Mutated trna for codon expansion

Abstract

To provide tRNAs and translation systems, and methods of using the same.SOLUTION: Provided are mutated tRNAs produced by modifying tRNA, the modification including that the first nucleoside N1 of a modified anticodon represented by N1 N2 N3 is lysidine (k2C), a lysidine derivative, agmatidine (agm2C), or an agmatidine derivative, and N2 and N3 are each an arbitrary nucleoside at the second and third position of the anticodon, respectively.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present disclosure relates to tRNAs and translation systems and methods of use thereof. [Background technology]

[0002] Display libraries are a very useful technology that allows efficient evolutionary engineering of molecules that bind to target proteins. To obtain molecules with high binding affinity to a given target molecule or to obtain multiple molecules that bind to multiple epitopes using display libraries, panning from a highly diverse library is necessary. Constructing a highly diverse library involves increasing the number or variety of building blocks. However, if molecular weight is limited due to membrane permeability considerations, the number of building blocks is also limited. Therefore, increasing the variety of building blocks is an important way to increase library diversity.

[0003] Reconstituted cell-free translation systems such as the PURESYSTEM (Non-Patent Document 1) allow for the adjustment of concentrations of components such as amino acids, tRNAs, and aminoacyl-tRNA synthetases (ARSs), thereby enabling the alteration of natural codon-amino acid correspondences. Using such translation systems, it is possible to construct display libraries incorporating 20 or more building blocks. However, in the E. coli translation system using three-base codons, due to the existence of the wobble rule, the maximum number of building blocks that can be introduced is thought to be 32, in principle. More specifically, there is a "play factor" in the pairing of the third letter of the codon and the first letter of the anticodon, and in addition to Watson-Crick base pairing, a wobble base pairing between G and U is possible. Therefore, the anticodon GNN decodes the codons NNU and NNC, and the anticodon UNN decodes the codons NNA and NNG, making it impossible to distinguish between these codons, and the number of amino acids that can be introduced into one codon box is limited to a maximum of two (Non-Patent Document 2).

[0004] On the other hand, in nature, there are means that enable the distinction between AUA and AUG codons. One example is the lysidine modification introduced at position 34 (the first letter of the anticodon) of Escherichia coli tRNA Ile2. It is known that this modification allows tRNA Ile2 to decode only AUA codons, but not AUG codons (Non-Patent Document 3). This modification is induced by the enzyme isoleucine tRNA-lysidine synthetase (tRNA Ile Lysidine is introduced by TilS (Non-Patent Document 4), but the tRNA substrate is limited to tRNA Ile2, and it is not easy to introduce lysidine into other tRNAs (Non-Patent Document 5). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Shimizu et al., Nat Biotechnol., 2001 Aug;19(8):751-755. [Non-patent document 2] Iwane et al., Nat Chem.,2016 Apr;8(4):317-325. [Non-patent document 3] Grosjean et al.,Trends Biochem Sci.,2004 Apr;29(4):165-168. [Non-patent document 4] Suzuki T et al.,FEBS Lett.,2010 Jan 21;584(2):272-277. [Non-Patent Document 5] Lajoie et al.,J Mol Biol.,2016 Feb 27;428(5 Pt B):1004-1021. Summary of the Invention [Problem to be solved by the invention]

[0006] As described above, tRNA Ile2 allows the AUA and AUG codons to be read differently by introducing lysidine at position 34 (the first letter of the anticodon). However, no examples of lysidine modification in other tRNAs have been found in nature. Furthermore, no examples have been reported of the NNA and NNG codons being read differently by any artificial means. The present invention was made in light of these circumstances, and one of the objects of the present disclosure is to provide a new means for enabling the NNA and NNG codons to be read differently. [Means for solving the problem]

[0007] In this study, the inventors enzymatically linked chemically synthesized tRNA fragments with lysidine (also known as 2-lysylcytidine) to prepare tRNAs with various sequences at positions 35 and 36 (the second and third letters of the anticodon) and with lysidine introduced at position 34. When translation systems containing these tRNAs were reconstituted and amino acid translation was performed, it was found that both translation systems were capable of distinguishing between NNA and NNG codons. Furthermore, during these studies, it was discovered that tRNAs with a UNN anticodon decoded not only NNA and NNG codons but also the NNU codon. However, the use of lysidine-introduced tRNAs significantly reduced the misreading of the NNU codon.

[0008] The present disclosure is based on these findings and specifically includes the embodiments exemplified below. [1] A mutant tRNA prepared by modifying a tRNA, wherein the modification includes a modification in which the first nucleoside N1 after modification of the anticodon represented by N1N2N3 is either lysidine (k2C), a lysidine derivative, agmatidine (agm2C), or an agmatidine derivative, and N2 and N3 are any nucleosides at the second and third letters of the anticodon, respectively. [2] N1 before modification is cytidine (C), and the modification from cytidine (C) to lysidine (k2C) is performed using a lysidine synthase (tRNA lysidine synthase) having the amino acid sequence of SEQ ID NO: 51. Ile The mutant tRNA according to [1], which cannot be catalyzed by TilS (-lysidine synthetase). [3] N1 before modification is cytidine (C), and the modification from cytidine (C) to agmatidine (agm2C) is performed by agmatidine synthetase (tRNA 2C) having the amino acid sequence of SEQ ID NO: 52. Ile The mutant tRNA according to [1], which cannot be catalyzed by TiaS (tri-agmatidine synthetase). [4] A mutant tRNA according to any one of [1] to [3], having an anticodon complementary to a codon represented by M1M2A (wherein M1 and M2 represent the first and second nucleosides of the codon, respectively, and M1 and M2 are each selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U), and the third nucleoside is adenosine). [5] The mutant tRNA according to [4], wherein the anticodon is represented by k2CN2N3 or agm2CN2N3 (wherein the first nucleoside of the anticodon is lysidine (k2C) or agmatidine (agm2C), and the second nucleoside (N2) and the third nucleoside (N3) are complementary to M2 and M1, respectively). [6] The mutant tRNA according to [5], wherein N2 and N3 are each selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). [7] The mutant tRNA according to any one of [1] to [6], wherein the tRNA is an initiator tRNA or an elongation tRNA. [8] The mutant tRNA according to any one of [1] to [7], wherein the tRNA is derived from a prokaryote or eukaryote. [9] A mutant tRNA according to any one of [4] to [8], wherein M1 and M2 are selected from codons that constitute a codon box in which a codon whose third nucleoside is A and a codon whose third nucleoside is G both encode the same amino acid in the natural genetic code.

[10] A mutant tRNA according to any one of [4] to [8], wherein M1 and M2 are selected from codons that constitute a codon box in which a codon whose third nucleoside is U and a codon whose third nucleoside is A both encode the same amino acid in the natural genetic code.

[11] A mutant tRNA according to any one of [4] to [8], wherein M1 and M2 are selected from codons that constitute a codon box in which the third nucleoside, U, C, A, and G, all encode the same amino acid in the natural genetic code.

[12] A mutant tRNA according to any one of [4] to [8], wherein M1 and M2 are selected from codons that constitute codon boxes in which a codon whose third nucleoside is A and a codon whose third nucleoside is G encode different amino acids in the natural genetic code.

[13] A mutant tRNA according to any one of [4] to [8], wherein M1 and M2 are selected from codons that constitute a codon box in which the third nucleoside is A and / or G in the natural genetic code table is a stop codon.

[14] The mutant tRNA according to any one of [4] to [8], wherein M1 is uridine (U) and M2 is cytidine (C).

[15] The mutant tRNA according to any one of [4] to [8], wherein M1 is cytidine (C) and M2 is uridine (U).

[16] The mutant tRNA according to any one of [4] to [8], wherein M1 is cytidine (C) and M2 is cytidine (C).

[17] The mutant tRNA according to any one of [4] to [8], wherein M1 is cytidine (C) and M2 is guanosine (G).

[18] The mutant tRNA according to any one of [4] to [8], wherein M1 is adenosine (A) and M2 is uridine (U).

[19] The mutant tRNA according to any one of [4] to [8], wherein M1 is guanosine (G) and M2 is uridine (U).

[20] The mutant tRNA according to any one of [4] to [8], wherein M1 is guanosine (G) and M2 is cytidine (C).

[21] The mutant tRNA according to any one of [4] to [8], wherein M1 is guanosine (G) and M2 is guanosine (G).

[22] The mutant tRNA according to

[14] , wherein N2 is guanosine (G) and N3 is adenosine (A).

[23] The mutant tRNA according to

[15] , wherein N2 is adenosine (A) and N3 is guanosine (G).

[24] The mutant tRNA according to

[16] , wherein N2 is guanosine (G) and N3 is guanosine (G).

[25] The mutant tRNA according to

[17] , wherein N2 is cytidine (C) and N3 is guanosine (G).

[26] The mutant tRNA according to

[18] , wherein N2 is adenosine (A) and N3 is uridine (U).

[27] The mutant tRNA according to

[19] , wherein N2 is adenosine (A) and N3 is cytidine (C).

[28] The mutant tRNA according to

[20] , wherein N2 is guanosine (G) and N3 is cytidine (C).

[29] The mutant tRNA according to

[21] , wherein N2 is cytidine (C) and N3 is cytidine (C).

[30] The mutant tRNA according to any one of [1] to

[29] , which has an amino acid or an amino acid analog bound to its 3' end.

[31] The mutant tRNA according to

[30] , wherein the amino acid is a natural amino acid or an unnatural amino acid.

[32] The mutant tRNA according to

[31] , wherein the natural amino acid is selected from the group consisting of glycine (Gly), alanine (Ala), serine (Ser), threonine (Thr), valine (Val), leucine (Leu), isoleucine (Ile), phenylalanine (Phe), tyrosine (Tyr), tryptophan (Trp), histidine (His), glutamic acid (Glu), aspartic acid (Asp), glutamine (Gln), asparagine (Asn), cysteine ​​(Cys), methionine (Met), lysine (Lys), arginine (Arg), and proline (Pro).

[33] The mutant tRNA according to

[32] , wherein the natural amino acid is selected from the group consisting of glycine (Gly), alanine (Ala), serine (Ser), threonine (Thr), valine (Val), leucine (Leu), phenylalanine (Phe), tyrosine (Tyr), tryptophan (Trp), histidine (His), glutamic acid (Glu), aspartic acid (Asp), glutamine (Gln), asparagine (Asn), cysteine ​​(Cys), lysine (Lys), arginine (Arg), and proline (Pro).

[34] A translation system comprising multiple different types of tRNAs, the translation system comprising a mutant tRNA according to any one of [1] to

[33] .

[35] The translation system described in

[34] , wherein the mutant tRNA is capable of selectively translating a codon represented by M1M2A compared to a codon different from the codon represented by M1M2A, and the codon represented by M1M2A can be selectively translated by the mutant tRNA compared to a tRNA different from the mutant tRNA.

[36] A translation system according to

[34] or

[35] , comprising (a) a mutant tRNA according to any one of [1] to

[33] , and (b) a tRNA having an anticodon complementary to a codon represented by M1M2G.

[37] The translation system according to

[36] , wherein the anticodon of the tRNA according to

[36] (b) is CN2N3, ac4CN2N3, or CmN2N3 (wherein ac4C represents N4-acetylcytidine and Cm represents 2'-O-methylcytidine).

[38] The translation system according to

[36] or

[37] , wherein the tRNA according to

[36] (b) is capable of selectively translating a codon represented by M1M2G compared to a codon different from the codon represented by M1M2G, and wherein the codon represented by M1M2G can be selectively translated by the tRNA according to

[36] (b) compared to a tRNA different from the tRNA according to

[36] (b).

[39] A translation system according to any one of

[36] to

[38] , wherein the amino acids or amino acid analogs bound to the tRNAs according to

[36] (a) and

[36] (b) are different from each other.

[40] The translation system according to

[39] , which is capable of translating two types of amino acids from the codons M1M2A and M1M2G.

[41] The translation system described in

[39] , wherein the M1M2A and M1M2G codons can encode different amino acids or amino acid analogs.

[42] The translation system according to any one of

[34] to

[41] , further comprising (c) a tRNA having an anticodon complementary to a codon represented by M1M2U or M1M2C.

[43] The translation system according to

[42] , wherein the anticodon of the tRNA described in

[42] (c) is selected from the group consisting of AN2N3, GN2N3, QN2N3, and GluQN2N3 (wherein Q represents queuosine and GluQ represents glutamyl-queuosine).

[44] The translation system of

[42] or

[43] , wherein the tRNA of

[42] (c) is capable of selectively translating a codon represented by M1M2U or M1M2C compared to a codon different from the codon represented by M1M2U or M1M2C, and wherein a codon represented by M1M2U or M1M2C can be selectively translated by the tRNA of

[42] (c) compared to a tRNA different from the tRNA of

[42] (c).

[45] A translation system according to any one of

[42] to

[44] , wherein the amino acids or amino acid analogs bound to the tRNAs according to

[36] (a),

[36] (b), and

[42] (c) are all different from each other.

[46] The translation system according to

[45] , wherein three types of amino acids can be translated from a codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G.

[47] In the codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G, (i) M1M2A, M1M2G, and M1M2U may encode different amino acids or amino acid analogs from each other; or (ii) M1M2A, M1M2G, and M1M2C may encode different amino acids or amino acid analogs from each other; The translation system described in

[45] .

[48] ​​A translation system according to any one of

[45] to

[47] , wherein an unnatural amino acid is bound to at least one of the tRNAs according to

[36] (a),

[36] (b), and

[42] (c).

[49] The translation system according to any one of

[34] to

[48] , which is capable of translating more than 20 types of amino acids.

[50] The translation system according to any one of

[34] to

[49] , which is a cell-free translation system.

[51] The translation system described in

[50] , which is a reconstituted cell-free translation system.

[52] The translation system according to

[50] or

[51] , which comprises a ribosome derived from Escherichia coli.

[53] A method for producing a peptide, comprising translating a nucleic acid using the translation system according to any one of

[34] to

[52] .

[54] The method according to

[53] , wherein the peptide is a peptide having a cyclic portion.

[55] A peptide produced by the method according to

[53] or

[54] .

[56] A method for producing a peptide library, comprising translating a nucleic acid library using the translation system according to any one of

[34] to

[52] .

[57] A peptide library produced by the method according to

[56] .

[58] A method for identifying a peptide having binding activity to a target molecule, comprising contacting the target molecule with the peptide library described in

[57] .

[59] A nucleic acid-peptide complex comprising a peptide and a nucleic acid encoding the peptide, wherein the nucleic acid encoding the peptide contains three types of codons described in either (A) or (B) below: (A) M1M2U, M1M2A, and M1M2G; (B) M1M2C, M1M2A, and M1M2G, The nucleic acid-peptide complex, wherein the types of amino acids corresponding to the three types of codons on the peptide are all different.

[60] A library comprising the nucleic acid-peptide complex according to

[59] .

[61] The following compound or a salt thereof: [ka]

[62] A method for producing a mutant tRNA having lysidine at position 34 according to the tRNA numbering rules, comprising the step of linking the compound according to

[61] with a nucleic acid fragment constituting the tRNA by an enzymatic reaction.

[63] A method for producing a mutant tRNA having lysidine at position 34 of the tRNA numbering rules and having an amino acid or amino acid analog bound to the 3' end, the method comprising the step of linking the compound described in

[61] , one or more nucleic acid fragments constituting the tRNA, and an amino acid or amino acid analog by an enzymatic reaction.

[64] The following compound or a salt thereof: [ka]

[65] A method for producing a mutant tRNA having agmatidine at position 34 according to the tRNA numbering rules, comprising the step of linking the compound according to

[64] with a nucleic acid fragment constituting the tRNA by an enzymatic reaction.

[66] A method for producing a mutant tRNA having agmatidine at position 34 according to the tRNA numbering rules and having an amino acid or amino acid analog bound to the 3' end, the method comprising the step of linking the compound described in

[64] , one or more nucleic acid fragments constituting the tRNA, and an amino acid or amino acid analog by an enzymatic reaction.

[67] The method according to

[63] or

[66] , wherein the amino acid is an amino acid other than methionine (Met) and isoleucine (Ile).

[68] A mutant tRNA produced by the method according to

[62] or

[65] .

[69] A mutant tRNA having an amino acid or amino acid analog bound to its 3' end, produced by the method according to

[63] ,

[66] , or

[67] .

[70] A translation system comprising the mutant tRNA described in

[68] and / or

[69] .

[71] A method for producing a peptide, comprising translating a nucleic acid using the translation system described in

[70] .

