of) in N-substituted pyrrolidinyl).

[0024] Heterocycle: As used herein, the terms "heterocycle," "heterocyclyl," "heterocyclic radical," and "heterocyclic ring" are used interchangeably and refer to a stable 3- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is saturated or partially unsaturated and has, in addition to carbon atoms, one or more, preferably 1 to 4, heteroatoms as defined above. When used to refer to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. For example, a saturated or partially unsaturated ring having 0 to 3 heteroatoms selected from oxygen, sulfur, or nitrogen, wherein the nitrogen is N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or + It can be NR (as in N-substituted pyrrolidinyl).

[0025] A heterocycle can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure, and any ring atom can be substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocycle," "heterocyclyl," "heterocyclyl ring," "heterocyclic group," "heterocyclic moiety," and "heterocyclic radical" are used interchangeably herein and include groups in which a heterocyclyl ring is fused to one or more aryl groups, heteroaryl groups, or aliphatic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl, where the radical or point of attachment is on the heterocyclyl ring. The heterocyclyl ring can be monocyclic or bicyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted by a heterocyclyl, where the alkyl and heterocyclyl portions are independently optionally substituted.

[0026] Intraperitoneal: As used herein, the phrases "intraperitoneal administration" and "administered intraperitoneally" have their art-recognized meaning to refer to administration of a compound or composition into the peritoneal membrane of a subject.

[0027] In vitro: As used herein, the term "in vitro" refers to events that occur not within a living organism (e.g., an animal, plant, and / or microorganism) but in an artificial environment, e.g., in a test tube or reactor, in cell culture, etc.

[0028] In vivo: As used herein, the term "in vivo" refers to events that occur within a living organism (e.g., an animal, a plant, and / or a microorganism).

[0029] Lower alkyl: The term "lower alkyl" refers to a C 1~4It represents a straight or branched chain alkyl group. Illustrative lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0030] Lower haloalkyl: The term "lower haloalkyl" refers to a C alkyl group substituted with one or more halogen atoms. 1~4 It represents a straight or branched chain alkyl group.

[0031] Optionally substituted: As described herein, compounds of the invention may contain "optionally substituted" moieties. In general, the term "substituted," with or without the word "may," means that one or more hydrogens of the specified moiety are replaced with a suitable substituent. Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, where one or more positions in any given structure may be the same or different at each position. Combinations of substituents contemplated by the present invention are preferably those that result in the production of stable or chemically feasible compounds. As used herein, the term "stable" refers to compounds that are substantially unchanged when in a condition that allows for their preparation, detection, and, in certain embodiments, their recovery, purification, and use for one or more purposes disclosed herein.

[0032] Suitable monovalent substituents on a substitutable carbon atom of an "optionally substituted" group are independently: halogen; -(CH) 0~4 R ○ ;-(CH2) 0~4 OR ○ ;-O(CH2) 0~4 R ○ , -O-(CH2) 0~4 C(O)OR ○ ;-(CH2) 0~4 CH(OR ○ )2;-(CH2) 0~4 SR ○ ;R ○ may be substituted with (CH2) 0~4 Ph;R ○ may be substituted with (CH2) 0~4O(CH2) 0~1 Ph;R ○ CH=CHPh optionally substituted with R ○ may be substituted with (CH2) 0~4 O(CH2) 0~1 -pyridyl; -NO2; -CN; -N3; ​​(CH2) 0~4 N(R ○ )2;-(CH2) 0~4 N(R ○ )C(O)R ○ ;-N(R ○ )C(S)R ○ ;-(CH2) 0~4 N(R ○ )C(O)NR ○ 2;N(R ○ )C(S)NR ○ 2;-(CH2) 0~4 N(R ○ )C(O)OR ○ ;-N(R ○ )N(R ○ )C(O)R ○ ;N(R ○ )N(R ○ )C(O)NR ○ 2;N(R ○ )N(R ○ )C(O)OR ○ ;-(CH2) 0~4 C(O)R ○ ;-C(S)R ○ ;-(CH2) 0~4 C(O)OR ○ ;-(CH2) 0~4 C(O)SR ○ ;(CH2) 0~4 C(O)OSiR ○ 3;-(CH2) 0~4 OC(O)R ○ ;-OC(O)(CH2) 0~4 SR-, SC(S)SR ○ ;-(CH2) 0~4 SC(O)R ○ ;-(CH2) 0~4 C(O)NR ○ 2;-C(S)NR ○ 2;-C(S)SR ○ ;-SC(S)SR ○ , (CH2)0~4 OC(O)NR ○ 2;C(O)N(OR ○ )R ○ ;-C(O)C(O)R○;-C(O)CH2C(O)R○;-C(NOR○)R ○ ;(CH2) 0~4 SSR ○ ;-(CH2) 0~4 S(O)2R ○ ;-(CH2) 0~4 S(O)2OR ○ ;-(CH2) 0~4 OS(O)2R ○ ;-S(O)2NR ○ 2;(CH2) 0~4 S(O)R ○ ;N(R ○ )S(O)NR ○ 2;-N(R ○ )S(O)2R ○ ;-N(OR ○ )R ○ ;-C(NH)NR ○ 2;-P(O)2R ○ ;P(O)R ○ 2;OP(O)R ○ 2;-OP(O)(OR ○ )2;-SiR○3;-(C 1~4 Linear or branched alkylene)ON(R ○ )2; or -(C 1~4 Linear or branched alkylene)C(O)ON(R ○ )2(in the formula, each R ○ are optionally substituted as described below and independently represent hydrogen, C 1~6 Aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, -CH2- (5- to 6-membered heteroaryl ring) or a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the above definition, two independently occurring R ○taken together with their intervening atoms form a 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as described below.

[0033] R ○ The appropriate monovalent substituent (or two independently occurring R ○ together with the intervening atoms to form a ring) are independently halogen, -(CH2) 0~2 R ● ,-(Halo R ● ), -(CH2) 0~2 OH, -(CH2) 0~2 OR ● , -(CH2) 0~2 CH(OR ● )2;O(Halo R ● ), -CN, -N3, -(CH2) 0~2 C(O)R ● , -(CH2) 0~2 C(O)OH, -(CH2) 0~2 C(O)OR ● , -(CH2) 0~2 SR ● , -(CH2) 0~2 SH, -(CH2) 0~2 NH2, -(CH2) 0~2 NHR ● , -(CH2) 0~2 NR ● 2, -NO2, -SiR ● 3. -OSiR ● 3. C(O)SR ● , -(C 1~4 Straight or branched chain alkylene)C(O)OR ● , or -SSR ● (In the formula, each R ● is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and, independently, C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0~1Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. ○ Suitable divalent substituents on a saturated carbon atom of include ═O and ═S.

[0034] Suitable divalent substituents on a saturated carbon atom of an "optionally substituted" group include: =O, =S, =NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2~3 O-, or -S(C(R * 2)) 2~3 S-(wherein each R * can be substituted with hydrogen, 1~6 aliphatic, or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents attached to adjacent substitutable carbon atoms of an "optionally substituted" group include: -O(CR * 2) 2~3 O-(wherein each R * can be substituted with hydrogen, 1~6 aliphatic, or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0035] Suitable substituents on the aliphatic group of R* include halogen, -R ● ,-(Halo R ● ), -OH, -OR ● , -O(HaloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ●2, or -NO2 (wherein each R ● is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and, independently, C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0036] Suitable substituents on a substitutable nitrogen of an "optionally substituted" group include -R † , -NR † 2. -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CHC(O)R † , -S(O)2R † , S(O)NR † 2. -C(S)NR † 2. -C(NH)NR † 2, or -N(R † )S(O)2R † ;(In the formula, each R † are independently selected from halogen, and the following may be substituted C 1~6 an aliphatic, unsubstituted -OPh, or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; or, notwithstanding the above definition, two independently occurring R † together with their intervening atoms form an unsubstituted 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0037] R † Suitable substituents on the aliphatic group are independently halogen, -R ● ,-(Halo R ● ), -OH, -OR ● , -O(HaloR ● ), -CN, -C(O)OH, -C(O)OR ●, -NH2, -NHR ● , -NR ● 2, or -NO2 (wherein each R ● is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and, independently, C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0038] Oral: As used herein, the phrases "oral administration" and "orally administered" refer to administration of a compound or composition by mouth and have their art-recognized meaning.

[0039] Parenteral: As used herein, the phrases "parenteral administration" and "parenterally administered" have their art-recognized meaning to refer to modes of administration that are not enteral or topical, usually by injection, and include, but are not limited to, intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subcuticular, intra-articular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0040] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety that includes at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings with multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties as defined herein.

[0041] As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dosage suitable for administration in a treatment regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to an appropriate population. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, including for oral administration, e.g., drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., for buccal, sublingual, and systemic absorption, boluses, powders, granules, and pastes to be applied to the tongue; parenteral administration, e.g., as a sterile solution or suspension, or sustained-release formulation, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection; topical administration, e.g., as a cream, ointment, or sustained-release patch or spray to be applied to the skin, lungs, or oral cavity; intravaginally or rectally, e.g., as a pessary, cream, or foam; sublingually; ophthalmically; transdermally; or intranasally to the lungs and other mucosal surfaces.

[0042] Pharmaceutically acceptable: As used herein, the phrase "pharmaceutically acceptable" refers to compounds, substances, compositions, and / or dosage forms that, within sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0043] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, that is involved in the transport or transfer of a substance from one organ or body part to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials that can serve as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethyl cellulose, and cellulose acetate; tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic compatible substances used in pharmaceutical formulations.

[0044] Pharmaceutically acceptable salt: As used herein, the term "pharmaceutically acceptable salt" refers to a salt of such a compound that is suitable for use in a pharmaceutical context, i.e., a salt that is suitable for use in contact with the tissues of humans and lower animals, within the scope of sound medical judgment, at a reasonable benefit / risk ratio, and without undue harmful effects, irritation, allergic response, etc. Pharmaceutically acceptable salts are well known in the art. For example, SM Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, hydroxypropyl methylcellulose ... Examples of suitable salts include, but are not limited to, sulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed with counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkylsulfonates and arylsulfonates having 1 to 6 carbon atoms, as appropriate.

[0045] Prodrug: Generally, a "prodrug," as the term is used herein, and as understood in the art, is an entity that, when administered to an organism, is metabolized in the body to deliver an active (e.g., therapeutic or diagnostic) agent of interest. Typically, such metabolism results in the removal of at least one "prodrug moiety," so that the active agent is produced. Various forms of "prodrugs" are well known in the art. Examples of such prodrug moieties include: a) Design of Prodrugs, edited by H. Bundgaard, (Elsevier, 1985) and Methods in Enzymology, 42:309-396, edited by K. Widder, et al. (Academic Press, 1985); b)Prodrugs and Targeted Delivery, edited by by J. Rautio (Wiley, 2011); c)Prodrugs and Targeted Delivery, edited by by J. Rautio (Wiley, 2011); d)A Textbook of Drug Design and Development, edited by Krogsgaard-Larsen; e) Bundgaard, Chapter 5 “Design and Application of Prodrugs”, by H. Bundgaard, p. 113-191 (1991); f) Bundgaard, Advanced Drug Delivery Reviews, 8:1-38 (1992); g) Bundgaard, et al., Journal of Pharmaceutical Sciences, 77:285 (1988); and h)Kakeya, et al., Chem. Pharm. Bull., 32:692 (1984) reference.

[0046] Like other compounds described herein, prodrugs can be provided in any of a variety of forms, e.g., crystalline forms, salt forms, etc. In some embodiments, the prodrug is provided as a pharmaceutically acceptable salt thereof.

[0047] Protecting group: As used herein, the term "protecting group" is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T.W. Greene and P.G.M. Wuts, 3rd edition, John Wiley & Sons, 1999 (the entire text of which is incorporated herein by reference). It also includes protecting groups specifically adapted to nucleotides and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. 06 / 2012 (the entire text of Chapter 2 is incorporated herein by reference). Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluorenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenanthyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2- Phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc), 1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-Dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropyl allyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyl dithiocarbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitro p-Toluenesulfonylmethylcarbamate, p-bromobenzylcarbamate, p-chlorobenzylcarbamate, 2,4-dichlorobenzylcarbamate, 4-methylsulfinylbenzylcarbamate (Msz), 9-anthrylmethylcarbamate, diphenylmethylcarbamate, 2-methylthioethylcarbamate, 2-methylsulfonylethylcarbamate, 2-(p-toluenesulfonyl)ethylcarbamate, [2-(1,3-dithianyl)]methylcarbamate (Dmoc), 4-methylthiophenylcarbamate (Mtpc), 2,4-dimethylthio Phenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acryloxybenzyl carbamate, p-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivatives, N'-p-toluenesulfonylaminocarbonyl derivatives, N'-phenylaminothiocarbonyl derivatives, t-amyl carbamate, S-benzylthiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p-decyloxybenzyl carbamate, 2,2-Dimethoxycarbonylvinylcarbamate, o-(N,N-dimethylcarboxamido)benzyl carbamate, 1,1-dimethyl-3-(N,N-dimethylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isobornyl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p'-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methyl 1-methyl-1-cyclohexyl carbamate, 1-methyl-1-cyclopropylmethyl carbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate, 1-methyl-1-(p-phenylazophenyl)ethyl carbamate, 1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-trimethylbenzyl carbamates, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivatives, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenoxy)acetamide o-(methyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivatives, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-Tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrrolin-3-yl)amine, Quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylideneamine, Np- Methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylideneamine, Np-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-diphenyl Carbolic acid derivatives, N-[phenyl(pentacarbonylchromium or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosamine, amine N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-Dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridine sulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4- Methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.

[0048] Suitable protected carboxylic acids include, but are not limited to, silyl-, alkyl-, alkenyl-, aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, and tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.

[0049] Suitable hydroxyl protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (ME), and the like. M), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl] -4-Methoxypiperazin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trimethyl- methylethyl, 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxide, diphenylmethyl, p,p'-Dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromophenacyloxyphenyl)diphenylmethyl, 4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl, 4,4',4''-tris(levulinoyloxyphenyl)methyl, 4,4',4''-tris(benzoyloxyphenyl)methyl, 3-(imidazolinone) (4',4''-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxide, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylthiazolyl Silyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate ester, benzoylformate ester, acetate ester, chloroacetate ester, dichloroacetate ester, trichloroacetate ester, trifluoroacetate ester, methoxyacetate ester, triphenylmethoxyacetate ester, phenoxyacetate ester, p-chlorophenoxyacetate Acid esters, 3-phenylpropionate esters, 4-oxopentanoate esters (levulinate esters), 4,4-(ethylenedithio)pentanoate esters (levulinoyl dithioacetal), pivalate esters, adamantate, crotonate esters, 4-methoxycrotonate esters, benzoate esters, p-phenylbenzoate esters, 2,4,6-trimethylbenzoate esters (mesitoate), alkyl methyl carbonates, 9-fluorenylmethyl carbonates (Fmoc), alkyl ethyl carbonates, alkyl 2,2,2-Trichloroethyl (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-(triphenylphosphonio)ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate, alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoic acid ester, 4-azidobutyric acid ester, 4-nitro-4-methylpentanoic acid ester, o-(dibromomethyl)benzoic acid ester, 2-formylbenzenesulfonic acid ester, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyric acid Acid esters, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoic acid, nitrate, alkyl N,N,N',N'-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothionyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts). For protecting 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,Examples of suitable boronic acid derivatives include 4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methoxyethylidene orthoester, 1-ethoxyethylidene orthoester, 1,2-dimethoxyethylidene orthoester, α-methoxybenzylidene orthoester, 1-(N,N-dimethylamino)ethylidene derivatives, α-(N,N'-dimethylamino)benzylidene derivatives, 2-oxacyclopentylidene orthoester, di-t-butylsilylene group (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanylidene) derivatives (TIPDS), tetra-t-butoxydisiloxane-1,3-diylidene derivatives (TBDS), cyclic carbonates, cyclic boronates, ethyl borate, and phenyl borate.

[0050] In some embodiments, the hydroxyl protecting group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl(trityl), 4,4′-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4′-dimethoxytrityl, ( DMTr) and 4,4',4''-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl), or 9-(p-methoxyphenyl)xanthin-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting groups are selected from the group consisting of trityl, monomethoxytrityl, and 4,4'-dimethoxytrityl groups.

[0051] In some embodiments, the phosphite protecting group is a group attached to an internucleotide phosphite bond throughout oligonucleotide synthesis. In some embodiments, the phosphite protecting group is attached to the sulfur atom of an internucleotide phosphorothioate bond. In some embodiments, the phosphite protecting group is attached to the oxygen atom of an internucleotide phosphorothioate bond. In some embodiments, the phosphite protecting group is attached to the oxygen atom of an internucleotide phosphate bond. In some embodiments, the phosphite protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0052] Protein: As used herein, the term "protein" refers to a polypeptide (i.e., a chain of at least two amino acids linked to one another by peptide bonds). In some embodiments, a protein contains only naturally occurring amino acids. In some embodiments, a protein contains one or more non-naturally occurring amino acids (e.g., a moiety that forms one or more peptide bonds with adjacent amino acids). In some embodiments, one or more residues of a protein chain contain a non-amino acid moiety (e.g., a glycan, etc.). In some embodiments, a protein contains more than one polypeptide chain, for example, linked by one or more disulfide bonds or associated by other means. In some embodiments, a protein contains L-amino acids, D-amino acids, or both; in some embodiments, a protein contains one or more amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, etc. The term "peptide" is generally used to refer to polypeptides having a length of less than about 100 amino acids, less than about 50 amino acids, less than about 20 amino acids, or less than about 10 amino acids. In some embodiments, the protein is an antibody, an antibody fragment, a biologically active portion thereof, and / or a characteristic portion thereof.

[0053] Sample: As used herein, the term "sample" refers to a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, the source of interest includes an organism, such as an animal or a human. In some embodiments, the biological sample includes biological tissue or biological fluid. In some embodiments, the biological sample is or includes bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy sample; cell-containing body fluid; suspended nucleic acid; sputum; saliva; urine; cerebrospinal fluid, ascites; pleural fluid; feces; lymphatic fluid; gynecological fluid; skin swab; vaginal swab; oral swab; nasal swab; washings or lavage fluids, such as ductal lavage or bronchoalveolar lavage; aspirates; scrapings; bone marrow specimen; tissue biopsy specimen; surgical specimen; feces, other body fluids, secretions, and / or cells therefrom, etc. In some embodiments, the biological sample is or includes cells obtained from an individual. In some embodiments, the sample is a "primary sample" obtained directly from the source of interest by any suitable means. For example, in some embodiments, a primary biological sample is obtained by a method selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of bodily fluids (e.g., blood, lymph, stool, etc.), etc. In some embodiments, as will be clear from the context, the term "sample" refers to a preparation obtained by processing a primary sample (e.g., by removing one or more components thereof and / or adding one or more agents thereto), e.g., filtration through a semi-permeable membrane. Such a "processed sample" can include, for example, nucleic acids or proteins obtained by extraction from a sample or by processing the primary sample by techniques such as amplification or reverse transcription of mRNA, isolation and / or purification of specific components, etc.

[0054] Stereochemical isomers: As used herein, the phrase "stereochemical isomers" refers to different compounds constructed of the same atoms connected by the same series of bonds but having different, incompatible three-dimensional structures. In some embodiments of the present invention, the provided chemical compositions may be or contain a pure synthesis of an individual stereochemical isomer of a compound; in some embodiments, the provided chemical compositions may be or contain a mixture of two or more stereochemical isomers of the compound. In certain embodiments, such mixtures contain equal amounts of different stereochemical isomers; in certain embodiments, such mixtures contain unequal amounts of at least two different stereochemical isomers. In some embodiments, the chemical composition may contain all diastereomers and / or enantiomers of the compound. In some embodiments, the chemical composition may contain less than all diastereomers and / or enantiomers of the compound. In some embodiments, if a specific enantiomer of a compound of the present invention is desired, it may be synthesized, for example, by asymmetric synthesis or derivatization with a chiral auxiliary, and the resulting diastereomeric mixture separated and the auxiliary cleaved to yield the pure desired enantiomer. Alternatively, if the molecule contains a basic functional group such as amino, diastereomeric salts can be formed with a suitable optically active acid and resolved, for example, by fractional crystallization.

[0055] Subject: As used herein, the term "subject" or "subject" refers to any organism to which provided compounds or compositions are administered in accordance with the present invention, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, the subject is suffering from and / or susceptible to a disease, disorder, and / or condition.

[0056] Substantial: As used herein, the term "substantial" refers to the qualitative condition of exhibiting the full or nearly full extent or degree of a characteristic or property under consideration. Those skilled in the biological arts will understand that biological and chemical phenomena rarely eschew completeness and / or completion or accomplishment or absolute results. Thus, the term "substantial" is used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0057] Suffering from: An individual "suffering from" a disease, disorder, and / or condition has been diagnosed with and / or exhibits one or more symptoms of the disease, disorder, and / or condition.

[0058] Susceptible (to a disease): An individual who is "susceptible to" a disease, disorder, and / or condition is one who is at a higher risk of developing the disease, disorder, and / or condition than members of the general community. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not be diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.

[0059] Systemic: As used herein, the phrases "systemic administration," "systemically administered," "peripheral administration," and "peripherally administered" have their art-recognized meaning of referring to administering a compound or composition so that it enters the recipient's entire body.

[0060] Tautomers: As used herein, the phrase "tautomers" is used to describe different isomers of an organic compound that are readily interchangeable. Tautomers can be characterized by the formal migration of a hydrogen atom or a proton accompanied by the shifting of a single bond and an adjacent double bond. In some embodiments, tautomers can result from proton tautomerism (i.e., relocation of a proton). In some embodiments, tautomers can result from valence tautomerism (i.e., rapid relocation of bonding electrons). All such tautomers are intended to be included within the scope of the present invention. In some embodiments, tautomers of a compound exist in mobile equilibrium with one another such that attempts to synthesize the separate substances would result in mixtures. In some embodiments, tautomers of a compound are separable and isolatable compounds. In some embodiments of the present invention, chemical compositions can be provided that are or contain a pure composition of a single tautomer of a compound. In some embodiments of the present invention, chemical compositions can be provided as mixtures of two or more tautomers of a compound. In certain embodiments, such mixtures contain equal amounts of different tautomers; in certain embodiments, such mixtures contain different amounts of at least two tautomers of a compound. In some embodiments of the present invention, a chemical composition may contain all tautomers of a compound. In some embodiments of the present invention, a chemical composition may contain fewer than all tautomers of a compound. In some embodiments of the present invention, a chemical composition may contain one or more tautomers of a compound in amounts that vary over time as a result of interconversion. In some embodiments of the present invention, the tautomer is keto-enol tautomerism. One skilled in the chemical arts can "capture" (i.e., chemically modify to retain the "enol" form) keto-enol tautomerism using any suitable reagent known in the chemical arts to obtain an enol derivative that can be subsequently isolated using one or more suitable techniques known in the art. Unless otherwise indicated, the present invention encompasses all tautomers of the relevant compounds, whether in pure form or in mixtures with each other.

[0061] Therapeutic Agent: As used herein, the term "therapeutic agent" refers to any agent that, when administered to a subject, induces a therapeutic effect and / or a desired biological and / or pharmacological effect. In some embodiments, a therapeutic agent is any substance that can be used to alleviate, ameliorate, relieve, suppress, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition.

[0062] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that, when administered as part of a treatment regimen, elicits a desired biological response. In some embodiments, a therapeutically effective amount of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to the disease, disorder, and / or condition. As will be recognized by those skilled in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance delivered, the target cell or tissue, and others. For example, an effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that alleviates, ameliorates, relieves, suppresses, prevents, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms or characteristics of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0063] Treatment: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, suppress, prevent, delay onset, reduce severity, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment may be administered to a subject who does not show signs of the disease, disorder, and / or condition. In some embodiments, treatment may be administered to a subject who shows only early signs of the disease, disorder, and / or condition, for example, to reduce the risk of developing pathology associated with the disease, disorder, and / or condition.

[0064] Unsaturated: As used herein, the term "unsaturated" means that a moiety has one or more units of unsaturation.

[0065] Unit dose: As used herein, the phrase "unit dose" refers to an amount administered as a single dose of a pharmaceutical composition and / or in a physically discrete unit. In many embodiments, a unit dose contains a predetermined amount of an active agent. In some embodiments, a unit dose contains an entire single dose of the agent. In some embodiments, one or more unit doses are administered to achieve the entire single dose. In some embodiments, administration of multiple unit doses is necessary or expected to be necessary to achieve the intended effect. A unit dose can be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined amount of one or more therapeutic agents, a predetermined amount of a solid form, sustained-release formulation, or drug delivery device containing a predetermined amount of one or more therapeutic agents, etc. It will be appreciated that a unit dose can be in a formulation containing any variety of ingredients in addition to the therapeutic agent. For example, an acceptable carrier (e.g., a pharmaceutically acceptable carrier), a diluent, a stabilizer, a buffer, a preservative, etc., as described below, can be included. It will be understood by those skilled in the art that in many embodiments, an appropriate total daily dosage of a particular therapeutic agent may comprise a fraction or multiple unit doses, and may be determined, for example, by an attending physician within the scope of sound medical judgment. In some embodiments, the specific effective dosage level for any particular subject or organism will depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific active compound used; the specific composition used; the age, weight, health, sex, and diet of the subject; the number of administrations and the excretion rate of the specific compound used; the duration of treatment; drugs and / or additional therapies used in combination or simultaneously with the specific compound used, and similar factors well known in the medical arts.

