Gene therapy for age-related diseases and conditions

Abstract

To provide methods of gene therapy for treating or preventing age-related diseases or conditions by regulating one or more functional proteins associated with age-related diseases or conditions.SOLUTION: Provided are a viral vector comprising a first nucleic acid sequence comprising a gene capable of expressing a mammalian protein or an inhibitor mRNA product, the gene being selected from a particular group, and the first nucleic acid sequence being operably linked to a first regulatory sequence for expression of the product in mammalian cells; and a gene therapy using the viral vector.SELECTED DRAWING: None

Description

[Technical field]

[0001] Related Application Data This application claims priority to U.S. Provisional Application No. 62 / 339,182, filed May 20, 2016, and U.S. Provisional Application No. 62 / 421,665, filed November 14, 2016, both of which are incorporated by reference in their entireties for all purposes. [Background technology]

[0002] Aging is the gradual loss and deterioration of function at the cellular, tissue, and organ levels, leading to increased susceptibility to disease and external stressors, and ultimately death. All organisms age, but it is possible to delay, minimize, or manipulate the effects of aging. Numerous experiments have demonstrated the ability to increase maximum lifespan and healthspan, along with reduced susceptibility to other age-related pathologies. Aging interventions tested to date include environmental manipulations such as caloric restriction (CR), small molecule drugs such as rapamycin, and genetic manipulations achieved by creating transgenic animals such as Ames dwarf and Snell dwarf mice. These experiments have led to a greater understanding of the mechanisms involved in aging, but are not suitable for return to aging human and pet populations. Caloric restriction requires strict adherence to dietary restrictions, and evidence to date suggests that caloric restriction may not be a means of treatment. Rapamycin has immunomodulatory effects and can increase vulnerability to certain pathogens. Also, creating transgenic animals is not applicable to all existing organisms. AAV delivery of hTERT into mice with a cancer-resistant genetic background is described in Bernardes de Jesus B. et al. (2012) EMBO Mol Med. 4(8):691-704.

[0003] Gene therapy approaches are known. For example, GLYBERA is a human gene therapy by uniQure to treat lipoprotein lipase deficiency (LPLD) by adding a working copy of the responsible gene via intramuscular injection of AAV (adeno-associated virus). SPK-RPE65 is a human gene therapy by Spark Therapeutics to treat a rare blinding condition caused by a non-functional RPE65 gene. Summary of the Invention [Means for solving the problem]

[0004] The present disclosure provides gene therapy methods, such as combination gene therapy methods to provide or regulate one or more endogenous proteins. The present disclosure provides methods of treating or preventing age-related diseases and conditions or the age-related phenotypes using gene therapy. The present disclosure provides identification of genes that may be associated with certain diseases and conditions associated with ageing. The present disclosure provides regulation of such genes by increasing or decreasing the protein associated with the gene. The present disclosure provides increasing the functional protein associated with a gene by introducing a nucleic acid encoding the functional protein to be expressed in a cell. Expression results in an increase in the amount of the functional protein that provides a therapeutic or preventative effect, either intracellularly or secreted. The present disclosure provides inhibiting a gene to decrease the functional protein associated with the gene by introducing a nucleic acid encoding an inhibitory RNA that, when expressed, binds to the gene or messenger RNA and inhibits expression of the functional protein. The present disclosure provides inhibiting a functional protein to decrease the activity of the functional protein by introducing a nucleic acid encoding a protein inhibitor, such as a soluble receptor protein, that, when expressed, binds to the functional protein. The present disclosure provides gene therapy methods using a gene construct that targets cells in an animal and delivery of the gene construct using a vector, such as a viral vector. The present disclosure provides gene therapy methods using cell-targeted gene constructs in animals and delivery of the gene constructs using means such as liposomes, synthetic or naturally occurring polymers, electroporation, coated or uncoated nanoparticle delivery, gene gun delivery, laser-mediated transfection (optoporation or phototransfection). See, e.g., Kim, TK et al. (2010) Analytical and Bioanalytical Chemistry. 397(8):3173-3178. The present disclosure provides gene therapy methods using cell-targeted gene constructs in animals and delivery of the gene constructs, where the gene constructs are engineered from original DNA to miRNA, shRNA, RNAi, or mRNA (wherein the mRNA consists of a 5' cap and a 3' polyA or equivalent).According to a further aspect, the RNA is targeted to the ribosome for translation using a 5' cap analogue known to one skilled in the art or a 3' polyA analogue known to one skilled in the art. Insofar as the gene or gene product, DNA encoding said gene, or mRNA or processed pri-mRNA or miRNA corresponding to said gene is modified or regulated to effect a cellular effect in the therapeutic or prophylactic methods described herein, the present disclosure provides for the use of said gene or gene product, DNA encoding said gene, or mRNA or processed pri-mRNA or miRNA corresponding to said gene in the gene therapy methods described herein.

[0005] Preventive or therapeutic methods are provided to address age-related diseases or conditions by regulating or providing specific proteins associated with age-related diseases or conditions. Methods are provided to rejuvenate organisms, including humans and other mammals, by regulating or providing specific proteins, genes, gene products encoding said genes, or mRNAs or processed pri-mRNAs or miRNAs corresponding to said genes, which correspond to genes associated with age-related diseases and conditions. The present disclosure provides gene therapy methods in which one or more nucleic acids, such as genes, are delivered to one or more target cells in an animal. The present disclosure provides delivery of multiple nucleic acids to cells using a single vector, including a single promoter driving expression of the multiple nucleic acids. One or more nucleic acids are expressed to produce one or more corresponding proteins, and the one or more proteins change the state of the organism. The present disclosure provides combination therapy in which different cell types are targeted by one or more nucleic acids in an animal.

[0006] The present disclosure provides combination therapy in which one or more cellular processes in a cell are targeted by one or more nucleic acids. The present disclosure provides gene therapy using a viral vector, such as a parvovirus virion. The present disclosure provides gene therapy using a viral vector, such as an adeno-associated virus ("AAV"). The adeno-associated virus inserts an exogenous gene into a cell, and the protein encoded by the exogenous gene becomes expressed. In this way, the protein, whether a functional protein, an inhibitory RNA, or an inhibitory protein, will alter the cell and / or the organism that contains the cell.

[0007] The present disclosure provides for slowing, inhibiting, preventing, or reversing age-related diseases or conditions. Examples of age-related or other diseases or conditions include one or more of cardiovascular disease, diabetes, atherosclerosis, obesity, cancer, infection, and neurological disorders. The present disclosure provides long-term gene therapy methods for treating and / or preventing age-related or other diseases or conditions. The methods include reversing age-related diseases and conditions and correcting these pathological conditions to result in healthspan (good quality of life for many years) and extended lifespan.

[0008] The present disclosure provides a method for identifying a gene or set of genes to be regulated that prevents or treats one or more diseases or conditions, such as age-related diseases or conditions. The gene or set of genes is identified as being associated with an age-related disease or condition. The gene is determined to be associated or unassociated with a particular tissue type, and appropriate regulation of the gene can be determined using a desired method. Furthermore, genes associated with a particular tissue type can benefit from regulation using a specific vector that delivers a nucleic acid, inhibitory RNA, or inhibitory protein to a particular tissue type cell to regulate the amount or activity of the protein in the particular tissue type cell. A tissue-specific promoter can be used to express the nucleic acid.

[0009] Exemplary nucleic acids encoding specific functional proteins, inhibitory RNAs, or inhibitory proteins are provided in Appendix A, the sequences of which are provided in Appendix A or are known in the literature or readily available. Similarly, the sequences of the functional proteins, inhibitory RNAs, or inhibitory proteins may be known to those of skill in the art or derived from nucleic acid sequences. Appendix B includes the DNA and amino acid sequences of the mouse version of the gene, and pri-miRNA DNA constructs that target multiple RNA species.

[0010] A functional protein as described herein may be a full-length protein or may be a protein that differs from the full-length protein but retains all or a portion of the activity of the full-length protein.

[0011] Additional features and advantages of particular embodiments of the invention will become more fully apparent from the following description of the embodiments and drawings, and from the claims. [Brief description of the drawings]

[0012] [Figure 1] Representative echocardiograms 7 weeks after AAC surgery. [Diagram 2] 1 is a graph of data showing TGFb1 knockdown versus dose. [Diagram 3] 1 is a graph of data showing the percentage of fibrosis and associated images. [Figure 4] 13 shows images showing WGA staining of control and treated heart sections. [Diagram 5] 1 is a graph of data showing changes in cardiac parameters in controls versus sTGFbR2-FC administration. [Figure 6] This is a typical trichrome stained image. [Figure 7] Graph of survival rate versus time (days). [Figure 8A] FIG. 1 is a graph of weight loss versus time (days) for FGF21. [Figure 8B]1 is a graph of weight loss versus time (days) for various FGF21 gene therapies. [Figure 9] Graph of weight loss versus time (days) for GDF15, adiponectin, ZAG, and Nrf2. [Figure 10] Vector map of the viral construct containing the ITRs promoter sTGFbR2-Fc and 3'UTR. [Figure 11] 1 is a vector map of the viral construct containing the ITRs promoter Nrf2 and the 3′UTR. [Figure 12] Vector maps of possible constructs of the seven Pri-miRNAs and the order in which they are ligated are shown. The locations where mismatches are planned in the "shRNA" portion for proper processing of the miRNA are also marked in red. [Figure 13] Vector maps of possible constructs of the six Pri-miRNAs and the order in which they are ligated are shown. The locations where mismatches are planned in the "shRNA" portion for proper processing of the miRNA are also marked in red. [Figure 14] The ELISA assay design is shown. [Figure 15] Binding data of soluble TGFb receptor 2 to TGFb1 in dog serum is shown. [Figure 16] 1 is a graph of food intake of mice treated with FGF21 versus food intake of control mice. [Figure 17] Data are shown for FGF21 treated mice versus control mice. [Figure 18] Glucose level data is shown. [Figure 19] Fractional shortening data is shown. [Figure 20] 4 shows survival data following gene therapy. [Figure 21-1] FIG. 21 shows data focusing on increased healthy lifespan. [Figure 21-2] FIG. 21 shows data focusing on increased healthy lifespan. [Figure 21-3]FIG. 21 shows data focusing on increased healthy lifespan. [Figure 21-4] FIG. 21 shows data focusing on increased healthy lifespan. [Figure 21-5] FIG. 21 shows data focusing on increased healthy lifespan. [Figure 22] 1 shows kidneys from mice that received gene therapy as described herein versus kidneys from control mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] The present disclosure provides gene therapy methods in which one or more nucleic acids encoding functional proteins, inhibitory RNAs, or inhibitory proteins are provided to cells in a subject, the one or more nucleic acids being administered by one or more vectors or combined into a single viral vector, such as AAV, to treat or prevent a disease or condition associated with aging and age-related physiological decline.

[0014] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly indicates otherwise. Thus, for example, reference to "a protein" includes two or more proteins, and reference to "an excipient" includes two or more excipients.

[0015] The use of "or" is further understood to mean "and / or" unless otherwise stated. Similarly, "comprise," "comprises," "comprising," "includes," and "including" are interchangeable and are not intended to be limiting. Also, when the description of various embodiments uses the term "comprising," those of ordinary skill in the art will understand that in some specific instances, the description can alternatively be made using the words "consisting essentially of" or "consisting of."

[0016] The foregoing general description, including the drawings, and the following detailed description are exemplary and explanatory only and are not restrictive of the present disclosure.

[0017] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0018] definition In connection with the present disclosure, technical and scientific terms used in the description herein shall have the meanings that are commonly understood by those of ordinary skill in the art, unless otherwise defined. Accordingly, the following terms are intended to have the following meanings:

[0019] "Gene" as used herein refers to a nucleic acid region, also called a transcribed region, that expresses a polynucleotide, such as an RNA. A transcribed polynucleotide can have a sequence that encodes a polypeptide, such as a functional protein, that can be translated into the encoded polypeptide when placed under the control of appropriate regulatory regions. A gene can include several operably linked fragments, such as a promoter, a 5' leader sequence, a coding sequence, and a 3' untranslated sequence, such as a polyadenylation site. A chimeric or recombinant gene is a gene that is not normally found in nature, such as a gene that is not naturally associated with a promoter for part or all of the transcribed DNA region. "Expression of a gene" refers to the process by which a gene is transcribed into RNA and / or translated into a functional protein.

[0020] "Gene delivery" or "gene transfer" refers to a method for introducing recombinant or foreign DNA into a host cell. The introduced DNA may remain non-integrated or, preferably, may be integrated into the genome of the host cell. Gene delivery can be achieved, for example, by transduction, the use of viral vectors, or by transformation of cells using known methods such as electroporation, cell bombardment, etc.

[0021] "Transgene" refers to a gene that is introduced into a host cell. A transgene may contain sequences that are native to the cell, sequences that do not naturally occur in the cell, or a combination thereof. A transgene may contain a sequence that encodes one or more proteins that may be operably linked to appropriate regulatory sequences for expression of the coding sequence in the cell.

[0022] "Transduction" refers to the delivery of a nucleic acid molecule to a recipient host cell by a gene delivery vector, such as, for example, rAAV. For example, transduction of a target cell by an rAAV virion results in the transfer of the rAAV vector contained in the virion to the transduced cell. "Host cell" or "target cell" refers to the cell into which nucleic acid delivery takes place.

[0023] A "functional protein" includes variants, mutants, homologues, and functional fragments of the full-length protein. One of skill in the art could readily construct proteins homologous to the full-length protein that retain all or a portion of the activity of the full-length protein.

[0024] A "vector" generally refers to a nucleic acid construct suitable for cloning and expressing a nucleotide sequence. One example of a vector is a viral vector. The term vector may also refer to a vehicle that contains the vector, such as a virus or virion, that can transfer the vector into and between host cells.

[0025] "AAV vector" or "rAAV vector" refers to a recombinant vector derived from an adeno-associated virus, such as, for example, serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, AAvDJ, and AAVrh10.XX. A rAAV vector is deleted of one or preferably all wild-type AAV genes, but may contain functional ITR nucleic acid sequences. Functional ITR sequences are necessary for replication, rescue, and packaging of AAV virions. ITR sequences may be wild-type sequences or substantially identical sequences (as defined below), or may be altered by insertion, mutation, deletion, or substitution of nucleotides, so long as they remain functional.

[0026] A "therapeutically effective amount" refers to an amount effective at a dosage and for a period of time necessary to achieve a desired therapeutic result, such as a result related to an age-related disease or condition. A therapeutically effective amount of a parvovirus virion or pharmaceutical composition may vary depending on factors such as the disease state, age, sex, and weight of the individual, and the ability of the parvovirus virion or pharmaceutical composition to induce a desired response in the individual. Dosage regimens may be adjusted to provide an optimal therapeutic response. A therapeutically effective amount is also typically one in which the therapeutically beneficial effects of the parvovirus virion or pharmaceutical composition outweigh any toxic or detrimental effects.

[0027] A "prophylactically effective amount" refers to an amount effective, for example, for preventing or inhibiting various age-related diseases or symptoms, at dosages and for periods of time necessary to achieve the desired prophylactic result. A prophylactic dose may be used in subjects prior to or at an early stage of disease, and in some cases, the prophylactically effective amount may be greater or less than the therapeutically effective amount.

[0028] "Nucleic acid" includes any molecule composed of or containing monomeric nucleotides. In this specification, the term "nucleotide sequence" may be used interchangeably with "nucleic acid". A nucleic acid may be an oligonucleotide or a polynucleotide. A nucleic acid may be DNA or RNA. A nucleic acid may be a gene. A nucleic acid may be chemically modified or artificial. Artificial nucleic acids include peptide nucleic acid (PNA), morpholino, and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Each of these is distinguished from naturally occurring DNA or RNA by changes to the backbone of the molecule. Phosphorothioate nucleotides may also be used.

[0029] As used herein, a "nucleic acid construct" is understood to mean an artificial nucleic acid molecule resulting from the use of recombinant DNA technology. A nucleic acid construct is a single- or double-stranded nucleic acid molecule that has been modified to contain segments of nucleic acid, combined and juxtaposed in a manner that is not believed to occur in nature. A nucleic acid construct is usually a "vector", i.e., a nucleic acid molecule used to deliver exogenously produced DNA to a host cell. One type of nucleic acid construct is an "expression cassette" or "expression vector". These terms refer to a nucleotide sequence that can result in the expression of a gene in a host organism or a host cell that is compatible with said sequence. An expression cassette or expression vector typically includes at least an appropriate transcriptional regulatory sequence and optionally a 3' transcriptional termination signal. Additional factors necessary or useful for expression, such as expression enhancer elements, may also be present. A nucleic acid construct may also be a vector that expresses or suppresses a protein by acting as an RNA instead of a DNA. In the case of increased expression of a target protein, the nucleic acid construct may be an mRNA or similar, which the cell, or more specifically the ribosome, recognizes and produces many copies of the protein. When suppressing the expression of a target sequence, the RNA may be in a form that acts by preventing ribosomes from producing proteins, which may be done through the mechanisms of RNAi, shRNA, miRNA, or Pri-miRNA. One skilled in the art may also imagine, through Boolean logic, that suppressing a known suppressor of a target sequence will actually increase the target sequence through suppression, and one may remove the target protein so that the target sequence can be regulated by "inversion" or "intimation" through the delivery of either mRNA (or analogue) or shRNA (or analogue). This may also be done through a vector that provides the DNA that must be expressed, such as in AAV.

[0030] "Operably linked" refers to the linkage of polynucleotide (or polypeptide) elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are usually contiguous, and, where necessary, the linkage of two protein coding regions is contiguous and in reading frame.

[0031] "Expression control sequence" refers to a nucleic acid sequence that regulates the expression of a nucleotide sequence to which it is operably linked. An expression control sequence is "operably linked" to a nucleotide sequence if it controls and regulates the transcription and / or translation of the nucleotide sequence. Thus, an expression control sequence can include promoters, enhancers, internal ribosome entry sites (IRES), transcription terminators, a start codon in front of a gene encoding a protein, splicing signals of introns, 2A peptide sequences (allowing multicistronic expression), and stop codons. The term "expression control sequence" is intended to include, at a minimum, sequences designed to affect expression, and may further include advantageous components. For example, leader sequences and fusion partner sequences are expression control sequences. The term can also include designing a nucleic acid sequence such that undesirable potential start codons in and out of frame are removed from the sequence. The term can also include designing a nucleic acid sequence such that undesirable potential splice sites are removed. The term includes sequences or polyadenylation sequences (pA) that direct the addition of a chain of adenine residues to the 3' end of an mRNA, also called a polyA tail, i.e., polyA sequence. They can also be designed to increase the stability of the mRNA. Expression control sequences that affect transcriptional and translational stability, such as promoters, and sequences that affect translation, such as Kozak sequences, suitable for use in insect cells are well known to those skilled in the art. Expression control sequences may have the property of regulating the operably linked nucleotide sequence so that lower or higher expression levels are achieved.

[0032] Functional domains can also be fused to known proteins, such as when a mitochondrial signal is fused to CAT (catalase) so that catalase is targeted to shuttle to the mitochondria and functions inside or near the mitochondria instead of its natural location. Targeting signals can be added to other proteins to target them to other parts of the cell or even secrete them from the cell. For some proteins, well-known versions of the protein can replace the native sequence to enhance the effect, such as taking the human or mouse secretion signal of TGFbR2 and fusing it to the canine version of the protein.

[0033] A "promoter" or "transcriptional regulatory sequence" refers to a nucleic acid fragment that functions to control the transcription of one or more coding sequences, located upstream in the direction of transcription of the transcriptional start site of the coding sequence, and is structurally identified by the presence of a DNA-dependent RNA polymerase binding site, a transcriptional start site, and any other DNA sequences, including, but not limited to, transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequences, such as attenuators or enhancers, and silencers, known to those skilled in the art to directly or indirectly regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically or developmentally regulated, for example, by application of a chemoattractant. A "tissue-specific" promoter is only active in a particular type of tissue or cell. The present disclosure provides for the operable linkage of a nucleic acid construct to a mammalian cell-compatible expression control sequence, such as a promoter. Many such promoters are known in the art (Sambrook and Russell, 2001, supra). Constitutive promoters that are broadly expressed in many cell types are disclosed, such as the CMV promoter and the hEf1α promoter. Shorter variants of full-length hEf1α that still confer effective constitutive expression are also disclosed. Inducible promoters, tissue-specific promoters, cell type-specific promoters, or cell cycle-specific promoters are disclosed. In disclosed embodiments, the nucleotide sequence encoding porphobilinogen deaminase is operably linked to a liver-specific promoter. Liver-specific promoters are particularly preferred for use with non-erythrocytic deaminases.Preferably, in the constructs of the present disclosure, the expression control sequence for liver-specific expression is selected from the group consisting of, for example, alpha 1-antitrypsin (AAT) promoter, thyroid hormone-binding globulin promoter, albumin promoter, thyroxine-binding globulin (TBG) promoter, hepatic control region (HCR)-ApoCII hybrid promoter, HCR-hAAT hybrid promoter, and AAT promoter combined with mouse albumin gene enhancer (Ealb) element and apolipoprotein E promoter. Other examples include the E2F promoter for tumor-selective expression, particularly neuronal tumor-selective expression (Parr et al. (1997) Nat. Med. 3:1145-9) or the IL-2 promoter for use in mononuclear blood cells (Hagenbaugh et al. (1997) J Exp Med; 185:2101-10).

