Methods of treating myeloproliferative neoplasms

Abstract

To provide methods of treating myeloproliferative neoplasms.SOLUTION: Therapeutic methods and pharmaceutical compositions for treating a myeloproliferative neoplasm (MPN), including polycythemia vera (PV), essential thrombocythemia (ET), and myelofibrosis, are described. In certain embodiments, the invention includes therapeutic methods of treating a MPN using a combination of a compound of Formula (I) or Formula (II) with a therapeutic agent selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] A method of treating myeloproliferative neoplasms (MPNs) using a mouse double minute 2 homolog (MDM2) inhibitor and a therapeutic agent selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof. [Background technology]

[0002] p53 is a tumor suppressor and transcription factor that responds to cellular stress by activating the transcription of numerous genes involved in cell cycle arrest, apoptosis, senescence, and DNA repair. Unlike normal cells, which rarely have a cause for p53 activation, tumor cells are under constant cellular stress from a variety of insults, including hypoxia and proapoptotic oncogene activation. It has therefore been proposed that there may be a strong selective advantage for inactivation of the p53 pathway in tumors, and that removal of p53 function may be a prerequisite for tumor survival. In support of this concept, researchers from three groups have used mouse models to demonstrate that the absence of p53 function is a continuous prerequisite for the maintenance of established tumors. When researchers restored p53 function to tumors with inactivated p53, the tumors regressed.

[0003] p53 is inactivated by mutation and / or loss in 50% of solid tumors and 10% of liquid tumors. Other key members of the p53 pathway are also genetically or epigenetically altered in cancer. The oncoprotein MDM2 inhibits p53 function and is activated by gene amplification in incidences reported as high as 10%. MDM2 is in turn inhibited by another tumor suppressor, p14ARF. It has been suggested that downstream alterations of p53 may be responsible for at least partial inactivation of the p53 pathway in p53 WT tumors (p53 wild type). In support of this concept, some p53WT tumors appear to exhibit reduced apoptotic capacity, although their ability to undergo cell cycle arrest remains intact. One cancer treatment strategy involves the use of small molecules that bind to MDM2 and neutralize its interaction with p53. MDM2 inhibits p53 activity by three mechanisms: 1) acting as an E3 ubiquitin ligase to promote p53 degradation, 2) binding to and blocking the p53 transcriptional activation domain, and 3) transporting p53 from the nucleus to the cytoplasm. All three of these mechanisms are blocked by neutralizing the MDM2-p53 interaction. Notably, this therapeutic strategy may be applicable to tumors that are p53 WT, and studies with small molecule MDM2 inhibitors have led to promising reductions in tumor growth both in vitro and in vivo. Furthermore, in patients with p53-inactivated tumors, stabilization of wild-type p53 in normal tissues by MDM2 inhibition may allow selective protection of normal tissues from mitotic poisons. As used herein, MDM2 refers to human MDM2 protein, and p53 refers to human p53 protein. Human MDM2 may also be referred to as HDM2 or hMDM2. Several MDM2 inhibitors are in human clinical trials for the treatment of various cancers.

[0004] Myeloproliferative neoplasms (MPN), including but not limited to polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF), are clonal hematopoietic stem cell (HSC) disorders characterized by clonal proliferation of terminally differentiated myeloid cells. Approximately 1%, 4%, and 20% of ET, PV, and PMF patients, respectively, progress to blast phase (BP), referred to as MPN-BP, within a 10-year period from the time of diagnosis. Cervantes F,et al.,Acta Haematol.1991;85(3):124-127. MPN-BP and de novo acute myeloid leukemia (AML) each have distinct mutation patterns and clinical courses. Rampal R, et al., Proc Natl Acad Sci USA. 2014;111(50):E5401-10. Patients with MPN-BP have a particularly dismal prognosis with a median survival of less than 6 months with currently available therapies.

[0005] The present invention relates to a method of treating myeloproliferative neoplasms in a human subject with an MDM2 inhibitor and a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of Janus kinase (JAK) inhibitors, isocitrate dehydrogenase (IDH) inhibitors, programmed death-1 (PD-1) inhibitors, programmed death-ligand 1 (PD-L1) inhibitors, programmed death-ligand 2 (PD-L2) inhibitors, interferons, phosphoinositide 3-kinase (PI3K) inhibitors, protein kinase B (AKT) inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. Summary of the Invention

[0006] The present invention relates to a method of treating myeloproliferative neoplasms (MPNs), comprising administering to a human in need thereof a therapeutically effective amount of an MDM2 inhibitor in combination with a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analogue, and combinations thereof.

[0007] In one embodiment, the MDM2 inhibitor is a compound of formula (I) or a compound of formula (II) [ka] or a pharma- ceutically acceptable salt thereof.

[0008] In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, triptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutlin-3, Nutlin-3a, Nutlin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof.

[0009] In one embodiment, the MDM2 inhibitor is a compound of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1 601, and pharma- ceutically acceptable salts thereof.

[0010] In one embodiment, the JAK inhibitor is AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerdulatinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel, tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.

[0011] In one embodiment, the JAK inhibitor is selected from the group consisting of baricitinib phosphate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitinib phosphate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride.

[0012] In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof.

[0013] In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof.

[0014] In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A.

[0015] In one embodiment, the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutically acceptable salts thereof.

[0016] In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, vistusertib, CC-223, OSI-027, voxtalisib, palomid 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharmaceutically acceptable salts thereof.

[0017] In one embodiment, the PI3K inhibitor is bupallisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, serabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and and pharma- ceutically acceptable salts thereof.

[0018] In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof.

[0019] In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.

[0020] In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

[0021] In one embodiment, the interferon is PEGylated rIFN-alpha 2b (PEG-Intron), PEGylated rIFN-alpha 2a (Pegasys), rIFN-alpha 2b (Intron A), rIFN-alpha 2a (Roferon-A), interferon alpha (MOR-22, OPC-18, Alphaferon, Alphanatib, Multiferon, Subarin), interferon alfacon-1 (Infergen), interferon alfa-n1 (Wellferon), interferon alfa-n3 (Alferon), Albuinterferon alfa-2b (Albuferon), IFN alpha-2b XL, BLX-883 (Rocteron), DA-3021, AVI-005, Bellerophon, Sepeginterferon alfa-2b, and combinations thereof.

[0022] In one embodiment, the MPN is thrombocythemia.

[0023] In one embodiment, the thrombocythemia is essential thrombocythemia (ET).

[0024] In one embodiment, the MPN is myelofibrosis.

[0025] In one embodiment, the myelofibrosis is selected from primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF).

[0026] In one embodiment, the MPN is chronic myeloid leukemia.

[0027] In one embodiment, the MPN is systemic mastocytosis (SM).

[0028] In one embodiment, the MPN is chronic neutrophilic leukemia (CNL).

[0029] In one embodiment, the MPN is myelodysplastic syndrome (MDS).

[0030] In one embodiment, the MPN is mast cell disease (SMCD).

[0031] In one embodiment, the MPN is chronic eosinophilic leukemia.

[0032] In one embodiment, the MPN is chronic myelomonocytic leukemia (CMML).

[0033] In one embodiment, the MPN is atypical chronic myeloid leukemia (aCML).

[0034] In one embodiment, the MPN is juvenile myelomonocytic leukemia (JMML).

[0035] In one embodiment, the MPN is hypereosinophilic syndrome (HES).

[0036] In one embodiment, the compound of formula (I) or formula (II) is in a crystalline form.

[0037] In one embodiment, the crystalline form is characterized by an X-ray powder diffraction pattern comprising at least three peaks at diffraction angles of about 11.6, 12.4, 18.6, 19.0, 21.6 and 23.6±0.1 degrees 2-theta.

[0038] In one embodiment, the compound of formula (I) or formula (II) is in free form.

[0039] In one embodiment, the MDM2 inhibitor is a pharma- ceutically acceptable salt of a compound of Formula (I) or Formula (II).

[0040] In one embodiment, the compound of formula (I) or formula (II) is in amorphous form.

[0041] In one embodiment, the compound of Formula (I) or Formula (II) is administered once daily at a dose selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

[0042] In one embodiment, the compound of formula (I) or formula (II) is administered twice daily at a dose selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

[0043] In one embodiment, the human is treated with the MDM2 inhibitor for a period of time selected from the group consisting of about 14 days, about 21 days, about 28 days, about 35 days, about 42 days, about 49 days, and about 56 days.

[0044] In one embodiment, the compound of Formula (I) or Formula (II) is administered orally.

[0045] In one embodiment, the MDM2 inhibitor is administered prior to administration of the therapeutic agent, and the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

[0046] In one embodiment, the MDM2 inhibitor is administered after administration of a therapeutic agent, the therapeutic agent being a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

[0047] In one embodiment, the MDM2 inhibitor is administered simultaneously with the administration of a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

[0048] In one embodiment, the therapeutically effective amount of the MDM2 inhibitor is 100 mg. [Brief description of the drawings]

[0049] In addition to the foregoing summary, the following detailed description of the invention is better understood when read in conjunction with the accompanying drawings.

[0050] [Figure 1] 1 shows the XRPD pattern of the compound of formula (I) in anhydrous crystalline form. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0051] While preferred embodiments of the present invention are shown and described herein, such embodiments are provided by way of example only and are not intended to otherwise limit the scope of the invention. Various alternatives to the described embodiments of the invention may be employed in the practice of the invention.

[0052] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0053] The terms "administered in combination" and "co-administration," as used herein, include administration of two or more active pharmaceutical ingredients to a subject such that both agents and / or their metabolites are present in the subject at the same time. Co-administration includes simultaneous administration in separate compositions, administration at different times in separate compositions, or administration in a composition in which two or more agents are present.

[0054] The term "combination" or "pharmaceutical combination" is defined herein to refer to a fixed combination in one dosage unit form, a non-fixed combination, or a kit of parts for combined administration, where the therapeutic agents may be administered together, independently simultaneously, or separately within a time interval, preferably allowing the combination partners to exhibit a coordinated, e.g., synergistic, effect. Thus, the single compounds of the pharmaceutical combination of the present disclosure may be administered simultaneously or sequentially.

[0055] Furthermore, the pharmaceutical combinations of the present disclosure may be in the form of a fixed combination or in the form of a non-fixed combination.

[0056] The term "effective amount" or "therapeutically effective amount" refers to an amount of an active pharmaceutical ingredient or a combination of active pharmaceutical ingredients as described herein that is sufficient to bring about the intended application, including but not limited to disease treatment. The therapeutically effective amount may vary depending on the intended application (in vitro or in vivo), or the subject and disease state being treated (e.g., the subject's weight, age and sex), the severity of the disease state, the mode of administration, and other factors that can be easily determined by those skilled in the art. The term also applies to a dose that induces a specific response in target cells (e.g., reducing platelet adhesion and / or cell migration). The specific dose varies depending on the particular compound selected, the administration regimen followed, whether the compound is administered in combination with other compounds, the timing of administration, the tissue to which it is administered, and the physical delivery system in which the compound is delivered.

[0057] The terms "enantiomerically enriched", "enantiomerically pure", and "non-racemic" as used herein refer to a composition in which the weight percentage of one enantiomer is greater than the amount of that one enantiomer in a control mixture of racemic composition (e.g., greater than 1:1 by weight). For example, an enantiomerically enriched preparation of the (S)-enantiomer refers to a preparation of a compound having greater than 50% by weight, e.g., at least 75% by weight, e.g., at least 80% by weight, of the (S)-enantiomer relative to the (R)-enantiomer. In some embodiments, the enrichment can be significantly greater than 80% by weight, thereby providing a "substantially enantiomerically enriched", "substantially enantiomerically pure", or "substantially non-racemic" preparation, which refers to a preparation of a composition having at least 85% by weight, e.g., at least 90% by weight, and e.g., at least 95% by weight, of one enantiomer relative to the other enantiomer. The terms "diastereomerically enriched" and "diastereomerically pure" as used herein refer to a composition in which the weight percentage of one diastereomer is greater than the amount of that one enantiomer in a control mixture of diastereomers. In some embodiments, the enrichment can be significantly greater than 80% by weight, thereby providing a "substantially diastereomerically enriched" or "substantially diastereomerically pure" preparation, which refers to a preparation of a composition having at least 85% by weight, such as at least 90% by weight, and such as at least 95% by weight, of one diastereomer relative to the other diastereomer.

[0058] In some embodiments, enantiomerically enriched compositions have higher efficacy in terms of therapeutic utility per unit mass than racemic mixtures of the compositions. Enantiomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high performance liquid chromatography (HPLC) and the formation and crystallization of chiral salts, or some enantiomers can be prepared by asymmetric synthesis. See, for example, Jacques, Enantiomers, Racemates and Resolutions, Wiley Interscience, New York (1981); EL Eliel and SH Wilen, Stereochemistry of Organic Compounds, Wiley-Interscience, New York (1994).

[0059] "Enantiomeric purity" as used herein refers to the relative amount of a particular enantiomer present relative to the other enantiomer, expressed as a percentage. For example, if a compound potentially having (R) or (S) isomeric configuration exists as a racemic mixture, the enantiomeric purity is about 50% for either (R) or (S) isomer. If the compound has one isomeric form that predominates over the other, for example, 80% (S) and 20% (R), the enantiomeric purity of the compound for the (S) isomeric form is 80%. The enantiomeric purity of a compound can be determined by several methods known in the art, including but not limited to, chromatography using a chiral support, polarimetric measurement of the rotation of polarized light, nuclear magnetic resonance spectroscopy using chiral shift reagents, including but not limited to lanthanide-containing chiral complexes or Pirkle alcohols, or derivatization of the compound using chiral compounds such as Mosher's acid followed by chromatography or nuclear magnetic resonance spectroscopy.

[0060] The term "fixed combination" means that the therapeutic agents, e.g., a single compound of the combination, are in the form of a single entity or dosage form.

[0061] "I C 50 The term "EC" refers to the half maximal inhibitory concentration, i.e., 50% inhibition of the desired activity. 50 The term "maximum response" refers to the concentration of drug at which half of the maximum response is achieved.

[0062] "Isomers" are different compounds with the same molecular formula. "Stereoisomers" are isomers that differ only in the way the atoms are arranged in space, i.e., have different stereochemical configurations. "Enantiomers" are pairs of stereoisomers that are non-superimposable mirror images of each other. A 1:1 mixture of a pair of enantiomers is a "racemic" mixture. The term "(±)" is used to designate racemic mixtures when appropriate. "Diastereoisomers" are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other. Absolute stereochemistry is specified according to the Cahn-Ingold-Prelog RS system. When a compound is a pure enantiomer, the stereochemistry at each chiral carbon can be specified by either R or S. A resolved compound whose absolute configuration is unknown can be specified as (+) or (-), depending on the direction (dextrorotatory or levorotatory) it rotates plane polarized light at the wavelength of the sodium D line. Certain compounds described herein contain one or more asymmetric centers and can therefore give rise to enantiomers, diastereomers, and other stereoisomeric forms that can be defined in terms of absolute stereochemistry as (R) or (S). The chemical entities, pharmaceutical compositions, and methods of the present invention are intended to include all such possible isomers, including racemic mixtures, optically pure forms, and intermediate mixtures. Optically active (R) and (S) isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. Where the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, and unless otherwise specified, the compounds are intended to include both E and Z geometric isomers.

[0063] In one embodiment, the compounds described herein include one of their isomers, stereoisomers, and enantiomers.

[0064] "MPN-BP" refers to the blast crisis phase (BP) of a myeloproliferative neoplasm (MPN) as described in this disclosure.

[0065] The term "non-fixed combination" means that therapeutic agents, e.g., single compounds of the combination, are administered to a patient as separate entities or dosage forms either simultaneously or sequentially without specific time limitations, preferably such administration providing therapeutically effective levels of the two therapeutic agents in the body of the subject, e.g., a mammal or human in need thereof.

[0066] "Pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" is intended to include any and all solvents, dispersion media, coating agents, antibacterial agents, antifungal agents, isotonic agents, and absorption delaying agents. The use of such media and agents for active pharmaceutical ingredients is well known in the art. Except where any conventional media or agent is incompatible with the active pharmaceutical ingredient, its use in the therapeutic composition of the present invention is envisioned. Supplementary active ingredients can also be incorporated into the described compositions. Unless otherwise specified or clearly indicated by the text, reference to therapeutic agents useful in the pharmaceutical combination of the present disclosure includes both the free base of the compound and all pharmaceutically acceptable salts of the compound.

[0067] The term "pharmaceutically acceptable salt" refers to salts derived from various organic and inorganic counterions known in the art. Pharmaceutically acceptable acid addition salts can be formed with inorganic and organic acids. Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid. Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicylic acid. Pharmaceutically acceptable The base addition salts that are acceptable for use in the present invention can be formed with inorganic and organic bases. Inorganic bases from which salts can be derived include, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum. Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines, including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins. Specific examples include isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine. In selected embodiments, the pharma-ceutically acceptable base addition salts are selected from ammonium, potassium, sodium, calcium, and magnesium salts. The term "cocrystal" refers to a molecular complex derived from a number of cocrystal formers known in the art. Unlike salts, cocrystals typically do not involve proton transfer between the cocrystal and the drug, but instead involve intermolecular interactions such as hydrogen bonding, aromatic ring stacking, or dispersion forces between the cocrystal former and the drug in the crystal structure.

[0068] The terms "QD", "qd", or "qd" mean once a day, once a day, or once daily. The terms "BID", "bid", or "bid" mean twice a day, twice a day, or twice daily. The terms "TID", "tid", or "tid" mean three times a day, three times a day, or three times a day. The terms "QID", "qid", or "qid" mean four times a day, four times a day, or four times daily.

[0069] "Solvate" refers to a compound that is in physical association with one or more molecules of a pharma- ceutically acceptable solvent.

[0070] A "therapeutic effect," as that term is used herein, encompasses therapeutic and / or prophylactic benefits as described above. A prophylactic effect includes delaying or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof.

[0071] When ranges are used herein to describe physical or chemical properties, such as, for example, molecular weight or chemical formula, all combinations and subcombinations of the ranges and specific embodiments therein are intended to be included. The use of the term "about" when referring to a number or numerical range means that the number or numerical range referred to is approximate within experimental variation (or within statistical experimental error), and thus the number or numerical range may vary, for example, by 1% to 15% of the stated number or numerical range. The term "comprising" (and related terms such as "comprise" or "comprises" or "having" or "including") includes embodiments, such as, for example, an embodiment of any composition, method, or process that "consists of" or "consists essentially of" the described features.

[0072] The compounds of the invention include crystalline and amorphous forms, including, for example, polymorphs, pseudopolymorphs, solvates, hydrates, nonsolvated polymorphs (including anhydrates), conformational polymorphs, and amorphous forms of the compounds, as well as combinations thereof. "Crystal form" and "polymorph" refer to all crystalline and amorphous forms of a compound, unless a specific crystalline or amorphous form is referenced. The term "crystalline form" is intended to include, for example, polymorphs, pseudopolymorphs, solvates, hydrates, nonsolvated polymorphs (including anhydrates), conformational polymorphs, and amorphous forms, as well as combinations thereof.

[0073] Coadministration of Compounds The present invention relates to a pharmaceutical combination or pharmaceutical composition that is particularly useful as a medicine.Specifically, the combination or composition of the present disclosure can be applied to the treatment of cancer.In one embodiment, the cancer is MPN.The present invention also relates to the use of the pharmaceutical combination or pharmaceutical composition of the present disclosure for preparing a medicament for treating cancer (particularly MPN), and the method for treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the pharmaceutical combination of the present disclosure, or the pharmaceutical composition of the present disclosure.

[0074] In one embodiment, the MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mast cell disease (SMCD).

[0075] In one embodiment, the myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF).

[0076] In one embodiment, primary myelofibrosis (PMF) is selected from the group consisting of prefibrotic / early PMF and overt fibrotic PMF.

[0077] In one embodiment, the MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myelogenous leukemia (aCML), juvenile myelomonocytic leukemia (JMML), hypereosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasm with ringed sideroblasts and thrombocytosis (MDS / MPN-RS-T).

[0078] One embodiment of the present invention is a composition, e.g., a pharmaceutical composition, comprising a combination comprising an MDM2 inhibitor in combination with a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof. Another embodiment is a kit containing both components formulated in separate pharmaceutical compositions that are formulated for combined administration.

[0079] Another embodiment of the present invention is a method for treating myeloproliferative neoplasms (MPN), wherein the MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, thrombocythemia, idiopathic myelofibrosis, chronic myelogenous leukemia, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mast cell disease (SMCD) in a subject, comprising co-administering to a subject in need thereof a therapeutically effective amount of a combination comprising an MDM2 inhibitor in combination with a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof. Both the pharmaceutical composition comprising the combination and the kit are for use in treating such diseases or conditions.

[0080] In one embodiment, the MDM2 inhibitor is a compound of Formula (I) or Formula (II).

[0081] In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, triptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutlin-3, Nutlin-3a, Nutlin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof.

[0082] In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof.

[0083] In one embodiment, the JAK inhibitor is a JAK1 inhibitor.

[0084] In one embodiment, the JAK inhibitor is a JAK2 inhibitor.

[0085] In one embodiment, the JAK inhibitor is a JAK3 inhibitor.

[0086] In one embodiment, the JAK inhibitor is a selective JAK inhibitor.

[0087] In one embodiment, the JAK inhibitor is a pan JAK inhibitor.

[0088] In one embodiment, the JAK inhibitor is AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerdulatinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel, tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.

[0089] In one embodiment, the JAK inhibitor is selected from the group consisting of baricitinib phosphate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitinib phosphate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride.

[0090] In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof.

[0091] In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof. .

[0092] In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A.

[0093] In one embodiment, the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutically acceptable salts thereof.

[0094] In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, vistusertib, CC-223, OSI-027, voxtalisib, palomid 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharmaceutically acceptable salts thereof.

[0095] In one embodiment, the PI3K inhibitor is selected from the group consisting of bupallisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, serabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof.

[0096] In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof.

[0097] In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.

[0098] In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

[0099] In one embodiment, the interferon is PEGylated rIFN-alpha 2b (PEG-Intron), PEGylated rIFN-alpha 2a (Pegasys), rIFN-alpha 2b (Intron A), rIFN-alpha 2a (Roferon-A), interferon alpha (MOR-22, OPC-18, Alphaferon, Alphanatib, Multiferon, Subarin), interferon alfacon-1 (Infergen), interferon alfa-n1 (Wellferon), interferon alfa-n3 (Alferon), Albuinterferon alfa-2b (Albuferon), IFN alpha-2b XL, BLX-883 (Rocteron), DA-3021, AVI-005, Belleropho The therapeutic agent is selected from the group consisting of cepegylated interferon alfa-2b, cepegylated interferon alfa-2b, and combinations thereof.

[0100] In one embodiment, the nucleoside analog is selected from the group consisting of decitabine, cytarabine, azacytidine, zebularine, and pharma- ceutically acceptable salts thereof.

[0101] This combination can be administered by any route known in the art.In an exemplary embodiment, the MDM2 inhibitor and the therapeutic agent are administered independently by oral, intravenous, intramuscular, intraperitoneal, subcutaneous or transdermal means, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.In one embodiment, the MDM2 inhibitor is administered orally.

[0102] In an exemplary embodiment, the MDM2 inhibitor is in the form of a pharma- ceutically acceptable salt.

[0103] In an exemplary embodiment, the MDM2 inhibitor is administered to the subject prior to administration of the therapeutic agent, and the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

[0104] In an exemplary embodiment, the MDM2 inhibitor is administered to the subject following administration of a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

[0105] In an exemplary embodiment, the MDM2 inhibitor is administered to the subject concomitantly with the administration of a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

[0106] In one embodiment, the disclosure provides a method for treating blast phase myeloproliferative neoplasms (MPN-BP) in a subject, comprising co-administering to a subject in need thereof a therapeutically effective amount of a combination comprising an MDM2 inhibitor in combination with a therapeutic agent, the therapeutic agent being selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof. Both pharmaceutical compositions comprising the combination, and kits, are for use in treating such diseases or conditions. In one embodiment, the MPN-BP is selected from the group consisting of polycythemia vera in blast phase (BP-PV), myelofibrosis in blast phase, primary myelofibrosis in blast phase, thrombocythemia in blast phase, essential thrombocythemia in blast phase (BP-ET), idiopathic myelofibrosis in blast phase, systemic mastocytosis in blast phase (BP-SM), chronic neutrophilic leukemia in blast phase (BP-CNL), myelodysplastic syndrome in blast phase (BP-MDS), and systemic mast cell disease in blast phase (BP-SMCD). In one embodiment, myelofibrosis in blast phase is selected from the group consisting of primary myelofibrosis in blast phase (BP-PMF), myelofibrosis after polycythemia vera in blast phase (post-BP-PV MF), and myelofibrosis after essential thrombocythemia in blast phase (post-BP-ET MF). In one embodiment, the blast crisis phase primary myelofibrosis (BP-PMF) is selected from the group consisting of preblast crisis phase / early PMF and blast crisis phase overt fibrosis phase PMF. In one embodiment, the MPN-BP is blast crisis phase chronic neutrophilic leukemia (BP-CNL), blast crisis phase chronic eosinophilic leukemia, blast crisis phase chronic myelomonocytosis ... In one embodiment, the MDM2 inhibitor is selected from the group consisting of myelomonocytic leukemia (BP-CMML), blast crisis atypical chronic myelogenous leukemia (BP-aCML), blast crisis juvenile myelomonocytic leukemia (BP-JMML), blast crisis hypereosinophilic syndrome (BP-HES), and myelodysplastic / myeloproliferative neoplasms with ringed sideroblasts and thrombocytosis in blast crisis (BP-MDS / MPN-RS-T). In one embodiment, the MDM2 inhibitor is a compound of Formula (I) or Formula (II). In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, triptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutlin-3, Nutlin-3a, Nutlin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof. In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof.

[0107] In one embodiment, the disclosure provides a method for treating blast phase myeloproliferative neoplasms (MPN-BP) in a subject, comprising co-administering to a subject in need thereof therapeutically effective amounts of a combination comprising a compound of formula (I) in combination with a nucleoside analog, wherein the nucleoside analog is selected from the group consisting of decitabine, cytarabine, azacytidine, zebularine, and pharmaceutically acceptable salts thereof.

[0108] In one embodiment, the disclosure provides a method for treating blast phase myeloproliferative neoplasms (MPN-BP) in a subject, comprising co-administering to a subject in need thereof therapeutically effective amounts of a combination comprising a compound of formula (I) in combination with decitabine or a pharma- ceutical acceptable salt thereof.

[0109] In one embodiment, the disclosure provides a method for treating blast phase myeloproliferative neoplasms (MPN-BPs) in a subject, comprising co-administering to a subject in need thereof therapeutically effective amounts of a combination comprising a compound of formula (I) in combination with cytarabine or a pharma- ceutical acceptable salt thereof.

[0110] In one embodiment, the MPN in a human subject is characterized by CALR mutations (calreticulin, located on chromosome 19p13.2), as described in Massie, N. Engl. J. Med. 2013, 25:2379-2390, incorporated herein by reference in its entirety.

[0111] In one embodiment, MPN in a human subject is characterized by an MPL mutation (myeloproliferative leukemia viral oncogene, located on chromosome 1p34), as described in Pikman, Plos Med. 2006;3(7):e270, incorporated herein by reference in its entirety.

[0112] In one embodiment, the MPN in a human subject is characterized by JAK2V617F mutation, which is a functional mutation that promotes cytokine-dependent proliferation of bone marrow cells and accounts for the majority of myeloproliferative neoplasms (MPNs), as described in Nakatake, Oncogene, 2012, 31, 1323-1333 and incorporated herein by reference in its entirety.

[0113] In one embodiment, the MPN in the human subject is JAK2V617F, MPL, CALR and combinations thereof.

[0114] In an exemplary embodiment, the subject is a mammal, such as a human.

[0115] MDM2 inhibitors The compounds of formula (I) have the structure and name shown below. 2-((3R,5R,6S)-5-(3-chlorophenyl)-6-(4-chlorophenyl)-1-((S)-1-(isopropylsulfonyl)-3-methylbutan-2-yl)-3-methyl-2-oxopiperidin-3-yl)acetic acid: [ka]

[0116] The synthesis of compounds of formula (I) is described in International Application WO2011 / 153509 and WO201 No. 4 / 200937, U.S. Pat. Nos. 8,569,341, 9,593,129, 9,296,736, 9,623,018, 9,757,367, 9,801,867, 9,376,386, and 9,855,259, the disclosures of which are incorporated herein by reference in their entireties.

[0117] In one embodiment, the compound of formula (I) or formula (II) is in amorphous form. In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II) in crystalline form. In one embodiment, the MDM2 inhibitor is a compound of formula (I) in anhydrous crystalline form. In one embodiment, the MDM2 inhibitor is a compound of formula (I) in anhydrous crystalline form characterized by a powder X-ray diffraction pattern comprising peaks at diffraction angles 2 theta degrees at about 11.6, 12.4, 18.6, 19.0, 21.6 and 23.6. In one embodiment, the MDM2 inhibitor is a compound of formula (I) in anhydrous crystalline form having an X-ray diffraction pattern substantially as shown in FIG. 1. A method for producing such crystalline forms was disclosed in International Application WO2014200937, the disclosure of which is incorporated herein by reference in its entirety.

[0118] In one embodiment, the MDM2 inhibitor is a compound of formula (II) having the structure and name shown below. [ka] 4-(2-((3R,5R,6S)-1-((S)-2-(tert-butylsulfonyl)-1-cyclopropylethyl)-6-(4-chloro-3-fluorophenyl)-5-(3-chlorophenyl)-3-methyl-2-oxopiperidin-3-yl)acetamido)-2-methoxybenzoic acid.