[0066] Wild-type: As used herein, the term "wild-type" has its art-recognized meaning of referring to an entity having a structure and / or activity actually found in a "normal" (as opposed to mutant, diseased, altered, etc.) state or context. Those of skill in the art will recognize that wild-type genes and polypeptides often exist in multiple alternative forms (e.g., alleles).

[0067] Nucleic Acid: The term "nucleic acid" includes any nucleotide, its analogs, and polymers thereof. As used herein, the term "polynucleotide" refers to polymeric forms of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of the molecule and thus include double- and single-stranded DNA, and double- and single-stranded RNA. These terms include, by way of equivalents, analogs of either RNA or DNA synthesized from nucleotide analogs and modified polynucleotides, such as, but not limited to, methylated, protected, and / or capped nucleotides or polynucleotides. The term encompasses poly- or oligoribonucleotides (RNA) and poly- or oligodeoxyribonucleotides (DNA); RNA or DNA derived from N- or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified phosphorus atom bridges (also referred to herein as "internucleotide linkages"). The term encompasses nucleic acids containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges. Examples include, but are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxyribose moieties, nucleic acids containing both ribose and deoxyribose moieties, and nucleic acids containing ribose and modified ribose moieties. The prefix poly refers to nucleic acids containing from 2 to about 10,000 nucleotide monomer units, and the prefix oligo refers to nucleic acids containing from 2 to about 200 nucleotide monomer units.

[0068] Nucleotide: As used herein, the term "nucleotide" refers to a monomeric unit of a polynucleotide consisting of a heterocyclic base, a sugar, and one or more phosphate or phosphorus-containing internucleotide linkages. The natural bases (guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)) are purine or pyrimidine derivatives, although it should be understood that natural and unnatural base analogs are also included. The natural sugars are the pentoses (five-carbon sugars) deoxyribose (forming DNA) or ribose (forming RNA), although it should be understood that natural and unnatural base analogs are also included. Nucleotides are linked via internucleotide linkages to form nucleic acids, or polynucleotides. Many internucleotide linkages are well known in the art, including, but not limited to, phosphate, phosphorothioate, and boranophosphate. Artificial nucleic acids include PNAs (peptide nucleic acids), phosphotriesters, phosphorothioates, H-phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates and other variants of the phosphate backbone of natural nucleic acids such as those described herein.

[0069] Nucleoside: The term "nucleoside" refers to a moiety in which a nucleobase or modified nucleobase is covalently linked to a sugar or modified sugar.

[0070] Sugar: The term "sugar" refers to a monosaccharide in closed and / or open form. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term also encompasses structural analogs used in place of normal sugar molecules, such as glycols, whose polymers form the backbone of nucleic acid analogs, glycol nucleic acids ("GNAs").

[0071] Modified sugar: The term "modified sugar" refers to a moiety that can replace a sugar, such that the modified sugar mimics the spatial arrangement, electronic state, or some other physicochemical property of a sugar.

[0072] Nucleobase: The term "nucleobase" refers to a nucleic acid moiety that participates in hydrogen bonds to bind one nucleic acid strand to another complementary strand in a sequence-specific manner. Most naturally occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the naturally occurring nucleobase is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the naturally occurring nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleobase is a "modified nucleobase," e.g., a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobases mimic the spatial arrangement, electronic state, or some other physicochemical property of nucleobases and retain the hydrogen-bonding properties that allow one nucleic acid strand to bind to another complementary strand in a sequence-specific manner. In some embodiments, the modified nucleobases can pair with all five natural bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes, or activity of the oligonucleotide duplex.

[0073] Chiral Ligand: The term "chiral ligand" or "chiral auxiliary" refers to a moiety that is chiral and can be incorporated into a reactant so that a reaction can be carried out with a particular stereoselectivity.

[0074] Condensing Reagent: In a condensation reaction, the term "condensing reagent" refers to a reagent that activates a less reactive site, making it more susceptible to action with another reagent. In some embodiments, such another reagent is a nucleophile.

[0075] Blocking group: The term "blocking group" refers to a group that masks the reactivity of a functional group that can be subsequently unmasked by removal of the blocking group. In some embodiments, a blocking group is a protecting group.

[0076] Moiety: The term "moiety" refers to a specific segment or functional group of a molecule. A chemical moiety is often recognized as a chemical entity incorporated into or added to a molecule.

[0077] Solid support: The term "solid support" refers to any support that allows for the synthesis of nucleic acids. In some embodiments, the term refers to glass or polymer that is insoluble in the medium used in the reaction step to carry out nucleic acid synthesis and derivatize to introduce reactive groups. In some embodiments, the solid support is highly cross-linked polystyrene (HCP) or controlled pore glass (CPG). In some embodiments, the solid support is controlled pore glass (CPG). In some embodiments, the solid support is a composite support of controlled pore glass (CPG) and highly cross-linked polystyrene (HCP).

[0078] Linking moiety: The term "linking moiety" refers to any moiety that may be located between the terminal nucleotide and the solid support or between the terminal nucleoside and another nucleoside, nucleotide, or nucleic acid.

[0079] DNA molecule: The term "DNA molecule" refers to either its single-stranded form or the polymeric form of double-helical deoxyribonucleotides (adenine, guanine, thymine, or cytosine). The term refers only to the primary and secondary structure of the molecule and does not limit it to any particular tertiary form. Thus, the term includes double-stranded DNA found in, inter alia, linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing specific double-stranded DNA molecule structures, the sequence may be described herein according to the convention of providing only the sequence in the 5' to 3' direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to mRNA).

[0080] Coding sequence: A DNA "coding sequence" or "coding region" is a double-stranded DNA that is transcribed and translated into an in vivo polypeptide when placed under the control of appropriate expression control sequences. The boundaries of the coding sequence ("open reading frame" or "ORF") are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxylic) terminus. Coding sequences include, but are not limited to, prokaryotic sequences, cDNA from prokaryotic mRNA, genomic DNA sequences from prokaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. Polyadenylation signals and transcription termination sequences are typically located 3' to the coding sequence. The terms "non-coding sequence" or "non-coding region" refer to regions of a polynucleotide sequence that are not translated into amino acids (e.g., 5' and 3' untranslated regions).

[0081] Reading Frame: The term "reading frame" refers to one of six possible reading frames, three in each direction of a double-stranded DNA molecule. The reading frame used determines which codons are used to code for amino acids within the coding sequence of the DNA molecule.

[0082] Antisense: As used herein, an "antisense" nucleic acid molecule comprises a nucleic acid sequence that is complementary to, for example, the coding strand of a double-stranded cDNA molecule, complementary to an mRNA sequence, or complementary to a "sense" nucleic acid encoding a protein that is complementary to the coding strand of a gene. Thus, an antisense nucleic acid molecule can associate with a sense nucleic acid molecule through hydrogen bonding.

[0083] Wobble position: As used herein, "wobble position" refers to the third position of a codon. In some embodiments, a mutation in a DNA molecule within the wobble position of a codon results in a silent or conservative mutation at the amino acid level. For example, there are four codons that code for glycine, namely, GGU, GGC, GGA, and GGG; therefore, mutation of any nucleotide at any wobble position to another nucleotide selected from A, U, C, and G will not result in a change at the amino acid level of the encoded protein, and is therefore a silent substitution.

[0084] Silent Substitution: A "silent substitution" or "silent mutation" is one in which a nucleotide in a codon is changed but does not result in a change in the amino acid residue encoded by the codon. Examples include mutations in the first position of a particular codon, such as the codon "CGG," which when mutated to AGG still encodes Arg, as well as mutations in the third position of the codon.

[0085] Gene: As used herein, the terms "gene," "recombinant gene," and "gene construct" refer to a DNA molecule, or portion of a DNA molecule, that encodes a protein or portion thereof. The DNA molecule may include an open reading frame that encodes the protein (as an exon sequence) and may further include intron sequences. As used herein, the term "intron" refers to a DNA sequence present in a given gene that is not translated into protein, and in some, but not all, cases, found between exons. As is well known in the art, it may be desirable for a gene to be operably associated with (or may include) one or more promoters, enhancers, repressors, and / or other control sequences that regulate the activity or expression of the gene.

[0086] Complementary DNA: As used herein, "complementary DNA" or "cDNA" includes recombinant polynucleotides synthesized by reverse transcription of mRNA, from which intervening sequences (introns) have been removed.

[0087] Homology: "Homology" or "identity" or "similarity" refers to the sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparing a position in each sequence that can be positioned for comparison purposes. When the same position in the compared sequences is occupied by the same base, then the molecules are identical at that position; when the same site is occupied by the same or similar nucleic acid residue (e.g., similar in steric and / or electronic state), then the molecules can be said to be homologous (similar) at that position. Expression of percentage homology / similarity or identity represents a function of the number of identical or similar nucleic acids at a position shared by the compared sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with a sequence described herein. When comparing two sequences, the absence of residues (amino acids or nucleic acids) or the presence of extra residues also reduces the identity and homology / similarity.

[0088] In some embodiments, the term "homology" describes a mathematically based comparison of sequence similarity used for identical genes with similar functions or motifs. The nucleic acid sequences described herein can be used as "query sequences" to perform searches against public databases, for example, to identify other family members, related sequences, or homologs. In some embodiments, such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. In some embodiments, BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12, to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. In some embodiments, gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402, to obtain gapped alignments for comparison purposes. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (eg, XBLAST and BLAST) can be used (see www.ncbi.nlm.nih.gov).

[0089] Identity: As used herein, "identity" means the percentage of identical nucleotide residues at corresponding positions in two or more sequences when the sequences are aligned for maximum sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including, but not limited to, those described in Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Methods to determine identity are designed to maximize the match between the sequences tested. Moreover, methods to determine identity are codified in publicly available computer programs.Computer program methods for determining identity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Molec. Biol. 215: 403-410 (1990) and Altschul et al. Nuc. Acids Res. 25: 3389-3402 (1997)). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S., et al., J. Mol. Biol. 215: 403-410 (1990)). The well known Smith-Waterman algorithm may also be used to determine identity.

[0090] Heterologous: A "heterologous" region of a DNA sequence is an identifiable segment of DNA within a larger DNA sequence that is not found in relation to the larger sequence. Thus, when a heterologous region encodes a mammalian gene, the gene may be located on a side of DNA that is not normally adjacent to the mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a sequence in which the coding sequence itself is not found at all (e.g., a cDNA containing introns or synthetic sequences in which the genomic coding sequence has codons or motifs that differ from the native gene). Allelic variation or natural mutational events do not give rise to a non-homologous region of DNA as defined herein.

[0091] Transition Mutation: The term "transition mutation" refers to a base change in a DNA sequence in which a pyrimidine (cytidine (C) or thymidine (T)) is replaced by another pyrimidine, or a purine (adenosine (A) or guanosine (G)) is replaced by another purine.

[0092] Transversion Mutation: The term "transversion mutation" refers to a base change in a DNA sequence in which a pyrimidine (cytidine (C) or thymidine (T)) is replaced by a purine, or a purine (adenosine (A) or guanosine (G)) is replaced by a pyrimidine.

[0093] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotide monomers containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges (also referred to herein as "internucleotide linkages," as further defined herein).

[0094] Oligonucleotides can be single-stranded or double-stranded. As used herein, the term "oligonucleotide strand" encompasses single-stranded oligonucleotides. Single-stranded oligonucleotides can have double-stranded regions, and double-stranded oligonucleotides can have single-stranded regions. Illustrative oligonucleotides include, but are not limited to, structural genes, genes including regulatory and terminal regions, viral or plasmid DNA, self-replicating systems such as single-stranded and double-stranded siRNAs and other RNA interference agents (RNAi agents or iRNA agents), shRNAs, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, Ul adapters, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0095] The double-stranded and single-stranded oligonucleotides that are effective in inducing RNA interference are also referred to herein as siRNA, RNAi agent or iRNA agent.In some embodiments, these RNA interference-inducing oligonucleotides are associated with the cytoplasmic multiprotein complex known as RNAi-induced silencing complex (RISC).In many embodiments, single-stranded and double-stranded RNAi agents are long enough that they can be cut by endogenous molecules, such as Dicer, to produce smaller oligonucleotides that can enter RISC mechanism and participate in the RISC-mediated cleavage of target sequence, such as target mRNA.

[0096] Oligonucleotides of the present invention can vary in length. In certain embodiments, oligonucleotides can range from about 2 to about 200 nucleotides in length. In various related embodiments, single-stranded, double-stranded, and triple-stranded oligonucleotides can range in length from about 4 to about 10 nucleotides, about 10 to about 50 nucleotides, about 20 to about 50 nucleotides, about 15 to about 30 nucleotides, or about 20 to about 30 nucleotides. In some embodiments, the oligonucleotides are about 9 to about 39 nucleotides in length. In some embodiments, the oligonucleotides are at least 4 nucleotides in length. In some embodiments, the oligonucleotides are at least 5 nucleotides in length. In some embodiments, the oligonucleotides are at least 6 nucleotides in length. In some embodiments, the oligonucleotides are at least 7 nucleotides in length. In some embodiments, the oligonucleotides are at least 8 nucleotides in length. In some embodiments, the oligonucleotides are at least 9 nucleotides in length. In some embodiments, the oligonucleotides are at least 10 nucleotides in length. In some embodiments, the oligonucleotides are at least 11 nucleotides in length. In some embodiments, the oligonucleotides are at least 12 nucleotides in length. In some embodiments, the oligonucleotide is at least 15 nucleotides in length. In some embodiments, the oligonucleotide is at least 20 nucleotides in length. In some embodiments, the oligonucleotide is at least 25 nucleotides in length. In some embodiments, the oligonucleotide is at least 30 nucleotides in length. In some embodiments, the oligonucleotide is a double-stranded complementary strand at least 18 nucleotides in length. In some embodiments, the oligonucleotide is a double-stranded complementary strand at least 21 nucleotides in length.

[0097] Internucleotide linkage: As used herein, the phrase "internucleotide linkage" generally refers to a phosphorus-containing bond between nucleotide units of an oligonucleotide, and is synonymous above and herein with "intersugar linkage" and "phosphorus atom bridge." In some embodiments, the internucleotide linkage is a phosphodiester linkage found in natural DNA and RNA molecules. In some embodiments, the internucleotide linkage is a "modified internucleotide linkage" in which each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, such organic or inorganic moieties are selected from, but not limited to, =S, =Se, =NR', -SR', -SeR', -N(R')2, B(R')3, -S-, -Se-, and -N(R')- (wherein each R' is independently as defined and described below). In some embodiments, the internucleotide linkage is a phosphotriester linkage, a phosphorothioate diester linkage, or a phosphodiester diester linkage. [ka] or a modified phosphorothioate triester bond. Those skilled in the art will appreciate that the internucleotide linkage may exist as an anion or cation at a given pH depending on the presence of an acid or base moiety in the linkage.

[0098] Unless otherwise specified, when used with an oligonucleotide sequence, each s, s1, s2, s3, s4, s5, s6 and s7 independently represents the following modified internucleotide linkages shown in Table 1 below:

[0099] Table 1. Illustrative modified internucleotide linkages [Table 1] TIFF2025066783000004.tif224166TIFF2025066783000005.tif96166

[0100] For example, (Rp,Sp)-ATsCs1GA has 1) a phosphorothioate internucleotide bond between T and C; ( [ka] ) and 2) between C and G [ka] Unless otherwise specified, the Rp / Sp designation preceding an oligonucleotide sequence refers to the configuration of the chiral phosphorus atoms of the internucleotide linkages sequentially from 5' to 3' of the oligonucleotide sequence. For example, in (Rp,Sp)-ATsCs1GA, the phosphorus of the "s" bond between T and C has the Rp configuration, and the phosphorus of the "s1" bond between C and G has the Sp configuration. In some embodiments, "all (Rp)" or "all (Sp)" is used to indicate that all chiral phosphorus atoms of the oligonucleotide have the same Rp or Sp configuration, respectively. For example, all (Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC indicates that all the chiral linking phosphorus atoms of the oligonucleotide have the Rp configuration; all (Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC indicates that all the chiral linking phosphorus atoms of the oligonucleotide have the Sp configuration.

[0101] Oligonucleotide Type: As used herein, the phrase "oligonucleotide type" refers to an oligonucleotide having a particular base sequence, backbone linkage pattern (i.e., internucleotide linkage pattern, e.g., phosphate, phosphorothioate, etc.), backbone chiral center pattern (i.e., linked phosphorus stereochemistry pattern (Rp / Sp)), and backbone phosphorus modification pattern (e.g., "-XLR" in Formula I). 1 "Type" is used to define oligonucleotides having a pattern of "groups." Oligonucleotides of a commonly designated "type" are structurally identical to each other.

[0102] Those skilled in the art will recognize that the synthesis methods of the present invention provide a degree of control during the synthesis of an oligonucleotide chain, such that each nucleotide unit of the oligonucleotide chain can be designed and / or preselected to have a specific stereochemistry at the linking phosphorus and / or a specific modification at the linking phosphorus and / or a specific base and / or a specific sugar. In some embodiments, the oligonucleotide chain is designed and / or determined to have a specific combination of modifications at the linking phosphorus. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination of bases. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination of one or more of the above structural features. The present invention provides compositions (e.g., chiral-controlled oligonucleotide compositions) comprising or consisting of a plurality of oligonucleotide molecules. In some embodiments, all such molecules are of the same type (i.e., structurally identical to each other). However, in many embodiments, the provided compositions typically contain multiple oligonucleotides of different types in predetermined relative amounts.

[0103] Chiral control: As used herein, "chiral control" refers to the ability to control the stereochemical orientation of each chiral linkage phosphorus within an oligonucleotide chain. The phrase "chiral controlled oligonucleotide" refers to an oligonucleotide that exists in a single diastereoisomer about the chiral linkage phosphorus.

[0104] Chiral control oligonucleotide composition: As used herein, the phrase "chiral control oligonucleotide composition" refers to an oligonucleotide composition that contains a predetermined level of an individual oligonucleotide type. For example, in some embodiments, the chiral control oligonucleotide composition contains one oligonucleotide type. In some embodiments, the chiral control oligonucleotide composition contains a mixture of multiple oligonucleotide types. Illustrative chiral control oligonucleotide compositions are further described herein.

[0105] Chiral pure: The phrase "chiral pure" is used herein to describe chiral controlled oligonucleotide compositions in which the entire oligonucleotide exists in a single diastereoisomer with respect to the attached phosphorus.

[0106] Chiral homogeneous: As used herein, the phrase "chiral homogeneous" is used to describe an oligonucleotide molecule or type in which all nucleotide units have the same stereochemistry at the junction phosphorus. For example, an oligonucleotide in which all nucleotide units have Rp stereochemistry at the junction phosphorus is chiral homogeneous. Similarly, an oligonucleotide in which all nucleotide units have Sp stereochemistry at the junction phosphorus is chiral homogeneous.

[0107] Predetermined: Predetermined means deliberately selected, e.g., as opposed to randomly occurring or achieved. Those skilled in the art will understand upon reading this specification that the present invention provides new and surprising technology that allows for the selection of specific oligonucleotide types for formulation and / or inclusion in provided compositions, and further allows for the controlled formulation of the selected specific types, optionally in selected specific relative amounts, precisely so that provided compositions are formulated. Such provided compositions are "predetermined" as described herein. Compositions that may contain specific individual oligonucleotide types are not "predetermined" compositions because they were created through a process that, by chance, does not control the intentional creation of specific oligonucleotide types. In some embodiments, a predetermined composition is one that can be intentionally replicated (e.g., through the repetition of a controlled process).

[0108] Bound phosphorus: As defined herein, the phrase "bound phosphorus" is used to indicate that the particular phosphorus atom depicted is present in an internucleotide linkage, and that the phosphorus atom corresponds to the phosphorus atom of the phosphodiester internucleotide linkage that occurs in natural DNA and RNA. In some embodiments, the bound phosphorus atom is in a modified internucleotide linkage, where each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, the bound phosphorus atom is represented by P * In some embodiments, the linking phosphorus atom is chiral. In some embodiments, the chiral linking phosphorus atom is P of Formula I * is.

[0109] P modification: As used herein, the term "P modification" refers to any modification at the bound phosphorus other than a stereochemical modification. In some embodiments, a P modification includes the addition, substitution, or removal of a pendant moiety covalently attached to the bound phosphorus. In some embodiments, the "P modification" ... 1 (Wherein X, L and R 1 are independently as defined and described herein and below).

[0110] Blockmir: As used herein, the term "blockmir" refers to an oligonucleotide chain in which the pattern of structural features that characterize each individual nucleotide unit is characterized by the presence of at least two consecutive nucleotide units that share a common structural feature at the internucleotide phosphorus linkage. A common structural feature refers to a common stereochemistry at the linking phosphorus or a common modification at the linking phosphorus. In some embodiments, the at least two consecutive nucleotide units that share a common structural feature at the internucleotide phosphorus linkage are referred to as a "block."

[0111] In some embodiments, the blockmirror is a "stereoblockmirror," e.g., at least two consecutive nucleotide units have the same stereochemistry at the linked phosphorus. Such at least two consecutive nucleotide units form a "stereoblockmirror." For example, (Rp,Sp)-ATsCs1GA is a stereoblockmirror because at least two consecutive nucleotide units, Ts and Cs1, have the same stereochemistry at the linked phosphorus (both Sp). In the same oligonucleotide, (Rp,Sp)-ATsCs1 forms a block, which is a stereoblock.

[0112] In some embodiments, a blockmir is a "P-modified blockmir," e.g., at least two consecutive nucleotide units have the same modification at the linked phosphorus. Such at least two consecutive nucleotide units form a "P-modified block." For example, (Rp,Sp)-ATsCsGA is a P-modified blockmir because at least two consecutive nucleotide units, Ts and Cs, have the same P modification (i.e., both are phosphorothioate diester). In the same oligonucleotide of (Rp,Sp)-ATsCsGA, Ts and Cs form a block, which is a P-modified block.

[0113] In some embodiments, a blockmir is a "linked blockmir," e.g., at least two consecutive nucleotide units have the same stereochemistry and the same modification at the linking phosphorus. At least two consecutive nucleotide units form a "linked block." For example, (Rp,Rp)-ATsCsGA is a linked blockmir because at least two consecutive nucleotide units, Ts and Cs, have the same stereochemistry (both Rp) and P modification (both phosphorothioate). In the same oligonucleotide of (Rp,Rp)-ATsCsGA, TsCs forms a block and is a linked block.

[0114] In some embodiments, the blockmir comprises one or more blocks independently selected from a stereoblock, a P-modified block, and a linking block, hi some embodiments, the blockmir is a stereoblockmir to one block, and / or a P-modified blockmir to another block, and / or a linking blockmir to yet another block. For example, (Rp,Rp,Rp,Rp,Rp,Sp,Sp,Sp)-AAsTsCsGsAs1Ts1Cs1Gs1ATCG is a stereoblockmir with respect to the stereoblock AsTsCsGsAs1 (all Rp's at the bound phosphorus) or Ts1Cs1Gs1 (all Sp's at the bound phosphorus), a P-modified blockmir with respect to the P-modified block AsTsCsGs (all s-bonds) or As1Ts1Cs1Gs1 (all s1-bonds), or a bonded blockmir with respect to the bonded block AsTsCsGs (all Rp's and all s-bonds at the bound phosphorus) or Ts1Cs1Gs1 (all Sp's and all s1-bonds at the bound phosphorus).

[0115] Altmer: As used herein, the term "altmer" refers to an oligonucleotide chain whose structural feature pattern characterizing each individual nucleotide unit is characterized by the absence of two consecutive nucleotide units in the oligonucleotide chain that share a particular structural feature in the internucleotide phosphorus bond. In some embodiments, an altmer is designed so that it contains a repeating pattern. In some embodiments, an altmer is designed so that it does not contain a repeating pattern.

[0116] In some embodiments, the altomer is a "stereoaltomer," e.g., no two consecutive nucleotide units have the same stereochemistry at the linked phosphorus, e.g., (Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC.

[0117] In some embodiments, the altmer is a "P-modified altmer," e.g., no two consecutive nucleotide units have the same modification at the linked phosphorus, e.g., all (Sp)CAs1GsT, where each linked phosphorus has a different P modification than the others.

[0118] In some embodiments, the altmer is a "linked altmer," e.g., no two consecutive nucleotide units have the same stereochemistry or the same modification at the linked phosphorus, e.g., (Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCs1CsTs1CsAs1GsTs1CsTs1GsCs1TsTs2CsGs3CsAs4CsC.

[0119] Unimer: As used herein, the term "unimer" refers to an oligonucleotide chain whose structural feature pattern characterizes each individual nucleotide unit, in which all nucleotide units in the chain share at least one common structural feature at the internucleotide phosphorus linkage. A common structural feature refers to a common stereochemistry at the linking phosphorus or a common modification at the linking phosphorus.

