Treating metastatic cancer and model system for metastatic disease

Abstract

To provide: treatments for metastatic cancer; and model systems for metastatic disease.SOLUTION: This invention relates to methods and compositions for inhibiting metastatic spread of cancer and / or inhibiting progression of pre-existing metastatic disease in a subject, using L1CAM inhibition. It is based, at least in part, on the discovery that L1CAM is a marker of metastatic cancer stem-like cells (MetCSCs), and is expressed on these quiescent, very slowly dividing cells that can therefore escape standard chemotherapy and later re-initiate tumor growth. It is further based on the discovery that L1CAM-depletion inhibits the initiation of metastasis not only in the brain, but also in the lungs, liver, and bone from breast, lung, colon, and renal cancer xenografts, demonstrating the importance of L1CAM in the initiation of multi-organ metastasis.SELECTED DRAWING: None

Description

[Technical field]

[0001] Claiming priority This application claims priority to U.S. Provisional Application No. 62 / 370,108, filed August 2, 2016, the contents of which are hereby incorporated by reference in their entirety herein.

[0002] Grant Information This invention was made with Government support under Grant No. 5 U54 CA163167-03 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0003] 1. Introduction The present invention relates to methods and compositions for inhibiting the metastatic spread of cancer and / or inhibiting the progression of existing metastatic disease in a subject.In certain embodiments, it provides a method comprising treating a subject with an L1CAM inhibitor using a regimen that targets slow-growing metastatic cancer stem-like cells ("MetCSCs"), such as those present in post-chemotherapy residual disease.It further provides a model of metastatic disease that includes L1CAM-expressing MetCSCs, which can be used to study the metastatic progression of cancer and to identify useful therapeutic agents. [Background technology]

[0004] 2. 2. Background of the Invention Despite recent advances in cancer therapeutics, metastasis remains the leading cause of cancer death. Chemotherapy and targeted therapy for metastatic disease can induce tumor responses, but are almost always followed by resistance and fatal relapse. Residual disease that persists after treatment and drives regrowth has been proposed to contain metastatic cancer stem-like cells (MetCSCs), which are specifically capable of self-renewal and slow cell cycling, re-initiating tumors and being therapy resistant (Oskarsson et al., 2014; Hanahan et al., 2011; Malladi et al., 2013). 6). Targeting MetCSCs may provide an important approach for treating metastatic cancer and micrometastatic residual disease in the adjuvant setting.

[0005] L1CAM was initially identified as a neural cell adhesion molecule (Rathjen et al., 1984; Maness and Schachner, 2007). L1CAM is a large, multidomain protein ectopically expressed at the invasion front of many solid tumors and is commonly associated with metastasis and poor prognosis (e.g., Altevogt et al., 2015). Single cells of metastatic lung and breast cancer that invade the brain use L1CAM to intimately spread along blood vessels in a process termed vascular co-option (Valiente et al., 2014; PCT / US2014 / 056379). RNAi-mediated L1CAM knockdown inhibits vascular co-option and prevents the development of brain macrometastases (PCT / US2014 / 056379). [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Oskarsson T, Batlle E, Massague J. Metastatic stem cells: sources, niches, and vital pathways. Cell Stem Cell. 2014 Mar 6; 14(3):306-21

Outdoor Tool2

Outdoor Tools3

Outdoor Tools 4

Direct Environment 5

Outdoor Configuration6

[0007] 3. Summary of the Invention The present invention relates to methods for preventing and treating metastatic disease, assay systems for identifying therapeutic agents, and compositions useful therein.

[0008] The present invention is based, at least in part, on the discovery that L1CAM is a marker for MetCSCs and is expressed on these quiescent, very slowly dividing cells, and therefore can escape standard chemotherapy and subsequently reinitiate tumor growth.The present invention is further based on the discovery that L1CAM depletion inhibits the initiation of metastasis not only in the brain, but also in the lung, liver and bone from breast, lung, colon and kidney cancer xenografts, demonstrating the importance of L1CAM in the initiation of multi-organ metastasis.In particular, it has been observed that inducible L1CAM knockdown in progressive macrometastatic xenografts inhibits metastatic progression, highlighting the clinical relevance of L1CAM inhibition in established metastatic disease.The present invention is further based, in part, on the discovery that L1CAM inhibition inhibits the growth of chemoresistant lung cancer xenografts, supporting a mechanism of action different from cytotoxic drugs, and that L1CAM inhibition has been observed to render chemoresistant tumor cells chemosensitive. In certain embodiments, for example, the following are provided: (Item 1) A method for reducing the risk of metastatic spread of a primary cancer in a subject who has been treated for the primary cancer, the method comprising administering to the subject a therapeutic amount of an L1CAM inhibitor. (Item 2) The method of claim 1, wherein the L1CAM inhibitor is administered after completion of one or more cycles of chemotherapy, targeted therapy, immunotherapy, or a combination thereof for the primary cancer. (Item 3) The method of claim 1, wherein the L1CAM inhibitor is administered after a radiation therapy regimen for the primary cancer has been completed. (Item 4) The method of claim 1, wherein the L1CAM inhibitor is administered after essentially complete surgical resection of the primary cancer or metastasis has been completed. (Item 5) 5. The method of any of items 1 to 4, wherein the L1CAM inhibitor is administered in a maintenance regimen. (Item 6) The method of claim 5, wherein the L1CAM inhibitor is administered at least once a week. (Item 7) The method of claim 5, wherein the L1CAM inhibitor is administered at least once a month. (Item 8) The method of claim 5, wherein the L1CAM inhibitor is administered at least once every two months. (Item 9) 6. The method of claim 5, wherein the L1CAM inhibitor is administered at least once every three months. (Item 10) 6. The method of claim 5, wherein the L1CAM inhibitor is administered at least once every six months. (Item 11) 11. The method of any of items 1 to 10, wherein the L1CAM inhibitor treatment is initiated after the subject has reached remission of the primary cancer. (Item 12) 12. The method of any of items 1 to 11, wherein the L1CAM inhibitor is an immunoglobulin. (Item 13) The method of claim 12, wherein the L1CAM inhibitor is an immunoglobulin bispecific for L1CAM and CD133. (Item 14) The method of claim 12, wherein the L1CAM inhibitor is an immunoglobulin bispecific for L1CAM and CD44. (Item 15) 12. The method of any of items 1 to 11, wherein the L1CAM inhibitor is an interfering RNA. (Item 16) 12. The method of any of items 1 to 11, wherein the L1CAM inhibitor is an antisense RNA. (Item 17) 17. The method of any of items 1 to 16, wherein the primary cancer is breast cancer. (Item 18) 17. The method of any of items 1 to 16, wherein the primary cancer is lung cancer. (Item 19) 17. The method of any of items 1 to 16, wherein the primary cancer is renal cancer. (Item 20) 17. The method of any of items 1 to 16, wherein the primary cancer is colorectal cancer. (Item 21) An L1CAM inhibitor for use in a method for reducing the risk of metastatic spread of a primary cancer in a subject who has been treated for said primary cancer. (Item 22) 22. The L1CAM inhibitor of item 21, administered after completion of one or more cycles of chemotherapy, targeted therapy, immunotherapy, or a combination thereof for the primary cancer. (Item 23) 22. The L1CAM inhibitor of item 21, administered after completion of a radiation therapy regimen for the primary cancer. (Item 24) 22. The L1CAM inhibitor of item 21, administered after essentially complete surgical resection of the primary cancer or metastasis has been completed. (Item 25) 22. The L1CAM inhibitor of item 21, administered in a maintenance regimen. (Item 26) 22. The L1CAM inhibitor of item 21, which is initially administered after the subject has reached remission of the primary cancer. (Item 27) 27. The L1CAM inhibitor according to any of items 21 to 26, which is an immunoglobulin. (Item 28) 28. The L1CAM inhibitor according to item 27, which is a bispecific immunoglobulin against L1CAM and CD133. (Item 29) 28. The L1CAM inhibitor according to item 27, which is a bispecific immunoglobulin for L1CAM and CD44. (Item 30) 27. The L1CAM inhibitor according to any of items 21 to 26, which is an interfering RNA. (Item 31) 27. The L1CAM inhibitor according to any of items 21 to 26, which is an antisense RNA. (Item 32) 32. The L1CAM inhibitor according to any of items 21 to 31, wherein the primary cancer is breast cancer. (Item 33) 32. The L1CAM inhibitor according to any of items 21 to 31, wherein the primary cancer is lung cancer. (Item 34) 32. The L1CAM inhibitor according to any one of items 21 to 31, wherein the primary cancer is renal cancer. (Item 35) 32. The L1CAM inhibitor according to any of items 21 to 31, wherein the primary cancer is colorectal cancer. (Item 36) A method for inhibiting metastatic spread of a primary cancer in a subject undergoing treatment for the primary cancer, the method comprising administering to the subject a therapeutic amount of an L1CAM inhibitor. (Item 37) 37. The method of claim 36, wherein the L1CAM inhibitor is administered after completion of one or more cycles of chemotherapy, targeted therapy, immunotherapy, or a combination thereof for the primary cancer. (Item 38) The L1CAM inhibitor is administered after completion of a radiation therapy regimen for the primary cancer. 37. The method of claim 36, wherein the (Item 39) 37. The method of claim 36, wherein the L1CAM inhibitor is administered after essentially complete surgical resection of the primary cancer or metastasis has been completed. (Item 40) 40. The method of any of items 36 to 39, wherein the L1CAM inhibitor is administered in a maintenance regimen. (Item 41) The method of claim 40, wherein the L1CAM inhibitor is administered at least once a week. (Item 42) 41. The method of item 40, wherein the L1CAM inhibitor is administered at least once a month. (Item 43) 41. The method of claim 40, wherein the L1CAM inhibitor is administered at least once every two months. (Item 44) 41. The method of claim 40, wherein the L1CAM inhibitor is administered at least once every three months. (Item 45) 41. The method of item 40, wherein the L1CAM inhibitor is administered at least once every six months. (Item 46) 46. ​​The method of any of items 36 to 45, wherein the L1CAM inhibitor treatment is initiated after the subject has reached remission of the primary cancer. (Item 47) 47. The method of any of items 36 to 46, wherein the L1CAM inhibitor is an immunoglobulin. (Item 48) 48. The method of claim 47, wherein the L1CAM inhibitor is an immunoglobulin bispecific for L1CAM and CD133. (Item 49) 48. The method of claim 47, wherein the L1CAM inhibitor is an immunoglobulin bispecific for L1CAM and CD44. (Item 50) 47. The method of any of items 36 to 46, wherein the L1CAM inhibitor is an interfering RNA. (Item 51) 47. The method of any of items 36 to 46, wherein the L1CAM inhibitor is an antisense RNA. (Item 52) 52. The method according to any of items 36 to 51, wherein the primary cancer is breast cancer. (Item 53) 52. The method according to any of items 36 to 51, wherein the primary cancer is lung cancer. (Item 54) 52. The method of any of items 36 to 51, wherein the primary cancer is renal cancer. (Item 55) 52. The method of any of items 36 to 51, wherein the primary cancer is colorectal cancer. (Item 56) Risk of metastatic spread of a primary cancer in a subject who has been treated for said primary cancer. 23. An L1CAM inhibitor for use in a method for reducing (Item 57) 57. The L1CAM inhibitor of item 56, administered after completion of one or more cycles of chemotherapy, targeted therapy, immunotherapy, or a combination thereof for the primary cancer. (Item 58) 57. The L1CAM inhibitor of item 56, administered after completion of a radiation therapy regimen for the primary cancer. (Item 59) 57. The L1CAM inhibitor of item 56, administered after essentially complete surgical resection of the primary cancer or metastasis has been completed. (Item 60) 57. The L1CAM inhibitor of item 56, administered in a maintenance regimen. (Item 61) 57. The L1CAM inhibitor of item 56, which is initially administered after the subject has reached remission of the primary cancer. (Item 62) 62. The L1CAM inhibitor according to any of items 56 to 61, which is an immunoglobulin. (Item 63) 63. The L1CAM inhibitor according to item 62, which is a bispecific immunoglobulin against L1CAM and CD133. (Item 64) 63. The L1CAM inhibitor according to item 62, which is a bispecific immunoglobulin for L1CAM and CD44. (Item 65) 62. The L1CAM inhibitor according to any of items 56 to 61, which is an interfering RNA. (Item 66) 62. The L1CAM inhibitor according to any of items 56 to 61, which is an antisense RNA. (Item 67) 67. The L1CAM inhibitor according to any of items 56 to 66, wherein the primary cancer is breast cancer. (Item 68) 67. The L1CAM inhibitor according to any of items 56 to 66, wherein the primary cancer is lung cancer. (Item 69) 67. The L1CAM inhibitor according to any of items 56 to 66, wherein the primary cancer is renal cancer. (Item 70) 67. The L1CAM inhibitor according to any of items 56 to 66, wherein the primary cancer is colorectal cancer. (Item 71) A method of inhibiting the progression of metastatic disease in a subject who has been treated for a primary cancer, comprising administering to the subject a therapeutic amount of an L1CAM inhibitor. (Item 72) 72. The method of claim 71, wherein the L1CAM inhibitor is administered after completion of one or more cycles of chemotherapy, targeted therapy, immunotherapy, or a combination thereof for the primary cancer. (Item 73) 72. The method of claim 71, wherein the L1CAM inhibitor is administered after a radiation therapy regimen for the primary cancer has been completed. (Item 74) 72. The method of claim 71, wherein the L1CAM inhibitor is administered after essentially complete surgical resection of the primary cancer or metastasis has been completed. (Item 75) 75. The method of any of items 71 to 74, wherein the L1CAM inhibitor is administered in a maintenance regimen. (Item 76) 76. The method of item 75, wherein the L1CAM inhibitor is administered at least once a week. (Item 77) 76. The method of item 75, wherein the L1CAM inhibitor is administered at least once a month. (Item 78) 76. The method of item 75, wherein the L1CAM inhibitor is administered at least once every two months. (Item 79) 76. The method of item 75, wherein the L1CAM inhibitor is administered at least once every three months. (Item 80) 76. The method of item 75, wherein the L1CAM inhibitor is administered at least once every six months. (Item 81) 81. The method of any of items 71 to 80, wherein the L1CAM inhibitor treatment is initiated after the subject has reached remission of the primary cancer. (Item 82) 82. The method of any of items 71 to 81, wherein the L1CAM inhibitor is an immunoglobulin. (Item 83) 83. The method of item 82, wherein the L1CAM inhibitor is an immunoglobulin bispecific for L1CAM and CD133. (Item 84) 83. The method of item 82, wherein the L1CAM inhibitor is an immunoglobulin bispecific for L1CAM and CD44. (Item 85) 82. The method of any of items 71 to 81, wherein the L1CAM inhibitor is an interfering RNA. (Item 86) 82. The method of any of items 71 to 81, wherein the L1CAM inhibitor is an antisense RNA. (Item 87) 87. The method of any of items 71 to 86, wherein the primary cancer is breast cancer. (Item 88) 87. The method of any of items 71 to 86, wherein the primary cancer is lung cancer. (Item 89) 87. The method of any of items 71 to 86, wherein the primary cancer is renal cancer. (Item 90) 87. The method of any of items 71 to 86, wherein the primary cancer is colorectal cancer. (Item 91) An L1CAM inhibitor for use in a method for reducing the risk of metastatic spread of a primary cancer in a subject who has been treated for said primary cancer. (Item 92) The L1CAM inhibitor of item 91, administered after completion of one or more cycles of chemotherapy, targeted therapy, immunotherapy, or a combination thereof for the primary cancer. (Item 93) The L1CAM inhibitor of item 91, administered after completion of a radiation therapy regimen for the primary cancer. (Item 94) The L1CAM inhibitor of item 91, administered after essentially complete surgical resection of the primary cancer or metastasis has been completed. (Item 95) 92. The L1CAM inhibitor of item 91, administered in a maintenance regimen. (Item 96) The L1CAM inhibitor of item 91, which is initially administered after the subject has reached remission of the primary cancer. (Item 97) 97. The L1CAM inhibitor according to any of items 91 to 96, which is an immunoglobulin. (Item 98) 98. The L1CAM inhibitor according to item 97, which is a bispecific immunoglobulin against L1CAM and CD133. (Item 99) 98. The L1CAM inhibitor according to item 97, which is a bispecific immunoglobulin for L1CAM and CD44. (Item 100) 97. The L1CAM inhibitor according to any of items 91 to 96, which is an interfering RNA. (Item 101) 97. The L1CAM inhibitor according to any of items 91 to 96, which is an antisense RNA. (Item 102) 102. The L1CAM inhibitor according to any of items 91 to 101, wherein the primary cancer is breast cancer. (Item 103) 102. The L1CAM inhibitor according to any of items 91 to 101, wherein the primary cancer is lung cancer. (Item 104) 102. The L1CAM inhibitor according to any of items 91 to 101, wherein the primary cancer is renal cancer. (Item 105) 102. The L1CAM inhibitor according to any of items 91 to 101, wherein the primary cancer is colorectal cancer. (Item 106) A method for reversing chemoresistance of cancer cells to a chemotherapeutic agent, the method comprising administering to the cancer cells an effective amount of an L1CAM inhibitor. (Item 107) 107. The method of claim 106, wherein the cancer cells are metastatic cancer cells. (Item 108) Item 107. The method of item 106, wherein the cancer is breast cancer. (Item 109) Item 107. The method of item 106, wherein the cancer is lung cancer. (Item 110) Item 107. The method of item 106, wherein the cancer is renal cancer. (Item 111) 107. The method of claim 106, wherein the cancer is colorectal cancer. (Item 112) The method of item 106, wherein the L1CAM inhibitor is an immunoglobulin. (Item 113) 113. The method of any of items 106 to 112, wherein the chemotherapeutic agent is carboplatin. (Item 114) 113. The method of any of items 106 to 112, wherein the chemotherapeutic agent is methotrexate. (Item 115) An assay for identifying agents that inhibit metastasis comprising organoid cultures containing cancer cells expressing L1CAM. (Item 116) The assay of paragraph 115, further wherein the cancer cells express EphB2. (Item 117) 117. The assay of paragraph 115 or 116, wherein the cancer cells express high levels of L1CAM. (Item 118) 118. The assay of any of paragraphs 115 to 117, wherein the cancer cells express intermediate or high levels of EphB2. (Item 119) 119. The assay of any of paragraphs 115 to 118, wherein the cancer cells further express surface EPCAM. (Item 120) 120. The assay of any of items 115 to 119, wherein the cancer cells are MetCSCs. (Item 121) 121. The assay of paragraph 120, wherein the cells express a fluorescent exogenous marker. (Item 122) 1. A method for identifying an agent that inhibits metastasis, comprising: (i) providing an organoid culture comprising cancer cells expressing L1CAM; (ii) contacting the organoid culture with a test substance; (iii) determining whether the level of L1CAM expression is decreased in the test substance-contacted cultures relative to control organoid cultures not contacted with the test substance; A decrease in the level of expression of L1CAM in response to contact with the test substance indicates that the test substance inhibits metastasis. (Item 123) 1. A kit for identifying an agent that inhibits metastasis, comprising: A kit comprising: (i) cancer cells expressing L1CAM; and (ii) a means for determining the level of L1CAM expression. (Item 124) The kit of item 124, wherein the cancer cells express high levels of L1CAM. (Item 125) The cancer cells express one or more of CD133, CD44, and / or EphB2. 125. The kit according to item 123 or 124, further expressing (Item 126) 126. The kit according to any of items 123 to 125, wherein the means for detecting L1CAM expression is an oligonucleotide probe that detectably binds to L1CAM. (Item 127) 126. The kit according to any of items 123 to 125, wherein the means for detecting L1CAM expression is a pair of primers that can be used in a polymerase chain reaction to determine the L1CAM expression level. (Item 128) 126. The kit according to any of items 123 to 125, wherein the means for detecting L1CAM expression is an antibody that specifically binds to L1CAM. (Item 129) 1. A method of inhibiting progression of metastatic disease in a subject, comprising: The method includes administering to the subject a therapeutic amount of an agent that reduces L1CAM expression in cancer cells, e.g., via CRISPR / Cas9-mediated gene editing. 4. BRIEF DESCRIPTION OF THE DRAWINGS [Brief description of the drawings]