[0119] The synthesis of compounds of formula (II) is set forth in US Pat. No. 8,952,036, the disclosure of which is incorporated herein by reference in its entirety.

[0120] RG7388 (idasanutrin) In one embodiment, the MDM2 inhibitor is RG7388. RG7388 has the chemical structure and name shown below:

[0121] 4-[[(2R,3S,4R,5S)-3-(3-chloro-2-fluorophenyl)-4-(4-chloro-2-fluorophenyl)-4-cyano-5-(2,2-dimethylpropyl)pyrrolidine-2-carbonyl]amino]-3-methoxybenzoic acid [ka]

[0122] Triptolide (PG490) In one embodiment, the MDM2 inhibitor is triptolide, which has the chemical structure and name shown below:

[0123] (5bS,6aS,7aS,8R,8aR,9aS,9bS,10aS,10bS)-8-Hydroxy-8a-isopropyl-10b-methyl-2,5,5b,6,6a,8, 8a,9a,9b,10b-Decahydrotris(oxireno)[2',3':4b,5;2'',3'':6,7;2''',3''':8a,9]phenanthro[1,2-c]furan-3(1H)-one [ka]

[0124] Nutlin-3a In one embodiment, the MDM2 inhibitor is nutlin-3a, which has the chemical structure and name shown below:

[0125] 4-[(4S,5R)-4,5-bis(4-chlorophenyl)-2-(4-methoxy-2-propan-2-yloxyphenyl)-4,5-dihydroimidazole-1-carbonyl]piperazin-2-one [ka]

[0126] HDM201 In one embodiment, the MDM2 inhibitor is HDM201. HDM201 has the chemical structure and name shown below:

[0127] (4S)-5-(5-chloro-1-methyl-2-oxopyridin-3-yl)-4-(4-chlorophenyl)-2-(2,4-dimethoxypyrimidin-5-yl)-3-propan-2-yl-4H-pyrrolo[3,4-d]imidazol-6-one [ka]

[0128] RG7112 In one embodiment, the MDM2 inhibitor is RG7112. RG7112 has the chemical structure and name shown below:

[0129] [(4S,5R)-2-(4-tert-butyl-2-ethoxyphenyl)-4,5-bis(4-chlorophenyl)-4,5-dimethylimidazol-1-yl]-[4-(3-methylsulfonylpropyl)piperazin-1-yl]methanone [ka]

[0130] CGM097A In one embodiment, the MDM2 inhibitor is CGM097A, which has the chemical structure and name shown below:

[0131] (1S)-1-(4-chlorophenyl)-6-methoxy-2-[4-[methyl-[[4-(4-methyl-3-oxopiperazin-1-yl)cyclohexyl]methyl]amino]phenyl]-7-propan-2-yloxy-1,4-dihydroisoquinolin-3-one [ka]

[0132] Nutlin-3 In one embodiment, the MDM2 inhibitor is Nutlin-3. Nutlin-3 has the chemical structure and name shown below:

[0133] 4-[4,5-bis(4-chlorophenyl)-2-(4-methoxy-2-propan-2-yloxyphenyl)-4,5-dihydroimidazole-1-carbonyl]piperazin-2-one [ka]

[0134] SJ-172550 In one embodiment, the MDM2 inhibitor is SJ-172550. SJ-172550 has the chemical structure and name shown below:

[0135] Methyl 2-[2-chloro-6-ethoxy-4-[(3-methyl-5-oxo-1-phenylpyrazol-4-ylidene)methyl]phenoxy]acetate [ka]

[0136] SAR405838(MI-77301) In one embodiment, the MDM2 inhibitor is SAR405838. SAR405838 has the chemical structure and name shown below:

[0137] (2'R,3R,3'S,5'S)-6-Chloro-3'-(3-chloro-2-fluorophenyl)-5'-(2,2-dimethylpropyl)-N-(4-hydroxycyclohexyl)-2-oxospiro[1H-indole-3,4'-pyrrolidine]-2'-carboxamide [ka]

[0138] MI-773 In one embodiment, the MDM2 inhibitor is MI-773, which has the chemical structure and name shown below:

[0139] (2'R,3S,3'S,5'R)-6-chloro-3'-(3-chloro-2-fluorophenyl)-5'-(2,2-dimethylpropyl)-N-(4-hydroxycyclohexyl)-2-oxospiro[1H-indole-3,4'-pyrrolidine]-2'-carboxamide [ka]

[0140] MX69 In one embodiment, the MDM2 inhibitor is MX69, which has the chemical structure and name shown below:

[0141] 4-[8-[(3,4-dimethylphenyl)sulfamoyl]-3a,4,5,9b-tetrahydro-3H-cyclopenta[c]quinolin-4-yl]benzoic acid [ka]

[0142] YH239-EE In one embodiment, the MDM2 inhibitor is YH239-EE, which has the chemical structure and name shown below:

[0143] Ethyl 3-[2-(tert-butylamino)-1-[(4-chlorophenyl)methyl-fulmylamino]-2-oxoethyl]-6-chloro-1H-indole-2-carboxylate [ka]

[0144] RO8994 In one embodiment, the MDM2 inhibitor is RO8994. RO8994 has the chemical structure and name shown below:

[0145] (2'R,3R,3'S,5'S)-N-(4-carbamoyl-2-methoxyphenyl)-6-chloro-3'-(3-chloro-2-fluorophenyl)-5'-(2,2-dimethylpropyl)-2-oxospiro[1H-indole-3,4'-pyrrolidine]-2'-carboxamide [ka]

[0146] Nutlin-3b In one embodiment, the MDM2 inhibitor is nutlin-3b, which has the chemical structure and name shown below:

[0147] 4-[(4R,5S)-4,5-bis(4-chlorophenyl)-2-(4-methoxy-2-propan-2-yloxyphenyl)-4,5-dihydroimidazole-1-carbonyl]piperazin-2-one [ka]

[0148] Serdemattan (JNJ-26854165) In one embodiment, the MDM2 inhibitor is celdematane, which has the chemical structure and name shown below:

[0149] 1-N-[2-(1H-indol-3-yl)ethyl]-4-N-pyridin-4-ylbenzene-1,4-diamine [ka]

[0150] NSC59984 In one embodiment, the MDM2 inhibitor is NSC59984. NSC59984 has the chemical structure and name shown below:

[0151] (E)-1-(4-Methylpiperazin-1-yl)-3-(5-nitrofuran-2-yl)prop-2-en-1-one [ka]

[0152] CHEMBL2386350 In one embodiment, the MDM2 inhibitor is CHEMBL2386350. CHEMBL2386350 has the chemical structure and name shown below:

[0153] 2-[4-[(4S,5R)-2-(4-tert-butyl-2-ethoxyphenyl)-4,5-bis(4-chlorophenyl)-4,5-dimethylimidazole-1-carbonyl]piperazin-1-yl]-1-morpholin-4-ylethanone [ka]

[0154] CGM0970B In one embodiment, the MDM2 inhibitor is CGM0970B, which has the chemical structure and name shown below:

[0155] (1R)-1-(4-chlorophenyl)-6-methoxy-2-[4-[methyl-[[4-(4-methyl-3-oxopiperazin-1-yl)cyclohexyl]methyl]amino]phenyl]-7-propan-2-yloxy-1,4-dihydroisoquinolin-3-one [ka]

[0156] MK-8242 In one embodiment, the MDM2 inhibitor is MK-8242. MK-8242 has the chemical structure and name shown below:

[0157] 4-Amino-1-[(2R,3S,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]pyrimidin-2-one [ka]

[0158] DS-3032 In one embodiment, the MDM2 inhibitor is DS-3032. DS-3032 has the chemical structure and name shown below:

[0159] (3'R,4'S,5'R)-N-((3R,6S)-6-Carbamoyltetrahydro-2H-pyran-3-yl)-6''-chloro-4'-(2-chloro-3-fluoropyridin-4-yl)-4,4-dimethyl-2''-oxodispiro[cyclohexane-1,2'-pyrrolidine-3',3''-indoline]-5'-carboxamide [ka]

[0160] DS-3032B In one embodiment, the MDM2 inhibitor is DS-3032B, which has the chemical structure and name shown below:

[0161] (3'R,4'S,5'R)-N-((3R,6S)-6-Carbamoyltetrahydro-2H-pyran-3-yl)-6''-chloro-4'-(2-chloro-3-fluoropyridin-4-yl)-4,4-dimethyl-2''-oxodispiro[cyclohexane-1,2'-pyrrolidine-3',3''-indoline]-5'-carboxamide 4-methylbenzenesulfonate [ka]

[0162] HDM201 In one embodiment, the MDM2 inhibitor is HDM201. HDM201 has the chemical structure and name shown below:

[0163] (4S)-5-(5-chloro-1-methyl-2-oxopyridin-3-yl)-4-(4-chlorophenyl)-2-(2,4-dimethoxypyrimidin-5-yl)-3-propan-2-yl-4H-pyrrolo[3,4-d]imidazol-6-one [ka]

[0164] APG-115 In one embodiment, the MDM2 inhibitor is APG-115. APG-115 is It has the chemical structure and name shown below.

[0165] 4-((3'R,4'S,5'R)-6''-chloro-4'-(3-chloro-2-fluorophenyl)-1'-ethyl-2''-oxodispiro[cyclohexane-1,2'-pyrrolidine-3',3''-indoline]-5'-carboxamide)bicyclo[2.2.2]octane-1-carboxylic acid [ka]

[0166] MI-1061 In one embodiment, the MDM2 inhibitor is APG-115, which has the chemical structure and name shown below:

[0167] 4-((3'R,4'S,5'R)-6''-chloro-4'-(3-chloro-2-fluorophenyl)-2''-oxodispiro[cyclohexane-1,2'-pyrrolidine-3',3''-indoline]-5'-carboxamido)benzoic acid [ka]

[0168] JAK inhibitors Ruxolitinib In one embodiment, the JAK inhibitor is ruxolitinib (available from Incyte Corp. and Novartis AG). Ruxolitinib has the chemical structure and name shown below: (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile [ka]

[0169] The preparation of this compound is described in U.S. Patent Nos. 8,604,043, 7,834,022, 8,486,902, 8,530,485, 7,598,257, 8,541,425, and 8,410,265, the disclosures of which are incorporated herein by reference.In one embodiment, the JAK inhibitor is a compound selected from the structures disclosed in U.S. Patent Nos. 8,604,043, 7,834,022, 8,486,902, 8,530,485, 7,598,257, 8,541,425, and 8,410,265, the disclosures of which are incorporated herein by reference.

[0170] In one embodiment, the JAK inhibitor is ruxolitinib phosphate (available from Incyte Corp. and Novartis AG). In one embodiment, the JAK inhibitor is (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-cyclopentylpropanenitrile phosphate.

[0171] Baricitinib In one embodiment, the JAK inhibitor is baricitinib (available from Incyte Corp. and Eli Lilly & Co.). Baricitinib has the chemical structure and name shown as: 2-(3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-1-(ethylsulfonyl)azetidin-3-yl)acetonitrile. [ka]

[0172] The preparation of this compound is described in U.S. Patent Nos. 8,158,616 and 8,420,629, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patent Nos. 8,158,616 and 8,420,629, the disclosures of which are incorporated herein by reference.

[0173] Momelotinib In one embodiment, the JAK inhibitor is momelotinib (Gilead Sciences). Momelotinib is also known as CYT-387. Momelotinib has the chemical structure and name shown below: N-(cyanomethyl)-4-(2-((4-morpholinophenyl)amino)pyrimidin-4-yl)benzamide. [ka]

[0174] The preparation of this compound is described in U.S. Patent No. 8,486,941, the disclosure of which is incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patent No. 8,486,941, the disclosure of which is incorporated herein by reference.

[0175] Ganetespib In one embodiment, the JAK inhibitor is ganetespib, which has the chemical structure and name shown below: 5-(2,4-dihydroxy-5-isopropylphenyl)-4-(1-methyl-1H-indol-5-yl)-2,4-dihydro-3H-1,2,4-triazol-3-one. [ka]

[0176] The preparation of this compound is described in U.S. Patent Nos. 7,825,148 and 8,628,752, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patent Nos. 7,825,148 and 8,628,752, the disclosures of which are incorporated herein by reference.

[0177] NS-018 In one embodiment, the JAK inhibitor is NS-018. NS-018 has the chemical structure and name shown below: (S)-N 2 -(1-(4-fluorophenyl)ethyl)-6-(1-methyl-1H-pyrazol-4-yl)-N 4 -(Pyrazin-2-yl)pyrimidine-2,4-diamine [ka]

[0178] The preparation of this compound is described in U.S. Patent Nos. 8,673,891 and 8,586,591, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patent Nos. 8,673,891 and 8,586,591, the disclosures of which are incorporated herein by reference.

[0179] BMS-911543 In one embodiment, the JAK inhibitor is BMS-911543. BMS-911543 has the chemical structure and name shown below: N,N-dicyclopropyl-4-((1,5-dimethyl-1H-pyrazol-3-yl)amino)-6-ethyl-1-methyl-1,6-dihydroimidazo[4,5-d]pyrrolo[2,3-b]pyridine-7-carboxamide. [ka]

[0180] The preparation of this compound is described in U.S. Patent Nos. 8,673,933 and 8,202,881, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patent Nos. 8,673,933 and 8,202,881, the disclosures of which are incorporated herein by reference.

[0181] Gandotinib (LY2784544) In one embodiment, the JAK inhibitor is gandotinib, which has the chemical structure and name shown below: 3-(4-chloro-2-fluorobenzyl)-2-methyl-N-(5-methyl-1H-pyrazol-3-yl)-8-(morpholinomethyl)imidazo[1,2-b]pyridazin-6-amine [ka]

[0182] The preparation of this compound is described in U.S. Patent No. 7,897,600, the disclosure of which is incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patent No. 7,897,600, the disclosure of which is incorporated herein by reference.

[0183] ENMD-2076 In one embodiment, the JAK inhibitor is ENMD-2076, which has the chemical structure and name shown below: (E)-N-(5-methyl-1H-pyrazol-3-yl)-6-(4-methylpiperazin-1-yl)-2-styrylpyrimidin-4-amine [ka]

[0184] The preparation of this compound is described in U.S. Patent Nos. 8,153,630, 7,563,787 and 8,114,870, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patent Nos. 8,153,630, 7,563,787 and 8,114,870, the disclosures of which are incorporated herein by reference.

[0185] AT-9283 In one embodiment, the JAK inhibitor is AT-9283. AT-9283 has the chemical structure and name shown below: 1-cyclopropyl-3-(3-(5-(morpholinomethyl)-1H-benzo[d]imidazol-2-yl)-1H-pyrazol-4-yl)urea [ka]

[0186] The preparation of this compound is described in U.S. Patent Nos. 8,399,442 and 7,977,477, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patent Nos. 8,399,442 and 7,977,477, the disclosures of which are incorporated herein by reference.

[0187] Pacritinib In one embodiment, the JAK inhibitor is pacritinib, which has the chemical structure and name shown below: 11-(2-pyrrolidin-1-yl-ethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)]heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene [ka]

[0188] In one embodiment, the structure of pacritinib may be in a tautomeric form. The preparation of pacritinib is described in U.S. Patent Nos. 8,143,255, 8,153,632 and 8,415,338, the disclosures of which are incorporated herein by reference.

[0189] AC-410 In one embodiment, the JAK inhibitor is AC-410 (available from Ambit Biosciences). AC-410 has the chemical structure and name shown below: (S)-(4-fluorophenyl)(4-((5-methyl-1H-pyrazol-3-yl)amino)quinazolin-2-yl)methanol. [ka]

[0190] The preparation of racemic (4-fluorophenyl)(4-((5-methyl-1H-pyrazol-3-yl)amino)quinazolin-2-yl)methanol hydrochloride is described in Examples 3 and 12 of U.S. Pat. No. 8,349,851, the disclosure of which is incorporated herein by reference.

[0191] AZD-1480 In one embodiment, the JAK inhibitor is AZD-1480. AZD-1480 has the chemical structure and name shown below: (S)-5-chloro-N 2-(1-(5-fluoropyrimidin-2-yl)ethyl)-N 4 -(5-Methyl-1H-pyrazol-3-yl)pyrimidine-2,4-diamine [ka]

[0192] The preparation of this compound is described in U.S. Patent No. 8,088,784, the disclosure of which is incorporated herein by reference. In one embodiment, the JAK inhibitor is selected from the compounds described in U.S. Patent No. 8,088,784, the disclosure of which is incorporated herein by reference.

[0193] CYT387 In one embodiment, the JAK inhibitor is CYT387. CYT387 has the chemical structure and name shown below: N-(cyanomethyl)-4-(2-(4-morpholinophenylamino)pyrimidin-4-yl)benzamide. [ka]

[0194] The preparation of this compound is described in US Pat. Nos. 9,809,559 and 8,486,941, the disclosures of which are incorporated herein by reference.

[0195] TYK2-IN-2 In one embodiment, the JAK inhibitor is TYK2-IN-2. TYK2-IN-2 has the chemical structure and name shown below: 6-((3,5-dimethylphenyl)amino)-8-(methylamino)imidazo[1,2-b]pyridazine-3-carboxamide D [ka]

[0196] SAR-20347 In one embodiment, the JAK inhibitor is SAR-20347. SAR-20347 has the chemical structure and name shown below: 2-(2-chloro-6-fluorophenyl)-5-[4-(morpholine-4-carbonyl)anilino]-1,3-oxazole-4-carboxamide. [ka]

[0197] Upadacitinib (ABT-494) In one embodiment, the JAK inhibitor is upadacitinib (ABT-494). Upadacitinib has the chemical structure and name shown below: (3S,4R)-3-ethyl-4-(3H-imidazo[1,2-a]pyrrolo[2,3-e]pyrazin-8-yl)-N-(2,2,2-trifluoroethyl)pyrrolidine-1-carboxamide. [ka]

[0198] WP1066 In one embodiment, the JAK inhibitor is WP1066. WP1066 has the chemical structure and name shown below: (E)-3-(6-bromopyridin-2-yl)-2-cyano-N-[(1S)-1-phenylethyl]prop-2-enamide. [ka]

[0199] GLPG0634 (filgotinib) In one embodiment, the JAK inhibitor is GLPG0634 (filgotinib). GLPG0634 has the chemical structure and name shown below: N-[5-[4-[(1,1-dioxo-1,4-thiazin-4-yl)methyl]phenyl]-[1,2,4]triazolo[1,5-a]pyridin-2-yl]cyclopropanecarboxamide. [ka]

[0200] TG101348 (Fedratinib, SAR 302503) In one embodiment, the JAK inhibitor is TG101348 (Fedratinib, SAR 302503). TG101348 has the chemical structure and name shown below: N-tert-butyl-3-[[5-methyl-2-[4-(2-pyrrolidin-1-ylethoxy)anilino]pyrimidin-4-yl]amino]benzenesulfonamide [ka]

[0201] Celduratinib (PRT062070, PRT2070) In one embodiment, the JAK inhibitor is celduratinib (PRT062070, PRT2070). Celduratinib has the chemical structure and name shown below: 4-(cyclopropylamino)-2-[4-(4-ethylsulfonylpiperazin-1-yl)anilino]pyrimidine-5-carboxamide. [ka]

[0202] Tofacitinib In one embodiment, the JAK inhibitor is tofacitinib, which has the chemical structure and name shown below: 3-[(3R,4R)-4-methyl-3-[methyl(7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino]piperidin-1-yl]-3-oxopropanenitrile [ka] Itacitinib In one embodiment, the JAK inhibitor is Itacitinib, which has the chemical structure and name shown below: 2-[1-[1-[3-fluoro-2-(trifluoromethyl)pyridine-4-carbonyl]piperidin-4-yl]-3-[4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)pyrazol-1-yl]azetidin-3-yl]acetonitrile [ka] Decernotinib In one embodiment, the JAK inhibitor is decernotinib, which has the chemical structure and name shown below: (2R)-2-methyl-2-[[2-(1H-pyrrolo[2,3-b]pyridin-3-yl)pyrimidin-4-yl]amino]-N-(2,2,2-trifluoroethyl)butanamide [ka]

[0203] CHZ868 In one embodiment, the JAK inhibitor is CHZ868. CHZ868 has the chemical structure and name shown below: N-[4-[2-(2,4-difluoroanilino)-1,4-dimethylbenzimidazol-5-yl]oxypyridin-2-yl]acetamide [ka]

[0204] SB1317 In one embodiment, the JAK inhibitor is SB1317. SB1317 has the chemical structure and name shown below: (E)-6-methyl-12-oxa-3,6-diaza-2(4,2)-pyrimidina-1,4(1,3)-dibenzenacyclododecaphan-8-ene. [ka]

[0205] Solcitinib In one embodiment, the JAK inhibitor is solcitinib. Solcitinib has the chemical structure and name shown below: N-[5-[4-(3,3-dimethylazetidine-1-carbonyl)phenyl]-[1,2,4]triazolo[1,5-a]pyridin-2-yl]cyclopropanecarboxamide. [ka]

[0206] Peficitinib In one embodiment, the JAK inhibitor is peficitinib. Peficitinib has the chemical structure and name shown below: 4-[[(1R,3S)-5-hydroxy-2-adamantyl]amino]-1H-pyrrolo[2,3-b]pyridine-5-carboxamide. [ka]

[0207] CEP-33779 In one embodiment, the JAK inhibitor is CEP-33779. CEP-33779 has the chemical structure and name shown below: N-[3-(4-methylpiperazin-1-yl)phenyl]-8-(4-methylsulfonylphenyl)-[1,2,4]triazolo[1,5-a]pyridin-2-amine [ka]

[0208] Pyridone 6 In one embodiment, the JAK inhibitor is pyridone 6. Pyridone 6 has the chemical structure and name shown below: 2-(tert-butyl)-9-fluoro-3H-benzo[h]imidazo[4,5-f]isoquinolin-7-ol. [ka]

[0209] LFM-A13 In one embodiment, the JAK inhibitor is LFM-A13, which has the chemical structure and name shown below: (Z)-2-cyano-N-(2,5-dibromophenyl)-3-hydroxybut-2-enamide [ka]

[0210] BMS-911543 In one embodiment, the JAK inhibitor is BMS-911543. BMS-911543 has the chemical structure and name shown below: (Z)-N,N-dicyclopropyl-4-((1,5-dimethyl-1,2-dihydro-3H-pyrazol-3-ylidene)amino)-6-ethyl-1-methyl-1,6-dihydroimidazo[4,5-d]pyrrolo[2,3-b]pyridine-7-carboxamide. [ka]

[0211] NS-018 In one embodiment, the JAK inhibitor is NS-018. NS-018 has the chemical structure and name shown below: 6-N-[(1S)-1-(4-fluorophenyl)ethyl]-4-(1-methylpyrazol-4-yl)-2-N-pyrazin-2-ylpyridine-2,6-diamine [ka]

[0212] JANEX-1 In one embodiment, the JAK inhibitor is JANEX-1. JANEX-1 has the chemical structure and name shown below: 4-[(6,7-dimethoxyquinazolin-4-yl)amino]phenol [ka]

[0213] TG101209 In one embodiment, the JAK inhibitor is TG101209. TG101209 has the chemical structure and name shown below: N-tert-butyl-3-[[5-methyl-2-[4-(4-methylpiperazin-1-yl)anilino]pyrimidin-4-yl]amino]benzenesulfonamide [ka]

[0214] WHI-P154 In one embodiment, the JAK inhibitor is WHI-P154. WHI-P154 has the chemical structure and name shown below: 2-Bromo-4-[(6,7-dimethoxyquinazolin-4-yl)amino]phenol [ka]

[0215] NVP-BSK805 In one embodiment, the JAK inhibitor is NVP-BSK805. NVP-BSK805 has the chemical structure and name shown below: 4-[[2,6-difluoro-4-[3-(1-piperidin-4-ylpyrazol-4-yl)quinoxalin-5-yl]phenyl]methyl]morpholine [ka]

[0216] ZM39923 In one embodiment, the JAK inhibitor is ZM39923, which has the chemical structure and name shown below: 3-[benzyl(propan-2-yl)amino]-1-naphthalen-2-ylpropan-1-one [ka]

[0217] Ruxolitinib-S In one embodiment, the JAK inhibitor is ruxolitinib-S. Ruxolitinib-S has the chemical structure and name shown below: (3S)-3-cyclopentyl-3-[4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)pyrazol-1-yl]propionate. Propanenitrile [ka]

[0218] XL019 In one embodiment, the JAK inhibitor is XL019. XL019 has the chemical structure and name shown below: (2S)-N-[4-[2-(4-morpholin-4-ylanilino)pyrimidin-4-yl]phenyl]pyrrolidine-2-carboxamide. [ka]

[0219] AZ960 In one embodiment, the JAK inhibitor is AZ960. AZ960 has the chemical structure and name shown below: 5-fluoro-2-[[(1S)-1-(4-fluorophenyl)ethyl]amino]-6-[(5-methyl-1H-pyrazol-3-yl)amino]pyridine-3-carbonitrile. [ka]

[0220] JAK3-IN-1 In one embodiment, the JAK inhibitor is JAK3-IN-1, which has the chemical structure and name shown below: N-[3-[[[5-chloro-2-[2-methoxy-4-(4-methylpiperazin-1-yl)anilino]pyrimidin-4-yl]amino]methyl]phenyl]prop-2-enamide [ka]

[0221] WHI-P97 In one embodiment, the JAK inhibitor is WHI-P97. WHI-P97 has the chemical structure and name shown below: 2,6-dibromo-4-[(6,7-dimethoxyquinazolin-4-yl)amino]phenol [ka]

[0222] RGB-286638 In one embodiment, the JAK inhibitor is RGB-286638. RGB-286638 has the chemical structure and name shown below: 1-[3-[4-[[4-(2- Methoxyethyl)piperazin-1-yl]methyl]phenyl]-4-oxo-1H-indeno[1,2-c]pyrazol-5-yl]-3-morpholin-4-ylurea dihydrochloride [ka]

[0223] Tofacitinib (3R,4S) In one embodiment, the JAK inhibitor is tofacitinib (3R,4S), which has the chemical structure and name shown below: 3-[(3R,4S)-4-methyl-3-[methyl(7H-pyrrolo[2,3-D]pyrimidin-4-yl)amino]piperidin-1-yl]-3-oxopropanenitrile [ka]

[0224] NSC42834 In one embodiment, the JAK inhibitor is NSC42834. NSC42834 has the chemical structure and name shown below: 2-methyl-1-phenyl-4-pyridin-2-yl-2-(2-pyridin-2-ylethyl)butan-1-one [ka]

[0225] PF-06651600 In one embodiment, the JAK inhibitor is PF-06651600. PF-06651600 has the chemical structure and name shown below: benzyl 2-(hydroxymethyl)-5-[(2-methylpropan-2-yl)oxycarbonylamino]piperidine-1-carboxylate [ka]

[0226] Tofacitinib (3S,4S) In one embodiment, the JAK inhibitor is tofacitinib (3S,4S), which has the chemical structure and name shown below: 3-[(3S,4S)-4-methyl-3-[methyl(7H-pyrrolo[2,3-D]pyrimidin-4-yl)amino]piperidin-1-yl]-3-oxopropanenitrile [ka]

[0227] Tofacitinib (3S,4R) In one embodiment, the JAK inhibitor is tofacitinib (3S,4R), which has the chemical structure and name shown below: 3-[(3S,4R)-4-methyl-3-[methyl(7H-pyrrolo[2,3-D]pyrimidin-4-yl)amino]piperidin-1-yl]-3-oxopropanenitrile [ka]

[0228] AEG3482 In one embodiment, the JAK inhibitor is AEG3482. AEG3482 has the chemical structure and name shown below: 6-phenylimidazo[2,1-b][1,3,4]thiadiazole-2-sulfonamide [ka]

[0229] Lestaurtinib (CEP-701) In one embodiment, the JAK inhibitor is lestaurtinib (CEP-701). Lestaurtinib has the chemical structure and name shown below: (5R,7S,8S)-7-hydroxy-7-(hydroxymethyl)-8-methyl-5,6,7,8,13,14-hexahydro-15H-16-oxa-4b,8a,14-triaza-5,8-methanodibenzo[b,h]cycloocta[jkl]cyclopenta[e]-AS-indacen-15-one [ka]

[0230] Oclacitinib In one embodiment, the JAK inhibitor is oclacitinib. Oclacitinib has the chemical structure and name shown below: N-methyl-1-[4-[methyl(7H-pyrrolo[2,3-d]pyrimidin-4-yl)amino]cyclohexyl]methanesulfonamide [ka]

[0231] In one embodiment, the JAK inhibitor is (E)-4-(2-(pyrrolidin-1-yl)ethoxy)-6,11-dioxa-3-aza-2(4,2)-pyrimidina-1(2,5)-furan-4(1,3)-benzenacyclododecaphan-8-ene. In one embodiment, the JAK inhibitor is (9E)-15-(2-(pyrrolidin-1-yl)ethoxy)-7,12,25-trioxa-19,21,24-triaza-tetracyclo[18.3.1.1(2,5).1(14,18)]hexacosa-1(24),2,4,9,14(26),15,17,20,22-nonaene. In one embodiment, the JAK inhibitor is a compound of formula (LIV-A): [ka] Or a pharmaceutically acceptable salt thereof. The preparation and properties of this JAK inhibitor are known to those skilled in the art and are described, for example, in Madan (2012) J.Immunol.189, 4123-4134 and William (2012) J.Med.Chem.55, 2623-2640.