[0120] In some embodiments, the unimer is a "stereounimer," e.g., all nucleotide units have the same stereochemistry at the linkage phosphorus, e.g., all (Sp)-CsAs1GsT, where all the linkages have Sp phosphorus.

[0121] In some embodiments, the unimer is a "P-modified unimer," e.g., all nucleotide units have the same modification at the linked phosphorus, e.g., (Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC, where all the internucleotide linkages are phosphorothioate diesters.

[0122] In some embodiments, the unimer is a "linked unimer," e.g., all nucleotide units have the same stereochemistry and the same modification at the linked phosphorus, e.g., all (Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC, where all the internucleotide linkages are phosphorothioate diesters with an Sp linked phosphorus.

[0123] Gapmer: As used herein, the term "gapmer" refers to an oligonucleotide chain characterized in that at least one internucleotide phosphorus bond of the oligonucleotide chain is a phosphodiester bond, such as that found in natural DNA or RNA. In some embodiments, one or more internucleotide phosphorus bonds of the oligonucleotide chain are phosphodiester bonds, such as those found in natural DNA or RNA. For example, all (Sp)-CAs1GsT, in which the internucleotide bond between C and A is a phosphodiester bond.

[0124] Skipmer: As used herein, the term "skipmer" refers to a type of gapmer in which every other internucleotide phosphorus bond of the oligonucleotide strand is a phosphodiester bond, such as found in natural DNA or RNA, and every other internucleotide phosphorus bond of the oligonucleotide strand is a modified internucleotide bond, e.g., all (Sp)-AsTCs1GAs2TCs3G.

[0125] For purposes of this invention, chemical elements are identified according to the Periodic Table of the Elements, edited by CAS, Handbook of Chemistry and Physics, 67th Edition, 1986-87, inside cover.

[0126] The methods and structures described herein relating to the compounds and compositions of the present invention also apply to pharmaceutically acceptable acid or base addition salts and all stereoisomers of these compounds and compositions. [Brief explanation of the drawings]

[0127] [Figure 1] The chiral control oligonucleotide has a significantly different retention time by HPLC compared to the stereorandom oligonucleotide. A: Crude chiral control oligonucleotide (oligonucleotide 101); C: The corresponding stereorandom oligonucleotide (oligonucleotide 118).

[0128] [Figure 2] HPLC of chiral-controlled and stereorandom oligonucleotides. A: Oligonucleotide 101 (all Rp); B: Oligonucleotide 102 (all Sp); and C: Oligonucleotide 118 (stereorandom).

[0129] [Figure 3] Tm of chiral controlled oligonucleotides and stereorandom oligonucleotides.

[0130] [Figure 4] Representative data: Melting curve analysis of target and endogenous control pair-generated single amplicons.

[0131] [Figure 5] Representative data and IC50 of compounds.

[0132] [Figure 6] HPLC of crude (Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] ((RRS)6-R, stereoblockmer and P-modified unimer (s-unimer)).

[0133] [Figure 7] Purified (Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] ((RRS)6-R, stereoblockmer and P-modified unimer (s-unimer)) by HPLC.

[0134] [Figure 8]LCMS of (Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] ((RRS)6-R, stereoblockmer and P-modified unimer (s-unimer)).

[0135] [Figure 9] HPLC of crude (Sp,Rp,Rp,Sp,Rp,Rp,Rp,Sp,Rp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] (S-(RRS)6, stereoblockmer and P-modified unimer (s-unimer)).

[0136] [Figure 10] Purified (Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] (S-(RRS)6, stereoblockmer and P-modified unimer (s-unimer)) by HPLC.

[0137] [Figure 11] LCMS of (Sp,Rp,Rp,Sp,Rp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] (S-(RRS)6, stereoblockmer and P-modified unimer (s-unimer)).

[0138] [Figure 12] HPLC of crude (Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp)d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] (RS-(RRS)5-RR, stereoblockmer and P-modified unimer (s-unimer)).

[0139] [Figure 13] Purified (Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp)d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] (RS-(RRS)5-RR, stereoblockmer and P-modified unimer (s-unimer)) by HPLC.

[0140] [Figure 14] LCMS of (Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC] (RS-(RRS)5-RR, stereoblockmer and P-modified unimer (s-unimer)).

[0141] [Figure 15] HPLC of crude (Rp,Rp,Rp,Sp,Sp,Sp,Sp,Sp,Rp,Rp,Rp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] (3R-5S-3R, stereoblockmer and P-modified unimer (s1 unimer)).

[0142] [Figure 16] HPLC of purified (Rp,Rp,Rp,Sp,Sp,Sp,Sp,Sp,Sp,Rp,Rp,Rp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] (3R-5S-3R, stereoblockmer and P-modified unimer (s1 unimer)).

[0143] [Figure 17] LCMS of (Rp,Rp,Rp,Sp,Sp,Sp,Sp,Sp,Rp,Rp,Rp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G] (3R-5S-3R, stereoblockmer and P-modified unimer (s1 unimer)).

[0144] [Figure 18] HPLC of crude total (Rp)-d[Cs3As3Gs3T] (P-modified unimer (s3 unimer), stereounimer, and coupled unimer).

[0145] [Figure 19] LCMS of all (Rp)-d[Cs3As3Gs3T] (P-modified unimer (s3 unimer), stereounimer, and coupled unimer).

[0146] [Figure 20] HPLC of crude total (Rp)-d[Cs2As2Gs2T] (P-modified unimer (s2 unimer), stereounimer, and coupled unimer).

[0147] [Figure 21] LCMS of all (Rp)-d[Cs2As2Gs2T] (P-modified unimer (s2 unimer), stereounimer, and coupled unimer).

[0148] [Figure 22] HPLC of crude total (Sp)-d[Cs1AGs1T] (gapmer, stereoaltomer, P-modified altmer, and coupled altmer).

[0149] [Figure 23] LCMS of all (Sp)-d[Cs1AGs1T] (gapmer, stereoaltomer, P-modified altmer, and conjugated altmer).

[0150] [Figure 24] Crude total (Rp)-d[TsCs1AsT] (stereounimer, P-modified altmer and coupled altmer).

[0151] [Figure 25] LCMS of all (Rp)-d[TsCs1AsT] (stereounimer, P-modified altmer, and coupled altmer).

[0152] [Figure 26] Illustrative oligonucleotides described in WO2012 / 030683 and contemplated for synthesis using the methods of the present invention.

[0153] [Figure 27] Illustrative oligonucleotides described in WO2012 / 030683 and contemplated for synthesis using the methods of the present invention.

[0154] [Figure 28] Illustrative oligonucleotides described in WO2012 / 030683 and contemplated for synthesis using the methods of the present invention.

[0155] [Figure 29] Illustrative oligonucleotides described in WO2012 / 030683 and contemplated for synthesis using the methods of the present invention.

[0156] [Figure 30] Illustrative oligonucleotides described in WO2012 / 030683 and contemplated for synthesis using the methods of the present invention.

[0157] [Figure 31] Illustrative linkers described in WO2012 / 030683 for use in the methods of the present invention.

[0158] [Figure 32] Illustrative linkers described in WO2012 / 030683 for use in the methods of the present invention.

[0159] [Figure 33] Illustrative linkers described in WO2012 / 030683 for use in the methods of the present invention.

[0160] [Figure 34] Illustrative linkers described in WO2012 / 030683 for use in the methods of the present invention.

[0161] [Figure 35] Reverse-phase HPLC of crude DMT-treated oligonucleotides: ONT-75 (Panel A); ONT-80 (Panel B); ONT-77 (Panel C); ONT-81 (Panel D); ONT-87 (Panel E); ONT-88 (Panel F); ONT-89 (Panel G); ONT-82 (Panel H); ONT-84 (Panel I); ONT-85 (Panel J); ONT-86 (Panel K).

[0162] [Figure 36] Reverse-phase HPLC of purified DMT-free oligonucleotides: ONT-75 (Panel A); ONT-80 (Panel B); ONT-77 (Panel C); ONT-81 (Panel D); ONT-87 (Panel E); ONT-88 (Panel F); ONT-89 (Panel G); ONT-82 (Panel H); ONT-84 (Panel I); ONT-85 (Panel J); ONT-86 (Panel K).

[0163] [Figure 37] Overlay of purified DMT-free oligonucleotides: ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88, ONT-89, and ONT-41 (Panel A); Overlay of reverse-phase HPLC traces of ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88, ONT-89, and ONT-41 (Panel B).

[0164] [Figure 38] Overlay of reverse-phase HPLC traces of purified DMT-free oligonucleotides: ONT-82, ONT-84, ONT-85, ONT-86, and ONT-83 (Panel A); Overlay of reverse-phase HPLC traces of ONT-82, ONT-84, ONT-85, ONT-86, and ONT-83 (Panel B).

[0165] [Figure 39]Tm overlay of chiral control oligonucleotides ONT-81, ONT-41, ONT-75, ONT-77, and ONT-80.

[0166] [Figure 40] Graphical representation of the time course of serum human apolipoprotein B protein levels compared to PBS following intraperitoneal administration of 5 mg / kg of stereoisomer or mipomersen to huApoB mice for ONT-41, ONT-75, ONT-80, ONT-77, and ONT-81. Down arrow indicates dosing day.

[0167] [Figure 41] 1 is a graphical representation of the time course of serum human apolipoprotein B protein levels following intraperitoneal administration of 5 mg / kg of stereoisomers or mipomersen to huApoB mice compared to PBS for mipomersen, "all-R" mipomersen, "all-S" mipomersen, "RSR" mipomersen, and "SRS" mipomersen. The down arrow indicates the day of dosing.

[0168] [Figure 42] 1 is a graphical representation of the time course of serum human apolipoprotein B protein levels following intraperitoneal administration of 10 mg / kg of stereoisomers or mipomersen to huApoB mice compared to PBS for mipomersen, "all-R" mipomersen, "all-S" mipomersen, "RSR" mipomersen, and "SRS" mipomersen. The down arrow indicates the day of dosing.

[0169] [Figure 43] Illustrated time course of serum human apolipoprotein B protein levels compared to PBS following intraperitoneal administration of 5 mg / kg of stereoisomer or mipomersen to huApoB mice for mipomersen, ONT-87, ONT-88, and ONT-89. Down arrow indicates dosing day.

[0170] [Figure 44]Graphical representation of the time course of serum human apolipoprotein B protein levels compared to PBS following intraperitoneal administration of 10 mg / kg of stereoisomer or mipomersen to huApoB mice for ONT-87, ONT-88, and ONT-89. Down arrow indicates dosing day.

[0171] [Figure 45] Graphic representation of the % remaining PCSK-9 mRNA after treatment of Hep3B with siRNA duplexes.

[0172] [Figure 46] Graphical representation of % PCSK-9 mRNA remaining after Hep3B treatment using siRNA duplex curve fitting.

[0173] .

[0174] [Figure 47] Graphic representation of the % PCSK-9 mRNA remaining after treatment of HeLa with siRNA duplexes.

[0175] [Figure 48] Graphical representation of % PCSK-9 mRNA remaining after HeLa treatment with siRNA duplex curve fitting.

[0176] [Figure 49] Graphic representation of the % PCSK-9 mRNA remaining after treatment of HeLa with siRNA duplexes containing 3 phosphorothioate stereocenters.

[0177] [Figure 50] Graphic representation of % PCSK-9 mRNA remaining after treatment of HeLa with siRNA duplexes containing 3 phosphorothioate stereocenters curve fitting.

[0178] [Figure 51] Overlay of reverse-phase HPLC traces of purified DMT-free oligonucleotides: ONT-108, ONT-109, and ONT-114.

[0179] [Figure 52] Overlay of reverse-phase HPLC traces of purified DMT-free oligonucleotides: ONT-106, ONT-107, and ONT-114.

[0180] [Figure 53] Illustrated time course of serum human apolipoprotein B protein levels compared to PBS following intraperitoneal administration of 10 mg / kg of stereoisomers or mipomersen to huApoB mice. Down arrow indicates dosing day.

[0181] [Figure 54] Graphical representation of the time course of serum human apolipoprotein B protein levels compared to PBS after multiple intraperitoneal administrations (n=3-4) of 5 mg / kg stereoisomers or mipomersen to huApoB mice. Downward arrows indicate dosing days.

[0182] [Figure 55] Serum human apolipoprotein B protein levels compared to PBS on day 17 after intraperitoneal administration of 10 mg / kg of stereoisomer (ONT-87, ONT-88, or ONT-89) or mipomersen to huApoB mice.

[0183] [Figure 56] Serum human apolipoprotein B protein levels compared to PBS on day 24 after intraperitoneal administration of 10 mg / kg of stereoisomer (ONT-87, ONT-88, or ONT-89) or mipomersen to huApoB mice.

[0184] [Figure 57] Serum human apolipoprotein B protein levels after administration of 10 mg / kg of stereoisomer (ONT-41, ONT-87, ONT-88, or ONT-89) to huApoB mice compared to PBS.

[0185] [Figure 58]Serum human apolipoprotein B protein levels after administration of 10 mg / kg of stereoisomer (ONT-87, ONT-88, or ONT-89) to huApoB mice compared to PBS.

[0186] [Figure 59] Plot of ion-exchange HPLC quantitative analysis of svPDE digestion studies on oligonucleotides ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88, ONT-89 and ONT-41.

[0187] [Figure 60] Ion-exchange HPLC of enzymatic digestion studies with nP1 on oligonucleotide ONT-75(all(Rp))-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mCs.

[0188] [Figure 61] Ion-exchange HPLC analysis of enzymatic digestion studies using nP1 for oligonucleotide ONT-77(Rp,Rp,Rp,Rp,Rp,Sp,Sp,Sp,Sp,Sp,Sp,Sp,Sp,Sp,Sp,Sp,Sp,Sp,Rp,Rp,Rp)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC (5R-10S-4R).

[0189] [Figure 62] Ion-exchange HPLC of enzymatic digestion studies with nP1 for oligonucleotide ONT-80(all(Sp))-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mCs.

[0190] [Figure 63]Ion-exchange HPLC analysis of enzymatic digestion studies using nP1 for oligonucleotide ONT-81 (Sp,Sp,Sp,Sp,Sp,Rp,Rp,Rp,Rp,Rp,Rp,Rp,Rp,Rp,Rp,Sp,Sp,Sp)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC (5S-10R-4S).

[0191] [Figure 64] Ion-exchange HPLC analysis of enzymatic digestion studies using nP1 for oligonucleotide ONT-87 (Rp,Rp,Rp,Rp,Rp,Sp,Sp,Rp,Sp,Rp,Sp,Sp,Rp,Sp,Sp,Rp,Rp,Rp,Rp,Rp)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC (5R-(SSR)3-5R).

[0192] [Figure 65] Ion-exchange HPLC analysis of enzymatic digestion studies using nP1 for oligonucleotide ONT-88 (Sp,Sp,Sp,Sp,Sp,Rp,Rp,Sp,Rp,Sp,Rp,Rp,Sp,Sp,Sp,Sp,Sp,Sp)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC (5S-(RRS)3-5S).

[0193] [Figure 66] Ion-exchange HPLC analysis of enzymatic digestion studies using nP1 for oligonucleotide ONT-89 (Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCsGs5mCsAs5mCs5mC((SR)9S).

[0194] [Figure 67]Ion-exchange HPLC of enzymatic digestion studies with nP1 for oligonucleotide ONT-41 (diastereomixture)-Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs 5mCsTsTs5mCsGs5mCsAs5mCs5mCs.

[0195] [Figure 68] Comparison of the stability of chirally pure oligonucleotides ONT-75 and ONT-77 with the stereorandom "parent" oligonucleotide ONT-41 (mipomersen) in preincubated rat whole liver homogenates.

[0196] [Figure 69] UPLC profile of oligonucleotide derivative production using 13b monomer.

[0197] [Figure 70] UPLC profile of oligonucleotide derivative production using 27 monomers.

[0198] [Figure 71] Mouse apolipoprotein B / GAPDH mRNA levels after transfection of primary cultured mouse hepatocytes with stereoisomers (ONT-82, ONT-83, ONT-84, ONT-85, or ONT-86) compared with mock and untreated controls.

[0199] [Figure 72] Mouse apolipoprotein B / GAPDH mRNA levels after transfection of primary cultured mouse hepatocytes with stereoisomers (ONT-83, ONT-84, ONT-85, or ONT-86) compared with mock and untreated controls. DETAILED DESCRIPTION OF THE INVENTION

[0200] Synthetic oligonucleotides provide useful molecular tools for a wide variety of applications. For example, oligonucleotides are useful in therapeutics, diagnostics, research, and novel nanomaterial applications. The use of natural nucleic acids (e.g., unmodified DNA or RNA) is limited by their susceptibility to endo- and exonucleases. Therefore, to circumvent these shortcomings, various synthetic equivalents have been developed. These include synthetic oligonucleotides containing backbone modifications that make these molecules less susceptible to degradation. From a structural perspective, such modifications to internucleotide phosphate linkages introduce chirality. It has become clear that certain properties of oligonucleotides can be affected by the arrangement of phosphorus atoms forming the oligonucleotide backbone. For example, in vitro studies have shown that properties of antisense nucleotides, such as binding affinity, specific binding sequences with complementary RNA, and stability against nucleases, are particularly affected by backbone chirality (e.g., the arrangement of the phosphorus atom). Thus, the present invention encompasses the recognition that there is a need for chiral-controlled oligonucleotides, including phosphorus atom-modified nucleic acids, and related compositions and methods. In some embodiments, the present invention provides chiral controlled oligonucleotides that are structurally optimized and exhibit certain desirable properties, such as, for example, improved stability and increased efficacy in in vitro and / or in vivo applications.

[0201] Oligonucleotides in which one or two of the two non-bridging oxygen atoms of the internucleotide phosphate are replaced with different types of atoms or substituents are known to be useful as therapeutic agents, and investigations are being conducted to clarify the mechanism of enzymatic reactions. However, such oligonucleotides can exhibit undesirable properties that make them unusable in many applications (e.g., susceptibility to degradation by nucleases, poor cell membrane permeability). Therefore, various types of chemical modifications have been developed to improve properties and / or confer new functions.

[0202] Modified Oligonucleotide Structures As noted above, in view of the usefulness of oligonucleotide compositions in various applications and conditions, those skilled in the art have endeavored to develop modifications of oligonucleotide structures, as compared to native oligonucleotide molecules, that may, for example, have preferred or desirable properties or characteristics for use in particular applications and conditions. Exemplary such modifications are described below.

[0203] WO 2010 / 141471 (hereinafter "Traversa I") teaches the modification of different types of nucleic acid structures modified to have reduced net polyanionic charge. WO 2010 / 039543 (hereinafter "Traversa II") teaches compositions and methods for making neutral polynucleotides (NNs) with reduced polyanionic charge. WO 2008 / 008476 (hereinafter "Traversa III") describes the synthesis of SATE (Imbach-type) phosphate prodrugs. Traversa I, II, and III do not disclose the chiral-controlled oligonucleotides, compositions thereof, and methods for making them described in the present invention.

[0204] International Publication No. 2010 / 072831 (hereinafter "Girindus et al.") also teaches the modification of oligonucleotides. In particular, Girindus et al. disclose the use of sulfurizing agents to generate phosphorothioate triesters as prodrugs. Girindus et al. does not disclose the chiral controlled oligonucleotides, compositions thereof, and methods of making them described in the present invention.

[0205] Similarly, International Publication No. 2004 / 085454 (hereinafter "Avecia I") teaches, for example, the preparation of phosphorothioate oligonucleotides through transient silylation of poly-H-phosphonate diesters. International Publication No. 2001 / 027126 (hereinafter "Avecia II") teaches a process for the solid-phase synthesis of phosphotriester oligonucleotides in which an H-phosphonate monomer is coupled to a solid-supported 5'-hydroxyl oligonucleotide and the resulting H-phosphonate diester is further sulfurized to a phosphorothioate triester. International Publication No. 2001 / 064702 (hereinafter "Avecia III") is similar to Avecia II, but describes solid-phase synthesis on a different solid support. Avecia I, II, and III do not disclose the chiral-controlled oligonucleotides, compositions thereof, and methods of making them according to the present invention.

[0206] WO 1997 / 006183 (hereinafter "Chiron") teaches oligonucleotides containing asymmetric phosphorus, such as stereopure amidated oligonucleotides, having cationic internucleotide bonds. Chiron teaches mixtures of diastereomers or stereopure oligonucleotides obtained by crystallization using a solution such as column chromatography. Chiron does not teach the chiral controlled oligonucleotides, their compositions, and methods of preparation using the same described in the present invention.

[0207] WO 2009 / 146123 (hereinafter "Spring Bank I") discloses compositions and methods for treating viral infections using substituted phosphate oligonucleotides and phosphorothioate triesters. WO 2007 / 070598 (hereinafter "Spring Bank II") teaches the synthesis of phosphotriester and phosphorothioate prodrugs as antiviral nucleic acids. Spring Bank I and II do not disclose the chiral-controlled oligonucleotides, compositions thereof, and methods of making them described in the present invention.

[0208] European Patent No. 0779893 (hereinafter "Hybridon") teaches lipid-soluble prodrugs of antisense oligonucleotides that have high cellular uptake, and identifies Rp and Sp phosphorothioate and phosphorothioate triester dimers with different enzymatic stabilities. Hybridon does not disclose the chiral controlled oligonucleotides, their compositions, and methods of making them described in the present invention.

[0209] International Publication No. WO 1997 / 047637 (hereinafter "Imbach I") generally teaches Imbach "SATE" (S-acylthioethyl) prodrug oligonucleotide compositions and methods. Imbach I describes, for example, the preparation of certain prodrug oligonucleotides using bioreversible phosphotriester prodrugs and phosphoramidites containing post-synthetic alkylation or prodrug groups. U.S. Patent No. 6,124,445 (hereinafter "Imbach II") teaches modified antisense and chimeric prodrug oligonucleotides. Imbach I and II do not disclose the chiral-controlled oligonucleotides, compositions thereof, and methods of making them according to the present invention.

[0210] WO 2006 / 065751 (hereinafter "Beaucage") teaches CpG oligonucleotide phosphorothioate prodrugs containing thermally labile substituents (substituents introduced via phosphoramidite monomers) and their uses. Beaucage does not disclose the chiral controlled oligonucleotides, their compositions, and methods of making them described in the present invention.

[0211] Takeshi Wada et al. have developed a novel method for the stereocontrolled synthesis of P-chiral nucleic acids using amidite chiral auxiliaries (Japanese Patent No. 4348077, International Publication Nos. 2005 / 014609, 2005 / 92909, and 2010 / 064146, collectively referred to herein as "Wada I"). In particular, International Publication No. 2010 / 064146 (referred to herein as "Wada II") discloses a method for the synthesis of phosphate-modified nucleic acids with controlled stereochemical configuration at phosphorus. However, the Wada II method is limited in that it does not provide for the individual P-modification of each chiral linked phosphate in a controlled and designed manner. That is, the Wada II P-modification attachment method provides for the production of a condensation intermediate poly H-phosphonate oligonucleotide chain that, once created to the desired length, is mass-modified at the attached phosphate to provide, for example, the desired phosphorothioate diester, phosphoramidate, or boranophosphate, or another such phosphorus-atom-modified nucleic acid (referred to in the literature as Route B, Scheme 6, p. 36). Furthermore, the Wada II H-phosphonate oligonucleotide chains are shorter in length (e.g., dimers, trimers, or tetramers). Combined with the fact that no capping step is included in Route B, which generally exhibits lower purity as a result of the accumulation of "n-1" by-products, the Wada II pathway has limitations with regard to the synthesis of longer oligonucleotides. While Wada II generally contemplates that a particular oligonucleotide may contain different modifications at each attached phosphate, Wada II does not describe or suggest the method described herein for repeatedly incorporating such controlled modifications.To the extent that Wada II describes a synthesis cycle that does not require complete incorporation of the H-phosphonate intermediate oligonucleotide prior to modification with the attached phosphate (referred to in the literature as Route A, p. 35, Scheme 5, "Synthesis of Nucleic Acids Containing Chiral X-Phosphonate Moieties of Formula 1 via Route A"), this general disclosure does not teach the critical steps required to incorporate certain P-modifications provided by the present invention, nor does it provide the efficiency or versatility to make this cycle useful in the synthesis of chiral controlled P-modified oligonucleotides, particularly for the synthesis of longer oligonucleotides.

[0212] At least one such inefficiency in Wada II is described by Wada et al. in International Publication No. 2012 / 039448 (hereinafter "Wada III"). Wada III discloses the use of novel chiral auxiliaries in the Wada II method to generate and subsequently modify H-phosphonate oligonucleotides, once assembled, to yield, among other things, phosphorothioates. Wada et al. confirmed in Wada III that the four types of chiral auxiliaries disclosed in Wada II cannot be efficiently removed because they form strong bonds with the phosphorus in the attached phosphate. Wada III noted that harsh conditions are required to remove the Wada II chiral auxiliaries, which tend to compromise the integrity of the oligonucleotide product. Wada III confirmed this is particularly problematic when synthesizing long oligonucleotides, at least because as the degradation reaction proceeds, additional by-products are generated that further react with and degrade the oligonucleotide product. Thus, Wada III demonstrates the use of S N The mechanism of 1 has been used to provide chiral auxiliaries that can be efficiently cleaved from oligonucleotides via a β-elimination pathway under mildly acidic conditions (route B) or via a β-elimination pathway under relatively mildly basic conditions.