[0009] [Figure 1A-D] Figure 1A-D. L1CAM is required for multi-organ metastasis, and knockdown of L1CAM expression in cancer cells inhibits (reduces) (A) breast cancer metastasis to the lung; (B) breast cancer metastasis to the bone; (C) colon cancer metastasis to the liver; and (D) renal cell carcinoma metastasis to the brain.

[0010] [Diagram 2] Use of doxycycline-inducible "knockdown" of L1CAM to determine the effect of L1CAM inhibition on established metastases.

[0011] [Figure 3A-B]Figure 3A-C. L1CAM knockdown inhibits the growth of established metastases, including (A) lung cancer brain metastases; (B) breast cancer bone metastases; and (C) breast cancer lung metastases. [Figure 3C] Figure 3A-C. L1CAM knockdown inhibits the growth of established metastases, including (A) lung cancer brain metastases; (B) breast cancer bone metastases; and (C) breast cancer lung metastases.

[0012] [Figure 4A-B] FIG. 4A-B. Histological comparison of established metastases without (A) or with (B) L1CAM inhibition.

[0013] [Figure 5A] Figure 5A-B. Expression of L1CAM at the primary tumor invasive front. (A) The primary tumor invasive front is strongly L1CAM+; (B) L1CAM+ cells at the invasive front are quiescent (relatively low KI67 expression). [Figure 5B] Figure 5A-B. Expression of L1CAM at the primary tumor invasive front. (A) The primary tumor invasive front is strongly L1CAM+; (B) L1CAM+ cells at the invasive front are quiescent (relatively low KI67 expression).

[0014] [Figure 6A-C] Figure 6A-D. (A) Comparison of L1CAM expression in primary colorectal tumors and (B) liver metastases. (C) Percentage of total segments that are L1CAM+. (D) Absence of detectable L1CAM expression in normal colon. [Figure 6D] Figure 6A-D. (A) Comparison of L1CAM expression in primary colorectal tumors and (B) liver metastases. (C) Percentage of total segments that are L1CAM+. (D) Absence of detectable L1CAM expression in normal colon.

[0015] [Figure 7A-C]FIG. 7A-C. Abundance of L1CAM+ cells in (A) normal colon, (B) primary colorectal tumors, and (C) liver metastases.

[0016] [Figure 8A] Figure 8A-B. L1CAM expression in post-chemotherapy residual disease. (A) Post-chemotherapy residual disease is strongly L1CAM+; (B) L1CAM+ cells are quiescent (relatively low KI67 expression). [Figure 8B] Figure 8A-B. L1CAM expression in post-chemotherapy residual disease. (A) Post-chemotherapy residual disease is strongly L1CAM+; (B) L1CAM+ cells are quiescent (relatively low KI67 expression).

[0017] [Figure 9A-C] Figure 9A-D. (A) Expression of L1CAM in tumors before chemotherapy; (B) after chemotherapy (after neoadjuvant chemotherapy); and (C) graphical comparison between (A) and (B). (D) Relationship between the number of organoids formed and L1CAM expression. [Figure 9D] Figure 9A-D. (A) Expression of L1CAM in tumors before chemotherapy; (B) after chemotherapy (after neoadjuvant chemotherapy); and (C) graphical comparison between (A) and (B). (D) Relationship between the number of organoids formed and L1CAM expression.

[0018] [Figure 10] Figure 10. Schematic showing a typical organoid culture.

[0019] [Figure 11] Figure 11. Schematic showing obtaining metastatic cells from patients and selection of EpCAM+, L1CAM+ cells for organoid culture.

[0020] [Figure 12] Figure 12. FACS results sorting for EphB22medium / high and L1CAM+ cells.

[0021] [Figure 13] FIG. 13. Simultaneous expression of EphB22, CD133, and CD44 markers on L1CAM high and low expressing cells.

[0022] [Figure 14-1] Figure 14. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 14-2] Figure 14. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 14-3] Figure 14. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 14-4] Figure 14. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 14-5] Figure 14. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 14-6] Figure 14. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 14-7] Figure 14. FACS analysis for L1CAM, EphB22, CD133, and CD44.

[0023] [Figure 15-1] Figure 15. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 15-2] Figure 15. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 15-3] Figure 15. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 15-4] Figure 15. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 15-5] Figure 15. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 15-6]Figure 15. FACS analysis for L1CAM, EphB22, CD133, and CD44. [Figure 15-7] Figure 15. FACS analysis for L1CAM, EphB22, CD133, and CD44.

[0024] [Figure 16] Figure 16. Relationship between L1CAM expression and organoid growth.

[0025] [Figure 17] Figure 17. Relationship between L1CAM expression and organoid formation for specific tumor samples.

[0026] [Figure 18] Figure 18. L1CAM expression by L1CAM-high cells in organoid cultures.

[0027] [Figure 19] Figure 19. Ability to change in L1CAM status during organoid culture in vivo.

[0028] [Figure 20A] Figure 20A-B. L1CAM expression is a trait selected for during organoid generation. (A) Patient MSKCRC55; (B) Patient MSKCRC51. [Figure 20B] Figure 20A-B. L1CAM expression is a trait selected for during organoid generation. (A) Patient MSKCRC55; (B) Patient MSKCRC51.

[0029] [Figure 21] Figure 21. Organoid formation following L1CAM deletion.

[0030] [Figure 22] Figure 22. L1CAM expression as a function of organoid size.

[0031] [Figure 23]Figure 23. Nascent small organoids are composed largely of L1CAM+ cells, but as the organoids grow, the cells divide and give rise to L1CAM- differentiated progeny, which make up the majority of the organoid.

[0032] [Figure 24] Figure 24. Inducible L1CAM knockdown reverses chemoresistance of Kras mutant lung cancer cells.

[0033] [Fig. 25A-B] Figure 25A-C. (A) Tumor re-initiation by L1CAM-high cells vs. L1CAM-low cells in NSG mice. (B) Histology of formed tumors. (C) Organoid formation by L1CAM-high vs. L1CAM-low tumor cells. [Figure 25C] Figure 25A-C. (A) Tumor re-initiation by L1CAM-high cells vs. L1CAM-low cells in NSG mice. (B) Histology of formed tumors. (C) Organoid formation by L1CAM-high vs. L1CAM-low tumor cells.

[0034] [Figure 26A-B] Figure 26A-D. (A) Schematic of the procedure for generating successive generations of metastatic cells. (B) Metastasis-free survival of mice inoculated with parental (light grey) or M1 generation cells (dark grey). (C) Macroscopic images showing the relative numbers of metastases arising from parental cells (upper panel) at 7 days and 7 weeks, and M1 generation cells at 7 days and 4 weeks. (D) Levels of L1CAM mRNA in parental, M1, and M2 cells. [Fig. 26C-D] Figure 26A-D. (A) Schematic of the procedure for generating successive generations of metastatic cells. (B) Metastasis-free survival of mice inoculated with parental (light grey) or M1 generation cells (dark grey). (C) Macroscopic images showing the relative numbers of metastases arising from parental cells (upper panel) at 7 days and 7 weeks, and M1 generation cells at 7 days and 4 weeks. (D) Levels of L1CAM mRNA in parental, M1, and M2 cells.

[0035] [Figure 27] Figure 27. Relative L1CAM expression in intact organoids, 24 hour dissociated organoids, and 24 hour suspension cultures (control).