[72] A method according to the following formula A, comprising the following steps: [ka] (In the formula, R1 and R2 are each independently H or C1-C3 alkyl; L is a C2-C6 straight chain alkylene or C2-C6 straight chain alkenylene optionally substituted by one or more substituents selected from the group consisting of hydroxy and C1-C3 alkyl, wherein a carbon atom of the C2-C6 straight chain alkylene is optionally substituted by one oxygen atom or sulfur atom; M is a single bond, [ka] where the wavy line indicates the point of attachment to the carbon atom, * indicates the point of attachment to the hydrogen atom, and ** indicates the point of attachment to the nitrogen atom, provided that if M is a single bond, there is no H bonded to M. A method for producing lysidine diphosphate or a derivative thereof, or agmatidine diphosphate or a derivative thereof, represented by the formula: Formula B1 below: [ka] (In the formula, PG 11 is a protecting group for an amino group. is intramolecularly cyclized to form a compound represented by the following formula C1: [ka] (In the formula, PG 11 is the same as above.) obtaining a compound represented by the formula: The compound represented by formula C1 may be treated with a compound represented by formula D1: [ka] (In the formula, R1, R2, L, and M are the same as above.) or a salt thereof, [ka] (Wherein R1, R2, L, M, and PG 11 is the same as above.) obtaining a compound represented by the formula: Compound E1 is PG 12 and / or PG 13 By introducing the following formula F1A or F1B: [ka] (In the formula, R2 is C1-C3 alkyl; PG 12 is a protecting group for an amino group, PG 13 is a protecting group for a carboxyl group or an imino group, R1, L, M, and PG 11 is the same as above, However, when M is a single bond, PG 13 does not exist.) obtaining a compound represented by the formula: Acetonide is removed from the compound represented by formula F1A or F1B, and PG 14 and P.G. 15 By introducing the following formula G1A or G1B: [ka] (In the formula, R2 is C1-C3 alkyl; PG 14 is a protecting group for a hydroxyl group, PG 15 is a protecting group for a hydroxyl group, R1, L, M, PG 11 , P.G. 12 , and P.G. 13 is the same as above.) obtaining a compound represented by the formula: Compounds represented by formula G1A or G1B are treated with PG 16 By introducing the following formula H1A or H1B [ka] (In the formula, R2 is C1-C3 alkyl; PG 16 is a protecting group for a hydroxyl group and / or an amino group, R1, L, M, PG 11 , P.G. 12 , P.G. 13 , P.G. 14 , and P.G. 15 is the same as above.) obtaining a compound represented by the formula: Compounds represented by formula H1A or H1B can be used to produce PG 14 and P.G. 15 to form a compound of formula I1A or I1B: [ka] (In the formula, R2 is C1-C3 alkyl; R1, L, M, PG 11 , P.G. 12 , P.G. 13 , and P.G. 16 is the same as above.) obtaining a compound represented by the formula: A compound of formula I1A or I1B is phosphite esterified and then oxidized to give a compound of formula J1A or J1B: [ka] (In the formula, R2 is C1-C3 alkyl; PG 17 is a protecting group for a hydroxyl group, R1, L, M, PG 11 , P.G. 12 , P.G. 13 , and P.G. 16 is the same as above.) obtaining a compound represented by the formula: Compounds represented by formula J1A to PG 11 , P.G. 12、 PG 13 , and P.G. 17or from the compound of formula J1B to obtain PG 11 , P.G. 13 , and P.G. 17 is removed to obtain the following formula K1: [ka] (In the formula, R2 is H or C1-C3 alkyl; R1, R2, L, M, and PG 16 is the same as above.) obtaining a compound represented by the formula: From the compound represented by formula K1 to PG 16 to obtain a compound of formula A.

[73] The compound represented by formula A is lysidine diphosphate: [ka] or agmatidine diphosphate: [ka] The method described in

[72] ,

[74] PG 11 The method according to

[72] , wherein is p-bromobenzoyl, optionally substituted benzoyl, pyridine carbonyl, or acetyl.

[75] PG 12 The method according to

[72] , wherein is Fmoc.

[76] PG 13 But M [ka] is methyl, ethyl, or optionally substituted benzyl; [ka]

[72] The method according to

[72] , wherein, in the above case, it is optionally substituted benzyl, Cbz, or optionally substituted benzyloxycarbonyl.

[77] PG 14 and P.G. 15 The method according to

[72] , wherein together form di-tert-butylsilyl.

[78] PG 16 The method described in

[72] , wherein is TOM.

[79] PG 17

[72] The method according to

[72] , wherein is cyanoethyl.

[80] The method according to

[72] , wherein the intramolecular cyclization is carried out in the presence of diisopropyl azodicarboxylate and triphenylphosphine.

[81] The method according to

[72] , wherein the introduction of an amine represented by formula D1 or a salt thereof is carried out in the presence of lithium chloride and DBU.

[82] PG 12 is Fmoc, and PG 12 The method according to

[72] , wherein the reagents used for the introduction are (2,5-dioxopyrrolidin-1-yl)(9H-fluoren-9-yl)methyl carbonate and sodium carbonate.

[83] PG 13 is methyl and PG 13 The method according to

[72] , wherein the reagents used for the introduction are N,N'-diisopropylcarbodiimide, methanol, and N,N-dimethyl-4-aminopyridine.

[84] The method described in

[72] , wherein the reagent used to remove acetonide is TFA.

[85] PG 14 and P.G. 15 The method according to

[72] , wherein the above are combined to form di-tert-butylsilyl, and the reagent used to introduce di-tert-butylsilyl is di-tert-butylsilyl bis(trifluoromethanesulfonate).

[86] PG 16 is TOM and PG 16 The method according to

[72] , wherein the reagents used for the introduction are DIPEA and (triisopropylsiloxy)methyl chloride.

[87] PG 14and P.G. 15 The method according to

[72] , wherein the reagent used to remove is hydrogen fluoride pyridine complex.

[88] The method described in

[72] , wherein the reagent used for phosphite esterification is bis(2-cyanoethyl)-N,N-diisopropylaminophosphoramidite.

[89] The method according to

[72] , wherein the reagent used for oxidation is tert-butyl hydroperoxide.

[90] PG 11 , P.G. 12、 PG 13 , and P.G. 17 The method according to

[72] , wherein the reagents used for removing are bis-(trimethylsilyl)acetamide and DBU.

[91] PG 16 The method according to

[72] , wherein the reagent used to remove is ammonium fluoride.

[92] The method described in

[72] , wherein R1 is H.

[93] The method described in

[72] , wherein R2 is H.

[94] The method according to

[72] , wherein the C2-C6 straight-chain alkylene or C2-C6 straight-chain alkenylene is a C4-C5 straight-chain alkylene or C4-C5 straight-chain alkenylene.

[95] The method described in

[72] , wherein L is -(CH2)3-, -(CH2)4-, -(CH2)5, -(CH2)2-O-CH2-, -(CH2)2-S-CH2-, -CH2CH(OH)(CH2)2-, or -CH2CH=CH- (cis or trans).

[96] A method according to the following formula A, comprising the following steps: [ka] (In the formula, R1 and R2 are each independently H or C1-C3 alkyl; L is a C2-C6 straight chain alkylene or C2-C6 straight chain alkenylene optionally substituted by one or more substituents selected from the group consisting of hydroxy and C1-C3 alkyl, wherein a carbon atom of the C2-C6 straight chain alkylene is optionally substituted by one oxygen atom or sulfur atom; M is a single bond, [ka] where the wavy line indicates the point of attachment to the carbon atom, * indicates the point of attachment to the hydrogen atom, and ** indicates the point of attachment to the nitrogen atom, provided that if M is a single bond, there is no H bonded to M. A method for producing lysidine diphosphate or a derivative thereof, or agmatidine diphosphate or a derivative thereof, represented by the formula: Formula B2 below: [ka] (In the formula, PG 21 is a protecting group for an amino group. is intramolecularly cyclized to form a compound represented by the following formula C2: [ka] (In the formula, PG 21 is the same as above.) obtaining a compound represented by the formula: The compound represented by formula C2 may be treated with a compound represented by formula D2A or D2B: [ka] (In the formula, R2 is C1-C3 alkyl; PG 22 is a protecting group for an amino group, PG 23 is a protecting group for a carboxyl group or an imino group, R1, L, and M are the same as above, However, when M is a single bond, PG 23 does not exist.) or a salt thereof, to form a compound represented by the following formula E2A or E2B: [ka] (In the formula, R2 is C1-C3 alkyl; R1, L, M, PG 21 , P.G. 22 , and P.G. 23 is the same as above.) obtaining a compound represented by the formula: Acetonide is removed from the compound represented by formula E2A or E2B, and PG 24 and P.G. 25 By introducing the following formula F2A or F2B: [ka] (In the formula, R2 is C1-C3 alkyl; PG 24 is a protecting group for a hydroxyl group, PG 25 is a protecting group for a hydroxyl group, R1, R2, L, M, PG 21 , P.G. 22 , and P.G. 23 is the same as above.) obtaining a compound represented by the formula: Compounds represented by formula F2A or F2B are treated with PG 26 By introducing the following formula G2A or G2B [ka] (In the formula, R2 is C1-C3 alkyl; PG 26 is a protecting group for a hydroxyl group, R1, R2, L, M, PG 21 , P.G. 22 , P.G. 23, P.G. 24 , and P.G. 25 is the same as above.) obtaining a compound represented by the formula: Compounds represented by formula G2A or G2B are converted to PG 24 and P.G. 25 to obtain the following formula H2A or H2B: [ka] obtaining a compound represented by the formula: (In the formula, R2 is C1-C3 alkyl; R1, L, M, PG 21 , P.G. 22 , P.G. 23 , and P.G. 26 is the same as above.) A compound of formula H2A or H2B is phosphite esterified and then oxidized to give a compound of formula I2A or I2B: [ka] (In the formula, R2 is C1-C3 alkyl; PG 27 is a protecting group for a hydroxyl group, R1, L, M, PG 21 , P.G. 22 , P.G. 23 , and P.G. 26 is the same as above.) obtaining a compound represented by the formula: Compounds of formula I2A to PG 21 , P.G. 22 , P.G. 23 , and P.G. 27 or from the compound of formula I2B to obtain PG 21 , P.G. 23 , and P.G. 27 is removed to obtain the following formula J2: [ka] (In the formula, R2 is H or C1-C3 alkyl; R1, L, M, and PG 26 is the same as above.) obtaining a compound represented by the formula: From the compound represented by formula J2 to PG 26 to obtain a compound of formula A.

[97] The compound represented by formula A is lysidine diphosphate: [ka] or agmatidine diphosphate: [ka] The method described in

[96] ,

[98] PG 21

[96] The method according to

[96] , wherein is Cbz, optionally substituted benzyloxycarbonyl, or optionally substituted benzyl.

[99] PG 22

[96] The method according to

[96] , wherein is Cbz, optionally substituted benzyloxycarbonyl, or optionally substituted benzyl.

[100] PG 23 But M [ka] is optionally substituted benzyl when M is [ka]

[96] The method according to

[96] , wherein, in the above case, it is optionally substituted benzyl, Cbz, or optionally substituted benzyloxycarbonyl.

[101] PG 24 and P.G. 25 The method according to

[96] , wherein together form di-tert-butylsilyl.

[102] PG 26

[96] The method according to

[96] , wherein is tetrahydropyranyl, tetrahydrofuranyl, or methoxymethyl.

[103] PG 27

[96] The method according to

[96] , wherein is benzyl.

[104] The method according to

[96] , wherein the intramolecular cyclization is carried out in the presence of diisopropyl azodicarboxylate and triphenylphosphine.

[105] The method according to

[96] , wherein the introduction of an amine represented by formula D2 or a salt thereof is carried out in the presence of lithium chloride and DBU.

[106] The method according to

[96] , wherein the reagent used to remove acetonide is TFA.

[107] PG 24 and P.G. 25 The method according to

[96] , wherein the above are combined to form di-tert-butylsilyl, and the reagent used to introduce di-tert-butylsilyl is di-tert-butylsilyl bis(trifluoromethanesulfonate).

[108] PG 26 is tetrahydropyranyl, and PG 26 The method according to

[96] , wherein the reagents used for the introduction are TFA and 3,4-dihydro-2H-pyran.

[109] PG 24 and P.G. 25 The method according to

[96] , wherein the reagent used to remove is tetrabutylammonium fluoride.

[110] The method described in

[96] , wherein the reagent used for phosphite esterification is dibenzyl N,N-diisopropylphosphoramidite.

[111] The method according to

[96] , wherein the reagent used for oxidation is Dess-Martin periodinane.

[112] PG 21、 PG 22、 PG 23 , and P.G. 27

[96] The method according to

[96] , wherein is removed by catalytic hydrogenation.

[113] PG 26 The method according to

[96] , wherein the reagent used to remove is hydrochloric acid.

[114] The method described in

[96] , wherein R1 is H.

[115] The method described in

[96] , wherein R2 is H.

[116] The method according to

[96] , wherein the C2-C6 straight-chain alkylene or C2-C6 straight-chain alkenylene is a C4-C5 straight-chain alkylene or C4-C5 straight-chain alkenylene.

[117] The method described in

[96] , wherein L is -(CH2)3-, -(CH2)4-, -(CH2)5, -(CH2)2-O-CH2-, -(CH2)2-S-CH2-, -CH2CH(OH)(CH2)2-, or -CH2CH=CH- (cis or trans). [Brief explanation of the drawings]