[0034] "3'UTR" or "3' untranslated sequence" (often referred to as 3' untranslated region or 3' end) refers to nucleic acid sequences found downstream of the coding sequence of a gene, including, for example, transcription termination sites and (in most, but not all, eukaryotic mRNAs) polyadenylation signals (such as, for example, AAUAAA or variants thereof). After transcription termination, the mRNA transcript may be cleaved downstream of the polyadenylation signal and a polyA tail may be added, which is involved in transport of the mRNA into the cytoplasm where translation takes place.

[0035] As used herein, a "naturally occurring sequence" or "native sequence" refers to a polynucleotide or amino acid that has been isolated from a naturally occurring source. A "native sequence" includes recombinant forms of a naturally occurring polypeptide or polynucleotide having a sequence identical to the naturally occurring form.

[0036] As used herein, "mutation" or "variation" refers to an amino acid sequence or polynucleotide sequence that has been altered by substitution, insertion, and / or deletion. In some embodiments, the mutant or variant sequence may have increased, decreased, or substantially similar activity or properties compared to the parent sequence.

[0037] "Percentage of sequence identity" and "percentage of homology" are used interchangeably herein to refer to a comparison between a polynucleotide stem and a polypeptide, and are determined by comparing two optimally aligned sequences over a comparison window, where a portion of the polynucleotide or polypeptide sequence in the comparison window may contain additions or deletions (i.e., gaps) compared to a reference sequence for optimal alignment of the two sequences. The percentage may be calculated by determining the number of positions at which identical nucleic acid bases or amino acid residues occur in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Alternatively, the percentage may be calculated by determining the number of positions at which identical nucleic acid bases or amino acid residues occur in both sequences, or the number of positions at which nucleic acid bases or amino acid residues align with gaps to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Those skilled in the art will appreciate that there are many established algorithms available for aligning two sequences. Optimal alignment of sequences for comparison can be performed, for example, by local homology algorithms (Smith and Waterman (1981) Adv. Appl. Math. 2:482), homology alignment algorithms (Needleman and Wunsch (1970) J. Mol. Biol. 48:443), search for similarity methods (Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444), computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA), or visual inspection (see generally Current Protocols in Molecular Biology, eds. FMAusubel et al., Current Protocols, Greene Publishing Associates, Inc., and John Wiley & Sons, Inc. (1995 Supplement)).

[0038] Examples of suitable algorithms for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, described in Altschul et al. (1990), J. Mol. Biol. 215:403-410, and Altschul et al. (1977) Nucleic Acids Res. 3389-3402, respectively. Software for performing BLAST analysis is publicly available on the National Center for Biotechnology Information website. This algorithm involves first identifying high-scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that match or satisfy some positive threshold score T when aligned with words of the same length in database sequences. T represents the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds to initiate searches to find longer HSPs that contain them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of the word hits in each direction is stopped when the cumulative alignment score falls off its maximum achieved value by an amount X, when the accumulation of one or more negative scoring residue alignments causes the cumulative score to fall below zero, or when the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands.For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).

[0039] The percentage degree of amino acid sequence identity can be obtained by performing a ClustalW analysis (version W1.8) by counting the number of matches in the alignment, dividing the number of matches by the length of the reference sequence, and achieving slow / accurate pairwise optimal alignment using default ClustalW parameters (gap opening penalty: 10; gap extension penalty: 0.10; protein weight matrix: Gonnet series; DNA weight matrix: IUB; Toggle Slow / Fast pairwise alignment = SLOW or FULL alignment).

[0040] "Subject" or "patient" refers to a mammal, such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkey or human). Preferably, the mammal is a livestock animal, such as a dog, cat, mouse, cow, sheep, goat, horse, and pig, or a human subject. In some embodiments, the human is an adult patient. In some embodiments, the human is a pediatric patient.

[0041] Gene therapy by expression of functional proteins and regulation of functional protein expression As summarized above, the present disclosure provides for the regulation of one or more genes or their associated functional proteins in a method for treating or preventing a disease or condition associated with the target genes. In particular, individual target genes or one or more combinations of target genes are associated with age-related diseases or conditions and / or affect biological life span. The genes or gene products targeted by the described gene therapy are involved in diverse cellular roles such as metabolic activity, insulin-like growth factor activity pathway (i.e., IGF1 / GH / mTOR axis), mitochondrial function, inflammation / fibrosis, autophagy, neuronal function, genomic stability, etc. Gene therapy may be based on one or more of the following, by way of example and not limitation: a nucleic acid or gene that overexpresses a functional protein or a variant thereof; expression of a functional protein that regulates another target gene / protein; expression of a polynucleotide, such as an inhibitory RNA, to regulate expression of a target gene; and expression of a gene editing system that modulates the target gene in situ. Such nucleic acids may be "synthetic nucleotide sequences," which is understood herein to mean that the nucleotide sequence itself does not occur in nature, but rather has been designed, engineered, and / or constructed by human intervention. Thus, the term "synthetic" does not necessarily mean that the sequence is obtained exclusively and / or entirely from chemical synthesis. Rather, molecules comprising the synthetic sequences of the invention will typically be obtained from biological sources, such as cells (cultured cells, e.g., recombinant cells), although portions of the synthetic sequence may at some stage be obtained by chemical synthesis.

[0042] In some embodiments, genes and corresponding expressed gene products for therapeutic use that can be administered, for example, by viral vector systems or Cas9 guide RNA systems, are shown in Table 1.

[0043] [Table 1]

[0044] [Table 2]

[0045] [Table 3]

[0046] [Table 4]

[0047] [Table 5]

[0048] The description in Table 1 identifies exemplary genes and whether the genes are overexpressed ("overexpressed") or inhibited ("pri-miRNA / shRNA") in the method. Thus, when the description refers to "overexpressing" genes, gene therapy refers to the case where a nucleic acid encoding the indicated protein product is used and the protein product is overexpressed. Thus, in such a description, reference to an identified gene also refers to the protein encoded by this gene. For example, "Klotho" can refer to both the gene and the protein encoded by this gene. In some embodiments, a nucleic acid can encode a protein product that is a mutant of a naturally occurring expressed protein. By way of example and not of limitation, Adra1a(mut) refers to a nucleic acid sequence encoding a mutant of the naturally occurring Adra1a protein product, where the expressed mutant of the receptor protein is constitutively active. Where a description in Table 1 refers to a "pri-miRNA / shRNA," gene therapy refers to the use of a nucleic acid having a sequence for the expressed pri-miRINA / shRNA where the expressed pri-miRINA / shRNA inhibits or ultimately attenuates expression of a gene product of a target gene.

[0049] In some embodiments, nucleic acids for gene therapy may use sequences that are homologous to gene sequences provided herein or known in the art and function as reference proteins, inhibitory RNAs, or inhibitory proteins. Thus, the present disclosure contemplates the nucleic acid sequences described herein and nucleic acid sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to the nucleic acid sequences. Similarly, the present disclosure contemplates the amino acid sequences described herein and amino acid sequences that are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to the amino acid sequences, such that the proteins retain at least partial or total function or activity. It should be understood that a person skilled in the art can easily design nucleic acid sequences that are different from those identified herein or known in the art to code for known proteins based on the degeneracy of the genetic code. Thus, it should be understood that the identification of specific nucleic acid sequences herein is not limiting.

[0050] It should be understood that each gene and corresponding nucleic acid in Table 1 can be used separately in a gene therapy method to produce a desired physiological (e.g., therapeutic) effect. In some embodiments, combinations of the nucleic acids in Table 1 can be used in a gene therapy method to produce a desired therapeutic effect. Thus, the present disclosure encompasses all possible combinations of the genes and corresponding nucleic acids in Table 1 for use in gene therapy, as described herein. In some embodiments, gene therapy includes any or all combinations of nucleic acids numbered 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 of Table 1, which have an intended therapeutic effect, particularly with respect to the treatment or prevention of age-related diseases or conditions. It is understood that one skilled in the art can readily envision combinations and subcombinations of nucleic acids for use in therapeutic methods.

[0051] According to one embodiment, one or more genes in Table 1, such as FGF21 or Klotho, can be operably linked to a stabilizing peptide, such as sTGFbR2-FC, to increase its half-life. Those skilled in the art can easily identify suitable fusion peptides, an example of which is FC. The present disclosure also contemplates the modification of one or more genes listed in Table 1, such as FGF21 and Klotho, to increase the stability or half-life of the protein encoded by the gene.

[0052] According to certain embodiments, one or more genes in Table 1, such as FGF21 or Klotho, can be operably linked to a secretion signal such that the secretion signal is attached to the secreted protein in a manner that enhances expression. One of skill in the art can readily identify appropriate secretion signals and methods for adding secretion signals to secreted proteins for enhanced expression.

[0053] In some embodiments identified in Table 2, a gene therapy method for treating or preventing an age-related disease or condition comprises administering to a subject in need thereof an effective amount of a single vector or multiple vectors expressing the following genes, which express gene products as set forth in Table 1 above:

[0054] [Table 6]

[0055] [Table 7]

[0056] [Table 8]

[0057] In the exemplary embodiments described above, when there is more than one gene used in gene therapy, these genes may be included in separate gene delivery vectors individually or, if permitted, in specific combinations (e.g., based on the capabilities of the viral gene therapy vector), e.g., based on the intended target tissue, as further described below.

[0058] As described in further detail herein, the nucleic acids of Table 1 and corresponding nucleic acid constructs, expression cassettes, expression vectors, expression control sequences, promoters, and other elements associated with delivery of nucleic acid sequences can be constructed as gene delivery vectors, such as viral vectors. The vectors are administered to a mammal under conditions that result in expression of the nucleic acid that alters the level of a functional protein to provide a prophylactic or therapeutic effect. Thus, the present disclosure also contemplates vectors, particularly viral vectors, more particularly AAV vectors, for each of the genes and corresponding nucleic acids listed in Table 1. Details of such viral vectors are described below.

[0059] In some embodiments, the nucleic acids of Table 1 can be collectively modulated to produce a desired therapeutic effect. Gene therapies and the corresponding nucleic acids used can be categorized based on the desired effect, including effects on metabolism, IGF1 or GH signaling, protein synthesis or autophagy, inflammation, fibrosis, or immune response, genomic stability, cancer, mitochondrial fitness or function, oxidative function, or neuronal function, among others.

[0060] Table 3 identifies exemplary genes and their groupings based on their effect on indicated biological functions that may be collectively modulated to achieve a desired effect.

[0061] [Table 9]

[0062] [Table 10]

[0063] [Table 11]

[0064] In some embodiments, gene therapy relates to exemplary combinations of nucleic acids (i.e., genes) as defined in each group of Table 2 or Table 3. In some embodiments, gene therapy involves the use of combinations or subcombinations of nucleic acids of FGF21, GDF15 (hNAG), Slc13a1, mTOR, Cebpa / Cebpb, Dgat1, Insr, Ubd, Prkar2b, UCP1, Pck1, Sirt1, adiponectin, AMPK, PCSK9, and Slc13a5 (INDY), as defined in Table 1, such as for treating or preventing a metabolic condition or disease associated with aging.

[0065] In some embodiments, gene therapy involves the use of combinations or subcombinations of nucleic acids of FGF21, GDF15 (hNAG), Pappa, Klotho, mTOR, Sirt6, sIFG1r-Fc, Akt1, and Rps6kb1 (S6K1), as defined in Table 1, such as for the treatment or prevention of conditions or diseases associated with IGF1 / GH activity, particularly with respect to such activity implicated in age-related diseases or conditions.

[0066] In some embodiments, gene therapy involves the use of combinations or subcombinations of nucleic acids against mTOR, Cisd2, Atg5, Akt1, TFEB, as defined in Table 1, such as for the treatment or prevention of conditions or diseases related to protein synthesis and autophagy, particularly with respect to such activities involved in age-related diseases or conditions.

[0067] In some embodiments, gene therapy involves the use of nucleic acid combinations or subcombinations of Klotho, FGF21, Ctf1, Txn1, Nrf2, Sirt1, and sTGFbR2-FC, as defined in Table 1, such as for the treatment or prevention of inflammation, fibrosis, immune conditions or diseases, particularly those activities involved in age-related diseases or conditions. Exemplary gene combinations include FGF21 and Klotho; FGF21 and sTGFbR2-FC; Klotho and sTGFbR2-FC, or FGF21, Klotho and sTGFbR2-FC.

[0068] In some embodiments, gene therapy involves the use of combinations or subcombinations of nucleic acids of Coq7, Ctf1, NUDT1, BubR1, TERT, Par4 SAC domain, and HAS2, as defined in Table 1, such as for the treatment or prevention of DNA damage, genomic instability, or cancer, particularly with respect to such activities such as DNA damage or genomic instability involved in age-related diseases or conditions.

[0069] In some embodiments, gene therapy involves the use of combinations or subcombinations of nucleic acids of Adcy5, Agtr1a, Cisd2, Coq7, mCAT, Mt1, Pck1, Sirt6, Slc13a1, Nrf2, and TFAM, as defined in Table 1, such as for the treatment or prevention of conditions or diseases associated with mitochondrial function or oxidative damage, particularly with respect to such activities implicated in age-related diseases or conditions.

[0070] In some embodiments, gene therapy involves the use of combinations or subcombinations of nucleic acids of Ikbkb, NUDT1, Adra1a(mut), NGF, NEU1, humanized FoxP2, and PDE4b, as defined in Table 1, such as for the treatment or prevention of a neurological condition or disease, such as cognitive impairment or decline, particularly for neurological conditions or diseases associated with aging.

[0071] It should also be understood that a group of genes and corresponding nucleic acids used to treat or prevent a symptom or disease in a corresponding class of biological processes, particularly as those biological processes are associated with aging, can be used in combination with one or more other groups of genes and corresponding nucleic acids. Thus, gene therapy methods using any possible combination of genes and corresponding nucleic acids listed in Table 1 or identified in different groups in Tables 2 or 3 are encompassed by the present disclosure. Groups of genes and corresponding nucleic acids used in gene therapy for (i) treatment or prevention of metabolic symptoms or diseases, (ii) symptoms or diseases associated with IGF1 / GH activity, (iii) symptoms or diseases associated with protein synthesis and autophagy, (iv) inflammation, fibrosis, immune symptoms or diseases, (v) DNA damage, genomic instability or cancer, (vi) symptoms or diseases associated with mitochondrial function or oxidative damage, and (vii) neurological symptoms or diseases can be used in combination or subcombination to treat multiple classes of diseases or conditions, particularly multiple diseases or conditions associated with aging. By way of example, a combination or subcombination of a group of genes and corresponding nucleic acids for treating or preventing a neurological disease or condition (vii) can be used with a combination or subcombination of a group of genes and corresponding nucleic acids for treating or preventing a disease or condition associated with mitochondrial function or oxidative damage, i.e., group (iv). Other such exemplary combinations include, by way of example and not limitation, combinations of 2, 3, 4, 5, 6 or all 7 of the above groups (i)-(vii).

[0072] In some embodiments, the gene and corresponding nucleic acid set of the gene therapy method herein can also be selected based on the tissue type targeted for gene therapy. An appropriate gene delivery construct for expression in a particular tissue can incorporate the nucleic acid associated with gene therapy. In some embodiments, tissue-specific delivery is based on the selection of an appropriate viral vector and viral packaging system. The viral vector can incorporate an appropriate promoter and other transcriptional regulators that allow expression of the gene product in the target tissue. The viral packaging system can take advantage of the host cell range specificity of the viral components used to package the viral vector so that the gene therapy vector is delivered to the target tissue. In terms of AAV vector and capsid design, AAV serotypes, either naturally occurring or synthetic derivatives, can be used to manipulate the tropism range of gene therapy applications, as described in more detail below. For example, neuronal target genes can use viral capsids designed to cross the blood-brain barrier, such as AAV9, and liver target genes can use AAV8, which does not cross the blood-brain barrier to the same extent but accumulates in the liver and muscle.

[0073] Other tissue-specific methods can be used to limit expression in tissues of interest, including, among others, the use of tissue-specific promoters and miRNA binding sites that target those sequences expressed in the target tissue. Table 4 shows exemplary gene therapy nucleic acids as defined herein, target cells or tissues, AAV serotypes or combinations of serotypes with appropriate tropism for the target tissue, exemplary promoters for regulating expression that function in specific cells or target tissues, routes of administration, and gene sizes. A=adipose tissue, M=muscle tissue, B=brain tissue, L=liver tissue, E=systemic delivery throughout the organism, N=non-brain tissue, and H=heart tissue. Table 4 also shows whether the gene product is an expressed protein or an inhibitory RNA. In some embodiments, the nucleic acid for gene therapy contains an expression inhibitory element that, when expressed, inhibits or attenuates the expression of the gene product in one or more non-target tissues, also referred to as detargeting (see, e.g., Broderick et al. (2011) Gene Ther. 18(2):1104-1110, incorporated herein by reference). In Table 4, an exemplary inhibitory element is a sequence of a miRNA in the 3'UTR of an expressed mRNA, such that the mRNA (or other transcription RNA, such as pri-miRNA / shRNA) is silenced in a specific non-target tissue, such as the liver. Various miRNAs used to detarget expression in non-target tissues include, among others, miRNA-122 for silencing expression in hepatocytes, miRNA-124 for silencing expression in neuronal cells, and miRNA-142 for silencing expression in hematopoietic cells. Other miRNAs known in the art for inhibiting expression in specific cells and tissues can be used by the skilled artisan in the gene therapy applications of the present disclosure. One or a combination of such silencing miRNA target sequences can be used to inhibit or attenuate the undesired expression of a gene therapy construct in one or more non-target cells and tissues, which may be different from each other.

[0074] [Table 12]

[0075] [Table 13]

[0076] [Table 14]

[0077] In view of the descriptions in Table 4, the present disclosure relates to exemplary gene therapy vectors comprising the elements (i.e., genes, promoters, miRNA silencers) identified for each of the embodiments 1-53 in Table 4. In some embodiments, the gene therapy vectors can be based on the vector construct hEf1a-WPRE3-SV40, where Hef1a refers to the human elongation factor 1a promoter, WPRE3 is a truncated woodchuck hepatitis post-transcriptional regulatory element, and SV40 is a truncated SV40 polyadenylation site (PMCID: PMC3975461). The present disclosure relates to recombinant AAV viral particles having specific AAV serotypes and specific vector elements for each of the embodiments 1-53 in Table 4. AAV capsid proteins that specify the serotype of the recombinant viral particle can be provided using an appropriate AAV helper virus. See, for example, Yuan et al., 2011, Hum Gene Ther. 22(5):613-24, incorporated herein by reference. hEf1a may also refer to a truncated form of the hEf1a promoter, which is 231 bp long and is referenced as SEQ ID NO:18.

[0078] Considering the ability of gene therapy vectors to deliver nucleic acids to target cells, in some embodiments, viral vectors can have two or more nucleic acids for the expression of two or more corresponding functional proteins, inhibitory RNAs, or inhibitory proteins. Each nucleic acid for expressing different gene expression products can have its own transcriptional regulatory element, and when expressing proteins, the translational control elements can be separated so that separate RNAs are expressed. In some embodiments, a single RNA can be expressed in the form of a cistron, in which case the gene products are expressed from a single RNA. Thus, in some embodiments, gene therapy vectors can have polycistronic elements such as an internal ribosome entry site (IRES) or 2A sequence (PMCID: PMC3084703) to induce ribosome skipping as may be required for the expression of various gene therapy products from a single RNA.

[0079] In some embodiments, in gene therapy with multiple nucleic acids expressing multiple different gene products, two or more gene delivery vectors, particularly viral vectors, are administered to a mammal. Thus, in some embodiments, the present disclosure includes simultaneous or separate administration of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more separate vectors for delivering relevant genes in gene therapy methods. The amount of each vector administered alone or in combination can be determined based on, among other things, the vector design, the nucleic acid sequence delivered, the delivery efficiency to the target tissue, the mode of administration, and the intended therapeutic effect. In various embodiments, the optimal ratio of each viral vector administered simultaneously can be evaluated from the maximum viral dose for each subject and the efficacy of each vector. Those skilled in the art can determine the appropriate ratio and dose based on the present disclosure.

[0080] An exemplary set of viral vectors carrying one or more genes for gene therapy is shown in Table 2. For gene therapy using a combination of genes expressing the referenced proteins and / or inhibitory RNA, the described viruses are administered to a mammal in a gene therapy method. Thus, the present disclosure provides a method of administering a plurality of viruses containing one or more genes, inhibitory RNA, or inhibitory proteins, examples and combinations of which, particularly for treating or preventing age-related diseases or conditions, are provided below.

[0081] In group 1, virus 1 contains AAV8-GFP as a control and virus 2 contains AAV9:GFP as a control.

[0082] In group 2, a single virus containing a single gene, GDF15, is administered to a mammal in a gene therapy approach.

[0083] In group 3, virus 1 contains TERT and virus 2 contains BubR1.

[0084] In group 4, virus 1 contains GDF15, virus 2 contains TERT, and virus 3 contains BubR1.

[0085] In group 5, virus 1 contains GDF15, virus 2 contains TERT, virus 3 contains FGF21, and virus 4 contains BubR1.

[0086] In group 6, virus 1 contains GDF15, virus 2 contains TERT, virus 3 contains FGF21, virus 4 contains Klotho, and virus 5 contains BubR1.

[0087] In group 7, virus 1 contains BubR1, p2A, and Par4, virus 2 contains Cis2d, virus 3 contains Txn1, virus 4 contains FGF21, virus 5 contains BubR1, virus 6 contains Agtr1a, ikbkb, and mTOR, virus 7 contains Nudt1, virus 8 contains Slc13a5 and pappa, virus 9 contains Coq7, ASdcy5, and Agtr1a, and virus 10 contains Ctf1 / akt1.