[0036] [Fig. 28A-D] Figure 28A-M. (A) Median percent L1CAM expression after CRISPR-Cas9-mediated L1CAM knockout. (B) Number of organoids per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (C) Relative luminescence after CRISPR-Cas9-mediated L1CAM knockout. (D) Fluorescence microscopy showing organoids generated per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (E) Days of luminescence after doxycycline-mediated knockdown of L1CAM. (F) Relative luminescence with or without doxycycline-induced L1CAM knockdown. (G) Fluorescence microscopy showing organoids with or without doxycycline-induced L1CAM knockdown. (H) Luminescence when doxycycline was discontinued after 14 days. (I) Similar experiment as in (H) with an independent L1CAM-targeting shRNA. (J) Caspase activity after dissociation with or without doxycycline-induced L1CAM knockdown. (K) Tumor regrowth with or without doxycycline-induced L1CAM knockdown. (L) Mean radiance of tumor regrowth after 3 weeks with or without doxycycline-induced L1CAM knockdown. (M) Relative differences in levels of L1CAM and YAP target genes in intact organoids (left-most bar of paired bars) versus dissociated cells. [Fig. 28E-F]Figure 28A-M. (A) Median percent L1CAM expression after CRISPR-Cas9-mediated L1CAM knockout. (B) Number of organoids per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (C) Relative luminescence after CRISPR-Cas9-mediated L1CAM knockout. (D) Fluorescence microscopy showing organoids generated per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (E) Days of luminescence after doxycycline-mediated knockdown of L1CAM. (F) Relative luminescence with or without doxycycline-induced L1CAM knockdown. (G) Fluorescence microscopy showing organoids with or without doxycycline-induced L1CAM knockdown. (H) Luminescence when doxycycline was discontinued after 14 days. (I) Similar experiment as in (H) with an independent L1CAM-targeting shRNA. (J) Caspase activity after dissociation with or without doxycycline-induced L1CAM knockdown. (K) Tumor regrowth with or without doxycycline-induced L1CAM knockdown. (L) Mean radiance of tumor regrowth after 3 weeks with or without doxycycline-induced L1CAM knockdown. (M) Relative differences in levels of L1CAM and YAP target genes in intact organoids (left-most bar of paired bars) versus dissociated cells. [Fig. 28G-H]Figure 28A-M. (A) Median percent L1CAM expression after CRISPR-Cas9-mediated L1CAM knockout. (B) Number of organoids per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (C) Relative luminescence after CRISPR-Cas9-mediated L1CAM knockout. (D) Fluorescence microscopy showing organoids generated per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (E) Days of luminescence after doxycycline-mediated knockdown of L1CAM. (F) Relative luminescence with or without doxycycline-induced L1CAM knockdown. (G) Fluorescence microscopy showing organoids with or without doxycycline-induced L1CAM knockdown. (H) Luminescence when doxycycline was discontinued after 14 days. (I) Similar experiment as in (H) with an independent L1CAM-targeting shRNA. (J) Caspase activity after dissociation with or without doxycycline-induced L1CAM knockdown. (K) Tumor regrowth with or without doxycycline-induced L1CAM knockdown. (L) Mean radiance of tumor regrowth after 3 weeks with or without doxycycline-induced L1CAM knockdown. (M) Relative differences in levels of L1CAM and YAP target genes in intact organoids (left-most bar of paired bars) versus dissociated cells. [Fig. 28I-J]Figure 28A-M. (A) Median percent L1CAM expression after CRISPR-Cas9-mediated L1CAM knockout. (B) Number of organoids per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (C) Relative luminescence after CRISPR-Cas9-mediated L1CAM knockout. (D) Fluorescence microscopy showing organoids generated per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (E) Days of luminescence after doxycycline-mediated knockdown of L1CAM. (F) Relative luminescence with or without doxycycline-induced L1CAM knockdown. (G) Fluorescence microscopy showing organoids with or without doxycycline-induced L1CAM knockdown. (H) Luminescence when doxycycline was discontinued after 14 days. (I) Similar experiment as in (H) with an independent L1CAM-targeting shRNA. (J) Caspase activity after dissociation with or without doxycycline-induced L1CAM knockdown. (K) Tumor regrowth with or without doxycycline-induced L1CAM knockdown. (L) Mean radiance of tumor regrowth after 3 weeks with or without doxycycline-induced L1CAM knockdown. (M) Relative differences in levels of L1CAM and YAP target genes in intact organoids (left-most bar of paired bars) versus dissociated cells. [Fig. 28K-L]Figure 28A-M. (A) Median percent L1CAM expression after CRISPR-Cas9-mediated L1CAM knockout. (B) Number of organoids per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (C) Relative luminescence after CRISPR-Cas9-mediated L1CAM knockout. (D) Fluorescence microscopy showing organoids generated per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (E) Days of luminescence after doxycycline-mediated knockdown of L1CAM. (F) Relative luminescence with or without doxycycline-induced L1CAM knockdown. (G) Fluorescence microscopy showing organoids with or without doxycycline-induced L1CAM knockdown. (H) Luminescence when doxycycline was discontinued after 14 days. (I) Similar experiment as in (H) with an independent L1CAM-targeting shRNA. (J) Caspase activity after dissociation with or without doxycycline-induced L1CAM knockdown. (K) Tumor regrowth with or without doxycycline-induced L1CAM knockdown. (L) Mean radiance of tumor regrowth after 3 weeks with or without doxycycline-induced L1CAM knockdown. (M) Relative differences in levels of L1CAM and YAP target genes in intact organoids (left-most bar of paired bars) versus dissociated cells. [Figure 28M]Figure 28A-M. (A) Median percent L1CAM expression after CRISPR-Cas9-mediated L1CAM knockout. (B) Number of organoids per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (C) Relative luminescence after CRISPR-Cas9-mediated L1CAM knockout. (D) Fluorescence microscopy showing organoids generated per 2000 cells after CRISPR-Cas9-mediated L1CAM knockout. (E) Days of luminescence after doxycycline-mediated knockdown of L1CAM. (F) Relative luminescence with or without doxycycline-induced L1CAM knockdown. (G) Fluorescence microscopy showing organoids with or without doxycycline-induced L1CAM knockdown. (H) Luminescence when doxycycline was discontinued after 14 days. (I) Similar experiment as in (H) with an independent L1CAM-targeting shRNA. (J) Caspase activity after dissociation with or without doxycycline-induced L1CAM knockdown. (K) Tumor regrowth with or without doxycycline-induced L1CAM knockdown. (L) Mean radiance of tumor regrowth after 3 weeks with or without doxycycline-induced L1CAM knockdown. (M) Relative differences in levels of L1CAM and YAP target genes in intact organoids (left-most bar of paired bars) versus dissociated cells.

[0037] [Figure 29A]FIG. 29A-F. (A) L1CAM expression in human normal colon, dissociated crypts, and organoids at day 14 (upper panel, left to right), and mouse normal colon and organoids at day 14. Bar graphs show the respective fold change of expression in crypts (left-most bar of paired bars) versus organoids in three different human or mouse. (B) L1CAM expression (compared to 1-Ki67 expression; squared line) over time in normal mouse colon organoids (circled line). (C) Schematic and histological results showing L1CAM expression in mouse colon after epithelial injury. (D) Larger magnification showing L1CAM expression in regenerating transit-amplifying colonocytes. (E) Consequences of L1CAM loss on body weight and survival in mice sustaining colonic epithelial injury. (F) Macroscopic and microscopic histology of the results in (E). [Fig. 29B-C] FIG. 29A-F. (A) L1CAM expression in human normal colon, dissociated crypts, and organoids at day 14 (upper panel, left to right), and mouse normal colon and organoids at day 14. Bar graphs show the respective fold change of expression in crypts (left-most bar of paired bars) versus organoids in three different human or mouse. (B) L1CAM expression (compared to 1-Ki67 expression; squared line) over time in normal mouse colon organoids (circled line). (C) Schematic and histological results showing L1CAM expression in mouse colon after epithelial injury. (D) Larger magnification showing L1CAM expression in regenerating transit-amplifying colonocytes. (E) Consequences of L1CAM loss on body weight and survival in mice sustaining colonic epithelial injury. (F) Macroscopic and microscopic histology of the results in (E). [Fig. 29D-F]FIG. 29A-F. (A) L1CAM expression in human normal colon, dissociated crypts, and organoids at day 14 (upper panel, left to right), and mouse normal colon and organoids at day 14. Bar graphs show the respective fold change of expression in crypts (left-most bar of paired bars) versus organoids in three different human or mouse. (B) L1CAM expression (compared to 1-Ki67 expression; squared line) over time in normal mouse colon organoids (circled line). (C) Schematic and histological results showing L1CAM expression in mouse colon after epithelial injury. (D) Larger magnification showing L1CAM expression in regenerating transit-amplifying colonocytes. (E) Consequences of L1CAM loss on body weight and survival in mice sustaining colonic epithelial injury. (F) Macroscopic and microscopic histology of the results in (E).

[0038] [Fig. 30A-B] Figure 30A-F. (A) Relative L1CAM mRNA levels in intact organoids, dissociated organoids, or various cell suspensions. (B) Changes in L1CAM levels in organoids or suspension cultures upon addition of various inflammatory mediators (represented by bars from left to right, corresponding to the top to bottom of the list in the legend). (C) Effect of e-cadherin knockdown on expression of L1CAM, CDH1, CYR61, and ANKRD1. (D) Effect of REST knockdown on L1CAM expression. (E) CHIP-PCR results for binding of REST to the first intron of the L1CAM locus. (F) Immunohistochemical studies using antibodies directed against L1CAM, e-cadherin, and REST (p120-catenin) in primary CRC invasive fronts. [Figure 30C-D]Figure 30A-F. (A) Relative L1CAM mRNA levels in intact organoids, dissociated organoids, or various cell suspensions. (B) Changes in L1CAM levels in organoids or suspension cultures upon addition of various inflammatory mediators (represented by bars from left to right, corresponding to the top to bottom of the list in the legend). (C) Effect of e-cadherin knockdown on expression of L1CAM, CDH1, CYR61, and ANKRD1. (D) Effect of REST knockdown on L1CAM expression. (E) CHIP-PCR results for binding of REST to the first intron of the L1CAM locus. (F) Immunohistochemical studies using antibodies directed against L1CAM, e-cadherin, and REST (p120-catenin) in primary CRC invasive fronts. [Figure 30E] Figure 30A-F. (A) Relative L1CAM mRNA levels in intact organoids, dissociated organoids, or various cell suspensions. (B) Changes in L1CAM levels in organoids or suspension cultures upon addition of various inflammatory mediators (represented by bars from left to right, corresponding to the top to bottom of the list in the legend). (C) Effect of e-cadherin knockdown on expression of L1CAM, CDH1, CYR61, and ANKRD1. (D) Effect of REST knockdown on L1CAM expression. (E) CHIP-PCR results for binding of REST to the first intron of the L1CAM locus. (F) Immunohistochemical studies using antibodies directed against L1CAM, e-cadherin, and REST (p120-catenin) in primary CRC invasive fronts. [Figure 30F]Figure 30A-F. (A) Relative L1CAM mRNA levels in intact organoids, dissociated organoids, or various cell suspensions. (B) Changes in L1CAM levels in organoids or suspension cultures upon addition of various inflammatory mediators (represented by bars from left to right, corresponding to the top to bottom of the list in the legend). (C) Effect of e-cadherin knockdown on expression of L1CAM, CDH1, CYR61, and ANKRD1. (D) Effect of REST knockdown on L1CAM expression. (E) CHIP-PCR results for binding of REST to the first intron of the L1CAM locus. (F) Immunohistochemical studies using antibodies directed against L1CAM, e-cadherin, and REST (p120-catenin) in primary CRC invasive fronts. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0039] 5. Detailed Description of the Invention For clarity of explanation, and not by way of limitation, the detailed description of the invention is divided into the following subsections: (i) The method of treatment; (ii) an assay system; and (iii) Kits.

[0040] 5.1 Treatment Method In various non-limiting embodiments, the present invention provides a method for reducing the risk of metastatic spread of a primary cancer in a subject who has undergone or is undergoing treatment for the primary cancer, comprising administering a therapeutic amount of an L1CAM inhibitor to the subject. In certain non-limiting embodiments, the L1CAM inhibitor is administered after one or more cycles of chemotherapy, targeted therapy, and / or immunotherapy of the primary cancer are completed. In certain non-limiting embodiments, the L1CAM inhibitor is administered after a radiation therapy regimen of the primary cancer is completed. In certain non-limiting embodiments, the L1CAM inhibitor is administered after essentially complete (cancer-free peripheral) surgical resection of the primary cancer or metastatic cancer is completed. In certain non-limiting embodiments, the L1CAM inhibitor is administered in a maintenance regimen for a period of time after a cycle of treatment or surgical resection of the primary cancer (e.g., administered at regular intervals (e.g., at least once a week, at least once a month, at least once every two months, at least once every three months, at least once every six months)). The period for maintenance treatment can be at least about three months, or at least about six months, or at least about one year, or at least about two years. In certain non-limiting embodiments, the L1CAM inhibitor is administered after the subject has reached remission of the primary cancer. In certain non-limiting embodiments, the L1CAM inhibitor is administered in a maintenance regimen for a period of time after reaching remission of the primary cancer (e.g., administered at regular intervals (e.g., at least once a week, at least once a month, at least once every two months, at least once every three months, at least once every six months)). The duration for maintenance treatment can be at least about 3 months, or at least about 6 months, or at least about 1 year, or at least about 2 years.