[0213] Those skilled in the chemical and synthetic arts will readily appreciate the complexities associated with producing, for example, the chiral controlled oligonucleotides provided by the present invention. For example, to synthesize and isolate a chiral controlled oligonucleotide, the conditions for each monomer addition must be designed so that: (1) the chemistry is compatible with each portion of the incremental oligonucleotide; (2) by-products generated during each monomer addition do not compromise the structural and stereochemical integrity of the incremental oligonucleotide; and (3) the composition of the final crude product is such that the desired chiral controlled oligonucleotide product is isolated.

[0214] Oligonucleotide phosphorothioates have shown therapeutic potential (Stein et al., Science (1993), 261:1004-12; Agrawal et al., Antisense Res. and Dev. (1992), 2:261-66; Bayever et al., Antisense Res. and Dev. (1993), 3:383-390). Oligonucleotide phosphorothioates prepared without regard to the stereochemistry of the phosphorothioate have been shown to be 2 nThey exist as a mixture of diastereomers, where n is the number of internucleotide phosphorothioate linkages. The chemical and biological properties of these diastereomeric phosphorothioates can be distinctly different from one another. For example, Wada et al. (Nucleic Acids Symposium Series No. 51, p. 119-120; doi:10.1093 / nass / nrm060) found that the stereodefined -(Rp)-(Ups)U / (Ap)A duplex exhibited higher Tm values ​​than the normal -(Up)U / (Ap)A and the stereodefined, non-duplex -(Sp)-(Ups)U. In another example, a study by Tang et al. (Nucleosides Nucleotides (1995), 14:985-990) found that stereo-pure Rp oligodeoxyribonucleoside phosphorothioates have lower stability to nucleases present in human serum than the parent oligodeoxyribonucleoside phosphorothioates with undefined phosphoryl chirality.

[0215] Chiral controlled oligonucleotides and chiral controlled oligonucleotide compositions The present invention provides chiral controlled oligonucleotides and chiral controlled oligonucleotide compositions with high crude purity and high diastereomeric purity. In some embodiments, the present invention provides chiral controlled oligonucleotides and chiral controlled oligonucleotide compositions with high crude purity. In some embodiments, the present invention provides chiral controlled oligonucleotides and chiral controlled oligonucleotide compositions with high diastereomeric purity.

[0216] In some embodiments, the present invention provides chiral controlled compositions comprising at least one type of a plurality of oligonucleotides, each type defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone P-modifications.

[0217] In some embodiments, the invention provides chiral controlled compositions comprising a plurality of oligonucleotides of the same type, each type defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone P-modifications. In some embodiments, the invention provides chiral controlled compositions comprising a plurality of two or more types of oligonucleotides, each type defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone P-modifications.

[0218] In some embodiments, the present invention provides oligonucleotides comprising one or more diastereomerically pure internucleotide linkages with respect to the chirally linked phosphate. In some embodiments, the present invention provides oligonucleotides comprising one or more diastereomerically pure internucleotide linkages having the structure of Formula I. In some embodiments, the present invention provides oligonucleotides comprising one or more diastereomerically pure internucleotide linkages with respect to the chirally linked phosphate and one or more phosphodiester linkages. In some embodiments, the present invention provides oligonucleotides comprising one or more diastereomerically pure internucleotide linkages with the structure of Formula I and one or more phosphodiester linkages. In some embodiments, the present invention provides oligonucleotides comprising one or more diastereomerically pure internucleotide linkages with the structure of Formula Ic and one or more phosphodiester linkages. In some embodiments, such oligonucleotides are prepared using stereoselective oligonucleotide synthesis, as described herein, to form pre-designed diastereomerically pure internucleotide linkages with respect to the chirally linked phosphate. For example, in one exemplary oligonucleotide designated (Rp / Sp,Rp / Sp,Rp / Sp,Rp,Rp,Sp,Sp,Sp,Sp,Sp,Sp,Sp,Sp,Rp,Rp,Rp,Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGs1Cs1As1CsC], the first three internucleotide linkages are generated using conventional oligonucleotide synthesis methods, and diastereomerically pure internucleotide linkages are generated with stereochemical control as described herein. Exemplary internucleotide linkages include those having the structure of Formula I, which is further described below. In some embodiments, such oligonucleotides further comprise sequences described herein, including, but not limited to, those set forth in Tables 2 and 4, and Appendices A, B, and C.

[0219] In some embodiments, provided oligonucleotides contain a combination of stereo-pure and stereo-random internucleotide linkages with respect to the chirality at the attached phosphate. For example, in some embodiments, it is desirable to have one or more blocks of stereo-defined internucleotide linkages within an oligonucleotide that is otherwise stereo-random with respect to the chirality at the attached phosphate. In some embodiments, it is desirable to have one or more blocks of stereo-random internucleotide linkages within an oligonucleotide that is otherwise stereo-defined with respect to the chirality at the attached phosphate.

[0220] In some embodiments, at least one nucleotide unit of a provided oligonucleotide is incorporated using stereoselective oligonucleotide synthesis as described herein to form a pre-designed diastereomerically pure internucleotide linkage with respect to a chiral linked phosphate. In some embodiments, at least two nucleotide units of a provided oligonucleotide are incorporated using stereoselective oligonucleotide synthesis as described herein to form at least two pre-designed diastereomerically pure internucleotide linkages with respect to a chiral linked phosphate. In some embodiments, at least three nucleotide units of a provided oligonucleotide are incorporated using stereoselective oligonucleotide synthesis as described herein to form at least three pre-designed diastereomerically pure internucleotide linkages with respect to a chiral linked phosphate. In some embodiments, at least one, two, or three pre-designed diastereomerically pure internucleotide linkages are adjacent to one another. In some embodiments, at least one, two, or three pre-designed diastereomerically pure internucleotide linkages are not adjacent to one another.

[0221] In some embodiments, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the nucleotide units of a provided oligonucleotide are incorporated using the stereoselective oligonucleotide synthesis methods described herein to form pre-designed diastereomerically pure internucleotide linkages with respect to the chiral linked phosphate. As described herein, in some embodiments, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the nucleotide units occur within one or more blocks, providing blockmirs. In some embodiments, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the nucleotide units occur in an alternating pattern, providing altmers. Those skilled in the relevant art will understand that any desired pattern can be achieved using the methods of the present invention discussed herein.

[0222] In some embodiments, the present invention provides chirality-controlled oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different stereochemistry and / or different P-modifications. In certain embodiments, the present invention provides chirality-controlled oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different P-modifications from each other. In certain embodiments, the present invention provides chirality-controlled oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different P-modifications from each other, wherein the chirality-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage. In certain embodiments, the present invention provides chirality-controlled oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different P-modifications from each other, wherein the chirality-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least one phosphorothioate diester internucleotide linkage. In certain embodiments, the present invention provides chirality-controlled oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different P-modifications from each other, wherein the chirality-controlled oligonucleotide comprises at least one phosphorothioate triester internucleotide linkage. In certain embodiments, the present invention provides chirality-controlled oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different P-modifications, and the chirality-controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least one phosphorothioate triester internucleotide linkage.

[0223] In certain embodiments, the present invention provides compounds independently comprising Formula I: [ka] wherein each variable is defined and described as follows. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising one or more modified internucleotide linkages of Formula I, wherein each internucleotide linkage of Formula I within the oligonucleotide has a P-modification that is different from each other ... 1 In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising one or more modified internucleotide linkages of Formula I, wherein each internucleotide linkage of Formula I within the oligonucleotide has a different X from each other. In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising one or more modified internucleotide linkages of Formula I, wherein each internucleotide linkage of Formula I within the oligonucleotide has a different -LR 1 It has.

[0224] In some embodiments, the present invention provides chiral controlled oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different stereochemistry and / or different P-modifications from one another. In some embodiments, the present invention provides chiral controlled oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different stereochemistry from one another, and at least a portion of the structure of the chiral controlled oligonucleotide is characterized by a repeating pattern of alternating stereochemistry.

[0225] In some embodiments, the present invention provides chiral controlled oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide are -XLR 1with different X atoms in the moiety, and / or -XLR 1 with different L groups in the moiety and / or -XLR 1 Different R in different parts 1 They have different P-modifications from each other in the sense that they have different atoms.

[0226] In some embodiments, the present invention provides chiral controlled oligonucleotides, wherein at least two of the individual internucleotide linkages within the oligonucleotide have different stereochemistry and / or different P-modifications from one another, and the oligonucleotide has the following formula: [S B n1R B n2S B n3R B n4...S B nxR B ny] and having a structure represented by Here, each R B independently represents a block of nucleotide units having the R configuration at the attached phosphate; Each S B independently represents a block of nucleotide units having an S configuration at the attached phosphate; each of n1 through ny is zero or an integer, with the requirement that at least one odd number n and at least one even number n is non-zero, such that the oligonucleotide contains at least two individual internucleotide linkages of different stereochemistry; and wherein the sum of n1 through ny is 2 to 200, and in some embodiments, the lower limit is selected from the group consisting of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more, and the upper limit is selected from the group consisting of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, and 200 or more, and the upper limit is greater than the lower limit.

[0227] In some such embodiments, each n is the same value; in some embodiments, each even n is the same value as each other even n; in some embodiments, each odd n is the same value as each other odd n; in some embodiments, at least two even n are different values ​​from each other; in some embodiments, at least two odd n are different values ​​from each other.

[0228] In some embodiments, at least two adjacent n's are equal to each other, and the provided oligonucleotides comprise adjacent blocks of equal length S and R stereochemical bonds. In some embodiments, the provided oligonucleotides comprise repeating blocks of equal length S and R stereochemical bonds. In some embodiments, the provided oligonucleotides comprise repeating blocks of S and R stereochemical bonds, and at least two such blocks are different lengths from each other; in some such embodiments, each S stereochemical block is the same length and different from the length of each R stereochemical, and the lengths of each R stereochemical may optionally be the same length as each other.

[0229] In some embodiments, at least two adjacent n's, skipping one other than n, are equal to each other, and the provided oligonucleotide comprises at least two blocks of bonds of a first stereochemistry that are equal in length, separated by blocks of bonds of a different stereochemistry, which may be the same length as or different from the blocks of the first stereochemistry.

[0230] In some embodiments, the n's associated with the linking blocks at the ends of a provided oligonucleotide are the same length. In some embodiments, a provided oligonucleotide has endblocks of the same linking stereochemistry. In some such embodiments, the endblocks are separated from one another by midblocks of different linking stereochemistry.

[0231] In some embodiments, the formula [S B n1R B n2S B n3R B n4...S B nxR B ny], provided oligonucleotides are stereoblockmers. B n1R B n2S B n3R B n4...S B nxR B ny] and provided oligonucleotides are stereoskipmers. B n1R B n2S B n3R B n4...S B nxR B ny], provided that the oligonucleotide is a stereoisomer. B n1R B n2S B n3R B n4...S B nxR B ny] and provided oligonucleotides are gapmers.

[0232] In some embodiments, the formula [S B n1R B n2S B n3R B n4...S B nxR B ny], provided oligonucleotides can have any of the patterns described above, and further include patterns of P-modifications. For example, in some embodiments, oligonucleotides of the formula [S B n1R B n2S B n3R B n4...S B nxR B ny] and provided oligonucleotides are stereoskipmers and P-modified skippmers.B n1R B n2S B n3R B n4...S B nxR B ny], provided oligonucleotides are stereoblockmers and P-modified altmers. In some embodiments, oligonucleotides of formula [S B n1R B n2S B n3R B n4...S B nxR B ny] and provided oligonucleotides are stereoaltomers and P-modified blockmirs.

[0233] In some embodiments, the formula [S B n1R B n2S B n3R B n4...S B nxR B ny], independently represent the formula I: [ka] a chiral controlled oligonucleotide containing one or more modified internucleotide linkages having the structure: where P * is an asymmetric phosphorus atom, either Rp or Sp; W is O, S or Se; Each of X, Y and Z is independently -O-, -S-, -N(-LR 1 )-, or L; L is a covalent bond or an optionally substituted, straight-chain or branched C1-C 10alkylene, wherein one or more methylene units of L are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R') optionally and independently substituted by -C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-; R 1 is halogen, R, or optionally substituted C1-C 50 aliphatic, wherein one or more methylene units are optionally and independently replaced by optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-; Each R' is independently -R, -C(O)R, -COR, or -SOR, or: two R' on the same nitrogen together with their intervening atoms form an optionally substituted heterocyclic or heteroaryl ring, or two R' on the same carbon together with their intervening atoms form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring; -Cy- is an optionally substituted divalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene; each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl; and each TIFF2025066783000010.tif10166 represents the bond to the nucleoside independently.

[0234] In some embodiments, the chiral controlled oligonucleotide comprises one or more modified internucleotide phosphate linkages. In some embodiments, the chiral controlled oligonucleotide comprises, for example, phosphorothioate or phosphorothioate triester linkages. In some embodiments, the chiral controlled oligonucleotide comprises phosphorothioate triester linkages. In some embodiments, the chiral controlled oligonucleotide comprises at least two phosphorothioate triester linkages. In some embodiments, the chiral controlled oligonucleotide comprises at least three phosphorothioate triester linkages. In some embodiments, the chiral controlled oligonucleotide comprises at least four phosphorothioate triester linkages. In some embodiments, the chiral controlled oligonucleotide comprises at least five phosphorothioate triester linkages. Such exemplary modified internucleotide phosphate linkages are further described herein.

[0235] In some embodiments, the chiral controlled oligonucleotide contains different internucleotide phosphate linkages. In some embodiments, the chiral controlled oligonucleotide contains at least one phosphodiester internucleotide linkage and at least one modified internucleotide linkage. In some embodiments, the chiral controlled oligonucleotide contains at least one phosphodiester internucleotide linkage and at least one phosphorothioate triester linkage. In some embodiments, the chiral controlled oligonucleotide contains at least one phosphodiester internucleotide linkage and at least two phosphorothioate triester linkages. In some embodiments, the chiral controlled oligonucleotide contains at least one phosphodiester internucleotide linkage and at least three phosphorothioate triester linkages. In some embodiments, the chiral controlled oligonucleotide contains at least one phosphodiester internucleotide linkage and at least four phosphorothioate triester linkages. In some embodiments, the chiral controlled oligonucleotide contains at least one phosphodiester internucleotide linkage and at least five phosphorothioate triester linkages. Such exemplary modified internucleotide phosphate linkages are further described herein.

[0236] In some embodiments, the phosphorothioate triester linkage includes a chiral auxiliary used, for example, to control the stereoselectivity of the reaction. In some embodiments, the phosphorothioate triester linkage does not include a chiral auxiliary. In some embodiments, the phosphorothioate triester linkage is intentionally maintained until and / or throughout administration to a subject.

[0237] In some embodiments, the chiral controlled oligonucleotide is attached to a solid support. In some embodiments, the chiral controlled oligonucleotide is cleaved from the solid support.

[0238] In some embodiments, the chiral controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least two consecutive modified internucleotide linkages, hi some embodiments, the chiral controlled oligonucleotide comprises at least one phosphodiester internucleotide linkage and at least two consecutive phosphorothioate triester internucleotide linkages.

[0239] In some embodiments, the chiral controlled oligonucleotide is a blockmir. In some embodiments, the chiral controlled oligonucleotide is a stereoblockmir. In some embodiments, the chiral controlled oligonucleotide is a P-modified blockmir. In some embodiments, the chiral controlled oligonucleotide is a linked blockmir.

[0240] In some embodiments, the chiral controlled oligonucleotide is an altomer. In some embodiments, the chiral controlled oligonucleotide is a stereoaltomer. In some embodiments, the chiral controlled oligonucleotide is a P-modified altomer. In some embodiments, the chiral controlled oligonucleotide is a linked altomer.

[0241] In some embodiments, the chiral controlled oligonucleotide is a unimer. In some embodiments, the chiral controlled oligonucleotide is a stereounimer. In some embodiments, the chiral controlled oligonucleotide is a P-modified unimer. In some embodiments, the chiral controlled oligonucleotide is a linked unimer.

[0242] In some embodiments, the chiral controlled oligonucleotide is a gapmer.

[0243] In some embodiments, the chiral controlled oligonucleotide is a skipmer.

[0244] In some embodiments, the present invention provides a compound of formula I: [ka] and a chiral controlled oligonucleotide comprising one or more modified internucleotide linkages independently having the structure: where P * is an asymmetric phosphorus atom, either Rp or Sp; W is O, S or Se; Each of X, Y and Z is independently -O-, -S-, -N(-LR 1 )-, or L; L is a covalent bond or an optionally substituted, straight-chain or branched C1-C 10 alkylene, wherein one or more methylene units of L are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R') optionally and independently substituted by -C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-; R 1 is halogen, R, or optionally substituted C1-C 50aliphatic, wherein one or more methylene units are optionally and independently replaced by optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-; Each R' is independently -R, -C(O)R, -COR, or -SOR, or: two R' on the same nitrogen together with their intervening atoms form an optionally substituted heterocyclic or heteroaryl ring, or two R' on the same carbon together with their intervening atoms form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring; -Cy- is an optionally substituted divalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene; each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl; and each TIFF2025066783000012.tif10166 represents the bond to the nucleoside independently.

[0245] As generally described above and herein, P * is an asymmetric phosphorus atom and is either Rp or Sp. In some embodiments, P * is Rp. In another embodiment, P * In some embodiments, the oligonucleotide comprises each P *In some embodiments, the oligonucleotide comprises one or more internucleotide linkages of Formula I, each P being independently Rp or Sp. * In some embodiments, the oligonucleotide comprises one or more internucleotide linkages of Formula I, where each P * In some embodiments, the oligonucleotide comprises one or more internucleotide linkages of Formula I, where P * In some embodiments, the oligonucleotide comprises at least one internucleotide linkage of Formula I, where P * In some embodiments, the oligonucleotide comprises at least one internucleotide linkage of Formula I, where P * contains at least one internucleotide linkage of formula I, where Rp, and P * contains at least one internucleotide linkage of formula I, where Sp.

[0246] As generally described above and herein, W is O, S, or Se. In some embodiments, W is O. In some embodiments, W is S. In some embodiments, W is Se. In some embodiments, an oligonucleotide comprises at least one internucleotide linkage of Formula I, where W is O. In some embodiments, an oligonucleotide comprises at least one internucleotide linkage of Formula I, where W is S. In some embodiments, an oligonucleotide comprises at least one internucleotide linkage of Formula I, where W is Se.

[0247] As generally described above and herein, each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl.

[0248] In some embodiments, R is hydrogen. In some embodiments, R is an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl.

[0249] In some embodiments, R is an optionally substituted C1-C6 aliphatic. In some embodiments, R is an optionally substituted C1-C6 alkyl. In some embodiments, R is an optionally substituted straight-chained or branched hexyl. In some embodiments, R is an optionally substituted straight-chained or branched pentyl. In some embodiments, R is an optionally substituted straight-chained or branched butyl. In some embodiments, R is an optionally substituted straight-chained or branched propyl. In some embodiments, R is an optionally substituted ethyl. In some embodiments, R is an optionally substituted methyl.

[0250] In some embodiments, R is an optionally substituted phenyl. In some embodiments, R is a substituted phenyl. In some embodiments, R is phenyl.

[0251] In some embodiments, R is an optionally substituted carbocyclyl. In some embodiments, R is an optionally substituted C3-C 10 In some embodiments, R is an optionally substituted monocyclic carbocyclyl. In some embodiments, R is an optionally substituted cycloheptyl. In some embodiments, R is an optionally substituted cyclohexyl. In some embodiments, R is an optionally substituted cyclopentyl. In some embodiments, R is an optionally substituted cyclobutyl. In some embodiments, R is an optionally substituted cyclopropyl. In some embodiments, R is an optionally substituted bicyclic carbocyclyl.

[0252] In some embodiments, R is an optionally substituted aryl. In some embodiments, R is an optionally substituted bicyclic aryl ring.

[0253] In some embodiments, R is an optionally substituted heteroaryl. In some embodiments, R is an optionally substituted 5- to 6-membered monocyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from nitrogen, sulfur, or oxygen. In some embodiments, R is a substituted 5- to 6-membered monocyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an unsubstituted 5- to 6-membered monocyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from nitrogen, sulfur, or oxygen.

[0254] In some embodiments, R is an optionally substituted 5-membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 6-membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0255] In some embodiments, R is an optionally substituted 5-membered monocyclic heteroaryl ring having one heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, R is selected from pyrrolyl, furanyl, or thienyl.

[0256] In some embodiments, R is an optionally substituted 5-membered heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is an optionally substituted 5-membered heteroaryl ring having one nitrogen atom, and the additional heteroatom is selected from sulfur or oxygen. Exemplary R groups include optionally substituted pyrazolyl, imidazolyl, thiazolyl, isothiazolyl, oxazolyl, or isoxazolyl.

[0257] In some embodiments, R is a 6-membered heteroaryl ring having 1 to 3 nitrogen atoms. In other embodiments, R is an optionally substituted 6-membered heteroaryl ring having 1 to 2 nitrogen atoms. In some embodiments, R is an optionally substituted 6-membered heteroaryl ring having 2 nitrogen atoms. In certain embodiments, R is an optionally substituted 6-membered heteroaryl ring having 1 nitrogen. Exemplary R groups are optionally substituted pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, or tetrazinyl.

[0258] In certain embodiments, R is an optionally substituted 8- to 10-membered bicyclic heteroaryl ring having 1 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In other embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having 1 heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted indolyl. In some embodiments, R is an optionally substituted azabicyclo[3.2.1]octanyl. In certain embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted azaindolyl. In some embodiments, R is optionally substituted benzimidazolyl. In some embodiments, R is optionally substituted benzothiazolyl. In some embodiments, R is optionally substituted benzoxazolyl. In some embodiments, R is optionally substituted indazolyl. In certain embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having three heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0259] In certain embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having 1 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In other embodiments, R is an optionally substituted 6,6-fused heteroaryl ring having 1 heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted quinolinyl. In some embodiments, R is an optionally substituted isoquinolinyl. In one aspect, R is an optionally substituted 6,6-fused heteroaryl ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is quinazoline or quinoxaline.

[0260] In some embodiments, R is an optionally substituted heterocyclyl. In some embodiments, R is an optionally substituted 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is a substituted 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an unsubstituted 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0261] In some embodiments, R is an optionally substituted heterocyclyl. In some embodiments, R is an optionally substituted 6-membered saturated or partially unsaturated heterocyclic ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 6-membered partially unsaturated heterocyclic ring having 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 6-membered partially unsaturated heterocyclic ring having 2 oxygen atoms.

[0262] In certain embodiments, R is a 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, oxepanyl, aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, azepanyl, thiiranyl, thietanyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, thiepanyl, dioxolanyl, oxathiolanyl, oxazolidinyl, imidazolidinyl, thiazolidinyl, dithiolanyl, dioxanyl, morpholinyl, oxathianyl, piperazinyl, thiomorpholinyl, dithianyl, dioxepanyl, oxazepanyl, oxathiepanyl, dithiepanyl, diazepanyl, dihydrofuranonyl, tetrahydropyranonyl, oxepanonyl, pyrrolidinonyl, piperidinonyl, azepanonyl, dihydrothiophenonyl, tetra ... hydrothiopyranonyl, thiepanonyl, oxazolidinonyl, oxazinanonyl, oxazepanonyl, dioxolanonyl, dioxanonyl, dioxepanonyl, oxthiolinonyl, oxathianonyl, oxathiepanonyl, thiazolidinonyl, thiazinanonyl, thiazepanonyl, imidazolidinonyl, tetrahydropyrimidinonyl, diazepanonyl, imidazolidinedionyl, oxazolidinedionyl, thiazolidinedionyl, dioxolanedionyl, oxathiolanedionyl, piperazinedionyl, morpholinedionyl, thiomorpholinedionyl, tetrahydropyranyl, tetrahydrofuranyl, morpholinyl, thiomorpholinyl, piperidinyl, piperazinyl, pyrrolidinyl, tetrahydrothiophenyl, or tetrahydrothiopyranyl. In some embodiments, R is an optionally substituted 5-membered saturated or partially unsaturated heterocyclic ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0263] In certain embodiments, R is an optionally substituted 5-6 membered partially unsaturated monocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R is an optionally substituted tetrahydropyridinyl, dihydrothiazolyl, dihydrooxazolyl, or oxazolinyl group.

[0264] In some embodiments, R is an optionally substituted 8- to 10-membered bicyclic saturated or partially unsaturated heterocyclic ring having 1 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted indolinyl. In some embodiments, R is an optionally substituted isoindolinyl. In some embodiments, R is an optionally substituted 1,2,3,4-tetrahydroquinoline. In some embodiments, R is an optionally substituted 1,2,3,4-tetrahydroisoquinoline.

[0265] As generally described above and herein, each R' is independently -R, -C(O)R, -COR, or -SOR, or: two R' on the same nitrogen together with their intervening atoms form an optionally substituted heterocyclic or heteroaryl ring, or two R' on the same carbon together with their intervening atoms form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;

[0266] In some embodiments, R' is -R, -C(O)R, -CO2R, or -SO2R, where R is as defined above and described herein.