[0232] In one embodiment, the JAK inhibitor is (R)-(4-fluorophenyl)(4-((5-methyl-1H-pyrazol-3-yl)amino)quinazolin-2-yl)methanol, which is also known in the art to be active as a JAK inhibitor. In one embodiment, the JAK inhibitor is racemic (4-fluorophenyl)(4-((5-methyl-1H-pyrazol-3-yl)amino)quinazolin-2-yl)methanol, which is also known in the art to be active as a JAK inhibitor.

[0233] In one embodiment, the JAK inhibitor is (S)-5-fluoro-2-((1-(4-fluorophenyl)ethyl)amino)-6-((5-methyl-1H-pyrazol-3-yl)amino)nicotinonitrile. In one embodiment, the JAK inhibitor is a compound of formula (LX) [ka] Or its pharmaceutically acceptable salt.The preparation of this compound is described in U.S. Patent No. 8,324,252, the disclosure of which is incorporated herein by reference.In one embodiment, the JAK inhibitor is selected from the compounds described in U.S. Patent No. 8,324,252, the disclosure of which is incorporated herein by reference.

[0234] In one embodiment, the JAK inhibitor is (R)-7-(2-aminopyrimidin-5-yl)-1-((1-cyclopropyl-2,2,2-trifluoroethyl)amino)-5H-pyrido[4,3-b]indole-4-carboxamide, also named 7-(2-aminopyrimidin-5-yl)-1-{[(1R)-1-cyclopropyl-2,2,2-trifluoroethyl]amino}-5H-pyrido[4,3-b]indole-4-carboxamide. In one embodiment, the JAK inhibitor is a compound of formula (LXII): [ka] or a pharma- ceutically acceptable salt thereof. The preparation of this compound is known to those skilled in the art and is described in Lim (2011) J. Med. Chem. 54, 7334-7349, the disclosure of which is incorporated herein by reference.

[0235] IDH inhibitors Enasidenib In one embodiment, the IDH inhibitor is enasidenib. Enasidenib has the chemical structure and name shown below: 2-methyl-1-[[4-[6-(trifluoromethyl)pyridin-2-yl]-6-[[2-(trifluoromethyl)pyridin-4-yl]amino]-1,3,5-triazin-2-yl]amino]propan-2-ol. [ka]

[0236] Ivosidenib (AG-120) In one embodiment, the IDH inhibitor is ivosidenib. Ivosidenib has the chemical structure and name shown below: (2S)-N-[(1S)-1-(2-chlorophenyl)-2-[(3,3-difluorocyclobutyl)amino]-2-oxoethyl]-1-(4-cyanopyridin-2-yl)-N-(5-fluoropyridin-3-yl)-5-oxopyrrolidine-2-carboxamide. [ka]

[0237] AGI-5198(IDH-C35) In one embodiment, the IDH inhibitor is AGI-5198. AGI-5198 has the chemical structure and name shown below: N-cyclohexyl-2-(3-fluoro-N-[2-(2-methylimidazol-1-yl)acetyl]anilino)-2-(2-methylphenyl)acetamide [ka]

[0238] AGI-6780 In one embodiment, the IDH inhibitor is AGI-6780. AGI-6780 has the chemical structure and name shown below: 1-[5-(cyclopropylsulfamoyl)-2-thiophen-3-ylphenyl]-3-[3-(trifluoromethyl)phenyl]urea [ka]

[0239] CHEMBL3682093 In one embodiment, the IDH inhibitor is CHEMBL 3682093. CHEMBL 3682093 has the chemical structure and name shown below: (4S)-3-[2-[[(1S)-1-[4-[(4-acetylpiperazin-1-yl)methyl]phenyl]ethyl]amino]pyrimidin-4-yl]-4-propan-2-yl-1,3-oxazolidin-2-one [ka]

[0240] Vorasidenib (AG-881) In one embodiment, the IDH inhibitor is vorasidenib. Vorasidenib has the chemical structure and name shown below: 6-(6-chloropyridin-2-yl)-2-N,4-N-bis[(2R)-1,1,1-trifluoropropan-2-yl]-1,3,5-triazine-2,4-diamine [ka]

[0241] IDH-305 In one embodiment, the IDH inhibitor is IDH-305. IDH-305 has the chemical structure and name shown below: (4R)-4-[(1S)-1-fluoroethyl]-3-[2-[[(1S)-1-[4-methyl-5-[2-(trifluoromethyl)pyridin-4-yl]pyridin-2-yl]ethyl]amino]pyrimidin-4-yl]-1,3-oxazolidin-2-one. [ka]

[0242] BAY-1436032 In one embodiment, the IDH inhibitor is BAY-1436032. BAY-1436032 has the chemical structure and name shown below: 3-[2-[4-(trifluoromethoxy)anilino]-1-[(1R,5R)-3,3,5-trimethylcyclohexyl]benzimidazol-5-yl]propanoic acid. [ka]

[0243] GSK864 In one embodiment, the IDH inhibitor is GSK864. GSK864 is shown as follows: It has the chemical structure and name (7S)-1-[(4-fluorophenyl)methyl]-3-N-(4-methoxy-3,5-dimethylphenyl)-7-methyl-5-(1H-pyrrole-2-carbonyl)-4,6-dihydropyrazolo[4,3-c]pyridine-3,7-dicarboxamide. [ka]

[0244] (R,S)-Ivosidenib In one embodiment, the IDH inhibitor is (R,S)-ivosidenib, which has the chemical structure and name shown below: (2R)-N-[(1S)-1-(2-chlorophenyl)-2-[(3,3-difluorocyclobutyl)amino]-2-oxoethyl]-1-(4-cyanopyridin-2-yl)-N-(5-fluoropyridin-3-yl)-5-oxopyrrolidine-2-carboxamide. [ka]

[0245] IDH1-IN-2 In one embodiment, the IDH inhibitor is IDH1-IN-2. IDH1-IN-2 has the chemical structure and name shown below: (4S)-3-[2-[[(1S)-1-[4-[(4,4-difluoropiperidin-1-yl)methyl]phenyl]ethyl]amino]pyrimidin-4-yl]-4-propan-2-yl-1,3-oxazolidin-2-one [ka]

[0246] IDH1-IN-1 In one embodiment, the IDH inhibitor is IDH1-IN-1. IDH1-IN-1 has the chemical structure and name shown below: 2-(N-[2-(benzimidazol-1-yl)acetyl]-3-fluoroanilino)-N-cyclohexyl-2-(2-methylphenyl)acetamide. [ka]

[0247] Ensidenib mesylate In one embodiment, the IDH inhibitor is enasidenib mesylate, which has the chemical structure and name shown below: 2-methyl-1-[[4-[6-(trifluoromethyl)pyridin-2-yl]-6-[[2-(trifluoromethyl)pyridin-4-yl]amino]-1,3,5-triazin-2-yl]amino]propan-2-ol methanesulfonic acid [ka]

[0248] PD-1 inhibitors The PD-1 inhibitor may be any PD-1 inhibitor or PD-1 blocker known in the art. In particular, it is one of the PD-1 inhibitors or blockers described in more detail in the following paragraphs. The terms "inhibitor" and "blocker" are used interchangeably herein with respect to a PD-1 inhibitor. For the avoidance of doubt, reference herein to a PD-1 inhibitor that is an antibody may refer to the compound or an antigen-binding fragment, variant, conjugate, or biosimilar thereof. For the avoidance of doubt, reference herein to a PD-1 inhibitor may also refer to the compound or a pharma- ceutically acceptable salt, ester, solvate, hydrate, cocrystal, or prodrug thereof.

[0249] In some embodiments, the compositions and methods described include a PD-1 inhibitor. In some embodiments, the PD-1 inhibitor is a small molecule. In a preferred embodiment, the PD-1 inhibitor is an antibody, a fragment thereof including a Fab fragment, or a single chain variable fragment (scFv). In some embodiments, the PD-1 inhibitor is a polyclonal antibody. In a preferred embodiment, the PD-1 inhibitor is a monoclonal antibody. In some embodiments, the PD-1 inhibitor competes for binding to PD-1 and / or binds to an epitope on PD-1. In one embodiment, the antibody competes for binding to PD-1 and / or binds to an epitope on PD-1. In some embodiments, the PD-1 inhibitor is included in the composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, an anti-PD-1 monoclonal antibody is included in the composition or method. In some embodiments, an anti-PD-1 monoclonal antibody is included in a composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, an anti-PD-1 monoclonal antibody is included in a composition or method and is further combined with a BTK inhibitor and / or a JAK-2 inhibitor. In some embodiments, a PD-1 inhibitor is included in a composition or method and is further combined with a BTK inhibitor. In some embodiments, an anti-PD-1 monoclonal antibody is included in a composition or method and is further combined with a BTK inhibitor. In some embodiments, a PD-1 inhibitor is included in a composition or method and is further combined with a PI3K inhibitor. In some embodiments, an anti-PD-1 monoclonal antibody is included in a composition or method and is further combined with a PI3K inhibitor. In some embodiments, a PD-1 inhibitor is included in a composition or method and is further combined with a JAK-2 inhibitor. In some embodiments, an anti-PD-1 monoclonal antibody is included in a composition or method and is further combined with a JAK-2 inhibitor. In some embodiments, the compositions described herein provide for a combination of a PD-1 inhibitor and a BTK inhibitor, or a method of using a combination of a PD-1 inhibitor and a BTK inhibitor. In some embodiments, the PD-1 inhibitors provided herein are selective for PD-1, in that the compounds bind to or interact with PD-1 at substantially lower concentrations than they bind to or interact with other receptors.

[0250] In some embodiments, the compositions and methods described bind human PD-1 to a K of about 100 pM or less. D or binds human PD-1 with a K of approximately 90 pM or less. D or binds human PD-1 with a K of approximately 80 pM or less. D or binds human PD-1 with a K of approximately 70 pM or less. D or binds human PD-1 with a K of approximately 60 pM or less. D or binds human PD-1 with a K of approximately 50 pM or less. D or binds human PD-1 with a K of approximately 40 pM or less. D or binds human PD-1 with a K of approximately 30 pM or less D These include PD-1 inhibitors that bind to

[0251] In some embodiments, the compositions and methods described deliver about 7.5×10 5 k over l / M s assoc or binds to human PD-1 at approximately 7.5 × 10 5 k over l / M s assoc or binds to human PD-1 at approximately 8 × 10 5 k over l / M s assoc or binds to human PD-1 at approximately 8.5 × 10 5 k over l / M s assoc or binds to human PD-1 at approximately 9 × 10 5 k over l / M s assoc or binds to human PD-1 at approximately 9.5 × 10 5 k over l / M s assoc or binds to human PD-1 at approximately 1 × 10 6 k over l / M s assoc These include PD-1 inhibitors that bind to

[0252] In some embodiments, the compositions and methods described deliver about 2×10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.1 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.2 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.3 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.4 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.5 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.6 × 10 -5 k below l / s dissoc or to human PD-1 at approximately 2.7 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.8 × 10 -5 k below l / s dissocor binds to human PD-1 at approximately 2.9 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 3 × 10 -5 k below l / s dissoc These include PD-1 inhibitors that bind to

[0253] In some embodiments, the compositions and methods described enhance binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of about 10 nM or less. 50 or block or inhibit binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 9 nM or less 50 or block or inhibit the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 8 nM or less 50 or human PD-1. Binding of D-L1 or human PD-L2 was observed with an IC of approximately 7 nM or less 50 or block or inhibit binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 6 nM or less 50 or block or inhibit the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 5 nM or less 50 or block or inhibit the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 4 nM or less 50 or block or inhibit binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 3 nM or less 50 or block or inhibit the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 2 nM or less 50 or inhibit the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of about 1 nM or less. 50 These include PD-1 inhibitors, which block or inhibit

[0254] In one embodiment, the anti-PD-1 antibody comprises nivolumab, or an antigen-binding fragment, conjugate, or variant thereof, manufactured by Bristol-Myers Squibb Co. Nivolumab is referred to as 5C4 in International Patent Publication No. WO2006 / 121168. Nivolumab is assigned CAS Registry Number 946414-94-4, and is also known to those skilled in the art as BMS-936558, MDX-1106, or ONO-4538. Nivolumab is a fully human IgG4 antibody that blocks the PD-1 receptor. The clinical safety and efficacy of nivolumab in various forms of cancer are described in Wang, Cancer Immunol Res. 2014, 2, 846-56; Page, Ann. Rev. Med., 2014, 65, 185-202; and Weber, J. Clin. Oncology, 2013, 31, 4311-4318. The nivolumab monoclonal antibody comprises a heavy chain given by SEQ ID NO: 1 and a light chain given by SEQ ID NO: 2. In one embodiment, the anti-PD-1 antibody is an immunoglobulin G4 kappa, anti-(human CD274) antibody. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains having the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively, or an antigen-binding fragment, Fab fragment, single chain variable fragment (scFv), variant, or conjugate thereof. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains that are at least 99% identical to the sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 98% identical to the sequences set forth in SEQ ID NO:1 and SEQ ID NO:2, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 97% identical to the sequences set forth in SEQ ID NO:1 and SEQ ID NO:2, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 96% identical to the sequences set forth in SEQ ID NO:1 and SEQ ID NO:2, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 95% identical to the sequences set forth in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0255] In other embodiments, the anti-PD-1 antibody comprises the heavy and light chain CDRs or VRs of nivolumab. H The region comprises the sequence shown in SEQ ID NO:3, L The region comprises the sequence set forth in SEQ ID NO: 4. In one embodiment, the anti-PD-1 antibody comprises a V region that is at least 99% identical to the sequences set forth in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. H and V L In one embodiment, the anti-PD-1 antibody comprises a V region that is at least 98% identical to the sequences set forth in SEQ ID NO:3 and SEQ ID NO:4, respectively. H and V L In one embodiment, the anti-PD-1 antibody comprises a V region that is at least 97% identical to the sequences set forth in SEQ ID NO:3 and SEQ ID NO:4, respectively. H and V L In one embodiment, the anti-PD-1 antibody comprises a V region that is at least 96% identical to the sequences set forth in SEQ ID NO:3 and SEQ ID NO:4, respectively. H and V L In one embodiment, the anti-PD-1 antibody comprises a V region that is at least 95% identical to the sequences set forth in SEQ ID NO:3 and SEQ ID NO:4, respectively. H and V L In alternative embodiments, the antibody comprises a V region having the amino acid sequence shown in SEQ ID NO:3 and / or SEQ ID NO:4, respectively. H and / or V L Includes the area.

[0256] In another embodiment, the anti-PD-1 antibody comprises heavy chain CDR1, CDR2, and CDR3 domains having the sequences set forth in SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, respectively, or conservative amino acid substitutions thereof, and light chain CDR1, CDR2, and CDR3 domains having the sequences set forth in SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, respectively, or conservative amino acid substitutions thereof.

[0257] In one embodiment, the anti-PD-1 antibody comprises CDR1, CDR2, and CDR3 domains that are at least 95% identical to the sequences set forth in SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, respectively. In one embodiment, the anti-PD-1 antibody comprises CDR1, CDR2, and CDR3 domains that are at least 94% identical to the sequences set forth in SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, respectively. In one embodiment, the anti-PD-1 antibody comprises CDR1, CDR2, and CDR3 domains that are at least 90% identical to the sequences set forth in SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, respectively. In one embodiment, the anti-PD-1 antibody comprises CDR1, CDR2, and CDR3 domains that are at least 88% identical to the sequences set forth in SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, respectively. In another embodiment, the antibody competes for binding to PD-1 and / or binds to the same epitope on PD-1 as the aforementioned antibodies.

[0258] In one embodiment, the anti-PD-1 antibody comprises CDR1, CDR2, and CDR3 domains that are at least 95% identical to the sequences set forth in SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, respectively. In one embodiment, the anti-PD-1 antibody comprises CDR1, CDR2, and CDR3 domains that are at least 91% identical to the sequences set forth in SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, respectively. In one embodiment, the anti-PD-1 antibody comprises CDR1, CDR2, and CDR3 domains that are at least 90% identical to the sequences set forth in SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, respectively. In one embodiment, the anti-PD-1 antibody comprises CDR1, CDR2, and CDR3 domains that are at least 85% identical to the sequences set forth in SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, respectively. In another embodiment, the antibody competes for binding to PD-1 and / or binds to the same epitope on PD-1 as the above-mentioned antibodies.

[0259] In one embodiment, the anti-PD-1 antibody is an antibody disclosed and / or prepared according to U.S. Patent No. 8,008,449 or U.S. Patent Application Publication No. 2009 / 0217401A1 or 2013 / 0133091A1, the disclosures of which are specifically incorporated herein by reference. For example, in one embodiment, the monoclonal antibody comprises 5C4 (referred to herein as nivolumab), 17D8, 2D3, 4H1, 4A11, 7D3, and 5F4, which are described in U.S. Patent No. 8,008,449, the disclosures of which are specifically incorporated herein by reference. The PD-1 antibodies 17D8, 2D3, 4H1, 5C4, and 4A11 are all directed against human PD-1 and specifically bind to PD-1 and do not bind to other members of the CD28 family. The sequences and CDR regions of these antibodies are provided in US Pat. No. 8,008,449, particularly Figures 1-12, all of which are incorporated herein by reference in their entirety.

[0260] The anti-PD-1 antibody nivolumab may be prepared by the following procedure, as described in U.S. Patent No. 8,008,449. The antibody nivolumab may be manufactured in this manner, or by other known means in light of the amino acid sequence disclosure herein.

[0261] In another embodiment, the anti-PD-1 antibody comprises pembrolizumab, or an antigen-binding fragment, conjugate, or variant thereof, commercially available from Merck. Pembrolizumab is disclosed in International Patent Publication No. WO2008 / 156712A1, U.S. Patent No. 8,354,509, and U.S. Patent Application Publication Nos. US2010 / 0266617A1, US2010 / 0266617A1, and ... It is referred to as h409All in US2013 / 0108651A1 and US2013 / 0109843A2. Pembrolizumab has a disulfide, dimeric structure with immunoglobulin G4, anti-(human protein PDCD1 (programmed cell death 1)) (human-mouse monoclonal heavy chain), human-mouse monoclonal light chain. The structure of pembrolizumab is also sometimes described as disulfide-bisdisulfide with immunoglobulin G4, anti-(human programmed cell death 1); humanized mouse monoclonal [228-L-proline (H10-S>P)] gamma 4 heavy chain (134-218')-humanized mouse monoclonal kappa light chain dimer (226-226'':229-229''). Pembrolizumab is assigned the CAS Registry Number 1374853-91-4 and is also known as lambrolizumab, MK-3475, and SCH-900475. The clinical safety and efficacy of pembrolizumab in various forms of cancer are described in Fuerst, Oncology Times, 2014, 36, 35-36; Robert, Lancet, 2014, 384, 1109-17; and Thomas, Exp.Opin.Biol.Ther., 2014, 14, 1061-1064. In one embodiment, the pembrolizumab monoclonal antibody comprises a heavy chain as given by SEQ ID NO: 12 and a light chain as given by SEQ ID NO: 14, and is also shown below with disulfide and glycosylation information. [Table 1]

[0262] In one embodiment, the anti-PD-1 antibody comprises heavy and light chains having the sequences set forth in SEQ ID NO: 12 and SEQ ID NO: 14, respectively, or antigen-binding fragments and variants thereof. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains that are at least 99% identical to the sequences set forth in SEQ ID NO: 12 and SEQ ID NO: 14, respectively, or antigen-binding fragments and variants thereof. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains that are at least 98% identical to the sequences set forth in SEQ ID NO: 12 and SEQ ID NO: 14, respectively, or antigen-binding fragments and variants thereof. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains that are at least 97% identical to the sequences set forth in SEQ ID NO: 12 and SEQ ID NO: 14, respectively, or antigen-binding fragments and variants thereof. In one embodiment, the anti-PD-1 antibody comprises The anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 96% identical to the sequences set forth in SEQ ID NO: 12 and SEQ ID NO: 14, respectively, or antigen-binding fragments and variants thereof. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 95% identical to the sequences set forth in SEQ ID NO: 12 and SEQ ID NO: 14, respectively, or antigen-binding fragments and variants thereof.

[0263] In other embodiments, the anti-PD-1 antibody comprises the heavy and light chain CDRs or VRs of pembrolizumab. H The region comprises the sequence of residues 20 to 446 of SEQ ID NO: 11, and L The region comprises the sequence set forth in SEQ ID NO: 14. In one embodiment, the anti-PD-1 antibody comprises a V region that is at least 99% identical to the sequence of residues 20-446 of SEQ ID NO: 11 and the sequence set forth in SEQ ID NO: 14, respectively. H and V L In one embodiment, the anti-PD-1 antibody comprises a V region that is at least 98% identical to the sequence of residues 20-446 of SEQ ID NO:11 and the sequence set forth in SEQ ID NO:14, respectively. H and V L In one embodiment, the anti-PD-1 antibody comprises a V region that is at least 97% identical to the sequence of residues 20-446 of SEQ ID NO:11 and the sequence set forth in SEQ ID NO:14, respectively. Hand V L In one embodiment, the anti-PD-1 antibody comprises a V region that is at least 96% identical to the sequence of residues 20-446 of SEQ ID NO:11 and the sequence set forth in SEQ ID NO:14, respectively. H and V L In one embodiment, the anti-PD-1 antibody comprises a V region that is at least 95% identical to the sequence of residues 20-446 of SEQ ID NO:11 and the sequence set forth in SEQ ID NO:14, respectively. H and V L Includes the area.

[0264] In one embodiment, the anti-PD-1 antibody comprises a heavy chain comprising amino acid residues 20-446 of SEQ ID NO:11, and a light chain comprising amino acid residues 20-237 of SEQ ID NO:13.

[0265] In one embodiment, the anti-PD-1 antibody is an isolated antibody or antibody fragment that binds to human PD-1 that comprises the three light chain CDRs of SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17, or conservative amino acid substitutions thereof, and the three heavy chain CDRs of SEQ ID NO:18, SEQ ID NO:19, and SEQ ID NO:20, or conservative amino acid substitutions thereof.

[0266] In one embodiment, the anti-PD-1 antibody comprises a heavy chain comprising CDR1, CDR2, and CDR3 domains that are at least 95% identical to the sequences set forth in SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain comprising CDR1, CDR2, and CDR3 domains that are at least 90% identical to the sequences set forth in SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain comprising CDR1, CDR2, and CDR3 domains that are at least 85% identical to the sequences set forth in SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain comprising CDR1, CDR2, and CDR3 domains that are at least 80% identical to the sequences set forth in SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17, respectively. In another embodiment, the antibody competes for binding to PD-1 and / or binds to the same epitope on PD-1 as the aforementioned antibodies.

[0267] In one embodiment, the anti-PD-1 antibody comprises a light chain comprising CDR1, CDR2, and CDR3 domains that are at least 95% identical to the sequences set forth in SEQ ID NO:18, SEQ ID NO:19, and SEQ ID NO:20, respectively. In one embodiment, the anti-PD-1 antibody comprises a light chain comprising CDR1, CDR2, and CDR3 domains that are at least 90% identical to the sequences set forth in SEQ ID NO:18, SEQ ID NO:19, and SEQ ID NO:20, respectively. In one embodiment, the anti-PD-1 antibody comprises a light chain comprising CDR1, CDR2, and CDR3 domains that are at least 85% identical to the sequences set forth in SEQ ID NO:18, SEQ ID NO:19, and SEQ ID NO:20, respectively. In one embodiment, the anti-PD-1 antibody comprises a light chain comprising CDR1, CDR2, and CDR3 domains that are at least 80% identical to the sequences set forth in SEQ ID NO:18, SEQ ID NO:19, and SEQ ID NO:20, respectively. and a light chain comprising a CDR3 domain. In another embodiment, the antibody competes for binding to PD-1 and / or binds to the same epitope on PD-1 as the above-mentioned antibodies.

[0268] In one embodiment, the anti-PD-1 antibody is an antibody disclosed in U.S. Pat. No. 8,354,509 or U.S. Patent Application Publication Nos. 2010 / 0266617A1, 2013 / 0108651A1, or 2013 / 0109843A2, the disclosures of which are specifically incorporated herein by reference.

[0269] In one embodiment, the anti-PD-1 antibody is pidilizumab, also known as CT-011 (CureTech Ltd.), and disclosed in U.S. Patent No. 8,686,119 B2, the disclosure of which is specifically incorporated herein by reference. The efficacy of pidilizumab in treating cancers, such as hematological malignancies, is described in Berger, Clin.Cancer Res.2008, 14, 3044-51. The pidilizumab monoclonal antibody comprises a heavy chain as given by SEQ ID NO:21 and a light chain as given by SEQ ID NO:22. Pidilizumab has intra-heavy chain disulfide bonds at 22--96, 144--200, 261--321, 367--425, 22''-96'', 144''-200'', 261''-321'', and 367''-425'', intra-light chain disulfide bonds at 23'-87'', 133'-193'', 23''''-87'''', and 133''''-193'''', heavy chain-light chain disulfide bonds at 220--213' and 220''-213'''', heavy chain-heavy chain disulfide bonds at 226-226'', 229-229'', and N-glycosylation sites (H CH284.4) at 297, 297''.

[0270] In one embodiment, the anti-PD-1 antibody is an immunoglobulin G1 kappa, anti-(human CD274) humanized monoclonal antibody. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains having the sequences set forth in SEQ ID NO:21 and SEQ ID NO:22, respectively, or an antigen-binding fragment, variant, or conjugate thereof. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains that are at least 99% identical to the sequences set forth in SEQ ID NO:21 and SEQ ID NO:22, respectively. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains that are at least 98% identical to the sequences set forth in SEQ ID NO:21 and SEQ ID NO:22, respectively. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains that are at least 97% identical to the sequences set forth in SEQ ID NO:21 and SEQ ID NO:22, respectively. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains that are at least 96% identical to the sequences set forth in SEQ ID NO:21 and SEQ ID NO:22, respectively. In one embodiment, the anti-PD-1 antibody comprises heavy and light chains that are at least 95% identical to the sequences set forth in SEQ ID NO:21 and SEQ ID NO:22, respectively.

[0271] In one embodiment, the anti-PD-L1 antibody has a V sequence that is at least 99% identical to the sequences set forth in SEQ ID NO:23 and SEQ ID NO:24, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 98% identical to the sequences set forth in SEQ ID NO:23 and SEQ ID NO:24, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 97% identical to the sequences set forth in SEQ ID NO:23 and SEQ ID NO:24, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 96% identical to the sequences set forth in SEQ ID NO:23 and SEQ ID NO:24, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 95% identical to the sequences set forth in SEQ ID NO:23 and SEQ ID NO:24, respectively. H and V L Includes the area.

[0272] In another embodiment, the anti-PD-1 antibodies and other PD-1 inhibitors include those described in U.S. Pat. No. 8,287,856, U.S. Pat. No. 8,287,856, the disclosures of which are specifically incorporated herein by reference. Nos. 5,580,247, and 8,168,757, and U.S. Patent Application Publication Nos. 2009 / 0028857A1, 2010 / 0285013A1, 2013 / 0022600A1, and 2011 / 0008369A1. In another embodiment, antibodies that compete with any of these antibodies for binding to PD-1 are included. In another embodiment, the anti-PD-1 antibody is an antibody disclosed in U.S. Patent No. 8,735,553 B1, the disclosure of which is specifically incorporated herein by reference.

[0273] In one embodiment, the anti-PD-1 antibody is a commercially available monoclonal antibody, such as anti-m-PD-1 clone J43 (catalog number BE0033-2) and RMP1-14 (catalog number BE0146) (Bio X Cell, Inc., West Lebanon, NH, USA). Several commercially available anti-PD-1 antibodies are known to those of skill in the art.

[0274] Monoclonal antibodies that inhibit or block PD-1 can be prepared by procedures known to those skilled in the art, such as by injecting a test subject with PD-1 antigen and then isolating hybridomas that express antibodies with the desired sequence or functional properties. DNA encoding the monoclonal antibodies is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that can specifically bind to genes encoding the heavy and light chains of the monoclonal antibody). Hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA can be placed into an expression vector and then transfected into host cells, such as E. coli cells, monkey COS cells, Chinese hamster ovary (CHO) cells, myeloma cells, or other suitable cells that do not otherwise produce immunoglobulin proteins, to obtain the synthesis of the monoclonal antibody in the recombinant host cells. Details of the recombinant production of specific antibodies can be found in the aforementioned references, the disclosures of which are incorporated herein by reference. Monoclonal antibodies that inhibit PD-1 can be prepared by standard molecular biology methods using the sequences provided herein by back-translating and inserting into an appropriate DNA or RNA vector.

[0275] The sequences of the anti-PD-1 antibodies discussed and referenced in the above embodiments are summarized in Table 1. [Table 2]

[0276] PD-1 inhibitors may also be small molecules or peptides, or peptide derivatives, such as those described in U.S. Pat. Nos. 8,907,053, 9,096,642, and 9,044,442, and U.S. Patent Application Publication No. 2015 / 0087581; 1,2,4 oxadiazole compounds and derivatives, such as those described in U.S. Patent Application Publication No. 2015 / 0073024; cyclic peptidomimetic compounds and derivatives, such as those described in U.S. Patent Application Publication No. 2015 / 0073042; cyclic compounds and derivatives, such as those described in U.S. Patent Application Publication No. 2015 / 0125491; 1,3,4 oxadiazole and 1,3,4 thiadiazole compounds and derivatives, such as those described in International Patent Application Publication No. WO2015 / 033301; peptide-based compounds. and derivatives, such as those described in International Patent Application Publication Nos. WO2015 / 036927 and WO2015 / 04490, or macrocyclic peptide-based compounds and derivatives, such as those described in U.S. Patent Application Publication No. 2014 / 0294898, the disclosures of each of which are incorporated herein by reference in their entireties.

[0277] In one embodiment, the PD-1 inhibitor is AUNP-12.