[0041] In various non-limiting embodiments, the present invention provides a method for inhibiting metastatic spread of a primary cancer in a subject who has been treated for the primary cancer, comprising administering to the subject a therapeutic amount of an L1CAM inhibitor. In certain non-limiting embodiments, the L1CAM inhibitor is administered after one or more cycles of chemotherapy, targeted therapy, and / or immunotherapy of the primary cancer are completed. In certain non-limiting embodiments, the L1CAM inhibitor is administered after a radiation therapy regimen of the primary cancer is completed. In certain non-limiting embodiments, the L1CAM inhibitor is administered after essentially complete (cancer-free in the periphery) surgical resection of the primary cancer or metastatic cancer is completed. In certain non-limiting embodiments, the L1CAM inhibitor is administered in a maintenance regimen (e.g., at regular intervals (e.g., at least once a week, at least once a month, at least once every two months, at least once every three months, at least once every six months)) for a period after a cycle of treatment or surgical resection of the primary cancer. The period for maintenance treatment can be at least about 3 months, or at least about 6 months, or at least about 1 year, or at least about 2 years.In certain non-limiting embodiments, the L1CAM inhibitor is administered after the subject reaches remission of the primary cancer.In certain non-limiting embodiments, the L1CAM inhibitor is administered in a maintenance regimen for a period after the subject reaches remission of the primary cancer (e.g., administered at regular intervals (e.g., at least once a week, at least once a month, at least once every two months, at least once every three months, at least once every six months)).The period for maintenance treatment can be at least about 3 months, or at least about 6 months, or at least about 1 year, or at least about 2 years.

[0042] In various non-limiting embodiments, the present invention provides a method of inhibiting the progression of metastatic disease in a subject, comprising administering to the subject a therapeutic amount of an L1CAM inhibitor. In various non-limiting embodiments, the present invention provides a method of inhibiting the progression of metastatic disease in a subject who has been treated for a primary cancer, comprising administering to the subject a therapeutic amount of an L1CAM inhibitor. In certain non-limiting embodiments, the L1CAM inhibitor is administered after one or more cycles of chemotherapy, targeted therapy, and / or immunotherapy of the primary cancer are completed. In certain non-limiting embodiments, the L1CAM inhibitor is administered after a radiation therapy regimen of the primary cancer is completed. In certain non-limiting embodiments, the L1CAM inhibitor is administered after essentially complete (cancer-free peripheral) surgical resection of the primary cancer or metastatic cancer is completed. In certain non-limiting embodiments, the L1CAM inhibitor is administered in a maintenance regimen for a period of time after a cycle of treatment or surgical resection of the primary cancer (e.g., administered at regular intervals (e.g., at least once a week, at least once a month, at least once every two months, at least once every three months, at least once every six months)). The period for maintenance treatment can be at least about three months, or at least about six months, or at least about one year, or at least about two years. In certain non-limiting embodiments, the L1CAM inhibitor is administered after the subject has reached remission of the primary cancer. In certain non-limiting embodiments, the L1CAM inhibitor is administered in a maintenance regimen for a period of time after reaching remission of the primary cancer (e.g., administered at regular intervals (e.g., at least once a week, at least once a month, at least once every two months, at least once every three months, at least once every six months)). The duration for maintenance treatment can be at least about 3 months, or at least about 6 months, or at least about 1 year, or at least about 2 years.

[0043] In various non-limiting embodiments, the present invention provides a method of inhibiting progression of metastatic disease in a subject, comprising administering to the subject a therapeutic amount of an agent that reduces L1CAM expression in cancer cells, e.g., via CRISPR / Cas9-mediated gene editing.

[0044] A metastasis is a collection of cancer cells in a location that is not physically close to the original site of the cancer.

[0045] "Reducing the risk of metastatic spread" refers to a reduction relative to the risk of metastatic spread in a comparable control subject not treated with an L1CAM inhibitor.

[0046] "Inhibiting the metastatic spread of a primary cancer" means one or more of reducing the number, location, and / or size of metastases, and / or increasing the time to development of metastases, and / or prolonging survival, compared to comparable control subjects not treated with an L1CAM inhibitor.

[0047] "Inhibiting the progression of metastatic disease" means one or more of the following: reducing the size of existing metastases, reducing the growth rate of existing metastases, reducing the incidence of newly detectable metastases, improving quality of life and / or increasing the time to recurrence, and / or prolonging survival, compared to comparable control subjects not treated with an L1CAM inhibitor.

[0048] In certain non-limiting embodiments, the present invention provides a method of inhibiting metastatic spread of cancer in a subject having a primary cancer, comprising determining whether cells of the cancer express L1CAM, and, if the cells express L1CAM, administering a therapeutic amount of an L1CAM inhibitor to the subject in addition to treating the primary cancer.

[0049] In a non-limiting embodiment, a further indicator of increased risk is high / moderate surface expression of EphB2.

[0050] In various non-limiting embodiments, the subject is a human or a non-human animal, such as a dog, cat, horse, rodent, mouse, rat, hamster, non-human primate, rabbit, sheep, cow, whale, etc.

[0051] In various non-limiting embodiments, the cancer is breast cancer, lung cancer, renal cancer, colorectal cancer, ovarian cancer, prostate cancer, liver cancer, or melanoma.

[0052] The site of metastasis can be, for example, but not limited to, the brain, lung, bone, or liver.

[0053] In various non-limiting embodiments of the present invention, L1CAM inhibitors can be administered simultaneously with chemotherapy and / or targeted therapy and / or immunotherapy and / or radiotherapy regimens.However, in alternative non-limiting embodiments, L1CAM inhibitors can be administered after the completion of chemotherapy, targeted therapy, immunotherapy, and / or radiotherapy courses.In certain non-limiting examples, L1CAM inhibitors can be administered at the end of treatment regimens, or at least one month later, or at least three months later, or at least six months later, or at least one year later.In related non-limiting embodiments, L1CAM inhibitors can be administered after the completion of essentially complete (cancer-free peripheral) surgical resection of primary cancer or metastasis.

[0054] In various non-limiting embodiments, the L1CAM inhibitor may be administered in a maintenance regimen (e.g., at regular intervals (e.g., at least once a week, at least once a month, at least once every two months, at least once every three months, at least once every six months)) for a period of time after a course of chemotherapy or radiation therapy has been completed or after complete or partial remission of the primary cancer has been achieved. The maintenance regimen may be pursued regardless of whether active disease is determined to be present.

[0055] In various embodiments of the present invention, the decision to use L1CAM inhibition as a treatment can be supported by determining that the cancer and / or its metastasis to be treated expresses L1CAM, and optionally one or more of EphB2, CD133, and / or CD44. Expression of L1CAM can be determined by any method known in the art, for example, as discussed in the following section. In certain non-limiting embodiments, expression of L1CAM can be detected using an antibody specific for L1CAM, or amplification of L1CAM-encoding mRNA using polymerase chain reaction (PCR).

[0056] In various non-limiting embodiments, the present invention provides a method for improving chemoresistance of cancer cells to a chemotherapeutic agent, comprising administering to the cancer cells an effective amount of an L1CAM inhibitor. In non-limiting embodiments, the cancer cells are metastatic cancer. In non-limiting embodiments, the cancer is breast cancer, lung cancer, renal cancer, or colorectal cancer. In non-limiting embodiments, the chemotherapeutic agent is carboplatin or methotrexate. In certain non-limiting embodiments, the cancer is Kras mutant lung cancer and the chemotherapeutic agent is carboplatin or methotrexate. "Improvement of chemoresistance" means that administration of the L1CAM inhibitor increases the sensitivity of the cancer cells, cells, or tumors to the anti-cancer effect of the chemotherapeutic agent compared to control cancer cells not treated with the L1CAM inhibitor (e.g., the cancer cells are considered to be less responsive to the chemotherapeutic agent than would be expected). In certain non-limiting embodiments, the increase in sensitivity is at least about 30 percent.

[0057] L1CAM inhibitors are agents that reduce the ability of L1CAM to take up blood vessels and / or the ability of L1CAM to re-initiate or promote tumor growth or spread (e.g., the inhibitor reduces the invasiveness of tumor cells) and can be used to eliminate quiescent cells within tumors. L1CAM inhibitors can act, but are not limited to, by, for example, reducing the expression of L1CAM in cancer cells, or removing L1CAM from the surface of cancer cells, or binding to L1CAM, thereby reducing the amount of L1CAM available for cell binding, for example, by physical inhibition, reducing the ability of L1CAM to bind to endothelial cells or other cancer cells or normal tissues, or by labeling L1CAM-expressing cells and thus marking them for destruction by the immune system.

[0058] In a non-limiting embodiment, when the subject is a human, the L1CAM to be inhibited is human L1CAM having the amino acid sequence as set forth in UniProtKB Accession No. P32004 and / or NCBI Accession No. NM_000425 version NM_000425.4 and / or NM_001278116 version NM_001278116.1.

[0059] In a non-limiting embodiment, the L1CAM inhibitor can be an immunoglobulin that specifically binds to L1CAM, such as an antibody or antibody fragment or single-chain antibody, or a therapeutic molecule that comprises one or more immunoglobulin domains. Non-limiting examples of such antibodies are disclosed in U.S. Pat. No. 8,138,313, International Patent Application Publication No. WO 2007114550, and International Patent Application Publication No. WO 2008151819, as well as antibodies that compete for L1CAM binding with the antibodies described in these references. In certain non-limiting embodiments, the anti-L1CAM antibody or antibody fragment can be used to prepare a human, humanized, or otherwise chimeric antibody specific for L1CAM for use according to the present invention. In certain non-limiting embodiments, the L1CAM antibody, antibody fragment, or single chain antibody detects the binding of L1CAM to endothelial cells or capillaries, to L1CAM or other molecules on adjacent cancer or stromal cells, or to other components of the extracellular matrix under physiological conditions, e.g., in The inhibition may be in vitro or in vivo. In certain non-limiting embodiments, the L1CAM inhibitor comprises an immunoglobulin region that binds to L1CAM and CD133 (the immunoglobulin is bispecific). In certain non-limiting embodiments, the L1CAM inhibitor comprises an immunoglobulin region that binds to L1CAM and CD44. In certain non-limiting embodiments, the L1CAM inhibitor binds to L1CAM as well as a T cell antigen. In certain non-limiting embodiments, the L1CAM inhibitor binds to L1CAM as well as a NK cell antigen. In certain non-limiting embodiments, the L1CAM inhibitor binds to L1CAM and EphB2.

[0060] In a non-limiting embodiment, the L1CAM inhibitor can be a nucleic acid that contains a region of homology with L1CAM mRNA, such as a short hairpin, interfering, antisense, or ribozyme nucleic acid. For example, such a nucleic acid can be between about 15 and 50 nucleotides in length, or between about 15 and 30 nucleotides in length, or between about 20 and 30 nucleotides in length, and can hybridize with L1CAM mRNA under physiological conditions. A non-limiting example of a short hairpin (sh)RNA that inhibits L1CAM is shown in the examples below. In a non-limiting embodiment, the nucleic acid L1CAM inhibitor can be provided in an L1CAM-expressing cancer cell via a vector, such as a lentivirus, and the vector can be selectively delivered to the cancer cell and / or the expression of the L1CAM inhibitor nucleic acid therein can be driven by a promoter that is selectively active in tumor cells. Non-limiting examples of nucleic acid sequences for L1CAM mRNA include the sequences set forth in NCBI Accession Nos. NM_000425 version NM_000425.4 and / or NM_001278116 version NM_001278116.1. In one particular non-limiting embodiment, the L1CAM inhibitor is The hairpin sequence 5'-CCGGACGGGCAACAACAGCAACTTTCTCGAGAAAGTTGCTGTTGTTGCCCGTTTTTTG (SEQ ID NO:1) and the target sequence ACGGGCAACAACAGCAACTTT (SEQ ID NO:2); or The hairpin sequence 5'-CCGGCCACTTGTTTAAGGAGAGGATCTCGAGATCCTCTCCTTAAACAAGTGGTTTTTG (SEQ ID NO: 3) and the target sequence CCACTTGTTTAAGGAGAGGAT (SEQ ID NO: 4); or The hairpin sequence 5'-CCGGGCCAATGCCTACATCTACGTTCTCGAGAACGTAGATGTAGGCATTGGCTTTTTG (SEQ ID NO: 5) and the target sequence GCCAATGCCTACATCTACGTT (SEQ ID NO: 6) The RNAi sequence is TRCN0000063916 (The RNAi Consortium, Public TRC Portal).

[0061] In certain non-limiting embodiments, the L1CAM inhibitor can be an antibody directed against the mutant L1CAM protein that is expressed at high levels on the surface of MetCSCs.Non-limiting examples of mutant L1CAM proteins are shown in Vos, YJ and Hofstra, RM (2010) and Faltas et al., 2016, Nat. Genet. 48(12):1490-1499, both of which are incorporated herein by reference.Updated and upgraded L1CAM mutation database, Hum Mutat 31, E1102-1109.