[0267] In some embodiments, R' is -R, where R is as defined and described above and herein. In some embodiments, R' is hydrogen.

[0268] In some embodiments, R' is -C(O)R, where R is as defined above and as described herein. In some embodiments, R' is -COR, where R is as defined above and as described herein. In some embodiments, R' is -SOR, where R is as defined above and as described herein.

[0269] In some embodiments, two R' on the same nitrogen, together with their intervening atoms, form an optionally substituted heterocyclic or heteroaryl ring. In some embodiments, two R' on the same carbon, together with their intervening atoms, form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring.

[0270] As generally described above and herein, -Cy- is an optionally substituted divalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene.

[0271] In some embodiments, -Cy- is optionally substituted phenylene. In some embodiments, -Cy- is optionally substituted carbocyclylene. In some embodiments, -Cy- is optionally substituted arylene. In some embodiments, -Cy- is optionally substituted heteroarylene. In some embodiments, -Cy- is optionally substituted heterocyclylene.

[0272] As generally described above and herein, each of X, Y and Z independently represents -O-, -S-, -N(-LR 1 )-, or L, and L and R 1 each of which is independently as defined above and as described below.

[0273] In some embodiments, X is -O-. In some embodiments, X is -S-. In some embodiments, X is -O- or -S-. In some embodiments, an oligonucleotide comprises at least one internucleotide linkage of Formula I, and X is -O-. In some embodiments, an oligonucleotide comprises at least one internucleotide linkage of Formula I, and X is -S-. In some embodiments, an oligonucleotide comprises at least one internucleotide linkage of Formula I, and X is -O-, and at least one internucleotide linkage of Formula I, and X is -S-. In some embodiments, an oligonucleotide comprises at least one internucleotide linkage of Formula I, and X is -O-, and at least one internucleotide linkage of Formula I, and X is -S-, and at least one internucleotide linkage of Formula I, and L is an optionally substituted linear or branched C1-C 10 is alkylene, and one or more methylene units of L are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C( Optionally and independently substituted by -O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-.

[0274] In some embodiments, X is -N(-LR 1 In some embodiments, X is —N(R 1 )-. In some embodiments, X is -N(R')-. In some embodiments, X is -N(R)-. In some embodiments, X is -NH-.

[0275] In some embodiments, X is L. In some embodiments, X is a covalent bond. In some embodiments, X is an optionally substituted, straight-chain or branched C1-C 10 is alkylene, and one or more methylene units of L are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C( In some embodiments, X is optionally and independently substituted by an optionally substituted C1-C2 alkyl group. In some embodiments, X is optionally substituted by an optionally substituted C1-C2 alkyl group. In some embodiments, X is optionally substituted by an optionally substituted C1-C2 alkyl group. In some embodiments, X is optionally substituted by an optionally substituted C1-C2 alkyl group. In some embodiments, X is optionally substituted by an optionally substituted C1-C2 alkyl group. 10 Alkylene or C1-C 10 In some embodiments, X is methylene.

[0276] In some embodiments, Y is -O-. In some embodiments, Y is -S-.

[0277] In some embodiments, Y is -N(-LR 1 In some embodiments, Y is —N(R 1 )-. In some embodiments, Y is -N(R')-. In some embodiments, Y is -N(R)-. In some embodiments, Y is -NH-.

[0278] In some embodiments, Y is L. In some embodiments, Y is a covalent bond. In some embodiments, Y is an optionally substituted, straight-chain or branched C1-C 10is alkylene, and one or more methylene units of L are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C( In some embodiments, Y is optionally and independently substituted with an optionally substituted C1-C2 alkyl group. 10 Alkylene or C1-C 10 In some embodiments, Y is methylene.

[0279] In some embodiments, Z is -O-. In some embodiments, Z is -S-.

[0280] In some embodiments, Z is -N(-LR 1 In some embodiments, Z is —N(R 1 )-. In some embodiments, Z is -N(R')-. In some embodiments, Z is -N(R)-. In some embodiments, Z is -NH-.

[0281] In some embodiments, Z is L. In some embodiments, Z is a covalent bond. In some embodiments, Z is an optionally substituted, straight or branched C1-C 10is alkylene, and one or more methylene units of L are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C( In some embodiments, Z is optionally and independently substituted by an optionally substituted C1-C2 alkyl group. 10 Alkylene or C1-C 10 In some embodiments, Z is methylene.

[0282] As generally described above and herein, L is a covalent bond or an optionally substituted, straight or branched C1-C 10 is alkylene, and one or more methylene units of L are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C( Optionally and independently substituted by -O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-.

[0283] In some embodiments, L is a covalent bond. In some embodiments, L is an optionally substituted, straight or branched C1-C 10is alkylene, and one or more methylene units of L are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C( Optionally and independently substituted by -O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-.

[0284] In some embodiments, L is -L 1 -V- structure, L 1 is an optionally substituted group: [ka] TIFF2025066783000014.tif34166TIFF2025066783000015.tif31166Selected from C1-C6 alkylene, C1-C6 alkenylene, carbocyclylene, arylene, C1-C6 heteroalkylene, heterocyclylene, and heteroarylene; V is -O-, -S-, -NR'-, C(R')2, -SS-, -BSSC-, [ka] or an optionally substituted group selected from C1-C6 alkylene, arylene, C1-C6 heteroalkylene, heterocyclylene, and heteroarylene; A is =O, =S, =NR', or =C(R')2; Each of B and C is independently -O-, -S-, -NR'-, -C(R')2-, or an optionally substituted group selected from C1-C6 alkylene, carbocyclylene, arylene, heterocyclylene, or heteroarylene; and Each R' is independently as defined above and described herein.

[0285] In some embodiments, L 1 teeth, [ka] The file is TIFF2025066783000018.tif18166.

[0286] In some embodiments, L 1 teeth, [ka] and wherein ring Cy' is an optionally substituted arylene, carbocyclylene, heteroarylene, or heterocyclylene. 1 is optionally substituted [ka] In some embodiments, L 1 teeth, [ka] is.

[0287] In some embodiments, L 1 is bonded to X. In some embodiments, L 1 represents an optionally substituted group [ka] TIFF2025066783000023.tif30166, and the sulfur atom is bonded to V. In some embodiments, L 1 represents an optionally substituted group [ka] TIFF2025066783000025.tif31166, and the carbon atom is bonded to X.

[0288] In some embodiments, L is [ka] having the structure where: E is -O-, -S-, -NR'- or -C(R')2-; - - - is a single or double bond; The Two R's L1 taken together with the two carbon atoms to which they are attached form an optionally substituted aryl, carbocyclic, heteroaryl or heterocyclic ring; each R' is independently as defined above and as described herein.

[0289] In some embodiments, L is [ka] having the structure where: G is -O-, -S-, or -NR'; - - - is a single or double bond; and The Two R's L1 together with the two carbon atoms to which they are attached, form an optionally substituted aryl, C3-C 10 Forms a carbocyclic, heteroaryl or heterocyclic ring.

[0290] In some embodiments, L is [ka] having the structure wherein E is —O—, —S—, —NR′—, or —C(R′)2—; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-; and Each R' is independently as defined above and described herein.

[0291] In some embodiments, L is [ka] having the structure where: G is -O-, -S-, or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-.

[0292] In some embodiments, L is [ka] having the structure where: E is -O-, -S-, -NR'- or -C(R')2-; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-; and Each R' is independently as defined above and described herein.

[0293] In some embodiments, L is [ka] having the structure where: G is -O-, -S-, or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-.

[0294] In some embodiments, L is [ka] having the structure wherein E is —O—, —S—, —NR′—, or —C(R′)2—; - - - is a single or double bond; The Two R's L1 together with the two carbon atoms to which they are attached, form an optionally substituted aryl, C3-C 10 forming a carbocyclic, heteroaryl or heterocyclic ring; Each R' is independently as defined above and described herein.

[0295] In some embodiments, L is [ka] having the structure wherein G is -O-, -S-, or -NR'; - - - is a single or double bond; The Two R's L1 together with the two carbon atoms to which they are attached, form an optionally substituted aryl, C3-C 10 forming a carbocyclic, heteroaryl or heterocyclic ring; Each R' is independently as defined above and described herein.

[0296] In some embodiments, L is [ka] having the structure where: E is -O-, -S-, -NR'- or -C(R')2-; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-; and Each R' is independently as defined above and described herein.

[0297] In some embodiments, L is [ka] having the structure wherein G is -O-, -S-, or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-; and Each R' is independently as defined above and described herein.

[0298] In some embodiments, L is [ka] having the structure wherein E is —O—, —S—, —NR′—, or —C(R′)2—; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-; and Each R' is independently as defined above and described herein.

[0299] In some embodiments, L is [ka] having the structure wherein G is -O-, -S-, or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-; and Each R' is independently as defined above and described herein.

[0300] In some embodiments, L is [ka] having the structure wherein E is —O—, —S—, —NR′—, or —C(R′)2—; - - - is a single or double bond; The Two R's L1 together with the two carbon atoms to which they are attached, form an optionally substituted aryl, C3-C 10 forming a carbocyclic, heteroaryl or heterocyclic ring; Each R' is independently as defined above and described herein.

[0301] In some embodiments, L is [ka] having the structure wherein G is -O-, -S-, or -NR'; - - - is a single or double bond; The Two R's L1 together with the two carbon atoms to which they are attached, form an optionally substituted aryl, C3-C 10 forming a carbocyclic, heteroaryl or heterocyclic ring; Each R' is independently as defined above and described herein.

[0302] In some embodiments, L is [ka] having the structure wherein E is —O—, —S—, —NR′—, or —C(R′)2—; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-; and Each R' is independently as defined above and described herein.

[0303] In some embodiments, L is [ka] having the structure where: G is -O-, -S-, or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-; and R' is as defined above and described herein.

[0304] In some embodiments, L is [ka] having the structure where: E is -O-, -S-, -NR'- or -C(R')2-; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-; and Each R' is independently as defined above and described herein.

[0305] In some embodiments, L is [ka] having the structure where: G is -O-, -S-, or -NR'; D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))-, or =C(CF3)-; and R' is as defined above and described herein.

[0306] In some embodiments, L is [ka] having the structure wherein the phenyl ring may be substituted. In some embodiments, the phenyl ring is unsubstituted. In some embodiments, the phenyl ring is substituted.

[0307] In some embodiments, L is [ka] having the structure wherein the phenyl ring may be substituted. In some embodiments, the phenyl ring is unsubstituted. In some embodiments, the phenyl ring is substituted.

[0308] In some embodiments, L is [ka] having the structure where - - - is a single or double bond; and The Two R's L1 together with the two carbon atoms to which they are attached, form an optionally substituted aryl, C3-C 10 It forms a carbocyclic, heteroaryl or heterocyclic ring.

[0309] In some embodiments, L is [ka] having the structure where: G is -O-, -S-, or -NR'; - - - is a single or double bond; and The Two R's L1 together with the two carbon atoms to which they are attached, form an optionally substituted aryl, C3-C 10 It forms a carbocyclic, heteroaryl or heterocyclic ring.

[0310] As generally described above and herein, E is -O-, -S-, -NR'-, or -C(R')2-, where each R' is independently as defined above and described herein. In some embodiments, E is -O-, -S-, or -NR'-. In some embodiments, E is -O-, -S-, or -NH-. In some embodiments, E is -O-. In some embodiments, E is -S-. In some embodiments, E is -NH-.

[0311] As generally described above and herein, G is -O-, -S-, or -NR', where each R' is independently as defined above and described herein. In some embodiments, G is -O-, -S-, or -NH-. In some embodiments, G is -O-. In some embodiments, G is -S-. In some embodiments, G is -NH-.

[0312] In some embodiments, L is -L 3 -G-, where L 3is an optionally substituted C1-C5 alkylene or alkenylene, wherein one or more methylene units are optionally and independently -O-, -S-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -S(O)-, -S(O)2-, or [ka] is replaced by Each of G and R' and the ring Cy' is independently as defined above and as described herein.

[0313] In some embodiments, L is -L 3 -S- and L 3 is defined above and described herein. In some embodiments, L is -L 3 -O- and L 3 is defined above and described herein. In some embodiments, L is -L 3 -N(R')-, where L 3 and R' are each independently as defined above and as described herein. In some embodiments, L is -L 3 -NH- and L 3 and R' are each independently as defined above and described herein.

[0314] In some embodiments, L 3 is an optionally substituted C alkylene or alkenylene, wherein one or more methylene units are optionally and independently -O-, -S-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -S(O)-, -S(O)2-, or [ka] wherein each of R' and ring Cy' is independently as defined above and as described herein. 3is an optionally substituted C alkylene. 3 -G- is [ka] is.

[0315] In some embodiments, L 3 is an optionally substituted C alkylene or alkenylene, wherein one or more methylene units are optionally and independently —O—, —S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —S(O)—, —S(O)2—, or [ka] and each of R' and Cy' is independently as defined above and described herein.

[0316] In some embodiments, -L 3 -G- is [ka] The file is TIFF2025066783000053.tif34166.

[0317] In some embodiments, L 3 is an optionally substituted C alkylene or alkenylene, wherein one or more methylene units are optionally and independently —O—, —S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —S(O)—, —S(O)2—, or [ka] and each of R' and Cy' is independently as defined above and described herein.

[0318] In some embodiments, -L 3 -G- is [ka] TIFF2025066783000056.tif29166.

[0319] In some embodiments, L is [ka] In some embodiments, L is [ka] In some embodiments, L is [ka] is.

[0320] In some embodiments, L 3 C2 is alkylene or alkenylene, and one or more methylene units are -O-, -S-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -S(O)-, -S(O)2-, or [ka] wherein each of R' and Cy' is independently as defined above and as described herein.

[0321] In some embodiments, -L 3 -G- is [ka] and each of G and Cy' is independently as defined above and as described herein. In some embodiments, L is [ka] is.

[0322] In some embodiments, L is -L 4 -G- and L 4 is an optionally substituted C1-C2 alkylene; and G is as defined above and described herein. In some embodiments, L is -L 4 -G- and L 4 is an optionally substituted C1-C2 alkylene; G is as defined above and described herein; G is R 1 In some embodiments, L is bonded to -L 4 -G- and L 4 is an optionally substituted methylene; G is as defined above and described herein; and G is R 1 In some embodiments, L is linked to -L 4 -G- and L 4 is methylene; G is as defined above and described herein; and G is R 1 In some embodiments, L is linked to -L 4 -G- and L 4 is an optionally substituted —(CH)—; G is as defined above and described herein; and G is R 1 In some embodiments, L is linked to -L 4 -G- and L 4 is —(CH)—; G is as defined above and described herein; and G is R 1 is bonded to.

[0323] In some embodiments, L is [ka] or [ka] where G is as defined above and described herein, and G is R 1In some embodiments, L is attached to [ka] and G is as defined above and as described herein, and G is R 1 In some embodiments, L is attached to [ka] and G is as defined above and as described herein, and G is R 1 In some embodiments, L is attached to [ka] or [ka] where the sulfur atom is R 1 In some embodiments, L is attached to [ka] or TIFF2025066783000070.tif12166, where the oxygen atom is R 1 is connected to

[0324] In some embodiments, L is [ka] and G is as defined above and described herein.

[0325] In some embodiments, L is -SR L3 -or-SC(O)-R L3 - and R L3is an optionally substituted, straight-chain or branched C1-C9 alkylene, and one or more methylene units are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R' )C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)—, —S(O)N(R′)—, —N(R′)S(O)—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, where each of R′ and -Cy- is independently as defined above and described herein. In some embodiments, L is selected from the group consisting of —SR L3 -or-SC(O)-R L3 - and R L3 is an optionally substituted C1-C6 alkylene. In some embodiments, L is -SR L3 -or-SC(O)-R L3 - and R L3 In some embodiments, L is -SR L3 -or-SC(O)-R L3 - and R L3 is an optionally substituted C1-C6 alkylene, wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkenylene, arylene, or heteroarylene. L3 is optionally substituted -S-(C1-C6 alkenylene)-, -S-(C1-C6 alkylene)-, -S-(C1-C6 alkylene)-arylene-(C1-C6 alkylene)-, -S-CO-arylene-(C1-C6 alkylene)-, or -S-CO-(C1-C6 alkylene)-arylene-(C1-C6 alkylene)-.

[0326] In some embodiments, L is [ka] The file is TIFF2025066783000073.tif30166.

[0327] In some embodiments, L is [ka] is. In some embodiments, L is [ka] is. In some embodiments, [ka] is.

[0328] In some embodiments, the sulfur atom of L in the embodiments above and described herein is bonded to X. In some embodiments, the sulfur atom of L in the embodiments above and described herein is bonded to R 1 is connected to

[0329] As generally described above and herein, R 1 is halogen, R, or optionally substituted C1-C 50an aliphatic group in which one or more methylene units are optionally substituted, such as C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, and optionally and independently substituted by -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)-, -S(O)N(R')-, -N(R')S(O)-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, where each variable is independently as defined above and described herein. In some embodiments, R 1 is halogen, R, or optionally substituted C1-C 10 an aliphatic group in which one or more methylene units are optionally substituted, such as C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, and optionally and independently substituted by -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, where each variable is independently as defined above and described herein.

[0330] In some embodiments, R 1 is hydrogen. In some embodiments, R 1 is halogen. In some embodiments, R 1 is -F. In some embodiments, R 1 is -Cl. In some embodiments, R 1 is -Br. In some embodiments, R 1 is -I.

[0331] In some embodiments, R 1 is R, where R is as defined above and described herein.

[0332] In some embodiments, R 1 is hydrogen. In some embodiments, R 1 is C1~C 50 It is an optionally substituted group selected from aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl.

[0333] In some embodiments, R 1 is optionally substituted C1 to C 50 In some embodiments, R 1 is optionally substituted C1 to C 10 In some embodiments, R 1 is an optionally substituted C1-C6 aliphatic. In some embodiments, R 1 is an optionally substituted C1-C6 alkyl. In some embodiments, R 1 is optionally substituted, straight or branched hexyl. In some embodiments, R 1 is optionally substituted, straight or branched chain pentyl. In some embodiments, R 1 is optionally substituted, straight or branched butyl. In some embodiments, R 1 is optionally substituted, straight or branched propyl. In some embodiments, R 1 is optionally substituted ethyl. In some embodiments, R 1 is optionally substituted methyl.

[0334] In some embodiments, R 1 is optionally substituted phenyl. In some embodiments, R 1 is a substituted phenyl. In some embodiments, R 1 is phenyl.

[0335] In some embodiments, R 1 is an optionally substituted carbocyclyl. In some embodiments, R 1 is an optionally substituted C3 to C 10 In some embodiments, R 1 is an optionally substituted monocyclic carbocyclyl. In some embodiments, R 1 is optionally substituted cycloheptyl. In some embodiments, R 1 is optionally substituted cyclohexyl. In some embodiments, R 1 is optionally substituted cyclopentyl. In some embodiments, R 1 is optionally substituted cyclobutyl. In some embodiments, R 1 is optionally substituted cyclopropyl. In some embodiments, R 1 is an optionally substituted bicyclic carbocyclyl.

[0336] In some embodiments, R 1 is optionally substituted C1 to C 50 In some embodiments, R 1 is optionally substituted C1 to C 50It is a polycyclic hydrocarbon, and one or more methylene units are optionally substituted C1 to C6 alkylene, C1 to C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O) and optionally and independently substituted by -, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)-, -S(O)N(R')-, -N(R')S(O)-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, where each variable is independently as defined above and described herein. 1 is optionally substituted [ka] In some embodiments, R 1 teeth, [ka] In some embodiments, R 1 is optionally substituted [ka] is.

[0337] In some embodiments, R 1 is an optionally substituted C1-C50 aliphatic group containing one or more optionally substituted polycyclic hydrocarbon moieties. 1 is an optionally substituted C1-C cyclic hydrocarbon group containing one or more optionally substituted polycyclic hydrocarbon moieties. 50an aliphatic group in which one or more methylene units are optionally substituted, such as C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, and optionally and independently substituted by -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)-, -S(O)N(R')-, -N(R')S(O)-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, where each variable is independently as defined above and described herein. In some embodiments, R 1 is one or more optionally substituted C1 to C 50 aliphatic [ka] In some embodiments, R 1 teeth, [ka] In some embodiments, R 1 teeth, [ka] In some embodiments, R 1 teeth, [ka] In some embodiments, R 1 teeth, [ka] In some embodiments, R 1 teeth, [ka] is.

[0338] In some embodiments, R 1 is optionally substituted aryl. In some embodiments, R 1 is an optionally substituted bicyclic aryl ring.

[0339] In some embodiments, R 1 is optionally substituted heteroaryl. In some embodiments, R 1 is an optionally substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, or oxygen. In some embodiments, R 1 is a substituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is an unsubstituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur, or oxygen.

[0340] In some embodiments, R 1 is an optionally substituted 5-membered monocyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is an optionally substituted 6-membered monocyclic heteroaryl ring having 1 to 3 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0341] In some embodiments, R 1 is an optionally substituted 5-membered monocyclic heteroaryl ring having one heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is selected from pyrrolyl, furanyl, or thienyl.

[0342] In some embodiments, R 1is an optionally substituted 5-membered heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, or sulfur. 1 is an optionally substituted 5-membered heteroaryl ring having one nitrogen atom, and an additional heteroatom selected from sulfur or oxygen. 1 Groups include optionally substituted pyrazolyl, imidazolyl, thiazolyl, isothiazolyl, oxazolyl or isoxazolyl.

[0343] In some embodiments, R 1 is a 6-membered heteroaryl ring having 1 to 3 nitrogen atoms. 1 is an optionally substituted 6-membered heteroaryl ring having 1 to 2 nitrogen atoms. In some embodiments, R 1 is an optionally substituted 6-membered heteroaryl ring having two nitrogen atoms. In certain embodiments, R 1 is an optionally substituted 6-membered heteroaryl ring having one nitrogen. Exemplary R groups are optionally substituted pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, or tetrazinyl.

[0344] In certain embodiments, R 1 is an optionally substituted 8-10 membered bicyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is an optionally substituted 5,6-fused heteroaryl ring having 1 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. 1 is an optionally substituted 5,6-fused heteroaryl ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. 1is an optionally substituted 5,6-fused heteroaryl ring having one heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is an optionally substituted indolyl. In some embodiments, R 1 is an optionally substituted azabicyclo[3.2.1]octanyl. In certain embodiments, R 1 is an optionally substituted 5,6-fused heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is an optionally substituted azaindolyl. In some embodiments, R 1 is optionally substituted benzimidazolyl. In some embodiments, R 1 is optionally substituted benzothiazolyl. In some embodiments, R 1 is an optionally substituted benzoxazolyl. In some embodiments, R 1 is optionally substituted indazolyl. In certain embodiments, R 1 is an optionally substituted 5,6-fused heteroaryl ring having three heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0345] In certain embodiments, R 1 is an optionally substituted 6,6-fused heteroaryl ring having 1 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is an optionally substituted 6,6-fused heteroaryl ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. 1 is an optionally substituted 6,6-fused heteroaryl ring having one heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1is an optionally substituted quinolinyl. In some embodiments, R 1 is optionally substituted isoquinolinyl. 1 is an optionally substituted 6,6-fused heteroaryl ring having two heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is a quinazoline or quinoxaline.

[0346] In some embodiments, R 1 is optionally substituted heterocyclyl. In some embodiments, R 1 is an optionally substituted 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is a substituted 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is an unsubstituted 3- to 7-membered saturated or partially unsaturated heterocyclic ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0347] In some embodiments, R 1 is optionally substituted heterocyclyl. In some embodiments, R 1 is an optionally substituted 6-membered saturated or partially unsaturated heterocyclic ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is an optionally substituted, partially unsaturated 6-membered heterocyclic ring having two heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is an optionally substituted, partially unsaturated six-membered heterocyclic ring having two oxygen atoms.

[0348] In certain embodiments, R 1 is a 3-7 membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R 1 is oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, oxepanyl, aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, azepanyl, thiiranyl, thietanyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, thiepanyl, dioxolanyl, oxathiolanyl, oxazolidinyl, imidazolidinyl, thiazolidinyl, dithiolanyl, dioxanyl, morpholinyl, oxathianyl, piperazinyl, thiomorpholinyl, dithianyl, dioxepanyl, oxazepanyl, oxathiepanyl, dithiepanyl, diazepanyl, dihydrofuranonyl, tetrahydropyranonyl, oxepanonyl, pyrrolidinonyl, piperidinonyl, azepanonyl, dihydrothiophenonyl, tetrahydrothiopyranyl nonyl, thiepanonyl, oxazolidinonyl, oxazinanonyl, oxazepanonyl, dioxolanonyl, dioxanonyl, dioxepanonyl, oxthiolinonyl, oxathianonyl, oxathiepanonyl, thiazolidinonyl, thiazinanonyl, thiazepanonyl, imidazolidinonyl, tetrahydropyrimidinonyl, diazepanonyl, imidazolidinedionyl, oxazolidinedionyl, thiazolidinedionyl, dioxolanedionyl, oxathiolanedionyl, piperazinedionyl, morpholinedionyl, thiomorpholinedionyl, tetrahydropyranyl, tetrahydrofuranyl, morpholinyl, thiomorpholinyl, piperidinyl, piperazinyl, pyrrolidinyl, tetrahydrothiophenyl, or tetrahydrothiopyranyl. In some embodiments, R is an optionally substituted 5-membered saturated or partially unsaturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. 1 is an optionally substituted 5-membered saturated or partially unsaturated heterocyclic ring having 1 to 2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0349] In certain embodiments, R 1 is an optionally substituted 5-6 membered partially unsaturated monocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In certain embodiments, R 1 is an optionally substituted tetrahydropyridinyl, dihydrothiazolyl, dihydrooxazolyl, or oxazolinyl group.