[0278] In one embodiment, the PD-1 inhibitor is [ka] and SEQ ID NOs: 37 to 38, in which the branched chain group is given by SEQ ID NO: 25; and a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0279] In one embodiment, the PD-1 inhibitor is nivolumab, pembrolizumab, pidilizumab In one embodiment, the PD-1 inhibitor is selected from the group consisting of , AMP-224, AMP-514, PDR001, and combinations thereof. In one embodiment, the PD-1 inhibitor is nivolumab. In one embodiment, the PD-1 inhibitor is pembrolizumab. In one embodiment, the PD-1 inhibitor is pidilizumab. In one embodiment, the PD-1 inhibitor is AMP-224.

[0280] PD-L1 and PD-L2 inhibitors The PD-L1 or PD-L2 inhibitor may be any PD-L1 or PD-L2 inhibitor or blocker known in the art. In particular, it is one of the PD-L1 or PD-L2 inhibitors or blockers described in more detail in the following paragraphs. The terms "inhibitor" and "blocker" are used interchangeably herein with respect to PD-L1 and PD-L2 inhibitors. For the avoidance of doubt, reference herein to a PD-L1 or PD-L2 inhibitor that is an antibody may refer to the compound or an antigen-binding fragment, variant, conjugate, or biosimilar thereof. For the avoidance of doubt, reference herein to a PD-L1 or PD-L2 inhibitor may refer to the compound or a pharma- ceutically acceptable salt, ester, solvate, hydrate, cocrystal, or prodrug thereof.

[0281] In some embodiments, the compositions and methods include a PD-L1 or PD-L2 inhibitor. In some embodiments, the PD-L1 or PD-L2 inhibitor is a small molecule. In some embodiments, the PD-L1 or PD-L2 inhibitor is an anti-PD-L1 or anti-PD-L2 antibody, a fragment thereof including a Fab fragment, or a single chain variable fragment (scFv). In one aspect of the invention, the anti-PD-1 antibody or fragment thereof in any of the preceding embodiments is replaced with or combined with an anti-PD-L1 or anti-PD-L2 antibody or fragment thereof. In one embodiment, the antibody competes for binding with PD-L1 and / or PD-L2 and / or binds to an epitope on PD-L1 and / or PD-L2. In some embodiments, the PD-L1 or PD-L2 inhibitor is a monoclonal antibody. In some embodiments, the PD-L1 or PD-L2 inhibitor is a polyclonal antibody. In some embodiments, a PD-L1 inhibitor is included in the composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, an anti-PD-L1 monoclonal antibody is included in the composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, a PD-L2 inhibitor is included in the composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, an anti-PD-L2 monoclonal antibody is included in the composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, a PD-L1 inhibitor is included in the composition or method and is further combined with a BTK inhibitor. In some embodiments, an anti-PD-L1 monoclonal antibody is included in the composition or method and is further combined with a BTK inhibitor. In some embodiments, a PD-L2 inhibitor is included in the composition or method and is further combined with a BTK inhibitor. In some embodiments, an anti-PD-L2 monoclonal antibody is included in the composition or method and is further combined with a BTK inhibitor, hi some embodiments, a PD-L1 inhibitor is included in the composition or method and is further combined with a PI3K inhibitor.In some embodiments, an anti-PD-L1 monoclonal antibody is included in a composition or method and is further combined with a PI3K inhibitor. In some embodiments, a PD-L2 inhibitor is included in a composition or method and is further combined with a PI3K inhibitor. In some embodiments, an anti-PD-L2 monoclonal antibody is included in a composition or method and is further combined with a PI3K inhibitor. In some embodiments, a PD-L1 inhibitor is included in a composition or method and is further combined with a JAK-2 inhibitor. In some embodiments, an anti-PD-L1 monoclonal antibody is included in a composition or method and is further combined with a JAK-2 inhibitor. In some embodiments, a PD-L2 inhibitor is included in a composition or method and is further combined with a JAK-2 inhibitor. In some embodiments, an anti-PD-L2 monoclonal antibody is included in a composition or method and is further combined with a JAK-2 inhibitor. In some embodiments, a PD-1 inhibitor and a PD-L1 inhibitor are both included in a composition or method and are further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, an anti-PD-1 monoclonal antibody and an anti-PD-L1 monoclonal antibody are both included in a composition or method and are further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, a PD-1 inhibitor and a PD-L2 inhibitor are both included in a composition or method and are further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, an anti-PD-1 monoclonal antibody and an anti-PD-L2 monoclonal antibody are both included in a composition or method and are further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, an anti-PD-1 monoclonal antibody and an anti-PD-L2 monoclonal antibody are both included in a composition or method and are further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor.

[0282] In some embodiments, the compositions described herein provide methods of using a combination of a PD-L1 and / or PD-L2 inhibitor and a BTK inhibitor, or a combination of a PD-L1 and / or PD-L2 inhibitor and a BTK inhibitor. In some embodiments, the PD-L1 inhibitors provided herein are selective for PD-L1 in that the compounds bind to or interact with PD-L1 at substantially lower concentrations than they bind to or interact with other receptors, including the PD-L2 receptor. In certain embodiments, the compounds bind to the PD-L2 receptor with a binding constant that is at least about 2-fold higher, about 3-fold higher, about 5-fold higher, about 10-fold higher, about 20-fold higher, about 30-fold higher, about 50-fold higher, about 100-fold higher, about 200-fold higher, about 300-fold higher, or about 500-fold higher than to the PD-L1 receptor.

[0283] Without being bound by any theory, it is believed that tumor cells express PD-L1 and T cells express PD-1. However, PD-L1 expression by tumor cells is not required for the effectiveness of PD-1 or PD-L1 inhibitors or blockers. In one embodiment, tumor cells express PD-L1. In another embodiment, tumor cells do not express PD-L1. In some embodiments, the methods and compositions described herein include a combination of PD-1 and PD-L1 antibodies, such as those described herein, in combination with a BTK inhibitor. The administration of the combination of PD-1 and PD-L1 antibodies and the BTK inhibitor may be simultaneous or sequential.

[0284] In some embodiments, the compositions and methods described bind human PD-L1 and / or PD-L2 to a K of about 100 pM or less. D or binds human PD-L1 and / or PD-L2 with a K of approximately 90 pM or less D or bind human PD-L1 and / or PD-L2 with a K of approximately 80 pM or less D or binds human PD-L1 and / or PD-L2 with a K of approximately 70 pM or less D or binds human PD-L1 and / or PD-L2 with a K of approximately 60 pM or lessD binds at a K of approximately 50 pM or less D or binds human PD-L1 and / or PD-L2 with a K of approximately 40 pM or less D or binds human PD-L1 and / or PD-L2 with a K of approximately 30 pM or less D These include PD-L1 and / or PD-L2 inhibitors that bind to

[0285] In some embodiments, the compositions and methods described deliver about 7.5×10 5 k over l / M s assoc or binds to human PD-L1 and / or PD-L2 at approximately 8 × 10 5 k over l / M s assoc or binds to human PD-L1 and / or PD-L2 at approximately 8.5 × 10 5 k over l / M s assoc or binds to human PD-L1 and / or PD-L2 at approximately 9 × 10 5 k over l / M s assoc or binds to human PD-L1 and / or PD-L2 at approximately 9.5 × 10 5 k over l / M s assoc or human PD-L1 and / or or PD-L2, approximately 1 × 10 6 k over l / M s assoc These include PD-L1 and / or PD-L2 inhibitors that bind to

[0286] In some embodiments, the compositions and methods described deliver about 2×10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.1 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.2 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.3 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.4 × 10 -5 k below l / sdissoc or binds to human PD-1 at approximately 2.5 × 10 -5 k below l / s dissoc or binds to human PD-1 at approximately 2.6 × 10 -5 k below l / s dissoc or binds to human PD-L1 or PD-L2 at approximately 2.7 × 10 -5 k below l / s dissoc or binds to human PD-L1 or PD-L2 at approximately 3 × 10 -5 k below l / s dissoc These include PD-L1 and / or PD-L2 inhibitors that bind to

[0287] In some embodiments, the compositions and methods described enhance binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of about 10 nM or less. 50 or block or inhibit binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 9 nM or less 50 or block or inhibit the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 8 nM or less 50 or block or inhibit the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 7 nM or less 50 or block or inhibit binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 6 nM or less 50 or block or inhibit the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 5 nM or less 50 or block or inhibit the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 4 nM or less 50 or block or inhibit binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 3 nM or less 50 or block or inhibit the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of approximately 2 nM or less 50 or block or inhibit the binding of human PD-1 or human PD-L1 or human PD-L2 to human PD-1 with an IC of about 1 nM or less. 50These include PD-L1 and / or PD-L2 inhibitors that block

[0288] In one embodiment, the anti-PD-L1 antibody is durvalumab, or an antigen-binding fragment, conjugate, or variant thereof, which is also known as MEDI4736 and manufactured by Medimmune, LLC, Gaithersburg, Maryland, a subsidiary of AstraZeneca plc. In one embodiment, the anti-PD-L1 antibody is an antibody disclosed in U.S. Patent No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference. The clinical safety of durvalumab (MEDI4736, SEQ ID NO:39 and SEQ ID NO:40) is described in Page, Ann. Rev. Med., 2014, 65, 185-202; Brahmer, J. Clin. Oncol. 2014, 32, 5s (supplement, abstract 8021); and McDermott, Cancer Treatment Rev., 2014, 40, 1056-64. The durvalumab (MEDI4736) monoclonal antibody has a V-like domain as given by SEQ ID NO:41. H region (corresponding to SEQ ID NO: 72 in U.S. Pat. No. 8,779,108) and the V L The durvalumab monoclonal antibody comprises disulfide bonds at 22-96, 22''-96'', 23'-89', 23'''-89''', 135'-195', 135''-195''', 148-204, 148''-204'', 215'-224, 215'''-224'', 230-230'', 233-233'', 265-325, 265''-325'', 371-429, and 371''-429', and a disulfide bond at Asn It contains N-glycosylation sites at Asn-301 and Asn-301''.

[0289] In one embodiment, the anti-PD-L1 antibody is a disulfide dimer having Immunoglobulin G1, anti-(human CD antigen CD274) (human monoclonal heavy chain), and human monoclonal kappa chain. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains of durvalumab (MEDI4736). In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains having the sequences set forth in SEQ ID NO:39 and SEQ ID NO:40, respectively, or antigen-binding fragments, variants, or conjugates thereof. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 99% identical to the sequences set forth in SEQ ID NO:39 and SEQ ID NO:40, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 98% identical to the sequences set forth in SEQ ID NO:39 and SEQ ID NO:40, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 97% identical to the sequences set forth in SEQ ID NO:39 and SEQ ID NO:40, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 96% identical to the sequences set forth in SEQ ID NO: 39 and SEQ ID NO: 40, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 95% identical to the sequences set forth in SEQ ID NO: 39 and SEQ ID NO: 40, respectively.

[0290] In one embodiment, the anti-PD-L1 antibody has the sequence set forth in SEQ ID NO:41 (corresponding to SEQ ID NO:72 in U.S. Pat. No. 8,779,108) and SEQ ID NO:42 (corresponding to SEQ ID NO:77 in U.S. Pat. No. 8,779,108), respectively, as described in U.S. Pat. No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V domain that is at least 99% identical to the sequences set forth in SEQ ID NO: 41 and SEQ ID NO: 42, including antigen-binding fragments, conjugates, and variants thereof. H and V LIn one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 98% identical to the sequences set forth in SEQ ID NO: 41 and SEQ ID NO: 42, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 97% identical to the sequences set forth in SEQ ID NO:41 and SEQ ID NO:42, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 96% identical to the sequences set forth in SEQ ID NO: 41 and SEQ ID NO: 42, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 95% identical to the sequences set forth in SEQ ID NO: 41 and SEQ ID NO: 42, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 90% identical to the sequences set forth in SEQ ID NO:41 and SEQ ID NO:42, respectively. H and V L Includes the area.

[0291] In another embodiment, the anti-PD-L1 antibody has the amino acid sequence of SEQ ID NO:43 (corresponding to SEQ ID NO:23 in U.S. Pat. No. 8,779,108), or conservative amino acid substitutions thereof, as described in U.S. Pat. No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference. H CDR1, an amino acid sequence of SEQ ID NO:44 (corresponding to SEQ ID NO:24 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof H CDR2, an amino acid sequence of SEQ ID NO:45 (corresponding to SEQ ID NO:25 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof H CDR3, an amino acid sequence of SEQ ID NO:46 (corresponding to SEQ ID NO:28 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof LCDR1, an amino acid sequence of SEQ ID NO:47 (corresponding to SEQ ID NO:29 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L CDR2, an amino acid sequence of SEQ ID NO:48 (corresponding to SEQ ID NO:30 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L It contains an amino acid sequence including CDR3.

[0292] In another embodiment, the anti-PD-L1 antibody has the amino acid sequence of SEQ ID NO:49 (corresponding to SEQ ID NO:3 in U.S. Pat. No. 8,779,108), or conservative amino acid substitutions thereof, as described in U.S. Pat. No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559A1, the disclosures of which are specifically incorporated herein by reference. H CDR1, an amino acid sequence of SEQ ID NO:50 (corresponding to SEQ ID NO:4 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof H CDR2, an amino acid sequence of SEQ ID NO:51 (corresponding to SEQ ID NO:5 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof H CDR3, an amino acid sequence of SEQ ID NO:52 (corresponding to SEQ ID NO:8 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L CDR1, an amino acid sequence of SEQ ID NO:53 (corresponding to SEQ ID NO:9 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L CDR2, an amino acid sequence of SEQ ID NO:54 (corresponding to SEQ ID NO:10 of U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L It contains an amino acid sequence including CDR3.

[0293] In another embodiment, the anti-PD-L1 antibody has the amino acid sequence of SEQ ID NO:55 (corresponding to SEQ ID NO:13 in U.S. Pat. No. 8,779,108), or conservative amino acid substitutions thereof, as described in U.S. Pat. No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference.H CDR1, an amino acid sequence of SEQ ID NO:56 (corresponding to SEQ ID NO:14 of U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof H CDR2, an amino acid sequence of SEQ ID NO:57 (corresponding to SEQ ID NO:15 of U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof H CDR3, an amino acid sequence of SEQ ID NO:58 (corresponding to SEQ ID NO:18 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L CDR1, an amino acid sequence of SEQ ID NO:59 (corresponding to SEQ ID NO:19 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L CDR2, an amino acid sequence of SEQ ID NO:60 (corresponding to SEQ ID NO:20 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L It contains an amino acid sequence including CDR3.

[0294] In another embodiment, the anti-PD-L1 antibody has the amino acid sequence of SEQ ID NO:61 (corresponding to SEQ ID NO:63 in U.S. Pat. No. 8,779,108), or conservative amino acid substitutions thereof, as described in U.S. Pat. No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference. H CDR1, an amino acid sequence of SEQ ID NO:62 (corresponding to SEQ ID NO:64 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof H CDR2, an amino acid sequence of SEQ ID NO:63 (corresponding to SEQ ID NO:65 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof H CDR3, an amino acid sequence of SEQ ID NO:64 (corresponding to SEQ ID NO:68 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L CDR1, an amino acid sequence of SEQ ID NO:65 (corresponding to SEQ ID NO:69 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof LCDR2, an amino acid sequence of SEQ ID NO:66 (corresponding to SEQ ID NO:70 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L It contains an amino acid sequence including CDR3.

[0295] In another embodiment, the anti-PD-L1 antibody has the amino acid sequence of SEQ ID NO:67 (corresponding to SEQ ID NO:73 in U.S. Pat. No. 8,779,108), or conservative amino acid substitutions thereof, as described in U.S. Pat. No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference. H CDR1, SEQ ID NO: 68 (corresponding to SEQ ID NO: 74 in U.S. Pat. No. 8,779,108) ) or a V having a conservative amino acid substitution thereof H CDR2, an amino acid sequence of SEQ ID NO:69 (corresponding to SEQ ID NO:75 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof H CDR3, an amino acid sequence of SEQ ID NO: 70 (corresponding to SEQ ID NO: 78 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L CDR1, an amino acid sequence of SEQ ID NO: 71 (corresponding to SEQ ID NO: 79 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L CDR2, an amino acid sequence of SEQ ID NO: 72 (corresponding to SEQ ID NO: 80 in U.S. Pat. No. 8,779,108), or a V having a conservative amino acid substitution thereof L It contains an amino acid sequence including CDR3.

[0296] In one embodiment, the anti-PD-L1 antibody is atezolizumab, also known as MPDL3280A or RG7446, manufactured by Genentech, Inc., a subsidiary of Roche, or an antigen-binding fragment, conjugate, or variant thereof. In one embodiment, the anti-PD-L1 antibody is an antibody disclosed in U.S. Patent No. 8,217,149, the disclosures of which are specifically incorporated herein by reference. In one embodiment, the anti-PD-L1 antibody is an antibody disclosed in U.S. Patent Application Publication Nos. 2010 / 0203056A1, 2013 / 0045200A1, 2013 / 0045201A1, 2013 / 0045202A1, or 2014 / 0065135A1, the disclosures of which are specifically incorporated herein by reference. The atezolizumab monoclonal antibody comprises a heavy chain given by SEQ ID NO:73 and a light chain given by SEQ ID NO:74.

[0297] In one embodiment, the anti-PD-L1 antibody is an Immunoglobulin G1 kappa, anti-(human PD-L1) humanized monoclonal antibody. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains of atezolizumab (MPDL3280A). In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains having the sequences set forth in SEQ ID NO:73 and SEQ ID NO:74, respectively, or antigen-binding fragments, variants, or conjugates thereof. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 99% identical to the sequences set forth in SEQ ID NO:73 and SEQ ID NO:74, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 98% identical to the sequences set forth in SEQ ID NO:73 and SEQ ID NO:74, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 97% identical to the sequences set forth in SEQ ID NO:73 and SEQ ID NO:74, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 96% identical to the sequences set forth in SEQ ID NO: 73 and SEQ ID NO: 74, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 95% identical to the sequences set forth in SEQ ID NO: 73 and SEQ ID NO: 74, respectively.

[0298] In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chain CDRs or VRs of atezolizumab (MPDL3280A). H The region comprises the sequence set forth in SEQ ID NO:75 (corresponding to SEQ ID NO:20 in U.S. Patent No. 8,217,149), and is L The region comprises the sequence set forth in SEQ ID NO:76 (corresponding to SEQ ID NO:21 in U.S. Patent No. 8,217,149). In one embodiment, the anti-PD-L1 antibody comprises a V PD-L1 antibody that is at least 99% identical to the sequences set forth in SEQ ID NO:75 and SEQ ID NO:76, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 98% identical to the sequences set forth in SEQ ID NO: 75 and SEQ ID NO: 76, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 97% identical to the sequences set forth in SEQ ID NO: 75 and SEQ ID NO: 76, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 96% identical to the sequences set forth in SEQ ID NO: 75 and SEQ ID NO: 76, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a region having at least the sequence set forth in SEQ ID NO: 75 and SEQ ID NO: 76, respectively. V is 95% identical to H and V L Includes the area.

[0299] In one embodiment, the anti-PD-L1 antibody is avelumab, also known as MSB0010718C, manufactured by Merck KGaA / EMD Serono, or an antigen-binding fragment, conjugate, or variant thereof. In one embodiment, the anti-PD-L1 antibody is an antibody disclosed in US Patent Application Publication No. 2014 / 0341917A1, the disclosure of which is specifically incorporated herein by reference. The avelumab monoclonal antibody comprises a heavy chain of SEQ ID NO:83 and a light chain of SEQ ID NO:84.

[0300] In one embodiment, the anti-PD-L1 antibody is Immunoglobulin G1 lambda-1, an anti-(human PD-L1) human monoclonal antibody. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains of avelumab (MSB0010718C). In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains having the sequences set forth in SEQ ID NO:83 and SEQ ID NO:84, respectively, or an antigen-binding fragment, variant, or conjugate thereof. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 99% identical to the sequences set forth in SEQ ID NO:83 and SEQ ID NO:84, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 98% identical to the sequences set forth in SEQ ID NO:83 and SEQ ID NO:84, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 97% identical to the sequences set forth in SEQ ID NO:83 and SEQ ID NO:84, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 96% identical to the sequences set forth in SEQ ID NO: 83 and SEQ ID NO: 84, respectively. In one embodiment, the anti-PD-L1 antibody comprises heavy and light chains that are at least 95% identical to the sequences set forth in SEQ ID NO: 83 and SEQ ID NO: 84, respectively.

[0301] In one embodiment, the V of the anti-PD-L1 antibody H The region comprises the sequence given in SEQ ID NO:85 (corresponding to SEQ ID NO:24 in U.S. Patent Application Publication No. 2014 / 0341917), and L The region comprises the sequence given in SEQ ID NO:86 (corresponding to SEQ ID NO:25 in US Patent Application Publication No. 2014 / 0341917). In one embodiment, the anti-PD-L1 antibody comprises a V sequence at least 99% identical to the sequences set forth in SEQ ID NO:85 and SEQ ID NO:86, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 98% identical to the sequences set forth in SEQ ID NO: 85 and SEQ ID NO: 86, respectively. H and V LIn one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 97% identical to the sequences set forth in SEQ ID NO: 85 and SEQ ID NO: 86, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 96% identical to the sequences set forth in SEQ ID NO: 85 and SEQ ID NO: 86, respectively. H and V L In one embodiment, the anti-PD-L1 antibody comprises a V region that is at least 95% identical to the sequences set forth in SEQ ID NO: 85 and SEQ ID NO: 86, respectively. H and V L Includes the area.

[0302] In one embodiment, the anti-PD-L1 antibody comprises a heavy chain variable region (VH1, HVR-H2, and HVR-H3) comprising the sequences HVR-H1, HVR-H2, and HVR-H3. H ) polypeptide, wherein the HVR-H1 sequence is given by SEQ ID NO: 87 (corresponding to SEQ ID NO: 15 in US Patent Application Publication No. 2014 / 0341917) or a conservative amino acid substitution thereof, the HVR-H2 sequence is given by SEQ ID NO: 88 (corresponding to SEQ ID NO: 16 in US Patent Application Publication No. 2014 / 0341917) or a conservative amino acid substitution thereof, and the HVR-H3 sequence is given by SEQ ID NO: 89 (corresponding to SEQ ID NO: 17 in US Patent Application Publication No. 2014 / 0341917) or a conservative amino acid substitution thereof. The anti-PD-L1 antibody also comprises a light chain variable region (VL) comprising HVR-L1, HVR-L2 and HVR-L3 sequences. L ) polypeptide, wherein the HVR-L1 sequence is given by SEQ ID NO: 90 (corresponding to SEQ ID NO: 18 of US Patent Application Publication No. 2014 / 0341917) or a conservative amino acid substitution thereof, and the HVR-L2 sequence is given by SEQ ID NO: 91 (corresponding to SEQ ID NO: 19 of US Patent Application Publication No. 2014 / 0341917) or and the HVR-L3 sequence is given by SEQ ID NO:92 (corresponding to SEQ ID NO:20 of US Patent Application Publication No. 2014 / 0341917) or conservative amino acid substitutions thereof.

[0303] In one embodiment, the anti-PD-L1 antibody is MDX-1105, also known as BMS-935559, and is disclosed in U.S. Patent No. 7,943,743, the disclosure of which is specifically incorporated herein by reference. In one embodiment, the anti-PD-L1 antibody is selected from the anti-PD-L1 antibodies disclosed in U.S. Patent No. 7,943,743, the disclosure of which is specifically incorporated herein by reference.

[0304] In one embodiment, the anti-PD-L1 antibody is a commercially available monoclonal antibody, such as INVIVOMAB anti-m-PD-L1 clone 10F.9G2 (BioXCell). Several commercially available anti-PD-L1 antibodies are known to those of skill in the art.

[0305] In one embodiment, the anti-PD-L2 antibody is a commercially available monoclonal antibody, such as BIOLEGEND 24F.10C12 mouse IgG2a, kappa isotype (Biolegend), anti-PD-L2 antibody (Sigma-Aldrich), or other commercially available anti-PD-L2 antibodies known to one of skill in the art.

[0306] Monoclonal antibodies that inhibit PD-L1 and / or PD-L2 can be prepared by procedures known to those of skill in the art, such as by injecting a test subject with PD-L1 or PD-L2 antigen and then isolating hybridomas expressing antibodies with the desired sequence or functional characteristics. DNA encoding the monoclonal antibodies is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes capable of specifically binding to genes encoding the heavy and light chains of the monoclonal antibody). Hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA can be placed into an expression vector and then transfected into host cells, such as E. coli cells, monkey COS cells, Chinese hamster ovary (CHO) cells, myeloma cells, or other suitable cells that do not otherwise produce immunoglobulin proteins, to obtain the synthesis of the monoclonal antibody in the recombinant host cells. Details of the recombinant production of particular antibodies can be found in the aforementioned references, the disclosures of which are incorporated herein by reference. Monoclonal antibodies that inhibit PD-1 can be prepared by standard molecular biology methods using the sequences provided herein by back-translating and inserting into an appropriate DNA or RNA vector.

[0307] The sequences of the anti-PD-L1 antibodies referenced in the above embodiments are summarized in Table 2. [Table 3-1] [Table 3-2]

[0308] In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and combinations thereof. In one embodiment, the PD-L1 inhibitor is durvalumab (MEDI4736). In one embodiment, the anti-PD-L1 inhibitor is BMS-936559 (also known as MDX-1105-01). In one embodiment, the PD-L1 inhibitor is atezolizumab. In one embodiment, the PD-L1 inhibitor is avelumab.

[0309] In one embodiment, the PD-L2 inhibitor is an anti-PD-L2 antibody. In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A.

[0310] Interferon (IFN) IFNs induce cellular resistance to viral infection and play a key role in host defense mechanisms and homeostasis. They function as potent mediators of immune responses and were initially identified for their ability to regulate both innate and adaptive immune responses. IFNs are small, inducible 20-25K, glycosylated proteins that are typically produced by vertebrate cells in response to a variety of biological stimuli. Mechanistically, IFNs mediate their biological activity by binding to receptors present on the surface of target cells. Specific ligand-receptor interactions trigger downstream intracellular signaling cascades, resulting in the synthesis of proteins that mediate pleiotropic activities. IFNs are classified into three groups, type I, type II, or type III, based on their structure, physicochemical properties, and biological activity. In mammals, eight families of type I IFNs have been described. These include IFN-α, IFN-β, IFN-δ, IFN-ε, IFN-κ, IFN-ω, and IFN-tau (IFN-τ). In one embodiment, the IFN of the present invention is interferon alpha or alpha interferon (IFN-α). In one embodiment, the IFN of the present invention is glycosylated. In one embodiment, the IFN of the present invention is PEGylated.

[0311] In some embodiments, the interferon is administered at a dose selected from the group consisting of about 1 million international units (MU) to about 800 MU, about 1 MU to about 10 MU, about 20 MU to about 40 MU, about 2 MU to about 15 MU, about 5 MU to about 25 MU, about 50 MU to about 100 MU, about 150 MU to about 250 MU, about 300 MU to about 400 MU, and about 500 MU to about 600 MU.

[0312] In some embodiments, the interferon is administered at a dose selected from the group consisting of about 0.1 μg / day to about 1 mg / day, about 10 μg / day to about 200 μg / day, about 20 μg / day to about 150 μg / day, about 0.1 μg / day to about 125 μg / day, about 1 μg / day to about 20 μg / day, and about 4.5 μg / day to about 30 μg / day.

[0313] In some embodiments, the interferon is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 MU / m 2 The therapeutic agent is administered at a dose selected from the group consisting of:

[0314] In some embodiments, the interferon is PEGylated.

[0315] In some embodiments, the interferon is glycosylated.

[0316] rIFN-alpha 2b In one embodiment, the IFN is recombinant interferon alpha-2b (rIFN-α2b). In one embodiment, the IFN is recombinant interferon alpha-2b with the trade name Intron A from Merck Sharp & Dohme Limited. rIFN-alpha2b is a type I interferon consisting of 165 amino acid residues with arginine at position 23. This protein is produced by recombinant DNA technology and is similar to interferon secreted by leukocytes. In one embodiment, the IFN is an interferon having the sequence shown in SEQ ID NO: 93, or a fragment, variant, conjugate or biosimilar thereof.

[0317] PEGylated rIFN-alpha 2b In one embodiment, the IFN is PEGylated rIFN-alpha 2b. In one embodiment, the IFN is PEGylated rIFN-alpha 2b, which has the trade name PEG-Intron, manufactured by Merck Sharp & Dohme Limited. PEGylated rIFN-alpha 2b is derived from the alpha-2b portion of recombinant human interferon. It binds to and activates the human type 1 interferon receptor, causing it to dimerize.

[0318] rIFN-alpha 2a In one embodiment, the IFN is recombinant interferon alpha-2a (rIFN-α2a). In one embodiment, the IFN is recombinant interferon alpha-2a with the trade name Roferon-A from Hoffmann La Roche. rIFN-alpha2ab is a type I interferon with 165 amino acid residues, with a lysine at position 23. This protein is produced by recombinant DNA technology and is similar to interferon secreted by leukocytes. In one embodiment, the IFN is an interferon with the sequence shown in SEQ ID NO: 94, or a fragment, variant, conjugate or biosimilar thereof.

[0319] PEGylated rIFN-alpha 2a In one embodiment, the IFN is PEGylated rIFN-alpha 2a. In one embodiment, the IFN is PEGylated rIFN-alpha 2a, which has the trade name Pegasys from Hoffmann La Roche. PEGylated rIFN-alpha 2a is derived from the alpha-2a portion of recombinant human interferon. It binds to and activates the human type 1 interferon receptor to dimerize.