[0062] In certain non-limiting embodiments, the L1CAM inhibitor can be an agent that can edit the L1CAM gene, for example, through CRISPR / Cas9-mediated knockdown of the L1CAM gene (see, for example, FIG. 21 and the examples below). Genome editing is a technique that can edit, for example, modify, the endogenous chromosomal sequence present in one or more cells in a subject using a targeting endonuclease and single-stranded nucleic acid. Genome editing methods can result in the insertion of a nucleic acid sequence in a specific region in a genome, the excision of a specific sequence from a genome, and / or the replacement of a specific genomic sequence with a new nucleic acid sequence. A non-limiting example of genome editing technology is the CRISPR / Cas9 system. Non-limiting examples of such genome editing technology are disclosed in PCT application numbers WO2014 / 093701 and WO2014 / 165825, the contents of which are incorporated herein by reference in their entirety. In certain embodiments, genome editing techniques may include the use of one or more guide RNAs (gRNAs) that are complementary to specific sequences in the genome, including protospacer adjacent motifs (PAMs), to guide a nuclease, e.g., an endonuclease, to a specific genomic sequence, e.g., a sequence required for expression of L1CAM (including, but not limited to, the coding region of the gene itself and / or its promoter); the complementary region may be at least about 10 nucleotides in length, or at least about 20 nucleotides in length, or at least about 30 nucleotides in length. Non-limiting examples of endonucleases include clustered, regularly interspaced short palindromic repeats (CRISPR) associated protein 9 (Cas9). In certain embodiments, the endonuclease produces a cleavage of the target genomic sequence, allowing modification of the genome at the cleavage site through non-homologous end joining (NHEJ) or homologous recombination.In certain embodiments, the genome editing techniques of the present disclosure may include the introduction of an expression vector comprising a nucleic acid sequence encoding a Cas protein or a variant thereof, such as Cas9D10A, into one or more cells of a subject. In certain embodiments, the vector may further comprise one or more gRNAs for targeting the Cas9 protein to a specific nucleic acid sequence in the genome. In certain embodiments, the nucleic acid sequence encoding the Cas protein may be operably linked to a control element, and when transcribed, the one or more gRNAs may direct the Cas protein to a target sequence in the genome and induce cleavage of the genome locus by the Cas protein. In certain embodiments, the Cas9 protein cleaves about 3-4 nucleotides upstream of a PAM sequence present adjacent to the target sequence. In certain embodiments, the control element operably linked to the nucleic acid sequence encoding the Cas protein may be a promoter, for example, an inducible promoter, such as a doxycycline-inducible promoter. The term "operably linked" as applied to DNA sequences, for example in an expression vector, indicates that the sequences are positioned such that they function cooperatively to achieve their intended purpose, i.e., the promoter sequence allows the initiation of transcription of the linked coding sequence to proceed to a termination signal. In certain embodiments, the Cas9 enzyme encoded by the vector of the present invention may contain one or more mutations. The mutations may be artificially introduced mutations or gain-of-function or loss-of-function mutations. Non-limiting examples of such mutations include mutations in the catalytic domains of the Cas9 protein, for example, the RuvC and HNH catalytic domains, such as the D10 mutation in the RuvC catalytic domain and H840 in the HNH catalytic domain. In certain embodiments, a mutation in one of the catalytic domains of the Cas9 protein results in the Cas9 protein functioning as a "nickase," in which the mutant Cas9 protein cuts only one strand of the target DNA, generating a single-strand break or "nick."In certain embodiments, the use of mutant Cas9 proteins, such as Cas9D10A, allows the use of two gRNAs that promote the cleavage of both strands of target DNA. Additional non-limiting examples of Cas9 mutations include VP64, KRAB, and SID4X. In certain embodiments, the genome editing technology of the present disclosure further comprises introducing an additional vector comprising nucleic acid into one or more cells. In certain embodiments, this vector further comprises one or more target sequences that are complementary (e.g., can hybridize) to the same sequence and / or adjacent sequence of the genome sequence targeted by gRNA, and can cause homologous recombination and allow the insertion of nucleic acid sequence (i.e., donor nucleic acid sequence) into genome.

[0063] 5.2 Assay system In various embodiments, the present invention relates to assay systems and components thereof for generating models of metastatic disease and using such models as assay systems for identifying therapeutic agents.

[0064] In various non-limiting embodiments, the present invention provides an assay for identifying an agent that inhibits metastasis, comprising an organoid culture comprising cancer cells that express L1CAM. The cells can express high levels of L1CAM and / or intermediate or high levels of EphB2. In certain non-limiting embodiments, the cancer cells are MetCSCs, and optionally express an exogenous marker, for example, a fluorescent exogenous marker. Certain non-limiting embodiments provide a method for identifying MetCSCs, comprising determining that the cells express L1CAM, for example, high levels of L1CAM surface expression. In certain non-limiting embodiments, MetCSCs further express intermediate or high levels of EphB2. The expression of L1CAM and optionally EphB2 can be determined by any method known in the art, including but not limited to antibody-based or PCR-based methods. In certain non-limiting embodiments, MetCSCs are isolated from the primary cancer of a subject. In certain non-limiting embodiments, the MetCSCs are isolated from a metastatic cancer of the subject. In certain non-limiting embodiments, the cancer, either primary or metastatic, is of breast, lung, renal, or colorectal origin.

[0065] In certain non-limiting embodiments, where the cancer, whether primary or metastatic, is colorectal in origin, MetCSCs may be further identified as cells that exhibit surface expression of one or more of CD133 and / or CD44, in addition to L1CAM and optionally EphB2.

[0066] Certain non-limiting embodiments provide isolated MetCSC cells that express L1CAM. In certain non-limiting embodiments, MetCSC expresses high levels of L1CAM. In certain non-limiting embodiments, isolated MetCSC includes an exogenous marker introduced. In certain non-limiting embodiments, the exogenous marker is a fluorescent marker. In a particular embodiment, the present invention provides a composition comprising cells that are essentially pure populations of MetCSC that express L1CAM. In non-limiting embodiments, MetCSC can be isolated using FACS or other cell isolation methods known in the art.

[0067] The MetCSCs can be used to prepare a model system of metastasis that can be used to study the metastatic process and can be used as an assay system to identify agents for inhibiting and thereby treating metastatic disease in a subject.

[0068] In certain non-limiting embodiments, the present invention provides a model system / assay system of metastasis, comprising organoid culture formed by cancer cells expressing L1CAM and optionally EPCAM.In certain non-limiting embodiments, cancer cells further express EphB2.In certain embodiments, cancer cells express high level L1CAM and medium / high level EphB2.

[0069] In certain non-limiting embodiments, the present invention provides a model system / assay system of metastasis comprising organoid culture formed with MetCSC cells expressing L1CAM and EPCAM. In certain non-limiting embodiments, MetCSC cells further express EphB2. In certain embodiments, MetCSC cells express high levels of L1CAM and medium / high levels of EphB2. For a description of organoid culture techniques, see, for example, Drost et al., 2016, Nature Protocols vol. 11:347-358. For example, culture medium for organoid culture may include Wnt. MetCSC cells as described above may be used as a substrate for organoid development. A non-limiting example of an in vitro assay system includes said MetCSCs under conditions that promote organoid formation. An agent effective in inhibiting metastasis from occurring and / or progressing may be identified as an agent that reduces the development or growth of organoids in said system.

[0070] In certain non-limiting embodiments, MetCSCs as described above, optionally cultured to form organoids, are introduced into an experimental animal, such as an athymic mouse, or other immunodeficient non-human host, and used to test whether an administered agent is effective in slowing metastatic growth, reducing the number, or inhibiting the growth or dispersal of said MetCSCs, thereby identifying it as having anti-metastatic therapeutic activity.

[0071] In a related non-limiting embodiment, the invention provides a method for identifying an agent that inhibits metastasis, comprising the steps of: (i) providing an organoid culture comprising cancer cells expressing L1CAM; (ii) contacting the organoid culture with a test substance; (iii) determining whether the level of L1CAM expression is decreased in the test substance-contacted cultures compared to control organoid cultures not contacted with the test substance; wherein a decrease in the level of L1CAM expression, interaction, and / or signaling in response to contact with the test agent is indicative of the test agent inhibiting metastasis.

[0072] 5.3 kit In certain non-limiting embodiments, the present invention provides a kit for determining whether a subject with cancer is at increased risk of metastatic spread of the cancer, the kit comprising means for determining whether cells of the cancer express L1CAM, and optionally instructions informing the subject that expression of L1CAM on cancer cells indicates that the subject may benefit from L1CAM inhibitor treatment.

[0073] In certain non-limiting embodiments, the present invention provides a kit for identifying an agent that inhibits metastasis, comprising (i) cancer cells expressing L1CAM, and (ii) a means for determining L1CAM expression level. In various non-limiting embodiments, the cancer cells express high levels of L1CAM, and may optionally further express one or more of CD133, CD44, and / or EphB2. In certain non-limiting embodiments, the means for detecting L1CAM expression is an oligonucleotide probe that detectably binds to L1CAM. In certain non-limiting embodiments, the means for detecting L1CAM expression is a pair of primers that can be used in polymerase chain reaction to determine L1CAM expression level. In certain non-limiting embodiments, the means for detecting L1CAM expression is an immunoglobulin that specifically binds to L1CAM.

[0074] Non-limiting examples of types of kits include, but are not limited to, arrays / microarrays, L1CAM-specific antibodies, and beads, which may contain one or more primers, probes, antibodies, or other detection reagents for detecting L1CAM and, optionally, other markers set forth above (EphB2, CD133, CD44).

[0075] In a non-limiting embodiment, the present invention provides a kit for determining whether a subject with cancer has an increased risk of having or developing metastasis of the cancer, comprising means for detecting protein levels of L1CAM, and optionally, EphB2, CD133, and / or CD44 (directly or via mRNA).

[0076] In certain non-limiting embodiments, surface expression of L1CAM, and optionally, EphB2, CD44, and / or CD133, is detected.

[0077] In a non-limiting embodiment, the kit may include at least one antibody for immunodetection of L1CAM, and optionally EphB2, CD44, and / or CD133. Both polyclonal and monoclonal antibodies, including molecules containing antibody variable regions or subregions thereof, specific for these proteins may be prepared using conventional immunodetection techniques, as is commonly known to those skilled in the art. The immunodetection reagent of the kit may include a detectable label associated with or linked to a given antibody or antigen itself. Such detectable labels include, for example, chemiluminescent or fluorescent molecules (rhodamine, fluorescein, green fluorescent protein, luciferase, Cy3, Cy5, or ROX), radiolabels (3H, 35S, 32P, 14C, 131I), or enzymes (alkaline phosphatase, horseradish peroxidase). Alternatively, the detectable moiety may be included in a secondary antibody or antibody fragment that selectively binds to the primary antibody or antibody fragment (if said primary antibody or antibody fragment specifically recognizes a serpin).

[0078] In a further non-limiting embodiment, the L1CAM-specific antibody (or optionally, the EphB2, CD44, and / or CD133-specific antibody) may be provided bound to a solid support, such as a column matrix, an array, or a well of a microtiter plate. Alternatively, the support may be provided as a separate component of the kit.

[0079] In certain embodiments, kit types include, but are not limited to, packaged probe and primer sets (e.g., TaqMan probe / primer sets), which may further contain one or more probes, primers, or other detection reagents for detecting one or more serpins, such as neuroserpin, serpin B2, serpin E1, serpin E2, or serpin D1.

[0080] In certain non-limiting embodiments, the kit may include a pair of oligonucleotide primers suitable for polymerase chain reaction (PCR) or nucleic acid sequencing to detect the protein to be identified. The pair of primers may include a nucleotide sequence complementary to the mRNA encoding L1CAM, or optionally EphB2, CD133, and / or CD44, and may be of sufficient length to selectively hybridize with said mRNA. Multiple marker protein-specific primers may be included in the kit to simultaneously assay multiple proteins (e.g., L1CAM, and optionally one or more of EphB2, CD44, and / or CD133). The kit may also include one or more polymerases, reverse transcriptases, and nucleotide bases, which may be optionally further detectably labeled.

[0081] In non-limiting embodiments, primers can be at least about 10 nucleotides in length, or at least about 15 nucleotides in length, or at least about 20 nucleotides in length, and / or up to about 200 nucleotides in length, or up to about 150 nucleotides in length, or up to about 100 nucleotides in length, or up to about 75 nucleotides in length, or up to about 50 nucleotides in length.

[0082] In a further non-limiting embodiment, the oligonucleotide primers can be immobilized on a solid surface or support, such as a nucleic acid microarray, and optionally the position of each oligonucleotide primer bound to the solid surface or support is known and identifiable.

[0083] In certain non-limiting embodiments, the kit can include at least one nucleic acid probe suitable for in situ hybridization or fluorescent in situ hybridization for detecting the protein to be identified.

[0084] In one specific non-limiting embodiment, the kit may comprise one or more of a probe, primer, microarray, antibody, or antibody fragment suitable for detecting L1CAM, and one or more of EphB2, CD44, and / or CD133.

[0085] In certain non-limiting embodiments, the kit may include one or more detection reagents and other components (e.g., buffers, enzymes such as alkaline phosphatase, antibodies, etc.) necessary to perform an assay or reaction to determine the expression level of a biomarker.

[0086] In certain non-limiting embodiments, the present invention provides a diagnostic method for determining whether a subject with cancer has an increased risk of metastatic spread of cancer, comprising a means for determining whether the cells of the cancer express L1CAM and EphB2, and if the cancer cells are found to express L1CAM and EphB2, particularly high L1CAM and moderate / high EphB2, the subject is at increased risk of developing metastatic disease compared to subjects with cancer lacking these markers and may benefit from L1CAM inhibitor treatment. The method may further include a step of communicating the results of the determination and its associated risk to the subject or a health care worker. The method may further include a step of recommending or performing additional diagnostic procedures, such as imaging, to determine whether the subject has detectable metastatic disease if an increased risk is indicated. Non-limiting examples of imaging include magnetic resonance imaging, computed tomography, and positron emission tomography. In a related embodiment, the invention provides a method of treatment comprising carrying out a diagnostic method and then administering a therapeutic amount of an L1CAM inhibitor if an increased risk is indicated. EXAMPLES

[0087] 6. Working Example: L1CAM inhibition inhibits / reduces metastasis and inhibits progression of established metastases Metastasis is a highly inefficient process in that primary tumor cells must first undergo epithelial-mesenchymal transition and escape from their primary tumor. After spreading in the bloodstream, the majority of tumor cells die, leaving only a small fraction capable of survival in hostile foreign organs. These remaining few tumor cells may remain dormant for months or years, and then, when conditions are right, begin to proliferate and reinitiate tumor growth. At the time this so-called macrometastatic growth is initiated, it is usually still possible to kill large amounts of tumor cells with chemotherapy, radiation therapy, targeted therapy, and / or immunotherapy, and may even be possible to the point of no measurable disease, but true cure is rarely possible.