[0009] [Figure 1] 1 shows mass chromatograms of RNase-fragmented tRNA(Glu)uga-CA(UR-1) prepared using a ligation reaction as described in Example 10. The upper and lower panels show the results for a fragment having the CCCUUGp sequence, and the lower panel shows the results for a fragment having the CCCUUGp sequence. [Figure 2] 2 shows mass chromatograms of RNase-fragmented tRNA(Glu)Lga-CA(LR-1) prepared using a ligation reaction as described in Example 10. The top row shows the results for a fragment having the CCCULGp sequence, the middle row shows the results for a fragment having the CCCUUGp sequence, and the bottom row shows the results for a fragment having the CCCUUGp sequence. [Figure 3] 3 shows mass chromatograms of RNase-fragmented tRNA(Glu)Lag-CA(LR-2) prepared using a ligation reaction as described in Example 10. The top row shows the results for a fragment having the sequence CCCULAGp, the middle row shows the results for a fragment having the sequence CCCUAGp, and the bottom row shows the results for a fragment having the sequence CCCUUAGp. [Figure 4]4 shows mass chromatograms of RNase-fragmented tRNA(Glu)Lac-CA (LR-3) prepared using a ligation reaction as described in Example 10. The top row shows the results for a fragment having the sequence CCCULACACGp (SEQ ID NO: 197), the middle row shows the results for a fragment having the sequence CCCUACACGp, and the bottom row shows the results for a fragment having the sequence CCCUUACACGp (SEQ ID NO: 198). [Figure 5] 5 shows mass chromatograms of RNase-fragmented tRNA(Glu)Lcc-CA(LR-4) prepared using a ligation reaction as described in Example 10. The top row shows the results for a fragment having the sequence CCCULCCACGp (SEQ ID NO: 199), the middle row shows the results for a fragment having the sequence CCCUCCACCGp, and the bottom row shows the results for a fragment having the sequence CCCUUCCACGp (SEQ ID NO: 200). [Figure 6] FIG. 6 shows a mass chromatogram of tRNA(Asp)Lag-CA(LR-5) prepared using a ligation reaction as described in Example 10. The top row shows the results for a nucleic acid (target product) having the sequence of pGGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUULAGGUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC (SEQ ID NO: 134), the middle row shows the results for a nucleic acid (by-product when pLp was not ligated) having the sequence of pGGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUUAGGUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC (SEQ ID NO: 201), and the bottom row shows the results for a nucleic acid (by-product when pUp was ligated instead of pLp) having the sequence of pGGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUUUAGGUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC (SEQ ID NO: 154). [Figure 7]7 shows mass chromatograms of RNase-fragmented tRNA(AsnE2)Lag-CA(LR-6) prepared using a ligation reaction as described in Example 10. The top row shows the results for a fragment having the sequence AUULAGp, the middle row shows the results for a fragment having the sequence AUUAGp, and the bottom row shows the results for a fragment having the sequence AUUUAGp. [Figure 8] 8 shows mass chromatograms of RNase-fragmented tRNA(Glu)Lcg-CA(LR-7) prepared using a ligation reaction as described in Example 10. The top row shows the results for a fragment having the sequence CCCULCGp, the middle row shows the results for a fragment having the sequence CCCUCGp, and the bottom row shows the results for a fragment having the sequence CCCUUCGp. [Figure 9] 9 shows mass chromatograms of RNase-fragmented tRNA(Glu)Lau-CA(LR-8) prepared using a ligation reaction as described in Example 10. The top row shows the results for a fragment having the sequence CCCULAUACGp (SEQ ID NO: 202), the middle row shows the results for a fragment having the sequence CCCUAUACGp, and the bottom row shows the results for a fragment having the sequence CCCUUAUACGp (SEQ ID NO: 203). [Figure 10] 10 shows mass chromatograms of RNase-fragmented tRNA(Glu)(Agm)ag-CA(AR-1) prepared using a ligation reaction as described in Example 10. The top row shows the results for a fragment having the sequence CCCU(Agm)AGp, the middle row shows the results for a fragment having the sequence CCCUAGp, and the bottom row shows the results for a fragment having the sequence CCCUUAGp. [Figure 11]11 shows the results of translation evaluation of the ability to distinguish between three amino acids in one codon box with or without lysidine modification, as described in Examples 12 and 13. The codons evaluated were UCU, UCA, and UCG. The vertical axis of the graph shows the translation amount of peptides obtained when translation was performed using each combination of tRNA and mRNA described below (see Table 12 for specific measured values). (Left) tRNA: Compound AAtR-1 (anticodon: aga, amino acid: dA), Compound AAtR-2 (anticodon: uga, amino acid: SPh2Cl), Compound AAtR-5 (anticodon: cga, amino acid: nBuG). mRNA: mR-1 (containing the UCU codon), mR-2 (containing the UCA codon), mR-3 (containing the UCG codon). (Center) tRNA: Compound AAtR-1 (anticodon: aga, amino acid: dA), Compound AAtR-3 (anticodon: uga, amino acid: SPh2Cl), Compound AAtR-5 (anticodon: cga, amino acid: nBuG). mRNA: mR-1 (containing the UCU codon), mR-2 (containing the UCA codon), mR-3 (containing the UCG codon). (Right) tRNA: Compound AAtR-1 (anticodon: aga, amino acid: dA). Compound AAtR-4 (anticodon: Lga, amino acid: SPh2Cl) Compound AAtR-5 (anticodon: cga, amino acid: nBuG) mRNA: mR-1 (containing the UCU codon), mR-2 (containing the UCA codon), mR-3 (containing the UCG codon) [Figure 12]12 shows the results of translation evaluation of the ability to distinguish between three amino acids in one codon box depending on the presence or absence of lysidine modification, as described in Examples 12 and 13. The codons evaluated were CUU, CUA, and CUG. The vertical axis of the graph shows the translation amount of peptide obtained when translation was performed using each combination of tRNA and mRNA described below (see Table 13 for specific measured values). (Left) tRNA: Compound AAtR-6 (anticodon: aag, amino acid: nBuG), Compound AAtR-7 (anticodon: uag, amino acid: Pic2), Compound AAtR-9 (anticodon: cag, amino acid: dA). mRNA: mR-4 (contains the CUU codon), mR-5 (contains the CUA codon), mR-6 (contains the CUG codon). (Right) tRNA: Compound AAtR-6 (anticodon: aag, amino acid: nBuG), Compound AAtR-8 (anticodon: Lag, amino acid: Pic2), Compound AAtR-9 (anticodon: cag, amino acid: dA). mRNA: mR-4 (contains the CUU codon), mR-5 (contains the CUA codon), mR-6 (contains the CUG codon). [Figure 13]13 shows the results of translation evaluation of the discrimination of three amino acids in one codon box depending on the presence or absence of lysidine modification, as described in Examples 12 and 13. The codons evaluated were GUU, GUA, and GUG. The vertical axis of the graph shows the translation amount of peptide obtained when translation was performed using each combination of tRNA and mRNA described below (see Table 14 for specific measured values). (Left) tRNA: Compound AAtR-10 (anticodon: aac, amino acid: nBuG), Compound AAtR-11 (anticodon: uac, amino acid: Pic2), Compound AAtR-13 (anticodon: cac, amino acid: dA). mRNA: mR-7 (contains a GUU codon), mR-8 (contains a GUA codon), mR-9 (contains a GUG codon). (Right) tRNA: Compound AAtR-10 (anticodon: aac, amino acid: nBuG), Compound AAtR-12 (anticodon: Lac, amino acid: Pic2), Compound AAtR-13 (anticodon: cac, amino acid: dA). mRNA: mR-7 (contains a GUU codon), mR-8 (contains a GUA codon), mR-9 (contains a GUG codon). [Figure 14]14 shows the results of translation evaluation of the ability to distinguish between three amino acids in one codon box depending on the presence or absence of lysidine modification, as described in Examples 12 and 13. The codons evaluated were GGU, GGA, and GGG. The vertical axis of the graph shows the translation amount of peptide obtained when translation was performed using each combination of tRNA and mRNA described below (see Table 15 for specific measured values). (Left) tRNA: Compound AAtR-14 (anticodon: gcc, amino acid: dA), Compound AAtR-15 (anticodon: ucc, amino acid: Pic2), Compound AAtR-17 (anticodon: ccc, amino acid: MeHph). mRNA: mR-10 (contains a GGU codon), mR-11 (contains a GGA codon), mR-12 (contains a GGG codon). (Right) tRNA: Compound AAtR-14 (anticodon: gcc, amino acid: dA), Compound AAtR-16 (anticodon: Lcc, amino acid: Pic2), Compound AAtR-17 (anticodon: ccc, amino acid: MeHph). mRNA: mR-10 (contains a GGU codon), mR-11 (contains a GGA codon), mR-12 (contains a GGG codon). [Figure 15]15 shows the results of translation evaluation of the ability to distinguish between three amino acids in one codon box depending on the presence or absence of lysidine modification, as described in Examples 12 and 13. The codons evaluated were CUU, CUA, and CUG. The vertical axis of the graph shows the translation amount of peptide obtained when translation was performed using each combination of tRNA and mRNA described below (see Table 16 for specific measured values). (Left) tRNA: Compound AAtR-19 (anticodon: aag, amino acid: nBuG), Compound AAtR-20 (anticodon: uag, amino acid: SPh2Cl), Compound AAtR-22 (anticodon: cag, amino acid: dA). mRNA: mR-4 (contains the CUU codon), mR-5 (contains the CUA codon), mR-6 (contains the CUG codon). (Right) tRNA: Compound AAtR-19 (anticodon: aag, amino acid: nBuG), Compound AAtR-21 (anticodon: Lag, amino acid: SPh2Cl), Compound AAtR-22 (anticodon: cag, amino acid: dA). mRNA: mR-4 (contains the CUU codon), mR-5 (contains the CUA codon), mR-6 (contains the CUG codon). [Figure 16]16 shows the results of translation evaluation of the ability to distinguish between three amino acids in one codon box with or without lysidine modification, as described in Examples 12 and 13. The codons evaluated were CUU, CUA, and CUG. The vertical axis of the graph shows the translation amount of peptide obtained when translation was performed using each combination of tRNA and mRNA described below (see Table 17 for specific measured values). (Left) tRNA: Compound AAtR-23 (anticodon: aag, amino acid: nBuG) Compound AAtR-24 (anticodon: uag, amino acid: SPh2Cl) Compound AAtR-26 (anticodon: cag, amino acid: dA) mRNA: mR-4 (contains the CUU codon) mR-5 (contains the CUA codon) mR-6 (contains the CUG codon) (Right) tRNA: Compound AAtR-23 (anticodon: aag, amino acid: nBuG) Compound AAtR-25 (anticodon: Lag, amino acid: SPh2Cl) Compound AAtR-26 (anticodon: cag, amino acid: dA) mRNA: mR-4 (contains the CUU codon) mR-5 (contains the CUA codon) mR-6 (contains the CUG codon) [Figure 17]17 shows the results of translation evaluation of the ability to distinguish between three amino acids in one codon box with or without lysidine modification, as described in Examples 12 and 13. The codons evaluated were CUU, CUA, and CUG. The vertical axis of the graph shows the translation amount of peptide obtained when translation was performed using each combination of tRNA and mRNA described below (see Table 18 for specific measured values). (Left) tRNA: Compound AAtR-6 (anticodon: aag, amino acid: nBuG), Compound AAtR-27 (anticodon: uag, amino acid: MeHph), Compound AAtR-9 (anticodon: cag, amino acid: dA). mRNA: mR-4 (contains the CUU codon), mR-5 (contains the CUA codon), mR-6 (contains the CUG codon). (Right) tRNA: Compound AAtR-6 (anticodon: aag, amino acid: nBuG), Compound AAtR-28 (anticodon: Lag, amino acid: MeHph), Compound AAtR-9 (anticodon: cag, amino acid: dA). mRNA: mR-4 (contains the CUU codon), mR-5 (contains the CUA codon), mR-6 (contains the CUG codon). [Figure 18]18 shows the results of translation evaluation of the ability to distinguish between three amino acids in one codon box depending on the presence or absence of lysidine modification, as described in Examples 12 and 13. The codons evaluated were CUU, CUA, and CUG. The vertical axis of the graph shows the translation amount of peptide obtained when translation was performed using each combination of tRNA and mRNA described below (see Table 19 for specific measured values). (Left) tRNA: Compound AAtR-6 (anticodon: aag, amino acid: nBuG), Compound AAtR-29 (anticodon: uag, amino acid: F3Cl), Compound AAtR-9 (anticodon: cag, amino acid: dA). mRNA: mR-4 (contains the CUU codon), mR-5 (contains the CUA codon), mR-6 (contains the CUG codon). (Right) tRNA: Compound AAtR-6 (anticodon: aag, amino acid: nBuG), Compound AAtR-30 (anticodon: Lag, amino acid: F3Cl), Compound AAtR-9 (anticodon: cag, amino acid: dA). mRNA: mR-4 (contains the CUU codon), mR-5 (contains the CUA codon), mR-6 (contains the CUG codon). [Figure 19]19 shows the results of translation evaluation of the ability to distinguish between three amino acids in one codon box depending on the presence or absence of lysidine modification, as described in Examples 12 and 13. The codons evaluated were CUU, CUA, and CUG. The vertical axis of the graph shows the translation amount of peptide obtained when translation was performed using each combination of tRNA and mRNA described below (see Table 20 for specific measured values). (Left) tRNA: Compound AAtR-6 (anticodon: aag, amino acid: nBuG), Compound AAtR-31 (anticodon: uag, amino acid: SiPen), Compound AAtR-9 (anticodon: cag, amino acid: dA). mRNA: mR-4 (containing the CUU codon), mR-5 (containing the CUA codon), mR-6 (containing the CUG codon). (Right) tRNA: Compound AAtR-6 (anticodon: aag, amino acid: nBuG), Compound AAtR-32 (anticodon: Lag, amino acid: SiPen), Compound AAtR-9 (anticodon: cag, amino acid: dA). mRNA: mR-4 (containing the CUU codon), mR-5 (containing the CUA codon), mR-6 (containing the CUG codon). [Figure 20] Figure 20 shows the results of translation evaluation of the ability of lysidine modification to read three amino acids in one codon box, as described in Examples 12 and 13. The codons evaluated were CGU, CGA, and CGG. The vertical axis of the graph shows the amount of translated peptide obtained when translation was performed using each of the following combinations of tRNA and mRNA (see Table 21 for specific measurements). tRNA: Compound AAtR-33 (anticodon: gcg, amino acid: dA), Compound AAtR-34 (anticodon: Lcg, amino acid: Pic2), Compound AAtR-35 (anticodon: ccg, amino acid: nBuG). mRNA: mR-13 (containing a CGU codon), mR-14 (containing a CGA codon), mR-15 (containing a CGG codon). [Figure 21]Figure 21 shows the results of translation evaluation of the ability of lysidine modification to read three amino acids in one codon box, as described in Examples 12 and 13. The codons evaluated were AUU, AUA, and AUG. The vertical axis of the graph shows the amount of translated peptide obtained when translation was performed using each of the following combinations of tRNA and mRNA (see Table 22 for specific measurements). tRNA: Compound AAtR-36 (anticodon: aau, amino acid: nBuG), Compound AAtR-37 (anticodon: Lau, amino acid: Pic2), Compound AAtR-38 (anticodon: cau, amino acid: dA). mRNA: mR-16 (containing the AUU codon), mR-17 (containing the AUA codon), mR-18 (containing the AUG codon). [Figure 22] 22 shows the results of translation evaluation of the ability to distinguish between three amino acids in one codon box with or without agmatidine modification, as described in Examples 12 and 13. The codons evaluated were CUU, CUA, and CUG. The vertical axis of the graph shows the translation yield of peptides obtained when translation was performed using each combination of tRNA and mRNA described below (see Table 23 for specific measurements). (Left) tRNA: Compound AAtR-6 (anticodon: aag, amino acid: nBuG), Compound AAtR-39 (anticodon: uag, amino acid: SPh2Cl), Compound AAtR-9 (anticodon: cag, amino acid: dA). mRNA: mR-4 (containing the CUU codon), mR-5 (containing the CUA codon), mR-6 (containing the CUG codon). (Right) tRNA: Compound AAtR-6 (anticodon: aag, amino acid: nBuG), Compound AAtR-40 (anticodon: (Agm)ag, amino acid: SPh2Cl), Compound AAtR-9 (anticodon: cag, amino acid: dA). mRNA: mR-4 (containing the CUU codon), mR-5 (containing the CUA codon), mR-6 (containing the CUG codon). DETAILED DESCRIPTION OF THE INVENTION

[0010] I. Definition For purposes of interpreting this specification, the following definitions will apply, and wherever applicable, terms used in the singular will also include the plural and vice versa. It is to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. In the event that any of the definitions below conflict with any document incorporated herein by reference, the definition below shall control.

[0011] A "codon" refers to a triplet of three nucleosides that corresponds to an amino acid when genetic information in a living organism is translated into a protein. In DNA, four bases—adenine (A), guanine (G), cytosine (C), and thymine (T)—are used, while in mRNA, four bases—adenine (A), guanine (G), cytosine (C), and uracil (U)—are used. A table showing the correspondence between each codon and an amino acid is called the genetic code or codon table, and 20 amino acids are assigned to 61 codons, excluding the stop codon (Table 1). The genetic code shown in Table 1 is commonly used in almost all organisms, both eukaryotic and prokaryotic (eubacteria and archaea), and is therefore also called the standard genetic code or universal genetic code. In this disclosure, the genetic code used in naturally occurring organisms is referred to as the "natural genetic code" and is distinguished from a genetic code that has been artificially reprogrammed (in which the correspondence between codons and amino acids has been altered). In the genetic code, four codons that share the same first and second letters but differ only in the third letter are usually grouped together in a single box, which is called a codon box.

[0012] [Table 1]

[0013] In the present disclosure, codons in mRNA may be represented as "M1M2M3," where M1, M2, and M3 represent the first, second, and third nucleosides of the codon, respectively.

[0014] An "anticodon" is a sequence of three consecutive nucleosides on a tRNA that corresponds to a codon on an mRNA. Like mRNA, anticodons use four bases: adenine (A), guanine (G), cytosine (C), and uracil (U). Modified bases may also be used. The specific recognition of a codon by an anticodon allows the genetic information on the mRNA to be read and translated into a protein. The 5' to 3' codon sequence on the mRNA and the 5' to 3' anticodon sequence on the tRNA bind complementary to each other, forming complementary base pairs between the first, second, and third nucleosides of the codon and the third, second, and first nucleosides of the anticodon, respectively.

[0015] In the present disclosure, the anticodon in a tRNA may be represented as "N1N2N3," where N1, N2, and N3 represent the first, second, and third nucleosides of the anticodon, respectively. According to the tRNA numbering rules described below, N1, N2, and N3 are numbered at positions 34, 35, and 36 of the tRNA, respectively.

[0016] In the present disclosure, combinations of nucleic acids that can form thermodynamically stable base pairs are said to be "complementary" to each other. In addition to Watson-Crick base pairs such as adenosine and uridine (AU) and guanosine and cytidine (GC), combinations of nucleic acids that form non-Watson-Crick base pairs such as guanosine and uridine (GU), inosine and uridine (IU), inosine and adenosine (IA), and inosine and cytidine (IC) are also included in "complementary" nucleic acid combinations in the present disclosure. In particular, only Watson-Crick base pairs are allowed between the first letter of a codon and the third letter of an anticodon, and between the second letter of a codon and the second letter of an anticodon. However, due to the presence of spatial wobble between the third letter of a codon and the first letter of an anticodon, it is believed that non-Watson-Crick base pairs such as those described above are also allowed (wobble hypothesis).

[0017] Messenger RNA (mRNA) is RNA that contains genetic information that can be translated into proteins. Genetic information is encoded in mRNA as codons, each corresponding to one of the 20 amino acids. Protein translation begins with a start codon and ends with a stop codon. In eukaryotes, the start codon is typically AUG, but prokaryotes (eubacteria and archaea) may use other start codons, such as GUG and UUG. AUG encodes methionine (Met), and translation begins with methionine in eukaryotes and archaea. In contrast, in eubacteria, only the start codon AUG corresponds to N-formylmethionine (fMet), so translation begins with formylmethionine. There are three types of stop codons: UAA (ochre), UAG (amber), and UGA (opal). When a stop codon is recognized by a protein called a translation release factor (RF), the peptide chain synthesized up to that point dissociates from the tRNA, terminating the translation process.

[0018] "Transfer RNA (tRNA)" refers to a short RNA of 100 bases or less that mediates peptide synthesis using mRNA as a template. Its secondary structure is a cloverleaf structure consisting of three stem-loops (D arm, anticodon arm, and T arm) and one stem (acceptor stem). Some tRNAs may also contain an additional variable loop. The anticodon arm contains a region consisting of three consecutive nucleosides called the anticodon, which recognizes a codon on mRNA by forming base pairs with it. Meanwhile, the 3' end of the tRNA contains a nucleic acid sequence consisting of cytidine-cytidine-adenosine (CCA sequence), and an amino acid is added to the adenosine residue at the end (specifically, an ester bond is formed between the hydroxyl group at the 2nd or 3rd position of the ribose of the adenosine residue and the carboxyl group of the amino acid). A tRNA with an amino acid added is called an aminoacyl-tRNA. In this disclosure, aminoacyl-tRNA is also included in the definition of tRNA. Furthermore, as will be described later, a method is known in which the two terminal residues (C and A) are removed from the CCA sequence of tRNA and the resulting residue is used to synthesize aminoacyl-tRNA. Such tRNAs with the CA sequence removed from the 3' end are also included in the definition of tRNA in the present disclosure. In vivo, the addition of amino acids to tRNA is carried out by an enzyme called aminoacyl-tRNA synthetase (aaRS or ARS). Typically, one type of aminoacyl-tRNA synthetase exists for each amino acid, and each aminoacyl-tRNA synthetase specifically recognizes only a specific tRNA as a substrate from among multiple tRNAs, so the correspondence between tRNA and amino acid is strictly controlled.

[0019] Each nucleoside in a tRNA is numbered according to the tRNA numbering rules (Sprinzl et al., Nucleic Acids Res (1998) 26:148-153). For example, the anticodon is numbered 34-36, and the CCA sequence is numbered 74-76.

[0020] An "initiator tRNA" is a specific tRNA used at the start of mRNA translation. The initiator tRNA, bound to an initiator amino acid, is introduced into the ribosome by the catalysis of a translation initiation factor (IF) and binds to the start codon on the mRNA, thereby starting translation. Since AUG, the codon for methionine, is generally used as the start codon, the initiator tRNA has an anticodon corresponding to AUG, and is bound to methionine (formylmethionine in prokaryotes) as the start amino acid. An example of an initiator tRNA is tRNA fMet (SEQ ID NO: 10, 11).

[0021] "Elongator tRNA" refers to a tRNA used in the peptide chain elongation reaction in the translation process. In peptide synthesis, the elongation reaction of the peptide chain proceeds when the elongator tRNA bound to an amino acid is sequentially transported to the ribosome by the GTP-conjugated translation elongation factor (EF) EF-Tu / eEF-1. Examples of elongator tRNAs include tRNAs corresponding to various amino acids (SEQ ID NOS: 1-9, 12-50).

[0022] Lysidine is a modified nucleoside, also known as 2-lysylcytidine (k2C or L). Lysidine is used as the first nucleoside in the anticodon of the tRNA (tRNA Ile2) corresponding to isoleucine in eubacteria. tRNA Ile2 is synthesized as a precursor with a CAU anticodon, and the first cytidine (C) of the anticodon is converted to lysidine (k2C) by the action of an enzyme called tRNA Ile-lysidine synthetase (TilS). As a result, tRNA Ile2 with the anticodon k2CAU is completed (Muramatsu et al., J Biol Chem (1988) 263:9261-9267; Suzuki et al., FEBS Lett (2010) 584:272-277). The anticodon k2CAU is known to specifically recognize only the isoleucine codon AUA. It is also believed that only after the anticodon has been modified to k2CAU can tRNA Ile2 be recognized as a substrate by isoleucyl-tRNA synthetase, resulting in aminoacylation of tRNA Ile2 (addition of isoleucine). The amino acid sequence of E. coli TilS is shown in SEQ ID NO:51.