[0088] In group 8, virus 1 contains FGF21, virus 2 contains Nrf2, virus 3 contains sTGFbR2-Fc, virus 4 contains HAS2, virus 5 contains Nudt1, virus 6 contains TERT, virus 7 contains BubR1, p2A and Par4, virus 8 contains Ubd and Dgat1, virus 9 contains Ctf1 and Coq7, and virus 10 contains Adcy5, Agtr1a, and mTOR.

[0089] In group 9, virus 1 contains Atg5, virus 2 contains Nudt1, virus 3 contains Adra1a(mut), virus 4 contains NGF, virus 5 contains NEU1, virus 6 contains humanized FoxP2, virus 7 contains TFEB, virus 8 contains PDE4b, mTOR, and Slc13a5, virus 9 contains Slc13a5, Coq7, and Akt1, and virus 10 contains ikbkb and Slc13a1.

[0090] In group 10, virus 1 contains Klotho, virus 2 contains GDF15 (hNAG), virus 3 contains sIGF1r-Fc, virus 4 contains Mt1, virus 5 contains Adra1a (mut), virus 6 contains Nrf2, virus 7 contains Rps6kb1 and PCsk9, virus 8 contains Prkar2b and Dgat, virus 9 contains Ctf1 and Coq7, and virus 10 contains pappa and ikbkb.

[0091] In group 11, virus 1 contains Atg5, virus 2 contains Cebpa and Cebpb, virus 3 contains Ctf1 and akt1, virus 4 contains Pck1, virus 5 contains adiponectin, virus 6 contains PcsK9, virus 7 contains Nrf2, virus 8 contains Cisd2, virus 9 contains pappa and Dgat, and virus 10 contains Ctf1, Coq7, and mTOR.

[0092] In group 12, virus 1 contains FGF21, virus 2 contains GDF15, virus 3 contains Klotho, virus 4 contains Adra1a(mut), virus 5 contains Sirt6, virus 6 contains Bubr1, p2A, and Par4, virus 7 contains Coq7, Adcy5, and Agtr1a, virus 8 contains Agtr1a, ikbkb, and mTOR, virus 9 contains Slc13a1, pappa, and Ctf1, and virus 10 contains Ctf1 and Slc13a5 (AAV9).

[0093] In group 13, virus 1 contains FGF21, virus 2 contains GDF15, virus 3 contains Klotho, virus 4 contains TERT, virus 5 contains sIGF1r-Fc, virus 6 contains Bubr1, p2A, and Par4, virus 7 contains Rps6kb1 and PCSk9, virus 8 contains Adcy5 and Coq7, virus 9 contains Agtr1a and ikbkb, and virus 10 contains mTOR and Slc13a1.

[0094] In group 14, virus 1 contains Klotho, virus 2 contains Txn1, virus 3 contains Nrf2, virus 4 contains TFEB, virus 5 contains sTGFbr2-Fc, virus 6 contains Nudt1, virus 7 contains mt1, virus 8 contains Atg5, virus 9 contains Bubr1, p2A, and Par4, and virus 10 contains Ctf1, Coq7, and ikbkb.

[0095] In group 15, virus 1 contains FGF21, IRES, and sIGF1r-Fc, virus 2 contains Klotho, virus 3 contains sTGFbr2-Fc, IRES, and GDF15, virus 4 contains HAS2, p2A, Mt1, and Txn1, virus 5 contains Nrf2, p2A, and mCAT, virus 6 contains Adra1a(mut), p2Am, and TFEB, virus 7 contains Bubr1, p2A, and Par4, virus 8 contains Atg5, p2A, Cisd2, and Nudt1, virus 9 contains Sirt1, p2A, and Sirt6, and virus 10 contains mTOR, slc13a5, pappa, ikbkb, adcy5, agtr1a, and akt1.

[0096] In group 16, virus 1 contains TFEB, p2A, and Atg5, virus 2 contains Klotho, virus 3 contains UCP1, p2A, Cebpbeta, and miCebpa, virus 4 contains adiponectin, IRES, Mt1, p2A, and Txn1, virus 5 contains Nrf2, p2A, and mCAT, virus 6 contains TERT, virus 7 contains Bubr1, p2A, and Par4, virus 8 contains TFAM, p2A, Cisd2, and Nudt1, virus 9 contains Neu1, p2A, NGF, and Sirt6, and virus 10 contains Dgat, prkar2b, insr, ubd, Coq7, Ctf1, mTOR, and Slc13a5.

[0097] In group 17, the virus contains sTGFbR2-FC and / or Nrf2.

[0098] In group 18, the virus includes FGF21, TERT, BubR1, Agtra1a, Adcy5, Coq7, Slc13a1, Ikbkb, Klotho, GDF15, CTF1, mTOR, Slc13a5, Pappa, Pcsk9, and / or Rps6kb1.

[0099] In group 19, the virus comprises FGF21, GDF15, Klotho, Adra1a(mut), Sirt6, BubR1, Agtra1a, Adcy5, Akt1, MCAT, Slc13a1, Ikbkb, Ctf1, mTOR, Coq7, and / or Slc13a5.

[0100] In group 20, the virus includes Txn1, Sirt6, Mt1, TFEB, Pck1, adiponectin, Cisd2, Nudt1, Atg5, Ctf1, Ikbkb, and / or Coq7.

[0101] In group 21, the virus comprises Fgf21, Nrf2, sTGFbR2-FC, Has2, NudT1, TERT, BubR1, Dgat1, Pappa, Ctf1, mTOR, Coq7, Slc13a5, Agtra1a, Adcy5, and / or Akt1.

[0102] In group 22, the virus comprises Ctf1, Coq7, Agtra1a, Adcy5, mTOR, Cisd2, MCAT, FGF21, GDF15, Klotho, Slc13a1, Ikbkb, Txn1, and / or Sirt6.

[0103] In group 23, the virus includes Klotho, GDF15, Neu1, Mt1, Adra1a, hFoxP2, PCSK9, Rps6kb1, Ctf1, Ikbkb, Coq7, Slc13a1, mTOR, and / or NudT1.

[0104] In group 24, the virus includes Atg5, Ctf1, Akt1, BubR1, Pck1, adiponectin, TERT, Nrf2, Cisd2, Dgat1, Pappa, Ctf1, mTOR, Coq7, and / or Slc13a5.

[0105] In group 25, the virus comprises FGF21 and / or BMP2.

[0106] In group 26, the virus comprises FGF21 and / or BMP4.

[0107] In group 27, the virus contains FGF21 and / or Sema3a.

[0108] In group 28, the virus comprises FGF21, BMP2, and / or BMP4.

[0109] In group 29, the virus comprises FGF21, BMP2, and / or Sema3a.

[0110] In group 30, the virus comprises FGF21, BMP4, and / or Sema3a.

[0111] In group 31, the virus comprises FGF21, BMP2, BMP4, and / or Sema3a.

[0112] In group 32, the virus contains FGF21 and Klotho.

[0113] In group 33, the virus contains FGF21 and sTGFbR2-FC.

[0114] In group 34, the virus contains Klotho and sTGFbR2-FC.

[0115] In group 35, the virus contains FGF21, Klotho, and sTGFbR2-Fc.

[0116] Gene therapy using Pri-miRNA / shRNA for target genes In the present disclosure, gene constructs expressing primary miRNA molecules (pri-miRNAs) and / or short hairpins (shRNAs) are used to inhibit or attenuate expression of target genes. A single pri-miRNA may contain 1-6 miRNA precursors, which are processed to produce miRNAs that are transported from the nucleus to the cytoplasm where they silence expression of the target RNA. Exemplary hairpin loop structures are each composed of approximately 70 nucleotides. Each hairpin is flanked by sequences required for efficient processing.

[0117] The hairpin double-stranded RNA (dsRNA) structure in pri-miRNA is recognized by a nuclear protein known as DiGeorge Syndrome Critical Region 8 (DGCR8 or "Pasha" in invertebrates), named for its association with DiGeorge syndrome. DGCR8 associates with the enzyme Drosha, a protein that cleaves RNA, to form the microprocessor complex. See Lee, Y. et al., Nature 425(6956):415-9 (2003); Gregory RI.et al. (2006) Methods Mol. Biol. 342:33-47. In this complex, DGCR8 orients the catalytic RNaseIII domain of Drosha to release the hairpin from the pri-miRNA by cleaving the RNA approximately 11 nucleotides from the hairpin base (one helical dsRNA becomes the stem). See Han, J et al. (2004) Genes & Development 18(24):3016-27; Han, J. et al. (2006) Cell 125(5):887-901. The resulting product has a two-nucleotide overhang at its 3' end and has a 3' hydroxyl group and a 5' phosphate group. It is often referred to as pre-miRNA. Sequence motifs downstream of the pre-miRNA that are important for efficient processing have been identified. Conrad, T. et al., Cell Reports 9(2):542-554; Auyeung, V. et al. (2013) Cell 152(4):844-858; Ali, PSet al. (2012) FEBS Letters 586(22):3986-90.

[0118] Pre-miRNAs that are spliced ​​directly from introns, bypassing the microprocessor complex, are known as "mirtrons." Originally thought to exist only in Drosophila and C. elegans, mutrons have now been found in mammals. See Berezikov E.et al., 2007, "Mammalian mirtron genes," Mol.Cell 28(2):328-36.

[0119] 16% of pre-miRNAs can be altered by nuclear RNA editing. See Kawahara Y.et al.(2008)Nucleic Acids Res.36(16):5270-80; Winter J.et al.(2009)Nat.Cell Biol.11(3):228-34; Ohman M.(2007)Biochimie 89(10):1171-6. Most commonly, an enzyme known as adenosine deaminase acting on RNA (ADAR) catalyzes the transfer of adenosine to inosine (A to I). RNA editing can halt nuclear processing (e.g., nuclear processing of pri-miR-142, which leads to degradation by ribonuclease Tudor-SN) and alter downstream processes, including cytoplasmic miRNA processing and target specificity (e.g., by altering the seed region of miR-376 in the central nervous system). See Kawahara Y, et al. (2008) Nucleic Acids Res. 36(16):5270-80.

[0120] Pre-miRNA hairpins are exported from the nucleus in a process involving the nuclear-cytoplasmic shuttle protein Exportin-5. This protein is a member of the karyopherin family and recognizes a two-nucleotide overhang left at the 3' end of the pre-miRNA hairpin by the RNase III enzyme mirtronDrosha. Exportin-5-mediated export to the cytoplasm is energy dependent, using GTP bound to the Ran protein. See Murchison EP et al. (2004) Curr. Opin. Cell Biol. 16(3):223-9.

[0121] In the cytoplasm, the pre-miRNA hairpin is cleaved by the RNaseIII enzyme Dicer. See Lund E. et al. (2006) Cold Spring Harb. Symp. Quant. Biol. 71:59-66. This endoribonuclease interacts with the 5' and 3' ends of the hairpin (see Park, JE et al. (2011) Nature 475(7355):201-5) and cleaves the loop connecting the 3' and 5' arms, resulting in an incomplete miRNA:miRNA* duplex approximately 22 nucleotides long. See Lund E. et al. (2006) Cold Spring Harb. Symp. Quant. Biol. 71:59-66. The overall hairpin length and loop size affect the efficiency of Dicer processing. The incomplete nature of the miRNA:miRNA* pair also affects cleavage. See Lund E.et al., (2006) Cold Spring Harb.Symp.Quant.Biol.71:59-66; Ji X(2008)Current Topics in Microbiology and Immunology 320:99-116. Some G-rich pre-miRNAs can potentially adopt G-quadruplex structures as an alternative to the canonical stem-loop structure. For example, human pre-miRNA 92b adopts a G-quadruplex structure that is resistant to Dicer-mediated cleavage in the cytoplasm. See Mirihana A.et al.(2015)Chem.Biol.22:262-272. Although either strand of the duplex can potentially act as a functional miRNA, only one strand is usually incorporated into the RNA-induced silencing complex (RISC) where the miRNA and its mRNA target interact.

[0122] Gene therapy by Cas9-mediated regulation of functional proteins The present disclosure also provides a method for regulating the target genes and their corresponding functional proteins described herein using the Cas9 / guide RNA system together with transcriptional regulators. It should be understood that a person skilled in the art can design suitable guide RNAs to form co-localized complexes with target nucleic acids, including the target genes described herein.

[0123] Cas9 DNA-binding protein It is readily known to those skilled in the art that RNA-guided DNA-binding proteins bind to DNA for a variety of purposes. Such DNA-binding proteins may be naturally occurring. DNA-binding proteins with nuclease activity are known to those skilled in the art, and include naturally occurring DNA-binding proteins with nuclease activity, such as the Cas9 protein present in the type II CRISPR system. Such Cas9 proteins and type II CRISPR systems have been fully described in the art. See Makarova et al., Nature Reviews, Microbiology, Vol. 9, June 2011, pp. 467-477, including all supplementary information, which is incorporated herein by reference in its entirety. Such RNA-guided DNA-binding proteins may include one or more nuclear localization signals attached to the RNA-guided DNA-binding protein to facilitate transfer of the protein to the nuclease.

[0124] In general, bacterial and archaeal CRISPR-Cas systems rely on short guide RNAs complexed with Cas proteins to direct the degradation of complementary sequences present within the invading foreign nucleic acid. See Deltcheva, E. et al. (2011) Nature 471, 602-607; Gasiunas, G. et al. (2012) Proc Natl Acad Sci USA 109, E2579-2586; Jinek, M. et al. (2012) Science 337, 816-821; Sapranauskas, R. et al. (2011) Nucleic Acids Res 39:9275-9282; and Bhaya, D. et al. (2011) Ann Rev Gen 45:273-297. Recent in vitro reconstitution of the S. pyogenes type II CRISPR system has shown that a crRNA ("CRISPR RNA") fused to the normally trans-encoded tracrRNA ("trans-activating CRISPR RNA") is sufficient to direct the Cas9 protein to sequence-specifically cleave the target DNA sequence that coincides with the crRNA. Expression of a gRNA homologous to the target site leads to recruitment of Cas9 and degradation of the target DNA. See H. Deveau et al. (2008) J Bact 190, 1390. Further useful Cas proteins are from S. thermophilis or S. aureus.

[0125] Three classes of CRISPR systems are commonly known, referred to as type I, type II, or type III. In one embodiment, a particular useful enzyme of the present disclosure for cleaving dsDNA is the single effector enzyme Cas9 common to type II. See KS Makarova et al. (2011) Nature Rev Microbiol 9:467. All publications are incorporated herein by reference in their entirety.

[0126] In S. pyogenes, Cas9 generates a blunt-ended double-stranded break 3 bp upstream of the protospacer adjacent motif (PAM) through a process mediated by two catalytic domains in the protein: an HNH domain that cleaves the complementary strand of DNA and a RuvC-like domain that cleaves the non-complementary strand. See Jinek et al. (2012) Science 337, 816-821, which is incorporated herein by reference in its entirety. Cas9 protein is known to be present in many type II CRISPR systems and is listed in the supplementary information of Makarova et al., Nature Reviews, Microbiology, Vol. 9, June 2011, pp. 467-477, including: Methanococcus maripaludis C7; Corynebacterium diphtheriae; Corynebacterium efficiens YS-314; Corynebacterium glutamicum ATCC 13032 Kitasato; Corynebacterium glutamicum ATCC 13032 Bielefeld; Corynebacterium glutamicum R; Corynebacterium kroppenstedtii DSM 44385; Mycobacterium abscessus ATCC 19977; Nocardia farcinica IFM10152; Rhodococcus erythropolis PR4; Rhodococcus jostii RHA1;Rhodococcus opacus B4 uid36573;Acidothermus cellulolyticus 11B;Arthrobacter chlorophenolicus A6;Kribbella flavida DSM 17836 uid43465;Thermomonospora curvata DSM 43183;Bifidobacterium dentium Bd1;Bifidobacterium longum DJO10A;Slackia heliotrinireducens DSM 20476;Persephonella marina EX H1;Bacteroides fragilis NCTC 9434;Capnocytophaga ochracea DSM 7271;Flavobacterium psychrophilum JIP02 86;Akkermansia muciniphila ATCC BAA 835;Roseiflexus castenholzii DSM 13941;Roseiflexus RS1;Synechocystis PCC6803;Elusimicrobium minutum Pei191;uncultured Termite group 1 bacterium phylotype Rs D17;Fibrobacter succinogenes S85;Bacillus cereus ATCC 10987;Listeria innocua;Lactobacillus casei;Lactobacillus rhamnosus GG;Lactobacillus salivarius UCC118;Streptococcus agalactiae A909;Streptococcus agalactiae NEM316;Streptococcus agalactiae 2603;Streptococcus dysgalactiae equisimilis GGS 124;Streptococcus equi zooepidemicus MGCS10565; Streptococcus gallolyticus UCN34 uid46061; Streptococcus gordonii Challis subst CH1; Streptococcus mutans NN2025 uid46353; Streptococcus mutans; Streptococcus pyogenes M1 GAS; Streptococcus pyogenes MGAS5005; Streptococcus pyogenes MGAS2096; Streptococcus pyogenes MGAS9429; Streptococcus pyogenes MGAS10270; Streptococcus pyogenes MGAS6180; Streptococcus pyogenes MGAS315;Streptococcus pyogenes SSI-1;Streptococcus pyogenes MGAS10750;Streptococcus pyogenes NZ131;Streptococcus thermophiles CNRZ1066;Streptococcus thermophiles LMD-9;Streptococcus thermophiles LMG 18311;Clostridium botulinum A3 Loch Maree;Clostridium botulinum B Eklund 17B;Clostridium botulinum Ba4 657;Clostridium botulinum F Langeland;Clostridium cellulolyticum H10;Finegoldia magna ATCC 29328;Eubacterium rectale ATCC 33656;Mycoplasma gallisepticum;Mycoplasma mobile 163K;Mycoplasma penetrans;Mycoplasma synoviae 53;Streptobacillus moniliformis DSM 12112;Bradyrhizobium BTAi1;Nitrobacter hamburgensis X14;Rhodopseudomonas palustris BisB18;Rhodopseudomonas palustris BisB5;Parvibaculum lavamentivorans DS-1;Dinoroseobacter shibae DFL 12;Gluconacetobacter diazotrophicus Pal 5 FAPERJ;Gluconacetobacter diazotrophicus Pal 5 JGI;Azospirillum B510 uid46085;Rhodospirillum rubrum ATCC 11170;Diaphorobacter TPSY uid29975;Verminephrobacter eiseniae EF01-2;Neisseria meningitides 053442;Neisseria meningitides alpha14;Neisseria meningitides Z2491;Desulfovibrio salexigens DSM 2638;Campylobacter jejuni doylei 269 97;Campylobacter jejuni 81116;Campylobacter jejuni;Campylobacter lari RM2100;Helicobacter hepaticus;Wolinella succinogenes;Tolumonas auensis DSM 9187;Pseudoalteromonas atlantica T6c;Shewanella pealeana ATCC 700345;Legionella pneumophila Paris;Actinobacillus succinogenes 130Z;Pasteurella multocida;Francisella tularensis novicida U112;Francisella tularensis holarctica; Francisella tularensis FSC 198; Francisella tularensis; Francisella tularensis WY96-3418; and Treponema denticola ATCC 35405. In the literature, Cas9 protein is also referred to as Csn1 by those skilled in the art. The sequence of an exemplary S. pyogenes Cas9 protein is set forth in Deltcheva et al. (2011) Nature 471, 602-607, which is incorporated herein by reference in its entirety.

[0127] Modification of Cas9 protein is a representative embodiment of the present disclosure. CRISPR systems useful in the present disclosure are described in Barrangou, R. et al. (2012) Ann Rev Food Sci Technol.3:143 and Wiedenheft, B. et al. (2012) Nature 482, 331, each of which is incorporated herein by reference in its entirety.

[0128] According to certain embodiments, the DNA binding protein is modified or altered to inactivate nuclease activity. Such modifications or alterations include modification of one or more amino acids to inactivate nuclease activity or nuclease domain. Such modifications include removal of one or more polypeptide sequences exhibiting nuclease activity, i.e., nuclease domain, such that said polypeptide sequences exhibiting nuclease activity, i.e., nuclease domain, are absent from the DNA binding protein. Other modifications that inactivate nuclease activity will be readily apparent to those skilled in the art based on the present disclosure. Thus, a nuclease-deficient DNA binding protein includes a polypeptide sequence modified to inactivate nuclease activity or removal of one or more polypeptide sequences to inactivate nuclease activity. Even when nuclease activity is inactivated, the nuclease-deficient DNA binding protein retains the ability to bind to DNA. Thus, a DNA binding protein may include one or more polypeptide sequences required for DNA binding, but lack one or more or all of the nuclease sequences exhibiting nuclease activity. Thus, the DNA binding protein may contain one or more polypeptide sequences necessary for DNA binding, but may have one or more or all of the nuclease sequences inactivated, exhibiting inactivated nuclease activity. See Jinek et al. (2012) Science 337, 816-821. A Cas9 protein lacking nuclease activity is referred to as a nuclease-deficient Cas9 ("Cas9Nuc") and exhibits reduced or eliminated nuclease activity, or is absent or substantially absent within the detection level. According to this embodiment, the nuclease activity for Cas9Nuc may be undetectable by known assays, i.e., below the detection level of known assays.

[0129] In certain embodiments, the Cas9 protein comprises a sequence defined relative to a naturally occurring Cas9 from S. thermophiles or S. pyogenes and a protein sequence having at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% homology thereto, and which is a DNA binding protein, such as an RNA-guided DNA binding protein.