[0088] This suggests that the tumor cells that form macrometastases, MetCSCs, are resistant to chemotherapy, radiotherapy, targeted therapy, and / or immunotherapy, since they must survive these treatments applied initially to treat the primary tumor and, later, its metastases. In addition, MetCSCs can undergo long-term self-renewal, have the capacity to generate heterogeneous progeny (recapitulating tumor heterogeneity), and have the ability to enter and exit a dormant state, where they can potentially exist for years (even decades, as seen in the case of ER / PR-positive breast cancer).

[0089] Because chemotherapy may not be a treatment option for controlling metastatic growth, it is important to mechanistically understand MetCSCs and identify therapeutic targets that specifically kill these cells. To date, model systems for studying metastasis have been incomplete.

[0090] L1CAM is a molecule associated with various cancers. Aberrant L1CAM expression has been demonstrated in the frontier of primary tumors and has been associated with invasion, metastasis, and poor prognosis in many human cancers, including lung, breast, and colon cancers (Voura et al., 2001; Ben et al., 2010; Tsutsumi et al., 2011; Schroder et al., 2009; Tischler et al., 2011; Boo et al., 2007; Chen et al., 2013; Fogel et al., 2003a; Doberstein et al., 2011; Fogel et al., 2003b; Kim et al., 2009; Maness et al., 2007). L1CAM expression is normally restricted to neurons, where it mediates axon guidance through interactions with surrounding components of the growth cone (Castellani et al., 2002; Wiencken-Barger et al., 2004). To further investigate this phenomenon, several immunohistological studies were performed. L1CAM was found to be expressed at the primary tumor invasive front (Figure 5A), where cells remain quiescent (low Ki67; Figure 5B). Remarkably, well-differentiated areas of the tumor with intact glandular morphology predominantly expressed L1CAM in quiescent cells with low Ki67, whereas in less differentiated areas with loss of epithelial integrity, L1CAM expression could be observed in cells with high Ki67 (Figures 5A, 5B). L1CAM was not expressed in adjacent normal colonic epithelial cells (Figure 6D). L1CAM expression is increased in tumors compared to normal tissues and in metastases compared to tumors (Figures 6A-C, Figures 7A-C). Finally, residual disease after chemotherapy is strongly LCAM1+ and its cells are quiescent (low Ki67, Figures 8A-B). All these characteristics are consistent with L1CAM being a marker (and functionally related molecule) of MetCSC. Experiments were performed to determine whether inhibition of L1CAM could affect metastasis. Either shL1CAM-transfected (to knock down L1CAM expression) or control cancer cells were introduced into athymic mice (by intracardiac injection to assess brain or bone metastasis, and by tail vein injection to assess lung metastasis), and the amount of metastasis was determined several weeks later using bioluminescence imaging. As shown in Figure 1A-D, the extent of metastatic disease was dramatically reduced in mice that received L1CAM-depleted cancer cells. L1CAM depletion (L1CAM inhibition) significantly reduced the progression of metastatic disease, including breast cancer metastasis to lung (Figure 1A), breast cancer metastasis to bone (Figure 1B), colon cancer metastasis to liver (Figure 1C), and renal cell carcinoma metastasis to brain (Figure 1D).

[0091] Experiments were also performed to determine whether L1CAM inhibition could be used to treat existing metastatic disease. In these experiments, expression of shL1CAM was placed under the control of an inducible promoter that could be activated by the drug doxycycline, so that knockdown of L1CAM could be turned on after tumor cells had spread. Athymic mice receiving either shL1CAMind-transfected or control cancer cells were treated with doxycycline on day 14 and then assessed for metastatic disease by bioluminescence imaging on day 28 (Figure 2). The results are shown in Figures 2 and 3A-C, which show that L1CAM knockdown inhibited the growth of established metastases, specifically lung cancer metastases to the brain (Figure 3A), breast cancer metastases to the bone (Figure 3B), and breast cancer metastases to the lungs (Figure 3C). Although L1CAM has been determined to play a role in vascular co-optation, established metastases outgrow the requirement for vascular co-optation, and it was intriguing to observe that L1CAM inhibition was also able to inhibit the progression of established metastases (Figure 4A-B).

[0092] 7. Example: Model systems for metastatic disease Experiments were carried out to develop a model for metastatic disease. In particular, patient-derived cells were used to generate organoids in culture using a modification of the technology developed by Hans Clevers, where organoids are grown in 3D in Matrigel and Wnt-enriched stem cell medium is used for culture (Figure 10). For example, metastatic tumors were harvested from patients and dissociated into single cells, after which the L1CAM+, EpCAM+ fraction of cells was collected by fluorescence-activated cell sorting (FACS) and used to establish organoid cultures (Figure 11). Notably, EphB2-neutral;L1CAM+ cells were found to constitute a novel subset of MetCSCs (Figure 12). When collected from subjects with colorectal cancer, L1CAM+ cells were found to be cytotoxic and cytotoxic (CSC)-resistant. 高 Fraction L1CAM 低These cells were found to show increased cell surface expression of the established colorectal cancer stem cell markers CD133, CD44, and EphB2 compared to the established cells (Figure 13). The results of FACS analysis for the markers L1CAM, EphB22, CD133, and CD44 are shown in Figures 14 and 15.

[0093] We further observed that tumor L1CAM expression correlated with organoid-initiating ability (Figures 16 and 17). Residual tumors expressing high levels of cell surface L1CAM could be cultured as organoids more often than tumors with low L1CAM levels (Figures 9A-C). FACS-sorted L1CAM-high cells from freshly resected residual CRC liver metastases had higher organoid-generating potential than L1CAM-low cells from the same tumors (Figure 9D).

[0094] Interestingly, L1CAM 高 Cells express L1CAM 高 Descendants and L1CAM 低 In addition, L1CAM+ cells with low Ki67 in vivo were found to be more capable of initiating organoids than L1CAM- cells (with high Ki67 in vivo) (Figure 19), suggesting that L1CAM+ cells in patient tumors can, under permissive conditions, re-enter the cell cycle and re-initiate tumor growth, and L1CAM + Cells and L1CAM - This suggests that these are slow-cycling reserve cells capable of repopulating heterogeneous tumors composed of both L1CAM+ and L1CAM+ cells. This is demonstrated in Figure 22, which shows that nascent small organoids are composed broadly of L1CAM+ cells, but as the organoids grow, the cells divide and give rise to mostly L1CAM- differentiated progeny that make up the majority of the organoid.

[0095] When L1CAM expression was compared between dissociated tumors and organoids generated from dissociated tumors, L1CAM expression was found to be a selected trait during organoid generation. Results from dissociated tumors collected from two different patients are shown in Figure 20A and 20B. When L1CAM was deleted using CRISPR-Cas-9, fewer organoids were generated (Figure 21), suggesting that L1CAM is required for the survival and / or regrowth of MetCSCs that initiate organoids. Notably, dissociation of intact organoids into single cells significantly upregulated L1CAM expression (Figure 27).

[0096] Organoids derived from patient metastases were grown in vitro and were then analyzed for L1CAM expression. 高 Clusters and L1CAM 低 The cells were FACS sorted into a population and transplanted as subcutaneous xenografts into NSG mice, thereby expressing L1CAM 高 The cells exhibited higher in vivo tumor re-initiation ability (Figure 25A). The subcutaneous tumors exhibited well-differentiated glandular epithelial morphology and intestinal mucin secretion (Figure 25B). FACS sorting of cells from the subcutaneous tumors based on cell surface L1CAM expression revealed that L1CAM 高 The cells were found to retain their organoid re-initiation capacity (Figure 25C).

[0097] Next, we injected stage III CRC-derived organoids into the splenic vein of immunodeficient NSG mice. The liver metastases thus generated were then passaged as organoids and injected again into the splenic vein. Such serially passaged liver metastatic organoids not only formed larger liver metastases more rapidly than their parental organoids, but also expressed higher levels of L1CAM (Figure 26A-D). In summary, L1CAM in treatment-resistant residual metastatic patient tumors 高 The cells are organoids and metastasis re-initiation stem cells (MetSCs).

[0098] 8. Example: Inhibition of L1CAM reverses chemoresistance Kras mutant lung cancer cells resistant to carboplatin and methotrexate were transfected with shCONTROL or shL1CAM operably linked to a doxycycline-inducible promoter. Then, cells containing shCONTROL or shL1CAM were intracardially injected into athymic mice (day 0). Treatment with doxycycline and v=carboplatin or methotrexate was started on day 14, and tumors were evaluated on day 35. As shown in Figure 24, cancer cells expressing L1CAM inhibitors were more sensitive to carboplatin or methotrexate than control cells. This indicates that L1CAM inhibition can make chemoresistant cells more sensitive to chemotherapy.

[0099] 9. Example: L1CAM is required for anoikis avoidance and organoid regeneration To investigate whether L1CAM is functionally required for organoid growth or regeneration, we performed CRISPR-Cas9-mediated knockout of L1CAM in metastasis-derived organoids (see FIG. 21). L1CAM knockout significantly inhibited the ability of organoid-derived single cells to regenerate new organoids (FIG. 28A-D). Similarly, doxycycline-induced knockdown of L1CAM inhibited organoid regeneration (FIG. 28E-G). Notably, withdrawal of doxycycline after 14 days of culture did not allow organoid regrowth, suggesting that L1CAM-deficient metastatic CRC precursors require L1CAM not only to drive organoid regrowth but also to survive when detached from the epithelial structure (FIG. 28H-I). Consistent with this, L1CAM-deficient cells exhibited increased caspase activity in the first week after dissociation (FIG. 28J). Thus, L1CAM-deficient cells demonstrate detachment-induced caspase-mediated cell death, also known as anoikis. L1CAM knockdown did not alter expression of genes associated with pluripotency, ISC, wnt response, or differentiation. In vivo, L1CAM knockdown abrogated subcutaneous tumor growth in NSG mice (Figure 28K-L). In summary, L1CAM does not drive the phenotypic progenitor identity of MetSCs but is required for their survival and regrowth upon epithelial detachment, a critical prerequisite for successful tumor propagation and metastasis.

[0100] YAP activity is induced by loss of epithelial interaction and contact with the rigid basement membrane in multiple contexts (Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, Xie J, Ikenoue T, Yu J, Li L, Zheng P, Ye K, Chinnaiyan A, Halder G, Lai ZC, Guan KL. . Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes Dev. 20 November 1, 2007; Volume 21 (No. 21): Pages 2747-61. Aragona M, Panciera T, Manfrin A, Giulitti S, Michielin F, Elvassore N, Dupont S, Piccolo S. A mechanical checkpoint controls multicellular growth through YAP / TAZ regulation by actin-processing factors. Cell. August 29, 2013; Volume 154 (5 Issue): pages 1047-59. Benham-Pyle BW, Pruitt BL, Nelson WJ. Cell adhesion. Mechanical strain induces E-cadherin-dependent Yap1 and β-catenin activation to drive cell cycle entry. Science 2015 May 29;348(6238):1024-7. Gjorevski N, Sachs N, Manfrin A, Giger S, Bragina ME, Ordonez-Moran P, Clevers H, Lutolf MP. Designer matrices for intestinal stem cell and organoid culture. Nature 2016 Nov 24;539(7630):560-564. Indeed, dissociation of organoids into single cells significantly induced the expression of YAP target genes ANKRD1, CYR61, and ITGB1 (Figure 28M).

[0101] 10. Example: L1CAM expression by progenitor cells is required for epithelial regeneration after injury Since L1CAM is required for survival, regrowth, and restoration of tissue architecture by transformed epithelial cells, we were interested in whether it is also required in non-transformed epithelium when epithelial integrity is destroyed. As seen in humans, normal mouse colonic epithelium did not express significant amounts of L1CAM (Figure 29A). However, when grown as organoids, non-transformed colonic epithelial cells induced L1CAM expression (Figure 29A). As seen with cancer organoids, normal mouse colonic organoids dramatically upregulated L1CAM immediately after organoid dissociation, and total organoid L1CAM decreased over time as organoids grew larger (Figure 29B). To test whether L1CAM is induced during epithelial injury in vivo, we treated C57BL6 with dextran sodium sulfate (DSS) water for 7 days. L1CAM was not expressed in water-fed control mice, but was expressed in regenerating colonic crypts in areas that exhibited DSS injury from days 11 to 16 (Fig. 29C). L1CAM was not expressed in the crypt basal compartment with rapidly proliferating stem cells, nor in fully differentiated luminal cells, but instead in regenerating transit-amplifying colonocytes (Fig. 29D).

[0102] To investigate the functional significance of L1CAM in colon regeneration, we investigated the function of L1CAM in colonic regeneration. fl / fl Mice were crossed with intestinal stem cell-specific Lgr5-GFP-IRES-Cre-ERT2 mice. Cre recombinase expression was induced by treating mice with three doses of IP tamoxifen concomitantly with DSS or water treatment. When given water, tamoxifen-treated mice did not exhibit changes in body weight (Figure 29E), behavior, or toilet habits. When treated with DSS, tamoxifen-treated Lgr5-GFP-IRES-Cre-ERT2 / L1CAM mice showed no changes in body weight (Figure 29E), behavior, or toilet habits. fl / yshowed persistent weight loss and decreased survival compared to controls. Necropsy revealed a significantly shortened colon and histopathology showed diffuse inflammation with areas of mucosal denudation (FIG. 29F).