[0320] Interferon alfa In one embodiment, the IFN is interferon alpha, also called natural alpha interferon. Interferon alpha contains several naturally occurring IFN-α subtypes and is purified by affinity chromatography. Interferon alpha protein is mainly involved in the innate immune response to viral infections. There are 13 subtypes called IFN-α1, IFN-α2, IFN-α4, IFN-α5, IFN-α6, IFN-α7, IFN-α8, IFN-α10, IFN-α13, IFN-α14, IFN-α16, IFN-α17, IFN-α21. In one embodiment, the IFN is interferon alpha under the trade name Multiferon manufactured by Swedish Orphan Biovitrim. Multiferon consists of six major subtypes: IFN-α1, IFN-α2, IFN-α8, IFN-α10, IFN-α14 and IFN-α21. Of these, IFN-α2 and IFN-α14 are glycosylated. In one embodiment, the IFN is an interferon alpha selected from the group consisting of IFN-α1, IFN-α2, IFN-α4, IFN-α5, IFN-α6, IFN-α7, IFN-α8, IFN-α10, IFN-α13, IFN-α14, IFN-α16, IFN-α17, IFN-α21, and combinations thereof. In one embodiment, the IFN is an interferon alpha selected from the group consisting of IFN-α1, IFN-α2, IFN-α8, IFN-α10, IFN-α14, IFN-α21, and combinations thereof. In one embodiment, the IFN is IFN-α1. In one embodiment, the IFN is an interferon having the sequence set forth in SEQ ID NO: 95, or a fragment, variant, conjugate, or biosimilar thereof.

[0321] In one embodiment, the IFN is IFN-α2. In one embodiment, the IFN is an interferon having the sequence set forth in SEQ ID NO: 96, or a fragment, variant, conjugate or biosimilar thereof.

[0322] In one embodiment, the IFN is IFN-α8. In one embodiment, the IFN is an interferon having the sequence set forth in SEQ ID NO: 97, or a fragment, variant, conjugate or biosimilar thereof.

[0323] In one embodiment, the IFN is IFN-α10. In one embodiment, the IFN is No. 98, or a fragment, variant, conjugate or biosimilar thereof.

[0324] In one embodiment, the IFN is IFN-α 14. In one embodiment, the IFN is an interferon having the sequence set forth in SEQ ID NO: 99, or a fragment, variant, conjugate or biosimilar thereof.

[0325] In one embodiment, the IFN is IFN-α21. In one embodiment, the IFN is an interferon having the sequence set forth in SEQ ID NO: 100, or a fragment, variant, conjugate or biosimilar thereof.

[0326] Interferon alfacon-1 In one embodiment, the IFN is interferon alfacon-1. Interferon alfacon-1 is a recombinant, non-naturally occurring type I interferon. The 166 amino acid sequence of interferon alfacon-1 was derived by scanning the sequences of several natural interferon alpha subtypes and assigning the most frequently observed amino acid at each corresponding position. Four additional amino acid changes were made to facilitate molecular construction, and the corresponding synthetic DNA sequence was constructed using chemical synthesis methods. Interferon alfacon-1 differs from interferon alfa-2b at 20 / 166 amino acids (88% homology), and comparison with interferon-beta shows identity at more than 30% of the amino acid positions. In one embodiment, the IFN is interferon alfacon-1 under the trade name Infergen, manufactured by Three Rivers Pharmaceuticals LLC. In one embodiment, the IFN is an interferon having the sequence shown in SEQ ID NO: 101, or a fragment, variant, conjugate, or biosimilar thereof.

[0327] Interferon alfa-n1 In one embodiment, the IFN is interferon alpha-n1, also called interferon alpha-2 or interferon alpha-A. Interferon alpha-n1 is a purified native (n is native) glycosylated human interferon alpha protein having 166 residues. In one embodiment, the IFN is interferon alpha-n1 under the trade name Wellferon from The Wellcome Foundation Ltd. In one embodiment, the IFN is an interferon having the sequence shown in SEQ ID NO: 102, or a fragment, variant, conjugate or biosimilar thereof.

[0328] Interferon alpha-n3 In one embodiment, the IFN is interferon alpha-n3. Interferon alpha-n3 is a purified native (n is native) human interferon alpha protein having 166 residues (consisting of three forms or polymorphs including interferon alpha-2a, 2b and 2c, shown in SEQ ID NOs: 103-106, respectively), which is partially glycosylated. In one embodiment, the IFN is Hemispherx Interferon alpha-n3 under the trade name Alferon manufactured by Biopharma. In one embodiment, the IFN is an interferon having the sequence set forth in SEQ ID NO: 103, or a fragment, variant, conjugate or biosimilar thereof. In one embodiment, the IFN is an interferon having the sequence set forth in SEQ ID NO: 104, or a fragment, variant, conjugate or biosimilar thereof. In one embodiment, the IFN is an interferon having the sequence set forth in SEQ ID NO: 105, or a fragment, variant, conjugate or biosimilar thereof. In one embodiment, the IFN is an interferon having the sequence set forth in SEQ ID NO: 106, or a fragment thereof. , variants, conjugates or biosimilars.

[0329] AlbInterferon Alfa-2b In one embodiment, the IFN is albinterferon alpha-2b, also called albumin-interferon alpha or alb-IFN. Albumin-interferon alpha (Albuferon) is a novel long-acting form of interferon alpha. In one embodiment, the IFN is albinterferon alpha-2b under the trade name Albuferon manufactured by Human Genome Sciences.

[0330] IFN alpha-2b XL In one embodiment, the IFN is IFN alpha-2b XL, referred to as interferon alpha-2b controlled release, manufactured by Avadel Pharmaceuticals.

[0331] BLX-883 In one embodiment, the IFN is BLX-883, also known as Locteron. BLX-883 is a form of alpha interferon made by Biolex Therapeutics and is in clinical trials (NCT00863239, NCT00953589, and NCT00593151).

[0332] AVI-005 In one embodiment, the IFN is AVI-005. AVI-005 is a form of glycosylated interferon alpha-2b manufactured by AviGenics Inc.

[0333] Bellerophon In one embodiment, the IFN is Bellerophon, a form of long-acting human interferon alpha manufactured by Nautilus Biotech.

[0334] Cepeginterferon alfa-2b In one embodiment, the IFN is cepegylated interferon alpha-2b, a long-acting PEGylated interferon alpha 2b developed by Biocad and in clinical trials (NCT01889433).

[0335] PI3K inhibitors The PI3K inhibitor may be any PI3K inhibitor known in the art. In particular, it is one of the PI3K inhibitors described in more detail in the following paragraphs. Preferably, the PI3K inhibitor is a PI3K inhibitor selected from the group consisting of PI3K-gamma inhibitor, PI3K-delta inhibitor, and PI3K-gamma, delta inhibitor. In a particular embodiment, the PI3K inhibitor is a PI3K-delta inhibitor. For the avoidance of doubt, in this specification, reference to a PI3K inhibitor may refer to the compound or its pharma- ceutically acceptable salt, ester, solvate, hydrate, cocrystal, or prodrug.

[0336] In one embodiment, the PI3K inhibitor, preferably selected from the group consisting of a PI3K-gamma inhibitor, a PI3K-delta inhibitor, and a PI3K-gamma, delta inhibitor, is a compound selected from the structures disclosed in U.S. Pat. Nos. 8,193,182 and 8,569,323, and U.S. Patent Application Publication Nos. 2012 / 0184568, 2013 / 0344061, and 2013 / 0267521, the disclosures of which are incorporated herein by reference.

[0337] In one embodiment, the PI3K-gamma, delta inhibitor is a compound of formula (III-A) [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug thereof. Formula (III-A) is also known as IPI-145 or duvelisib (Infinity Pharmaceuticals) and has been studied in clinical trials at doses of 5 mg and 25 mg, including those described in Flinn, Blood, 2014, 124, 802, and O'Brien, Blood, 2014, 124, 3334.

[0338] In one embodiment, the PI3K inhibitor is a compound of formula (IV) [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0339] In a preferred embodiment, the PI3K inhibitor is (S)-3-(1-((9H-purin-6-yl)amino)ethyl)-8-chloro-2-phenylisoquinolin-1(2H)-one or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0340] In one embodiment, the PI3K inhibitor is (S)-3-amino-N-(1-(5-chloro-4-oxo-3-phenyl-3,4-dihydroquinazolin-2-yl)ethyl)pyrazine-2-carboxamide or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0341] In one embodiment, the PI3K inhibitor (which may be a PI3K-gamma inhibitor, a PI3K-delta inhibitor, or a PI3K-gamma, delta inhibitor) is a compound selected from the structures disclosed in U.S. Pat. Nos. 8,193,199, 8,586,739, and 8,901,135, the disclosures of which are incorporated herein by reference.

[0342] In one embodiment, the PI3K-δ inhibitor is a compound of formula (IX) [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0343] In one embodiment, the PI3K inhibitor or PI3K-δ inhibitor is (S)—N-(1-(7-fluoro-2-(pyridin-2-yl)quinolin-3-yl)ethyl)-9H-purin-6-amine or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0344] In one embodiment, the PI3K-δ inhibitor is a compound of formula (X) [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0345] In one embodiment, the PI3K inhibitor or PI3K-δ inhibitor is (S)—N-(1-(6-fluoro-3-(pyridin-2-yl)quinoxalin-2-yl)ethyl)-9H-purin-6-amine or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0346] In one embodiment, the PI3K-δ inhibitor is a compound of formula (XI) [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0347] In one embodiment, the PI3K-δ inhibitor is (S)—N-(1-(2-(3,5-difluorophenyl)-8-fluoroquinolin-3-yl)ethyl)-9H-purin-6-amine or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0348] In one embodiment, the PI3K-δ inhibitor is a compound of formula (XII) [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0349] In one embodiment, the PI3K-δ inhibitor is (S)-3-(1-((9H-purin-6-yl)amino)ethyl)-2-(pyridin-2-yl)quinoline-8-carbonitrile or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0350] In one embodiment, the PI3K-δ inhibitor is a compound of formula (XIII) [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0351] In one embodiment, the PI3K-δ inhibitor is (S)—N-(1-(5,7-difluoro-2-(pyridin-2-yl)quinolin-3-yl)ethyl)-9H-purin-6-amine or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0352] In one embodiment, the PI3K inhibitor (which may be a PI3K-gamma inhibitor, a PI3K-delta inhibitor, or a PI3K-gamma, delta inhibitor) is idelalisib. In one embodiment, the PI3K inhibitor (which may be a PI3K-gamma inhibitor, a PI3K-delta inhibitor, or a PI3K-gamma, delta inhibitor) is a compound of formula (XVI): [ka] or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0353] In one embodiment, the PI3K inhibitor (which may be a PI3K-gamma inhibitor, a PI3K-delta inhibitor, or a PI3K-gamma, delta inhibitor) is (S)-2-(1-((9H-purin-6-yl)amino)propyl)-5-fluoro-3-phenylquinazolin-4(3H)-one or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0354] In one embodiment, the PI3K inhibitor (which may be a PI3K-gamma inhibitor, a PI3K-delta inhibitor, or a PI3K-gamma, delta inhibitor) is 4(3H)-quinazolinone, 5-fluoro-3-phenyl-2-[(1S)-1-(9H-purin-6-ylamino)propyl]-5-fluoro-3-phenyl-2-{(1S)-1-[(7H-purin-6-yl)amino]propyl}quinazolin-4(3H)-one, or a pharma- ceutically acceptable salt, solvate, hydrate, co-crystal, or prodrug thereof.

[0355] Other suitable PI3K inhibitors for use in the above-described combinations with BTK inhibitors include, but are not limited to, those described in, for example, U.S. Pat. No. 8,193,182 and U.S. Published Application Nos. 2013 / 0267521, 2013 / 0053362, 2013 / 0029984, 2013 / 0029982, 2012 / 0184568, and 2012 / 0059000, the disclosures of which are each incorporated by reference in their entireties.

[0356] Buparishiv In one embodiment, the PI3K inhibitor is buparisib, which has the chemical structure and name shown below: 5-(2,6-dimorpholin-4-ylpyrimidin-4-yl)-4-(trifluoromethyl)pyridin-2-amine [ka]

[0357] Alpelisib In one embodiment, the PI3K inhibitor is alpelisib, which has the chemical structure and name shown below: (2S)-1-N-[4-methyl-5-[2-(1,1,1-trifluoro-2-methylpropan-2-yl)pyridin-4-yl]-1,3-thiazol-2-yl]pyrrolidine-1,2-dicarboxamide. [ka]

[0358] Pictilisiv In one embodiment, the PI3K inhibitor is pictilisib, which has the chemical structure and name shown below: 4-[2-(1H-indazol-4-yl)-6-[(4-methylsulfonylpiperazin-1-yl)methyl]thieno[3,2-d]pyrimidin-4-yl]morpholine [ka]

[0359] Pyralalisib In one embodiment, the PI3K inhibitor is piralalisib, which has the chemical structure and name shown below: 2-amino-N-[3-[[3-(2-chloro-5-methoxyanilino)quinoxalin-2-yl]sulfamoyl]phenyl]-2-methylpropanamide [ka]

[0360] Sonorishive In one embodiment, the PI3K inhibitor is sonolicib, which has the chemical structure and name shown below: (4S,4aR,5R,6aS,9aR,E)-1-((diallylamino)methylene)-11-hydroxy-4-(methoxymethyl)-4a,6a-dimethyl-2,7,10-trioxo-1,2,4,4a,5,6,6a,7,8,9,9a,10-dodecahydroindeno[4,5-h]isochromen-5-yl acetate. [ka]

[0361] Copanlisib In one embodiment, the PI3K inhibitor is copanlisib, which has the chemical structure and name shown below: 2-amino-N-(7-methoxy-8-(3-morpholinopropoxy)-2,3-dihydroimidazo[1,2-c]quinazolin-5-yl)pyrimidine-5-carboxamide. [ka]

[0362] CH5132799 In one embodiment, the PI3K inhibitor is CH5132799. CH5132799 has the chemical structure and name shown below: 5-(7-methylsulfonyl-2-morpholin-4-yl-5,6-dihydropyrrolo[2,3-d]pyrimidin-4-yl)pyrimidin-2-amine [ka]

[0363] Theravelisib In one embodiment, the PI3K inhibitor is seravelisib. Seravelisib is It has the chemical structure and name shown: [6-(2-amino-1,3-benzoxazol-5-yl)imidazo[1,2-a]pyridin-3-yl]-morpholin-4-ylmethanone [ka]

[0364] AZD8186 In one embodiment, the PI3K inhibitor is AZD8186. AZD8186 has the chemical structure and name shown below: 8-[(1R)-1-(3,5-difluoroanilino)ethyl]-N,N-dimethyl-2-morpholin-4-yl-4-oxochromene-6-carboxamide. [ka] SAR260301 In one embodiment, the PI3K inhibitor is SAR260301. SAR260301 has the chemical structure and name shown below: (S)-2-(2-(2-methylindolin-1-yl)-2-oxoethyl)-6-morpholinopyrimidin-4(3H)-one [ka]

[0365] GSK2636771 In one embodiment, the PI3K inhibitor is GSK2636771. GSK2636771 has the chemical structure and name shown below: 2-methyl-1-(2-methyl-3-(trifluoromethyl)benzyl)-6-morpholino-1H-benzo[d]imidazole-4-carboxylic acid [ka]

[0366] Idelalisib In one embodiment, the PI3K inhibitor is idelalisib, which has the chemical structure and name shown below: (S)-2-(1-((9H-purin-6-yl)amino)propyl)-5-fluoro-3-phenylquinazolin-4(3H)-one [ka]

[0367] AMG319 In one embodiment, the PI3K inhibitor is AMG319. AMG319 has the chemical structure and name shown below: N-[(1S)-1-(7-fluoro-2-pyridin-2-ylquinolin-3-yl)ethyl]-7H-purin-6-amine [ka]

[0368] Acalisib In one embodiment, the PI3K inhibitor is acalisib, which has the chemical structure and name shown below: 6-fluoro-3-phenyl-2-[(1S)-1-(7H-purin-6-ylamino)ethyl]quinazolin-4-one [ka]

[0369] Duvelisib In one embodiment, the PI3K inhibitor is duvelisib, which has the chemical structure and name shown below: 8-chloro-2-phenyl-3-[(1S)-1-(7H-purin-6-ylamino)ethyl]isoquinolin-1-one [ka]

[0370] Taselisib In one embodiment, the PI3K inhibitor is taselisib, which has the chemical structure and name shown below: 2-methyl-2-[4-[2-(5-methyl-2-propan-2-yl-1,2,4-triazol-3-yl)-5,6-dihydroimidazo[1,2-d][1,4]benzoxazepin-9-yl]pyrazol-1-yl]propanamide [ka]

[0371] GDC-0084 In one embodiment, the PI3K inhibitor is GDC-0084. GDC-0084 has the chemical structure and name shown below: 5-(6,6-dimethyl-4-morpholin-4-yl-8,9-dihydropurino[8,9-c][1,4]oxazin-2-yl)pyrimidin-2-amine [ka]

[0372] AKT inhibitors SB-203580 In one embodiment, the AKT inhibitor is SB-203580. SB-203580 has the chemical structure and name shown below: 4-[4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-1H-imidazol-5-yl]pyridine [ka]

[0373] MK-2206 In one embodiment, the AKT inhibitor is MK-2206. MK-2206 has the chemical structure and name shown below: 8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl-2H-[1,2,4]triazolo[3,4-f][1,6]naphthyridin-3-one [ka]

[0374] SC79 In one embodiment, the AKT inhibitor is SC79. SC79 has the chemical structure and name shown below: Ethyl 2-amino-6-chloro-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate [ka]

[0375] AZD5363 In one embodiment, the AKT inhibitor is AZD5363. AZD5363 has the chemical structure and name shown below: 4-amino-N-[(1S)-1-(4-chlorophenyl)-3-hydroxypropyl]-1-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)piperidine-4-carboxamide. [ka]

[0376] Miltefosine In one embodiment, the AKT inhibitor is miltefosine. Miltefosine has the chemical structure and name shown below: Hexadecyl 2-(trimethylazaniumyl)ethyl phosphate. [ka]

[0377] Perifosine In one embodiment, the AKT inhibitor is Perifosine. Perifosine has the chemical structure and name shown below: (1,1-dimethylpiperidin-1-ium-4-yl)octadecyl phosphate. [ka]

[0378] PF-04691502 In one embodiment, the AKT inhibitor is PF-04691502. PF-04691502 has the chemical structure and name shown below: 2-amino-8-[4-(2-hydroxyethoxy)cyclohexyl]-6-(6-methoxypyridin-3-yl)-4-methylpyrido[2,3-d]pyrimidin-7-one. [ka]

[0379] CCT128930 In one embodiment, the AKT inhibitor is CCT128930. CCT128930 has the chemical structure and name shown below: 4-[(4-chlorophenyl)methyl]-1-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)piperidin-4-amine [ka]

[0380] A-674563 In one embodiment, the AKT inhibitor is A-674563. A-674563 has the chemical structure and name shown below: (2S)-1-[5-(3-methyl-2H-indazol-5-yl)pyridin-3-yl]oxy-3-phenylpropan-2-amine [ka]

[0381] RX-0201 (Alchexin) In one embodiment, the AKT inhibitor is RX-0201 (Archexin).In one embodiment, the AKT inhibitor is an oligodeoxynucleotide having the sequence 5' gctgcatgatctccttggcg 3'.

[0382] PBI-05204 (Oleandrin) In one embodiment, the AKT inhibitor is PBI-05204 (oleandrin). PBI-05204 has the chemical structure and name shown below: [(3S,5R,8R,9S,10S,13R,14S,16S,17R)-14-hydroxy-3-[(2R,4S,5S,6S)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-17-(5-oxo-2H-furan-3-yl)-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthren-16-yl]acetate. [ka]

[0383] AKT inhibitor VIII In one embodiment, the AKT inhibitor is AKT inhibitor VIII. AKT inhibitor VIII has the chemical structure and name shown below: 3-[1-[[4-(7-phenyl Nyl-3H-imidazo[4,5-g]quinoxalin-6-yl)phenyl]methyl]piperidin-4-yl]-1H-benzimidazol-2-one [ka]

[0384] AT7867 In one embodiment, the AKT inhibitor is AT7867. AT7867 has the chemical structure and name shown below: 4-(4-chlorophenyl)-4-[4-(1H-pyrazol-4-yl)phenyl]piperidine [ka]

[0385] AT13148 In one embodiment, the AKT inhibitor is AT13148. AT13148 has the chemical structure and name shown below: (1S)-2-amino-1-(4-chlorophenyl)-1-[4-(1H-pyrazol-4-yl)phenyl]ethanol. [ka]

[0386] GDC-0068 (ipatasertib) In one embodiment, the AKT inhibitor is GDC-0068 (ipatasertib). GDC-0068 has the chemical structure and name shown below: (S)-2-(4-chlorophenyl)-1-(4-((5R,7R)-7-hydroxy-5-methyl-6,7-dihydro-5H-cyclopenta[d]pyrimidin-4-yl)piperazin-1-yl)-3-(isopropylamino)propan-1-one. [ka]

[0387] TIC10 In one embodiment, the AKT inhibitor is TIC10. TIC10 has the chemical structure and name shown below: 7-benzyl-4-(2-methylbenzyl)-1,2,6,7,8,9-hexahydroimidazo[1,2-a]pyrido[3,4-e]pyrimidin-5(4H)-one [ka]

[0388] SC79 In one embodiment, the AKT inhibitor is SC79. SC79 has the chemical structure and name shown below: Ethyl 2-amino-6-chloro-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate [ka]

[0389] GSK690693 In one embodiment, the AKT inhibitor is GSK690693. GSK690693 has the chemical structure and name shown below: 4-[2-(4-amino-1,2,5-oxadiazol-3-yl)-1-ethyl-7-[[(3S)-piperidin-3-yl]methoxy]imidazo[4,5-c]pyridin-4-yl]-2-methylbut-3-yn-2-ol. [ka]

[0390] GSK2110183 In one embodiment, the AKT inhibitor is GSK2110183. GSK2110183 has the chemical structure and name shown below: N-[(2S)-1-amino-3-(3,4-difluorophenyl)propan-2-yl]-5-chloro-4-(4-chlorophenyl)propan-2-yl. 2-Methylpyrazol-3-yl)thiophene-2-carboxamide [ka] GSK2141795 In one embodiment, the AKT inhibitor is GSK2141795. GSK2141795 has the chemical structure and name shown below: N-[(2S)-1-amino-3-(3,4-difluorophenyl)propan-2-yl]-5-chloro-4-(4-chloro-2-methylpyrazol-3-yl)furan-2-carboxamide. [ka]

[0391] mTOR inhibitors Sirolimus In one embodiment, the mTOR inhibitor is sirolimus, which has the chemical structure and name shown below: (3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-9,27-dihydroxy-3-[(1R)-2-[(1S,3R, 4R)-4-Hydroxy-3-methoxycyclohexyl]-1-methylethyl]-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-23,27-epoxy-3H-pyrido[2,1-c][1,4]oxaazacyclohentriacontin-1,5,11,28,29(4H,6H,31H)-pentone [ka]

[0392] Everolimus In one embodiment, the mTOR inhibitor is everolimus, which has the chemical structure and name shown below: (1R,9S,12S,15R,16E,18R,19R,21R,23S,24E,26E,28E,30S,32S,35R)-1,18-dihydroxy-12-{(1R)-2-[(1S,3R,4R)-4-(2hydroxyethoxy)-3-methoxycyclohexyl]-1-methylethyl}-19,30-dimethoxy-15,17,21,23,29,35-hexamethyl-11,36-dioxa-4-aza-tricyclo[30.3.1.04,9]hexatriaconta 16,24,26,28-tetraene-2,3,10,14,20-pentaenoic acid [ka]

[0393] Temsirolimus In one embodiment, the mTOR inhibitor is temsirolimus, which has the chemical structure and name shown below: (1R,2R,4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo -1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-Tetracosahydro-3H-23,27-epoxypyrido[2,1-c][1,4]oxaazacyclohentriacontin-3-yl]propyl}-2-methoxycyclohexyl 3-hydroxy-2-(hydroxymethyl)-2-methylpropanoate [ka]

[0394] Zotarolimus In one embodiment, the mTOR inhibitor is zotarolimus, which has the chemical structure and name shown below: (3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-3-{(1R)-2-[(1S,3R,4S)-3-methoxy-4-(1H-tetrazol-1-yl)cyclohexyl]-1-methylethyl}-6, 8,12,14,20,26-Hexamethyl-4,9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-heptadecahydro-3H-23,27-epoxypyrido[2,1-c][1,4]oxaazacyclohentriacontin-1,5,11,28,29(6H,31H)-pentone [ka]

[0395] Defolimus In one embodiment, the mTOR inhibitor is deforolimus, which has the chemical structure and name shown below: (1R,2R,4S)-4-[(2R)-2-[(1R,9S,12S,15R,16E,18R,19R,21R,23S,24E,26E,28Z,30S,32S,35R)-1,18-dihydroxy-19,30-dimethoxy-15,17,21,23,29,35-hexamethyl-2,3,10,14,20-pentaoxo-11,36-dioxa-4-azatricyclo[30.3.1.04,9]hexatriaconta-16,24,26,28-tetraen-12-yl]propyl]-2-methoxycyclohexyl dimethylphosphinate. [ka] Wortmannin In one embodiment, the mTOR inhibitor is wortmannin, which has the chemical structure and name shown below: (1S,6bR,9aS,11R,11bR)-1-(methoxymethyl)-9a,11b-dimethyl-3,6,9-trioxo-3,6,6b,7,8,9,9a,10,11,11b-decahydro-1H-furo[4,3,2-de]indeno[4,5-h]isochromen-11-yl acetate. [ka]

[0396] Ascomycin In one embodiment, the mTOR inhibitor is ascomycin, which has the chemical structure and name shown below: (3S,4R,5S,8R,9E,12S,14S,15R,16S,18R,19R,26aS)-8-Ethyl-5,6,8,11,12,13,14,15,16,17,18,19,24,25,26,26a-Hexadecahydro-5,19-dihydroxy-3-[(1E)-2-[(1R,3R,4R)-4-hydroxy-3-methoxycyclohexyl]-1-methylethenyl]-14,16-dimethoxy-4,10,12,18-tetramethyl-15,19-epoxy-3H-pyrido[2,1-c][1,4]oxaazacyclotricosine-1,7,20,21(4H,23H)-tetrone [ka]

[0397] Tacrolimus In one embodiment, the mTOR inhibitor is tacrolimus. Tacrolimus has the chemical structure and name shown below: [3S[3R * [E(1S * ,3S * ,4S * )],4S * ,5R * ,8S * ,9E,12R * ,14R * ,15S * ,16R * ,18S * ,19S * ,26aR * ]]-5,6,8,11,12,13,14,15,16,17,18,19,24,25,26,26a-Hexadecahydro-5,19-dihydroxy-3-[2-(4-hydroxy-3-methoxycyclohexyl)-1-methylethenyl]-14,16-dimethoxy-4,10,12,18-tetramethyl-8-(2-propenyl)-15,19-epoxy-3H-pyrido[2,1-c][1,4]oxaazacyclotricosine-1,7,20,21(4H,23H)-tetrone [ka]

[0398] KU-0063794 In one embodiment, the mTOR inhibitor is KU-0063794. KU-0063794 has the chemical structure and name shown below: [5-[2-[(2R,6S)-2,6-dimethylmorpholin-4-yl]-4-morpholin-4-ylpyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol. [ka]

[0399] Sapanisertib In one embodiment, the mTOR inhibitor is sapanisertib, which has the chemical structure and name shown below: 5-(4-amino-1-propan-2-ylpyrazolo[3,4-d]pyrimidin-3-yl)-1,3-benzoxazol-2-amine [ka]

[0400] AZD8055 In one embodiment, the mTOR inhibitor is AZD8055. AZD8055 has the chemical structure and name shown below: [5-[2,4-bis[(3S)-3-methylmorpholin-4-yl]pyrido[2,3-d]pyrimidin-7-yl]-2-methoxyphenyl]methanol. [ka]

[0401] Vistusertib In one embodiment, the mTOR inhibitor is bistusertib, which has the chemical structure and name shown below: 3-[2,4-bis[(3S)-3-methylmorpholin-4-yl]pyrido[2,3-d]pyrimidin-7-yl]-N-methylbenzamide [ka]

[0402] CC-223 In one embodiment, the mTOR inhibitor is CC-223. CC-223 has the chemical structure and name shown below: 3-[6-(2-hydroxypropan-2-yl)pyridin-3-yl]-5-(4-methoxycyclohexyl)-7,8-dihydropyrazino[2,3-b]pyrazin-6-one. [ka]

[0403] OSI-027 In one embodiment, the mTOR inhibitor is OSI-027. OSI-027 has the chemical structure and name shown below: 4-(4-amino-5-(7-methoxy-1H-indol-2-yl)imidazo[5,1-f][1,2,4]triazin-7-yl)cyclohexanecarboxylic acid. [ka]

[0404] Boxtalic In one embodiment, the mTOR inhibitor is voxtalisib, which has the chemical structure and name shown below: N-[4-[[3-(3,5-dimethoxyanilino)quinoxalin-2-yl]sulfamoyl]phenyl]-3-methoxy-4-methylbenzamide. [ka]

[0405] Palomido 529 In one embodiment, the mTOR inhibitor is Palomid 529. Palomid 529 has the chemical structure and name shown below: 8-(1-hydroxyethyl)-2-methoxy-3-[(4-methoxyphenyl)methoxy]benzo[c]chromen-6-one [ka]

[0406] PP242 In one embodiment, the mTOR inhibitor is PP242. PP242 has the chemical structure and name shown below: (2E)-2-(4-amino-1-propan-2-yl-2H-pyrazolo[3,4-d]pyrimidin-3-ylidene)indol-5-ol. [ka]

[0407] Ductolisiv In one embodiment, the mTOR inhibitor is dactolisib, which has the chemical structure and name shown below: 2-methyl-2-[4-(3-methyl-2-oxo-8-quinolin-3-ylimidazo[4,5-c]quinolin-1-yl)phenyl]propanenitrile [ka]

[0408] BGT226 In one embodiment, the mTOR inhibitor is BGT226. BGT226 has the chemical structure and name shown below: (Z)-but-2-enedioic acid; 8-(6-methoxypyridin-3-yl)-3-methyl-1-[4-piperazin-1-yl-3-(trifluoromethyl)phenyl]imidazo[4,5-c]quinolin-2-one [ka]

[0409] Apitolisib In one embodiment, the mTOR inhibitor is apitolisib, which has the chemical structure and name shown below: (2S)-1-[4-[[2-(2-aminopyrimidin-5-yl)-7-methyl-4-morpholin-4-ylthieno[3,2-d]pyrimidin-6-yl]methyl]piperazin-1-yl]-2-hydroxypropan-1-one [ka]

[0410] Omipalisib In one embodiment, the mTOR inhibitor is omipalisib, which has the chemical structure and name shown below: 2,4-difluoro-N-[2-methoxy-5-(4-pyridazin-4-ylquinolin-6-yl)pyridin-3-yl]benzenesulfonamide [ka]

[0411] PF-04691502 In one embodiment, the mTOR inhibitor is PF-04691502. PF-04691502 has the chemical structure and name shown below: 2-amino-8-[4-(2-hydroxyethoxy)cyclohexyl]-6-(6-methoxypyridin-3-yl)-4-methylpyrido[2,3-d]pyrimidin-7-one. [ka]

[0412] Gedatrisiv In one embodiment, the mTOR inhibitor is gedatolisib, which has the chemical structure and name shown below: 1-[4-[4-(dimethylamino)piperidine-1-carbonyl]phenyl]-3-[4-(4,6-dimorpholin-4-yl-1,3,5-triazin-2-yl)phenyl]urea [ka]

[0413] Nucleoside Analogues Decitabine In one embodiment, the nucleoside analog is decitabine, which has the chemical structure and name shown below: 4-amino-1-[(2R,4S,5R)-4-hydroxy-5-(hydroxymethyl)oxolan-2-yl]-1,3,5-triazin-2-one [ka]

[0414] Cytarabine In one embodiment, the nucleoside analog is cytarabine, which has the chemical structure and name shown below: 4-amino-1-[(2R,3S,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]pyrimidin-2-one [ka]

[0415] Azacitidine

[0416] In one embodiment, the nucleoside analog is azacitidine, which has the chemical structure and name shown below: 4-amino-1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1,3,5-triazin-2-one [ka]

[0417] Zebularin In one embodiment, the nucleoside analog is Zebularine. Zebularine has the chemical structure and name shown below: 1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]pyrimidin-2-one [ka]

[0418] Pharmaceutical Compositions In some embodiments, the present invention provides a pharmaceutical composition comprising a combination comprising an MDM2 inhibitor and a therapeutic agent for treating myeloproliferative neoplasms (MPNs), wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. In one embodiment, the MPNs are selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndromes (MDS), and systemic mast cell disease (SMCD). In one embodiment, the myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF). In one embodiment, the primary myelofibrosis (PMF) is selected from the group consisting of prefibrotic / early PMF and overt fibrotic PMF. In one embodiment, the MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myelogenous leukemia (aCML), juvenile myelomonocytic leukemia (JMML), hypereosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasm with ringed sideroblasts and thrombocytosis (MDS / MPN-RS-T).