[0023] Agmatidine is a modified nucleoside, also known as 2-agmatinylcytidine (agm2C or Agm). Agmatidine is used as the first nucleoside in the anticodon of the archaeal tRNA (tRNA Ile2) corresponding to isoleucine. tRNA Ile2 is synthesized as a precursor with a CAU anticodon, and then the first cytidine (C) in the anticodon is converted to agmatidine (agm2C) by the action of an enzyme called tRNA Ile-agmatidine synthetase (TiaS). This results in the completion of tRNA Ile2 with an agm2CAU anticodon (Ikeuchi et al., Nat Chem Biol (2010) 6(4):277-282). The anticodon of agm2CAU is known to specifically recognize only the isoleucine codon AUA. It is believed that only after the anticodon is modified to agm2CAU can isoleucyl-tRNA synthetase recognize tRNA Ile2 as a substrate, resulting in aminoacylation of tRNA Ile2 (addition of isoleucine). The amino acid sequence of TiaS from the archaea Methanosarcina acetivorans is shown in SEQ ID NO: 52.

[0024] <Definition of Substituents, etc.> In this disclosure, "alkyl" refers to a monovalent group derived from an aliphatic hydrocarbon by removing any one hydrogen atom, and does not contain heteroatoms or unsaturated carbon-carbon bonds in the backbone, and has a subset of hydrocarbyl or hydrocarbon group structures containing hydrogen and carbon atoms. The carbon chain length n ranges from 1 to 20, and examples of alkyl include C2-C 10Examples include alkyl, C1-C6 alkyl, and C1-C3 alkyl, and specific examples include methyl, ethyl, propyl, butyl, pentyl, hexyl, isopropyl, t-butyl, sec-butyl, 1-methylpropyl, 1,1-dimethylpropyl, 2,2-dimethylpropyl, 1,2-dimethylpropyl, 1,1,2-trimethylpropyl, 1,2,2-trimethylpropyl, 1,1,2,2-tetramethylpropyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl, 1-ethylbutyl, 2-ethylbutyl, isopentyl, and neopentyl.

[0025] In the present disclosure, "cycloalkyl" refers to a saturated or partially saturated cyclic monovalent aliphatic hydrocarbon group, including monocyclic, bicyclic, and spirocyclic rings. Examples of cycloalkyl include C3-C 10 Examples include cycloalkyl, specifically cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, bicyclo[2.2.1]heptyl, and the like.

[0026] In the present disclosure, "alkenyl" refers to a monovalent group having at least one double bond (two adjacent SP2 carbon atoms). Depending on the configuration of the double bond and any substituents, the geometry of the double bond can be in an entgegen (E) or zusammen (Z) configuration, a cis or trans configuration. Included are straight-chain or branched alkenyls, including straight-chains containing internal olefins. Alkenyls include, for example, C2-C 10 Alkenyl, C2-C6 alkenyl, etc., are exemplified, and specific examples include vinyl, allyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl (including cis and trans), 3-butenyl, pentenyl, hexenyl, etc.

[0027] In the present disclosure, "alkynyl" refers to a monovalent group having at least one triple bond (two adjacent SP carbon atoms). It includes straight-chain or branched-chain alkynyl, including internal alkylene. Examples of alkynyl include, for example, C2-C 10 alkynyl, C2-C6 alkynyl, etc., and specific examples thereof include ethynyl, 1-propynyl, propargyl, 3-butynyl, pentynyl, hexynyl, 3-phenyl-2-propynyl, 3-(2'-fluorophenyl)-2-propynyl, 2-hydroxy-2-propynyl, 3-(3-fluorophenyl)-2-propynyl, 3-methyl-(5-phenyl)-4-pentynyl, etc.

[0028] In the present disclosure, "aryl" refers to a monovalent aromatic hydrocarbon ring. Examples of aryl include C6-C 10 Examples include aryl, specifically phenyl, naphthyl (for example, 1-naphthyl, 2-naphthyl), and the like.

[0029] In the present disclosure, "heteroaryl" refers to a monovalent aromatic ring group containing a heteroatom among the atoms constituting the ring, and may be partially saturated. The ring may be a single ring or two condensed rings (e.g., a bicyclic heteroaryl condensed with benzene or a single ring heteroaryl). The number of atoms constituting the ring is, for example, 5-10 (5-membered to 10-membered heteroaryl). The number of heteroatoms contained among the atoms constituting the ring is, for example, 1-5. Specific examples of heteroaryl include furyl, thienyl, pyrrolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyrimidyl, pyridazinyl, pyrazinyl, triazinyl, benzofuranyl, benzothienyl, benzothiadiazolyl, benzothiazolyl, benzoxazolyl, benzoxadiazolyl, benzimidazolyl, indolyl, isoindolyl, indazolyl, quinolyl, isoquinolyl, cinnolinyl, quinazolinyl, quinoxalinyl, benzodioxolyl, indolizinyl, and imidazopyridyl.

[0030] In the present disclosure, "arylalkyl (aralkyl)" refers to a group containing both aryl and alkyl, for example, a group in which at least one hydrogen atom of the alkyl is substituted with an aryl. Examples of aralkyl include C5-C 10 aryl C1-C6 alkyl", and specific examples include benzyl.

[0031] In this disclosure, "alkylene" refers to a divalent group derived from the aforementioned "alkyl" by further removing one optional hydrogen atom, and may be straight-chain or branched. Examples of straight-chain alkylene include C2-C6 straight-chain alkylene and C4-C5 straight-chain alkylene, specifically, -CH2-, -(CH2)2-, -(CH2)3-, -(CH2)4-, -(CH2)5-, -(CH2)6-, etc. Examples of branched alkylene include C2-C6 branched alkylene and C4-C5 branched alkylene, specifically, -CH(CH3)CH2-, -C(CH3)2-, -CH(CH3)CH2CH2-, -C(CH3)2CH2-, -CH2CH(CH3)CH2-, -CH2C(CH3)2-, -CH2CH2CH(CH3)-, etc.

[0032] In the present disclosure, "alkenylene" refers to a divalent group derived from the "alkenyl" defined above by removing one optional hydrogen atom, and may be straight-chain or branched. Depending on the configuration of the double bond and substituents (if any), it may be in an entgegen (E) or zusammen (Z) configuration, a cis or trans configuration. Examples of straight-chain alkenylene include C2-C6 straight-chain alkenylene and C4-C5 straight-chain alkenylene, and specific examples include -CH=CH-, -CH=CHCH2-, -CH2CH=CH-, -CH=CHCH2CH2-, -CH2CH=CHCH2-, -CH2CH2CH=CH-, -CH2CH2CH=CH-, -CH2CH=CHCH2CH2-, -CH2CH2CH=CHCH2-, -CH2CH2CH=CH-, -CH2CH2CH=CHCH2-, -CH2CH2CH=CHCH2-, and -CH2CH2CH2CH=CH-.

[0033] In the present disclosure, "arylene" refers to a divalent group derived from the aryl by further removing one arbitrary hydrogen atom. The ring may be a single ring or a fused ring. The number of atoms constituting the ring is not particularly limited, but is, for example, 6 to 10 (C6-C 10 Specific examples of arylene include phenylene and naphthylene.

[0034] In the present disclosure, the term "heteroarylene" refers to a divalent group derived from the heteroaryl by further removing one arbitrary hydrogen atom. The ring may be a single ring or a fused ring. The number of atoms constituting the ring is not particularly limited, but is, for example, 5 to 10 (5- to 10-membered heteroarylene). Specific examples of heteroarylene include pyrrolediyl, imidazolediyl, pyrazolediyl, pyridinediyl, pyridazinediyl, pyrimidinediyl, pyrazinediyl, triazolediyl, triazinediyl, isoxazolediyl, oxazolediyl, oxadiazolediyl, isothiazolediyl, thiazolidinyl, thiadiazolediyl, furandiyl, and thiophenediyl.

[0035] In the present disclosure, the term "translation system" is defined as a concept that includes both a method for translating a peptide and a kit for translating a peptide. A translation system typically contains, as its components, ribosomes, translation factors, tRNA, amino acids, aminoacyl-tRNA synthetases (aaRSs), and factors necessary for the peptide translation reaction, such as ATP and GTP. The main types of translation systems include translation systems that utilize living cells and translation systems that utilize cell extracts (cell-free translation systems). Known examples of translation systems that utilize living cells include systems in which desired aminoacyl-tRNA and mRNA are introduced into living cells, such as Xenopus oocytes or mammalian cells, by microinjection or lipofection to perform peptide translation (Nowak et al., Science (1995) 268:439-442). Examples of cell-free translation systems include those using extracts from Escherichia coli (Chen et al., Methods Enzymol (1983) 101:674-690), yeast (Gasior et al., J Biol Chem (1979) 254:3965-3969), wheat germ (Erickson et al., Methods Enzymol (1983) 96:38-50), rabbit reticulocytes (Jackson et al., Methods Enzymol (1983) 96:50-74), HeLa cells (Barton et al., Methods Enzymol (1996) 275:35-57), or insect cells (Swerdel et al., Comp Biochem Physiol B (1989) 93:803-806). Such a translation system can be prepared appropriately by methods known to those skilled in the art or methods equivalent thereto. Cell-free translation systems also include translation systems constructed by isolating and purifying factors necessary for peptide translation and reconstituting them (reconstituted cell-free translation systems) (Shimizu et al., Nat Biotech (2001) 19:751-755).A reconstituted cell-free translation system typically contains ribosomes, amino acids, tRNA, aminoacyl-tRNA synthetase (aaRS), translation initiation factors (e.g., IF1, IF2, IF3), translation elongation factors (e.g., EF-Tu, EF-Ts, EF-G), translation termination factors (e.g., RF1, RF2, RF3), ribosome recycling factors (RRF), NTPs as an energy source, an energy regeneration system, and other factors necessary for translation. When a transcription reaction from DNA is also performed, RNA polymerase and other factors may also be included. The various factors contained in the cell-free translation system can be isolated and purified by methods well known to those skilled in the art, and a reconstituted cell-free translation system can be appropriately constructed using them. Alternatively, commercially available reconstituted cell-free translation systems such as PUREfrex® from Gene Frontier and PURExpress® from New England BioLabs can also be used. In the case of a reconstituted cell-free translation system, the desired translation system can be constructed by reconstituting only the necessary components of the translation system.

[0036] A specific combination of amino acid, tRNA, and aminoacyl-tRNA synthetase synthesizes an aminoacyl-tRNA, which is then used in peptide translation. Instead of the above combination, aminoacyl-tRNA can also be used directly as a component of the translation system. In particular, when amino acids that are difficult to aminoacylate with aminoacyl-tRNA synthetase, such as unnatural amino acids, are used in translation, it is preferable to use tRNAs that have already been aminoacylated with the unnatural amino acid as a component.

[0037] Translation is initiated by adding mRNA to a translation system. mRNA typically contains a sequence encoding the peptide of interest and may also contain sequences to increase the efficiency of the translation reaction (e.g., Shine-Dalgarno (SD) sequence in prokaryotes, Kozak sequence in eukaryotes, etc.). Pre-transcribed mRNA can be added directly to the system, or a promoter-containing template DNA and an appropriate RNA polymerase (e.g., T7 promoter and T7 RNA polymerase) can be added to the system instead of mRNA, allowing mRNA to be transcribed from the template DNA.

[0038] II. Compositions and Methods <Mutant tRNA> In one aspect, the present disclosure provides modified tRNAs. Specifically, the present invention provides mutant tRNAs prepared by modifying tRNAs. The modified tRNAs may be natural tRNAs derived from any organism (e.g., E. coli), or may be non-natural tRNAs artificially synthesized with a sequence different from that of natural tRNAs. Alternatively, the modified tRNAs may be artificially synthesized with the same sequence as natural tRNAs. In the present disclosure, all modifications introduced into tRNAs are artificial modifications, and the mutant tRNAs prepared by such modifications are characterized by having nucleic acid sequences that do not exist in nature.

[0039] In some embodiments, the term "modification of tRNA" used herein refers to the introduction of at least one or more modifications selected from the following group to one or more nucleosides constituting the tRNA: (i) addition (adding a new nucleoside to an existing tRNA), (ii) deletion (removing a nucleoside from an existing tRNA), (iii) substitution (replacing a nucleoside in an existing tRNA with another nucleoside), (iv) insertion (adding a new nucleoside between any two nucleosides in an existing tRNA), or (v) modification (changing a portion of the structure of a nucleoside in an existing tRNA (e.g., the base moiety or sugar moiety) to a different structure). The modification may be made to any part of the tRNA structure (e.g., the D arm, anticodon arm, T arm, acceptor stem, variable loop, etc.). In certain embodiments, the modification of tRNA used herein is made to the anticodon contained in the anticodon arm. In a further embodiment, the modification of the tRNA of the present disclosure is made to at least one of the first, second, and third nucleosides of the anticodon. According to the numbering rule for nucleosides in tRNA, the first, second, and third nucleosides of the anticodon correspond to positions 34, 35, and 36 of the tRNA, respectively. In this specification, the first, second, and third nucleosides of the anticodon may be referred to as N1, N2, and N3, respectively. In a specific embodiment, the modification of the tRNA of the present disclosure includes a modification made to the first nucleoside of the anticodon. The number of nucleosides modified in the tRNA of the present disclosure can be any number equal to or greater than one. In some embodiments, the number of modified nucleosides in a tRNA of the present disclosure is 20 or less, 15 or less, 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, 2 or less, or 1. In other embodiments, the nucleic acid sequence of the modified tRNA is 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identical to the nucleic acid sequence before modification.

[0040] In a specific embodiment, the modification of tRNA in the present disclosure means replacing one or more nucleosides constituting tRNA. With regard to the type of nucleoside, the substituted nucleoside may be any nucleoside present in natural tRNA, or any nucleoside (artificially synthesized nucleoside) not present in natural tRNA. Natural tRNA contains not only the four typical nucleosides adenosine, guanosine, cytidine, and uridine, but also variants (modified nucleosides) obtained by modifying them. In some embodiments, the nucleoside present in the natural tRNA can be selected from among the following nucleosides: adenosine (A), cytidine (C), guanosine (G), uridine (U), 1-methyladenosine (m1A), 2-methyladenosine (m2A), N6-isopentenyladenosine (i6A), 2-methylthio-N6-isopentenyladenosine (ms2i6A), N6-methyladenosine (m6A), N6- Threonylcarbamoyladenosine (N6-threonylcarbamoyladenosine; t6A), N6-methyl-N6-threonylcarbamoyladenosine (m6t6A), 2-methylthio-N6-threonylcarbamoyladenosine (ms2t6A), 2'-O-methyladenosine (Am), inosine (I), 1-methylinosine (m1I), 2'-O-ribosyladenosine(phosphate)Ar(p)), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-thiocytidine (s2C), 2'-O-methylcytidine (Cm), N4-acetylcytidine (ac4C), 5-methylcytidine (m5C), 3-methylcytidine (m3C), lysidine ( lysidine (k2C), 5-formylcytidine (f5C), 2'-O-methyl-5-formylcytidine (f5Cm), agmatidine (agm2C), 2'-O-ribosylguanosine(phosphate) (Gr(p)), 1-methylguanosine (m1G), N2-methylguanosine (N2-methylguanosine) ine (m2G), 2'-O-methylguanosine (Gm), N2,N2-dimethylguanosine (m22G), N2,N2,2'-O-trimethylguanosine (m22Gm), 7-methylguanosine (m7G), archaeosine (G*), queuosine (Q), mannosylqueuosine (mannosy) lqueuosine (manQ), galactosylqueuosine (galQ), wybutosine (yW), peroxywybutosine (o2yW), 5-methylaminomethyluridine (mnm5U), 2-thiouridine (s2U), 2'-O-methyluridine (Um), 4-thiouridine (4-thiouridines4U), 5-carbamoylmethyluridine (ncm5U), 5-methoxycarbonylmethyluridine (mcm5U), 5-methylaminomethyl-2-thiouridine (mnm5s2U), 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U), uridine 5-oxyacetic acid acid; cmo5U), 5-methoxyuridine (mo5U), 5-carboxymethylaminomethyluridine (cmnm5U), 5-carboxymethylaminomethyl-2-thiouridine (cmnm5s2U), 3-(3-amino-3-carboxypropyl)uridine (acp3U), 5-(carboxyhydroxymethyl)uridine methyl ester (5-(carboxyhydroxymethyl)uridinemethyl ester; mchm5U), 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm5Um), 5-carbamoylmethyl-2'-O-methyluridine (ncm5Um), dihydrouridine (D), pseudouridine (Ψ), 1-methylpseudouridine (m1Ψ), 2'-O-methylpseudouridine (Ψm), 5-methyluridine (m5U), 5-methyl-2-thiouridine (5-methyl-2-thiouridinem5s2U), 5,2'-O-dimethyluridine (m5Um). In certain embodiments, one or more nucleosides constituting the tRNA of the present disclosure are substituted with lysidine or agmatidine. Nucleoside derivatives obtained by modifying a part (e.g., the base portion) of the structure of the nucleoside present in the above-mentioned natural tRNA can also be used for substitution. In certain embodiments, one or more nucleosides constituting the tRNA of the present disclosure are substituted with a lysidine derivative or agmatidine derivative.