[0103] 11. Example: Epithelial disruption induces L1CAM by displacing REST from the L1CAM promoter Next, we sought to understand how epithelial progenitor cells induce and regulate L1CAM expression. To determine whether colitis-associated inflammatory cytokines contribute to L1CAM induction, we incubated human CRC organoids with conditioned medium from normal or inflamed colon. Neither colitis-conditioned medium nor incubation with recombinant cytokines associated with colitis or neuronal regeneration (to which L1CAM has previously been implicated) induced L1CAM (Figure 30A-B). In contrast, dissociation of organoids into single cells was necessary and sufficient for L1CAM upregulation (Figure 30A-B). Structural integrity in intact epithelium is ensured by e-cadherin homophilic cell-cell contacts at adherens junctions. Therefore, we hypothesized that loss of e-cadherin from the cell membrane in disrupted epithelium may induce L1CAM expression. Consistent with this hypothesis, shRNA-mediated knockdown of e-cadherin in CRC organoids induced L1CAM and YAP target gene expression (Figure 30C).

[0104] In various non-neuronal tissues, the transcriptional repressor NSRF / REST normally blocks the expression of L1CAM and other neuronal genes. REST has been identified as a tumor suppressor, and metastatic colorectal cancer frequently acquires loss-of-function mutations or deletions in the REST gene. Therefore, we investigated whether REST functions in suppressing L1CAM expression in organoids. REST knockdown in human CRC organoids strongly induced L1CAM expression, suggesting that REST is active in suppressing L1CAM expression (Figure 30D). REST specifically pulled down by CHIP-PCR bound to an intronic enhancer in the first intron of the L1CAM locus in CRC organoids (Figure 30E). To verify whether epithelial destruction is associated with L1CAM expression in patient tumors, we stained serial sections of primary CRC invasive fronts with antibodies against e-cadherin and REST. We identified a strong correlation between loss of membranous e-cadherin and L1CAM expression in patient tumors (Figure 30F). These results indicate that L1CAM is required for the survival of cells deprived of epithelial integrity and is downregulated in intact epithelium.