[0419] In one embodiment, the MDM2 inhibitor is a compound of Formula (I) or Formula (II), or a pharma- ceutically acceptable salt thereof.

[0420] In one embodiment, the MDM2 inhibitor is a compound of formula (I), formula (II), RG7388, triptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutlin-3, Nutlin-3a, Nutlin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-16 01, and pharma- ceutically acceptable salts thereof.

[0421] In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof.

[0422] In one embodiment, the JAK inhibitor is AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerdulatinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel, tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.

[0423] In one embodiment, the JAK inhibitor is selected from the group consisting of baricitinib phosphate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitinib phosphate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride.

[0424] In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof.

[0425] In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof.

[0426] In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A.

[0427] In one embodiment, the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutically acceptable salts thereof.

[0428] In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, vistusertib, CC-223, OSI-027, voxtalisib, palomid 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharmaceutically acceptable salts thereof.

[0429] In one embodiment, the PI3K inhibitor is selected from the group consisting of bupallisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, serabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof.

[0430] In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof.

[0431] In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.

[0432] In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

[0433] In one embodiment, the thrombocythemia is essential thrombocythemia (ET).

[0434] In one embodiment, the myelofibrosis is selected from primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF).

[0435] polycythemia vera In some embodiments, the present invention provides a pharmaceutical composition comprising a compound of Formula (I) or Formula (II), or a pharma- ceutically acceptable salt thereof, in combination with a therapeutic agent for treating polycythemia vera, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, and combinations thereof, and the JAK inhibitor is selected from the group consisting of AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerdulatinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, pacritinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), and the PD-1 inhibitor is selected from the group consisting of tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharma- ceutical acceptable salts thereof; and the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates thereof. or variants thereof; the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof; the anti-PD-L2 inhibitor is rHIgM12B7A; and the AKT inhibitor is SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII , AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutical acceptable salts thereof; and the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, bistusertib, CC-223, OSI-027, voxtalisib, palomis 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharma- ceutical acceptable salts thereof; and the PI3K inhibitor is selected from the group consisting of bupalisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, serabelisib, AZD8186, SAR26030 1, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharma- ceutically acceptable salts thereof; and the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharma- ceutically acceptable salts thereof, and the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

[0436] Essential thrombocythemia (ET) In some embodiments, the present invention provides a pharmaceutical composition comprising a compound of Formula (I) or Formula (II), or a pharma- ceutical acceptable salt thereof, in combination with a therapeutic agent for treating essential thrombocythemia, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, and combinations thereof. The JAK inhibitors selected were AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerdulatinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, and LY2784544. , NS-018, NSC42834, NVP-BSK805, oclacitinib, pacritinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2 -IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharma- ceutical acceptable salts thereof; and the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof; and the PD-1 inhibitor is selected from the group consisting of atezolizumab , avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof; the anti-PD-L2 inhibitor is rHIgM12B7A; and the AKT inhibitor is SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC -0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutically acceptable salts thereof; and the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, bistusertib, CC-223, OSI-027, voxtalisib, palomis 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharma- ceutical acceptable salts thereof; and the PI3K inhibitor is selected from the group consisting of bupalisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, serabelisib, AZD8186, SAR26030 1, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharma- ceutically acceptable salts thereof; and the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharma- ceutically acceptable salts thereof, and the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

[0437] Myelofibrosis In some embodiments, the present invention provides a pharmaceutical composition comprising a compound of Formula (I) or Formula (II), or a pharma- ceutical acceptable salt thereof, in combination with a therapeutic agent for treating myelofibrosis, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, and combinations thereof, and the JAK inhibitor is selected from the group consisting of A C-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerdulatinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BS K805, oclacitinib, pacritinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP 1066, XL019, ZM39923, and pharma- ceutical acceptable salts thereof; and the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof; and the PD-1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof. or a variant thereof, wherein the anti-PD-L2 inhibitor is rHIgM12B7A, and the AKT inhibitor is SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK6 90693, GSK2110183, GSK2141795, and pharma- ceutical acceptable salts thereof, and the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, bistusertib, CC-223, OSI-027, voxtalisib, palomis 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharma- ceutical acceptable salts thereof; and the PI3K inhibitor is selected from the group consisting of bupalisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, serabelisib, AZD8186, SAR26030 1, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharma- ceutically acceptable salts thereof; and the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharma- ceutically acceptable salts thereof, and the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

[0438] In one embodiment, the myelofibrosis is selected from primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF).

[0439] The pharmaceutical composition is typically formulated to provide a therapeutically effective amount of the MDM2 inhibitor and a therapeutically effective amount of the therapeutic agent, where the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. If desired, the pharmaceutical composition contains a pharma- ceutically acceptable salt and / or coordination complex thereof, as well as one or more pharma- ceutically acceptable excipients, carriers, such as inert solid diluents and fillers, diluents, such as sterile aqueous solutions and various organic solvents, penetration enhancers, solubilizers, and adjuvants.

[0440] In selected embodiments, the concentrations of the MDM2 inhibitor and therapeutic agent provided in the pharmaceutical compositions of the invention may be, independently, at least about 100%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.4%, 0.3%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 89%, 90%, 91%, 92%, .2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.009%, 0.008%, 0.007%, 0.006%, 0.005%, 0.004%, 0.003%, 0.002%, 0.001%, 0.0009%, 0.0008%, 0.0007%, 0.0006%, 0.0005%, 0.0004%, 0.0003% %, 0.0002% or 0.0001% (w / w, w / v or v / v) and the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analogue, and combinations thereof.

[0441] In selected embodiments, the concentrations of the MDM2 inhibitor and therapeutic agent provided in the pharmaceutical compositions of the invention are independently 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 19.75%, 19.50%, 19.25% 19%, 18.75%, 18.50%, 18.25% 18%, 17.75%, 17.50%, 17.25% 17%, 16.75%, 16.50%, 16.25% 16%, 15.75%, 15.50%, 15.25% 15%, 14.75%, 14.50%, 14.25% 14%, 13.75%, 13.50%, 13.25% 13%, 12.75%, 12.50%, 12.25% 12%, 11.75%, 11.50%, 11.25% 11%, 10.75%, 10.50%, 10.25% 10%, 9.75%, 9.50%, 9.25% 9%, 8.75%, 8.50%, 8.25% 8%, 7.75%, 7.50%, 7.25% 7%, 6.75%, 6.50%, 6.25% 6%, 5.75%, 5.50%, 5.25% 5%,4.75%,4.50%,4.25%,4%,3.75%,3.50%,3.25%,3%,2.75%,2.50%,2.25%,2%,1.75%,1.50%,125%,1%,0.5%,0.4%,0.3%,0.2%,0.1%,0.09%,0.08%,0.07%,0.06%,0.05%,0.04%,0.03%,0.02%,0.01%,0.009%,0.008%,0.007%,0.006%,0.005%,0.004%,0.003%,0.0 0.02%, 0.001%, 0.0009%, 0.0008%, 0.0007%, 0.0006%, 0.0005%, 0.0004%, 0.0003%, 0.0002% or 0.0001% (w / w, w / v or v / v) and the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analogue, and combinations thereof.

[0442] In selected embodiments, the concentrations of the MDM2 inhibitor and the therapeutic agent are, independently, from about 0.0001% to about 50%, from about 0.001% to about 40%, from about 0.01% to about 30%, from about 0.02% to about 29%, from about 0.03% to about 28%, from about 0.04% to about 27%, from about 0.05% to about 26%, from about 0.06% to about 25%, from about 0.07% to about 24%, from about 0.08% to about 23%, from about 0.09% to about 22%, from about 0.1% to about 21%, from about 0.2% to about 20%, from about 0.3% to about 19%, from about 0.4% to about 20%, from about 0.5% to about 22%, from about 0.6% to about 23%, from about 0.7% to about 24%, from about 0.8% to about 23%, from about 0.9% to about 22%, from about 0.1% to about 21%, from about 0.2% to about 20%, from about 0.3% to about 20%, from about 0.4% to about 22%, from about 0.5% to about 22%, from about 0.6% to about 22%, from about 0.7% to about 22%, from about 0.8% to about 22%, from about 0.9 ...9% to about 22%, from about 0.9% to about % to about 18%, about 0.5% to about 17%, about 0.6% to about 16%, about 0.7% to about 15%, about 0.8% to about 14%, about 0.9% to about 12%, or about 1% to about 10% (w / w, w / v, or v / v), and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0443] In selected embodiments, the concentrations of the MDM2 inhibitor and the therapeutic agent are, independently, in the range of about 0.001% to about 10%, about 0.01% to about 5%, about 0.02% to about 4.5%, about 0.03% to about 4%, about 0.04% to about 3.5%, about 0.05% to about 3%, about 0.06% to about 2.5%, about 0.07% to about 2%, about 0.08% to about 1.5%, about 0.09% to about 1%, about 0.1% to about 0.9% (w / w, w / v, or v / v), and the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

[0444] In selected embodiments, the amounts of MDM2 inhibitor and therapeutic agent are, independently, 10 g, 9.5g, 9.0g, 8.5g, 8.0g, 7.5g, 7.0g, 6.5g, 6.0g, 5.5g, 5.0g, 4.5g, 4.0g, 3.5 g, 3.0g, 2.5g, 2.0g, 1.5g, 1.0g, 0.95g, 0.9g, 0.85g, 0.8g, 0.75g, 0.7g, 0.65 g, 0.6g, 0.55g, 0.5g, 0.45g, 0.4g, 0.35g, 0.3g, 0.25g, 0.2g, 0.15g, 0.1g, 0. 09g, 0.08g, 0.07g, 0.06g, 0.05g, 0.04g, 0.03g, 0.02g, 0.01g, 0.009g, 0.008 g, 0.007g, 0.006g, 0.005g, 0.004g, 0.003g, 0.002g, 0.001g, 0.0009g, 0.0008g, 0.0007g, 0.0006g, 0.0005g, 0.0004g, 0.0003g, 0.0002g or 0.0001g, and the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

[0445] In selected embodiments, the amounts of MDM2 inhibitor and therapeutic agent are independently 0.0001g, 0.0002g, 0.0003g, 0.0004g, 0.0005g, 0.0006g, 0.0007g, 0.0008g, 0.0009g, 0.001g, 0.0015g, 0.002g, 0.0025g, 0.003g, 0.0035g, 0.004g, 0.00 45g, 0.005g, 0.0055g, 0.006g, 0.0065g, 0.007g, 0.0075g, 0.008g, 0.0085g, 0.009g, 0.0095g, 0. 01g, 0.015g, 0.02g, 0.025g, 0.03g, 0.035g, 0.04g, 0.045g, 0.05g, 0.055g, 0.06g, 0.065g, 0.07g, 0.075g, 0.08g, 0.085g, 0.09g, 0.095g, 0.1g, 0.15g, 0.2g, 0.25g, 0.3g, 0.35g, 0.4g, 0.45g, 0.5g , 0.55g, 0.6g, 0.65g, 0.7g, 0.75g, 0.8g, 0.85g, 0.9g, 0.95g, 1g, 1.5g, 2g, 2.5, 3g, 3.5, 4g, 4.5g, 5 g, 5.5 g, 6 g, 6.5 g, 7 g, 7.5 g, 8 g, 8.5 g, 9 g, 9.5 g or 10 g, and the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analogue, and combinations thereof.

[0446] MDM2 inhibitors are effective over a wide dosage range. For example, in the treatment of adult humans, dosages within the ranges of, independently, 0.01-1000 mg, 0.5-100 mg, 1-50 mg / day, and 5-40 mg / day are examples of dosages that may be used. The exact dosage will depend on the route of administration, the form in which the compound is administered, the sex and age of the subject being treated, the weight of the subject being treated, and the preference and experience of the attending physician.

[0447] Pharmaceutical Compositions for Oral Administration In selected embodiments, the invention provides pharmaceutical compositions for oral administration of a combination comprising an MDM2 inhibitor, a therapeutic agent, and a pharmaceutical excipient suitable for oral administration, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

[0448] In selected embodiments, the invention provides a solid pharmaceutical composition for oral administration that contains a combination comprising (i) an effective amount of an MDM2 inhibitor and a therapeutic agent, in combination with (ii) a pharmaceutical excipient suitable for oral administration, wherein the therapeutic agent is a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, In one embodiment, the solid pharmaceutical composition comprises a medicament for treating or preventing osteoarthritis of the ovarian tumor, the ...

[0449] In selected embodiments, the pharmaceutical composition may be a liquid pharmaceutical composition suitable for oral ingestion. The pharmaceutical composition of the present invention suitable for oral administration may be provided as a separate dosage form, for example, capsules, cachets, or tablets, or as a liquid or aerosol spray, each containing a predetermined amount of active ingredient, as a powder or in granules, solutions, or suspensions in aqueous or non-aqueous liquids, oil-in-water emulsions, or water-in-oil liquid emulsions. Such dosage forms may be prepared by any method, but all methods include the step of combining the active ingredient with a carrier that constitutes one or more necessary ingredients. In general, the composition is prepared by uniformly and intimately mixing the active ingredient with a liquid carrier or a finely divided solid carrier, or both, and then, if necessary, shaping the product into the desired presentation form. For example, a tablet may be prepared by compression or molding, optionally with one or more accessory ingredients. Compressed tablets can be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with excipients, such as, but not limited to, binders, lubricants, inert diluents, and / or surface active or dispersing agents. Molded tablets can be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.

[0450] The present invention further encompasses anhydrous pharmaceutical compositions and dosage forms, since water can accelerate the degradation of some compounds. For example, water is sometimes added (e.g., 5%) in the pharmaceutical arts as a means of simulating long-term storage to determine characteristics such as the shelf life or stability of a formulation over time. The anhydrous pharmaceutical compositions and dosage forms of the present invention can be prepared using anhydrous or low moisture containing ingredients and low moisture or low humidity conditions. Pharmaceutical compositions and dosage forms of the present invention containing lactose can be anhydrous if substantial contact with moisture and / or humidity during manufacturing, packaging, and / or storage is expected. Anhydrous pharmaceutical compositions may be prepared and stored such that their anhydrous nature is maintained. Thus, anhydrous compositions may be packaged using materials known to prevent exposure to water, thereby allowing them to be included in suitable formulary kits. Examples of suitable packaging include, but are not limited to, hermetically sealed foils, plastic or similar, unit dose containers, blister packs, and strip packs.

[0451] The combination of MDM2 inhibitor and therapeutic agent can be further combined in intimate mixture with pharmaceutical carrier according to conventional pharmaceutical compounding technology, and the therapeutic agent is selected from the group consisting of JAK inhibitor, IDH inhibitor, PD-1 inhibitor, PD-L1 inhibitor, PD-L2 inhibitor, interferon, PI3K inhibitor, AKT inhibitor, mTOR inhibitor, nucleoside analog, and combinations thereof. Carrier can take various forms depending on the form of preparation desired for administration. In preparing the composition for oral dosage form, any conventional pharmaceutical medium can be used as carrier, such as water, glycol, oil, alcohol, flavoring agent, preservative, and coloring agent for oral liquid preparation (e.g., suspension, solution, and elixir) or aerosol, or carrier such as starch, sugar, microcrystalline cellulose, diluent, granulating agent, lubricant, binder, and disintegrant for oral solid preparation, and in some embodiments, lactose is not used. For example, suitable carriers include powders, capsules, and tablets for the solid oral preparations. If desired, tablets can be coated by standard aqueous or nonaqueous techniques.

[0452] Binders suitable for use in pharmaceutical compositions and dosage forms include, but are not limited to, Examples of suitable gums include, but are not limited to, corn starch, potato starch, or other starches, gelatin, natural and synthetic gums such as acacia, sodium alginate, alginic acid, other alginates, powdered tragacanth, guar gum, cellulose and its derivatives (e.g., ethyl cellulose, cellulose acetate, calcium carboxymethylcellulose, sodium carboxymethylcellulose), polyvinylpyrrolidone, methylcellulose, pregelatinized starch, hydroxypropyl methylcellulose, microcrystalline cellulose, and combinations thereof.

[0453] Examples of suitable fillers for use in the pharmaceutical compositions and dosage forms disclosed herein include, but are not limited to, talc, calcium carbonate (e.g., granules or powder), microcrystalline cellulose, powdered cellulose, dextrates, kaolin, mannitol, silicic acid, sorbitol, starch, pregelatinized starch, and combinations thereof.

[0454] Disintegrants may be used in the compositions of the present invention to provide tablets that disintegrate when exposed to an aqueous environment. Too much disintegrant may result in tablets that disintegrate in the bottle. Too little may not be enough to cause disintegration to occur and alter the rate and extent of release of the active ingredient from the dosage form. Thus, a sufficient amount of disintegrant, but not too little or too much that adversely alters the release of the active ingredient, may be used to form a dosage form of the compounds disclosed herein. The amount of disintegrant used may vary based on the type of formulation and the mode of administration, and may be readily discernible to one of skill in the art. About 0.5 to about 15 weight percent of disintegrant, or about 1 to about 5 weight percent of disintegrant may be used in the pharmaceutical composition. Disintegrants that can be used to form pharmaceutical compositions and dosage forms of the invention include, but are not limited to, agar, alginic acid, calcium carbonate, microcrystalline cellulose, croscarmellose sodium, crospovidone, polacrilin potassium, sodium starch glycolate, potato or tapioca starch, other starches, pregelatinized starch, other starches, clays, other algins, other celluloses, gums or combinations thereof.

[0455] Lubricants that can be used to form the pharmaceutical compositions and dosage forms of the present invention include, but are not limited to, calcium stearate, magnesium stearate, mineral oil, light mineral oil, glycerin, sorbitol, mannitol, polyethylene glycol, other glycols, stearic acid, sodium lauryl sulfate, talc, hydrogenated vegetable oils (e.g., peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil, and soybean oil), zinc stearate, ethyl oleate, ethylaureate, agar, or combinations thereof. Additional lubricants include, for example, syloid silica gel, coagulated aerosol of synthetic silica, or combinations thereof. Lubricants can be optionally added in an amount of less than about 1 weight percent of the pharmaceutical composition.

[0456] When aqueous suspensions and / or elixirs are desired for oral administration, the essential active ingredient therein may be combined with diluents such as water, ethanol, propylene glycol, glycerin and various combinations thereof, as well as various sweetening or flavoring agents, coloring substances or dyes, and, if so desired, emulsifying and / or suspending agents.

[0457] The tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be used. Formulations for oral use may also be The active ingredient can be provided as a hard gelatin capsule in which the active ingredient is mixed with an inert solid diluent, such as calcium carbonate, calcium phosphate or kaolin, or as a soft gelatin capsule in which the active ingredient is mixed with water or an oil medium, such as peanut oil, liquid paraffin or olive oil.

[0458] Surfactants that can be used to form the pharmaceutical compositions and dosage forms of the present invention include, but are not limited to, hydrophilic surfactants, lipophilic surfactants, and combinations thereof. That is, a mixture of hydrophilic surfactants may be used, a mixture of lipophilic surfactants may be used, or a mixture of at least one hydrophilic surfactant and at least one lipophilic surfactant may be used.

[0459] Suitable hydrophilic surfactants may generally have an HLB value of at least 10, and suitable lipophilic surfactants may generally have an HLB value of about 10 or less. An empirical parameter used to characterize the relative hydrophilicity and hydrophobicity of nonionic amphiphilic compounds is the hydrophilic-lipophilic balance ("HLB" value). Surfactants with lower HLB values ​​are more lipophilic or hydrophobic and have higher solubility in oils, and surfactants with higher HLB values ​​are more hydrophilic and have higher solubility in aqueous solutions. Hydrophilic surfactants are generally considered to be anionic, cationic, or zwitterionic compounds, to which the HLB scale does not generally apply, in addition to compounds with HLB values ​​higher than about 10. Similarly, lipophilic (i.e., hydrophobic) surfactants are compounds with HLB values ​​equal to or less than about 10. However, the HLB value of a surfactant is merely a rough guide that is commonly used to enable the formulation of industrial, pharmaceutical, and cosmetic emulsions.

[0460] Hydrophilic surfactants may be either ionic or nonionic.Suitable ionic surfactants include but are not limited to alkyl ammonium salts; fusidate salts; fatty acid derivatives of amino acids, oligopeptides, and polypeptides; glyceride derivatives of amino acids, oligopeptides, and polypeptides; lecithin and hydrogenated lecithin; lysolecithin and hydrogenated lysolecithin; phospholipids and their derivatives; lysophospholipids and their derivatives; carnitine fatty acid ester salts; salts of alkyl sulfates; fatty acid salts; sodium docusate; acylactylates; mono- and diacetylated tartaric acid esters of mono- and diglycerides; succinylated mono- and diglycerides; citrate esters of mono- and diglycerides; and combinations thereof.

[0461] Within the above group, ionic surfactants include, by way of example, lecithin, lysolecithin, phospholipids, lysophospholipids and derivatives thereof; carnitine fatty acid ester salts; salts of alkyl sulfates; fatty acid salts; sodium docusate; acyl lactate salts; mono- and diacetylated tartaric acid esters of mono- and diglycerides; succinylated mono- and diglycerides; citrate esters of mono- and diglycerides; and combinations thereof.

[0462] Ionic surfactants include lecithin, lysolecithin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidic acid, phosphatidylserine, lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysophosphatidic acid, lysophosphatidylserine, PEG-phosphatidylethanolamine, PVP-phosphatidylethanolamine, lactyl esters of fatty acids, stearoyl-2-lactylate, stearoyl lactylate, succinylated monoglycerides, mono / diacetylated tartaric acid esters of mono / diglycerides, citric acid esters of mono / diglycerides, cholyl sarcosine, caproic acid, caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, oleic acid, ricinoleic acid, linoleic acid, linolenic acid, stearic acid, lauryl sulfate, teracecylic sulfate (teracecylic acid). l sulfate), docusate, lauroylcarnitine, palmitoylcarnitine, myristoylcarnitine, and salts and combinations thereof.

[0463] Hydrophilic nonionic surfactants may include, but are not limited to, alkyl glucosides; alkyl maltosides; alkyl thioglucosides; lauryl macrogol glycerides; polyoxyalkylene alkyl ethers, such as polyethylene glycol alkyl ethers; polyoxyalkylene alkylphenols, such as polyethylene glycol alkylphenols; polyoxyalkylene alkylphenol fatty acid esters, such as polyethylene glycol fatty acid monoesters and polyethylene glycol fatty acid diesters; polyethylene glycol glycerol fatty acid esters; polyglycerol fatty acid esters; polyoxyalkylene sorbitan fatty acid esters, such as polyethylene glycol sorbitan fatty acid esters; hydrophilic transesterification products of polyols with at least one member of the group consisting of glycerides, vegetable oils, hydrogenated vegetable oils, fatty acids, and sterols; polyoxyethylene sterols, derivatives, and analogs thereof; polyoxyethylated vitamins and derivatives thereof; polyoxyethylene-polyoxypropylene block copolymers; and combinations thereof; polyethylene glycol sorbitan fatty acid esters and hydrophilic transesterification products of polyols with at least one member of the group consisting of triglycerides, vegetable oils, and hydrogenated vegetable oils. The polyol may be glycerol, ethylene glycol, polyethylene glycol, sorbitol, propylene glycol, pentaerythritol, or a saccharide.

[0464] Other hydrophilic nonionic surfactants include PEG-10 laurate, PEG-12 laurate, PEG-20 laurate, PEG-32 laurate, PEG-32 dilaurate, PEG-12 oleate, PEG-15 oleate, PEG-20 oleate, PEG-20 dioleate, PEG-32 oleate, PEG-200 oleate, PEG-400 oleate, PEG-15 stearate, PEG-32 distearate, PEG-40 stearate, PEG-100 stearate, PEG-20 dilaurate, PEG-25 glyceryl trioleate, PEG-32 dioleate, PEG-20 glyceryl laurate, PEG-30 glyceryl laurate, PEG-20 glyceryl stearate, PEG-20 glyceryl oleate, PEG-30 glyceryl oleate, PEG-30 glyceryl laurate, PEG-40 glyceryl laurate, PEG- 40 Palm Kernel Oil, PEG-50 Hydrogenated Castor Oil, PEG-40 Castor Oil, PEG-35 Castor Oil, PEG-60 Castor Oil, PEG-40 Hydrogenated Castor Oil, PEG-60 Hydrogenated Castor Oil, PEG-60 Corn Oil, Capric / Caprylic PEG-6 Glycerides, Capric / Caprylic PEG-8 Glycerides, Polyglyceryl-10 Laurate, PEG-30 Cholesterol, PEG-25 Phytosterols, PEG-30 Soy Sterols, PEG-20 Trioleate, PEG-40 Sorbitan Oleate, PEG-80 Sorbitan Laurate, Polysorbate 20, Polysorbate 80, POE-9 Lauryl Ether, POE-23 Lauryl Ether, POE-10 Oleyl Ether, POE-20 Oleyl Ether, POE-20 Stearyl Ether, PEG-100 Tocopheryl Succinate, PEG-24 Cholesterol, Polyglyceryl-10 Oleate, Tween 40, Tween 60, Sucrose Monostearate, Sucrose Monolaurate, Sucrose Monopalmitate, PEG These include, but are not limited to, the 10-100 nonylphenol series, the PEG 15-100 octylphenol series, and poloxamers.

[0465] Suitable lipophilic surfactants include, by way of example only, fatty alcohols; glycerol fatty acid esters; acetylated glycerol fatty acid esters; lower alcohol fatty acid esters; propylene glycol fatty acid esters; sorbitan fatty acid esters; polyethylene glycol sorbitan fatty acid esters; sterols and sterol derivatives; polyoxyethylene ethers; The preferred lipophilic surfactants include ethylated sterols and sterol derivatives; polyethylene glycol alkyl ethers; sugar esters; sugar ethers; lactic acid derivatives of mono- and diglycerides; hydrophobic transesterification products of polyols with at least one member of the group consisting of glycerides, vegetable oils, hydrogenated vegetable oils, fatty acids and sterols; oil-soluble vitamins / vitamin derivatives; and combinations thereof. Among these groups, preferred lipophilic surfactants include glycerol fatty acid esters, propylene glycol fatty acid esters, and combinations thereof, or hydrophobic transesterification products of polyols with at least one member of the group consisting of vegetable oils, hydrogenated vegetable oils, and triglycerides.