[0130] Exemplary CRISPR systems include S. Thermophiles Cas9 nuclease (ST1 Cas9) (see Esvelt, KM et al. (2013) Nature Methods. 10(11):1116-21, which is incorporated herein by reference in its entirety). Exemplary CRISPR systems include S. pyogenes Cas9 nuclease (Sp.Cas9), which is an extremely high affinity (see Sternberg, SH, et al. (2014) Nature 507, 62-67, which is incorporated herein by reference in its entirety), programmable DNA binding protein (see Garneau, JE et al. (2010) Nature 468, 67-71 and Jinek, M. et al. (2012) Science 337, 816-821, which are incorporated herein by reference in their entirety) isolated from a type II CRISPR-associated system. Various Cas proteins are known to those of skill in the art, including CasI (Cas3), Cas IA (Cas8a), CasIB (Cas8b), CasIC (Cas8c), CasID (Cas10d), CasIE (Cse1), CasIF (Csy1), CasIU, CasII (Cas9), CasIIA (Csn2), CasIIB (Cas4), CasIIC, CasIII (Cas10), CasIIIA (Csm2), CasIIIB (Cmr5), CasIIIC, CasIIID, CasIV (Csf1), CasIVA, CasIVB, CasV (Cpf1), C2c2, and C2c1.

[0131] In numerous CRISPR-based biotechnology applications (each of which is incorporated herein by reference in its entirety, see Mali, P. et al. (2013) Nature Methods 10:957-963; Hsu, PD et al. (2014) Cell 157, 1262-1278; Chen, B. et al. (2013) Cell 155:1479-1491; Shalem, O. et al. (2014) Science 343, 84-87; Wang, T. et al. (2014) Science 343:80-84; Nissim, L. et al. (2014) Molecular Cell 54:698-710; Ryan, OW et al. (2014) eLife 3; Gilbert, LA et al. (2014) Cell 159(3):647-61; and Citorik, R J et al. (2014) Nature Biotechnol. 32:1141-1145), the guide is often called a sgRNA (single-stranded guide RNA), and the two native Cas9 RNA cofactors (gRNA and tracrRNA) are fused via an engineered loop or linker.

[0132] According to certain aspects, the Cas9 protein is an enzymatically active Cas9 protein, a wild-type Cas9 protein, a nickase Cas9 protein, or a nuclease-deficient or nuclease-deleted Cas9 protein. Further exemplary Cas9 proteins include Cas9 proteins bound, conjugated, or fused to a functional protein, such as a transcriptional regulator, such as a transcriptional activator or a transcriptional repressor.

[0133] According to certain embodiments, the Cas9 protein can be delivered directly to cells by methods known to those of skill in the art, including injection or lipofection, or translated from its cognate mRNA or transcribed from its cognate DNA into mRNA (which is then translated into protein). The Cas9 DNA and mRNA can themselves be introduced into cells via electroporation, transient and stable transfection (including lipofection), and viral transduction, or other methods known to those of skill in the art.

[0134] Guide RNA The present disclosure provides the use of guide RNAs to target Cas proteins to target genes as described herein. Such guide RNAs can be easily designed by those skilled in the art when they know the specific target nucleic acid. The guide RNA can include one or more of a spacer sequence, a tracr mate sequence, and a tracr sequence. The term spacer sequence is understood by those skilled in the art and can include any polynucleotide that hybridizes to a target nucleic acid sequence and has sufficient complementarity with the target nucleic acid sequence to allow sequence-specific binding of a CRISPR complex to the target sequence. A guide RNA can be formed from a spacer sequence covalently linked to a tracr mate sequence (sometimes referred to as a crRNA) and a separate tracr sequence, where the tracr mate sequence hybridizes to a portion of the tracr sequence. According to certain embodiments, the tracr mate sequence and the tracr sequence are linked or linked, for example, covalently by a linker sequence, and the construct can be referred to as a fusion of the tracr mate sequence and the tracr sequence. The linker sequence described herein is a sequence of nucleotides, herein referred to as a nucleic acid sequence, that links the tracr mate sequence and the tracr sequence. Thus, the guide RNA may be a binary species (i.e., separate crRNA and tracr RNA that hybridize together) or a unialle species (i.e., a crRNA-tracr RNA fusion, often referred to as sgRNA).

[0135] In certain aspects, the guide RNA is about 10 to about 500 nucleotides in length. In some aspects, the guide RNA is about 20 to about 100 nucleotides in length. In certain aspects, the spacer sequence is about 10 to about 500 nucleotides in length. In certain aspects, the tracr mate sequence is about 10 to about 500 nucleotides in length. In some embodiments, the tracr sequence is about 10 to about 100 nucleotides in length. In some embodiments, the linker nucleic acid sequence is about 10 to about 100 nucleotides in length.

[0136] In some embodiments, guide RNAs may be delivered directly to cells as native species or transcribed from their cognate DNA by methods known to those of skill in the art, including injection or lipofection, and cognate DNA is introduced into cells by electroporation, transient and stable transfection (including lipofection), and viral transduction.

[0137] Modifying transcription of targeted genes using Cas9 In some aspects, modified Cas9-gRNA systems are provided that allow RNA-guided DNA regulation in cells, such as human cells, by tethering or linking a transcriptional regulatory domain to a nuclease-deficient Cas9 or guide RNA. In some aspects of the present disclosure, one or more transcriptional regulatory proteins or domains (these terms are used interchangeably) are linked or linked to a nuclease-deficient Cas9 or one or more guide RNAs (gRNAs). The transcriptional regulatory domains correspond to a target locus. Thus, aspects of the present disclosure include methods and materials for localizing the transcriptional regulatory domains to a target locus by fusing, linking, or linking them to either Cas9N or gRNA.

[0138] In some embodiments, mutant Cas9N fusion proteins capable of transcriptional activation are provided. In some embodiments, a VP64 activation domain (see Zhang et al., Nature Biotechnology 29, 149-153 (2011), which is incorporated herein by reference in its entirety) is linked, fused, bound, or tethered to the C-terminus of mutant Cas9N. In some methods, a transcriptional regulatory domain is provided to a site of a target mitochondrial DNA by a mutant vCas9N protein. In some methods, mutant Cas9N fused to a transcriptional regulatory domain is provided in a cell with one or more guide RNAs. The mutant Cas9N fused to the transcriptional regulatory domain binds to or near the target mitochondrial DNA. The one or more guide RNAs bind to or near the target mitochondrial DNA. The transcriptional regulatory domain regulates the expression of a target mitochondrial nucleic acid sequence. In certain embodiments, mutant Cas9N-VP64 fusions activate transcription of a reporter construct when combined with a gRNA that targets a sequence near the promoter, thereby demonstrating RNA-guided transcriptional activation.

[0139] In some embodiments, a gRNA fusion protein capable of transcriptional activation is provided. In some embodiments, a VP64 activation domain is linked, fused, bound, or tethered to a gRNA. In some methods, a transcriptional regulatory domain is provided by a gRNA to a site of a target mitochondrial DNA. In some methods, a gRNA fused to a transcriptional regulatory domain is provided in a cell with a mutant Cas9N protein. The mutant Cas9N binds to or near the target DNA. One or more guide RNAs having a transcriptional regulatory protein or domain fused thereto bind to or near the target DNA. The transcriptional regulatory domain regulates expression of a target gene. In certain embodiments, the mutant Cas9N protein and the gRNA fused to the transcriptional regulatory domain activate transcription of a reporter construct, thereby demonstrating RNA-guided transcriptional activation.

[0140] Transcriptional regulatory proteins or domains that are transcriptional activators include VP16 and VP64, as well as others that can be readily identified by one of skill in the art based on the present disclosure. For example, one of skill in the art could use a Cas9-gRNA system (either with intact cleavage or with dCas9 that may or may not be fused to VP16, KRAB, HDAC, methyltransferase, etc., or that can recruit similar activators or repressors with "spycatcher" or MS2 recruitment domains or similar domains) that can be used to increase or decrease the expression of the target genes defined herein that are used in combination for therapeutic or prophylactic effect.

[0141] target nucleic acid Target nucleic acids include any nucleic acid sequence that the colocalization complexes described herein may be useful for regulating, such as genes identified herein. Target nucleic acids include nucleic acid sequences that may be expressed into proteins. For the purposes of this disclosure, a colocalization complex may bind to or colocalize with a target nucleic acid at the location of the target nucleic acid, adjacent to the target nucleic acid, or in the vicinity of the target nucleic acid, such that the colocalization complex has a desired effect on the target nucleic acid. Based on this disclosure, a person skilled in the art will be able to easily identify or design guide RNAs and Cas9 proteins that colocalize with a target nucleic acid. A person skilled in the art will also be able to identify transcriptional regulatory proteins or domains that similarly colocalize with a target regulatory nucleic acid.

[0142] cell Cells according to the present disclosure include any cell into which an exogenous nucleic acid can be introduced and expressed as described herein. It should be understood that the basic concept of the present disclosure described herein is not limited by the type of cell. Cells according to the present disclosure include eukaryotic cells, mammalian cells, animal cells, and human cells, etc. Additionally, cells include those in which it is believed beneficial or desirable to regulate the production of a functional protein. Such cells may include cells lacking expression of a particular protein that results in a disease or adverse condition. Such diseases or adverse conditions are readily known to those of skill in the art. According to the present disclosure, nucleic acids responsible for the expression of a particular protein may be targeted by the methods described herein with transcriptional activators that result in upregulation of the target nucleic acid and the corresponding expression of the particular protein. In this way, the methods described herein provide a therapeutic treatment. Such cells may include those that overexpress a particular protein or those in which production of a particular protein is desired to reduce the induction of a disease or adverse condition. Such diseases or adverse conditions are readily known to those of skill in the art. According to the present disclosure, nucleic acids responsible for the expression of a particular protein may be targeted by the methods described herein and with transcriptional repressors that result in downregulation of the target nucleic acid and the corresponding expression of the particular protein. In this manner, the methods described herein provide a therapeutic treatment.

[0143] Delivery of nucleic acids that regulate functional proteins Foreign nucleic acid, also referred to as heterologous nucleic acid (i.e., not part of the cell's natural nucleic acid composition), may be introduced into a cell using any method known to one of skill in the art for such introduction. Such methods include transfection, transduction, viral transduction, microinjection, lipofection, nucleofection, nanoparticle guns, transformation, conjugation, and the like. One of skill in the art would readily understand and adapt such methods using readily identifiable literature sources. Foreign nucleic acid may be delivered to a subject by administering to the subject a nucleic acid or vector comprising a nucleic acid as described herein, such as by systemic administration to the subject, such as by intravenous, intraperitoneal, intramuscular, intracranial, intraocular, or subcutaneous injection.

[0144] For example, methods of gene therapy and gene delivery to a subject using adeno-associated viruses are described in U.S. Pat. No. 6,967,018, WO 2014 / 093622, U.S. Patent Application Publication No. 2008 / 0175845, U.S. Patent Application Publication No. 2014 / 0100265, EP 2432490, EP 2352823, EP 2384200, WO 2014 / 12719, each of which is incorporated herein by reference in its entirety. No. 8, WO 2005 / 122723, WO 2008 / 137490, WO 2013 / 142114, WO 2006 / 128190, WO 2009 / 134681, EP 2341068, WO 2008 / 027084, WO 2009 / 054994, WO 2014059031, U.S. Pat. No. 7,977,049, and WO 2014 / 059029.

[0145] vector Vectors are intended for use with the methods and constructs described herein. The term "vector" includes a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. Vectors used to deliver the nucleic acids described herein to cells include vectors known to those of skill in the art and used for such purposes. Certain exemplary vectors include, among others, plasmids, lentiviruses, and adeno-associated viruses, and are known to those of skill in the art. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules that contain one or more free ends or that do not contain free ends (e.g., circular); nucleic acid molecules that contain DNA, RNA, or both; and other types of polynucleotides known in the art. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, in which viral-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retroviruses, lentiviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by viruses for transfection into host cells. Certain vectors are capable of autonomous replication in the host cells into which they are introduced (e.g., bacterial vectors and episomal mammalian vectors having a bacterial origin of replication). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of the host cell upon introduction into the host cell and are replicated along with the host genome. In addition, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors." Common expression vectors useful in recombinant DNA techniques are often in the form of plasmids.A recombinant expression vector may contain a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, meaning that the recombinant expression vector contains one or more regulatory elements operably linked to the nucleic acid sequence to be expressed, which may be selected based on the host cell used for expression. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to a regulatory element in such a way as to allow expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or within a host cell when the vector is introduced into the host cell).

[0146] Methods for non-viral delivery of nucleic acids or natural DNA binding proteins, natural guide RNAs or other natural species include lipofection, microinjection, gene guns, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and drug-enhanced DNA uptake.Lipofection is described, for example, in U.S. Patent Nos. 5,049,386, 4,946,787, and 4,897,355, which are incorporated herein by reference.Lipofection reagents are available from commercial sources (e.g., Transfectam™ and Lipofectin™).Cationic and neutral lipids suitable for efficient receptor-recognition lipofection of polynucleotides include those described in Felgner, WO 91 / 17424, WO 91 / 16024. It can be delivered to a cell (e.g., in vitro or ex vivo administration) or to a target tissue (e.g., in vivo administration). The term "naturally occurring" includes the protein, enzyme, or guide RNA species themselves, and does not include the nucleic acid encoding these species.

[0147] In some embodiments, the gene therapy vector for use in the methods herein is a parvoviral vector, such as an animal parvovirus, in particular a dependovirus, such as an infectious human adeno-associated virus (AAV) or an infectious simian adeno-associated virus (AAV), and components thereof (e.g., an animal parvovirus genome), for use as a vector for the introduction and / or expression of a nucleotide sequence encoding a porphobilinogen deaminase in mammalian cells. Viruses of the Parvoviridae family are small DNA animal viruses. The Parvoviridae family is divided into two subfamilies, the Parvovirinae, which infect vertebrates, and the Densovirinae, which infect insects. Members of the Parvovirinae family are referred to herein as parvoviruses, and include the genus Dependovirus. As inferred from their genus name, members of the dependoviruses are characterized in that they usually require co-infection with a helper virus, such as an adenovirus or a herpesvirus, for productive infection in cell culture. The Dependovirus genus includes AAV, which normally infects humans (e.g., serotypes 1, 2, 3A, 3B, 4, 5, and 6) or primates (e.g., serotypes 1 and 4), and closely related viruses that infect other warm-blooded animals (e.g., bovine, canine, equine, and ovine adeno-associated viruses). Further information regarding parvoviruses and other members of the Parvoviridae family can be found in Kenneth 1. Berns, Fields Virology (3rd ed., 1996), Chapter 69, "Parvoviridae: The Viruses and Their Replication." For convenience, the invention will be further illustrated and described herein with reference to AAV. However, it will be understood that the invention is not limited to AAV and is equally applicable to other parvoviruses.

[0148] The genomic organization of all known AAV serotypes is very similar. The genome of AAV is a linear, single-stranded DNA molecule less than about 5,000 nucleotides (nt) in length. Inverted terminal repeats (ITRs) flank unique coding nucleotide sequences for nonstructural replication (Rep) and structural (VP) proteins. The VP proteins (VP1, VP2, and VP3) form the capsid. The terminal 145 nt are self-complementary and organized such that energetically stable intramolecular duplexes forming T-shaped hairpins can form. These hairpin structures serve as origins of viral DNA replication and as primers for cellular DNA polymerase complexes. Following wild-type (wt) AAV infection in mammalian cells, the Rep genes (i.e., Rep78 and Rep52) are expressed from the P5 and P19 promoters, respectively, and both Rep proteins have a function in replicating the viral genome. Due to splicing events in the Rep ORF, four Rep proteins (i.e., Rep78, Rep68, Rep52, and Rep40) are actually expressed.However, it has been shown that the unspliced ​​mRNAs encoding the Rep78 and Rep52 proteins are sufficient for AAV vector production in mammalian cells.In insect cells, the Rep78 and Rep52 proteins are also sufficient for AAV vector production.

[0149] As used herein, "recombinant parvovirus," "AAV vector," or "rAAV vector" refers to a vector that contains one or more of a polynucleotide sequence of interest (ITR), a gene of interest, or a "transgene" flanked by at least one parvovirus or AAV inverted terminal repeat sequence. Such rAAV vectors can be replicated and packaged into infectious viral particles when present in an insect host cell that expresses the AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When the rAAV vector is incorporated into a larger nucleic acid construct (e.g., a chromosome, or another vector such as a plasmid or baculovirus used for cloning or transfection), the rAAV vector is commonly referred to as a "pro-vector" and is capable of being "rescued" by replication and encapsidation in the presence of AAV packaging functions and necessary helper functions. Thus, in a further aspect, the present invention relates to a nucleic acid construct comprising a nucleotide sequence encoding a porphobilinogen deaminase as defined above, said nucleic acid construct being a recombinant parvovirus or AAV vector and comprising at least one parvovirus or AAV ITR. Preferably, in the nucleic acid construct the nucleotide sequence encoding the porphobilinogen deaminase is flanked by parvovirus or both AAV ITRs.

[0150] AAV is capable of infecting many mammalian cells. See, e.g., Tratschin et al. (1985) Mol. Cell Biol. 5:3251-3260) and Grimm et al. (1999) Hum. Gene Ther. 10:2445-2450). However, AAV transduction of human synovial fibroblasts is significantly more efficient than analogous mouse cells (Jennings et al. (2001) Arthritis Res, 3:1), and the cell tropism of AAV varies with serotype. See, e.g., Davidson et al. (2000) Proc. Natl. Acad. Sci. USA, 97:3428-3432, which discusses differences between AAV2, AAV4, and AAV5 with respect to mammalian CNS cell tropism and transduction efficiency, and Goncalves, (2005) Virol J. 2(1):43, which discusses approaches to modifying AAV tropism. In some embodiments, for transduction of hepatocytes, rAAV virions having AAV1 capsid protein, AAV8 capsid protein, and AAV5 capsid protein are preferred (Nathwani et al. (2007) Blood 109(4):1414-1421; Kitajima et al. (2006) Atherosclerosis 186(1):65-73), of which rAAV virions having AAV5 capsid protein may be most preferred.

[0151] AAV is the most prevalent in the human population (see Gao, G., et al. (2004) J Virol. 78(12):6381-8 and Boutin, S., et al. (2010) Hum Gene Ther. 21(6):704-12) and is useful as a viral vector. Many serotypes exist, each with different tropism for tissue types (Zincarelli, C., et al. (2008) Mol Ther. 16(6):1073-80), and specific tissues can be preferentially targeted with appropriate pseudotyping. Some serotypes, such as serotypes 8, 9, and rh10, transduce the mammalian body. See Zincarelli, C., et al. (2008) Mol Ther. 16(6): 1073-80; Inagaki, K., et al. (2006) Mol Ther. 14(1): 45-53; Keeler, A. M., et al. (2012) Mol Ther. 20(6): 1131-8; Gray, S. J. et al. (2011) Mol Ther. 19(6): 1058-69; Okada, H., et al. (2013) Mol Ther Nucleic Acids. 2: e95; and Foust, K. D., et al. (2009) Nat Biotechnol. 27(1): 59-65. AAV9 has been demonstrated to cross the blood-brain barrier, which is inaccessible to many viral vectors and biologics. See Foust, KD, et al. (2009) Nat Biotechnol. 27(1):59-65; and Rahim, AA et al. (2011) FASEB J. 25(10):3505-18). Certain AAVs have a payload of 4.7-5.0 kb and contain viral terminal inverted repeats (ITRs) required in cis for viral packaging. See Wu, Z. et al. (2010) Mol Ther. 18(1):80-6 and Dong, JY et al. (1996) Hum Gene Ther. 7(17):2101-12, all publications of which are incorporated herein by reference.

[0152] AAV VP proteins are known to determine the cellular tropism of AAV virions. The sequences encoding VP proteins are significantly less conserved among various AAV serotypes than the Rep proteins and Rep genes. The ability of Rep and ITR sequences to cross-complement corresponding sequences of other serotypes allows the production of pseudotyped rAAV particles that contain the capsid proteins of one serotype (e.g., AAV5) and the Rep and / or ITR sequences of another AAV serotype (e.g., AAV2). Such pseudotyped rAAV particles are part of the present invention. Here, pseudotyped rAAV particles are referred to as "x / y" type, where "x" indicates the source of the ITRs and "y" indicates the serotype of the capsid. For example, a 2 / 5 rAAV particle has ITRs from AAV2 and a capsid from AAV5. Modified "AAV" sequences can also be used in the context of the present disclosure, for example for the production of rAAV vectors in insect cells. Such modified sequences include, for example, sequences having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more nucleotide and / or amino acid sequence identity (e.g., sequences having about 75% to about 99% nucleotide sequence identity) to AAV1 ITR, AAV2 ITR, AAV3 ITR, AAV4 ITR, AAV5 ITR, AAV6 ITR, AAV7 ITR, AAV8 ITR, AAV9 ITR, AAV10 ITR, AAV11 ITR, AAV12 ITR, AAV2.5 ITR, AAvDJ ITR, AAVrh10.XX ITR, Rep, or VP, which can be used in place of the wild-type AAV ITR, Rep, or VP sequences. Preferred adenoviral vectors are modified to reduce host responses. See, e.g., Russell (2000) J. Gen. Virol. 81:2573-2604; U.S. Patent Application Publication No. 2008 / 0008690, and Zaldumbide et al. (2008) Gene Therapy 15(4):239-46, all publications of which are incorporated herein by reference.