[0041] In the present disclosure, the tRNA to be modified can be appropriately selected from tRNAs having any nucleic acid sequence. In some embodiments, the tRNA is any of tRNA Ala, tRNA Arg, tRNA Asn, tRNA Asp, tRNA Cys, tRNA Gln, tRNA Glu, tRNA Gly, tRNA His, tRNA Ile, tRNA Leu, tRNA Lys, tRNA Met, tRNA Phe, tRNA Pro, tRNA Ser, tRNA Thr, tRNA Trp, tRNA Tyr, and tRNA Val. In addition to the 20 types of tRNAs listed above, tRNA fMet, tRNA Sec (selenocysteine), tRNA Pyl (pyrrolysine), tRNA AsnE2, and the like may also be used. In certain embodiments, the tRNA is any of tRNA Glu, tRNA Asp, and tRNA AsnE2. Exemplary nucleic acid sequences for some tRNAs are shown in SEQ ID NOS: 1 to 50. The term "tRNA body" is sometimes used to refer to the main portion of the tRNA (the main structural portion composed of nucleic acids).

[0042] In the present disclosure, tRNA may be expressed as follows: "tRNA Xxx" or "tRNA(Xxx)" indicates the full-length tRNA corresponding to amino acid Xxx (e.g., tRNA Glu or tRNA(Glu)). "tRNA(Xxx)nnn": This refers to a tRNA (full length) that corresponds to amino acid Xxx and has the anticodon sequence nnn (e.g., tRNA(Glu)uga, tRNA(Glu)Lga, etc.). "tRNA(Xxx)nnn-CA": This refers to a tRNA corresponding to amino acid Xxx, with the anticodon sequence nnn (the CA sequence at the 3' end has been removed) (e.g., tRNA(Glu)uga-CA, tRNA(Glu)Lga-CA, etc.).

[0043] In a specific embodiment, the modification of tRNA in the present disclosure includes substituting the first nucleoside (N1) of the anticodon with lysidine, a lysidine derivative, agmatidine, or an agmatidine derivative. Here, the term "lysidine derivative" refers to a molecule prepared by modifying a portion of the lysidine structure (e.g., the base portion), which, when used as part of the anticodon, has the same codon discrimination ability (ability to form complementary base pairs) as lysidine. Furthermore, the term "agmatidine derivative" refers to a molecule prepared by modifying a portion of the agmatidine structure (e.g., the base portion), which, when used as part of the anticodon, has the same codon discrimination ability (ability to form complementary base pairs) as agmatidine.

[0044] Lysidine in natural tRNA is synthesized by the action of an enzyme called tRNA Ile-lysidine synthetase (TilS). TilS specifically recognizes a tRNA corresponding to isoleucine (tRNA Ile2) as a substrate and has the activity of modifying (converting) the cytidine (C) in the first letter (N1) of the anticodon to lysidine (k2C). The lysidine in the tRNA of the present disclosure may be synthesized via TilS or may be synthesized without the intervention of TilS.

[0045] In the former case (when lysidine is synthesized via TilS), the tRNA of the present disclosure can be recognized as a substrate by TilS. That is, if the N1 of the tRNA before modification is cytidine, the cytidine can be modified to lysidine by TilS. Whether cytidine at N1 of a certain tRNA can be modified to lysidine by TilS can be confirmed, for example, by preparing TilS by genetic engineering techniques or extracting TilS from biological materials, reacting it with a tRNA whose N1 is cytidine under appropriate conditions, and then detecting lysidine in the reaction product (see, for example, Suzuki et al., FEBS Lett (2010) 584:272-277). Alternatively, it can be confirmed by introducing a tRNA whose N1 is cytidine into cells that endogenously express TilS or cells in which TilS has been expressed by genetic engineering techniques, reacting it with intracellular TilS under appropriate conditions, and then detecting lysidine contained in the tRNA. In one embodiment of the present disclosure, when N1 in a tRNA before modification is cytidine, the modification of the cytidine to lysidine can be catalyzed by TilS.

[0046] On the other hand, in the latter case (when lysidine is synthesized without the intervention of TilS), the tRNA of the present disclosure cannot be recognized as a substrate by TilS. That is, even if the N1 in the tRNA before modification is cytidine, the cytidine cannot be modified to lysidine by TilS. In this case, lysidine and a tRNA containing it can be synthesized by a method that does not use TilS (e.g., a chemical synthesis method). An example of such a synthesis method is shown in the Examples below. In one embodiment of the present disclosure, when the N1 in the tRNA before modification is cytidine, the modification of the cytidine to lysidine cannot be catalyzed by TilS. A state in which TilS cannot catalyze the conversion of cytidine to lysidine can be expressed as a state in which, when 10 μg / mL TilS is reacted with 1 μM tRNA in 100 mM Hepes-KOH (pH 8.0), 10 mM KCl, 10 mM MgCl2, 2 mM DTT, 2 mM ATP, and 100 μM lysine for 2 hours at 37°C, the activity of TilS to convert cytidine in the natural substrate tRNA Ile2 to lysidine is set to 1, and the activity of TilS to convert cytidine in the target tRNA to lysidine is reduced by 10-fold or more, 20-fold or more, 40-fold or more, 100-fold or more, 200-fold or more, or 400-fold or more. If the catalytic activity of TilS is reduced, the resulting target product will be of low purity, containing a large amount of unmodified tRNA whose N1 remains cytidine. Therefore, it is considered advantageous to synthesize lysidine by a method that does not use TilS (e.g., chemical synthesis) rather than by a method that uses TilS. In a specific embodiment, the TilS is TilS derived from Escherichia coli. In a further embodiment, the TilS is wild-type TilS derived from Escherichia coli having the amino acid sequence of SEQ ID NO: 51.

[0047] It has also been reported that TilS maintains a certain degree of lysidine synthesis ability even for tRNA after some nucleosides in tRNA Ile2 have been modified to other nucleosides (Ikeuchi et al., Mol Cell (2005) 19:235-246).

[0048] Agmatidine in natural tRNA is synthesized by the action of an enzyme called tRNA Ile-agmatidine synthetase (TiaS). TiaS specifically recognizes tRNA corresponding to isoleucine (tRNA Ile2) as a substrate and has the activity of modifying (converting) the cytidine (C) in the first letter (N1) of the anticodon to agmatidine (agm2C). Agmatidine in the tRNA of the present disclosure may be synthesized via TiaS or may be synthesized without the intervention of TiaS.

[0049] In the former case (when agmatidine is synthesized via TiaS), the tRNA of the present disclosure can be recognized as a substrate by TiaS. That is, if the N1 of the tRNA before modification is cytidine, the cytidine can be modified to agmatidine by TiaS. Whether cytidine at N1 of a certain tRNA can be modified to agmatidine by TiaS can be confirmed, for example, by preparing TiaS by genetic engineering techniques or extracting TiaS from biological materials, reacting it with a tRNA whose N1 is cytidine under appropriate conditions, and then detecting agmatidine in the reaction product (see, for example, Ikeuchi et al., Nat Chem Biol (2010) 6(4):277-282). Alternatively, agmatidine can be detected by introducing a tRNA whose N1 is cytidine into cells that endogenously express TiaS or cells in which TiaS is expressed by recombinant techniques, allowing the tRNA to react with intracellular TiaS under appropriate conditions, and then detecting the agmatidine contained in the tRNA. In one embodiment of the present disclosure, when the N1 of the tRNA before modification is cytidine, the modification of the cytidine to agmatidine can be catalyzed by TiaS.

[0050] On the other hand, in the latter case (when agmatidine is synthesized without the intervention of TiaS), the tRNA of the present disclosure cannot be recognized as a substrate by TiaS. That is, even if the N1 in the tRNA before modification is cytidine, the cytidine cannot be modified to agmatidine by TiaS. In this case, agmatidine and a tRNA containing agmatidine can be synthesized by a method that does not use TiaS (e.g., a chemical synthesis method). In one embodiment of the present disclosure, when the N1 in the tRNA before modification is cytidine, the modification of the cytidine to agmatidine cannot be catalyzed by TiaS. A state in which the modification of cytidine to agmatidine cannot be catalyzed by TiaS can be expressed, for example, as a state in which, when the activity of TiaS to modify cytidine in its natural substrate, tRNA Ile2, to agmatidine is set to 1, the activity of TiaS to modify cytidine in a target tRNA to agmatidine is reduced by 10-fold or more, 20-fold or more, 40-fold or more, 100-fold or more, 200-fold or more, or 400-fold or more. When the catalytic activity of TiaS is reduced, the target product obtained is of low purity, containing a large amount of unmodified tRNA in which N1 remains cytidine. Therefore, it is considered advantageous to synthesize agmatidine by a method that does not use TiaS (e.g., chemical synthesis) rather than by a method that uses TiaS. In a specific embodiment, the TiaS is derived from archaea. In a further embodiment, the TiaS is a wild-type TiaS from the archaeon Methanosarcina acetivorans having the amino acid sequence of SEQ ID NO:52.

[0051] It has also been reported that TiaS maintains a certain level of agmatidine synthesis ability even after some nucleosides in tRNA Ile2 have been modified to other nucleosides (Osawa et al., Nat Struct Mol Biol (2011) 18:1275-1280).

[0052] In some embodiments, the mutant tRNA of the present disclosure is an initiator tRNA or an elongator tRNA. The mutant tRNA may be prepared by modifying an initiator tRNA or an elongator tRNA, or the mutant tRNA prepared by modification may function as an initiator tRNA or an elongator tRNA. Whether a certain tRNA functions as an initiator tRNA can be determined by whether, when the tRNA is used in a translation system, it (i) is introduced into a ribosome via IF2 and (ii) can initiate peptide translation using an amino acid bound to the tRNA as an initiator amino acid. Furthermore, whether a certain tRNA functions as an elongator tRNA can be determined by whether, when the tRNA is used in a translation system, it (i) is introduced into a ribosome via EF-Tu and (ii) can incorporate an amino acid bound to the tRNA into a peptide chain to elongate the peptide chain.

[0053] In some embodiments, the mutant tRNA of the present disclosure is a tRNA derived from a prokaryote or a tRNA derived from a eukaryote. The mutant tRNA may be generated by modifying a tRNA derived from a prokaryote or a eukaryote, or the mutant tRNA generated by modification may have the highest nucleic acid sequence identity with a tRNA derived from a prokaryote or a tRNA derived from a eukaryote. Eukaryotes are further classified into animals, plants, fungi, and protists. The mutant tRNA of the present disclosure may be, for example, a tRNA derived from humans. Prokaryotes are further classified into eubacteria and archaea. Examples of eubacteria include Escherichia coli, Bacillus subtilis, lactic acid bacteria, and Desulfitobacterium hafniense. Examples of archaea include extreme halophiles, thermophiles, and methanogens (e.g., Methanosarcina mazei, Methanosarcina barkeri, and Methanocaldococcus jannaschii). The mutant tRNA of the present disclosure may be, for example, a tRNA derived from Escherichia coli, Desulfitobacterium hafniense, or Methanosarcina mazei.

[0054] In some embodiments, the mutant tRNA of the present disclosure can translate a codon represented by M1M2A. Here, the first nucleoside (M1) and the second nucleoside (M2) of the codon are independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U), and the third nucleoside is adenosine. In another embodiment, the mutant tRNA of the present disclosure has an anticodon complementary to a specific codon represented by M1M2A. In certain embodiments, the mutant tRNA of the present disclosure has an anticodon represented by k2CN2N3 or agm2CN2N3. Here, the first nucleoside of the anticodon is lysidine (k2C) or agmatidine (agm2C), and the second nucleoside (N2) and the third nucleoside (N3) are nucleosides complementary to the above-mentioned M2 and M1, respectively. Lysidine and agmatidine are both known as nucleosides that bind complementary to adenosine. In a further embodiment, N2 and N3 can be independently selected from adenosine (A), guanosine (G), cytidine (C), and uridine (U). Specifically, when M2 (or M1) is adenosine, N2 (or N3) is uridine. When M2 (or M1) is guanosine, N2 (or N3) is cytidine. When M2 (or M1) is cytidine, N2 (or N3) is guanosine. When M2 (or M1) is uridine, N2 (or N3) is adenosine.

[0055] In the context of the present disclosure, the embodiment that "a certain tRNA can translate a specific codon" essentially encompasses the embodiment that "a certain tRNA has an anticodon complementary to a specific codon," and these expressions are interchangeable as long as they refer to the sequence of the anticodon on the tRNA.

[0056] The first nucleoside (M1) and the second nucleoside (M2) of a codon that can be translated by a mutant tRNA of the present disclosure can be selected from the first nucleoside (M1) and the second nucleoside (M2) of a codon that constitutes a specific codon box in the genetic code table. In a specific embodiment, the genetic code table is a standard genetic code table. In another embodiment, the genetic code table is a natural genetic code table.

[0057] In one embodiment, M1 and M2 can be selected from M1 and M2 of codons constituting a codon box in which a codon whose third letter is A and a codon whose third letter is G both encode the same amino acid. As an example, in a codon box represented by UUN, a codon whose third letter is A (UUA) and a codon whose third letter is G (UUG) both encode the same amino acid (Leu), and therefore the first nucleoside (U) and the second nucleoside (U) in the codons constituting the codon box can be selected as M1 and M2, respectively.

[0058] In one embodiment, M1 and M2 can be selected from M1 and M2 of codons constituting a codon box in which a codon whose third letter is U and a codon whose third letter is A both encode the same amino acid. As an example, in a codon box represented by AUN, a codon whose third letter is U (AUU) and a codon whose third letter is A (AUA) both encode the same amino acid (Ile), and therefore the first nucleoside (A) and the second nucleoside (U) in the codons constituting the codon box can be selected as M1 and M2, respectively.

[0059] In one embodiment, M1 and M2 can be selected from M1 and M2 of codons constituting a codon box in which the codon whose third letter is U, the codon whose third letter is C, the codon whose third letter is A, and the codon whose third letter is G all encode the same amino acid. As an example, in a codon box represented by UCN, the codon whose third letter is U (UCU), the codon whose third letter is C (UCC), the codon whose third letter is A (UCA), and the codon whose third letter is G (UCG) all encode the same amino acid (Ser), so the first nucleoside (U) and the second nucleoside (C) in the codons constituting the codon box can be selected as M1 and M2, respectively.

[0060] In one embodiment, M1 and M2 can be selected from M1 and M2 of codons constituting a codon box in which a codon whose third letter is A and a codon whose third letter is G encode different amino acids. As an example, in a codon box represented by AUN, a codon whose third letter is A (AUA) and a codon whose third letter is G (AUG) encode different amino acids (Ile and Met), and therefore the first nucleoside (A) and the second nucleoside (U) in the codons constituting the codon box can be selected as M1 and M2, respectively.

[0061] In one embodiment, M1 and M2 can be selected from M1 and M2 of codons constituting a codon box in which the codon whose third letter is A and / or the codon whose third letter is G is a stop codon. As an example, in a codon box represented by UGN, the codon whose third letter is A (UGA) is a stop codon (opal), so the first nucleoside (U) and the second nucleoside (G) in the codons constituting the codon box can be selected as M1 and M2, respectively.

[0062] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons that constitute a codon box represented by UUN. Specifically, the first nucleoside (U) and the second nucleoside (U) in the codon can be selected as M1 and M2, respectively.

[0063] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons that constitute a codon box represented by UCN. Specifically, the first nucleoside (U) and the second nucleoside (C) in the codon can be selected as M1 and M2, respectively.

[0064] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons that constitute a codon box represented by UAN. Specifically, the first nucleoside (U) and the second nucleoside (A) in the codon can be selected as M1 and M2, respectively.

[0065] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons that constitute a codon box represented by UGN. Specifically, the first nucleoside (U) and the second nucleoside (G) in the codon can be selected as M1 and M2, respectively.

[0066] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons that constitute a codon box represented by CUN. Specifically, the first nucleoside (C) and the second nucleoside (U) in the codon can be selected as M1 and M2, respectively.

[0067] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons that constitute a codon box represented by CCN. Specifically, the first nucleoside (C) and the second nucleoside (C) in the codon can be selected as M1 and M2, respectively.

[0068] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons that constitute a codon box represented by C-A-N. Specifically, the first nucleoside (C) and the second nucleoside (A) in the codon can be selected as M1 and M2, respectively.

[0069] In a further embodiment, M1 and M2 can be selected from the M1 and M2 codons constituting a codon box represented by CGN. Specifically, the first nucleoside (C) and the second nucleoside (G) in the codon can be selected as M1 and M2, respectively.

[0070] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons that constitute a codon box represented by AUN. Specifically, the first nucleoside (A) and the second nucleoside (U) in the codon can be selected as M1 and M2, respectively.

[0071] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons constituting a codon box represented by ACN. Specifically, the first nucleoside (A) and the second nucleoside (C) in the codon can be selected as M1 and M2, respectively.

[0072] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons that constitute a codon box represented by AAN. Specifically, the first nucleoside (A) and the second nucleoside (A) in the codon can be selected as M1 and M2, respectively.

[0073] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of the codons that constitute the codon box represented by AGN. Specifically, the first nucleoside (A) and the second nucleoside (G) in the codon can be selected as M1 and M2, respectively.

[0074] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons constituting a codon box represented by GUN. Specifically, the first nucleoside (G) and the second nucleoside (U) in the codon can be selected as M1 and M2, respectively.

[0075] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons that constitute a codon box represented by GCN. Specifically, the first nucleoside (G) and the second nucleoside (C) in the codon can be selected as M1 and M2, respectively.

[0076] In a further embodiment, M1 and M2 can be selected from the M1 and M2 of codons constituting a codon box represented by GAN. Specifically, the first nucleoside (G) and the second nucleoside (A) in the codon can be selected as M1 and M2, respectively.

[0077] In a further embodiment, M1 and M2 can be selected from the M1 and M2 codons that constitute a codon box represented by GGN. Specifically, the first nucleoside (G) and the second nucleoside (G) in the codon can be selected as M1 and M2, respectively.

[0078] The third nucleoside (N3) and the second nucleoside (N2) of the anticodon in the mutant tRNA of the present disclosure can be selected as nucleosides complementary to M1 and M2, respectively.