[0350] In some embodiments, R 1 is an optionally substituted 8- to 10-membered bicyclic saturated or partially unsaturated heterocyclic ring having 1 to 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 is an optionally substituted indolinyl. In some embodiments, R 1 is an optionally substituted isoindolinyl. In some embodiments, R 1 is an optionally substituted 1,2,3,4-tetrahydroquinoline. In some embodiments, R is an optionally substituted 1,2,3,4-tetrahydroisoquinoline.

[0351] In some embodiments, R 1 is optionally substituted C1 to C 10 an aliphatic group in which one or more methylene units are optionally substituted, such as C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, and optionally and independently substituted by -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)-, -S(O)N(R')-, -N(R')S(O)-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, where each variable is independently as defined above and described herein. In some embodiments, R 1is optionally substituted C1 to C 10 is aliphatic, wherein one or more methylene units are optionally and independently replaced by -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -OC(O)-, or -C(O)O-, each R' is independently as defined above and described herein. In some embodiments, R 1 is optionally substituted C1 to C 10 is aliphatic, wherein one or more methylene units are optionally and independently replaced by any of -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -OC(O)-, or -C(O)O-, wherein each R' is independently as defined above and described herein.

[0352] In some embodiments, R 1 teeth, [ka] The file is TIFF2025066783000087.tif184166.

[0353] In some embodiments, R 1 teeth, [ka] The file is TIFF2025066783000089.tif19166.

[0354] In some embodiments, R 1 includes a terminus having an optionally substituted —(CH)— moiety attached to L. Such exemplary R 1 The groups are as follows: [ka] .

[0355] In some embodiments, R 1 is attached to L and includes an optionally substituted -(CH)- moiety. 1 The groups are as follows: [ka] .

[0356] In some embodiments, R 1 -SR L2 and R L2 is an optionally substituted C1 to C9 aliphatic group, and one or more methylene units are optionally substituted C1 to C6 alkylene, C1 to C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R' )C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)—, —S(O)N(R′)—, —N(R′)S(O)—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—, wherein each of R′ and -Cy- is independently as defined above and described herein. In some embodiments, R 1 -SR L2 and the sulfur atom is bonded to the sulfur atom of the L group.

[0357] In some embodiments, R 1 is -C(O)-R L2 and R L2is an optionally substituted C1-C9 aliphatic group, and one or more methylene units are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C and optionally and independently substituted by -Cy(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)-, -S(O)N(R')-, -N(R')S(O)-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, wherein each of R' and -Cy- is independently as defined above and described herein. In some embodiments, R 1 is -C(O)-R L2 and the carbonyl group is attached to the G of the L group. In some embodiments, R 1 is -C(O)-R L2 where the carbonyl group is bonded to the sulfur atom of the L group.

[0358] In some embodiments, R L2 is an optionally substituted C1-C9 aliphatic. L2 is an optionally substituted C1-C9 alkyl. In some embodiments, R L2 is an optionally substituted C1-C9 alkenyl. In some embodiments, R L2 is an optionally substituted C1-C9 alkynyl. In some embodiments, R L2 is an optionally substituted C1-C9 aliphatic, wherein one or more methylene units are optionally and independently replaced by -Cy- or -C(O)-. In some embodiments, R L2 is an optionally substituted C1-C9 aliphatic, wherein one or more methylene units are optionally and independently replaced by -Cy-. In some embodiments, R L2is an optionally substituted C1-C9 aliphatic, wherein one or more methylene units are optionally and independently replaced by an optionally substituted heterocyclohexylene. L2 is an optionally substituted C1-C9 aliphatic, wherein one or more methylene units are optionally and independently replaced by an optionally substituted arylene. L2 is an optionally substituted C1-C9 aliphatic, wherein each methylene unit is optionally and independently replaced by an optionally substituted heteroarylene. L2 is an optionally substituted C1-C9 aliphatic group, and one or more methylene units are optionally substituted C3-C 10 In some embodiments, R L2 is an optionally substituted C1-C9 aliphatic, wherein two methylene units are optionally and independently replaced by -Cy- or -C(O)-. In some embodiments, R L2 is an optionally substituted C1-C9 aliphatic, wherein two methylene units are optionally and independently replaced by -Cy- or -C(O)-. Exemplary R L2 The groups are as follows: [ka]

[0359] In some embodiments, R 1 is hydrogen or an optionally substituted group [ka] TIFF2025066783000094.tif25166-S-(C1~C 10 aliphatic), C1~C 10 In some embodiments, R is selected from aliphatic, aryl, C1-C6 heteroalkyl, heteroaryl, and heterocyclyl. 1 teeth, [ka] TIFF2025066783000096.tif24166 or -S-(C1~C 10 In some embodiments, R 1 teeth, [ka] The file is TIFF2025066783000098.tif24166.

[0360] In some embodiments, R 1 is -S-(C1~C6 aliphatic), C1~C 10 It is an optionally substituted group selected from aliphatic, C1-C6 heteroaliphatic, aryl, heterocyclyl and heteroaryl.

[0361] In some embodiments, R 1 teeth, [ka] is.

[0362] In some embodiments, R 1 In some embodiments, the sulfur atom of the R embodiment is bonded to a sulfur atom of the L embodiment described above and herein, to a G, E, or to a -C(O)- moiety. 1 The -C(O)- moiety of the embodiment of is bonded to the sulfur atom, G, E, or -C(O)- moiety of the embodiments of L described above and herein.

[0363] In some embodiments, -LR 1 is any of the embodiments of L and R described above and herein. 1 The embodiment is any one of the combinations of the above.

[0364] In some embodiments, -LR 1 -L 3-GR 1 where each variable is independently as defined above and described herein.

[0365] In some embodiments, -LR 1 -L 4 -GR 1 where each variable is independently as defined above and described herein.

[0366] In some embodiments, -LR 1 -L 3 -GSR L2 where each variable is independently as defined above and described herein.

[0367] In some embodiments, -LR 1 -L 3 -GC(O)-R L2 where each variable is independently as defined above and described herein.

[0368] In some embodiments, -LR 1 teeth, [ka] TIFF2025066783000101.tif16166, where R L2is an optionally substituted C1-C9 aliphatic group, and one or more methylene units are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, - and optionally and independently substituted by N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, wherein each G is independently as defined above and described herein.

[0369] In some embodiments, -LR 1 -R L3 -SSR L2 wherein each variable is independently as defined above and as described herein. In some embodiments, -LR 1 -R L3 -C(O)-SSR L2 where each variable is independently as defined above and described herein.

[0370] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0371] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0372] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0373] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0374] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0375] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0376] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0377] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0378] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0379] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0380] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0381] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0382] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0383] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0384] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0385] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0386] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0387] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0388] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0389] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0390] In some embodiments, -LR 1 teeth, [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0391] In some embodiments, L is [ka] having the structure wherein each variable is independently as defined above and as described herein.

[0392] In some embodiments, -XLR1 teeth, [ka] having the structure wherein the phenyl ring is optionally substituted, and R 1 and each of X is independently as defined above and described herein.

[0393] In some embodiments, -LR 1 teeth, [ka] TIFF2025066783000126.tif120166.

[0394] In some embodiments, -LR 1 teeth, [ka] is.

[0395] In some embodiments, -LR 1 teeth, [ka] In some embodiments, -LR 1 teeth, [ka] is.

[0396] In some embodiments, -LR 1 comprises an optionally substituted —(CH 2 ) 2 — moiety attached to X. In some embodiments, —LR 1 1 contains the terminus of the -(CH2)2- moiety attached to X. Such an exemplary -LR 1 The parts are as follows: [ka] .

[0397] In some embodiments, -LR 1 comprises an optionally substituted —(CH)— moiety attached to X. In some embodiments, —LR 1 contains the terminus of the -(CH2)- moiety attached to X. Such an exemplary -LR 1 The parts are as follows: [ka] .

[0398] In some embodiments, -LR 1 teeth, [ka] is.

[0399] In some embodiments, -LR 1 teeth, [ka] and X is -S-.

[0400] In some embodiments, -LR 1 teeth, [ka] wherein X is -S-, W is O, Y is -O-, and Z is -O-.

[0401] In some embodiments, R 1 teeth, [ka] or -S-(C1~C 10 aliphatic).

[0402] In some embodiments, R1 teeth, [ka] is.

[0403] In some embodiments, X is —O— or —S—, and R 1 teeth, [ka] or -S-(C1~C 10 aliphatic).

[0404] In some embodiments, X is —O— or —S—, and R 1 teeth, [ka] -S-(C1~C 10 Aliphatic) or -S-(C1-C 50 aliphatic).

[0405] In some embodiments, L is a covalent bond, -LR 1 is R 1 is.

[0406] In some embodiments, -LR 1 is other than hydrogen.

[0407] In some embodiments, -XLR 1 is R 1 teeth, [ka] TIFF2025066783000140.tif47166, -S-(C1~C 10 Aliphatic) or -S-(C1-C 50 aliphatic).

[0408] In some embodiments, -XLR 1 teeth, [ka] The part has the structure [ka] In some embodiments, -XLR is optionally substituted. 1 teeth, [ka] In some embodiments, -XLR 1 teeth, [ka] In some embodiments, -XLR 1 teeth, [ka] In some embodiments, -XLR 1 teeth, [ka] wherein X' is O or S, Y' is -O-, -S- or -NR'-, and the moiety [ka] is optionally substituted. In some embodiments, Y' is -O-, -S- or -NH-. In some embodiments, [ka] teeth, [ka] In some embodiments, [ka] teeth, [ka] In some embodiments, [ka] teeth, [ka] In some embodiments, -XLR 1 teeth, [ka] X' is O or S, and the moiety [ka] In some embodiments, [ka] teeth, [ka] In some embodiments, -XLR 1 teeth, [ka] and [ka] In some embodiments, -XLR is optionally substituted. 1 teeth, [ka] and [ka] is substituted. In some embodiments, -XLR 1 teeth, [ka] and [ka] is non-substituted.

[0409] In some embodiments, -XLR 1 is R 1 -C(O)-SL x -S- and L x represents an optionally substituted group [ka] In some embodiments, L x teeth, [ka] In some embodiments, -XLR 1 is (CH3)3C-SSL x In some embodiments, -XLR 1 is R 1 -C(=X')-Y'-C(R)2-SL x In some embodiments, -XLR 1 is RC(=X')-Y'-CH2-SL x In some embodiments, -XLR 1 teeth, [ka] is.

[0410] As will be appreciated by those skilled in the art, the -XLR described herein 1 Many of the groups are cleavable, allowing the -X - In some embodiments, -XLR 1 is cleavable. In some embodiments, -XLR 1 -SLR1 and after administration to the subject, -S - In some embodiments, the conversion is facilitated by an enzyme of interest. As will be appreciated by those skilled in the art, -SLR 1 The group is -S after administration. - is known in the art and practiced, including in drug metabolism and pharmacokinetic studies.

[0411] In some embodiments, an internucleotide linkage having the structure of Formula I is [ka] is.

[0412] In some embodiments, the internucleotide linkage of formula I has the structure of formula Ia: [ka] It has. wherein each variable is independently as defined above and as described herein.

[0413] In some embodiments, the internucleotide linkage of formula I has the structure of formula Ib: [ka] and wherein each variable is independently as defined above and as described herein.

[0414] In some embodiments, the internucleotide linkage of Formula I is represented by Formula Ic: [ka] is a phosphorothioate triester bond having the structure where P * is an asymmetric phosphorus atom, either Rp or Sp; L is a covalent bond or an optionally substituted, straight-chain or branched C1-C 10 alkylene, wherein one or more methylene units of L are optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R') optionally and independently substituted by -C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-; R 1 is halogen, R, or optionally substituted C1-C 50 aliphatic, wherein one or more methylene units are optionally and independently replaced by optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -C≡C-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-; Each R' is independently -R, -C(O)R, -COR, or -SOR, or: two R' on the same nitrogen together with their intervening atoms form an optionally substituted heterocyclic or heteroaryl ring, or two R' on the same carbon together with their intervening atoms form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring; -Cy- is an optionally substituted divalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene; each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl; and each TIFF2025066783000171.tif10166 represents the bond to the nucleoside independently; R 1 is other than -H when L is a covalent bond.

[0415] In some embodiments, an internucleotide linkage having the structure of Formula I is [ka] is.

[0416] In some embodiments, the internucleotide linkage has the structure of Formula Ic: [ka] is.

[0417] In some embodiments, the present invention provides chiral controlled oligonucleotides comprising one or more phosphodiester linkages and one or more modified internucleotide linkages having formula Ia, Ib, or Ic.

[0418] In some embodiments, the present invention provides chiral controlled oligonucleotides comprising at least one phosphodiester internucleotide linkage and at least one phosphorothioate triester linkage having the structure of Formula Ic. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising at least one phosphodiester internucleotide linkage and at least two phosphorothioate triester linkages having the structure of Formula Ic. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising at least one phosphodiester internucleotide linkage and at least three phosphorothioate triester linkages having the structure of Formula Ic. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising at least one phosphodiester internucleotide linkage and at least four phosphorothioate triester linkages having the structure of Formula Ic. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising at least one phosphodiester internucleotide linkage and at least five phosphorothioate triester linkages having the structure of Formula Ic.

[0419] In some embodiments, the present invention provides chiral controlled oligonucleotides comprising a sequence set forth in any of the Appendices hereto. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising a sequence set forth in Appendix A. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising a sequence set forth in Appendix B. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising a sequence set forth in Appendix C. In some embodiments, the present invention provides chiral controlled oligonucleotides having a sequence set forth in any of the Appendices hereto. In some embodiments, the present invention provides chiral controlled oligonucleotides having a sequence set forth in Appendix A. In some embodiments, the present invention provides chiral controlled oligonucleotides having a sequence set forth in Appendix B. In some embodiments, the present invention provides chiral controlled oligonucleotides having a sequence set forth in Appendix C.

[0420] In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC. In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein the sequence has 50% or greater identity to GCCTCAGTCTGCTTCGCACC. In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein the sequence has 60% or greater identity to GCCTCAGTCTGCTTCGCACC. In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein the sequence has 70% or greater identity to GCCTCAGTCTGCTTCGCACC. In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein the sequence has 80% or greater identity to GCCTCAGTCTGCTTCGCACC. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein the sequence has 90% or greater identity to GCCTCAGTCTGCTTCGCACC. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein the sequence has 95% or greater identity to GCCTCAGTCTGCTTCGCACC. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC. In some embodiments, the present invention provides chiral controlled oligonucleotides having the sequence GCCTCAGTCTGCTTCGCACC.

[0421] In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has a chiral linked phosphate. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has the structure of Formula I. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein each internucleotide linkage has the structure of Formula I. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has the structure of Formula Ic. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein each internucleotide linkage has the structure of Formula Ic. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has the structure of Formula Ic. [ka] In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, Each internucleotide bond is [ka] In some embodiments, the present invention provides a chirality-controlled oligonucleotide comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage is [ka] In some embodiments, the present invention provides a chirality-controlled oligonucleotide comprising the sequence set forth in GCCTCAGTCTGCTTCGCACC, wherein each internucleotide linkage is [ka] is.

[0422] In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has a chiral linked phosphate. The present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has the structure of Formula I. The present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each internucleotide linkage has the structure of Formula I. The present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has the structure of Formula Ic. The present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each internucleotide linkage has the structure of Formula Ic. The present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage [ka] The present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each internucleotide linkage is [ka] The present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide bond is [ka] The present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each internucleotide bond is [ka] is.

[0423] In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has a chiral linked phosphate. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has the structure of Formula I. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each internucleotide linkage has the structure of Formula I. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has the structure of Formula Ic. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each internucleotide linkage has the structure of Formula Ic. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage has the structure of Formula Ic. [ka] In some embodiments, the present invention provides a chirality-controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each internucleotide linkage is [ka] In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one internucleotide linkage is [ka] In some embodiments, the present invention provides a chirality-controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each internucleotide linkage is [ka] is.

[0424] In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one linked phosphate is Rp. In certain embodiments, it will be understood by those skilled in the art that the chirality-controlled oligonucleotide comprises an RNA sequence, wherein each T is independently and optionally replaced with U. In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each linked phosphate is Rp. In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one linked phosphate is Sp. In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each linked phosphate is Sp. In some embodiments, the present invention provides chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a blockmir. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a stereoblockmer. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a P-modified blockmer. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a linked blockmer. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is an altomer. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a stereoaltomer.In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a P-modified altmer. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a linked altmer. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a unimer. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a stereounimer. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a P-modified unimer. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a linked unimer. In some embodiments, the present invention provides chiral controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a gapmer. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a skipmer.

[0425] In some embodiments, the present invention provides a chirality-controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each cytosine is optionally and independently substituted with a 5-methylcytosine. In some embodiments, the present invention provides a chirality-controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one cytosine is optionally and independently substituted with a 5-methylcytosine. In some embodiments, the present invention provides a chirality-controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein each cytosine is optionally and independently substituted with a 5-methylcytosine. Exemplary chirality-controlled oligonucleotides comprising the sequence GCCTCAGTCTGCTTCGCACC are shown in Table 2 below.

[0426] Exemplary Chiral Controlled Oligonucleotides [Table 2] TIFF2025066783000187.tif238166TIFF2025066783000188.tif231166TIFF2025066783000189.tif23416 6TIFF2025066783000190.tif233166TIFF2025066783000191.tif233166TIFF2025066783000192.tif7166

[0427] In some embodiments, chiral controlled oligonucleotides are designed such that one or more nucleotides contain phosphate modifications that are susceptible to auto-release under certain circumstances.That is, under certain conditions, certain phosphorus modifications are designed to cleave from the oligonucleotide by themselves, to obtain, for example, phosphodiesters, as found in natural DNA and RNA.In some embodiments, such phosphate modifications are -OLR 1 and L and R 1Each of is independently as defined above and as described herein. In some embodiments, the auto-releasing group comprises a morpholino group. In some embodiments, the auto-releasing group is characterized by the ability to deliver an agent to the phosphate linker of an internucleotide, where the agent facilitates modification of the phosphorus atom, e.g., by desulfurization. In some embodiments, the agent is water, which is further modified by hydrolysis to form the phosphodiester found in natural DNA and RNA.

[0428] In some embodiments, chiral controlled oligonucleotides are designed to improve the properties of the resulting pharmaceuticals through one or more specific modifications at phosphate.It has been well documented in the art that some oligonucleotides are rapidly degraded by nucleases and have poor cellular uptake through cell membranes (Poijarvi-Virta et al., Curr. Med. Chem. (2006), 13(28);3441-65; Wagner et al., Med. Res. Rev. (2000), 20(6):417-51; Peyrottes et al., Mini Rev. Med. Chem. (2004), 4(4):395-408; Gosselin et al., (1996), 43(1):196-208; Bologna et al., (2002), Antisense & Nucleic Acid Drug Development 12:33-41). For example, Vives et al. (Nucleic Acids Research (1999), 27(20):4071-76) found that tert-butyl SATE pro-oligonucleotides showed significantly increased cell permeability compared to the parent oligonucleotides.

[0429] In some embodiments, the modification at the linked phosphate is characterized by its ability to be converted to a phosphodiester as occurs in natural DNA and RNA by one or more esterases, nucleases, and / or cytochrome P450 enzymes, including, but not limited to, those listed in Table 3 below. Exemplary Enzymes [Table 3] TIFF2025066783000194.tif231166TIFF2025066783000195.tif37166

[0430] In some embodiments, the modification at the phosphate results in a P-modification moiety that functions as a prodrug, e.g., the P-modification moiety facilitates delivery of the oligonucleotide to a desired location prior to removal. For example, in some embodiments, the P-modification moiety is pegylated at the attached phosphate. Those skilled in the relevant art will appreciate that a variety of PEG chain lengths are useful, with the selection of chain length being determined, in part, by the desired outcome of the pegylation. For example, in some embodiments, pegylation reduces RES uptake and increases the circulating lifetime of the oligonucleotide in vivo.

[0431] In some embodiments, the molecular weight of the reagent used in the PEGylation according to the present invention is about 300 g / mol to about 100,000 g / mol. In some embodiments, the molecular weight of the reagent used in the PEGylation is about 300 g / mol to about 10,000 g / mol. In some embodiments, the molecular weight of the reagent used in the PEGylation is about 300 g / mol to about 5,000 g / mol. In some embodiments, the molecular weight of the reagent used in the PEGylation is about 500 g / mol. In some embodiments, the molecular weight of the reagent used in the PEGylation is about 1,000 g / mol. In some embodiments, the molecular weight of the reagent used in the PEGylation is about 3,000 g / mol. In some embodiments, the molecular weight of the reagent used in the PEGylation is about 5,000 g / mol.

[0432] In certain embodiments, the reagent used for PEGylation is PEG500. In certain embodiments, the reagent used for PEGylation is PEG1000. In certain embodiments, the reagent used for PEGylation is PEG3000. In certain embodiments, the reagent used for PEGylation is PEG5000.

[0433] In some embodiments, the P-modifying moiety is characterized by functioning as a PK enhancer, such as, for example, a lipid, a PEGylated lipid, etc.

[0434] In some embodiments, the P-modifying moiety is characterized as functioning as an agent that promotes cell entry and / or endosomal escape, such as a membrane-disrupting lipid or peptide.

[0435] In some embodiments, the P-modifying moiety is characterized by its ability to function as a targeting agent. In some embodiments, the P-modifying moiety is or includes a targeting agent. The term "targeting agent" as used herein refers to an agent that associates with a target payload (e.g., associated with an oligonucleotide or oligonucleotide composition) and interacts with a target site of interest. Thus, a target payload targets a target site of interest when associated with the targeting agent substantially more than would be observed or under comparable circumstances if the target payload were not associated with the targeting agent. A targeting agent may be or include any of a variety of chemical moieties, such as, for example, a small molecule moiety, a nucleic acid, a polypeptide, or a carbohydrate. Targeting agents are further described in Adarsh ​​et al., "Organelle Specific Targeted Drug Delivery - A Review," International Journal of Research in Pharmaceutical and Biomedical Sciences, 2011, p. 895.

[0436] Exemplary such targeting agents include, but are not limited to, proteins (e.g., transferrin), oligopeptides (e.g., cyclic and acyclic RGD-containing oligopeptides), antibodies (monoclonal and polyclonal antibodies, e.g., IgG, IgA, IgM, IgD, IgE antibodies), sugars / carbohydrates (e.g., monosaccharides and / or oligosaccharides (mannose, mannose-6-phosphate, galactose, etc.)), vitamins (e.g., folic acid), or another small biomolecule. In some embodiments, the targeting moiety is a steroid molecule (e.g., bile acids, including cholic acid, deoxycholic acid, dehydrocholic acid; cortisone; digoxigenin; testosterone; cholesterol; cationic steroids such as cortisone having a trimethylaminomethylhydrazide group attached through a double bond at the 3-position of the cortisone ring; etc.). In some embodiments, the targeting moiety is a lipid-soluble molecule (e.g., alicyclic hydrocarbons, saturated and unsaturated fatty acids, waxes, terpenes, and polyalicyclic hydrocarbons such as enamel and buckminsterfullerene). In some embodiments, the lipid-soluble molecule is a terpenoid such as vitamin A, retinoic acid, retinal, or dehydroretinal. In some embodiments, the targeting moiety is a peptide.

[0437] In some embodiments, the P-modifying moiety has the formula --XLR 1 and X, L, and R 1 Each of is as defined in Formula I above.

[0438] In some embodiments, the P-modification moiety is characterized to facilitate specific delivery to cells.

[0439] In some embodiments, the P-modifying moiety is characterized by being included in one or more of the above-described categories. For example, in some embodiments, the P-modifying moiety functions as both a PK enhancer and a targeting ligand. In some embodiments, the P-modifying moiety functions as a prodrug and an endosomal escape agent. Those skilled in the relevant art will recognize that many other such combinations are possible and contemplated by the present invention.

[0440] Nucleic acid bases In some embodiments, the nucleobase present in provided oligonucleotide is natural nucleobase or is modified nucleobase derived from natural nucleobase.Examples include but are not limited to uracil, thymine, adenine, cytosine and guanine, each amino group of which is protected by acyl protecting group, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pyrimidine analogs such as pseudoisocytosine and pseudouracil, and other modified nucleobases such as 8-substituted purine, xanthine or hypoxanthine (the latter two are natural decomposition products). Exemplary modified nucleobases are disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048, Limbach et al. Nucleic Acids Research, 1994, 22, 2183-2196, and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313.