[0466] In one embodiment, the composition may contain a solubilizer to ensure good solubilization and / or dissolution of the compound of the present invention and to minimize the precipitation of the compound of the present invention.This may be particularly important for compositions for parenteral use, such as injection compositions.Solubilizers may also be added to increase the solubility of hydrophilic drugs and / or other components, such as surfactants, or to maintain the composition as a stable or homogeneous solution or dispersion.

[0467] Examples of suitable solubilizing agents include, but are not limited to, alcohols and polyols, such as ethanol, isopropanol, butanol, benzyl alcohol, ethylene glycol, propylene glycol, butanediol and its isomers, glycerol, pentaerythritol, sorbitol, mannitol, transcutol, dimethylisosorbide, polyethylene glycol, polypropylene glycol, polyvinyl alcohol, hydroxypropylmethylcellulose and other cellulose derivatives, cyclodextrin and cyclodextrin derivatives; ethers of polyethylene glycol having an average molecular weight of about 200 to about 6000, such as tetrahydrofurfuryl alcohol PEG ether (glycofurol) or methoxy PEG; amides and other nitrogen-containing compounds, such as 2-pyrrolidone, 2-piperidinol, tetrahydrofurfuryl alcohol PEG ether (glycofurol) or methoxy PEG; esters such as ethyl propionate, tributyl citrate, acetyl triethyl citrate, acetyl tributyl citrate, triethyl citrate, ethyl oleate, ethyl caprylate, ethyl butyrate, triacetin, propylene glycol monoacetate, propylene glycol diacetate, epsilon-caprolactone and its isomers, delta-valerolactone and its isomers, beta-butyrolactone and its isomers; and other solubilizing agents known in the art such as dimethylacetamide, dimethyl isosorbide, N-methylpyrrolidone, monooctanoin, diethylene glycol monoethyl ether, and water.

[0468] Mixtures of solubilizers can also be used. Examples include, but are not limited to, triacetin, triethyl citrate, ethyl oleate, ethyl caprylate, dimethylacetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropyl methylcellulose, hydroxypropyl cyclodextrin, ethanol, polyethylene glycol 200-100, glycofurol, transcutol, propylene glycol, and dimethyl isosorbide. Particularly preferred solubilizers include sorbitol, glycerol, triacetin, ethyl alcohol, PEG-400, glycofurol, and propylene glycol.

[0469] The amount of solubilizer that can be included is not particularly limited. The amount of a given solubilizer may be limited to a biotolerable amount, which can be easily determined by those skilled in the art. In some situations, for example, to maximize the concentration of the drug, it may be advantageous to include an amount of solubilizer that is far in excess of the biotolerable amount, and the excess solubilizer can be removed using conventional techniques such as distillation or evaporation. The solubilizer is removed before providing the composition to the patient. Thus, when present, it can be in a weight ratio of 10%, 25%, 50%, 100%, or up to about 200% by weight based on the combined weight of the drug and other excipients. If desired, very small amounts of solubilizer can be used, for example, 5%, 2%, 1% or even less. Typically, the solubilizer may be present in an amount of about 1% to about 100% by weight, more typically about 5% to about 25% by weight.

[0470] The composition may further comprise one or more pharma- ceutically acceptable additives and excipients.Such additives and excipients include, but are not limited to, detackifiers, antifoaming agents, buffering agents, polymers, antioxidants, preservatives, chelating agents, viscosity modifiers, tonicity agents, flavors, colorants, odorants, opacifiers, suspending agents, binders, fillers, plasticizers, lubricants, and combinations thereof.

[0471] Additionally, acids or bases may be incorporated into the composition to facilitate processing, promote stability, or for other reasons. Examples of pharma-ceutically acceptable bases include amino acids, amino acid esters, ammonium hydroxide, potassium hydroxide, sodium hydroxide, sodium bicarbonate, aluminum hydroxide, calcium carbonate, magnesium hydroxide, magnesium aluminum silicate, synthetic aluminum silicate, synthetic hydrocalcite, magnesium aluminum hydroxide, diisopropylethylamine, ethanolamine, ethylenediamine, triethanolamine, triethylamine, triisopropanolamine, trimethylamine, and tris(hydroxymethyl)aminomethane (TRIS). Also suitable are bases that are salts of pharma- ceutically acceptable acids, such as acetic acid, acrylic acid, adipic acid, alginic acid, alkanesulfonic acid, amino acids, ascorbic acid, benzoic acid, boric acid, butyric acid, carbonic acid, citric acid, fatty acids, formic acid, fumaric acid, gluconic acid, hydroquinosulfonic acid, isoascorbic acid, lactic acid, maleic acid, oxalic acid, para-bromophenylsulfonic acid, propionic acid, p-toluenesulfonic acid, salicylic acid, stearic acid, succinic acid, tannic acid, tartaric acid, thioglycolic acid, toluenesulfonic acid, and uric acid. Salts of polybasic acids, such as sodium phosphate, disodium hydrogen phosphate, and sodium dihydrogen phosphate, can also be used. When the base is a salt, the cation can be any convenient and pharma-ceutically acceptable cation, such as ammonium, alkali metals, and alkaline earth metals. Examples include, but are not limited to, sodium, potassium, lithium, magnesium, calcium, and ammonium.

[0472] Suitable acids are pharmaceutically acceptable organic or inorganic acids.Suitable examples of inorganic acids include hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, boric acid, and phosphoric acid.Suitable examples of organic acids include acetic acid, acrylic acid, adipic acid, alginic acid, alkanesulfonic acid, amino acid, ascorbic acid, benzoic acid, boric acid, butyric acid, carbonic acid, citric acid, fatty acid, formic acid, fumaric acid, gluconic acid, hydroquinosulfonic acid, isoascorbic acid, lactic acid, maleic acid, methanesulfonic acid, oxalic acid, para-bromophenylsulfonic acid, propionic acid, p-toluenesulfonic acid, salicylic acid, stearic acid, succinic acid, tannic acid, tartaric acid, thioglycolic acid, toluenesulfonic acid, and uric acid.

[0473] Pharmaceutical Composition for Injection In selected embodiments, the invention provides pharmaceutical compositions for injection comprising a combination comprising an MDM2 inhibitor, a therapeutic agent, and a pharmaceutical excipient suitable for injection, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analogue, and combinations thereof.

[0474] Forms in which the compositions of the present invention may be incorporated for administration by injection include aqueous or oily suspensions or emulsions, including sesame oil, corn oil, cottonseed oil, or peanut oil, as well as elixirs, mannitol, dextrose, or sterile aqueous solutions, and similar pharmaceutical vehicles.

[0475] Aqueous solutions in physiological saline are also conventionally used for injection. Ethanol, glycerol, propylene glycol and liquid polyethylene glycol (and suitable combinations thereof), cyclodextrin derivatives, and vegetable oils can also be used. Proper fluidity can be maintained, for example, by the use of coating such as lecithin to maintain the required particle size in the case of dispersion, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and thimerosal.

[0476] Sterile injectable solution is prepared by incorporating the required amount of MDM2 inhibitor and therapeutic agent into a suitable solvent, optionally with various other ingredients as listed above, followed by sterile filtration, where the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.Generally, dispersion is prepared by incorporating various sterilized active ingredients into a sterile solvent that contains a basic dispersion medium and other required ingredients from those listed above.In the case of sterile powders for the preparation of sterile injectable solution, one particular desired method of preparation is vacuum drying and freeze-drying technology, which results in a powder of active ingredients and any additional desired ingredients from the solution previously sterile filtered.

[0477] Administration of a combination comprising an MDM2 inhibitor and a therapeutic agent can be effected by any method that allows delivery of the compound to the site of action, where the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. These methods include oral routes, intraduodenal routes, parenteral injection (including intravenous, intraarterial, subcutaneous, intramuscular, intravascular or infusion), topical application (e.g., transdermal application), local delivery via catheter or stent.

[0478] Exemplary parenteral dosage forms include solutions or suspensions of the active compounds in sterile aqueous solutions, for example, aqueous propylene glycol or dextrose solutions. Such dosage forms can be suitably buffered, if desired.

[0479] The present invention also provides kits. The kits include the MDM2 inhibitor and the therapeutic agent, either alone or in combination in suitable packaging, and materials that may include instructions for use, discussion of clinical studies and listing of side effects, where the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. Such kits may also include information such as references to scientific literature, package insert materials, clinical trial results, and / or summaries thereof, which indicate or establish the activity and / or benefits of the composition and / or describe dosing, administration, side effects, drug interactions, or other information useful to health care providers. Such information may be based on the results of various studies, for example, studies using laboratory animals with in vivo models and studies based on human clinical trials. The kits may further contain another active pharmaceutical ingredient. Suitable packaging for use and additional items (e.g., measuring cups for liquid preparation, foil wrapping to minimize exposure to air, etc.) will be provided by the present invention. The kits described herein may be provided, sold and / or promoted to healthcare providers, including physicians, nurses, pharmacists, and prescribing authorities. The kits may also be sold directly to consumers in selected embodiments. In one embodiment, the present invention provides a kit comprising a combination comprising an MDM2 inhibitor and a therapeutic agent for use in treating MPN, the therapeutic agent being selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof. In one embodiment, the MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mast cell disease (SMCD). In one embodiment, the myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF). In one embodiment, the primary myelofibrosis (PMF) is selected from the group consisting of prefibrotic / early PMF and overt fibrotic PMF. In one embodiment, the MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myelogenous leukemia (aCML), juvenile myelomonocytic leukemia (JMML), hypereosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasm with ringed sideroblasts and thrombocythemia (MDS / MPN-RS-T).

[0480] Dosage and Administration Regimen The amount of MDM2 inhibitor and therapeutic agent administered will depend, independently, on the person being treated, the severity of the disorder or condition, the rate of administration, the nature of the compounds, and the discretion of the prescribing physician, where the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. However, effective dosages are within the range of about 0.001 to about 100 mg / kg body weight / day, e.g., about 1 to about 35 mg / kg / day, in single or divided doses. For a 70 kg human, this amounts to about 0.05 to 7 g / day, e.g., about 0.05 to about 2.5 g / day. In some cases, dosage levels below the lower limit of the aforementioned range may be more than sufficient, while in other cases even larger doses may be used without causing any adverse side effects, for example, by dividing such larger doses into several smaller doses for administration throughout the day.

[0481] In some embodiments, the MDM2 inhibitor and the therapeutic agent are administered independently in a single dose, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. Typically, such administration is by injection, e.g., intravenous injection, to rapidly introduce the agent. However, other routes may be used as appropriate. The single dose of the MDM2 inhibitor and the therapeutic agent may also be used for the treatment of acute conditions, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0482] In some embodiments, the MDM2 inhibitor and the therapeutic agent are administered independently in multiple doses to treat MPN, and the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof. In one embodiment, the MDM2 inhibitor and the JAK inhibitor are administered by injection, e.g., Independently administered in multiple doses by intravenous injection. In one embodiment, administration may be once, twice, three times, four times, five times, six times, or more than six times per day. In one embodiment, administration may be selected from the group consisting of once a day, twice a day, three times a day, four times a day, five times a day, six times a day, once every other day, once a week, twice a week, three times a week, four times a week, every other week, and monthly. In some embodiments, the MDM2 inhibitor and the therapeutic agent are independently administered three times a week (including every Monday, Wednesday, and Friday), and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0483] The administration of the MDM2 inhibitor and the therapeutic agent may continue independently as necessary, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. In some embodiments, the MDM2 inhibitor and the therapeutic agent are administered independently for more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 days. In some embodiments, the MDM2 inhibitor and the therapeutic agent are administered independently for less than 28, 14, 7, 6, 5, 4, 3, 2, or 1 days. In some embodiments, the MDM2 inhibitor and the therapeutic agent are administered independently for about 14 days, about 21 days, about 28 days, about 35 days, about 42 days, about 49 days, or about 56 days. In some embodiments, the MDM2 inhibitor and the therapeutic agent are administered independently on a continuous, chronic basis, for example, for the treatment of chronic effects. In another embodiment, the administration of the MDM2 inhibitor and the therapeutic agent continues independently for less than about 7 days. In yet another embodiment, the administration continues for more than about 6, 10, 14, 28 days, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 1 year. In some embodiments, the administration continues for more than about 1 year, 2 years, 3 years, 4 years, or 5 years. In some embodiments, the continuous administration is achieved and maintained for as long as necessary.

[0484] In some embodiments, the effective doses of the MDM2 inhibitor and the therapeutic agent are, independently, from about 1 mg to about 500 mg, about 10 mg to about 300 mg, about 20 mg to about 250 mg, about 25 mg to about 200 mg, about 10 mg to about 200 mg, about 20 mg to about 150 mg, about 30 mg to about 120 mg, about 10 mg to about 90 mg, about 20 mg to about 80 mg, about 30 mg to about 70 mg, about 40 mg to about 60 mg, about 45 mg to about 55 mg, about 48 mg to about 52 mg, about 50 mg to about 150 mg, about 60 mg to about 140 mg, about 70 mg to about 130 mg, about 8 ...10 mg to about 150 mg, about 150 mg to about 160 mg, about 150 mg to about 170 mg, about 160 mg to about 180 mg, about 180 mg to about 200 mg, about 180 mg to about 220 mg, about 180 mg to about 240 mg, about 180 mg to about 260 mg, about 180 mg to about 280 mg, about 180 mg to about 290 mg mg, about 90 mg to about 110 mg, about 95 mg to about 105 mg, about 150 mg to about 250 mg, about 160 mg to about 240 mg, about 170 mg to about 230 mg, about 180 mg to about 220 mg, about 190 mg to about 210 mg, about 195 mg to about 205 mg, or about 198 mg to about 202 mg, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. In some embodiments, the effective dosage of the MDM2 inhibitor and therapeutic agent is about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 225 mg, about 250 mg, about 275 mg, about 300 mg, about 325 mg, about 350 mg, about 375 mg, about 400 mg, about 425 mg, about 450 mg, about 475 mg, or about 500 mg. In some embodiments, the effective dosage of the MDM2 inhibitor or JAK inhibitor is 25 mg, 50 mg, 75 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 375 mg, 400 mg, 425 mg, 450 mg, 475 mg, or 500 mg, and the therapeutic agent is a JAK inhibitor. agents, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0485] In some embodiments, the effective dose of the MDM2 inhibitor or therapeutic agent is independently about 0.01 mg / kg to about 4.3 mg / kg, about 0.15 mg / kg to about 3.6 mg / kg, about 0.3 mg / kg to about 3.2 mg / kg, about 0.35 mg / kg to about 2.85 mg / kg, about 0.15 mg / kg to about 2.85 mg / kg, about 0.3 mg / kg to about 2.15 mg / kg, about 0.45 mg / kg to about 1.7 mg / kg, about 0.15 mg / kg to about 1.3 mg / kg, about 0.3 mg / kg to about 1.15 mg / kg, about 0.45 mg / kg to about 1 mg / kg, about 0.55 mg / kg to about 0.85 mg / kg, about 0.65 mg / kg to about 0.8 mg / kg, about 0. 7 mg / kg to about 0.75 mg / kg, about 0.7 mg / kg to about 2.15 mg / kg, about 0.85 mg / kg to about 2 mg / kg, about 1 mg / kg to about 1.85 mg / kg, about 1.15 mg / kg to about 1.7 mg / kg, about 1.3 mg / kg to about 1.6 mg / kg, about 1.35 mg / kg to about 1.5 mg / kg, about 2.15 mg / kg to about 3.6 mg / kg, about 2.3 mg / kg to about 3.4 mg / kg, about 2.4 mg / kg to about 3.3 mg / kg, about 2.6 mg / kg to about 3.15 mg / kg, about 2.7 mg / kg to about 3 mg / kg, about 2.8 mg / kg to about 3 mg / kg, or about 2.85 mg / kg to about 2.95 mg / kg. In some embodiments, the effective dosage of the MDM2 inhibitor or JAK inhibitor is about 0.35 mg / kg, about 0.7 mg / kg, about 1 mg / kg, about 1.4 mg / kg, about 1.8 mg / kg, about 2.1 mg / kg, about 2.5 mg / kg, about 2.85 mg / kg, about 3.2 mg / kg, or about 3.6 mg / kg, and the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

[0486] In some embodiments, the MDM2 inhibitor or a pharma- ceutically acceptable salt thereof is administered at a dosage of 10 to 500 mg BID (including dosages of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg BID).

[0487] In some embodiments, the MDM2 inhibitor or a pharma- ceutically acceptable salt thereof is administered at a dosage of 10 to 500 mg QD (including dosages of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg QD).

[0488] In some embodiments, the interferon is administered at a dose selected from the group consisting of about 1 million international units (MU) to about 800 MU, about 1 MU to about 10 MU, about 20 MU to about 40 MU, about 2 MU to about 15 MU, about 5 MU to about 25 MU, about 50 MU to about 100 MU, about 150 MU to about 250 MU, about 300 MU to about 400 MU, and about 500 MU to about 600 MU.

[0489] In some embodiments, the interferon is administered at a dose selected from the group consisting of about 0.1 μg / day to about 1 mg / day, about 10 μg / day to about 200 μg / day, about 20 μg / day to about 150 μg / day, about 0.1 μg / day to about 125 μg / day, about 1 μg / day to about 20 μg / day, and about 4.5 μg / day to about 30 μg / day.

[0490] In some embodiments, the interferon is 1, 2, 3, 4, 5, 6, 7, 8, 9, 1 0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 MU / m 2 The therapeutic agent is administered at a dose selected from the group consisting of:

[0491] An effective amount of an MDM2 inhibitor or therapeutic agent may be administered in either a single dose or multiple doses by any accepted mode of administration of agents having similar utilities, including buccal, sublingual, and transdermal routes, by arterial injection, intravenously, parenterally, intramuscularly, subcutaneously, or orally.

[0492] In some embodiments, the MDM2 inhibitor and the therapeutic agent are administered to the subject independently intermittently, known as intermittent administration. "Intermittent administration" means that there is a period of administration of a therapeutically effective amount of the MDM2 inhibitor and / or the therapeutic agent, followed by a period of withdrawal, then another period of administration, etc. In each administration period, the administration frequency can be independently selected from three times a day, twice a day, daily, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, or monthly. In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II). In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, Triptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutlin-3, Nutlin-3a, Nutlin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof. In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof.In one embodiment, the JAK inhibitor is AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerdulatinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel, tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof. In one embodiment, the JAK inhibitor is selected from the group consisting of baricitinib phosphate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitinib phosphate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride. In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof. In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof. In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A. In one embodiment, the AKT inhibitor is SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PB. I-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutically acceptable salts thereof. In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, vistusertib, CC-223, OSI-027, voxtalisib, palomid 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharmaceutically acceptable salts thereof. In one embodiment, the PI3K inhibitor is selected from the group consisting of bupallisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, serabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof. In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharma- ceutically acceptable salts thereof. In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

[0493] "Period of withdrawal" or "period of withdrawal" or "period of rest" refers to the length of time when administration of the MDM2 inhibitor and / or therapeutic agent is discontinued. The period of withdrawal may be longer or shorter than the administration period or the same as the administration period. For example, if the administration period includes administration three times daily, twice daily, once daily, once weekly, twice weekly, three times weekly, four times weekly, five times weekly, six times weekly, or once monthly, the period of withdrawal may be at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 1 month, 2 months, 3 months, 4 months, or more days. During the period of withdrawal, other therapeutic agents other than the MDM2 inhibitor and therapeutic agent may be administered.

[0494] In one embodiment, the MDM2 inhibitor and the therapeutic agent are independently administered to a human subject in need thereof for treatment of a myeloproliferative neoplasm (MPN) for a first administration period, followed by a withdrawal period, followed by a second administration period, etc. In one embodiment, the MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mast cell disease (SMCD). In one embodiment, the myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF). In one embodiment, the primary myelofibrosis (PMF) is selected from the group consisting of prefibrotic / early PMF and overt fibrotic PMF. In one embodiment, the MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myelogenous leukemia (aCML), juvenile myelomonocytic leukemia (JMML). , hypereosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasms with ringed sideroblasts and thrombocytosis (MDS / MPN-RS-T). The first administration period, the second administration period, and the withdrawal period are independently selected from the group consisting of more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 1 month, 2 months, 3 months, 4 months, and more days, and the MDM2 inhibitor and the therapeutic agent are independently administered to the subject 3 times daily, twice daily, once daily, once weekly, twice weekly, 3 times weekly, 4 times weekly, 5 times weekly, 6 times weekly, or once monthly. In one embodiment, the first administration period is the same length as the second administration period. In one embodiment, the first administration period is shorter than the second administration period. In one embodiment, the first administration period is longer than the second administration period. In one embodiment, the first administration period and the second administration period are about 3 weeks, the MDM2 inhibitor and the therapeutic agent are independently administered to the subject once a day, and the discontinuation is about 2 weeks. In one embodiment, the first administration period and the second administration period are about 3 weeks, the MDM2 inhibitor and the therapeutic agent are independently administered to the subject once a week, and the discontinuation is about 2 weeks. In one embodiment, the first administration period and the second administration period are about 4 weeks, the MDM2 inhibitor and the therapeutic agent are independently administered to the subject once a day, and the discontinuation is about 2 weeks. In one embodiment, the first administration period and the second administration period are about 4 weeks, the MDM2 inhibitor and the therapeutic agent are independently administered to the subject once a week, and the discontinuation is about 2 weeks. In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II).In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, triptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutlin-3, Nutlin-3a, Nutlin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof. In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof. In one embodiment, the JAK inhibitor is AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerdulatinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel, tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.In one embodiment, the JAK inhibitor is selected from the group consisting of baricitinib phosphate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitinib phosphate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride. In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof. In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or barriers thereof. In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A. In one embodiment, the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutically acceptable salts thereof. In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, vistusertib, CC-223, OSI-027, voxtalisib, palomid 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharmaceutically acceptable salts thereof. In one embodiment, the PI3K inhibitor is selected from the group consisting of bupallisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, serabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof. In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharma- ceutically acceptable salts thereof. In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

[0495] In one embodiment, the MDM2 inhibitor is administered to the human intermittently, while the therapeutic agent is administered to the human non-intermittently. In one embodiment, the therapeutic agent is administered to the human intermittently, while the MDM2 inhibitor is administered to the human non-intermittently. In one embodiment, the MDM2 inhibitor and the therapeutic agent are both administered to the human intermittently. In one embodiment, the MDM2 inhibitor and the therapeutic agent are both administered to the human non-intermittently.

[0496] Methods for Treating Myeloproliferative Neoplasms (MPNs) In one embodiment, the invention provides a method of treating MPN in a human comprising administering a therapeutically effective amount of an MDM2 inhibitor to a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of an MDM2 inhibitor and a medicament for treating MPN in a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of an MDM2 inhibitor and a medicament for treating MPN in a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of an MDM2 inhibitor and a medicament for treating MPN in a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of an MDM2 inhibitor and a medicament for treating MPN in a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of an MDM2 inhibitor and a medicament for treating MPN in a patient in need thereof, the administering to said human a therapeutic agent at a dosage independently selected from the group consisting of 250 mg BID, 275 mg BID, 300 mg BID, 325 mg BID, 350 mg BID, 360 mg BID, 375 mg BID, and 480 mg BID; In one embodiment, the MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mast cell disease (SMCD). In one embodiment, the myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF). In one embodiment, the primary myelofibrosis (PMF) is selected from the group consisting of prefibrotic / early PMF and overt fibrotic PMF. In one embodiment, the MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myelogenous leukemia (aCML), juvenile myelomonocytic leukemia (JMML), hypereosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasm with ringed sideroblasts and thrombocytosis (MDS / MPN-RS-T). In one embodiment, the MDM2 inhibitor is a compound of Formula (I) or Formula (II). In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, triptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutlin-3, Nutlin-3a, Nutlin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof. In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof.In one embodiment, the JAK inhibitor is AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerdulatinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel, tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof. In one embodiment, the JAK inhibitor is selected from the group consisting of baricitinib phosphate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitinib phosphate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride. In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof. In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof. In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A.In one embodiment, the AKT inhibitor is SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutical acceptable salts thereof. In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, bistusertib, CC-223, OSI-027, voxtalisib, palomido 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolicib, and pharmaceutically acceptable salts thereof. In one embodiment, the PI3K inhibitor is selected from the group consisting of bupallisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, serabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof. In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharma- ceutically acceptable salts thereof. In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof. In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

[0497] In one embodiment, the invention provides a combination of a therapeutically effective amount of an MDM2 inhibitor and a therapeutic agent for use in treating MPN in a human, wherein the MDM2 inhibitor and the therapeutic agent are 15 mg QD, 25 mg QD, 30 mg QD, 50 mg QD, 60 mg QD, 75 mg QD, 100 mg QD, 120 mg QD, 150 mg QD, 175 mg QD, 200 mg QD, 225 mg QD, 240 mg QD, 250 mg QD, 275 mg QD, 300 mg QD, 325 mg QD, 350 mg QD, 360 mg QD, QD, 375 mg QD, 480 mg QD, 15 mg BID, 25 mg BID, 30 mg BID, 50 mg BID, 60 mg BID, 75 mg BID, 100 mg BID, 120 mg BID, 150 mg BID, 175 mg BID, 200 mg BID, 225 mg BID, 240 mg BID, 250 mg BID, 275 mg BID, 300 mg BID, 325 mg BID, 350 mg BID, 360 mg BID, 375 mg BID, and 480 mg BID. In one embodiment, the MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mast cell disease (SMCD). In one embodiment, the myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF). In one embodiment, the primary myelofibrosis (PMF) is selected from the group consisting of prefibrotic / early PMF and overt fibrotic PMF. In one embodiment, the MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myelogenous leukemia (aCML), juvenile myelomonocytic leukemia (JMML), hypereosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasm with ringed sideroblasts and thrombocytosis (MDS / MPN-RS-T). In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II). In one embodiment, the MDM2 inhibitor is The inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, triptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutlin-3, Nutlin-3a, Nutlin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof. In one embodiment, the MDM2 inhibitor is selected from the group consisting of a compound of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharma- ceutically acceptable salts thereof. In one embodiment, the JAK inhibitor is AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerdulatinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel, tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.In one embodiment, the JAK inhibitor is selected from the group consisting of baricitinib phosphate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitinib phosphate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride. In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof. In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof. In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A. In one embodiment, the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutical acceptable salts thereof. In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, vistusertib, CC-223, OSI-027, voxtalisib, palomid 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharmaceutically acceptable salts thereof.In one embodiment, the PI3K inhibitor is selected from the group consisting of bupallisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, serabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof. In one embodiment, the IDH inhibitor is enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305. , BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharma- ceutically acceptable salts thereof. In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof. In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

[0498] The above methods may be used as first line cancer therapy or following treatment with conventional chemotherapeutic active pharmaceutical ingredients, including cyclophosphamide, fludarabine (FC chemotherapy), and chlorambucil.

[0499] The combination of MDM2 inhibitors and therapeutic agents may be used in conjunction with radiation therapy, hormone therapy, surgery and immunotherapy, treatments well known to those skilled in the art. EXAMPLES

[0500] The embodiments encompassed herein will now be described with reference to the following examples, which are provided for illustrative purposes only, and the disclosure encompassed herein should in no way be construed as being limited to these examples, but rather as encompassing any and all variations that become evident as a result of the teachings provided herein.

[0501] Example 1: Effect of the combination of a compound of formula (I) and a therapeutic agent on polycythemia vera cells The procedure for testing the effect of the combination of the compound of formula (I) and a therapeutic agent on polycythemia vera cells follows that described in Lu, Blood, 2012, 120(15);3098-3105, which is incorporated by reference in its entirety. The following briefly describes the procedure. The therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0502] Cell preparation: Peripheral blood is obtained from polycythemia vera (PV) patients. Appropriate approval is obtained from the Institutional Review Board. Informed consent is obtained prior to the study. All patients meet the World Health Organization diagnostic criteria for polycythemia vera (PV). Peripheral blood samples are layered on Ficoll-Hypaque (1.077 g / mL; GE Healthcare) and low density mononuclear cells are separated via centrifugation. CD34+ cells are isolated using a human CD34+ cell selection kit (StemCell Technologies) according to the manufacturer's instructions. Purity of the CD34+ cell population is analyzed using a FACSCalibur flow cytometer (BD Biosciences) and purity is required to be at least 85% for all experiments. Fresh normal human bone marrow CD34+ cells are purchased from ALLCELLS as a control.

[0503] HPC assay The effect of the compound of formula (I) on polycythemia vera (PV) patients can be assessed by the HPC assay described in Lu, Blood, 2012, 3098-3105, which is incorporated by reference in its entirety. Briefly, CD34+ cells were cultured at 50 ng / mL of stem cell culture medium. The cells are cultured in serum-free medium (StemCell Technologies) containing Stem Cell Factor (SCF), 50 ng / mL thrombopoietin (TPO), 50 ng / mL fms-like tyrosine kinase 3 (Flt-3) ligand, and 50 ng / mL IL-3, and treated with various doses of the compound of formula (I) for 4 days. After 4 days of treatment, CD34+ cells are assayed in semi-solid medium as described in Bruno, Blood, 2006, 3128-3134, the entirety of which is incorporated by reference. Briefly, 5×10 cells per dish were cultured in duplicate in 1 mL of IMDM containing 1.1% methylcellulose and 20% FBS. 2 CD34+ cells are seeded and supplemented with 50 ng / mL each of SCF, TPO, Flt-3 ligand, IL-3, and GM-CSF, and 2 U / mL erythropoietin (EPO). Colonies are enumerated after 14 days of incubation, and individual colonies are picked and genotyped for JAK2V617F.