[0079] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (U) and the second nucleoside (U) in a codon constituting a codon box represented by UUN. Specifically, A can be selected as N3 and A can be selected as N2.

[0080] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (U) and the second nucleoside (C) in a codon constituting a codon box represented by UCN. Specifically, A can be selected as N3, and G can be selected as N2.

[0081] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (U) and the second nucleoside (A) in a codon constituting a codon box represented by UAN. Specifically, A can be selected as N3 and U can be selected as N2.

[0082] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (U) and the second nucleoside (G) in the codon constituting the codon box represented by UGN. Specifically, A can be selected as N3, and C can be selected as N2.

[0083] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (C) and the second nucleoside (U) in a codon constituting a codon box represented by CUN. Specifically, G can be selected as N3, and A can be selected as N2.

[0084] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first and second nucleosides (C) in a codon constituting a codon box represented by CCN. Specifically, G can be selected as N3 and G can be selected as N2.

[0085] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (C) and the second nucleoside (A) in a codon constituting a codon box represented by C-A-N. Specifically, G can be selected as N3, and U can be selected as N2.

[0086] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (C) and the second nucleoside (G) in the codon constituting the codon box represented by CGN. Specifically, G can be selected as N3 and C can be selected as N2.

[0087] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (A) and the second nucleoside (U) in a codon constituting a codon box represented by AUN. Specifically, U can be selected as N3, and A can be selected as N2.

[0088] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (A) and the second nucleoside (C) in a codon constituting a codon box represented by ACN. Specifically, U can be selected as N3, and G can be selected as N2.

[0089] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (A) and the second nucleoside (A) in a codon constituting a codon box represented by AAN. Specifically, U can be selected as N3 and U can be selected as N2.

[0090] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (A) and the second nucleoside (G) in the codon constituting the codon box represented by AGN. Specifically, U can be selected as N3, and C can be selected as N2.

[0091] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (G) and the second nucleoside (U) in a codon constituting a codon box represented by GUN. Specifically, C can be selected as N3, and A can be selected as N2.

[0092] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (G) and the second nucleoside (C) in a codon constituting a codon box whose codon is represented by GCN. Specifically, C can be selected as N3, and G can be selected as N2.

[0093] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (G) and the second nucleoside (A) in the codon constituting the codon box represented by GAN. Specifically, C can be selected as N3 and U can be selected as N2.

[0094] In one embodiment, N3 and N2 can be selected as nucleosides complementary to the first nucleoside (G) and the second nucleoside (G) in a codon constituting a codon box represented by GGN. Specifically, C can be selected as N3 and C can be selected as N2.

[0095] In some embodiments, an amino acid or amino acid analog is bound to the mutant tRNA of the present disclosure. The amino acid or amino acid analog is usually bound to the 3'-terminus of the tRNA, more specifically, to the adenosine residue of the CCA sequence at the 3'-terminus. The specific type of amino acid or amino acid analog bound to the mutant tRNA can be appropriately selected from the amino acids or amino acid analogs listed below.

[0096] In the present disclosure, amino acids include α-amino acids, β-amino acids, γ-amino acids, etc. Both L-amino acids and D-amino acids are included in the three-dimensional structure. Furthermore, in the present disclosure, amino acids include natural amino acids and unnatural amino acids. In certain embodiments, the natural amino acids consist of the following 20 α-amino acids: glycine (Gly), alanine (Ala), serine (Ser), threonine (Thr), valine (Val), leucine (Leu), isoleucine (Ile), phenylalanine (Phe), tyrosine (Tyr), tryptophan (Trp), histidine (His), glutamic acid (Glu), aspartic acid (Asp), glutamine (Gln), asparagine (Asn), cysteine ​​(Cys), methionine (Met), lysine (Lys), arginine (Arg), and proline (Pro). Alternatively, the naturally occurring amino acids of the present disclosure may be any of the 20 amino acids excluding one or more amino acids. In one embodiment, the naturally occurring amino acids consist of 19 amino acids excluding isoleucine. In one embodiment, the naturally occurring amino acids consist of 19 amino acids excluding methionine. In a further embodiment, the naturally occurring amino acids consist of 18 amino acids excluding isoleucine and methionine. Naturally occurring amino acids are usually L-amino acids.

[0097] In the present disclosure, unnatural amino acids refer to all amino acids other than the 20 naturally occurring α-amino acids. Examples of unnatural amino acids include β-amino acids, γ-amino acids, D-amino acids, α-amino acids with side chains different from those of naturally occurring amino acids, α,α-disubstituted amino acids, and amino acids with a substituent in the main chain amino group (N-substituted amino acids). The side chains of unnatural amino acids are not particularly limited and may contain, in addition to hydrogen atoms, for example, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, cycloalkyl, etc. In addition, in the case of α,α-disubstituted amino acids, the two side chains may form a ring. Furthermore, these side chains may contain one or more substituents. In certain embodiments, the substituents can be selected from any functional group including a halogen atom, an O atom, a S atom, a N atom, a B atom, a Si atom, or a P atom. For example, in the present disclosure, "C1-C6 alkyl having a halogen atom as a substituent" means "C1-C6 alkyl" in which at least one hydrogen atom in the alkyl is substituted with a halogen atom, and specifically includes, for example, trifluoromethyl, difluoromethyl, fluoromethyl, pentafluoroethyl, tetrafluoroethyl, trifluoroethyl, difluoroethyl, fluoroethyl, trichloromethyl, dichloromethyl, chloromethyl, pentachloroethyl, tetrachloroethyl, trichloroethyl, dichloroethyl, chloroethyl, etc. 10 "Aryl C1-C6 alkyl" refers to a "C5-C" alkyl group in which at least one hydrogen atom in the aryl and / or alkyl is replaced by a substituent. 10 "Aryl C1-C6 alkyl" refers to "having two or more substituents." Furthermore, "having two or more substituents" also includes having a functional group (e.g., a functional group containing an S atom) as a substituent, and that functional group further having another substituent (e.g., a substituent such as amino or halogen). Specific examples of unnatural amino acids can be found in WO2013 / 100132 and WO2018 / 143145.

[0098] The amino group in the main chain of an unnatural amino acid may be an unsubstituted amino group (NH group) or a substituted amino group (NHR group). Here, R represents alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, or cycloalkyl, each of which may have a substituent. Alternatively, as in proline, the carbon chain bonded to the N atom of the amino group in the main chain and the carbon atom at the α-position may form a ring. The substituent can be selected from any functional group containing a halogen atom, O atom, S atom, N atom, B atom, Si atom, or P atom. Examples of alkyl substitution of an amino group include N-methylation, N-ethylation, N-propylation, and N-butylation, and examples of aralkyl substitution include N-benzylation. Specific examples of N-methylamino acids include N-methylalanine, N-methylglycine, N-methylphenylalanine, N-methyltyrosine, N-methyl-3-chlorophenylalanine, N-methyl-4-chlorophenylalanine, N-methyl-4-methoxyphenylalanine, N-methyl-4-thiazolealanine, N-methylhistidine, N-methylserine, and N-methylaspartic acid.

[0099] Examples of substituents containing halogen atoms include fluoro (-F), chloro (-Cl), bromo (-Br), iodo (-I), and the like.

[0100] Examples of substituents containing an O atom include hydroxyl (-OH), oxy (-OR), carbonyl (-C=OR), carboxyl (-COH), oxycarbonyl (-C=O-OR), carbonyloxy (-OC=OR), thiocarbonyl (-C=O-SR), carbonylthio (-SC=OR), aminocarbonyl (-C=O-NHR), carbonylamino (-NH-C=OR), oxycarbonylamino (-NH-C=O-OR), sulfonylamino (-NH-SO-R), aminosulfonyl (-SO-NHR), sulfamoylamino (-NH-SO-NHR), thiocarboxyl (-C(=O)-SH), carboxylcarbonyl (-C(=O)-COH), and the like.

[0101] Examples of oxy (-OR) include alkoxy, cycloalkoxy, alkenyloxy, alkynyloxy, aryloxy, heteroaryloxy, aralkyloxy, and the like.

[0102] Examples of carbonyl (-C=OR) include formyl (-C=OH), alkylcarbonyl, cycloalkylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, arylcarbonyl, heteroarylcarbonyl, aralkylcarbonyl, and the like.

[0103] Examples of oxycarbonyl (-C=O-OR) include alkyloxycarbonyl, cycloalkyloxycarbonyl, alkenyloxycarbonyl, alkynyloxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl, aralkyloxycarbonyl, and the like.

[0104] Examples of carbonyloxy (-OC=OR) include alkylcarbonyloxy, cycloalkylcarbonyloxy, alkenylcarbonyloxy, alkynylcarbonyloxy, arylcarbonyloxy, heteroarylcarbonyloxy, aralkylcarbonyloxy, and the like.

[0105] Examples of thiocarbonyl (-C=O-SR) include alkylthiocarbonyl, cycloalkylthiocarbonyl, alkenylthiocarbonyl, alkynylthiocarbonyl, arylthiocarbonyl, heteroarylthiocarbonyl, aralkylthiocarbonyl, and the like.

[0106] Examples of carbonylthio (-SC=OR) include alkylcarbonylthio, cycloalkylcarbonylthio, alkenylcarbonylthio, alkynylcarbonylthio, arylcarbonylthio, heteroarylcarbonylthio, aralkylcarbonylthio, and the like.

[0107] Examples of aminocarbonyl (-C=O-NHR) include alkylaminocarbonyl, cycloalkylaminocarbonyl, alkenylaminocarbonyl, alkynylaminocarbonyl, arylaminocarbonyl, heteroarylaminocarbonyl, aralkylaminocarbonyl, etc. Furthermore, the H atom bonded to the N atom in -C=O-NHR may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl.

[0108] Examples of carbonylamino (-NH-C=OR) include alkylcarbonylamino, cycloalkylcarbonylamino, alkenylcarbonylamino, alkynylcarbonylamino, arylcarbonylamino, heteroarylcarbonylamino, aralkylcarbonylamino, etc. Furthermore, the H atom bonded to the N atom in -NH-C=OR may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl.

[0109] Examples of oxycarbonylamino (-NH-C=O-OR) include alkoxycarbonylamino, cycloalkoxycarbonylamino, alkenyloxycarbonylamino, alkynyloxycarbonylamino, aryloxycarbonylamino, heteroaryloxycarbonylamino, aralkyloxycarbonylamino, etc. Furthermore, the H atom bonded to the N atom in -NH-C=O-OR may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl.

[0110] Examples of sulfonylamino (-NH-SO-R) include alkylsulfonylamino, cycloalkylsulfonylamino, alkenylsulfonylamino, alkynylsulfonylamino, arylsulfonylamino, heteroarylsulfonylamino, aralkylsulfonylamino, etc. Furthermore, the H atom bonded to the N atom in -NH-SO-R may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl.

[0111] Examples of aminosulfonyl (-SO2-NHR) include alkylaminosulfonyl, cycloalkylaminosulfonyl, alkenylaminosulfonyl, alkynylaminosulfonyl, arylaminosulfonyl, heteroarylaminosulfonyl, aralkylaminosulfonyl, etc. Furthermore, the H atom bonded to the N atom in -SO2-NHR may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl.

[0112] Examples of sulfamoylamino (-NH-SO-NHR) include alkylsulfamoylamino, cycloalkylsulfamoylamino, alkenylsulfamoylamino, alkynylsulfamoylamino, arylsulfamoylamino, heteroarylsulfamoylamino, and aralkylsulfamoylamino. Furthermore, at least one of the two H atoms bonded to the N atom in -NH-SO-NHR may be substituted with a substituent selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. When both H atoms are substituted, the substituents may be independently selected, and these two substituents may form a ring.

[0113] Examples of substituents containing an S atom include thiol (-SH), thio (-SR), sulfinyl (-S=OR), sulfonyl (-S(O)2-R), and sulfo (-SO3H).

[0114] Examples of thio (-SR) include alkylthio, cycloalkylthio, alkenylthio, alkynylthio, arylthio, heteroarylthio, aralkylthio, and the like.

[0115] Examples of sulfinyl (-S=OR) include alkylsulfinyl, cycloalkylsulfinyl, alkenylsulfinyl, alkynylsulfinyl, arylsulfinyl, heteroarylsulfinyl, aralkylsulfinyl, and the like.

[0116] Examples of sulfonyl (-S(O)2-R) include alkylsulfonyl, cycloalkylsulfonyl, alkenylsulfonyl, alkynylsulfonyl, arylsulfonyl, heteroarylsulfonyl, aralkylsulfonyl, and the like.

[0117] Examples of substituents containing an N atom include azido (-N3), cyano (-CN), primary amino (-NH2), secondary amino (-NH-R), tertiary amino (-NR(R')), amidino (-C(=NH)-NH2), substituted amidino (-C(=NR)-NR'R''), guanidino (-NH-C(=NH)-NH2), substituted guanidino (-NR-C(=NR''')-NR'R''), aminocarbonylamino (-NR-CO-NR'R''), and the like.

[0118] Examples of secondary amino (-NH-R) include alkylamino, cycloalkylamino, alkenylamino, alkynylamino, arylamino, heteroarylamino, aralkylamino, and the like.

[0119] The two substituents R and R' on the N atom of the tertiary amino (-NR(R')) can be independently selected from the group consisting of alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. Examples of tertiary amino include alkyl(aralkyl)amino. These two substituents may form a ring.

[0120] The three substituents R, R', and R'' on the N atom of the substituted amidino (-C(=NR)-NR'R'') can be independently selected from the group consisting of a hydrogen atom, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. Examples of the substituted amidino include alkyl(aralkyl)(aryl)amidino. These substituents may join together to form a ring.

[0121] The four substituents R, R', R'', and R''' on the N atom of the substituted guanidino (-NR-C(=NR''')-NR'R'') can be independently selected from the group consisting of a hydrogen atom, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. These substituents may join together to form a ring.

[0122] The three substituents R, R', and R'' on the N atom of aminocarbonylamino (-NR-CO-NR'R'') can be independently selected from the group consisting of a hydrogen atom, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. These substituents may join together to form a ring.

[0123] Examples of substituents containing a B atom include boranyl (-BR(R’)) and dioxaborolyl (-B(OR)(OR’)). The two substituents R and R’ on the B atom can each be independently selected from the group consisting of a hydrogen atom, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, heteroaryl, and aralkyl. These substituents may form a ring with each other.

[0124] Examples of the amino acid analogs in the present disclosure include, for example, hydroxycarboxylic acids (hydroxy acids). Hydroxycarboxylic acids include α-hydroxycarboxylic acids, β-hydroxycarboxylic acids, γ-hydroxycarboxylic acids, etc. A side chain other than a hydrogen atom may be bonded to the carbon at the α-position in the hydroxycarboxylic acid, similar to an amino acid. As the stereostructure, both L-type and D-type may be included. The structure of the side chain can be defined in the same manner as the side chains of the above-mentioned natural amino acids or non-natural amino acids. Examples of hydroxycarboxylic acids include hydroxyacetic acid, lactic acid, phenyl lactic acid, etc.

[0125] The amino acids in the present disclosure may be translatable amino acids, and the amino acid analogs may be translatable amino acid analogs. As used herein, a "translatable" amino acid or amino acid analog (sometimes collectively referred to as amino acids, etc.) means an amino acid, etc. that can be incorporated into a peptide by translation synthesis (for example, using the translation system described in the present disclosure). Whether a certain amino acid, etc. is translatable can be confirmed by a translation synthesis experiment using tRNA to which the amino acid, etc. is bound. A reconstituted cell-free translation system may be used for the translation synthesis experiment (for example, see WO2013100132).

[0126] The non-natural amino acids and amino acid analogs in the present disclosure can be prepared by conventionally known chemical synthesis methods, the synthesis methods described in the examples below, or synthesis methods similar thereto.

[0127] <Preparation of tRNA> tRNA can be synthesized, for example, by preparing DNA encoding the desired tRNA gene, placing an appropriate promoter such as T7, T3, or SP6 upstream of the gene, and then performing a transcription reaction using the DNA as a template with an RNA polymerase appropriate for each promoter. tRNA can also be prepared by purification from biological materials. For example, tRNA can be recovered by preparing an extract from a tRNA-containing material, such as cells, and adding a probe containing a sequence complementary to the tRNA nucleic acid sequence. In this case, an expression vector capable of expressing the desired tRNA can be prepared, and cells transformed with the expression vector can be used as the source material. tRNA synthesized by in vitro transcription typically contains only the four typical nucleosides: adenosine, guanosine, cytidine, and uridine. On the other hand, tRNA synthesized intracellularly may also contain modified nucleosides. Modified nucleosides (e.g., lysidine) in natural tRNAs are thought to be specifically introduced into the tRNAs after they have been synthesized by transcription by the action of enzymes that perform the modification (e.g., TilS). Alternatively, tRNAs can also be prepared by a method in which fragments synthesized by transcription or, as described in the Examples below, chemically synthesized fragments are linked by an enzymatic reaction.

[0128] Aminoacyl-tRNAs can also be prepared by chemical and / or biological synthesis. For example, aminoacyl-tRNAs can be synthesized by attaching an amino acid to a tRNA using an aminoacyl-tRNA synthetase (ARS). The amino acid can be a natural or unnatural amino acid, as long as it can serve as a substrate for the ARS. Alternatively, a natural amino acid can be attached to the tRNA and then chemically modified. Numerous reports have also shown that the activity of an ARS with unnatural amino acids can be enhanced by introducing amino acid mutations into the ARS (see, for example, WO2006 / 135096, WO2007 / 061136, WO2007 / 103307, WO2008 / 001947, WO2010 / 141851, WO2015 / 120287, etc.). An amino acid can also be attached to a tRNA using such a mutant ARS. In addition to the ARS method, aminoacyl-tRNA can be synthesized by removing the CA sequence from the 3' end of tRNA and then attaching aminoacylated pdCpA (a dinucleotide composed of deoxycytidine and adenosine) to the tRNA using RNA ligase (pdCpA method; Hecht et al., J Biol Chem (1978) 253:4517-4520). A method using pCpA (a dinucleotide composed of cytidine and adenosine) instead of pdCpA is also known (pCpA method; Wang et al., ACS Chem Biol (2015) 10:2187-2192). Aminoacyl-tRNA can also be synthesized by attaching a non-natural amino acid, which has been activated by esterification, to tRNA using an artificial RNA catalyst (flexizyme) (WO 2007 / 066627).