[0153] Regulatory Elements and Terminators Regulatory elements are intended to be used with the gene therapy vector constructs described herein. The term "regulatory elements" is intended to include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Regulatory elements include elements that direct constitutive expression of a nucleotide sequence in many types of host cells and elements that direct expression of a nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can direct expression primarily in a desired tissue of interest, such as muscle, neurons, bone, skin, blood, a specific organ (e.g., liver, pancreas), or a specific cell type (e.g., lymphocytes). Regulatory elements can also direct expression in a time-dependent manner, such as cell cycle-dependent or developmental stage-dependent, and may or may not be tissue or cell type specific. In some embodiments, the vector may include one or more pol III promoters (e.g., 1, 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g., 1, 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g., 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof. Examples of pol III promoters include, but are not limited to, the U6 promoter and the H1 promoter.Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer (see, e.g., Boshart et al. (1985) Cell 41:521-530), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, as well as the EF1α promoter and Pol II promoters described herein. The term "regulatory element" also includes the WPRE, the CMV enhancer, the R-U5' segment in the LTR of HTLV-1 (Takebe, Y. (1988) Mol. Cell. Biol. 8(1):466-472), the SV40 enhancer, and the intron sequence between the second and third exons of rabbit β-globin (O'Hare K. et al. (1985) Cell 41:521-530). al. (1981) Proc. Natl. Acad. Sci. USA. 78(3):1527-31). Those skilled in the art will appreciate that the design of the expression vector may depend on factors such as the choice of the host cell to be transformed, the level of expression desired, etc. The vector can be introduced into a host cell to produce a transcript, protein, or peptide, including a fusion protein or fusion peptide, encoded by the nucleic acid described herein (e.g., a clustered regularly interspaced short palindromic repeats (CRISPR) transcript, protein, enzyme, variants thereof, fusion proteins thereof, etc.).

[0154] Aspects of the methods described herein may utilize terminator sequences. Terminator sequences include portions of a nucleic acid sequence that indicate the end of a gene or operon in genomic DNA during transcription. This sequence mediates transcription termination by providing a signal in the newly synthesized mRNA that triggers processes that release the mRNA from the transcription complex. These processes include direct interaction of the complex with mRNA secondary structures and / or indirect activity of recruited termination factors. Release of the transcription complex frees RNA polymerase and associated transcription machinery to begin transcription of new mRNAs. Terminator sequences are known in the art and include those identified and described herein.

[0155] Dosage, Administration, and Treatment In various embodiments, the one or more gene delivery vectors, including viral vectors, and packaged viral particles, including viral vectors, may be in the form of a medicament or pharmaceutical composition and may be used in the manufacture of a medicament or pharmaceutical composition. The pharmaceutical composition may include a pharmaceutical acceptable carrier. Preferably, the carrier is suitable for parenteral administration. In certain embodiments, the carrier is suitable for intravenous, intraperitoneal, or intramuscular administration. Pharmaceutically acceptable carriers or excipients are described, for example, in Remington: The Science and Practice of Pharmacy, edited by Alfonso R. Gennaro, Publishing Company (1997). Exemplary pharmaceutical forms may be combined with sterile saline, dextrose solution, or buffer solution, or other pharmaceutical acceptable sterile liquids. Alternatively, a solid carrier, such as, for example, microcarrier beads, may be used.

[0156] The pharmaceutical compositions are usually sterile and stable under the conditions of manufacture and storage. The pharmaceutical compositions can be formulated as solutions, microemulsions, liposomes, or ordered structures suitable for delivery of gene therapy vectors. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the composition. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin. The vectors of the present disclosure can be administered in sustained or controlled release formulations in compositions containing, for example, slow release polymers or other carriers that protect the compound against rapid release, including implants and microencapsulated delivery systems. For example, biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid, and polylactic / polyglycolic acid copolymers (PLG).

[0157] In some embodiments, the gene therapy vector, formulated with any acceptable carrier, can be administered parenterally, such as intravenously, intraperitoneally, subcutaneously, or intramuscularly, by limb perfusion, or a combination thereof. Administration can be systemic, such that the gene delivery vector is delivered to the entire body of the subject. In some embodiments, the gene delivery vector can be administered directly to the target tissue, such as to the heart, liver, synovium, or intrathecally to neural tissue. In some embodiments, the gene delivery vector can be administered locally, such as by catheter. The route of administration can be determined by one of skill in the art, taking into consideration, for example, the nature of the target tissue, the gene delivery vector, the intended therapeutic effect, the maximum load that can be administered and absorbed by the target tissue, etc.

[0158] In general, an effective amount, particularly a therapeutically effective amount, of gene delivery vector is administered to a subject in need thereof. "Therapeutically effective amount" refers to an amount effective at the dosage and duration required to achieve a desired therapeutic result, such as treatment or improvement of age-related symptoms. An effective or therapeutically effective amount of vector may vary depending on factors such as the individual's condition, age, sex, and weight, and the ability of the viral vector to induce a desired response in the individual. Dosage regimens may be adjusted to provide an optimal therapeutic response.

[0159] In certain embodiments, the therapeutically or prophylactically effective amount of a nucleic acid, nucleic acid construct, parvoviral virion, or pharmaceutical composition is in the range of 1×10 11 ~1×10 14 Genome copies (gc) / kg or 1 x 10 12 ~1×10 13 The dose is expressed in genome copies (gc) / kg. It should be noted that the value of the dosage may vary depending on the severity of the condition to be alleviated. The dosage may also vary based on the potency of the virion used. For example, AAV8 is better for infecting the liver compared to AAV2, and AAV9 is better for infecting the brain than AAV8. In these two cases, less AAV8 or AAV9 is needed for each case of liver or brain. For any particular subject, a particular dosing regimen can be adjusted over time according to the individual's needs and the professional judgment of the person administering or supervising the administration of the composition. The dosage ranges described herein are merely exemplary and do not limit the dosage ranges that may be selected by a physician.

[0160] The target tissue may be specific, such as liver tissue, or may be a combination of several tissues, such as muscle tissue and liver tissue. Exemplary target tissues may include liver, skeletal muscle, cardiac muscle, fat deposits, kidney, lung, vascular endothelium, epithelial cells, and / or hematopoietic cells. In some embodiments, the effective dose range for small animals (mice) by intramuscular injection is 1×10 12 ~1×10 13Genome copies (gc) / kg, 1×10 for larger animals (cats or dogs) and humans 11 ~1×10 12 gc / kg or 1×10 11 ~1×10 14 Genome copies (gc) / kg.

[0161] In various embodiments, the gene delivery vector can be administered as a bolus or by continuous infusion over time. In some embodiments, several divided doses can be administered over time, or the dose can be proportionally reduced or increased as indicated by the exigencies of the treatment situation. In some embodiments, the gene delivery vector can be administered daily, weekly, biweekly, or monthly. The treatment period can be at least one week, one month, two months, three months, six months, eight months, or more. In some embodiments, the treatment period can be up to one year or more, up to two years or more, up to three years or more, or indefinitely.

[0162] In some embodiments, a therapeutically effective amount is administered to a subject to treat a condition or disease associated with aging, such as an age-related disease or disorder.The application of the present invention extends the period during which an individual is generally healthy and free of chronic disease, and / or the present invention improves disorders that frequently appear in elderly and aging adult populations, including one or more of cardiovascular disease, diabetes, atherosclerosis, obesity, cancer, infectious diseases, and neurological disorders.Any well-established indicator of aging progression can be used.

[0163] In some embodiments, the gene therapy described herein is used to at least one of the following indicators of aging: reducing the incidence of cancer, delaying or ameliorating cardiovascular diseases such as atherosclerosis, delaying and / or ameliorating osteoporosis, improving glucose tolerance or reducing the incidence of related diseases such as diabetes and obesity, improving or reducing the decline in memory function and other cognitive functions, improving or reducing the decline in neuromuscular co-operation, improving or reducing the decline in immune function. The improvement of age-related disorders brought about by the gene therapy methods herein can occur as a result of a reduction in symptoms in affected subjects or a reduction in the incidence of the disease or disorder in a population compared to an untreated population. Gene therapy has the effect of treating and / or preventing various age-related symptoms and diseases as assessed by specific markers and aging disorders. Thus, in a further aspect, the present invention refers to the use of a gene therapy method or a nucleic acid vector as described above for use in the treatment or prevention in a subject of at least one disorder or marker of ageing selected from the group consisting of: decreased cardiovascular function, osteoporosis, arthropathy, glucose tolerance, insulin resistance, memory loss, loss of neuromuscular co-ordination, increased cardiovascular disease, decreased cardiac, circulatory or pulmonary function, and decreased lifespan, or a combination thereof.

[0164] In some embodiments, the gene therapy methods described herein are used to extend the lifespan of a subject of any particular species. The extended lifespan can be an increase in the average lifespan of individuals of that species who have reached adulthood and / or an increase in the maximum lifespan of that species. In some embodiments, the extended lifespan can be a 5%, 10%, 15%, 20% or more increase in the maximum lifespan and / or a 5%, 10%, 15%, 20% or more increase in the average lifespan. EXAMPLES

[0165] Example 1: Methods of modulating TGFβ1 The present disclosure provides gene therapy methods for long-term regulation of TGFβ1 in animals, such as humans or other mammals, such as domestic animals, such as dogs or cats. The present disclosure provides gene therapy methods for long-term regulation of TGFβ1 in animals, such as humans or other mammals, such as domestic animals, such as dogs or cats, as a method of treating or preventing inflammation, remodeling, or fibrosis. The present disclosure provides gene therapy methods for regulation of TGFβ1 in animals, such as humans or other mammals, such as domestic animals, such as dogs or cats, to treat cardiac disease, such as increased fibrosis. The present disclosure provides for regulation of TGFβ1 by gene therapy, including nucleic acid delivery to cells, for example, by using an adeno-associated vector. The present disclosure provides for regulation of TGFβ1 by delivery of a nucleic acid that produces a soluble circulating protein that binds to TGFβ1 and inhibits its ability to activate the endogenous pathway. The soluble circulating protein can be the extracellular domain of TGFβ receptor 2. One skilled in the art can also make forms from TGFβ receptor 1 or TGFβ receptor 3 as well. The soluble TGFβ receptor 2 protein is truncated at the transmembrane domain of the protein as predicted by annotation software and the hydrophobicity of the amino acids.

[0166] Plasmids The AAV vector was generated using the following forward and reverse primers: The extracellular domain was amplified using

[0167] [ka]

[0168] The bold and italicized parts of the forward primer are the Kozak sequence, and the bold and italicized parts of the reverse primer match the mouse igg domain fused to the C-terminus by overlap PCR.

[0169] The igg domain was amplified using the following forward and reverse primers:

[0170] [ka]

[0171] The bold and italicized parts match the extracellular domain of TGFbR2 for overlap PCR. The two parts were combined using an equimolar ratio of the amplified fragments in a second round of PCR using the forward primer from the TGFbR2 amplification and the reverse primer from the igg amplification. This generated the full length 1251 base pair fusion protein sTGFbR2-Fc(igg2Ae), which was ligated into the AAV backbone with unique restriction enzyme site overhangs NotI and NheI.

[0172] AAV production Quantification of AAV production and titer was performed according to Lock, M. 2010 Human gene therapy and Kwon, O. et al. (2010) J Histochem Cytochem. 58(8):687-694. Briefly, Hek293 cells were triple-co-transduced at 75% confluency in a 10-layer Nunc™ Cell Factory™ system from Thermo Scientific (Rockford, IL) using PEI transfection reagent according to the manufacturer's instructions. Cells and supernatants were harvested separately 72 hours after transfection. Cells were spun down, lysed by three freeze-thaw cycles, and incubated with benzonase (E1015-25KU, Sigma). They were then clarified by centrifugation at 10,500×G for 20 min, and the supernatant was added to the remaining medium supernatant. The whole was filtered through a 0.2 μM filter and then concentrated to 15 ml using a lab-scale TFF system (EMD Chemicals, Gibbstown, NJ). A Pellicon XL 100 kDa filter was used, following the manufacturer's instructions (EMD Chemicals, Gibbstown, NJ). The concentrated preparation was re-cleared by centrifugation at 10,500×g for 20 min at 15° C., and the supernatant was carefully transferred to a new tube. A six-step iodixanol gradient was formed according to the method of Zolotukhin et al. (1999) Gene Ther. 6:973-85, with the following modifications: Stepwise high density solutions of iodixanol (OptiPrep, Sigma-Aldrich, St. Louis, MO) in phosphate buffered saline (PBS) containing 10 mM magnesium chloride and 25 mM potassium were layered sequentially into 39 ml Quick-Seal centrifuge tubes (Beckman Instruments, Palo Alto, CA). The gradient steps were 4 ml of 15% iodixanol, 9 ml of 25% iodixanol, 9 ml of 40% iodixanol, and 5 ml of 54% iodixanol. 14 ml of clarified feed was layered on top of the gradient and the tubes were sealed.The tubes were centrifuged at 242,000 × g for 70 min at 18 °C in a VTi 50 rotor (Beckman Instruments), and the 40% gradient was collected through an 18-gauge needle inserted horizontally at the 54% / 40% interface. The virus containing iodixanol was diafiltered using an Amicon 15-Ultra, washed five times with final formulation buffer (PBS-35 mM NaCl), and concentrated to approximately 1 ml.

[0173] Vector characterization DNase I-resistant vector genomes were titered by TaqMan PCR amplification (Applied Biosystems, Foster City, CA) using primers and a probe for the WPRE3 polyadenylation signal encoded in the transgene cassette. The purity of gradient fractions and final vector lots was assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and proteins were visualized by SYPRO Ruby stain (Invitrogen) and UV excitation.

[0174] infection Mice were infected by intraperitoneal (IP), tail vein (IV), or retro-orbital (RO) injection. Briefly, the IP injection location is determined by drawing an imaginary line across the abdomen just above the knee. The needle is inserted along this line on the right side of the animal, close to the midline. To perform an IP injection, the mouse must be sufficiently restrained to prevent movement during the procedure. Tilt the entire mouse so that the top of the head is facing the ground and the hind legs are elevated so that the abdomen faces the surgeon. Entering the needle into the abdomen at an angle of approximately 30 degrees will result in the needle shaft entering approximately 0.5 centimeters deep. Aspirate to ensure that the needle has not reached blood vessels, intestines, or bladder. Inject the contents of the syringe, withdraw the needle, and return the mouse to its original cage. The recommended needle size for IP injections in mice is 25-27 gauge. For IV injections into the tail vein, restrain the mouse and hold the tail over a bright light to locate the tail vein. Allow the vein to dilate by placing the mouse briefly under a heat lamp to dilate the blood vessels. Then, using a 25 gauge needle, inject the mouse with up to 200ul. RO injections are performed under anesthesia. Prepare the anesthetized mouse by applying slight pressure to inflate the eye, then slide the needle behind the eye and inject up to 150ul for adult mice.

[0175] surgery Aortic constriction (ACC) is caused in adult animals by constriction of the ascending aorta. An incision can be made in the chest wall at approximately the third intercostal space. A rodent thoracotomy is inserted and the ribs gently spread apart to gain access to the thoracic cavity. The ascending aorta is then isolated from the pulmonary artery and a sterile 8.0 Prolene ligature is passed through it approximately 3 mm from the base of the heart. A 27-gauge blunt needle is placed at the top end of the aorta and a ligature is tied around the needle. The needle is then carefully removed from under the ligature. The thoracotomy is closed and the lungs are reinflated. The ribs, pectoralis muscle, and skin are closed with sterile sutures (5-0 Dexon and 6-0 Prolene sutures to close the muscle, subcutaneous layer, and skin, respectively). The surgeon minimizes pneumothorax by expanding the lungs in conjunction with the placement of the final suture to close the thoracotomy. Sham-operated animals undergo a similar procedure without constriction of the aorta. Animals will be closely monitored until fully recovered from anesthesia. Once the animal regains consciousness (and has an accessible airway), it will be extubated. Animals will be constantly and closely monitored until full neurological clarity is achieved. Sutures will be removed 10-14 days after surgery. Date, time, and type of surgical procedure will be recorded in the clinical postoperative record, as appropriate. ACC operative mortality may be 30%.

[0176] Noninvasive echocardiography To continuously and non-invasively evaluate cardiac structure and function, animals undergo non-invasive transthoracic echocardiography at designated time points (not more than once a week). For this, animals are brought to a designated procedure room. Animals (mice and rats) are lightly anesthetized with 1.5-5% isoflurane. Sedation is confirmed by the lack of reaction to gentle pinching of the skin. Ophthalmic ointment is applied to the anesthetized animals to prevent eye dryness and the development of inflammation or ulcers. To obtain clear echo images, hair is removed from the animal's chest using a #40 blade and medical grade depilatory cream. The animal is gently placed on a platform and an echocardiographic probe is placed on the left chest wall. While ultrasound imaging is taking place, the animal's heart rate and respiratory rate are monitored by a physiological monitor connected to the echo machine and the platform on which the animal is placed. Ultrasound images are generally obtained within 15 minutes, and the examination does not cause pain to the animal. During the procedure, animals are closely monitored for signs of distress, if any are observed the procedure is terminated immediately and the animals are returned to their home cages.

[0177] Euthanasia Animals were kept in a CO 2 Euthanasia is by slow dosing. Animals are typically euthanized in their home cage, out of view of other animals. A regulator is used to ensure adequate flow rate. Animals will rapidly lose consciousness within 30 seconds. When breathing ceases (several minutes), animals will be euthanized by secondary physical methods.

[0178] Tissue collection Tissues were harvested immediately after euthanasia. One part of each organ was flash frozen on dry ice for qPCR analysis and sequencing, and the other part of each organ was then fixed in formalin for 24–48 h depending on size and frozen in OCT buffer for sectioning and analysis.

[0179] blood sampling Hold the mouse by the back of the neck and puncture the mandibular vein / artery with a needle and collect blood into heparin-coated tubes.

[0180] Staining and sectioning Mice are sectioned using a microtome and then paraffin embedded. Deparaffinization and rehydration are performed by heating the slides to 50°C, followed by xylene and ethanol and finally DI H. 2 Successive baths in 1000 ml of PBS are then performed. Slides are then incubated in boiling citrate buffer for 10 minutes and cooled on the bench at room temperature. Slides are then washed 5 times in PBS for 2 minutes each. Slides are blocked with 3% BSA in PBS for 1 hour at room temperature. Primary antibody was applied at 1:300 dilution in 3% BSA / PBS overnight at 4°C. Slides are then washed 5 times in PBS for 2 minutes each. Secondary antibody in 3% BSA / PBS is applied at 1 / 100 dilution for 1 hour at 37°C. Slides are then washed 5 times in PBS for 2 minutes each. 50 μl of DAPI (or Hoechst final concentration 5 μg / ml) per slide is applied for 30 minutes at room temperature (in a humid chamber). Slides are then washed 5 times in PBS for 2 minutes each. Mount and cover with mounting medium without DAPI.

[0181] Inhibition of transforming growth factor beta 1 (TGF beta 1) In a mouse model of HCM / DCM in which aortic ligation is used to achieve pressure overload that ultimately causes the desired phenotype, AAV was used to deliver nucleic acid encoding a soluble receptor protein of transforming growth factor receptor II (TGFbRII) to cells. AAV was used for long-term, permanent reduction of TGFβ1, which is beneficial in reducing heart failure and extending lifespan, as shown in the survival curves shown in Figure 7. The soluble receptor protein binds to TGFβ1 to reduce signaling of this pathway and alleviate the induction of fibrotic tissue and inflammatory responses. As shown in Figure 2, administration of nucleic acid encoding a soluble receptor protein of transforming growth factor receptor II (TGFbRII) with AAV reduced serum TGFβ1 by up to 95% and reduced TGFβ1 signaling.

[0182] Gene therapy affected the development of fibrotic lesions. As shown in Figure 3, control samples show fibrosis of about 30% of the total area of ​​the sectioned heart compared to about 8% in the hearts of AAV-treated mice. Gene therapy also affected the function of the heart 7 weeks after AAC surgery. As shown in Figure 1, there is a large difference in the strength of cardiac contraction and left ventricular volume as seen in the echocardiogram. Figure 5 shows that control animals have negative changes in several parameters such as heart wall thickness, left ventricular ejection fraction, left ventricular fractional shortening, and left ventricular volume. Gene therapy animals show no change or positive changes in these parameters.

[0183] Figure 4 shows WGA and DAPI staining of control hearts, and Figure 6 shows representative trichrome staining images.

[0184] Example 2: Combination Gene Therapy The present disclosure provides a gene therapy method for the delivery of a nucleic acid encoding a soluble receptor protein for transforming growth factor receptor II (TGFbRII) and a nucleic acid encoding Nrf2 (or nuclear factor (erythroid-derived 2)-like 2 Nfe212). Nrf2 is an antioxidant protein that protects against oxidative damage caused by injury and inflammation. The present disclosure provides a method of using two viruses, each containing one transgene cassette (i.e., ITR-hEf1α-sTGFbR2-Fc-WPRE3-SV40pA-ITR, and ITR-hEf1α-Nrf2-WPRE3-SV40pA-ITR), in combination with each other by direct injection. The present disclosure provides for combining both transgenes in one vector by use of a viral 2A sequence or IRES where the two genes are expressed from one promoter (i.e., ITR-hEf1α-sTGFbR2-Fc-P2A-Nrf2-WPRE3-SV40pA-ITR, or ITR-hEf1α-sTGFbR2-Fc-IRES-Nrf2-WPRE3-SV40pA-ITR).