[0504] Nested allele-specific PCR for JAK2V617F-positive colonies Genomic DNA is isolated from randomized picked colonies using Extract-N-Amp Blood PCR Kits (Sigma-Aldrich). JAK2V617F is detected by using nested allele-specific PCR as described in Bruno, Blood, 2006, 3128-3134, which is incorporated by reference in its entirety. The final PCR products are analyzed on a 2.0% agarose gel. A 279bp product indicates allele-specific JAK2V617F positivity, while a 229bp product indicates JAK2V617F negativity. Colonies are classified as homozygous for JAK2V617F if they contain only the 279bp band, while heterozygous colonies are identified based on the presence of both the 279bp and 229bp bands.

[0505] Apoptosis assay The treated cells are collected and washed with PBS for staining with Annexin-V (BD Biosciences). The staining procedure is performed according to the protocol provided by the manufacturer. Data is acquired on a FACSCalibur flow cytometer (BD Biosciences), and at least 10,000 live cells are acquired for each analysis (BD FACS Diva software; BD Biosciences).

[0506] Western blot analysis CD34+ cells are purified from peripheral blood of patients with polycythemia vera (PV) and cultured in serum-free medium containing SCF, FL-3 ligand, IL-3, and TPO. Cells are treated with various doses of the compound of formula (I) for 4 hours. Cells are harvested and whole cell protein extracts are prepared using RIPA lysis buffer (Boston BioProducts) for Western blotting.

[0507] To prepare cytoplasmic and nuclear protein fractions of cells from patients with polycythemia vera (PV), CD34+ cells are expanded for 10 days in serum-free medium containing SCF, FL-3 ligand, and IL-3. CD34+ cells are then repurified and treated with various doses of the compound of formula (I) in the presence of SCF, FL-3 ligand, IL-3, and TPO for 48 hours. Protein extracts are prepared using NE-PER nuclear and cytoplasmic extraction reagent (Thermo Scientific) according to the manufacturer's instructions.

[0508] Prior to Western blotting, all samples were denatured by heating at 95°C for 5 min in Laemmli SDS-sample buffer (Boston BioProducts), and each sample was resolved on an SDS-PAGE gel and transferred to a polyvinyldifluoridine membrane (Bio-Rad). Antibodies (Cell Signaling Technologies) and E Phospho-p53, p53, MDM2, p21, p-STAT1, PUMA, and Bak were visualized using CL Western blotting reagents (Denville Scientific).

[0509] Example 2. Modeling transformation of JAK2V617F mutant MPN: Role of interferon alpha and MDM2 inhibition in preventing disease progression Philadelphia chromosome-negative myeloproliferative neoplasms are clonal hematological malignancies characterized by increased proliferation of myeloid lineages, resulting in abnormally large numbers of mature blood cells. These include polycythemia vera (PV), essential thrombocythemia (ET) and primary myelofibrosis (PMF). Contrary to PMF, PV and ET are chronic diseases with a median survival of more than 15 years. However, the main risk is progression to secondary acute myeloid leukemia (sAML), which is associated with a very poor outcome. Hematopoietic stem or progenitor cells in MPNs accumulate genetic and epigenetic alterations that model the phenotype and drive hematological evolution. The genomic landscape of sAML is close to that observed in therapy-related acute myeloid leukemia (tAML) harboring mutations in TP53. Indeed, leukemic transformation in PV and ET harbors TP53 mutations (mostly loss-of-function mutations) in roughly 35–50% of cases.

[0510] Treatment is limited to bone marrow transplantation when sAML develops, and currently available therapies (cytarabine, anthracyclines, hypomethylating agents, etc.) remain unsuccessful in such cases. Medical treatments for PMF developed so far are more or less palliative (JAK2 inhibitors, hypomethylating agents, hydroxyurea) and do not prevent disease progression.

[0511] Myeloproliferation and acute transformation in mouse models carrying the JAK2V617F mutation and inactivated or not inactivated with respect to TP53 are modeled, and the impact of treatment with interferon-alpha (IFNα), compounds of formula (I) or (II), or a combination of both drugs, on disease development in these models is tested.

[0512] To study disease progression in vivo, we study the cooperation of two mutant JAK2 with P53 deficiency by mouse model. We use inducible KI JAK2V617F mice that develop erythrocytosis, granulocytosis and thrombocythemia along with myelofibrosis. JAK2V617F mutation is expressed in these CD45.2 mice after crossing with CD45.2 Tg(Vav-cre)A2Kio mice. CD45.2 vav-cre mice crossed with JAK2V617F induce MPN in less than 6 weeks and cause the development of myelofibrosis without leukemia in 6 months. These JAK2V617F KI mice and vav-cre are crossed to P53 KO mice and then backcrossed on TP53 KO background to obtain vav-cre / TP53 KO mice on the one hand and JAK2V617F floxed + / - / TP53 KO mice on the other hand. These two types of mice are crossed to obtain CD45.2 vav-cre / JAK2V617F / TP53 KO mice.

[0513] The combination of JAK2V617F and P53 KO has already been studied via a retroviral mouse model, which develops AML with a massive expansion of erythroid megakaryocytic precursors. However, these studies used retroviral mouse models, and the expression levels of the transgene vary from clone to clone, and the JAK2V617F KI mice used here would be closer to what occurs in patients, where all stem cells express JAK2V617F at the same level.

[0514] Use bone marrow transplant cells to mix normal and mutant cells in mouse recipients. Next, JAK2V617F mouse bone marrow (CD45.2 phenotype), JAK2V Bone marrow cells from 617F / TP53 KO mice (CD45.2), or CD451+2 normal mice are sorted. Healthy mice (WT) of CD45.1 phenotype serve as hosts after irradiation. Either JAK2V617F CD45.1 and normal CD451+2 cells in a CD45.2 background, or CD45.1 JAK2V617F / TP53 KO cells with CD451+2 normal cells in CD45.2 irradiated mice are transplanted. The ratio of pathological to normal cells is 20 / 80, a ratio previously demonstrated to be able to induce MPNs in recipients in less than 2 months. 10 mice are transplanted from one donor, resulting in 10 transplanted mice / pathological mouse. Groups of 20 mice are tested.

[0515] To measure the effect of IFN alpha, compounds of formula (I) or (II), or combination therapy on the potential effect on the malignant clone, the transplanted mice are divided into four groups that are treated on the 15th day of BMT (normalization of blood cell counts after transplantation): one with IFN alpha, one with compounds of formula (I) or (II), one with a combination of both drugs, and one with PBS as control. Chimerism and phenotype (weight, hematological parameters, etc.) are analyzed weekly (for blood) and at 1, 3, and 6 months for bone marrow chimerism in each stem cell and progenitor compartment (SLAM, short-term, precursors). A secondary transplant is performed when the chimerism shows a statistically significant modification in the blood. Monitoring of hematological parameters helps to detect chronic diseases, i.e. PV / MF phase (increased number of red blood cells, platelets, etc.) or AML (increased number of circulating immature cells). If the treatment alters chimerism and allows selection of normal cells, an increased proportion of CD451+2 cells that have a low or no conversion rate to AML is observed in the treated mice population. Such an outcome indicates that the treatment is capable of reducing or curing the JAK2V617F clone and / or the P53 mutated / inactivated JAK2V617F subclone, respectively.

[0516] Example 3: Effect of the combination of the compound of formula (I) and decitabine on MPN-BP stem cells Preparation of MPN-BP cells Currently, CD3 from one patient with WT TP53 gene and MPN-BP + It has been shown that cell-depleted mononuclear cells (MNCs) can serially engraft and cause leukemia in NSG mice. To recover sufficient cells to evaluate the effect of the combination of the compound of formula (I) and decitabine on MPN-BP stem cells, MPN-BP cells collected from the bone marrow (BM) or spleen of NSG mice are passaged in NSG mice by serial transplantation. Mutation patterns and karyotypic abnormalities present in the cells after serial transplantation are determined by capture-based next-generation sequencing (NGS) and fluorescent in situ hybridization (FISH).

[0517] Effect of the combination of compounds of formula (I) with decitabine To examine the effect of the combination of the compound of formula (I) and decitabine on MPN-BP stem cells, 0.5 to 2 × 10 cells harvested from NSG mice fed with MPN-BP cells were 6 The cells / mouse are transplanted into sublethally irradiated (220 cGy) 8-9 week old NSG mice. The mice are then monitored for general condition daily and body weight measured weekly. Peripheral blood is collected from the recipient mice 28 days after transplantation and analyzed using complete blood count (CBC) performance and flow cytometry analysis to determine whether human MPN-BPs have developed in these mice. These mice are used in further studies.

[0518] High dose testing of compounds of formula (I) or decitabine Three to four mice were cultured to develop MPN-BP and have similar leukemic burdens in the peripheral blood. Mice are randomly divided into 4 groups. Two of these groups are treated with vehicle or a compound of formula (I) (at a higher dose of either 100 or 150 mg / kg) by oral gavage once a day for 7 days. The other two groups are treated with vehicle or decitabine at 5 mg / kg by IP injection three times a week for 7 days. Peripheral blood blast counts are monitored weekly after treatment using flow cytometric analysis. Tolerance to treatment is assessed by daily body weight (BW) measurements. These analyses allow the establishment of the dynamics of MPN-BP reversion after each drug treatment, which is used to determine treatment-free intervals for subsequent survival and combination treatment studies.

[0519] Combination therapy with low doses of the compound of formula (I) and decitabine NSG mice transplanted with MPN-BP cells are randomly assigned to four groups of 4-5 mice. These mice are treated with the compound of formula (I), decitabine alone or in combination as follows: Group 1: compound of formula (I) + PBS, Group 2: vehicle + decitabine, Group 3: compound of formula (I) + decitabine, Group 4: vehicle + PBS. 30-50 mg / kg of the compound of formula (I) or vehicle is administered once daily by oral gavage on days 1-7 for 7 days. Decitabine (2.5 mg / kg) or PBS is administered three times a week by IP injection for 7 days. Treatment is repeated for up to three cycles. After treatment, survival and disease progression are monitored, and the mice are euthanized and analyzed. After euthanasia of the mice, cells are harvested from the BM, spleen, and peripheral blood. Human CD45 in these organs is detected. + , CD34 + , CD33 + , CD14 + , Gly A + , CD41a + , CD19 + , and CD3 + The presence of cells is determined by mAb staining and flow cytometric analysis.

[0520] Example 4: An open-label, multicenter, phase 1b / 2 study of the safety and efficacy of the compound of formula I in combination with low-dose cytarabine (LDAC) or decitabine in patients with acute myeloid leukemia (AML) All subjects will receive the compound of formula I in combination with low dose cytarabine (LDAC) or decitabine. Dosage Formulation for the Compound of Formula I: The compound is formulated as an immediate release oral solid dosage form in tablet strengths of 15 mg and 60 mg. Administration: The compound of formula I is taken in the morning on an empty stomach (no food or liquids other than water 2 hours before the drug) and food and liquid intake (except water) should be refrained from for 2 hours after administration. Tablets should not be crushed, chewed, or dissolved in water. The compound of formula I is administered on days 1-7 of each treatment cycle, which is 28 days.

[0521] For cytarabine, LDAC is administered by subcutaneous (SC) injection at 20 mg / m2 / day once daily on days 1-10 of each 28-day cycle. For decitabine, LDAC is administered by intravenous (IV) injection at 20 mg / m2 / day once daily on days 1-5 of each 28-day cycle. Test reasoning Part A (Phase 1b): The subject population consists of male or female individuals aged 18 years or older with relapsed or refractory AML. Part B (Phase 2): The subject population consists of male or female individuals aged 18 years or older with newly diagnosed, relapsed, or refractory AML secondary to myeloproliferative neoplasms (MPNs).

[0522] Test Treatment All subjects will receive a compound of Formula I in combination with low-dose cytarabine (LDAC) or decitabine.

[0523] Study design Part A (Phase 1b): The Phase 1b portion of this study will follow a 3+3 dose escalation design to determine the recommended Phase 2 dose (PR2D) of the compound of Formula I for the Phase 2 portion of this study. Investigators may assign subjects to either Cohort 1 (LDAC) or Cohort 2 (decitabine) if there are open spots for enrollment in that cohort and if the subject meets the eligibility criteria for that cohort.

[0524] Dose Level 1 (Starting Dose) of the Compound of Formula I: 20 mg / m once daily on days 1-10 of each 28-day cycle. 2 240 mg orally once daily on days 1-7 of each 28-day cycle (Cohort 1A, n=3-6 subjects) or 20 mg / m orally once daily on days 1-5 of each 28-day cycle in combination with SC administration of LDAC / day 2 / day decitabine administered IV (Cohort 2A, n = 3–6 subjects).

[0525] If there are no dose-limiting toxicities (DLTs) in the first three subjects enrolled in dose level 1 (Cohort 1A or Cohort 2A), then dose level 2 will open for that cohort. If there is at least one DLT among the first three subjects enrolled in Cohort 1A or Cohort 2A, then three additional subjects will be added to the cohort in which the DLT occurred, for a total of six subjects in that cohort. If there is one or less DLT among six subjects in a cohort, then dose level 2 will open for that cohort. If there are two or more DLTs in Cohort 1A or Cohort 2A, then the dose level 1 step-down cohort will open.

[0526] Dose Level 1 Step-Down Cohort: 20 mg / m once daily on days 1-10 of each 28-day cycle 2Subjects received 180 mg of the compound of formula I orally once daily on days 1-7 of each 28-day cycle in combination with SC administration of LDAC / day (Cohort 1A-1, n=3-6 subjects) or decitabine IV at 20 mg / m2 / day once daily on days 1-5 of each 28-day cycle (Cohort 2A-1, n=3-6 subjects). If there are no DLTs in the first 3 subjects enrolled in a dose level 1 step-down (Cohort 1A-1 or Cohort 2A-1), the dose level 1 step-down will be declared the RP2D for that cohort. If there is at least one DLT among the first 3 subjects enrolled in Cohort 1A-1 or Cohort 2A-1, 3 additional subjects will be added to the cohort in which the DLT occurred, for a total of 6 subjects in that cohort. If there is 1 or less DLT among 6 subjects in a cohort, dose level 1 step-down will be declared the recommended RP2D for that cohort. If there are 2 or more DLTs in dose level 1 step-down (cohort 1A-1 or cohort 2A-1), the cohort will be closed.

[0527] Dose Level 2: 20 mg / m once daily on days 1-10 of each 28-day cycle 2 360 mg of the compound of Formula I administered orally once daily on days 1-7 of each 28-day cycle (Cohort 1B, n=3-6 subjects) or 20 mg / m once daily on days 1-5 of each 28-day cycle in combination with SC administration of LDAC / day. 2 100 mg / day decitabine IV (Cohort 2B, n=3-6 subjects). If there are no DLTs in the first 3 subjects enrolled in dose level 2 (Cohort 1B or Cohort 2B), dose level 3 of the compound of Formula I will be opened for that cohort. If there is at least one DLT among the first 3 subjects enrolled in dose level 2 (Cohort 1B or Cohort 2B), add 3 additional subjects to the cohort in which the DLT occurred for a total of 6 subjects in that cohort. If there is 1 or less DLT among 6 subjects in a cohort, dose level 3 will be opened for that cohort. If there are 2 or more DLTs in Cohort 1B or Cohort 2B, the dose level 2 step-down cohort will be opened.

[0528] Dose Level 2 Step-Down Cohort: 20 mg / m once daily on days 1-10 of each 28-day cycle 2 300 mg of the compound of formula I administered orally once daily on days 1-7 of each 28-day cycle (Cohort 1B-1, n=3-6 subjects) or 20 mg / m once daily on days 1-5 of each 28-day cycle in combination with SC administration of LDAC / day. 2 Decitabine was administered IV at doses of 100 mg / day (Cohort 2B-1, n=3-6 subjects). If there are no DLTs in the first three subjects enrolled in the step-down (Cohort 1B-1 or Cohort 2B-1), the dose level 2 step-down will be declared the RP2D for that cohort. If there is at least one DLT among the first three subjects enrolled in Cohort 1B-1 or Cohort 2B-1, add three additional subjects to the cohort in which the DLT occurred for a total of six subjects in that cohort. If there is one or less DLT among six subjects in a cohort, the dose level 2 step-down will be declared the recommended RP2D for that cohort. If there are two or more DLTs in the dose level 2 step-down (Cohort 1B-1 or Cohort 2B-1), dose 1 for that cohort will be declared the RP2D.

[0529] Dose Level 3: Cycle 1 only: 480 mg of the compound of formula I administered orally once daily on days 1-7 of the first 28-day cycle in combination with LDAC or decitabine. Cycle 2 and beyond: 360 mg of the compound of formula I administered orally once daily on days 1-7 of each 28-day cycle in combination with LDAC or decitabine. 20 mg / m once daily on days 1-10 of each 28-day cycle. 2 / day LDAC SC (Cohort 1C, n = 3–6 subjects) or 20 mg / m once daily on days 1–5 of each 28-day cycle 2IV decitabine / day (Cohort 2C, n=3–6 subjects). If there are no DLTs in the first 3 subjects enrolled in Cohort 1C or Cohort 2C, dose level 3 is considered the RP2D for that cohort. If there is at least 1 DLT among the first 3 subjects enrolled in Cohort 1C or Cohort 2C, add 3 additional subjects to the cohort in which the DLT occurred for a total of 6 subjects in that cohort. If there is 1 or less DLT among 6 subjects in a cohort, that dose is declared the RP2D for that cohort. If there are 2 or more DLTs in Cohort 1C or Cohort 2C, the dose level 3 step-down cohort opens.

[0530] Dose Level 3 Step-Down Cohort: Cycle 1 only: 420 mg of the compound of Formula I administered orally once daily on days 1-7 of the first 28-day cycle in combination with LDAC or decitabine. Cycle 2 and onwards: 360 mg of the compound of Formula I administered orally once daily on days 1-7 of each 28-day cycle in combination with LDAC or decitabine. 20 mg / m administered orally once daily on days 1-10 of each 28-day cycle. 2 / day LDAC SC (Cohort 1C-1, n = 3–6 subjects) or 20 mg / m once daily on days 1–5 of each 28-day cycle 2 IV decitabine / day (Cohort 2C-1, n=3–6 subjects). If there are no DLTs in the first 3 subjects enrolled in dose level 3 step-down (Cohort 1C-1 or Cohort 2C-1), the dose level 3 step-down will be declared the RP2D for that cohort. If there is at least 1 DLT among the first 3 subjects enrolled in Cohort 1C-1 or Cohort 2C-1, add 3 additional subjects to the cohort in which the DLT occurred for a total of 6 subjects in that cohort. If there is 1 or less DLT among 6 subjects in a cohort, the dose level 3 step-down will be declared the recommended RP2D for that cohort. If there are 2 or more DLTs in dose level 3 step-down (Cohort 1C-1 or Cohort 2C-1), dose 2 for that cohort will be declared the RP2D.

[0531] The above description is for the purpose of teaching those skilled in the art how to practice the invention and is not intended to describe in detail all of the obvious modifications and variations that will become apparent to those skilled in the art upon reading the description. However, all such obvious modifications and variations are intended to be included within the scope of the invention as defined by the following claims. The claims are intended to cover any sequence of elements and steps that is effective to meet the objectives intended therein, unless the context specifically indicates otherwise.

Claims

1. A method of treating myeloproliferative neoplasms (MPNs), comprising administering to a human in need thereof a therapeutically effective amount of an MDM2 inhibitor in combination with a therapeutic agent, wherein the MDM2 inhibitor is a compound of formula (I) or a compound of formula (II): 【Chemistry 1】 or a pharma- ceutically acceptable salt thereof, wherein the therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

2. 2. The method of claim 1, wherein the MPN is polycythemia vera (PV).

3. 2. The method of claim 1, wherein the MPN is thrombocythemia.

4. 4. The method of claim 3, wherein the thrombocythemia is essential thrombocythemia (ET).

5. 2. The method of claim 1, wherein the MPN is myelofibrosis.

6. 6. The method of claim 5, wherein the myelofibrosis is selected from primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF).

7. 2. The method of claim 1, wherein the MPN is chronic myeloid leukemia.

8. 2. The method of claim 1, wherein the MPN is systemic mastocytosis (SM).

9. 2. The method of claim 1, wherein the MPN is chronic neutrophilic leukemia (CNL).

10. 2. The method of claim 1, wherein the MPN is a myelodysplastic syndrome (MDS).

11. 2. The method of claim 1, wherein the MPN is mast cell disease (SMCD).

12. 2. The method of claim 1, wherein the MPN is chronic eosinophilic leukemia.

13. 2. The method of claim 1, wherein the MPN is chronic myelomonocytic leukemia (CMML).

14. 2. The method of claim 1, wherein the MPN is atypical chronic myeloid leukemia (aCML).

15. 2. The method of claim 1, wherein the MPN is juvenile myelomonocytic leukemia (JMML).

16. 2. The method of claim 1, wherein the MPN is hypereosinophilic syndrome (HES).

17. The method of any one of claims 1 to 16, wherein the compound of formula (I) or formula (II) is in a crystalline form.

18. 18. The method of claim 17, wherein the crystalline form is characterized by an X-ray powder diffraction pattern comprising at least three peaks at diffraction angles of degrees 2 theta selected from the group consisting of peaks at about 11.6, 12.4, 18.6, 19.0, 21.6, and 23.6±0.

1.

19. The method according to any one of claims 1 to 16, wherein said compound of formula (I) or formula (II) is in free form.

20. The method of any one of claims 1 to 16, wherein the compound of formula (I) or formula (II) is in amorphous form.

21. The method of any one of claims 1 to 20, wherein the MDM2 inhibitor is a pharma- ceutically acceptable salt of a compound of formula (I) or formula (II).

22. 22. The method of any one of claims 1 to 21, wherein the compound of formula (I) or formula (II) is administered once daily at a dose selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

23. 22. The method of any one of claims 1 to 21, wherein the compound of formula (I) or formula (II) is administered twice daily at a dose selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

24. 24. The method of any one of claims 1-23, wherein the human is treated with the MDM2 inhibitor for a period selected from the group consisting of about 14 days, about 21 days, about 28 days, about 35 days, about 42 days, about 49 days, and about 56 days.

25. The method of any one of claims 1 to 24, wherein the compound of formula (I) or formula (II) is administered orally.

26. The JAK inhibitor is AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerduratinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-I N-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, pacritinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG10134 8, tofacitinib (3R, 4S), tofacitinib (3S, 4R), tofacitinib (3S, 4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharma- ceutically acceptable salts thereof.

27. 26. The method of any one of claims 1 to 25, wherein the JAK inhibitor is selected from the group consisting of baricitinib phosphate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitinib phosphate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride.

28. The method of any one of claims 26-27, wherein the JAK inhibitor is administered orally.

29. 13. The method of claim 1, wherein the MDM2 inhibitor is administered prior to administration of the therapeutic agent.

30. 13. The method of claim 1, wherein the MDM2 inhibitor is administered after administration of the therapeutic agent.

31. The method of claim 1 , wherein the MDM2 inhibitor is administered simultaneously with administration of the therapeutic agent.

32. The method of any one of claims 1 to 31, wherein the therapeutically effective amount of the MDM2 inhibitor is 100 mg.

33. 2. The method of claim 1, wherein the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof.

34. The method of claim 1, wherein the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof.

35. 2. The method of claim 1, wherein the anti-PD-L2 inhibitor is rHIgM12B7A.

36. 2. The method of claim 1, wherein the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutically acceptable salts thereof.

37. 2. The method of claim 1, wherein the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, vistusertib, CC-223, OSI-027, voxtalisib, palomid 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharmaceutically acceptable salts thereof.

38. 2. The method of claim 1, wherein the PI3K inhibitor is selected from the group consisting of bupallisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, seravelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof.

39. 2. The method of claim 1, wherein the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharma- ceutically acceptable salts thereof.

40. 2. The method of claim 1, wherein the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.

41. 2. The method of claim 1, wherein the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha-n3, and combinations thereof.

42. 42. The method of any one of claims 1 to 41, wherein the MPN in the human subject has a JAK2V617F mutation.

43. A combination of a therapeutically effective amount of an MDM2 inhibitor and a therapeutic agent for use in treating myeloproliferative neoplasms (MPNs), wherein the MDM2 inhibitor is a compound of formula (I) or a compound of formula (II) 【Chemistry 2】 or a pharma- ceutically acceptable salt thereof, wherein said therapeutic agent is selected from the group consisting of a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, a PI3K inhibitor, an AKT inhibitor, an mTOR inhibitor, a nucleoside analog, and combinations thereof.

44. 44. The use according to claim 43, wherein the MPN is polycythemia vera (PV).

45. 44. The use of claim 43, wherein the MPN is thrombocythemia.

46. 46. ​​The use according to claim 45, wherein the thrombocythemia is essential thrombocythemia (ET).

47. 44. The use of claim 43, wherein the MPN is myelofibrosis.

48. 48. The use of claim 47, wherein the myelofibrosis is selected from primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF).

49. 44. The use of claim 43, wherein the MPN is chronic myelogenous leukemia.

50. 44. The use of claim 43, wherein the MPN is systemic mastocytosis (SM).

51. 44. The use of claim 43, wherein the MPN is chronic neutrophilic leukemia (CNL).

52. 44. The use of claim 43, wherein the MPN is myelodysplastic syndrome (MDS).

53. 44. The use of claim 43, wherein the MPN is mast cell disease (SMCD).

54. 44. The use of claim 43, wherein the MPN is chronic eosinophilic leukemia.

55. 44. The use of claim 43, wherein the MPN is chronic myelomonocytic leukemia (CMML).

56. 44. The use of claim 43, wherein the MPN is atypical chronic myeloid leukemia (aCML).

57. 44. The use of claim 43, wherein the MPN is juvenile myelomonocytic leukemia (JMML).

58. 44. The use of claim 43, wherein the MPN is hypereosinophilic syndrome (HES).

59. The use according to any one of claims 43 to 58, wherein the compound of formula (I) or formula (II) is in a crystalline form.

60. 60. The use of claim 59, wherein the crystalline form is characterized by an X-ray powder diffraction pattern comprising at least three peaks at diffraction angles 2 theta degrees selected from the group consisting of peaks at about 11.6, 12.4, 18.6, 19.0, 21.6 and 23.6±0.

1.

61. The use according to any one of claims 43 to 58, wherein said compound of formula (I) or formula (II) is in free form.

62. The use according to any one of claims 43 to 58, wherein the compound of formula (I) or formula (II) is in amorphous form.

63. The use according to any one of claims 43 to 62, wherein the MDM2 inhibitor is a pharma- ceutically acceptable salt of a compound of formula (I) or formula (II).

64. 64. The use of any one of claims 43 to 63, wherein the compound of formula (I) or formula (II) is administered once daily at a dose selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

65. 64. The use of any one of claims 43 to 63, wherein the compound of formula (I) or formula (II) is administered twice daily at a dose selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

66. 66. The use of any one of claims 43-65, wherein the human is treated with the MDM2 inhibitor for a period selected from the group consisting of about 14 days, about 21 days, about 28 days, about 35 days, about 42 days, about 49 days, and about 56 days.

67. The use according to any one of claims 43 to 66, wherein the compound of formula (I) or formula (II) is administered orally.

68. The JAK inhibitor is selected from the group consisting of AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, cerduratinib, CHZ868, CYT387, decernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, pacritinib, peficitinib, 44. The use of claim 43, wherein the compound is selected from the group consisting of nib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharma- ceutically acceptable salts thereof.

69. 44. The use of claim 43, wherein the JAK inhibitor is selected from the group consisting of baricitinib phosphate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitinib phosphate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride.

70. 70. The use of any one of claims 68 to 69, wherein the JAK inhibitor is administered orally.

71. 68. The use according to any one of claims 43 to 67, wherein the MDM2 inhibitor is administered prior to administration of the therapeutic agent.

72. 68. The use according to any one of claims 43 to 67, wherein the MDM2 inhibitor is administered after administration of the therapeutic agent.

73. The use according to any one of claims 43 to 67, wherein the MDM2 inhibitor is administered simultaneously with administration of the therapeutic agent.

74. 74. The use according to any one of claims 43 to 73, wherein the therapeutically effective amount of the MDM2 inhibitor is 100 mg.

75. 44. The use of claim 43, wherein the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof.

76. The use according to claim 43, wherein the PD-L1 inhibitor is an anti-PD-L1 antibody, in one embodiment the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof.

77. 44. The use of claim 43, wherein the anti-PD-L2 inhibitor is rHIgM12B7A.

78. 44. The use of claim 43, wherein the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharma- ceutically acceptable salts thereof.

79. 44. The use of claim 43, wherein the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, wortmannin, ascomycin, tacrolimus, KU-0063794, sapanisertib, AZD8055, bistusertib, CC-223, OSI-027, voxtalisib, palomid 529, PP 242, dactolisib, BGT226, apitolisib, omipalisib, PF-04691502, gedatolisib, and pharmaceutically acceptable salts thereof.

80. 44. The use of claim 43, wherein the PI3K inhibitor is selected from the group consisting of bupallisib, alpelisib, pictilisib, piralalisib, sonolisib, copanlisib, CH5132799, seravelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselisib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof.

81. 44. The use of claim 43, wherein the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, vorasidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharma- ceutically acceptable salts thereof.

82. 44. The use of claim 43, wherein the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.

83. The interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, pegylated interferon-alpha-2a, pegylated interferon-alpha-2b, pegylated interferon-alpha-2c, pegylated interferon-alpha-n1, pegylated interferon-alpha- n3, and combinations thereof.

84. The use according to any one of claims 43 to 83, wherein the MPN in a human subject has a JAK2V617F mutation.

Images