[0129] <Translation> In one aspect, the present disclosure provides a set of tRNAs suitable for peptide translation. The set of tRNAs includes multiple different types of tRNAs, and multiple different types of amino acids can be translated from these tRNAs. In one aspect, the present disclosure provides a composition including multiple different types of tRNAs suitable for peptide translation. In another aspect, the present disclosure provides a method for translating a peptide, the method including providing multiple different types of tRNAs suitable for peptide translation. In one aspect, the present disclosure provides a translation system including multiple different types of tRNAs suitable for peptide translation. In a particular aspect, the multiple different types of tRNAs include a mutant tRNA of the present disclosure. The following description relates to these tRNAs, compositions, translation methods, and translation systems suitable for peptide translation.

[0130] In one embodiment, a mutant tRNA of the present disclosure has lysidine (k2C), a lysidine derivative, agmatidine (agm2C), or an agmatidine derivative as the first letter (N1) of the anticodon. Lysidine and agmatidine form complementary base pairs with adenosine (A), and therefore are considered to function as equivalents to uridine (U) in codons. In some embodiments, the mutant tRNA of the present disclosure can selectively translate a codon represented by M1M2A over other codons. The other codon can be a codon different from the codon represented by M1M2A, such as a codon represented by M1M2U, M1M2C, or M1M2G. In certain embodiments, the mutant tRNA of the present disclosure can selectively translate a codon represented by M1M2A over any of the codons represented by M1M2U, M1M2C, and M1M2G.

[0131] In one aspect of the present disclosure, a mutant tRNA being able to selectively translate the M1M2A codon means that the amount of M1M2A codon translated by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more greater than the amount of other codons translated by the tRNA. For example, whether a mutant tRNA can selectively translate a codon represented by CUA can be determined by whether the amount of CUA codon translated by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more greater than the amount of CUG codon translated by the tRNA.

[0132] When comparing the amount of a particular codon (e.g., M1M2A) translated with the amount of another codon (e.g., M1M2G) translated, this can be done, for example, by preparing an mRNA encoding a peptide that contains the M1M2A codon and another mRNA that has the same nucleic acid sequence as the mRNA except that the M1M2A codon has been replaced with the M1M2G codon, translating these two mRNAs under the same conditions, and comparing the amounts of the two resulting peptides synthesized.

[0133] In another aspect of the present disclosure, a mutant tRNA being able to selectively translate the M1M2A codon means that the amount of translation of codons other than M1M2A by the tRNA is less than the amount of translation of codons other than M1M2A by a tRNA having a UN2N3 anticodon, for example, less than 1 / 2, less than 1 / 3, less than 1 / 4, less than 1 / 5, less than 1 / 6, less than 1 / 7, less than 1 / 8, less than 1 / 9, less than 1 / 10, less than 1 / 15, less than 1 / 20, less than 1 / 30, less than 1 / 40, less than 1 / 50, less than 1 / 60, less than 1 / 70, less than 1 / 80, less than 1 / 90, or less than 1 / 100. Here, the UN2N3 anticodon refers to a codon in which the first letter (N1) of the anticodon is uridine, and the second letter (N2) and third letter (N3) of the anticodon represent nucleosides complementary to M2 and M1, respectively. Because the role of lysidine and agmatidine in the anticodon corresponds to that of uridine, uridine was chosen for comparison. Furthermore, the codon other than M1M2A can be any of the codons represented by M1M2U, M1M2C, or M1M2G. For example, whether a mutant tRNA can selectively translate a codon represented by CUA can be determined by whether the amount of CUG codon translated by the tRNA is less than the amount of CUG codon translated by a tRNA having a UN2N3 anticodon, for example, 1 / 2 or less, 1 / 3 or less, 1 / 4 or less, 1 / 5 or less, 1 / 6 or less, 1 / 7 or less, 1 / 8 or less, 1 / 9 or less, 1 / 10 or less, 1 / 15 or less, 1 / 20 or less, 1 / 30 or less, 1 / 40 or less, 1 / 50 or less, 1 / 60 or less, 1 / 70 or less, 1 / 80 or less, 1 / 90 or less, or 1 / 100 or less.

[0134] In another embodiment, the codon represented by M1M2A can be selectively translated by the mutant tRNA of the present disclosure over other tRNAs. The other tRNA can be a tRNA that can translate a codon different from the codon represented by M1M2A, for example, a tRNA that can translate any of the codons M1M2U, M1M2C, or M1M2G. In a specific embodiment, the codon represented by M1M2A can be selectively translated by the mutant tRNA of the present disclosure over any of the tRNAs that can translate the codon M1M2U, the tRNA that can translate the codon M1M2C, and the tRNA that can translate the codon M1M2G.

[0135] In one aspect of the present disclosure, the statement that a codon represented by M1M2A can be selectively translated by a certain mutant tRNA means that the amount of M1M2A codon translated by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more than the amount of M1M2A codon translated by another tRNA. As an example, whether a codon represented by CUA can be selectively translated by a certain mutant tRNA can be determined by whether the amount of translation of the CUA codon by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more than the amount of translation of the CUA codon by a tRNA that can translate a CUG codon (e.g., a tRNA having a CAG anticodon).

[0136] A translation system including a mutant tRNA of the present disclosure may have both of the above-mentioned two characteristics. That is, in a specific embodiment, in the translation system of the present disclosure, (i) the mutant tRNA can selectively translate a codon represented by M1M2A compared to other codons, and (ii) the codon represented by M1M2A can be selectively translated by the mutant tRNA of the present disclosure compared to other tRNAs. When such a relationship is established, in the translation system of the present disclosure, peptide translation using the mutant tRNA of the present disclosure and peptide translation using other tRNAs can be said to be independent and non-interacting, i.e., orthogonal. In the translation systems of naturally occurring organisms, a strict correspondence between codons and amino acids is inherently established. Therefore, the addition of a non-orthogonal mutant tRNA can disrupt this correspondence, potentially resulting in a fatal impact on the function of the translation system. Therefore, the establishment of orthogonality between the mutant tRNA of the present disclosure and other tRNAs can be an important feature of the translation system of the present disclosure.

[0137] In one embodiment, the translation system of the present disclosure further comprises a tRNA having an anticodon complementary to a codon represented by M1M2G (hereinafter, this tRNA will also be referred to as "tRNA-G"). In some embodiments, the translation system of the present disclosure comprises at least two tRNAs: (a) a mutant tRNA described in the present disclosure and (b) a tRNA-G described in the present disclosure. In certain embodiments, examples of anticodons complementary to a codon represented by M1M2G include CN2N3, ac4CN2N3, or CmN2N3. Here, the first nucleoside of each anticodon is cytidine (C), N4-acetylcytidine (ac4C), or 2'-O-methylcytidine (Cm), and the second nucleoside (N2) and the third nucleoside (N3) are nucleosides complementary to the above-mentioned M2 and M1, respectively. The mutant tRNA and tRNA-G described in the present disclosure may have the same or different nucleic acid sequences other than the anticodon. If the nucleic acid sequences other than the anticodon are identical, the physicochemical properties of these two tRNAs may be similar to each other, which may allow the construction of a translation system with more homogeneous reactivity and stability.

[0138] In some embodiments, the tRNA-G of the present disclosure can selectively translate the codon represented by M1M2G compared to other codons. The other codons can be codons different from the codon represented by M1M2G, such as codons represented by M1M2U, M1M2C, or M1M2A. In certain embodiments, the tRNA-G of the present disclosure can selectively translate the codon represented by M1M2G compared to any of the codons represented by M1M2U, M1M2C, and M1M2A.

[0139] In one aspect of the present disclosure, a tRNA being able to selectively translate the M1M2G codon means that the amount of M1M2G codon translated by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more greater than the amount of other codons translated by the tRNA. For example, whether a mutant tRNA can selectively translate a codon represented by CUG can be determined by whether the amount of CUG codon translation by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more greater than the amount of CUA codon translation by the tRNA.

[0140] In another embodiment, the codon represented by M1M2G can be selectively translated by the tRNA-G of the present disclosure over other tRNAs. The other tRNA can be a tRNA that can translate a codon different from the codon represented by M1M2G, for example, a tRNA that can translate any of the codons M1M2U, M1M2C, or M1M2A. In a specific embodiment, the codon represented by M1M2G can be selectively translated by the tRNA-G of the present disclosure over any of the tRNAs that can translate the codon M1M2U, the tRNA that can translate the codon M1M2C, and the tRNA that can translate the codon M1M2A.

[0141] In one aspect of the present disclosure, the statement that a codon represented by M1M2G can be selectively translated by a certain tRNA means that the amount of translation of the M1M2G codon by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more than the amount of translation of the M1M2G codon by another tRNA. As an example, whether a codon represented by CUG can be selectively translated by a certain tRNA can be determined by whether the amount of CUG codon translated by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more greater than the amount of CUG codon translated by a tRNA that can translate a CUA codon (e.g., a tRNA having an anticodon of k2CAG).

[0142] A translation system containing tRNA-G of the present disclosure may have both of the above two characteristics. That is, in a specific embodiment, in the translation system of the present disclosure, (i) tRNA-G can selectively translate the codon represented by M1M2G compared to other codons, and (ii) the codon represented by M1M2G can be selectively translated by tRNA-G of the present disclosure compared to other tRNAs. When such a relationship is established, in the translation system of the present disclosure, peptide translation using tRNA-G and peptide translation using other tRNAs can be said to be independent and non-interacting, i.e., orthogonal. In the translation system of the present disclosure, the establishment of orthogonality between tRNA-G and other tRNAs can be one of its important characteristics.

[0143] In a further embodiment, the amino acid bound to a mutant tRNA of the present disclosure (hereinafter, this amino acid will also be referred to as "amino acid-A") and the amino acid bound to tRNA-G (hereinafter, this amino acid will also be referred to as "amino acid-G") may be different in type from each other. When the above-described orthogonal relationship is established between the mutant tRNA and tRNA-G of the present disclosure, in the present translation system, there is a one-to-one correspondence between the M1M2A codon and amino acid-A, and between the M1M2G codon and amino acid-G. In other words, in the translation system of the present disclosure, two different amino acids can be translated from two codons, (i) M1M2A and (ii) M1M2G, present in the same codon box.

[0144] In one embodiment, the translation system of the present disclosure further comprises a tRNA having an anticodon complementary to a codon represented by M1M2U or M1M2C (hereinafter, this tRNA is also referred to as "tRNA-U / C"). In some embodiments, the translation system of the present disclosure comprises at least three tRNAs: (a) a mutant tRNA described in the present disclosure, (b) a tRNA-G described in the present disclosure, and (c) a tRNA-U / C described in the present disclosure. In certain embodiments, examples of the anticodon complementary to the codon represented by M1M2U include AN2N3, GN2N3, QN2N3, or GluQN2N3. Here, the first nucleoside of each anticodon is adenosine (A), guanosine (G), queuosine (Q), or glutamylqueuosine (GluQ), and the second and third nucleosides (N2 and N3) are nucleosides complementary to the above-mentioned M2 and M1, respectively. In another embodiment, anticodons complementary to the codon represented by M1M2C include, for example, GN2N3, QN2N3, or GluQN2N3. Since anticodons complementary to the codons M1M2U and M1M2C often overlap, in the present disclosure, these two codons can be treated as a single codon. In a specific embodiment, anticodons complementary to the codon represented by M1M2U or M1M2C include, for example, AN2N3, GN2N3, QN2N3, or GluQN2N3. The mutant tRNA, tRNA-G, and tRNA-U / C described in the present disclosure may all be identical in nucleic acid sequence except for the anticodon, or may be different from each other. If the nucleic acid sequences except for the anticodon are identical, the physicochemical properties of these three tRNAs may be similar to each other, potentially enabling the construction of a translation system with more homogeneous reactivity and stability.

[0145] In some embodiments, the tRNA-U / C of the present disclosure can selectively translate a codon represented by M1M2U or M1M2C compared to other codons. The other codon can be a codon different from the codon represented by M1M2U or M1M2C, for example, a codon represented by M1M2A or M1M2G. In certain embodiments, the tRNA-U / C of the present disclosure can selectively translate a codon represented by M1M2U or M1M2C compared to both the codons represented by M1M2A and M1M2G.

[0146] In one aspect of the present disclosure, a tRNA being able to selectively translate the M1M2U or M1M2C codon means that the amount of M1M2U or M1M2C codon translated by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more greater than the amount of other codons translated by the tRNA. For example, whether a certain tRNA can selectively translate a codon represented by CUU or CUC can be determined by whether the amount of CUU or CUC codon translated by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more greater than the amount of CUA codon translated by the tRNA.

[0147] In another embodiment, a codon represented by M1M2U or M1M2C can be selectively translated by the tRNA-U / C of the present disclosure over other tRNAs. The other tRNA can be a tRNA that can translate a codon different from the codon represented by M1M2U or M1M2C, for example, a tRNA that can translate either the codon M1M2A or M1M2G. In a specific embodiment, a codon represented by M1M2U or M1M2C can be selectively translated by the tRNA-U / C of the present disclosure over both a tRNA that can translate the codon M1M2A and a tRNA that can translate the codon M1M2G.

[0148] In one aspect of the present disclosure, the statement that a codon represented by M1M2U or M1M2C can be selectively translated by a certain tRNA means that the amount of translation of the M1M2U or M1M2C codon by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more than the amount of translation of the M1M2U or M1M2C codon by another tRNA. As an example, whether a codon represented by CUU or CUC can be selectively translated by a certain tRNA can be determined by whether the amount of CUU or CUC codon translated by the tRNA is, for example, 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more, 8-fold or more, 9-fold or more, 10-fold or more, 15-fold or more, 20-fold or more, 30-fold or more, 40-fold or more, 50-fold or more, 60-fold or more, 70-fold or more, 80-fold or more, 90-fold or more, or 100-fold or more greater than the amount of CUU or CUC codon translated by a tRNA that can translate a CUA codon (e.g., a tRNA having an anticodon of k2CAG).

[0149] A translation system containing tRNA-U / C according to the present disclosure may have both of the above-mentioned two characteristics. That is, in a specific embodiment, in the translation system according to the present disclosure, (i) tRNA-U / C can selectively translate a codon represented by M1M2U or M1M2C compared to other codons, and (ii) a codon represented by M1M2U or M1M2C can be selectively translated by the tRNA-U / C according to the present disclosure compared to other tRNAs. When such a relationship is established, in the translation system according to the present disclosure, peptide translation using tRNA-U / C and peptide translation using other tRNAs can be said to be independent, i.e., orthogonal, in that they do not interact with each other. In the translation system according to the present disclosure, the establishment of orthogonality between tRNA-U / C and other tRNAs can be an important feature.

[0150] In a further embodiment, the amino acid bound to the mutant tRNA ("amino acid-A"), the amino acid bound to tRNA-G ("amino acid-G"), and the amino acid bound to tRNA-U / C (hereinafter, these amino acids will also be referred to as "amino acid-U / C") of the present disclosure may all be different from each other. When the orthogonal relationships described above are established for the mutant tRNA, tRNA-G, and tRNA-U / C of the present disclosure, in the present translation system, there is a one-to-one correspondence between the codon for M1M2A and amino acid-A, the codon for M1M2G and amino acid-G, and the codon for M1M2U or M1M2C and amino acid-U / C. In other words, the translation system of the present disclosure can translate three different amino acids from three codons in the same codon box: (i) M1M2A, (ii) M1M2G, and (iii) M1M2U or M1M2C. Alternatively, in the translation system of the present disclosure, three different types of amino acids can be translated from a codon box composed of M1M2U, M1M2C, M1M2A, and M1M2G.

[0151] In some embodiments, an unnatural amino acid may be bound to at least one of the mutant tRNAs disclosed herein, tRNA-G, and tRNA-U / C.

[0152] In some embodiments, the mutant tRNA of the present disclosure may be assigned to a codon that constitutes at least one codon box in the genetic code table. In further embodiments, the mutant tRNA of the present disclosure may be assigned to a codon that constitutes multiple codon boxes in the genetic code table. The multiple codon boxes can be, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 codon boxes. In addition to the mutant tRNA, tRNA-G may be assigned to another codon that constitutes the same codon box (a codon different from the codon assigned to the mutant tRNA), or tRNA-U / C may be assigned to another codon that constitutes the same codon box (a codon different from the codon assigned to the mutant tRNA and the codon assigned to tRNA-G). The codon box to which each tRNA is assigned is determined by the second nucleoside (N2) and the third nucleoside (N3) of the anticodon of the tRNA. tRNAs assigned to codons that constitute different codon boxes have different N2 and N3. Furthermore, the nucleic acid sequences of tRNAs assigned to codons that constitute different codon boxes may be the same or different apart from the anticodon. When the nucleic acid sequences of these tRNAs apart from the anticodon are identical, the physicochemical properties of these tRNAs may be similar to each other, potentially enabling the construction of a translation system with more homogeneous reactivity and stability.

[0153] In some embodiments, the translation system of the present disclosure can translate 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids. Alternatively, by using a mutant tRNA of the present disclosure to distinguish between M1M2A and M1M2G codons in a single codon box, it is possible to translate more than 20 amino acids. In further embodiments, for example, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, or 48 amino acids can be translated from a translation system of the disclosure.

[0154] In some embodiments, the translation system of the present disclosure is a cell-free translation system. In further embodiments, the translation system of the present disclosure is a reconstituted cell-free translation system. Cell extracts and factors necessary for peptide translation (e.g., ribosomes) in the cell-free translation system can be derived from various biological materials. Examples of such biological materials include Escherichia coli, yeast, wheat germ, rabbit reticulocytes, HeLa cells, and insect cells.