[0185] Example 3: Methods for modulating adiponectin The present disclosure provides a gene therapy method for modulating adiponectin in animals, such as humans or other mammals, such as domestic animals, such as dogs or cats. Adeno-associated viruses are provided that include a constitutive promoter driving expression of adiponectin and DsbA-L (GSTΚ1)-encoding nucleic acids. Such nucleic acid constructs can include a 3'UTR that includes WPRE3 and SV40 late poly(A). Adiponectin-encoding nucleic acid is provided in a first vector, and DsbA-L-encoding nucleic acid is provided in a second vector. The first and second vectors are self-complementary AAV vectors. Self-complementary adeno-associated viruses (scAAV) are viral vectors engineered from naturally occurring adeno-associated viruses (AAV). rAAV is referred to as "self-complementary" because the coding region is designed to form an intramolecular double-stranded DNA template. Because a typical AAV genome is a single-stranded DNA template, the rate-limiting step of a standard AAV genome involves second strand synthesis. However, this is not the case with the scAAV genome. Upon infection, rather than waiting for cell-mediated synthesis of the second strand, the two complementary halves of the scAAV associate to form one double-stranded DNA (dsDNA) unit ready for immediate replication and transcription. In gene therapy applications utilizing rAAV, the virus transduces cells with a single-stranded DNA (ssDNA) flanked by two inverted terminal repeats (ITRs). These ITRs form hairpins at the ends of their sequence and act as primers to initiate second-strand synthesis before the subsequent infection step begins. Second-strand synthesis is thought to be one of several blocks for efficient infection. Additional advantages of scAAV include extended transgene expression in vitro and in vivo, as well as higher in vivo DNA stability and more effective circularization.

[0186] Example 4: Methods of Treating Obesity The present disclosure provides a gene therapy method for the delivery of nucleic acids encoding fibroblast growth factor 21 (FGF21) and either or all of BMP2, BMP4, or Sema3a collectively. FGF21 is known to shift the balance between osteoblasts and osteoclasts toward osteoclastogenesis through inhibition of cell differentiation into osteoblasts and promotion of cell differentiation into osteoclasts. To balance the negative side effects of bone loss due to increased expression of FGF21, multiple genes are delivered. FGF21 induces weight loss as seen in Figures 8A and 8B without obvious toxicity (as seen by body condition score and activity monitoring). Mice maintained on a high-fat diet were able to lose up to 40% weight (returning to normal weight for the age of the mouse) and appeared to stabilize in the normal range. To combat bone loss, one, two, or all of BMP2, BMP4, or Sema3a are delivered simultaneously or sequentially with FGF21 as part of a combination therapy to restore the balance of osteoblasts and osteoclasts to homeostasis.

[0187] According to certain aspects, there is provided a method of reducing body weight in an individual or increasing the metabolic rate of an individual comprising delivering to the individual a nucleic acid encoding fibroblast growth factor 21 (FGF21) or modulating (upregulating or downregulating) FGF21 in a gene therapy method, such as using AAV.

[0188] Experiments were performed to measure food intake when mice were given FGF21 as a gene therapy, and showed that treated mice consumed a higher fat diet but were still able to maintain normal mouse lean body mass, indicating a change in metabolic state. See Figure 16. The effect of gene therapy on respiratory rate and activity was determined. Mice treated with FGF21 were placed in a Columbus Instruments CLAMS system and the mouse O 2 consumption, CO 2The production of omega-3 fatty acids and the movement in the X, Y, and Z planes were measured. The results are shown in Figure 17. The data was generated automatically when the mice were placed in the system. FGF21 mice, which consumed more food but maintained lean body mass, showed a greater increase in O 2 Consumption and CO 2 The FGF21 mice had higher metabolic activity as indicated by the increase in mitochondrial activity compared to controls. However, as indicated by the movement sensor, the FGF21 mice were less mobile, another indication that periods on a high-fat diet alter mitochondrial activity and metabolic state and that the behavior of the mice does not contribute to their ability to maintain lean body mass.

[0189] The effect of FGF21 on glucose and insulin sensitivity was examined by glucose tolerance test and was found to have a significant effect as shown in Figure 18. Briefly, mice were fasted overnight for about 6-10 hours. Blood was collected for baseline blood glucose analysis. Mice were then ingested with up to 500ul of ddH 2 A dose of glucose solution was administered orally using 250 mg / ml glucose in O. Blood was then drawn and blood glucose was measured at intervals of 15, 30, 60, and 120 minutes. The data is shown in Figure 18, with the left graph showing several different doses of FGF21 and the right graph showing different combinations of a constant 1E10 dose of FGF21 with other proteins. FGF21 + sTGFbR2-FC and FGF21 + sTGFbR2-FC + Klotho were tested and the results are shown in the right graph along with glucose differences.

[0190] The present disclosure provides a gene therapy method for the delivery of a nucleic acid encoding growth differentiation factor 15 (GDF15) and a nucleic acid encoding adiponectin, as well as a nucleic acid encoding ZAG and a nucleic acid encoding Nrf2. The combined delivery of effective amounts of all four of these nucleic acids showed evidence of weight loss without toxicity (as observed by body condition scores and activity monitoring). These mice lost up to 15% of their body weight and continued to trend downward as shown in FIG. 9.

[0191] Example 5: Expression Cassettes The present disclosure provides an expression cassette contained within an AAV that contains 14 Pri-miRNA-shRNA sequences. The vector has a first cassette in an upstream direction and a second cassette in a downstream direction. The first cassette contains 7 miRNA-shRNA sequences. The second cassette contains multiple miRNA-shRNA sequences. The upstream and downstream cassettes prevent read-through between the two cassettes. The outline of the two cassettes is: ITR_3'UTR-1_7miRNAs_Promoter-1__Promoter-2_7miRNAs_3'UTR-2_ITR. As shown in the outline above as ITR___<---------------____--------------->___ITR, the first cassette is oriented in the upstream 3'←5'<------- direction and the second cassette is oriented in the downstream 5'→3' ("normal")------> direction. ITR-bGHpA-7miRNA-CMV-hEf1α-7miRNA-WPRE3-SV40pA-ITR.

[0192] Example 6: Modification of dog protein dog-stgfbr2-fc The dog protein dog-stgfbr2-fc was modified to include a mouse / human secretion signal. The nucleic acid encoding dog-stgfbr2-fc was modified to replace the native secretion signal: ATGCACAGTCAAGGGCGGGGTTGCAACAACACAAAACAAAACAAAACTTCCGGACTTCGACCTGCAGCTGAGAAGAACATCTCGCAAAGCGGCGTT with the following mouse / human secretion signal: ATGGGTCGGGGGCTGCTCCGGGGCCTGTGGCCGCTGCATATCGTCCTGTGGACGCGCATCGCCAGCACG.

[0193] The nucleic acid sequence encoding the final protein is as follows:

[0194] [ka]

[0195] Bold indicates secretion signal. Bold and italics indicates canine IGb heavy chain. Non-bold indicates canine TGFb receptor 2 extracellular domain.

[0196] FIG. 14 shows an in vitro ELISA assay demonstrating that the hybrid proteins perform better than the original canine proteins. The ELISA detects TGFb1 except when TGFb1 is bound by soluble TGF receptor 2, which prevents binding in the ELISA assay. Briefly, supernatants of 293-Hek cells transfected with each construct or with sHef1a-EGFP as a control were mixed with dog serum containing native canine TGFb1, and the cells were evaluated for their ability to secrete soluble TGF receptor 2. As shown in FIG. 15, the native canine protein was not produced or secreted as well as the hybrid canine protein containing the mouse / human secretion signal. 293-Hek cells were better able to secrete the hybrid canine protein containing the mouse / human secretion signal.

[0197] The experiment includes the following secretion factors instead of the natural TGFbR2 secretion signal. Those skilled in the art will be able to identify additional useful secretion signals in publicly available information that regulate expression to desired levels based on the present disclosure. Also, screening mutagenesis can be carried out to find the optimal secretion signal for a specific peptide sequence to be secreted. According to this embodiment, the sequence to be secreted can regulate the efficacy of the secretion signal, and the secretion signal can be optimized for a specific gene of interest.

[0198] In some embodiments, the vector may contain a synthetic intron to increase expression by enhancing the transport of RNA from the nucleus. Either synthetic or natural introns known to those skilled in the art may be used for this purpose.

[0199] [ka]

[0200] Example 7: Methods for preventing heart failure According to a particular embodiment, a gene therapy method for treating or preventing heart failure is provided. A first group of mice was treated with AAV8:sHef1a-sTGFbR2-FC-WPRE3-SV40pA at 1E11vg per mouse and AAV9:sHef1a-Nrf2-WPRE3-SV40pA at 1E11vg per mouse (dual therapy). A second group of mice was treated with AAV8:sHef1a-sTGFbR2-FC-WPRE3-SV40pA at 1E11vg per mouse (monotherapy). Control AAC mice were operated on but not treated. Mice receiving either dual therapy or monotherapy had higher left ventricular fractional shortening, higher left ventricular ejection fraction, and lower heart mass compared to controls. According to a particular embodiment, in a method of treating or preventing heart failure or renal failure, mice are treated with sTGFbR2-FC, sTGFbR2-FC+FGF21, sTGFbR2-FC+Klotho, or sTGFbR2-FC+FGF21+Klotho.

[0201] The combination of FGF21, Klotho, and sTGFbR2-FC genes was evaluated as a gene therapy, such as using one or more AAVs to treat or prevent heart failure. As shown in FIG. 19, the measurements of fractional shortening (three months after surgery, as described above for AAC) indicate that the gene combination treats or prevents heart failure. More mice in the combination group were bifurcated into a compensatory treatment regimen, thereby overcoming the surgical ligature placed three months earlier. All control mice decompensated and likely died in the coming weeks. Meanwhile, mice in the other groups that eventually compensated showed no signs of death. All echocardiograms of mice were performed conscientiously and analyzed with the echo software provided with the device.

[0202] Example 8: Methods of Promoting Weight Loss According to certain embodiments, a gene therapy method for promoting weight loss, such as promoting weight loss in obese individuals, is provided. Obese mice fed a high fat diet for 3 months were obtained from Jackson Laboratory. After arriving from Jackson Laboratory, mice were maintained on about 45% high fat diet D12451 from the research diet form for about 1 week. Then, mice were administered different doses of AAV8:sHef1a-FGF21-WPRE3-SV40pA, as well as one combination of AAV8:sHef1a-FGF21-WPRE3-SV40pA at 1E9vg per mouse, AAV8:sHef1a-Klotho-WPRE3-SV40pA at 1E11vg per mouse, and AAV8:sHef1a-sTGFbR2-Fc-WPRE3-SV40pA at 1E11vg per mouse. All doses promoted weight loss, but 1E11 and 1E10 promoted sustained weight loss.

[0203] Example 9: Methods for extending life span According to a specific embodiment, the gene therapy method described herein is provided for increasing the lifespan, health lifespan or survival rate of an individual.Experiments are carried out using mice treated with sTGFbR2-FC in the gene therapy method described herein.As shown in Figure 20, the mice administered with sTGFbR2-FC gene have an increased lifespan, with an increase of about 10% in average lifespan and maximum lifespan.

[0204] Additional experiments were performed using cameras and sensors 24 hours a day, 7 days a week to analyze images for metrics and to determine the increase in healthspan as measured by increased activity and respiration leading to old age. Mice were weighed over time. Results are shown in FIG. 21. Experiments showed numerous differences between the various treatment groups in circadian rhythm, respiration rate, lifespan, daily movement, and nighttime movement. Treatment groups and gene therapy combinations are shown in Table 5 below.

[0205] [Table 15]

[0206] [Table 16]

[0207] Example 10: Method for treating or preventing renal failure In certain embodiments, gene therapy methods are provided for treating or preventing renal failure. A combination of FGF21, Klotho, and sTGFbR2-FC genes is evaluated as a gene therapy method, such as using one or more AAVs to treat or prevent heart failure. Figure 22 shows a striking difference between the kidney of a control mouse and a mouse that received sTGFbR2-Fc gene therapy. A and C show a non-operated contralateral control kidney. B and D show a kidney with UUO, with B showing improved results compared to D.

[0208] All publications, patents, patent applications, and other documents cited in this application are incorporated by reference for all purposes to the same extent as if each individual publication, patent, patent application, or other document was individually indicated to be incorporated by reference for all purposes.

[0209] While various specific embodiments have been illustrated and described, it will be understood that various modifications can be made without departing from the spirit and scope of the invention.

[0210] [Table 17]

[0211] [Table 18]

[0212] [Table 19]

[0213] [Table 20]

[0214]

Table 21

[0215]

Table 22

[0216]

Table 23

[0217]

Table 24

[0218]

Table 25

[0219]

Table 26

[0220]

Table 27

[0221]

Table 28

[0222]

Table 29

[0223]

Table 30

[0224]

Table 31

[0225]

Table 32

[0226]

Table 33

[0227]

Table 34

[0228]

Table 35

[0229]

Table 36

[0230]

Table 37

[0231]

Table 38

[0232]

Table 39

[0233]

Table 40

[0234]

Table 41

[0235]

Table 42

[0236]

Table 43

[0237]

Table 44

[0238]

Table 45

[0239]

Table 46

[0240]

Table 47

[0241]

Table 48

[0242]

Table 49

[0243]

Table 50

[0244]

Table 51

[0245]

Table 52

[0246]

Table 53

[0247]

Table 54

[0248]

Table 55

[0249]

Table 56

[0250]

Table 57

[0251]

Table 58

[0252]

Table 59

[0253]

Table 60

Claims

1. 1. A viral vector comprising a first nucleic acid sequence comprising a gene capable of expressing a mammalian protein or inhibitor mRNA product, said gene being selected from Table 1, said first nucleic acid sequence being operably linked to a first regulatory sequence for expression of said product in a mammalian cell.

2. The viral vector of claim 1 , wherein the first regulatory sequence comprises a first promoter, and the first promoter is a constitutive promoter or an inducible promoter.

3. 3. The viral vector of claim 1 or claim 2, wherein the first regulatory sequence comprises a first promoter selected from the group consisting of heF1a promoter, CAGGS (cytomegalovirus, chicken beta actin intron, rabbit beta globin gene splice acceptor), CMV, shEf1a (truncated hEf1a), AAT promoter, thyroid hormone binding globulin promoter, albumin promoter, thyroxine binding globulin (TBG) promoter, liver control region (HCR)-ApoCII hybrid promoter, CASI, HCR-hAAT hybrid promoter, and AAT promoter in combination with mouse albumin gene enhancer (Ealb) element and apolipoprotein E promoter.

4. The viral vector according to any one of claims 1 to 4, wherein the gene is FGF21, Klotho, or sTGFbR2-FC.

5. The viral vector of any one of claims 1 to 4, wherein the first nucleic acid sequence is operably linked to a first 3' untranslated region for RNA stability and expression in mammalian cells.

6. The viral vector of claim 5 , wherein the first 3' untranslated region comprises a first tissue-specific miRNA binding sequence for regulating expression of the fusion protein in mammalian cells.

7. The viral vector of claim 6 , wherein the first tissue-specific miRNA binding sequence comprises a first mir122a tissue-specific miRNA binding sequence for inhibiting expression in hepatocytes.

8. The viral vector of any one of claims 5 to 7, wherein the first 3' untranslated region comprises a polyadenylation signal selected from the group consisting of WPRE, WPRE3, SV40 late polyadenylation signal (truncated, SEQ ID NO: 114), HBG polyadenylation signal, rabbit beta globin poly A, bovine bgpA, and ETC polyadenylation signal, or a hybrid thereof.

9. The viral vector according to any one of claims 1 to 8, wherein the viral vector is a parvovirus vector.

10. The viral vector of claim 9 , wherein the parvovirus vector is an adeno-associated virus (AAV) vector.

11. 11. The viral vector of claim 10, wherein the AAV vector is selected from an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, or AAVrhlO.XX (where xx represents different known variants) viral vector.

12. 12. The viral vector of any one of claims 10 to 11, wherein the viral vector is serotyped to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, or AAVrhlO.XX (where xx represents different known variants), or a combination thereof.

13. An AAV vector selected from the AAV vectors of Table 3.

14. A method for treating an age-related disease or condition comprising administering a therapeutically effective amount of one or more of the viral vectors described in any one of claims 1 to 12 or one or more of the AAV vectors described in claim 13.

15. 15. The method of claim 14, comprising administering multiple viral vectors selected from Table 1 or multiple AAV vectors selected from Table 3.

16. A viral vector comprising a first nucleic acid sequence encoding a fusion protein of a mammalian soluble transforming growth factor beta receptor II (sTGFβ-R2) protein or a fragment thereof having a receptor extracellular domain and an Ig Fc domain, A viral vector, wherein the fusion protein is capable of binding to TGFβ1, and wherein the first nucleic acid sequence is operably linked to a first regulatory sequence for expression of the fusion protein in a mammalian cell.

17. The viral vector of claim 16, wherein the mammalian sTGFβ-R2 protein is a human sTGFβ-R2 protein.

18. The viral vector of claim 16, wherein the mammalian sTGFβ-R2 protein is a canine sTGFβ-R2 protein.

19. 17. The viral vector of claim 16, wherein the mammalian sTGFβ-R2 protein is selected from the group consisting of human, canine, feline, bovine, ovine, caprine, equine, murine, and porcine sTGFβ-R2 proteins.

20. 17. The viral vector of claim 16, wherein the encoded mammalian sTGFβ-R2 protein has at least 90% sequence identity to the amino acid sequence of a mammalian sTGFβ-R2 protein corresponding to SEQ ID NOs: 17, 11, 10, 5 (as well as feline, bovine, ovine, caprine, equine, murine, and porcine).

21. The viral vector of any one of claims 16 to 20, wherein the Ig Fc is selected from the group consisting of human, canine, feline, bovine, ovine, caprine, equine, murine, and porcine Ig Fc.

22. The viral vector of claim 21 , wherein the Ig Fc is an IgG Fc selected from the group consisting of IgG1, IgG2a, IgG2b, IgG3, and IgG4.

23. The viral vector of claim 21 , wherein the Ig Fc has at least 90% sequence identity to the amino acid sequence of the Ig Fc represented by SEQ ID NO: 20, 27.

24. The viral vector of any one of claims 16 to 23, wherein the first regulatory sequence comprises a first liver tissue-specific promoter for expression of the fusion protein in liver cells.

25. The viral vector of any one of claims 16 to 24, wherein the first regulatory sequence comprises a first promoter, and the first promoter is a constitutive promoter or an inducible promoter.

26. 25. The viral vector of claims 16 to 24, wherein the first regulatory sequence comprises a first promoter selected from the group consisting of heF1a promoter, AAT promoter, thyroid hormone binding globulin promoter, albumin promoter, thyroxine binding globulin (TBG) promoter, liver control region (HCR)-ApoCII hybrid promoter, HCR-hAAT hybrid promoter, and AAT promoter in combination with mouse albumin gene enhancer (Ealb) element and apolipoprotein E promoter.

27. The viral vector of claims 16 to 26, wherein the first regulatory sequence comprises a constitutive promoter.

28. The viral vector of any one of claims 16 to 27, wherein the first nucleic acid sequence is operably linked to a first 3' untranslated region for RNA stability and expression in mammalian cells.

29. 29. The viral vector of claim 28, wherein the first 3' untranslated region comprises a first tissue-specific miRNA binding sequence for regulating expression of the fusion protein in mammalian cells.

30. 30. The viral vector of claim 29, wherein the first tissue-specific miRNA binding sequence comprises a first mir122a tissue-specific miRNA binding sequence for inhibiting expression in hepatocytes.

31. The viral vector of any one of claims 28 to 30, wherein the first 3' untranslated region comprises a polyadenylation signal selected from the group consisting of WPRE3, SV40 late polyadenylation signal (truncated, SEQ ID NOs: 113 and 114), HBG polyadenylation signal, and ETC polyadenylation signal, or a hybrid thereof.

32. The viral vector of any one of claims 16 to 31, further comprising a second nucleic acid encoding a mammalian nuclear factor (erythroid-derived 2)-like 2 (Nrf2) protein, the second nucleic acid sequence being operably linked to a second regulatory sequence for expression of the Nrf2 protein in the mammalian cell.

33. The viral vector of claim 32, wherein the mammalian sTGFβ-R2 protein and the mammalian Nrf2 protein are of the same mammalian species.

34. 34. The viral vector of claim 33, wherein the mammalian species is selected from the group consisting of human, canine, feline, bovine, ovine, caprine, equine, murine, and porcine.

35. The viral vector of any one of claims 32 to 34, wherein the second regulatory sequence comprises a second liver tissue-specific promoter for expression of the Nrf2 protein in liver cells.

36. The viral vector of any one of claims 32 to 35, wherein the second regulatory sequence comprises a second promoter, the second promoter being a constitutive promoter or an inducible promoter.

37. 37. The viral vector of any one of claims 32 to 36, wherein the second regulatory sequence comprises a second promoter selected from the group consisting of a heF1a promoter, an AAT promoter, a thyroid hormone binding globulin promoter, an albumin promoter, a thyroxine binding globulin (TBG) promoter, a liver control region (HCR)-ApoCII hybrid promoter, an HCR-hAAT hybrid promoter, and an AAT promoter in combination with a mouse albumin gene enhancer (Ealb) element and an apolipoprotein E promoter.

38. The viral vector of any one of claims 32 to 37, wherein the second regulatory sequence comprises a constitutive promoter.

39. The viral vector of any one of claims 32 to 38, wherein the second nucleic acid sequence is operably linked to a second 3' untranslated region that regulates RNA stability and expression in mammalian cells.

40. The viral vector of any one of claims 32 to 39, wherein the second 3' untranslated region comprises a second tissue-specific miRNA binding sequence for regulating expression of the Nrf2 protein in mammalian cells.

41. The viral vector of claim 40 , wherein the second tissue-specific miRNA binding sequence comprises a second mir122a tissue-specific miRNA binding sequence for inhibiting expression in hepatocytes.

42. The viral vector of any one of claims 32 to 39, wherein the second 3' untranslated region comprises a second polyadenylation signal selected from the group consisting of WPRE3, SV40 late polyadenylation signal (truncated, SEQ ID NO: 114), HBG polyadenylation signal, and ETC polyadenylation signal, or a hybrid thereof.