[0441] Compounds represented by the following general formula are also contemplated as modified nucleobases: [ka] where R 8is an optionally substituted straight or branched chain group selected from aliphatic, aryl, aralkyl, aryloxylalkyl, carbocyclyl, heterocyclyl or heteroaryl groups having 1 to 15 carbon atoms, including, by way of example only, methyl, isopropyl, phenyl, benzyl, or phenoxymethyl groups; and R 9 and R 10 Each of is independently an optionally substituted group selected from straight-chain or branched aliphatic, carbocyclyl, aryl, heterocyclyl, and heteroaryl.

[0442] Modified nucleobases also include the expanded nucleobases, for example, by adding one or more aryl rings, such as phenyl rings.Nucleobase substitutions are described in the Glen Research catalog (www.glenresearch.com); Krueger AT et al., Acc. Chem. Res., 2007, 40, 141-150; Kool, ET, Acc. Chem. Res., 2002, 35, 936-943; Benner SA, et al., Nat. Rev. Genet., 2005, 6, 553-543; Romesberg, FE, et al., Curr. Opin. Chem. Biol., 2003, 7, 723-733; Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627, and are considered to be useful in the synthesis of the nucleic acids described herein. Some examples of expanded size nucleobases are as follows: [ka]

[0443] Here, modified nucleobases also include structures that are not considered nucleobases, but are other moieties such as, but not limited to, corrin or porphyrin-derived rings. Porphyrin-derived base substitutions are described in Morales-Rojas, H and Kool, ET, Org. Lett., 2002, 4, 4377-4380. An example of a porphyrin-derived ring used as a base substitution is shown below: [ka]

[0444] In some embodiments, a modified nucleobase has any of the following structures, optionally substituted: [ka] .

[0445] In some embodiments, the modified nucleobase is fluorescent. Exemplary modified nucleobases that are fluorescent include phenanthrene, pyrene, stilbene, isoxanthine, isozanthopterin, terphenyl, terthiophene, benzoterthiophene, coumarin, lumazine, tethered stilbene, benzo-uracil, and naphtho-uracil, as shown below: [ka] .

[0446] In some embodiments, modified nucleobase is unsubstituted.In some embodiments, modified nucleobase is substituted.In some embodiments, modified nucleobase is substituted to include, for example, heteroatom, alkyl group, or binding moiety that is linked to fluorescent moiety, biotin or avidin moiety, or another protein or peptide.In some embodiments, modified nucleobase is not a nucleobase in the most classical sense, but is a "universal base" that functions similarly to nucleobase.A typical example of such universal base is 3-nitropyrrole.

[0447] In some embodiments, other nucleosides can also be used in the processes disclosed herein, including nucleosides incorporating modified nucleobases or nucleobases covalently linked to modified sugars. Some examples of nucleosides incorporating modified nucleobases include 4-acetylcytidine; 5-(carboxyhydroxymethyl)uridine; 2'-O-methylcytidine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyluridine; dihydrouridine; 2'-O-methylpseudouridine; beta, D-galactosylqueosine; 2'-O-methylguanosine; N-acetylcytidine ... 6 -Isopentenyl adenosine; 1-methyl adenosine; 1-methylpseudouridine; 1-methylguanosine; l-methylinosine; 2,2-dimethylguanosine; 2-methyladenosine; 2-methylguanosine; N 7 -Methylguanosine; 3-methyl-cytidine; 5-methylcytidine; 5-hydroxymethylcytidine; 5-formylcytosine; 5-carboxylcytosine; N 6 -Methyladenosine; 7-methylguanosine; 5-methylaminoethyluridine; 5-methoxyaminomethyl-2-thiouridine; beta,D-mannosylqueosine; 5-methoxycarbonylmethyluridine; 5-methoxyuridine; 2-methylthio-N 6-isopentenyladenosine; N-((9-beta D ribofuranosyl-2-methylthiopurin-6-yl)carbamoyl)threonine; N-((9-beta D ribofuranosylpurin-6-yl)-N-methylcarbamoyl)threonine; uridine-5-oxyacetic acid methyl ester; uridine-5-oxyacetic acid(v); pseudouridine; queosine; 2-thiocytidine; 5-methyl-2-thiouridine; 2-thiouridine; 4-thiouridine; 5-methyluridine; 2'-O-methyl-5-methyluridine; and 2'-O-methyluridine.

[0448] In some embodiments, the nucleoside comprises a 6'-modified bicyclic nucleoside analog having either (R) or (S) chirality at the 6' position, including the analogs described in U.S. Patent No. 7,399,845. In another embodiment, the nucleoside comprises a 5'-modified bicyclic nucleoside analog having either (R) or (S) chirality at the 5' position, including the analogs described in U.S. Patent Application Publication No. 20070287831.

[0449] In some embodiments, the nucleobase or modified nucleobase comprises one or more biomolecule-binding moieties, such as, for example, an antibody, antibody fragment, biotin, avidin, streptavidin, receptor ligand, or chelating moiety. In another embodiment, the nucleobase or modified nucleobase is 5-bromouracil, 5-iodouracil, or 2,6-diaminopurine. In some embodiments, the nucleobase or modified nucleobase is modified by substitution with a fluorescent or biomolecule-binding moiety. In some embodiments, the substituent on the nucleobase or modified nucleobase is a fluorescent moiety. In some embodiments, the substituent on the nucleobase or modified nucleobase is biotin or avidin.

[0450] Representative U.S. patents that teach the preparation of certain of the above and other modified nucleobases include, but are not limited to, the above-mentioned U.S. Pat. No. 3,687,808, and U.S. Pat. Nos. 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,457,191; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540. ;5,587,469;5,594,121;5,596,091;5,614,617;5,681,941;5,750,692;6,015,886;6,147,200;6,166,197;6,222,025;6,235,887;6,380,368;6,528,640;6,639,062;6,617,438;7,045,610;7,427,672;and7,495,088, which are incorporated herein in their entireties.

[0451] sugar The most common natural nucleotides consist of a ribose sugar linked to the nucleobases adenosine (A), cytosine (C), guanine (G), and thymine (T) or uracil (U). Modified nucleotides are also contemplated, in which the phosphate group or linked phosphate in the nucleotide can be attached to various positions on the sugar or modified sugar. As a non-limiting example, the phosphate group or linked phosphate can be attached to the 2', 3', 4', or 5' hydroxyl moiety of the sugar or modified sugar. Nucleotides incorporating modified nucleobases described herein are also contemplated in this context. In some embodiments, nucleotides or modified nucleotides containing an unprotected -OH moiety are used in accordance with the methods of the present invention.

[0452] Other modified sugars are also incorporated into the provided oligonucleotides. In some embodiments, the modified sugar comprises one or more substituents at the 2-position including one of the following: -F; -CF, -CN, -N, -NO, -NO, -OR', -SR', or -N(R')2, where each R' is independently as defined above and described herein; -O-(C1-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 alkyl), or -N(C1-C 10 alkyl)2;-O-(C2-C 10 alkenyl), -S-(C2-C 10 alkenyl), -NH-(C2-C 10 alkenyl), or -N(C2-C 10 alkenyl)2; -O-(C2-C 10 alkynyl), -S-(C2-C 10 alkynyl), -NH-(C2-C 10 alkynyl), or -N(C2-C 10 alkynyl)2; or -O--(C1-C 10 Alkylene)-O--(C1-C 10 alkyl), -O-(C1-C 10 Alkylene)-NH-(C1-C 10 alkyl) or -O-(C1-C 10 Alkylene)-NH(C1-C 10 alkyl)2, -NH-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), or -N(C1-C 10 Alkyl)-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), where alkyl, alkylene, alkenyl, and alkynyl may be substituted or unsubstituted. Examples of substituents include, but are not limited to, -O(CH) n OCH3 and -O(CH2) nNH2, where n is 1 to about 10, including MOE, DMAOE, and DMAEOE. Also contemplated herein are modified sugars described in WO 2001 / 088198 and Martin et al., Helv. Chim. Acta, 1995, 78, 486-504. In some embodiments, the modified sugar comprises one or more groups selected from a substituted silyl group, an RNA cleaving group, a reporter group, a fluorescent label, an intercalator, a group that improves the pharmacokinetics of nucleic acids, a group that improves the pharmacodynamic properties of nucleic acids, or another substituent with similar properties. In some embodiments, the modification occurs at one or more of the 2', 3', 4', 5', or 6' positions of the sugar or modified sugar, including the 3' position of the sugar of the 3'-terminal nucleotide or the 5' position of the 5'-terminal nucleotide.

[0453] In some embodiments, the 2'-OH of the ribose is substituted with a substituent comprising one of the following: -H, -F; -CF, -CN, -N, -NO, -NO, -OR', -SR', or -N(R') where each R' is independently as defined above and as described herein; -O-(C1-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 alkyl), or -N(C1-C 10 alkyl)2;-O-(C2-C 10 alkenyl), -S-(C2-C 10 alkenyl), -NH-(C2-C 10 alkenyl), or -N(C2-C 10 alkenyl)2; -O-(C2-C 10 alkynyl), -S-(C2-C 10 alkynyl), -NH-(C2-C 10 alkynyl), or -N(C2-C 10 alkynyl)2; or -O--(C1-C 10 Alkylene)-O--(C1-C 10 alkyl), -O-(C1-C 10 Alkylene)-NH-(C1-C10 alkyl) or -O-(C1-C 10 Alkylene)-NH(C1-C 10 alkyl)2, -NH-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), or -N(C1-C 10 Alkyl)-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), where alkyl, alkylene, alkenyl, and alkynyl may be substituted or unsubstituted. In some embodiments, 2'-OH is substituted with -H (deoxyribose). In some embodiments, 2'-OH is substituted with -F. In some embodiments, 2'-OH is substituted with -OR'. In some embodiments, 2'-OH is substituted with -OMe. In some embodiments, 2'-OH is substituted with -OCHCHOMe.

[0454] Modified sugars also include locked nucleic acids (LNAs). In some embodiments, locked nucleic acids have the structure shown below: In the locked nucleic acids of the following structure, Ba represents a nucleobase or modified nucleobase as described herein, and R represents a nucleobase or modified nucleobase as described herein. 2s is -OCH2C4'-. [ka]

[0455] In some embodiments, the modified sugar is an ENA, e.g., as described in Sethet al., Jam Chem Soc. 2010 October 27;132(42):14942-14950. In some embodiments, the modified sugar is one found in an XNA (xenonucleic acid), e.g., arabinose, anhydrohexitol, threose, 2'fluoroarabinose, or cyclohexene.

[0456] Modified sugars include sugar mimetics such as cyclobutyl or cyclopentyl moieties in place of pentofuranosyl sugars. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; and 5,359,044. Some contemplated modified sugars include sugars in which the oxygen atom of the ribose ring is replaced with nitrogen, sulfur, selenium, or carbon. In some embodiments, the modified sugar is a modified ribose, in which the oxygen atom in the ribose ring is replaced with nitrogen, which may be replaced with an alkyl group (e.g., methyl, ethyl, isopropyl, etc.).

[0457] Non-limiting examples of modified sugars include glycerol to form glycerol nucleic acid (GNA) analogs. An example of a GNA analog is shown below and is described in Zhang, R et al., J. Am. Chem. Soc., 2008, 130, 5846-5847; Zhang L, et al., J. Am. Chem. Soc., 2005, 127, 4174-4175 and Tsai CH et al., PNAS, 2007, 14598-14603 (X = O - ) [ka] .

[0458] Another example of a GNA-derived analogue, a flexible nucleic acid (FNA) based on the mixed acetal aminal of formylglycerol, is described in Joyce GF et al., PNAS, 1987, 84, 4398-4402 and Heuberger BD and Switzer C, J. Am. Chem. Soc., 2008, 130, 412-413, and is as follows: [ka] .

[0459] Further non-limiting examples of modified sugars include hexopyranosyl(6'-4'), pentopyranosyl(4'-2'), pentopyranosyl(4'-3'), or tetrofuranosyl(3'-2') sugars. In some embodiments, the hexopyranosyl(6'-4') sugar has the formula: [ka] , One of the following: where X s is a P-modifying group "-XLR" as described herein 1 " and Ba is as defined herein.

[0460] In some embodiments, the pentopyranosyl(4'-2') sugar has the formula: [ka] One of the following: where X s is a P-modifying group "-XLR" as described herein 1 " and Ba is as defined herein.

[0461] In some embodiments, the pentopyranosyl(4'-3') sugar has the formula: [ka] , One of the following: where X s is a P-modifying group "-XLR" as described herein 1 " and Ba is as defined herein.

[0462] In some embodiments, the tetrofuranosyl(3'-2') sugar has the formula: [ka] , Either where Xs is a P-modifying group "-XLR" as described herein 1 " and Ba is as defined herein.

[0463] In some embodiments, the modified sugar has the formula: [ka] One of the following: where X s is a P-modifying group "-XLR" as described herein 1 " and Ba is as defined herein.

[0464] In some embodiments, one or more hydroxyl groups of the sugar moiety may be independently substituted with a halogen, R'-N(R')2, -OR', or -SR', where each R' is independently as defined above and described herein.

[0465] In some embodiments, the sugar mimetic is as shown below, X s is a P-modifying group "-XLR" as described herein 1 ", Ba is as defined herein, and X 1 -S-, -Se-, -CH 2- , -NMe-, -NEt- or -NiPr-. [ka]

[0466] In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 12 In some embodiments, about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, or more (e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more) of the sugars of the chiral controlled oligonucleotide compositions are modified. In some embodiments, only purine residues are modified (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, or more (e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, or more [e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more] of the purine residues are modified). In some embodiments, only pyrimidine residues are modified (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 3%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50% or more [e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more] of the pyridimine residues are modified. In some embodiments, both purine and pyrimidine residues are modified.

[0467] Modified sugars and sugar mimetics can be prepared by known methods, including, but not limited to, A. Eschenmoser, Science (1999), 284:2118; M. Bohringer et al., Helv. Chim. Acta (1992), 75:1416-1477; M. Eglietal, J. Am. Chem. Soc. (2006), 128(33):10847-56; A. Eschenmoser, Chemical Synthesis:GnosistoPrognosis,C.ChatgilialogluandV.Sniekus,Ed.,(KluwerAcademic,Netherlands,1996),p.293;K.-U.Schoningetal,Science(2000),290:1347-1351;A.Eschenmoseretal,Helv.Chim.Acta(19 92),75:218;J.Hunzikeretal,Helv.Chim.Acta(1993),76:259;G.Ottingetal,Helv.Chim.Acta(1993),76: 2701; K. Groebkeetal, Helv. Chim. Acta (1998), 81: 375; and A. Eschenmoser, Science (1999), 284: 2118. Modifications to 2' modifications are described in Verma, S. et al. Annu. Rev. Biochem. 1998, 67, 99-134 and all references cited therein. Specific modifications to ribose are described in the following references: 2'-fluoro (Kawasaki et al., J. Med. Chem., 1993, 36, 831-841), 2'-MOE (Martin, P. Helv. Chim. Acta 1996, 79, 1930-1938), "LNA" (Wengel, J. Acc. Chem. Res. 1999, 32, 301-310). In some embodiments, the modified sugar is any of those described in PCT Publication WO 2012 / 030683, which is incorporated herein by reference and depicted in Figures 26-30 of this application.

[0468] Oligonucleotides In some embodiments, the present invention provides chiral controlled oligonucleotides and oligonucleotide compositions. For example, in some embodiments, the provided compositions comprise predetermined levels of one or more individual oligonucleotide types, where the oligonucleotide types are defined by 1) base sequence; 2) backbone bond pattern; 3) backbone chiral center pattern; and 4) backbone P-modification pattern.

[0469] In some embodiments, provided oligonucleotides are unimers. In some embodiments, provided oligonucleotides are P-modified unimers. In some embodiments, provided oligonucleotides are stereounimers. In some embodiments, provided oligonucleotides are stereounimers in the Rp configuration. In some embodiments, provided oligonucleotides are stereounimers in the Sp configuration.

[0470] In some embodiments, provided oligonucleotides are altomers. In some embodiments, provided oligonucleotides are P-modified altomers. In some embodiments, provided oligonucleotides are stereoaltomers.

[0471] In some embodiments, provided oligonucleotides are blockmirs. In some embodiments, provided oligonucleotides are P-modified blockmirs. In some embodiments, provided oligonucleotides are stereoblockmirs.

[0472] In some embodiments, the provided oligonucleotide is a gapmer.

[0473] In some embodiments, the provided oligonucleotide is a skipmer.

[0474] In some embodiments, the provided oligonucleotides are a combination of one or more of unimers, altmers, blockmers, gapmers, and skipmers. For example, in some embodiments, the provided oligonucleotides are both altmers and gapmers. In some embodiments, the provided nucleotides are both gapmers and skipmers. Those skilled in the art of chemistry and synthesis will recognize that numerous alternative combinations are possible, limited only by the commercial availability and / or synthetic accessibility of the components necessary to synthesize the provided oligonucleotides according to the methods of the present invention.

[0475] In some embodiments, provided oligonucleotides comprise one or more optionally substituted nucleotides. In some embodiments, provided oligonucleotides comprise one or more modified nucleotides. In some embodiments, provided oligonucleotides comprise one or more optionally substituted nucleosides. In some embodiments, provided oligonucleotides comprise one or more modified nucleosides. In some embodiments, provided oligonucleotides comprise one or more optionally substituted LNAs.

[0476] In some embodiments, provided oligonucleotides comprise one or more optionally substituted nucleobases. In some embodiments, provided oligonucleotides comprise one or more optionally substituted natural nucleobases. In some embodiments, provided oligonucleotides comprise one or more optionally substituted modified nucleobases. In some embodiments, provided oligonucleotides comprise one or more 5-methylcytidines; 5-hydroxymethylcytidine, 5-formylcytosine, or 5-carboxylcytosine. In some embodiments, provided oligonucleotides comprise one or more 5-methylcytidines.

[0477] In some embodiments, provided oligonucleotides comprise one or more optionally substituted sugars. In some embodiments, provided oligonucleotides comprise one or more optionally substituted sugars found in natural DNA and RNA. In some embodiments, provided oligonucleotides comprise one or more optionally substituted riboses or deoxyriboses. In some embodiments, provided oligonucleotides comprise one or more optionally substituted riboses or deoxyriboses, wherein one or more hydroxyl groups of the ribose or deoxyribose moiety are independently substituted with a halogen, R', -N(R')2, -OR', or -SR', where each R' is independently defined above and as described herein. In some embodiments, provided oligonucleotides comprise one or more optionally substituted deoxyriboses, wherein the 2'-position of the deoxyribose is independently substituted with a halogen, R', -N(R')2, -OR', or -SR', where each R' is independently defined above and as described herein. In some embodiments, provided oligonucleotides comprise one or more optionally substituted deoxyriboses, wherein the 2' position of the deoxyribose is optionally substituted with a halogen. In some embodiments, provided oligonucleotides comprise one or more optionally substituted deoxyriboses, wherein the 2' position of the deoxyribose is optionally substituted with one or more -F halogens. In some embodiments, provided oligonucleotides comprise one or more optionally substituted deoxyriboses, wherein the 2' position of the deoxyribose is optionally substituted with -OR', wherein each R' is independently as defined above and described herein. In some embodiments, provided oligonucleotides comprise one or more optionally substituted deoxyriboses, wherein the 2' position of the deoxyribose is optionally substituted with -OR', wherein each R' is independently an optionally substituted C1-C6 aliphatic.In some embodiments, provided oligonucleotides comprise one or more optionally substituted deoxyribose groups, each of which is independently substituted at the 2' position with -OR', where each R' is an optionally substituted C1-C6 alkyl. In some embodiments, provided oligonucleotides comprise one or more optionally substituted deoxyribose groups, each of which is independently substituted at the 2' position with -OMe. In some embodiments, provided oligonucleotides comprise one or more optionally substituted deoxyribose groups, each of which is independently substituted at the 2' position with -O-methoxyethyl.

[0478] In some embodiments, the provided oligonucleotide is a single-stranded oligonucleotide.

[0479] In some embodiments, the provided oligonucleotide is a hybridized oligonucleotide strand. In some embodiments, the provided oligonucleotide is a partially hybridized oligonucleotide strand. In some embodiments, the provided oligonucleotide is a fully hybridized oligonucleotide strand. In some embodiments, the provided oligonucleotide is a double-stranded oligonucleotide. In some embodiments, the provided oligonucleotide is a triplex oligonucleotide (e.g., triplex).

[0480] In some embodiments, the provided oligonucleotides are chimeric, e.g., in some embodiments, the provided oligonucleotides are DNA-RNA chimeras, DNA-LNA chimeras, etc.

[0481] In some embodiments, any one of the oligonucleotide-containing structures described in WO 2012 / 030683 is modified according to the methods of the present invention to provide chirality-controlled variants thereof. For example, in some embodiments, the chirality-controlled variant includes a stereochemical modification at any one or more of the attached phosphates and / or a P-modification at any one or more of the attached phosphates. For example, in some embodiments, specific nucleotide units of the oligonucleotides of WO 2012 / 030683 are preselected to be stereochemically modified at the attached phosphate of that nucleotide unit and / or P-modified at the attached phosphate of that nucleotide unit. In some embodiments, the chirality-controlled oligonucleotide is any one of the structures shown in Figures 26-30. In some embodiments, the chirality-controlled oligonucleotide is a variant (e.g., a modified version) of any one of the structures shown in Figures 26-30. The disclosure of WO 2012 / 030683 is incorporated herein by reference in its entirety.

[0482] In some embodiments, provided oligonucleotides are therapeutic agents.

[0483] In some embodiments, the provided oligonucleotide is an antisense oligonucleotide.

[0484] In some embodiments, the provided oligonucleotide is an antigene oligonucleotide.

[0485] In some embodiments, the provided oligonucleotide is a decoy oligonucleotide.

[0486] In some embodiments, the provided oligonucleotide is part of a DNA vaccine.

[0487] In some embodiments, the oligonucleotides provided are immune modulatory oligonucleotides, such as immune stimulatory oligonucleotides and immune suppressive oligonucleotides.

[0488] In some embodiments, the provided oligonucleotide is an adjuvant.

[0489] In some embodiments, the provided oligonucleotide is an aptamer.

[0490] In some embodiments, the provided oligonucleotide is a ribozyme.

[0491] In some embodiments, the provided oligonucleotide is a deoxyribozyme (DNAzyme or DNA enzyme).

[0492] In some embodiments, the provided oligonucleotide is a small interfering RNA.

[0493] In some embodiments, the oligonucleotides provided are microRNAs or miRNAs.

[0494] In some embodiments, the oligonucleotides provided are ncRNAs (non-coding RNAs), including long non-coding RNAs (lncRNAs) and small non-coding RNAs such as Piwi-binding RNAs (piRNAs).

[0495] In some embodiments, provided oligonucleotides are complementary to structural RNA, such as tRNA.

[0496] In some embodiments, provided oligonucleotides are nucleic acid analogs, such as GNAs, LNAs, PNAs, TNAs, and morpholinos.

[0497] In some embodiments, provided oligonucleotides are prodrugs of the P-modification.

[0498] In some embodiments, the provided oligonucleotides are primers. In some embodiments, the primers are used in polymerase-based chain reactions (i.e., PCR) to amplify nucleic acids. In some embodiments, the primers are used in any of the known variations of PCR, such as reverse transcription PCR (RT-PCR) and real-time PCR.

[0499] In some embodiments, provided oligonucleotides are characterized by their ability to modulate RNase H activation. For example, in some embodiments, RNase H activation is modulated by the presence of stereocontrolled phosphorothioate nucleic acid analogs, with natural DNA / RNA being equally or more sensitive than the Rp stereoisomer, which is more sensitive than the corresponding Sp stereoisomer.

[0500] In some embodiments, provided oligonucleotides are characterized by their ability to indirectly or directly increase or decrease protein activity or to suppress or promote protein expression, hi some embodiments, provided oligonucleotides are characterized by their usefulness in regulating cell proliferation, viral replication, and / or another cell signaling process.

[0501] In some embodiments, the provided oligonucleotides are about 2 to about 200 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 180 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 160 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 140 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 120 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 100 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 90 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 80 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 70 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 60 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 50 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 40 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 2 to about 30 nucleotide units in length. In some embodiments, the oligonucleotides provided are from about 2 to about 29 nucleotide units in length. In some embodiments, the oligonucleotides provided are from about 2 to about 28 nucleotide units in length. In some embodiments, the oligonucleotides provided are from about 2 to about 27 nucleotide units in length. In some embodiments, the oligonucleotides provided are from about 2 to about 26 nucleotide units in length. In some embodiments, the oligonucleotides provided are from about 2 to about 25 nucleotide units in length. In some embodiments, the oligonucleotides provided are from about 2 to about 24 nucleotide units in length.In some embodiments, the oligonucleotides provided are from about 2 to about 23 nucleotide units in length. In some embodiments, the oligonucleotides provided are from about 2 to about 22 nucleotide units in length. In some embodiments, the oligonucleotides provided are from about 2 to about 21 nucleotide units in length. In some embodiments, the oligonucleotides provided are from about 2 to about 20 nucleotide units in length.