[0105] 12. References Allgayer, H., Heiss, MM, and Schildberg, FW (1997). Prognostic factors in gastric cancer. Br J Surg 84, 1651-1664. Altevogt P, Doberstein K, Fogel M. L1CAM in human cancer. Int J Cancer. June 25, 2015. Ashkenazi, A., and Dixit, VM (1998). Death receptors: signaling and modulation. Science 281, 1305-1308. Bao et al. (2008) Cancer Res. 68(15):6043-6048. Ben QW, Wang JC, Liu J, Zhu Y, Yuan F, Yao WY, Yuan YZ. Positive expression of L1-CAM is associated with perineural invasion and poor outcome in pancreatic ductal adenocarcinoma. Ann Surg Oncol. 2010 Aug;17(8):2213-21. Ben QW, Wang JC, Liu J, Zhu Y, Yuan F, Yao WY, Yuan YZ. (2010) Positive expression of L1-CAM is associated with perineural invasion and poor outcome in pancreatic ductal adenocarcinoma. Ann Surg Oncol. 17(8):2213-21. Blouw, B., Song, H., Tihan, T., Bosze, J., Ferrara, N., Gerber, H.P., Johnson, R.S., and Bergers, G. (2003). The hypoxic response of tumors is dependent on their microenvironment. Cancer Cell 4, 133-146. Boo, Y.J., Park, J.M., Kim, J., Chae, Y.S., Min, B.W., Um, J.W., and Moon, H.Y. (2007). L1 expression as a marker for poor prognosis, tumor progression, and short survival in patients with colorectal cancer. Ann Surg Oncol 14, 1703-1711. Bos, P.D., Zhang, X.H., Nadal, C., Shu, W., Gomis, R.R., Nguyen, D.X., Minn, A.J., van de Vijver, M.J., Gerald, W.L., Foekens, J.A., et al. (2009). Genes that mediate breast cancer metastasis to the brain. Nature 459, 1005-1009. Carbonell, W.S., Ansorge, O., Sibson, N., and Muschel, R. (2009). The vascular basement membrane as "soil" in brain metastasis. PloS one 4, e5857. Castellani, V., De Angelis, E., Kenwrick, S., and Rougon, G. (2002). Cis and trans interactions of L1 with neuropilin-1 control axonal responses to semaphorin 3A. EMBO J 21, 6348-6357. Chambers, A.F., Groom, A.C., and MacDonald, I.C. (2002). Dissemination and growth of cancer cells in metastatic sites. Nat Rev Cancer 2, 563-572. Chambers, A.M., I; Schmidt, E; Morris, V; Groom, A (2000). Clinical targets for antimetastasis therapy. Adv Cancer Res 79, 91-121. Chen DL, Zeng ZL, Yang J, Ren C, Wang DS, Wu WJ, Xu RH. (2013) L1CAM promotes tumor progression and metastasis and is an independent unfavorable prognostic factor in gastric cancer. J Hematol Oncol.6:43. Cho S, Park I, Kim H, Jeong MS, Lim M, Lee ES, Kim JH, Kim S, Hong HJ. (2016) Generation, characterization and preclinical studies of a human anti-L1CAM monoclonal antibody that cross-reacts with rodent L1CAM. MAbs. 8(2):414-25. Demyanenko, G.P., Tsai, A.Y., and Maness, P.F. (1999). Abnormalities in neuronal process extension, hippocampal development, and the ventricular system of L1 knockout mice. J Neurosci 19, 4907-4920. Dietrich, P.Y., Walker, P.R., and Saas, P. (2003). Death receptors on reactive astrocytes: a key role in the fine tuning of brain inflammation? Neurology 60, 548-554. Dippel V, Milde-Langosch K, Wicklein D, Schumacher U, Altevogt P, Oliveira-Ferrer L, Jaenicke F, Schroeder C. (2013). Influence of L1-CAM expression of breast cancer cells on adhesion to endothelial cells. J Cancer Res Clin Oncol. 2013 Jan;139(1):107-21. doi: 10.1007 / s00432-012-1306-z. Epub September 16, 2012. Doberstein, K., Wieland, A., Lee, S.B., Blaheta, R.A., Wedel, S., Moch, H., Schraml, P., Pfeilschifter, J., Kristiansen, G., and Gutwein, P. (2011). L1-CAM expression in ccRCC correlates with shorter patients survival times and confers chemoresistance in renal cell carcinoma cells. Carcinogenesis 32, 262-270. Doberstein K, Harter PN, Haberkorn U, Bretz NP, Arnold B, Carretero R, Moldenhauer G, Mittelbronn M, Altevogt P. (2015) Antibody therapy to human L1CAM in a transgenic mouse model blocks local tumor growth but induces EMT. Int J Cancer. 136(5):e326-39. Donier, E., Gomez-Sanchez, J.A., Grijota-Martinez, C., Lakoma, J., Baars, S., Garcia- Alonso, L., and Cabedo, H. (2012). L1CAM binds ErbB receptors through Ig-like domains coupling cell adhesion and neuregulin signalling. PloS one 7, e40674. Drost et al., 2016, Organoid culture systems for prostate epithelial and cancer tissue, Nature Protocols 11:347-358. Feld, R., Rubinstein, L.V., and Weisenberger, T.H. (1984). Sites of recurrence in resected stage I non-small-cell lung cancer: a guide for future studies. J Clin Oncol 2, 1352-1358. Felding-Habermann, B., Silletti, S., Mei, F., Siu, C.H., Yip, P.M., Brooks, P.C., Cheresh, D.A., O'Toole, T.E., Ginsberg, M.H., and Montgomery, A.M. (1997). A single immunoglobulin-like domain of the human neural cell adhesion molecule L1 supports adhesion by multiple vascular and platelet integrins. J Cell Biol 139, 1567-1581. Fidler, I.J. (2003). The pathogenesis of cancer metastasis: the 'seed and soil' hypothesis revisited. Nat Rev Cancer 3, 453-458. Foekens, J.A., Look, M.P., Peters, H.A., van Putten, W.L., Portengen, H., and Klijn, J.G. (1995). Urokinase-type plasminogen activator and its inhibitor PAI-1: predictors of poor response to tamoxifen therapy in recurrent breast cancer. J Natl Cancer Inst 87, 751- 756. Fogel, M., Gutwein, P., Mechtersheimer, S., Riedle, S., Stoeck, A., Smirnov, A., Edler, L., Ben-Arie, A., Huszar, M., and Altevogt, P. (2003a). L1 expression as a predictor of progression and survival in patients with uterine and ovarian carcinomas. Lancet 362, 869-875. Fogel M, Mechtersheimer S, Huszar M, Smirnov A, Abu-Dahi A, Tilgen W, Reichrath J, Georg T, Altevogt P, Gutwein P. (2003) L1 adhesion molecule (CD 171) in development and progression of human malignant melanoma. Cancer Lett. 189(2):237-47. Francia, G., Cruz-Munoz, W., Man, S., Xu, P., and Kerbel, R.S. (2011). Mouse models of advanced spontaneous metastasis for experimental therapeutics. Nat Rev Cancer 11, 135-141. Ganesh, B.S., and Chintala, S.K. (2011). Inhibition of reactive gliosis attenuates excitotoxicity-mediated death of retinal ganglion cells. PloS one 6, e18305. Gavrilovic, I.T., and Posner, J.B. (2005). Brain metastases: epidemiology and pathophysiology. J Neurooncol 75, 5-14. Gupta, G.P., and Massague, J. (2006). Cancer metastasis: building a framework. Cell 127, 679-695. Hai, J., Zhu, C.Q., Bandarchi, B., Wang, Y.H., Navab, R., Shepherd, F.A., Jurisica, I., and Tsao, M.S. (2012). L1 cell adhesion molecule promotes tumorigenicity and metastatic potential in non-small cell lung cancer. Clin Cancer Res 18, 1914-1924. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. (2011) Cell. 144(5):646-74. Harbeck, N., Thomssen, C., Berger, U., Ulm, K., Kates, R.E., Hofler, H., Janicke, F., Graeff, H., and Schmitt, M. (1999). Invasion marker PAI-1 remains a strong prognostic factor after long-term follow-up both for primary breast cancer and following first relapse. Breast Cancer Res Treat 54, 147-157. Herron, L.R., Hill, M., Davey, F., and Gunn-Moore, F.J. (2009). The intracellular interactions of the L1 family of cell adhesion molecules. Biochem J 419, 519-531. Heyn, C., Ronald, J.A., Ramadan, S.S., Snir, J.A., Barry, A.M., MacKenzie, L.T., Mikulis, D.J., Palmieri, D., Bronder, J.L., Steeg, P.S., et al. (2006). In vivo MRI of cancer cell fate at the single-cell level in a mouse model of breast cancer metastasis to the brain. Magn Reson Med 56, 1001-1010. Hoffman, E / . Minthz, C. D., Wang, S., McNickie, D,m Salton, S., Benson, D. (2008) Effects of alcohol on axon outgrowth and branching in developing rat cortical neurons. Neurosci. 157(3), 556-565. Hong H, Stastny M, Brown C, Chang WC, Ostberg JR, Forman SJ, Jensen MC. (2014) Diverse solid tumors expressing a restricted epitope of L1-CAM can be targeted by chimeric antigen receptor redirected T lymphocytes. J Immunother. 37(2):93-104. Kang, Y., Siegel, P.M., Shu, W., Drobnjak, M., Kakonen, S.M., Cordon-Cardo, C., Guise, T.A., and Massague, J. (2003). A multigenic program mediating breast cancer metastasis to bone. Cancer Cell 3, 537-549. Karrison, T.G., Ferguson, D.J., and Meier, P. (1999). Dormancy of mammary carcinoma after mastectomy. J Natl Cancer Inst 91, 80-85. Kienast, Y., von Baumgarten, L., Fuhrmann, M., Klinkert, W.E., Goldbrunner, R., Herms, J., and Winkler, F. (2010). Real-time imaging reveals the single steps of brain metastasis formation. Nat Med 16, 116-122. Kim HS, Yi SY, Jun HJ, Ahn JS, Ahn MJ, Lee J, Kim Y, Cui ZY, Hong HJ, Kim JM, Li S, Hwang IG, Park K. (2009) L1 cell adhesion molecule as a predictor for recurrence in pulmonary carcinoids and large-cell neuroendocrine tumors. APMIS. 117(2):140-6. Kim, S.J., Kim, J.S., Park, E.S., Lee, J.S., Lin, Q., Langley, R.R., Maya, M., He, J., Kim, S.W., Weihua, Z., et al. (2011). Astrocytes upregulate survival genes in tumor cells and induce protection from chemotherapy. Neoplasia 13, 286-298. Krammer, P.H. (2000). CD95's deadly mission in the immune system. Nature 407, 789- 795. Kulahin, N., Li, S., Hinsby, A., Kiselyov, V., Berezin, V., and Bock, E. (2008). Fibronectin type III (FN3) modules of the neuronal cell adhesion molecule L1 interact directly with the fibroblast growth factor (FGF) receptor. Mol Cell Neurosci 37, 528-536. Law, R.H., Zhang, Q., McGowan, S., Buckle, A.M., Silverman, G.A., Wong, W., Rosado, C.J., Langendorf, C.G., Pike, R.N., Bird, P.I., et al. (2006). An overview of the serpin superfamily. Genome Biol 7, 216. Lee ES, Jeong MS, Singh R, Jung J, Yoon H, Min JK, Kim KH, Hong HJ. A chimeric antibody to L1 cell adhesion molecule shows therapeutic effect in an intrahepatic cholangiocarcinoma model. Exp Mol Med. 2012 Apr 30;44(4):293-302. Leenders, W.P., Kusters, B., and de Waal, R.M. (2002). Vessel co-option: how tumors obtain blood supply in the absence of sprouting angiogenesis. Endothelium 9, 83-87. Leenders, W.P., Kusters, B., Verrijp, K., Maass, C., Wesseling, P., Heerschap, A., Ruiter, D., Ryan, A., and de Waal, R. (2004). Antiangiogenic therapy of cerebral melanoma metastases results in sustained tumor progression via vessel co-option. Clin Cancer Res 10, 6222-6230. Leyland-Jones, B. (2009). Human epidermal growth factor receptor 2-positive breast cancer and central nervous system metastases. J Clin Oncol 27, 5278-5286. Li, B., Wang, C., Zhang, Y., Zhao, X.Y., Huang, B., Wu, P.F., Li, Q., Li, H., Liu, Y.S., Cao, L.Y., et al. (2013). Elevated PLGF contributes to small-cell lung cancer brain metastasis. Oncogene 32, 2952-2962. Lin, N.U., and Winer, E.P. (2007). Brain metastases: the HER2 paradigm. Clin Cancer Res 13, 1648-1655. Lin, Q.B., K.; Fan, D.; Kim, S-J.; Guo, L.; Wang, H.; Bar-Eli, M.; Aldape, K. D.; Fidler, I. J. (2010). Reactive astrocytes protect melanoma cells from chemotherapy by sequestering intracellular calcium through gap junction communication channels. Neoplasia 12, 748-754. Lindenblatt D, Fischer E, Cohrs S, Schibli R, Gruenberg J. Paclitaxel improved anti-L1CAM lutetium-177 radioimmunotherapy in an ovarian cancer xenograft model. EJNMMI Res. December 2014;4(1):54. Lorger, M., and Felding-Habermann, B. (2010). Capturing changes in the brain microenvironment during initial steps of breast cancer brain metastasis. Am J Pathol 176, 2958-2971. Luo JL, Tan W, Ricono JM, Korchynskyi O, Zhang M, Gonias SL, Cheresh DA, Karin M. (2007). "Nuclear cytokine-activated IKKalpha controls prostate cancer metastasis by repressing Maspin". Nature. 446 (7136): 690-4. doi:10.1038 / nature05656. PMID 17377533. Lutterbach, J., Bartelt, S., and Ostertag, C. (2002). Long-term survival in patients with brain metastases. J Cancer Res Clin Oncol 128, 417-425. Maher, E.A., Mietz, J., Arteaga, C.L., DePinho, R.A., and Mohla, S. (2009). Brain metastasis: opportunities in basic and translational research. Cancer Res 69, 6015-6020. Malladi S, Macalinao DG, Jin X, He L, Basnet H, Zou Y, de Stanchina E, Massague J. Metastatic latency and immune evasion through autocrine inhibition of WNT. Cell. March 24, 2016;165(1):45-60. Maness, P.F., and Schachner, M. (2007). Neural recognition molecules of the immunoglobulin superfamily: signaling transducers of axon guidance and neuronal migration. Nat Neurosci 10, 19-26. Mechtersheimer, S., Gutwein, P., Agmon-Levin, N., Stoeck, A., Oleszewski, M., Riedle, S., Postina, R., Fahrenholz, F., Fogel, M., Lemmon, V., et al. (2001). Ectodomain shedding of L1 adhesion molecule promotes cell migration by autocrine binding to integrins. J Cell Biol 155, 661-673. Meuwissen, R., Linn, S.C., Linnoila, R.I., Zevenhoven, J., Mooi, W.J., and Berns, A. (2003). Induction of small cell lung cancer by somatic inactivation of both Trp53 and Rb1 in a conditional mouse model. Cancer Cell 4, 181-189. Minn, A.J., Gupta, G.P., Siegel, P.M., Bos, P.D., Shu, W., Giri, D.D., Viale, A., Olshen, A.B., Gerald, W.L., and Massague, J. (2005). Genes that mediate breast cancer metastasis to lung. Nature 436, 518-524. Mire E., Thomasett, N., Jakeman, L., Rougon, G, (2008) Modulating Sema3A signal with a L1 mimetic peptide is not sufficient to promote motor recovery and axon regeneration after spinal cord injury. Mol. Cell. Neurosci. 37(2), 222-235. Moody, S.E., Sarkisian, C.J., Hahn, K.T., Gunther, E.J., Pickup, S., Dugan, K.D., Innocent, N., Cardiff, R.D., Schnall, M.D., and Chodosh, L.A. (2002). Conditional activation of Neu in the mammary epithelium of transgenic mice results in reversible pulmonary metastasis. Cancer Cell 2, 451-461. Nguyen, D.X., Bos, P.D., and Massague, J. (2009a). Metastasis: from dissemination to organ-specific colonization. Nat Rev Cancer 9, 274-284. Nguyen, D.X., Chiang, A.C., Zhang, X.H., Kim, J.Y., Kris, M.G., Ladanyi, M., Gerald, W.L., and Massague, J. (2009b). WNT / TCF signaling through LEF1 and HOXB9 mediates lung adenocarcinoma metastasis. Cell 138, 51-62. Oskarsson T, Batlle E, Massague J. Metastatic stem cells: sources, niches, and vital pathways. Cell Stem Cell. March 6, 2014; 14(3):306-21. Palmieri, D., Bronder, J.L., Herring, J.M., Yoneda, T., Weil, R.J., Stark, A.M., Kurek, R., Vega-Valle, E., Feigenbaum, L., Halverson, D., et al. (2007). Her-2 overexpression increases the metastatic outgrowth of breast cancer cells in the brain. Cancer Res 67, 4190-4198. Park JR, Digiusto DL, Slovak M, Wright C, Naranjo A, Wagner J, Meechoovet HB, Bautista C, Chang WC, Ostberg JR, Jensen MC. Adoptive transfer of chimeric antigen receptor re-directed cytolytic T lymphocyte clones in patients with neuroblastoma. MolTher. April 2007;15(4):825-33. 2014 as of 9 / 18 / 2014 PCT / US2014 / 056379 Perera , M , Ribot , EJ , Percy , DB , McFadden , C , Simedrea , C , Palmieri , D . Chambers , AF , and Foster , PJ (2012). In vivo magnetic resonance imaging for investigating the development and distribution of experimental brain metastases due to breast cancer. Transl Oncol 5, 217–225. Polleux , F. , & Ghosh , A. (2002). The slice overlay assay: a versatile tool to study the influence of extracellular signals on neuronal development. Sci STKE 136, 19–29. Qian , Y. , Hua , E. , Bisht , K. , Woditschka , S. , Skordos , KW , Liewehr , DJ , Steinberg , SM , Brogi , E. , Akram , MM , Killian , JK , et al. (2011). Inhibition of Polo-like kinase 1 prevents the growth of metastatic breast cancer cells in the brain. Clin Exp Metastasis 28, 899–908. Rathjen FG, Schachner M. Immunocytological and biochemical characterization of a new neuronal cell surface component (L1 antigen) which is involved in cell adhesion. EMBO J. 1984 Jan;3(1):1-10. Regales, L., Gong, Y., Shen, R., de Stanchina, E., Vivanco, I., Goel, A., Koutcher, J.A., Spassova, M., Ouerfelli, O., Mellinghoff, I.K., et al. (2009). Dual targeting of EGFR can overcome a major drug resistance mutation in mouse models of EGFR mutant lung cancer. J Clin Invest 119, 3000-3010. Schafer, M.K., and Altevogt, P. (2010). L1CAM malfunction in the nervous system and human carcinomas. Cell Mol Life Sci 67, 2425-2437. Schaefer H, Dieckmann C, Korniienko O, Moldenhauer G, Kiefel H, Salnikov A, Krueger A, Altevogt P, Sebens S. Combined treatment of L1CAM antibodies and cytostatic drugs improve the therapeutic response of pancreatic and ovarian carcinoma. Cancer Lett. 2012 Jun 1;319(1):66-82. Schildge, S., Bohrer, C., Beck, K., and Schachtrup, C. (2013). Isolation and culture of mouse cortical astrocytes. Journal of visualized experiments : JoVE. Schmidt-Kittler, O., Ragg, T., Daskalakis, A., Granzow, M., Ahr, A., Blankenstein, T.J., Kaufmann, M., Diebold, J., Arnholdt, H., Muller, P., et al. (2003). From latent disseminated cells to overt metastasis: genetic analysis of systemic breast cancer progression. Proc Natl Acad Sci U S A 100, 7737-7742. Schouten, L.J., Rutten, J., Huveneers, H.A., and Twijnstra, A. (2002). Incidence of brain metastases in a cohort of patients with carcinoma of the breast, colon, kidney, and lung and melanoma. Cancer 94, 2698-2705. Schmohl and Vallera, 2016, Toxins 8(6):165. Schreiber, R.D., Old, L.J., and Smyth, M.J. (2011). Cancer immunoediting: integrating immunity's roles in cancer suppression and promotion. Science 331, 1565-1570. Schroder, C., Schumacher, U., Fogel, M., Feuerhake, F., Muller, V., Wirtz, R.M., Altevogt, P., Krenkel, S., Janicke, F., and Milde-Langosch, K. (2009). Expression and prognostic value of L1-CAM in breast cancer. Oncol Rep 22, 1109-1117. Seike, T., Fujita, K., Yamakawa, Y., Kido, M.A., Takiguchi, S., Teramoto, N., Iguchi, H., and Noda, M. (2011). Interaction between lung cancer cells and astrocytes via specific inflammatory cytokines in the microenvironment of brain metastasis. Clin Exp Metastasis 28, 13-25. Siegel, P.M., Shu, W., Cardiff, R.D., Muller, W.J., and Massague, J. (2003). Transforming growth factor beta signaling impairs Neu-induced mammary tumorigenesis while promoting pulmonary metastasis. Proc Natl Acad Sci U S A 100, 8430-8435. Sledge, G.W., Jr. (2011). HER2011: the changing face of HER2-positive breast cancer. Clin Breast Cancer 11, 9. Sofroniew, M.V., and Vinters, H.V. (2010). Astrocytes: biology and pathology. Acta Neuropathol Suppl (Berl) 119, 7-35. Steeg, P.S., Camphausen, K.A., and Smith, Q.R. (2011). Brain metastases as preventive and therapeutic targets. Nat Rev Cancer 11, 352-363. Thies, A., Schachner, M., Moll, I., Berger, J., Schulze, H.J., Brunner, G., and Schumacher, U. (2002). Overexpression of the cell adhesion molecule L1 is associated with metastasis in cutaneous malignant melanoma. Eur J Cancer 38, 1708-1716. Tischler, V., Pfeifer, M., Hausladen, S., Schirmer, U., Bonde, A.K., Kristiansen, G., Sos, M.L., Weder, W., Moch, H., Altevogt, P., et al. (2011). L1CAM protein expression is associated with poor prognosis in non-small cell lung cancer. Mol Cancer 10, 127-137. Tsutsumi , S. , Morohashi , S. , Kudo , Y. , Akasaka , H. , Ogasawara , H. , Ono , M. , Takasugi , K. , Ishido , K. , Hakamada , K. , and Kijima , H. (2011). L1 Cell adhesion molecule (L1CAM) expression at the invasive cancer Front is a novel prognostic marker of pancreatic ductal adenocarcinoma. J Surg Oncol 103, 669–673. The number of publications is 8,138,313 and the registration number WO 2007114550 is registered 2008151819 Valastyan , S. , & Weinberg , R. (2011). Tumor metastasis: molecular insights and evolving paradigms. Cell 147, 275–292. Valiente M, Obenauf AC, Jin X, Chen Q, Zhang XH, Lee DJ, Chaft JE, Kris MG, Huse JT, Brogi E, Massague J. Serpins promote cancer cell Survival and vascular co-option in brain metastasis. Cell. February 27, 2014; 156(5):1002-16. http: / / dx.doi.org / 10.1037 / 0021-843X.111.1.16 Vanharanta, S., & Massague, J. (2013). Origins of metastatic traits. Cancer Cell. 2013 Oct 14;24(4):410-21. doi: 10.1016 / j.ccr.2013.09.007. Vos, Y.J., and Hofstra, R.M. (2010). An updated and upgraded L1CAM mutation database. Hum Mutat 31, E1102-1109. Voura, E.B., Ramjeesingh, R.A., Montgomery, A.M., and Siu, C.H. (2001). Involvement of integrin alpha(v)beta(3) and cell adhesion molecule L1 in transendothelial migration of melanoma cells. Mol Biol Cell 12, 2699-2710. Wang, X., Haroon, F., Karray, S., Martina, D., and Schluter, D. (2013). Astrocytic Fas ligand expression is required to induce T-cell apoptosis and recovery from experimental autoimmune encephalomyelitis. Eur J Immunol 43, 115-124. Wang Y, Loers G, Pan HC, Gouveia R, Zhao WJ, Shen YQ, Kleene R, Costa J, Schachner M. Antibody fragments directed against different portions of the human neural cell adhesion molecule L1 act as inhibitors or activators of L1 function. PLoS One. 2012;7(12):e52404. Wiencken-Barger, A.E., Mavity-Hudson, J., Bartsch, U., Schachner, M., and Casagrande, V.A. (2004). The role of L1 in axon pathfinding and fasciculation. Cereb Cortex 14, 121-131. Winslow, M.M., Dayton, T.L., Verhaak, R.G., Kim-Kiselak, C., Snyder, E.L., Feldser, D.M., Hubbard, D.D., DuPage, M.J., Whittaker, C.A., Hoersch, S., et al. (2011). Suppression of lung adenocarcinoma progression by Nkx2-1. Nature 473, 101-104. Wolterink S, Moldenhauer G, Fogel M, Kiefel H, Pfeifer M, Luettgau S, Gouveia R, Costa J, Endell J, Moebius U, Altevogt P. Therapeutic antibodies to human L1CAM: functional characterization and application in a mouse model for ovarian carcinoma. Cancer Res. March 15, 2010;70(6):2504-15. Zhu, C.Q., Ding, K., Strumpf, D., Weir, B.A., Meyerson, M., Pennell, N., Thomas, R.K., Naoki, K., Ladd-Acosta, C., Liu, N., et al. (2010). Prognostic and predictive gene signature for adjuvant chemotherapy in resected non-small-cell lung cancer. J Clin Oncol 28, 4417-4424. Various publications are cited herein, the contents of which are incorporated herein by reference in their entireties.

Claims

[Claim 1] The invention as depicted in the drawings.

Images