43. The viral vector of claim 32, wherein the second nucleic acid encoding the Nrf2 protein is operably linked to the first regulatory sequence for expressing the fusion protein and a polycistronic mRNA transcript encoding the Nrf2 protein, and the second regulatory sequence comprises an operably linked IRES or 2A sequence for expressing the Nrf2 protein from the polycistronic transcript.

44. The viral vector according to any one of claims 16 to 44, wherein the viral vector is a parvovirus vector.

45. The viral vector of claim 44, wherein the viral vector is an adeno-associated viral (AAV) vector.

46. 46. ​​The viral vector of claim 45, wherein the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, and AAVrhlO.XX (where xx represents different known variants) viral vectors.

47. 48. The viral vector of any one of claims 45 to 47, wherein the viral vector is serotyped for AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, and AAVrhlO.XX (where xx represents different known variants), or combinations thereof.

48. A composition comprising a first viral vector and a second viral vector, the first viral vector comprises a first nucleic acid sequence encoding a fusion protein of a mammalian soluble transforming growth factor beta receptor II (sTGFβ-R2) protein or a fragment thereof having a receptor extracellular domain and an Ig Fc domain, the fusion protein being capable of binding to TGFβ1, the first nucleic acid sequence being operably linked to appropriate regulatory sequences for expression in a mammalian cell, and the first viral vector optionally comprises a first inhibitory sequence for inhibiting expression of the first nucleic acid sequence in a non-target tissue; The composition, wherein the second viral vector comprises a second nucleic acid sequence encoding a mammalian (erythroid-derived 2)-like 2 (Nrf2) protein, the second nucleic acid sequence being operably linked to a second regulatory sequence for expression in a mammalian cell, and the second viral vector optionally comprising a second inhibitory sequence for inhibiting expression of the second nucleic acid sequence in a non-target tissue.

49. A method for reducing the formation of fibrous tissue in a mammal, comprising administering to the mammal a therapeutically effective amount of the viral vector of any one of claims 16 to 47 or the composition of claim 48.

50. A method for treating cardiac, hepatic, pulmonary or renal fibrosis in a mammal, comprising administering to the mammal a therapeutically effective amount of a viral vector described in any one of claims 1 to 47 or a composition described in claim 48.

51. A viral vector comprising a first nucleic acid sequence encoding a mammalian adiponectin protein, said first nucleic acid sequence being operably linked to a regulatory sequence for expression of said adiponectin protein in a mammalian cell, said viral vector optionally comprising an inhibitory sequence for inhibiting expression of said first nucleic acid sequence in non-target tissues.

52. The viral vector of claim 51 , wherein the encoded mammalian adiponectin protein has at least 90% sequence identity to the amino acid sequence corresponding to human adiponectin represented by SEQ ID NO:

34.

53. A viral vector described in any one of claims 51 to 52, further comprising a second nucleic acid sequence encoding a mammalian glutathione S-transferase K1 (DsbA-L; GSTK1) protein, said second nucleic acid being operably linked to a second regulatory sequence for expression of said GSTK1 protein in a mammalian cell.

54. The viral vector of claim 53, wherein the encoded mammalian GSTK1 protein has at least 90% sequence identity to an amino acid sequence corresponding to a human GSTK1 protein.

55. The viral vector according to any one of claims 51 to 54, wherein the viral vector is an AAV vector.

56. The viral vector of claim 55, wherein the AAV vector is a self-complementary AAV vector.

57. 57. The viral vector of any one of claims 51 to 56, wherein the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, and AAVrhlO.XX (where xx represent different known variants) viral vectors.

58. A composition comprising a first viral vector and a second viral vector, a first viral vector comprising a first nucleic acid sequence encoding a mammalian adiponectin protein, said first nucleic acid sequence being operably linked to a regulatory sequence for expression of said adiponectin protein in a mammalian cell, said first viral vector optionally comprising an inhibitory sequence for inhibiting expression of said first nucleic acid sequence in a non-target tissue; The composition, wherein the second viral vector comprises a second nucleic acid sequence encoding a mammalian glutathione S-transferase K1 (DsbA-L; GSTK1) protein, the second nucleic acid being operably linked to a second regulatory sequence for expression of the GSTK1 protein in a mammalian cell, and the second viral vector optionally comprises a second inhibitory sequence for inhibiting expression of the second nucleic acid sequence in a non-target tissue.

59. 59. The composition of claim 58, wherein the first viral vector is a first self-complementary AAV vector and the second viral vector is a second self-complementary AAV vector.

60. 60. The composition of any one of claims 58 to 59, wherein the first viral vector comprises an AAV vector selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, and AAVrhlO.XX (where xx represent different known variants) viral vectors.

61. 61. The composition of any one of claims 58 to 60, wherein the second viral vector comprises an AAV vector selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, and AAVrhlO.XX (where xx represents different known variants) viral vectors.

62. A method for treating an age-related disease or condition comprising administering a therapeutically effective amount of a viral vector according to any one of claims 51 to 57 or a composition according to any one of claims 58 to 61.

63. 1. A method of treating an age-related disease or condition comprising administering to a subject a therapeutically effective amount of one or more suitable viral expression vectors, wherein the one or more viral vectors express in the subject a therapeutically effective amount of one or more heterologous functional proteins selected from the group consisting of adiponectin, Adra1a (mut), AMPK, Atg5, BubR1, mCat, Cebpbeta, Cisd2d, FGF21, GDF15 (hNAG), HAS2 (nmr), humanized FoxP2, Klotho, Mt1, NEU1, NGF, Nrf2, NUDT1, Par4 SAC domain, Pck1, sIGF1r-Fc, Sirt1, Sirt6, TERT, TFAM, TFEB, sTGFbR2-Fc, BMP2, BMP4, Sema3a, and Txn1.

64. 1. A method of treating an age-related disease or condition comprising administering an effective amount of one or more suitable viral expression vectors to express in a subject an effective amount of one or more heterologous inhibitory RNA sequences that inhibit expression of one or more endogenous proteins selected from the group consisting of ADcy5, Agtr1a, Akt1, Cebpalpha, Coq7, Ctf1, Dgat1, Ikbkb, Insr, mTOR, nf-kb, Pappa, PACKS, PDE4b, Prkar2b, Rps6kb1 (S6K1), Slc13a1, Slc13a5 (INDY), and Ubd.

65. administering an effective amount of one or more suitable viral expression vectors; expressing in a subject an effective amount of one or more heterologous functional proteins selected from the group consisting of adiponectin, Adra1a (mut), AMPK, Atg5, BubR1, mCat, Cebpbeta, Cisd2d, FGF21, GDF15 (hNAG), HAS2 (nmr), humanized FoxP2, Klotho, Mt1, NEU1, NGF, Nrf2, NUDT1, Par4 SAC domain, Pck1, sIGF1r-Fc, Sirt1, Sirt6, TERT, TFAM, TFEB, sTGFbR2-Fc, BMP2, BMP4, Sema3a, and Txn1; 1. A method of treating an age-related disease or condition comprising expressing in a subject an effective amount of one or more heterologous inhibitory RNA sequences that inhibit expression of one or more endogenous proteins selected from the group consisting of ADcy5, Agtr1a, Akt1, Cebalpha, Coq7, Ctf1, Dgat1, Ikbkb, Insr, mTOR, nf-kb, Pappa, PACKS, PDE4b, Prkar2b, Rps6kb1 (S6K1), Slc13a1, Slc13a5 (INDY), and Ubd.

66. administering an effective amount of one or more suitable viral expression vectors; Expressing one or more heterologous functional proteins selected from the group consisting of adiponectin, AMPK, Cebpbeta, FGF21, GDF15 (hNAG), Pck1, Sirt1, PCSK9, BMP2, BMP4, Sema3a, and UCP1 in a mammal; or A method of treating a mammal for an age-related disease or condition comprising expressing in the mammal one or more heterologous inhibitory RNA sequences that inhibit expression of one or more endogenous proteins selected from the group consisting of Cebalpha, Dgat1, Insr, mTOR, Prkar2b, Slc13a1, Slc13a5 (INDY), and Ubd.

67. administering an effective amount of one or more suitable viral expression vectors; Expressing one or more heterologous functional proteins selected from the group consisting of FGF21, GDF15 (hNAG), Klotho, sIGF1r-Fc, BMP2, BMP4, Sema3a, and Sirt6 in a mammal; and A method of treating a mammal for an age-related disease or condition comprising expressing in said mammal one or more heterologous inhibitory RNA sequences that inhibit expression of one or more endogenous proteins selected from the group consisting of Akt1, mTOR, Pappa, Rps6kb1, and (S6K1).

68. administering an effective amount of one or more suitable viral expression vectors; Expressing one or more heterologous functional proteins selected from the group consisting of Atg5, Cisd2d, and TFEB in a mammal; and A method of treating a mammal for an age-related disease or condition comprising expressing in said mammal one or more heterologous inhibitor RNA sequences that inhibit the expression of one or more endogenous proteins selected from the group consisting of Akt1 and mTOR.

69. administering an effective amount of one or more suitable viral expression vectors; Expressing one or more heterologous functional proteins selected from the group consisting of Klotho, Nrf2, Sirt1, sTGFbR2-Fc, and Txn1 in a mammal; and 20. A method of treating a mammal for an age-related disease or condition comprising expressing in said mammal one or more heterologous inhibitory RNA sequences which inhibit the expression of endogenous Ctf1 protein.

70. administering an effective amount of one or more suitable viral expression vectors; Expressing one or more heterologous functional proteins selected from the group consisting of BubR1, HAS2 (nmr), NUDT1, Par4 SAC domain, and TERT in a mammal; and 1. A method of treating a mammal for an age-related disease or condition comprising expressing in said mammal one or more inhibitory RNA sequences that inhibit expression of one or more endogenous proteins selected from the group consisting of Coq7 and Ctf1.

71. administering an effective amount of one or more suitable viral expression vectors; Expressing one or more heterologous functional proteins selected from the group consisting of mCat, Cisd2d, Mt1, Nrf2, Pck1, Sirt6, and TFAM in a mammal; and A method of treating a mammal for an age-related disease or condition comprising expressing one or more inhibitory RNA sequences that inhibit the expression of one or more endogenous proteins selected from the group consisting of ADcy5, Agtr1a, Coq7, and Slc13a1.

72. Administering one or more appropriate viral expression vectors; Expressing one or more heterologous functional proteins selected from the group consisting of Adra1a(mut), humanized FoxP2, NEU1, NGF, and NUDT1 in a mammal; and A method of treating a mammal for an age-related disease or condition comprising expressing one or more inhibitory RNA sequences that inhibit the expression of one or more endogenous proteins selected from the group consisting of Ikbkb and PDE4b.

73. 1. A method of treating a mammal for an age-related disease or condition, comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of FGF21, BMP2, BMP4, and SEM3A.

74. 1. A method of treating a mammal for an age-related disease or condition, comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of GDF15, TERT, BubR1, Agtra1a, Adcy5, Coq7, Slc13a1, and Ikbkb.

75. 1. A method of treating a mammal for an age-related disease or condition comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of BubR1, Cis2d, Txn1, FGF21, BubR1, Agtr1a, ikbkb, mTOR, Nudt1, Slc13a5, pappa, Coq7, Sdcy5, Agtr1a, and Ctf1 / akt1.

76. 1. A method of treating a mammal for an age-related disease or condition comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of BubR1, Cis2d, Txn1, FGF21, BubR1, Agtr1a, ikbkb, mTOR, Nudt1, Slc13a5, pappa, Coq7, Sdcy5, Agtr1a, and Ctf1 / akt1.

77. 1. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of FGF21, Nrf2, sTGFbR2-Fc, HAS2, Nudt1, TERT, BubR1, Par4, Ubd, Dgat1, Ctf1, Coq7 Adcy5, Agtr1a, and mTOR.

78. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of Atg5, Nudt1, Adra1a (mut), NGF, NEU1, humanized FoxP2, TFEB, PDE4b, mTOR, Slc13a5, Slc13a5, Coq7, Akt1, ikbkb, and Slc13a1.

79. 1. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of Klotho, GDF15 (hNAG), sIGF1r-Fc, Mt1, Adra1a (mut), Nrf2, Rps6kb1, PCsk9, Prkar2b, Dgat, Ctf1, Coq7, papa, and ikbkb.

80. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of Atg5, Cebpa, pb, Ctf1, akt1, Pck1, adiponectin, PcsK9, Nrf2, Cisd2, papa, Dgat, Ctf1, Coq7, and mTOR.

81. 1. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of FGF21, GDF15, Klotho, Adra1a (mut), Sirt6, Bubr1, Par4, Coq7, Adcy5, Agtr1a, Agtr1a, ikbkb, mTOR, Slc13a1, papa, Ctf1, Ctf1, and Slc13a5.

82. 1. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of FGF21, GDF15, Klotho, TERT, sIGF1r-Fc, Bubr1, Par4, Rps6kb1, PCSk9, Adcy5, Coq7, Agtr1a, ikbkb, mTOR, and Slc13a1.

83. 1. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of Klotho, Txn1, Nrf2, TFEB, sTGFbr2-Fc, Nudt1, mt1, Atg5, Bubr1, Par4, Ctf1, Coq7, and ikbkb.

84. 23. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of FGF21, sIGF1r-Fc, Klotho, sTGFbr2-Fc, GDF15, HAS2, Mt1, Txn1, Nrf2, mCAT, Adra1a (mut), TFEB, Bubr1, Par4, Atg5, Cisd2, Nudt1, Sirt1, Sirt6, mTOR, slc13a5, pappa, ikbkb, adcy5, agtr1a, and akt1.

85. 2. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of TFEB, Atg5, Klotho, UCP1, Cebpbeta, miCebpa, adiponectin, Mt1, Txn1, Nrf2, mCAT, TERT, Bubr1, Par4, TFAM, Cisd2, Nudt1, Neu1, NGF, Sirt6, Dgat, prkar2b, insr, ubd, Coq7, Ctf1, mTOR, and Slc13a5.

86. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of sTGFbR2-FC and Nrf2.

87. 1. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of FGF21, TERT, BubR1, Agtra1a, Adcy5, Coq7, Slc13a1, Ikbkb, Klotho, GDF15, CTF1, mTOR, Slc13a5, Pappa, Pcsk9, and Rps6kb1.

88. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of FGF21, GDF15, Klotho, Adra1a (mut), Sirt6, BubR1, Agtra1a, Adcy5, Akt1, MCAT, Slc13a1, Ikbkb, Ctf1, mTOR, Coq7, and Slc13a5.

89. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of Txn1, Sirt6, Mt1, TFEB, Pck1, adiponectin, Cisd2, Nudt1, Atg5, Ctf1, Ikbkb, and Coq7.

90. 1. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of Fgf21, Nrf2, sTGFbR2-FC, Has2, NudT1, TERT, BubR1, Dgat1, Pappa, Ctf1, mTOR, Coq7, Slc13a5, Agtra1a, Adcy5, and Akt1.

91. 1. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of Ctf1, Coq7, Agtra1a, Adcy5, mTOR, Cisd2, MCAT, FGF21, GDF15, Klotho, Slc13a1, Ikbkb, Txn1, and Sirt6.

92. 1. A method of treating a mammal for obesity and type 2 diabetes comprising expressing in the mammal one or more heterologous functional proteins selected from the group consisting of Klotho, GDF15, Neu1, Mt1, Adra1a, hFoxP2, PCSK9, Rps6kb1, Ctf1, Ikbkb, Coq7, Slc13a1, mTOR, and NudT1 by administering one or more appropriate viral expression vectors.

93. 1. A method of treating a mammal for obesity and type 2 diabetes comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of Atg5, Ctf1, Akt1, BubR1, Pck1, adiponectin, TERT, Nrf2, Cisd2, Dgat1, Pappa, Ctf1, mTOR, Coq7, and Slc13a5.

94. A method for treating a mammal to control adiposity and blood sugar, comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of FGF21, BMP2, BMP4, and SEM3A.

95. A method for treating a mammal for an age-related disease or condition, comprising administering one or more suitable viral expression vectors to express in the mammal one or more heterologous functional proteins selected from the group consisting of GDF15, adiponectin, ZAG, and NRF2.

96. A viral vector comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleic acid sequences, each encoding a corresponding functional protein and operably linked to a regulatory sequence for expression in a mammal.

97. A viral vector comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleic acid sequences, each encoding an inhibitory RNA sequence and operably linked to a regulatory sequence for expression in a mammal.

98. 1. A viral vector comprising a cassette having a first nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding a mammalian soluble transforming growth factor beta receptor II protein comprising an extracellular portion of the receptor, and a second nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding a fragment crystallizable (Fc) domain, expression of the first nucleic acid sequence and the second nucleic acid sequence produces a fusion of a mammalian soluble transforming growth factor beta receptor II protein and the Fc; the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a suitable promoter for expression in a mammalian cell; the viral vector comprises one or more ITR sequences flanking the cassette; The viral vector optionally comprises an inhibitor for inhibiting expression of the first nucleic acid sequence and the second nucleic acid sequence in a non-target tissue.

99. The viral vector of claim 1, wherein the cassette comprises a third nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding a mammalian Nrf2 protein, the third nucleic acid sequence being operably linked to a suitable promoter for expression in a mammalian cell.

100. The viral vector of claim 1 , wherein the viral vector is a parvovirus virion.

101. The viral vector of claim 1 , wherein the viral vector is an adeno-associated virus.

102. 2. The viral vector of claim 1, wherein the viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12.

103. 2. The viral vector of claim 1, wherein the viral vector comprises one or more sites of an adeno-associated virus selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12.

104. The viral vector of claim 1 , wherein the promoter is a liver tissue-specific promoter.

105. 2. The viral vector of claim 1, wherein the mammalian soluble transforming growth factor beta receptor II protein is a human soluble transforming growth factor beta receptor II protein.

106. 2. The viral vector of claim 1, wherein the mammalian soluble transforming growth factor beta receptor II protein is a canine soluble transforming growth factor beta receptor II protein.

107. 2. The viral vector of claim 1, wherein the mammalian soluble transforming growth factor beta receptor II protein is selected from the group consisting of human, canine, feline, bovine, ovine, caprine, equine, murine, and porcine soluble transforming growth factor beta receptor II proteins.

108. 2. The viral vector of claim 1, wherein the Fc is selected from the group consisting of human, canine, feline, bovine, ovine, caprine, equine, murine, and porcine Fc, or subtypes thereof, including Igg2a, Igg2b, Igg3, or Igg4.

109. 2. The viral vector of claim 1, wherein the suitable promoter is a constitutive or inducible promoter or is selected from the group consisting of heF1a promoter, AAT promoter, thyroid hormone binding globulin promoter, albumin promoter, thyroxine binding globulin (TBG) promoter, liver control region (HCR)-ApoCII hybrid promoter, HCR-hAAT hybrid promoter, and AAT promoter in combination with mouse albumin gene enhancer (Ealb) element and apolipoprotein E promoter.

110. 2. The viral vector of claim 1, wherein the ITR is selected from the group consisting of an AAV2 ITR, an AAV1 ITR, an AAV5 ITR, an AAV6 ITR, an AAV7 ITR, an AAV8 ITR, an AAV9 ITR, an AAV10 ITR, an AAV11 ITR, and an AAV12 ITR.

111. 2. The viral vector of claim 1, wherein the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a 3' untranslated region for RNA stability and expression in mammalian cells.

112. The viral vector of claim 1, wherein the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a 3' untranslated region comprising a tissue-specific miRNA binding sequence to regulate expression in mammalian cells.

113. The viral vector of claim 1, wherein the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a 3' untranslated region containing a mir122a tissue-specific miRNA binding sequence to inhibit expression in hepatocytes.

114. The viral vector of claim 1 , wherein the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a 3' untranslated region having a polyadenylation signal.

115. The viral vector of claim 1, wherein the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a 3' untranslated region having a polyadenylation signal selected from the group consisting of WPRE, WPRE3, SV40 polyadenylation signal, HBG polyadenylation signal, and ETC polyadenylation signal, or hybrids thereof.

116. The viral vector of claim 1, wherein the gene is Klotho or sTGFRbR2-FC.

117. A combination of a first viral vector and a second viral vector, the first viral vector comprises a cassette having a first nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding a mammalian soluble transforming growth factor beta receptor II protein and a second nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding an Fc (fragment crystallizable) domain, and expression of the first nucleic acid sequence and the second nucleic acid sequence produces a fusion of the mammalian soluble transforming growth factor beta receptor II protein and the Fc; the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a suitable promoter for expression in a mammalian cell; the viral vector comprises one or more ITR sequences flanking the cassette; the viral vector optionally comprises an inhibitor for inhibiting expression of the first nucleic acid sequence and the second nucleic acid sequence in a non-target tissue; the second viral vector comprises a third nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding a mammalian Nrf2 protein, the third nucleic acid sequence being operably linked to a suitable promoter for expression in a mammalian cell; the second viral vector comprises one or more ITR sequences flanking the cassette; A combination of said viral vectors, wherein said second viral vector optionally comprises an inhibitor for inhibiting expression of said third nucleic acid sequence in non-target tissues.

118. administering to a mammal a viral vector comprising a cassette having a first nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding a mammalian soluble transforming growth factor beta receptor II protein and a second nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding an Fc (fragment crystallizable) domain, wherein expression of the first nucleic acid sequence and the second nucleic acid sequence produces a fusion of the mammalian soluble transforming growth factor beta receptor II protein and the Fc, the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a suitable promoter for expression in a mammalian cell; the viral vector comprises one or more ITR sequences flanking the cassette; the viral vector optionally comprises an inhibitor for inhibiting expression of the first nucleic acid sequence and the second nucleic acid sequence in a non-target tissue; A method for reducing the formation of fibrous tissue in a mammal, wherein the viral vector is introduced into a cell, and the fusion of the mammalian soluble transforming growth factor beta receptor II protein and the Fc is produced by the cell and binds to transforming growth factor beta 1, thereby inhibiting the activity of transforming growth factor beta 1.