[0502] In some embodiments, the provided oligonucleotides are about 4 to about 200 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 180 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 160 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 140 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 120 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 100 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 90 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 80 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 70 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 60 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 50 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 40 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 4 to about 30 nucleotide units in length. In some embodiments, the oligonucleotides provided are about 4 to about 29 nucleotide units in length. In some embodiments, the oligonucleotides provided are about 4 to about 28 nucleotide units in length. In some embodiments, the oligonucleotides provided are about 4 to about 27 nucleotide units in length. In some embodiments, the oligonucleotides provided are about 4 to about 26 nucleotide units in length. In some embodiments, the oligonucleotides provided are about 4 to about 25 nucleotide units in length. In some embodiments, the oligonucleotides provided are about 4 to about 24 nucleotide units in length.In some embodiments, the oligonucleotides provided are about 4 to about 23 nucleotide units in length. In some embodiments, the oligonucleotides provided are about 4 to about 22 nucleotide units in length. In some embodiments, the oligonucleotides provided are about 4 to about 21 nucleotide units in length. In some embodiments, the oligonucleotides provided are about 4 to about 20 nucleotide units in length.

[0503] In some embodiments, the provided oligonucleotides are about 5 to about 10 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 10 to about 30 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 15 to about 25 nucleotide units in length. In some embodiments, the provided oligonucleotides are about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide units in length.

[0504] In some embodiments, the oligonucleotide is at least 2 nucleotide units long. In some embodiments, the oligonucleotide is at least 3 nucleotide units long. In some embodiments, the oligonucleotide is at least 4 nucleotide units long. In some embodiments, the oligonucleotide is at least 5 nucleotide units long. In some embodiments, the oligonucleotide is at least 6 nucleotide units long. In some embodiments, the oligonucleotide is at least 7 nucleotide units long. In some embodiments, the oligonucleotide is at least 8 nucleotide units long. In some embodiments, the oligonucleotide is at least 9 nucleotide units long. In some embodiments, the oligonucleotide is at least 10 nucleotide units long. In some embodiments, the oligonucleotide is at least 11 nucleotide units long. In some embodiments, the oligonucleotide is at least 12 nucleotide units long. In some embodiments, the oligonucleotide is at least 15 nucleotide units long. In some embodiments, the oligonucleotide is at least 20 nucleotide units long. In some embodiments, the oligonucleotide is at least 25 nucleotide units long. In some embodiments, the oligonucleotide is at least 30 nucleotide units long. In some embodiments, the oligonucleotide is double-stranded with complementary strands at least 18 nucleotide units long. In some embodiments, the oligonucleotide is double-stranded with complementary strands at least 21 nucleotide units in length.

[0505] In some embodiments, the 5' and / or 3' ends of the provided oligonucleotides are modified. In some embodiments, the 5' and / or 3' ends of the provided oligonucleotides are modified with a terminal cap moiety. Exemplary modifications, including terminal cap moieties, are described in detail herein and in the art, for example, but not limited to, U.S. Patent Application Publication No. 2009 / 0023675A1.

[0506] Oligonucleotide seeds In certain embodiments, the oligonucleotide of Formula I has any one of the structures shown in Table 2 above or described in the Examples.

[0507] In some embodiments, chiral controlled oligonucleotides are provided that contain the sequence of mipomersen or a portion of the sequence of mipomersen. Mipomersen is based on the following base sequence: GCCT / UCAGT / UCT / UGCT / UT / UCGCACC. In some embodiments, one or more nucleotides or any of the linkages may be modified in accordance with the present invention. In some embodiments, the present invention provides chiral controlled oligonucleotides with 3' to 5' phosphorothioate linkages and the following sequence: G*-C*-C*-U*-C*-dA-dG-dT-dC-dT-dG-dmC-dT-dT-dmC-G*-C*-A*-C*-C* [d=2'-deoxy, *=2'-O-(2-methoxyethyl)]. Exemplary modified mipomersen sequences are described throughout this application and include, but are not limited to, those listed in Table 4.

[0508] In some embodiments, the oligonucleotide provided is a mipomersen unimer. In some embodiments, the oligonucleotide provided is a mipomersen unimer in the Rp configuration. In some embodiments, the oligonucleotide provided is a mipomersen unimer in the Sp configuration.

[0509] Exemplary chiral controlled oligonucleotides containing the sequence of mipomersen, or a portion of the sequence of mipomersen, are set forth in Table 4 below.

[0510] Exemplary mipomersen-related sequences [Table 4] TIFF2025066783000211.tif230166TIFF2025066783000212.tif234166TIFF2025066783 000213.tif234166TIFF2025066783000214.tif233166TIFF2025066783000215.tif28166

[0511] Oligonucleotide Composition The present invention provides compositions comprising or consisting of a plurality of provided oligonucleotides (e.g., chiral controlled oligonucleotide compositions). In some embodiments, such provided oligonucleotides are all of the same type, i.e., all have the same base sequence, backbone linkage pattern (i.e., internucleotide linkage type pattern, e.g., phosphate, phosphorothioate, etc.), backbone chiral center pattern (i.e., linked phosphate stereochemistry (Rp / Sp) pattern), and phosphate backbone modification pattern (e.g., "-XLR" in the pattern of Formula I). 1 " group). In many embodiments, however, the compositions provided generally comprise a plurality of oligonucleotide types in predetermined relative amounts.

[0512] In some embodiments, provided chiral controlled oligonucleotide compositions are chirally pure mipomersen compositions, i.e., in some embodiments, provided chiral controlled oligonucleotide compositions provide mipomersen as one diastereomer with respect to the configuration of the attached phosphate.

[0513] In some embodiments, the provided chiral controlled oligonucleotide compositions are chirally uniform mipomersen compositions, i.e., in some embodiments, each and every linked phosphate of mipomersen is in the Rp configuration, or each and every linked phosphate of mipomersen is in the Sp configuration.

[0514] In some embodiments, the provided chiral controlled oligonucleotide compositions comprise a combination of one or more of the provided oligonucleotide types. Those skilled in the chemical and pharmaceutical fields will recognize that the selection and amount of each of the one or more types of provided oligonucleotides in the provided compositions will depend on the intended use of the composition. That is, those skilled in the relevant technical fields will design the provided chiral controlled oligonucleotide compositions so that the amount and type contained in the provided oligonucleotides have certain desired properties (e.g., biologically desirable properties, therapeutically desirable properties, etc.) for the composition as a whole.

[0515] In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of two or more provided oligonucleotide types. In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of three or more provided oligonucleotide types. In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of four or more provided oligonucleotide types. In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of five or more provided oligonucleotide types. In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of six or more provided oligonucleotide types. In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of seven or more provided oligonucleotide types. In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of eight or more provided oligonucleotide types. In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of nine or more provided oligonucleotide types. In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of ten or more provided oligonucleotide types. In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of fifteen or more provided oligonucleotide types.

[0516] In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of an amount of chirally uniform mipomersen in the Rp configuration and an amount of chirally uniform mipomersen in the Sp configuration.

[0517] In some embodiments, the chiral controlled oligonucleotide compositions provided are a combination of a fixed amount of chirally uniform mipomersen in the Rp configuration, a fixed amount of chirally uniform mipomersen in the Sp configuration, and a fixed amount of one or more chirally pure mipomersen in desired diastereomeric forms.

[0518] Methods for making chiral controlled oligonucleotides and compositions thereof The present invention provides methods for making chiral controlled oligonucleotides and chiral controlled compositions containing one or more unique nucleotide types. As noted above, the term "oligonucleotide type" herein refers to a specific base sequence, pattern of backbone linkages, pattern of backbone chiral centers, and pattern of phosphate backbone modifications (e.g., "-XLR"). 1 " group). Oligonucleotides of a generally designated "type" are structurally identical to one another with respect to base sequence, backbone bond pattern, backbone chiral center pattern, and phosphate backbone modification pattern.

[0519] In some embodiments, the chiral controlled oligonucleotides provided herein have different properties than their corresponding sterically random oligonucleotide mixtures. In some embodiments, the chiral controlled oligonucleotides have different lipid solubilities than their corresponding sterically random oligonucleotide mixtures. In some embodiments, the chiral controlled oligonucleotides have different retention times in HPLC. In some embodiments, the chiral controlled oligonucleotides may have peak retention times that are significantly different from their corresponding sterically random oligonucleotide mixtures. During oligonucleotide purification using HPLC, as is commonly practiced in the art, certain chiral controlled oligonucleotides are largely, if not completely, lost. During oligonucleotide purification using HPLC, as is commonly practiced in the art, certain chiral controlled oligonucleotides are largely, if not completely, lost. One consequence is that certain diastereomers (certain chiral controlled oligonucleotides) of a sterically random oligonucleotide mixture are not assayed. Another consequence is that, due to unavoidable instrumental and human error from batch to batch, a stereorandom oligonucleotide that is presumed to be "pure" will contain inconsistent compositions in that the diastereomers in the composition and their relative and absolute amounts will vary from batch to batch. The chiral controlled oligonucleotides and chiral controlled oligonucleotide compositions provided herein overcome such problems because chiral controlled oligonucleotides are synthesized in a chiral controlled manner as one diastereomer, and the chiral controlled oligonucleotide compositions contain predetermined levels of one or more individual oligonucleotide types.

[0520] Those skilled in the art of chemistry and synthesis will recognize that the synthetic methods of the present invention provide a degree of control over each step of the synthesis of a provided oligonucleotide, and that each nucleotide unit of the oligonucleotide can be pre-designed and / or pre-selected to have a particular stereochemistry at the attached phosphate, and / or a particular modification at the attached phosphate, and / or a particular base, and / or a particular sugar. In some embodiments, a provided oligonucleotide is pre-designed and / or pre-selected to have a particular combination of stereocenters at the attached phosphate of the internucleotide linkage.

[0521] In some embodiments, oligonucleotides produced and provided using the methods of the invention are designed and / or determined to have a particular combination of attached phosphate modifications. In some embodiments, oligonucleotides produced and provided using the methods of the invention are designed and / or determined to have a particular combination of bases. In some embodiments, oligonucleotides produced and provided using the methods of the invention are designed and / or determined to have a particular combination of sugars. In some embodiments, oligonucleotides produced and provided using the methods of the invention are designed and / or determined to have a particular combination of one or more of the above structural features.

[0522] The methods of the present invention exhibit a high degree of chiral control. For example, the methods of the present invention facilitate control of the stereochemical configuration of each linked phosphate within a provided oligonucleotide. In some embodiments, the methods of the present invention provide oligonucleotides containing one or more modified internucleotide linkages, each independently having the structure of Formula I.

[0523] In some embodiments, the methods of the present invention provide oligonucleotides that are mipomersen unimers. In some embodiments, the methods of the present invention provide oligonucleotides that are mipomersen unimers in the Rp configuration. In some embodiments, the methods of the present invention provide oligonucleotides that are mipomersen unimers in the Sp configuration.

[0524] In some embodiments, the methods of the present invention provide chiral controlled oligonucleotide compositions, i.e., oligonucleotide compositions containing a predetermined level of individual oligonucleotide types. In some embodiments, the chiral controlled oligonucleotide compositions contain one oligonucleotide type. In some embodiments, the chiral controlled oligonucleotide compositions contain more than one oligonucleotide type. In some embodiments, the chiral controlled oligonucleotide compositions contain multiple oligonucleotide types. Exemplary chiral controlled oligonucleotide compositions produced by the present invention are as described herein.

[0525] In some embodiments, the methods of the present invention provide compositions of mipomersen that are chirally pure with respect to the configuration of the attached phosphate, i.e., in some embodiments, the methods of the present invention provide compositions of mipomersen in which mipomersen is present in the composition in the form of a single diastereomeric form with respect to the configuration of the attached phosphate.

[0526] In some embodiments, the methods of the present invention provide mipomersen compositions that are chirally uniform with respect to the configuration of the attached phosphate, i.e., in some embodiments, the methods of the present invention provide compositions of mipomersen in which all nucleotide units have the same stereochemistry with respect to the configuration of the attached phosphate, for example, compositions in which all nucleotide units have the Rp configuration at the attached phosphate, or compositions in which all nucleotide units have the Sp configuration at the attached phosphate.

[0527] In some embodiments, the provided chiral controlled oligonucleotides are greater than 50% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 55% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 60% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 65% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 70% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 75% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 80% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 85% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 90% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 91% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 92% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 93% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 94% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 95% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 96% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 97% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 98% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 99% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 99.5% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 99.6% pure.In some embodiments, the provided chiral controlled oligonucleotides are greater than about 99.7% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 99.8% pure. In some embodiments, the provided chiral controlled oligonucleotides are greater than about 99.9% pure. In some embodiments, the provided chiral controlled oligonucleotides are at least about 99% pure.

[0528] In some embodiments, chiral controlled oligonucleotide compositions are compositions designed to contain one oligonucleotide type. In certain embodiments, such compositions are about 50% diastereomerically pure. In some embodiments, such compositions are about 50% diastereomerically pure. In some embodiments, such compositions are about 50% diastereomerically pure. In some embodiments, such compositions are about 50% diastereomerically pure. In some embodiments, such compositions are about 55% diastereomerically pure. In some embodiments, such compositions are about 60% diastereomerically pure. In some embodiments, such compositions are about 65% diastereomerically pure. In some embodiments, such compositions are about 70% diastereomerically pure. In some embodiments, such compositions are about 75% diastereomerically pure. In some embodiments, such compositions are about 80% diastereomerically pure. In some embodiments, such compositions are about 85% diastereomerically pure. In some embodiments, such compositions are about 90% diastereomerically pure. In some embodiments, such compositions are about 91% diastereomerically pure. In some embodiments, such compositions are about 92% diastereomerically pure. In some embodiments, such compositions are about 93% diastereomerically pure. In some embodiments, such compositions are about 94% diastereomerically pure. In some embodiments, such compositions are about 95% diastereomerically pure. In some embodiments, such compositions are about 96% diastereomerically pure. In some embodiments, such compositions are about 97% diastereomerically pure. In some embodiments, such compositions are about 98% diastereomerically pure. In some embodiments, such compositions are about 99% diastereomerically pure. In some embodiments, such compositions are about 99.5% diastereomerically pure.In some embodiments, such compositions are about 99.6% diastereomerically pure. In some embodiments, such compositions are about 99.7% diastereomerically pure. In some embodiments, such compositions are about 99.8% diastereomerically pure. In some embodiments, such compositions are about 99.9% diastereomerically pure. In some embodiments, such compositions are at least about 99% diastereomerically pure.

[0529] In some embodiments, the chiral-controlled oligonucleotide composition is a composition designed to contain multiple oligonucleotide types. In some embodiments, the methods of the present invention allow for the generation of a library of chiral-controlled oligonucleotides, where a preselected amount of any one or more chiral-controlled oligonucleotide types can be mixed with any one or more other chiral-controlled oligonucleotide types to create a chiral-controlled oligonucleotide composition. In some embodiments, the preselected amount of the oligonucleotide types is a composition having any one of the diastereomeric purities described above.

[0530] In some embodiments, the present invention provides a method for producing a method of manufacturing a semiconductor device comprising the steps of: (1) Coupling; (2) Capping; (3) Qualification; (4) deblocking; and (5) Repeat steps (1) to (4) until the desired length is achieved. The present invention provides a method for producing chiral controlled oligonucleotides, comprising:

[0531] When describing the provided methods, the term "cycle" has its ordinary meaning as understood by one of ordinary skill in the art. In some embodiments, a complete cycle of steps (1) through (4) is referred to as a cycle.

[0532] In some embodiments, the present invention provides a method for producing a method of manufacturing a semiconductor device comprising the steps of: (a) providing an amount of a first chiral controlled oligonucleotide; and (b) optionally providing a quantitation of one or more additional chiral controlled oligonucleotides; The present invention provides a method for making a chiral controlled oligonucleotide composition comprising:

[0533] In some embodiments, the first chiral controlled oligonucleotide is an oligonucleotide type described herein. In some embodiments, one or more additional chiral controlled oligonucleotides are one or more oligonucleotide types described herein.

[0534] Those skilled in the relevant chemical and synthetic fields will appreciate that when synthesized using the methods of the present invention, the oligonucleotides provided possess a degree of versatility and control over structural variations and stereochemical configurations. For example, after completing a first cycle, subsequent cycles can be performed using individually selected nucleotide units, which in some embodiments include nucleobases and / or sugars that differ from those of the first cycle. Similarly, the chiral auxiliary used in the coupling step of a subsequent cycle can be different from the chiral auxiliary used in the first cycle, generating a phosphate linkage of a different stereochemical configuration in the second cycle. In some embodiments, the stereochemistry of the phosphate attached at the newly formed internucleotide linkage is controlled using stereochemically pure phosphoramidites. Furthermore, the modifier used in the modification step of a subsequent cycle can be different from the modifier used in the first or previous cycle. The cumulative effect of this iterative construction approach is that each component of the provided oligonucleotide can be highly tailored in terms of structure and configuration. An additional advantage of this approach is the capping step, which minimizes the formation of "n-1" impurities. Without the capping step, isolation of the provided oligonucleotides would be very difficult, especially for long oligonucleotides.

[0535] In some embodiments, an exemplary cycle of a method for making chiral controlled oligonucleotides is set forth in Scheme I. In Scheme I, [ka] represents a solid support and may be part of a growing chiral controlled oligonucleotide attached to the solid support. An exemplary chiral auxiliary is represented by Formula 3-I: [ka] having the structure Further details are provided below. A "cap" is a chemical moiety introduced to a nitrogen atom in a capping step, which in some embodiments is an amino-protecting group. Those skilled in the art will understand that in the first cycle, there may be only one nucleoside attached to the solid support at the start, but the cycle may be terminated before deblocking. As will be understood by those skilled in the art, B PRO is a protecting group used in oligonucleotide synthesis. Each step of the above cycle in Scheme I is further described below.

[0536] Scheme I. Synthesis of chiral controlled oligonucleotides [ka]

[0537] Synthesis on solid support In some embodiments, the synthesis of the provided oligonucleotides is performed on a solid phase. In some embodiments, reactive groups present on the solid support are protected. In some embodiments, reactive groups present on the solid support are unprotected. During oligonucleotide synthesis, the solid support is treated with various reagents over several synthesis cycles to achieve stepwise elongation of the growing oligonucleotide chain by individual nucleotide units. The nucleoside unit directly attached to the solid support and at the end of the chain is referred to herein as the "first nucleoside." The first nucleoside is attached to the solid support through a linker moiety, i.e., a diradical, by a covalent bond between the nucleoside and either a CPG, a polymer, or another solid support. The linker remains intact during the synthesis cycles that build the oligonucleotide chain and is cleaved after chain assembly, liberating the oligonucleotide from the support.

[0538] The solid support of solid-phase nucleic acid synthesis includes, for example, the support described in United States Patent No. 4,659,774, 5,141,813, 4,458,066; United States Patent No. 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679 and 5,132,418 to Caruthers; United States Patent No. 5,047,524, 5,262,530 to Andrus et al.; and United States Patent No. 4,725,677 (reissued as Re34,069) to Koster.In some embodiments, solid phase is organic polymer support.In some embodiments, solid phase is inorganic polymer support. In some embodiments, the organic polymer support is polystyrene, including aminomethylpolystyrene, polyethylene glycol-polystyrene graft copolymers, polyacrylamide, polymethacrylate, polyvinyl alcohol, highly crosslinked polymers (HCPs), or other synthetic polymers, carbohydrates such as cellulose and starch or other polymeric carbohydrates, or other organic polymers and copolymers, composites or combinations of the above inorganic or organic materials. In some embodiments, the inorganic polymer support is silica, alumina, a silica gel support, or a controlled polyglass (CPG), such as aminopropyl CPG. Other useful solid supports include fluorous solid supports (see, e.g., WO / 2005 / 070859), long-chain alkylamine (LCAA) controlled pore glass (CPG) solid supports (see, e.g., SP Adams, KS Kavka, EJ Wykes, SB Holder and GR Galluppi, J. Am. Chem. Soc., 1983, 105, 661-663; GR Gough, MJ Bruden and PT Gilham, Tetrahedron Lett., 1981, 22, 4177-4180).Membrane supports and polymeric membranes (see, e.g., Innovation and Perspectives in Solid Phase Synthesis, Peptides, Proteins and Nucleic Acids, chapter 21, pp. 157-162, 1994, Ed. Roger Epton, and U.S. Pat. No. 4,923,901) are also useful for nucleic acid synthesis. Once formed, the membrane can be chemically functionalized for use in nucleic acid synthesis. In addition to attaching functional groups to the membrane, the use of a linker or spacer group attached to the membrane is used to minimize steric hindrance between the membrane and the synthetic strand.

[0539] Other preferred solid supports include those commonly known in the art and preferred for use in solid phase methods, such as glass sold as Primer™ 200 support, controlled pore glass (CPG), oxalyl-controlled pore glass (see, e.g., Alul, et al., Nucleic Acids Research, 1991, 19, 1527), TentaGel support - an aminopolyethylene glycol derivatized support (see, e.g., Wright, et al., Tetrahedron Lett., 1993, 34, 3373), and Poros-co-polystyrene / divinylbenzene.

[0540] Surface-activated polymers have been utilized for the synthesis of native and modified nucleic acids and proteins on several solid support media. The solid support material can be any polymer, preferably one with uniform porosity, sufficient amine content, and sufficient flexibility to withstand any associated manipulations without loss of integrity. Examples of materials selected include nylon, polypropylene, polyester, polytetrafluoroethylene, polystyrene, polycarbonate, and nitrocellulose. Other materials can function as solid supports, depending on the researcher's design. Some design considerations, such as metals coated with gold or platinum, can be selected (see, e.g., U.S. Publication No. 20010055761). In one embodiment of oligonucleotide synthesis, for example, nucleosides are immobilized on solid supports functionalized with hydroxyl or amino residues. Alternatively, the solid support can be derivatized to provide acid-labile trialkoxytrityl groups, such as trimethoxytrityl (TMT) groups. Without being bound by theory, it is expected that the presence of trialkoxytrityl protecting groups allows for early detritylation under conditions typically used in DNA synthesizers. To allow for faster cleavage of the oligonucleotide material in aqueous ammonia, a diglycoate linker may be introduced onto the support.

[0541] In some embodiments, the provided oligonucleotides are alternatively synthesized in the 5'-3' direction. In some embodiments, the nucleic acid is attached to a solid support through the 5' end of the growing nucleic acid, thereby presenting the 3' group for reaction. That is, the reaction occurs using a 5'-nucleoside phosphoramidite or during an enzymatic reaction (e.g., ligation and polymerization using a nucleoside 5'-triphosphate). When considering 5'-3' synthesis, the iterative steps of the present invention remain unchanged (i.e., capping and modification of the chiral phosphate).

[0542] joining part A linking moiety or linker may be used to attach a solid support to a compound containing a free nucleophilic moiety. Suitable linkers are known, for example, short molecules that function to attach a solid support to a functional group (e.g., a hydroxyl group) of an initial nucleoside molecule in solid-phase synthesis techniques. In some embodiments, the linking moiety is a succinamido acid linker, or a succinic acid linker (-CO-CH-CH-CO-), or an oxalyl linker (-CO-CO-). In some embodiments, the linking moiety and the nucleoside are linked together via an ester bond. In some embodiments, the linking moiety and the nucleoside are linked together via an amide bond. In some embodiments, the linking moiety links the nucleoside to another nucleotide or nucleic acid. Preferred disclosed linkers are described, for example, in Oligonucleotides And Analogues A Practical Approach, Ekstein, F. Ed., IRL Press, NY, 1991, Chapter 1 and Solid-Phase Supports for Oligonucleotide Synthesis, Pon, RT, Curr. Prot. Nucleic Acid Chem., 2000, 3.1.1-3.1.28.

[0543] A linker moiety is used to link a compound containing a free nucleophilic moiety to another nucleoside, nucleotide, or nucleic acid. In some embodiments, the linking moiety is a phosphodiester bond. In some embodiments, the linking moiety is an H-phosphonate moiety. In some embodiments, the linking moiety is a modified phosphate linkage described herein. In some embodiments, a universal linker (UnyLinker) is used to link an oligonucleotide to a solid support (Ravikumar et al., Org. Process Res. Dev., 2008, 12 (3), 399-410). In some embodiments, another universal linker is used (Pon, RT, Curr. Prot. Nucleic Acid Chem., 2000, 3.1.1-3.1.28). In some embodiments, various orthogonal linkers (e.g., disulfide linkers) are used (Pon, RT, Curr. Prot. Nucleic Acid Chem., 2000, 3.1.1-3.1.28).

[0544] General conditions - solvents used in synthesis The synthesis of the provided oligonucleotides is generally carried out in an aprotic organic solvent. In some embodiments, the solvent is a nitrile solvent, such as acetonitrile. In some embodiments, the solvent is a basic amine solvent, such as pyridine. In some embodiments, the solvent is an ether solvent, such as tetrahydrofuran. In some embodiments, the solvent is a halogenated hydrocarbon, such as dichloromethane. In some embodiments, a mixture of solvents is used. In some embodiments, the solvent is a ...

Claims

[Claim 1] 1. A chiral controlled oligonucleotide composition comprising a plurality of oligonucleotides of at least one type, said type being: 1) base sequence; 2) backbone bonding pattern; 3) backbone chiral center pattern; and 4) Pattern of the skeleton X part A composition defined by:

Images