119. administering to a mammal a viral vector comprising a cassette having a first nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding a mammalian soluble transforming growth factor beta receptor II protein and a second nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding an Fc (fragment crystallizable) domain, wherein expression of the first nucleic acid sequence and the second nucleic acid sequence produces a fusion of the mammalian soluble transforming growth factor beta receptor II protein and the Fc, and administering to the mammal a viral vector; the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a suitable promoter for expression in a mammalian cell; the viral vector comprises one or more ITR sequences flanking the cassette; the viral vector optionally comprises an inhibitor for inhibiting expression of the first nucleic acid sequence and the second nucleic acid sequence in a non-target tissue; A method for treating fibrosis in a mammalian heart, liver, lung or kidney, wherein the viral vector is introduced into the heart, liver, lung or kidney, and the fusion of the mammalian soluble transforming growth factor beta receptor II protein and the Fc is produced by the cell and binds to transforming growth factor beta 1, thereby inhibiting the activity of transforming growth factor beta 1.

120. A viral vector comprising a cassette having a first nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding a mammalian adiponectin, wherein expression of the first nucleic acid sequence results in the production of adiponectin; the first nucleic acid sequence is operably linked to a suitable promoter for expression in a mammalian cell; the viral vector comprises one or more ITR sequences flanking the cassette; The viral vector optionally comprises an inhibitor for inhibiting expression of the first nucleic acid sequence in a non-target tissue.

121. The viral vector of claim 1 , wherein the viral vector is a self-complementary AAV.

122. The method of claim 1, wherein the viral cassette comprises a second nucleic acid sequence encoding DsbA-L (GSTC1).

123. A combination of a first viral vector and a second viral vector, wherein the first viral vector comprises a cassette comprising a first nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding a mammalian adiponectin, and expression of the first nucleic acid sequence results in the production of adiponectin; the first nucleic acid sequence is operably linked to a suitable promoter for expression in a mammalian cell; the first viral vector comprises one or more ITR sequences flanking the cassette; the first viral vector optionally comprises an inhibitor for inhibiting expression of the first nucleic acid sequence in a non-target tissue; the second viral vector comprises a cassette having a second nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding DsbA-L (GSTC1); the second nucleic acid sequence is operably linked to a suitable promoter for expression in a mammalian cell; the second viral vector comprises one or more ITR sequences flanking the cassette; A combination of said viral vectors, wherein said second viral vector optionally comprises an inhibitor to prevent expression of said second nucleic acid sequence in non-target tissues.

124. 2. The method of claim 1, wherein the first viral vector is a first self-complementary AAV vector and the second viral vector is a second self-complementary AAV vector.

125. The method includes administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein the one or more viral vectors, when expressed by a cell into which the one or more viral vectors have been introduced, are capable of detecting adiponectin, Adra1a (mut), AMPK, Atg5, BubR1, mCat, Cebpbeta, Cisd2d, FGF21, GDF15 (hNAG), HAS2 (nmr), humanized FoxP2, Klotho, Mt1, NEU1, NGF, Nrf2, NUDT1, Par4, or other inflammatory cytokines.

1. A method of treating an age-related disease or condition, wherein one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of SAC domain, Pck1, sIGF1r-Fc, Sirt1, Sirt6, TERT, TFAM, TFEB, sTGFbR2-Fc, BMP2, BMP4, Sema3a, and Txn1 are expressed.

126. 1. A method for treating an age-related disease or condition, comprising administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been introduced, one or more inhibitor RNA sequences are expressed that inhibit expression of a functional protein associated with the one or more nucleic acid sequences selected from the group consisting of ADcy5, Agtr1a, Akt1, Cebpalpha, Coq7, Ctf1, Dgat1, Ikbkb, Insr, mTOR, nf-kb, Pappa, PACKS, PDE4b, Prkar2b, Rps6kb1 (S6K1), Slc13a1, Slc13a5 (INDY), and Ubd.

127. administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been transduced, one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of adiponectin, Adra1a (mut), AMPK, Atg5, BubR1, mCat, Cebpbeta, Cisd2d, FGF21, GDF15 (hNAG), HAS2 (nmr), humanized FoxP2, Klotho, Mt1, NEU1, NGF, Nrf2, NUDT1, Par4 SAC domain, Pck1, sIGF1r-Fc, Sirt1, Sirt6, TERT, TFAM, TFEB, sTGFbR2-Fc, BMP2, BMP4, Sema3a, and Txn1 are expressed; or 1. A method of treating an age-related disease or condition, comprising expressing one or more inhibitor RNA sequences that inhibit expression of a functional protein associated with said one or more nucleic acid sequences selected from the group consisting of ADcy5, Agtr1a, Akt1, Cebalpha, Coq7, Ctf1, Dgat1, Ikbkb, Insr, mTOR, nf-kb, Pappa, PACKS, PDE4b, Prkar2b, Rps6kb1 (S6K1), Slc13a1, Slc13a5 (INDY), and Ubd.

128. administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been transduced, one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of adiponectin, AMPK, Cebpbeta, FGF21, GDF15 (hNAG), Pck1, Sirt1, PCSK9, BMP2, BMP4, Sema3a, and UCP1 are expressed; or A method of treating an animal in which one or more inhibitor RNA sequences are expressed that inhibit expression of a functional protein associated with said one or more nucleic acid sequences selected from the group consisting of Cebpalpha, Dgat1, Insr, mTOR, Prkar2b, Slc13a1, Slc13a5 (INDY), and Ubd.

129. administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been transduced, one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of FGF21, GDF15 (hNAG), Klotho, sIGF1r-Fc, BMP2, BMP4, Sema3a, and Sirt6 are expressed; or A method of treating an animal in which one or more inhibitor RNA sequences are expressed that inhibit the expression of functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of Akt1, mTOR, Pappa, Rps6kb1, and (S6K1).

130. administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been transduced, one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of Atg5, Cisd2d, and TFEB are expressed; or A method of treating an animal in which one or more inhibitor RNA sequences are expressed that inhibit the expression of a functional protein associated with said one or more nucleic acid sequences selected from the group consisting of Akt1 and mTOR.

131. administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been transduced, one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of Klotho, Nrf2, Sirt1, sTGFbR2-Fc, and Txn1 are expressed; or A method of treating an animal in which one or more inhibitor RNA sequences are expressed that inhibit the expression of a functional protein associated with said one or more nucleic acid sequences selected from the group consisting of: Ctf1.

132. administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been transduced, one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of BubR1, HAS2 (nmr), NUDT1, Par4 SAC domain, and TERT are expressed; or A method of treating an animal in which one or more inhibitor RNA sequences are expressed that inhibit the expression of a functional protein associated with said one or more nucleic acid sequences selected from the group consisting of Coq7 and Ctf1.

133. administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been transduced, one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of mCat, Cisd2d, Mt1, Nrf2, Pck1, Sirt6, and TFAM are expressed; or A method of treating an animal in which one or more inhibitor RNA sequences are expressed that inhibit the expression of a functional protein associated with said one or more nucleic acid sequences selected from the group consisting of ADcy5, Agtr1a, Coq7, and Slc13a1.

134. administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been transduced, one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of Adra1a(mut), humanized FoxP2, NEU1, NGF, and NUDT1 are expressed; or A method of treating an animal in which one or more inhibitor RNA sequences are expressed which inhibit the expression of a functional protein associated with said one or more nucleic acid sequences selected from the group consisting of Ikbkb and PDE4b.

135. A viral vector comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleic acid sequences, each encoding a corresponding functional protein and operably linked to a promoter sequence.

136. A viral vector comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleic acid sequences, each encoding an inhibitory RNA sequence and operably linked to a promoter sequence.

137. administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been transduced, A method of treating an animal, wherein one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of FGF21, BMP2, BMP4, and SEM3A are expressed.

138. administering one or more viral vectors comprising one or more cassettes having one or more nucleic acid sequences, wherein, when expressed by a cell into which the one or more viral vectors have been transduced, A method of treating an animal, wherein one or more functional proteins associated with said one or more nucleic acid sequences selected from the group consisting of GDF15, adiponectin, ZAG, and NRF2 are expressed.

139. providing to a eukaryotic cell one or more guide RNA sequences complementary to one or more corresponding target nucleic acid sequences; providing said eukaryotic cell with one or more donor nucleic acid sequences capable of expressing a mammalian protein or inhibitor mRNA product, wherein said one or more donor nucleic acid sequences are selected from the group consisting of adiponectin, Adra1a (mut), AMPK, Atg5, BubR1, mCat, Cebpbeta, Cisd2d, FGF21, GDF15 (hNAG), HAS2 (nmr), humanized FoxP2, Klotho, Mt1, NEU1, NGF, Nrf2, NUDT1, Par4 SAC domain, Pck1, sIGF1r-Fc, Sirt1, Sirt6, TERT, TFAM, TFEB, sTGFbR2-Fc, BMP2, BMP4, Sema3a, Txn1, ADcy5, Agtr1a, Akt1, Cebpalpha, Coq7, Ctf1, Dgat1, Ikbkb, Insr, mTOR, nf-kb, Pappa, PACKS, PDE4b, Prkar2b, Rps6kb1 (S6K1), Slc13a1, Slc13a5 (INDY), and Ubd, or any combination, subcombination, or population thereof; providing said eukaryotic cell with a Cas9 enzyme that interacts with said one or more guide RNA sequences and site-specifically cleaves said one or more corresponding target nucleic acid sequences; the one or more guide RNA sequences bind to the complementary one or more corresponding target nucleic acid sequences, and the Cas9 enzyme cleaves the one or more target nucleic acid sequences in a site-specific manner; A method of integrating foreign DNA into a genomic nucleic acid sequence of a eukaryotic cell, wherein said one or more donor sequences are integrated into said genomic nucleic acid sequence and expressed.

140. 140. The method of claim 139, wherein the one or more donor nucleic acid sequences are integrated into the genomic nucleic acid sequence by homologous recombination.

141. providing said one or more guide RNA sequences to said eukaryotic cell by introducing into said cell one or more nucleic acids encoding said one or more guide RNA sequences; The Cas9 enzyme is provided to the cell by introducing a nucleic acid encoding the Cas9 enzyme into the cell; 140. The method of Claim 139, wherein the cell expresses the one or more guide RNA sequences and the Cas9 protein.

142. 140. The method of claim 139, wherein the eukaryotic cell is a mammalian cell.

143. 140. The method of claim 139, wherein the eukaryotic cell is a human cell.

144. 17. The viral vector of claim 16, wherein the secretion signal is selected from known mammalian secretion signals to regulate expression to obtain the desired expression.

145. The viral vector of claim 16, further comprising a second nucleic acid encoding Klotho and / or a third nucleic acid encoding FGF21, wherein the second nucleic acid sequence or the third nucleic acid sequence is operably linked to a second regulatory sequence or a third regulatory sequence for expression of the Klotho or FGF21 protein in the mammalian cell.

146. The viral vector of claim 145, wherein the mammalian sTGFβ-R2 protein and the mammalian Klotho protein or FGF21 protein are of the same mammalian species.

147. 147. The viral vector of claim 146, wherein the mammalian species is selected from the group consisting of human, canine, feline, bovine, ovine, caprine, equine, murine, and porcine.

148. The viral vector of claim 145, wherein the second regulatory sequence or the third regulatory sequence comprises a second liver tissue-specific promoter for expression of the Klotho or FGF21 protein in liver cells.

149. The viral vector of claim 145, wherein the second regulatory sequence or the third regulatory sequence comprises a second promoter or a third promoter, and the second promoter or the third promoter is a constitutive promoter or an inducible promoter.

150. The viral vector of claim 145, wherein the second regulatory sequence or the third regulatory sequence comprises a second promoter or a third promoter selected from the group consisting of a heF1a promoter, an AAT promoter, a thyroid hormone binding globulin promoter, an albumin promoter, a thyroxine binding globulin (TBG) promoter, a liver control region (HCR)-ApoCII hybrid promoter, an HCR-hAAT hybrid promoter, and an AAT promoter in combination with a mouse albumin gene enhancer (Ealb) element and an apolipoprotein E promoter.

151. The viral vector of claim 145, wherein the second regulatory sequence or the third regulatory sequence comprises a constitutive promoter.

152. The viral vector of claim 145, wherein the second nucleic acid sequence or the third nucleic acid sequence is operably linked to a second 3' untranslated region that regulates RNA stability and expression in mammalian cells.

153. The viral vector of claim 145, wherein the second 3' untranslated region or the third 3' untranslated region comprises a second tissue-specific miRNA binding sequence or a third tissue-specific miRNA binding sequence for regulating expression of the Klotho protein or FGF21 protein in a mammalian cell.

154. The viral vector of claim 153, wherein the second tissue-specific miRNA binding sequence or the third tissue-specific miRNA binding sequence comprises a second mir122a tissue-specific miRNA binding sequence or a third mir122a tissue-specific miRNA binding sequence for preventing expression in liver cells.

155. The viral vector of claim 145, wherein the second 3' untranslated region or the third 3' untranslated region comprises a second polyadenylation signal or a third polyadenylation signal selected from the group consisting of WPRE3, SV40 late polyadenylation signal (truncated, SEQ ID NO: 114), HBG polyadenylation signal, and ETC polyadenylation signal, or a hybrid thereof.

156. The viral vector of claim 145, wherein the second nucleic acid or the third nucleic acid encoding the FGF21 protein is operably linked to the first regulatory sequence, thereby expressing a polycistronic mRNA transcript encoding the fusion protein and the Klotho protein or the FGF21 protein, and the second regulatory sequence or the third regulatory sequence comprises an operably linked IRES or 2A sequence for expressing the Klotho protein or the FGF21 protein from the polycistronic transcript.

157. The viral vector of claim 145, wherein the viral vector is a parvovirus vector.

158. The viral vector of claim 157, wherein the viral vector is an adeno-associated viral (AAV) vector.

159. 159. The viral vector of claim 158, wherein the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, and AAVrhlO.XX (where xx represents different known variants) viral vectors.

160. 159. The viral vector of claim 158, wherein the viral vector is serotyped for AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, 11, AAV12, AAV2.5, and AAVrhlO.XX (where xx represents different known variants), or a combination thereof.

161. A composition comprising a first viral vector and a second viral vector, the first viral vector comprises a first nucleic acid sequence encoding a fusion protein of a mammalian soluble transforming growth factor beta receptor II (sTGFβ-R2) protein or a fragment thereof having a receptor extracellular domain and an Ig Fc domain, the fusion protein being capable of binding to TGFβ1, the first nucleic acid sequence being operably linked to appropriate regulatory sequences for expression in a mammalian cell, and the first viral vector optionally comprises a first inhibitor sequence for inhibiting expression of the first nucleic acid sequence in a non-target tissue; The composition, wherein the second viral vector comprises a second nucleic acid sequence encoding a Klotho protein or an FGF21 protein, the second nucleic acid sequence being operably linked to a second regulatory sequence for expression in a mammalian cell, and the second viral vector optionally comprises a second inhibitor sequence for inhibiting expression of the second nucleic acid sequence in a non-target tissue.

162. 162. A method of reducing the formation of fibrous tissue in a mammal comprising administering to the mammal a therapeutically effective amount of the viral vector of the composition of claim 161.

163. 162. A method for treating cardiac, hepatic, pulmonary, or renal fibrosis in a mammal comprising administering to the mammal a therapeutically effective amount of the viral vector of the composition of claim 161.

164. A viral vector comprising a first nucleic acid sequence encoding an FGF21 protein, A viral vector, wherein the first nucleic acid sequence is operably linked to a first regulatory sequence for expression of the FGF21 protein in a mammalian cell.

165. The viral vector of claim 164, further comprising a second nucleic acid encoding Klotho, said second nucleic acid sequence being operably linked to a second regulatory sequence for expression of the Klotho protein in the mammalian cell.

166. The viral vector of claim 165, wherein the FGF21 protein and the Klotho protein are of the same mammalian species.

167. 167. The viral vector of claim 166, wherein the mammalian species is selected from the group consisting of human, canine, feline, bovine, ovine, caprine, equine, murine, and porcine.

168. The viral vector of claim 164, wherein the second regulatory sequence comprises a second liver tissue-specific promoter for expression of the Klotho protein in liver cells.

169. The viral vector of claim 164, wherein the second regulatory sequence comprises a second promoter, the second promoter being a constitutive promoter or an inducible promoter.

170. The viral vector of claim 164, wherein the second regulatory sequence comprises a second promoter selected from the group consisting of a heF1a promoter, an AAT promoter, a thyroid hormone binding globulin promoter, an albumin promoter, a thyroxine binding globulin (TBG) promoter, a liver control region (HCR)-ApoCII hybrid promoter, an HCR-hAAT hybrid promoter, and an AAT promoter in combination with a mouse albumin gene enhancer (Ealb) element and an apolipoprotein E promoter.

171. The viral vector of claim 164, wherein the second regulatory sequence comprises a constitutive promoter.

172. The viral vector of claim 164, wherein the second nucleic acid sequence is operably linked to a second 3' untranslated region that regulates RNA stability and expression in mammalian cells.

173. The viral vector of claim 164, wherein the second 3' untranslated region comprises a second tissue-specific miRNA binding sequence for regulating expression of the Klotho protein in mammalian cells.

174. The viral vector of claim 173, wherein the second tissue-specific miRNA binding sequence comprises a second mir122a tissue-specific miRNA binding sequence for preventing expression in hepatocytes.

175. The viral vector of claim 164, wherein the second 3' untranslated region comprises a second polyadenylation signal selected from the group consisting of WPRE3, SV40 late polyadenylation signal (truncated, SEQ ID NO: 114), HBG polyadenylation signal, and ETC polyadenylation signal, or a hybrid thereof.

176. The viral vector of claim 164, wherein the second nucleic acid encoding the Klotho protein is operably linked to the first regulatory sequence, thereby expressing a polycistronic mRNA transcript encoding the FGF21 protein and the Klotho protein, and the second regulatory sequence comprises an operably linked IRES or 2A sequence for expressing the Klotho protein from the polycistronic transcript.

177. The viral vector of claim 164, wherein the viral vector is a parvovirus vector.

178. The viral vector of claim 164, wherein the viral vector is an adeno-associated viral (AAV) vector.

179. 179. The viral vector of claim 178, wherein the AAV vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, and AAVrhlO.XX (where xx represents different known variants) viral vectors.

180. The viral vector of claim 178, wherein the viral vector is serotyped for AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2.5, and AAVrhlO.XX (where xx represents different known variants), or a combination thereof.

181. A composition comprising a first viral vector and a second viral vector, the first viral vector comprises a first nucleic acid sequence encoding an FGF21 protein or a fragment thereof, the first nucleic acid sequence being operably linked to a suitable regulatory sequence for expression in a mammalian cell, the first viral vector optionally comprising a first inhibitor sequence for inhibiting expression of the first nucleic acid sequence in a non-target tissue; The composition, wherein the second viral vector comprises a second nucleic acid sequence encoding a Klotho protein, the second nucleic acid sequence being operably linked to a second regulatory sequence for expression in a mammalian cell, and the second viral vector optionally comprises a second inhibitor sequence for inhibiting expression of the second nucleic acid sequence in a non-target tissue.

182. 182. A method of reducing the formation of fibrous tissue in a mammal comprising administering to the mammal a therapeutically effective amount of the viral vector of the composition of claim 181.

183. 182. A method for treating cardiac, hepatic, pulmonary, or renal fibrosis in a mammal comprising administering to the mammal a therapeutically effective amount of the viral vector of the composition of claim 181.

184. A combination of a first viral vector and a second viral vector, wherein the first viral vector comprises a cassette having a first nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding a mammalian soluble transforming growth factor beta receptor II protein and a second nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding an Fc (fragment crystallizable) domain, wherein expression of the first nucleic acid sequence and the second nucleic acid sequence produces a fusion of the mammalian soluble transforming growth factor beta receptor II protein and the Fc, the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a suitable promoter for expression in a mammalian cell; the viral vector comprises one or more ITR sequences flanking the cassette; the viral vector optionally comprises an inhibitor to prevent expression of the first nucleic acid sequence and the second nucleic acid sequence in a non-target tissue; the second viral vector comprises a third nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding Klotho or FGF21, the third nucleic acid sequence being operably linked to a suitable promoter for expression in a mammalian cell; A combination of said viral vectors, wherein the second viral vector comprises one or more ITR sequences flanking the cassette, and the second viral vector optionally comprises an inhibitor to prevent expression of the third nucleic acid sequence in non-target tissues.

185. A combination of a first viral vector and a second viral vector, wherein the first viral vector comprises a cassette comprising a first nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding an FGF21 protein; the first nucleic acid sequence is operably linked to a suitable promoter for expression in a mammalian cell; the viral vector comprises one or more ITR sequences flanking the cassette; the viral vector optionally comprises an inhibitor to prevent expression of the first nucleic acid sequence in non-target tissues; the second viral vector comprises a second nucleic acid sequence having at least 90% homology to a nucleic acid sequence encoding Klotho, the second nucleic acid sequence being operably linked to a suitable promoter for expression in a mammalian cell; A combination of said viral vectors, wherein the second viral vector comprises one or more ITR sequences flanking the cassette, and the second viral vector optionally comprises an inhibitor to prevent expression of the third nucleic acid sequence in non-target tissues.

Images