[0155] In one aspect, the present disclosure provides a method for producing a peptide, comprising translating a nucleic acid using a translation system described herein. The peptides of the present disclosure may include compounds in which two or more amino acids are linked by amide bonds. The peptides of the present disclosure may also include compounds in which an amino acid analog, such as a hydroxycarboxylic acid, is linked by an ester bond instead of an amino acid. The number of amino acids or amino acid analogs contained in the peptide is not particularly limited as long as it is two or more, but examples include 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, etc., and also 100 or less, 80 or less, 50 or less, 30 or less, 25 or less, 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, etc. Alternatively, the number may be selected from 9, 10, 11, or 12.

[0156] In one embodiment, the peptides of the present disclosure may contain N-substituted amino acids, and the number of N-substituted amino acids contained in the peptide can be, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc. In another embodiment, the peptides of the present disclosure may contain amino acids that are not N-substituted, and the number of non-N-substituted amino acids can be, for example, 1, 2, 3, 4, etc. In a further embodiment, the peptides of the present disclosure may contain both N-substituted and non-N-substituted amino acids.

[0157] In some embodiments, the peptides of the present disclosure may be linear peptides or peptides having a cyclic portion. A peptide having a cyclic portion refers to a peptide in which the main chain or side chain of one amino acid or amino acid analog present on the peptide chain is bonded to the main chain or side chain of another amino acid or amino acid analog present on the same peptide chain, thereby forming a cyclic structure within the molecule. A peptide having a cyclic portion may consist solely of a cyclic portion, or may contain both a cyclic portion and a linear portion. The number of amino acids or amino acid analogs contained in the cyclic portion can be, for example, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 14 or less, 13 or less, 12 or less, 11 or less, or the like. Alternatively, the number can be selected from 9, 10, or 11. The number of amino acids or amino acid analogs contained in the linear portion can be, for example, 0 or more, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, or the like. Alternatively, you can choose from 0, 1, 2, or 3.

[0158] Examples of bonds that can be used to form the cyclic moiety include peptide bonds formed between amino and carboxyl groups. Other bonds that can be used include amide bonds, disulfide bonds, ether bonds, thioether bonds, ester bonds, thioester bonds, carbon-carbon bonds, alkyl bonds, alkenyl bonds, phosphonate ether bonds, azo bonds, amine bonds, C═NC bonds, lactam bridges, carbamoyl bonds, urea bonds, thiourea bonds, thioamide bonds, sulfinyl bonds, sulfonyl bonds, triazole bonds, and benzoxazole bonds, which are formed by combining appropriate functional groups. Carbon-carbon bonds can be formed by transition metal-catalyzed reactions such as the Suzuki reaction, Heck reaction, and Sonogashira reaction. In one embodiment, the peptide of the present disclosure contains at least one pair of functional groups capable of forming the above bond within the molecule. The cyclic moiety can also be formed by separately carrying out a reaction to bond the above functional groups after a linear peptide is produced using the translation system of the present disclosure. For the synthesis of peptides having a cyclic portion, reference can also be made to WO2013 / 100132, WO2012 / 026566, WO2012 / 033154, WO2012 / 074130, WO2015 / 030014, WO2018 / 052002, Comb Chem High Throughput Screen (2010) 13: 75-87, Nat Chem Biol (2009) 5: 502-507, Nat Chem Biol (2009) 5: 888-90, Bioconjug Chem (2007) 18: 469-476, ChemBioChem (2009) 10: 787-798, Chem Commun (Camb) (2011) 47: 9946-9958, etc.

[0159] In some embodiments, the nucleic acid to be translated in the translation system of the present disclosure is mRNA. The mRNA may encode a peptide having a desired amino acid sequence. By adding mRNA to the translation system of the present disclosure, the mRNA can be translated into a peptide. On the other hand, if the translation system contains an RNA polymerase for transcribing DNA into mRNA, by adding DNA to the translation system of the present disclosure, the transcription of the DNA into mRNA and the translation of the mRNA into a peptide can be simultaneously carried out.

[0160] Although methionine is typically present as the initiating amino acid at the N-terminus of a peptide to be translated, several methods for introducing amino acids other than methionine into the N-terminus have been reported. These methods may be used in combination with the peptide production methods described herein. One such method is to translate a peptide starting from a desired amino acid using an initiator tRNA aminoacylated with an amino acid other than methionine (initiation suppression). In particular, because the tolerance for exogenous amino acids is higher at translation initiation than during peptide chain elongation, even amino acids with significantly different structures from natural amino acids may be used at the N-terminus (Goto & Suga, J Am Chem Soc (2009) 131(14):5040-5041). Another method is to initiate translation from the second or subsequent codon by removing the initiator methionyl tRNA from the translation system or by replacing the initiator amino acid with an amino acid other than methionine that has low translation efficiency (initiation read-through). Another alternative method is to remove methionine from the N-terminus of peptides by the action of enzymes such as peptide deformylase and methionine aminopeptidase (Meinnel et al., Biochimie (1993) 75:1061-1075). By preparing a peptide library starting with methionine and then treating it with the enzymes described above, a peptide library starting with a random amino acid at the N-terminus can be prepared.

[0161] In another aspect, the present disclosure provides peptides produced by the peptide production method described in the present disclosure. Peptides obtained by further chemically modifying the peptides produced by the methods described in the present disclosure are also included in the peptides provided by the present disclosure.

[0162] In one aspect, the present disclosure provides a method for producing a peptide library, the method comprising translating a nucleic acid library using the translation system described in the present disclosure. A plurality of nucleic acid molecules each encoding a peptide and having a wide variety of nucleic acid sequences are prepared, and each of these is translated into peptides, thereby producing a plurality of peptide molecules having a wide variety of amino acid sequences. The size of the library is not particularly limited, but may be, for example, 10 6 That's it, 10 7 That's it, 10 8 That's it, 10 9 That's it, 10 10 That's it, 10 11 That's it, 10 12 That's it, 10 13 That's it, 10 14The nucleic acid may be DNA or RNA. RNA is usually mRNA. DNA is translated into peptides via transcription into mRNA. Such a nucleic acid library can be prepared by methods known to those skilled in the art or methods equivalent thereto. By using mixed bases at desired positions in the synthesis of a nucleic acid library, multiple nucleic acid molecules with diverse nucleic acid sequences can be easily prepared. Examples of codons using mixed bases include NNN (where N represents a mixture of four bases, A, T, G, and C), NNW (where W represents a mixture of two bases, A and T), NNM (where W represents a mixture of two bases, A and C), NNK (where K represents a mixture of two bases, G and T), and NNS (where S represents a mixture of two bases, C and G). Alternatively, by limiting the base used as the third letter of the codon to one of A, T, G, and C, it is possible to synthesize a nucleic acid library encoding only certain amino acids. Furthermore, when creating codons containing mixed bases, it is possible to arbitrarily adjust the frequency of the amino acids obtained from the codon by mixing multiple bases in different ratios rather than in equal proportions. By preparing multiple different types of codon units using the above-mentioned codon as a single unit and linking them in the desired order, it is possible to design a library in which the positions and frequencies of the amino acids contained therein are controlled.

[0163] In some embodiments, the peptide library described in the present disclosure is a library in which peptides are displayed on nucleic acids (nucleic acid display library, or simply display library). A display library is a library characterized in that peptides and nucleic acids encoding them bind to form a complex, thereby correlating phenotype with genotype. Examples of major display libraries include mRNA display (Roberts and Szostak, Proc Natl Acad Sci USA (1997) 94:12297-12302), in vitro viral display (Nemoto et al., FEBS Lett (1997) 414:405-408), cDNA display (Yamaguchi et al., Nucleic Acids Res (2009) 37:e108), ribosome display (Mattheakis et al., Proc Natl Acad Sci USA (1994) 91:9022-9026), covalent display (Reiersen et al., Nucleic Acids Res (2005) 33:e10), and CIS display (Odegrip et al., Proc Natl Acad Sci USA (2004) 101:2806-2810) or the like. Alternatively, a library prepared using an in vitro compartmentalization method (Tawfik and Griffiths, Nat Biotechnol (1998) 16:652-656) can also be used as a display library.

[0164] In another aspect, the present disclosure provides a peptide library produced by the method for producing a peptide library described in the present disclosure.

[0165] In one aspect, the present disclosure provides a method for identifying peptides having binding activity toward a target molecule, the method comprising contacting the target molecule with a peptide library described herein. The target molecule is not particularly limited and can be appropriately selected from, for example, low molecular weight compounds, high molecular weight compounds, nucleic acids, peptides, proteins, sugars, lipids, and the like. The target molecule may be an extracellular molecule or an intracellular molecule. Alternatively, it may be a molecule present in the cell membrane, in which case the target may be any of the extracellular domain, transmembrane domain, and intracellular domain. In the step of contacting the peptide library with the target molecule, the target molecule is typically immobilized on a solid support (e.g., a microtiter plate or microbeads). Subsequently, peptides that do not bind to the target molecule are removed, and only peptides that bind to the target molecule are recovered, thereby selectively enriching peptides having binding activity toward the target molecule (panning method). When the peptide library used is a nucleic acid display library, the recovered peptides are bound to nucleic acids encoding their genetic information, and the nucleic acid and amino acid sequences encoding the recovered peptides can be easily identified by isolating and analyzing them. Furthermore, based on the obtained nucleic acid sequence or amino acid sequence, the identified peptides can be individually produced by chemical synthesis or genetic recombination techniques.

[0166] In one aspect, the present disclosure provides a nucleic acid-peptide conjugate comprising a peptide and a nucleic acid encoding the peptide, the conjugate having the following characteristics: (i) the nucleic acid sequence encoding the peptide contains two codons, M1M2A and M1M2G, and (ii) In the amino acid sequence of the peptide, the types of amino acids corresponding to the M1M2A codon and the M1M2G codon are different from each other. Here, M1 and M2 represent the first and second letters, respectively, of a particular codon (except for codons where M1 is A and M2 is U).

[0167] In a further aspect, the present disclosure provides a nucleic acid-peptide conjugate comprising a peptide and a nucleic acid encoding the peptide, the conjugate having the following characteristics: (i) the nucleic acid sequence encoding the peptide contains three codons, M1M2U, M1M2A, and M1M2G; and (ii) In the amino acid sequence of the peptide, the types of amino acids corresponding to the codons M1M2U, M1M2A, and M1M2G are all different from one another. Here, M1 and M2 represent the first and second letters of a particular codon, respectively.

[0168] In another aspect, the present disclosure provides a nucleic acid-peptide conjugate comprising a peptide and a nucleic acid encoding the peptide, the conjugate having the following characteristics: (i) the nucleic acid sequence encoding the peptide contains three codons, M1M2C, M1M2A, and M1M2G; and (ii) In the amino acid sequence of the peptide, the types of amino acids corresponding to the M1M2C codon, the M1M2A codon, and the M1M2G codon are all different from one another. Here, M1 and M2 represent the first and second letters of a particular codon, respectively.

[0169] In some embodiments, the nucleic acid-peptide complexes described above can be included as one of the constituent elements of a peptide library (particularly a nucleic acid display library). In one embodiment, the present disclosure provides a library (peptide library or nucleic acid display library) containing the nucleic acid-peptide complexes described herein. In certain embodiments, the nucleic acid-peptide complexes and libraries described herein can be produced using the mutant tRNAs described herein or the translation systems described herein.

[0170] In one aspect, the present disclosure provides the following compound: lysidine-diphosphate (pLp), or a salt thereof. [ka] Such compounds can be used to prepare mutant tRNAs into which lysidine has been introduced. Accordingly, the present disclosure relates to a method for producing mutant tRNAs into which lysidine has been introduced using lysidine diphosphate, and to the mutant tRNAs produced by the method. The present disclosure also relates to a method for producing mutant tRNAs into which lysidine has been introduced, wherein the mutant tRNA is bound to an amino acid or amino acid analog (aminoacyl-mutated tRNA), using lysidine diphosphate, and to the aminoacyl-mutated tRNAs produced by the method. Such mutant tRNAs and / or aminoacyl-mutated tRNAs can be used in the translation systems of the present disclosure. Accordingly, the present disclosure relates to translation systems containing such mutant tRNAs and / or aminoacyl-mutated tRNAs. Furthermore, the present disclosure also provides a method for producing a peptide or peptide library using the translation system. The present disclosure also provides a peptide or peptide library produced by the method. In the present disclosure, lysidine may be introduced at position 34 of the tRNA (based on the tRNA numbering system). In one embodiment, a mutant tRNA with lysidine introduced at position 34 of the tRNA numbering system can be obtained by preparing one or more (e.g., two, three, four, five, or more) nucleic acid fragments of tRNA and lysidine diphosphate and ligating them using a method known to those skilled in the art. Specifically, one example includes ligating a nucleic acid fragment consisting of bases 1 to 33 of the tRNA, lysidine diphosphate, and a nucleic acid fragment consisting of bases 35 to 76 of the tRNA (or positions 35 to 75 of the tRNA, or positions 35 to 74 of the tRNA) in this order from the 5' end. The CA sequence at the 3' end may be removed.

[0171] In one aspect, the present disclosure provides the following compound: agmatidine diphosphate (p(Agm)p), or a salt thereof. [ka] Such compounds can be used to prepare mutant tRNAs into which agmatidine has been introduced. Accordingly, the present disclosure relates to a method for producing mutant tRNAs into which agmatidine has been introduced using agmatidine diphosphate, and to the mutant tRNAs produced by the method. The present disclosure also relates to a method for producing mutant tRNAs into which agmatidine has been introduced, wherein the mutant tRNA is bound to an amino acid or amino acid analog (aminoacyl-mutated tRNA), using agmatidine diphosphate, and to the aminoacyl-mutated tRNAs produced by the method. Such mutant tRNAs and / or aminoacyl-mutated tRNAs can be used in the translation systems of the present disclosure. Accordingly, the present disclosure relates to translation systems containing such mutant tRNAs and / or aminoacyl-mutated tRNAs. Furthermore, the present disclosure provides a method for producing a peptide or peptide library using the translation system. The present disclosure also provides a peptide or peptide library produced by the method. In the present disclosure, agmatidine may be introduced at position 34 of the tRNA (based on the tRNA numbering system). In one embodiment, a mutant tRNA with agmatidine introduced at position 34 of the tRNA numbering system can be obtained by preparing one or more (e.g., two, three, four, five, or more) nucleic acid fragments of tRNA and agmatidine diphosphate and ligating them using a method known to those skilled in the art. Specifically, one example includes ligating a nucleic acid fragment consisting of bases 1 to 33 of the tRNA, agmatidine diphosphate, and a nucleic acid fragment consisting of bases 35 to 76 of the tRNA (or positions 35 to 75 of the tRNA, or positions 35 to 74 of the tRNA) in this order from the 5' end. The CA sequence at the 3' end may be removed.

[0172] The compounds of the present disclosure can be in the free form or in the form of a salt. Examples of salts of the compounds of the present disclosure include hydrochlorides, hydrobromides, hydroiodides, phosphates, phosphonates, sulfates, sulfonates such as methanesulfonates and p-toluenesulfonates, carboxylates such as acetates, citrates, malates, tartrates, succinates, and salicylates, alkali metal salts such as sodium salts and potassium salts, alkaline earth metal salts such as magnesium salts and calcium salts, and ammonium salts such as ammonium salts, alkylammonium salts, dialkylammonium salts, trialkylammonium salts, and tetraalkylammonium salts. Salts of the compounds of the present disclosure can be prepared, for example, by contacting the compounds of the present disclosure with an acid or a base. The compounds of the present disclosure can be hydrated, and such hydrates are also included in the salts of the compounds of the present disclosure. The compounds of the present disclosure can also be solvated, and such solvates are also included in the salts of the compounds of the present disclosure.

[0173] In one aspect, the present invention relates to a method for producing lysidine diphosphate or a derivative thereof, or agmatidine diphosphate or a derivative thereof, represented by the following formula A: [ka]

[0174] In formula A, R1 and R2 are each independently H or C1-C3 alkyl, and it is preferred that R1 and R2 are both H.

[0175] In Formula A, L is a C2-C6 straight-chain alkylene or C2-C6 straight-chain alkenylene, optionally substituted with one or more substituents selected from the group consisting of hydroxy and C1-C3 alkyl, and a carbon atom of the C2-C6 straight-chain alkylene is optionally substituted with one oxygen atom or sulfur atom. The C2-C6 straight-chain alkylene is preferably a C4-C5 straight-chain alkylene, and the C2-C6 straight-chain alkenylene is preferably a C4-C5 straight-chain alkenylene. Specific examples of L include -(CH2)3-, -(CH2)4-, -(CH2)5, -(CH2)2-O-CH2-, -(CH2)2-S-CH2-, -CH2CH(OH)(CH2)2-, and -CH2CH=CH- (cis or trans).

[0176] In formula A, M is a single bond, [ka] The wavy line indicates the point of attachment to a carbon atom, * indicates the point of attachment to a hydrogen atom, and ** indicates the point of attachment to a nitrogen atom. If M is a single bond, there is no H bonded to M. For example, if M is [ka] then the compound of formula A is: [ka] and M can be expressed as [ka] then the compound of formula A is: [ka] and when M is a single bond, the compound of formula A can be represented as follows: [ka] It can be expressed as follows.

[0177] The compound represented by formula A is preferably lysidine diphosphate, agmatidine diphosphate, or a salt thereof.

[0178] In some embodiments, compounds of formula A can be prepared according to Scheme 1 below. Scheme 1: [ka] [ka] [ka] [ka]

[0179] Step 1 in Scheme 1 is a step of intramolecularly cyclizing a compound represented by Formula B1 to obtain a compound represented by Formula C1. This step can be performed by stirring the reaction mixture in the presence of an intramolecular cyclization reagent in a solvent at a temperature from −20° C. to near the boiling point of the solvent, preferably at a temperature from 0° C. to 180° C., for 15 minutes to 48 hours. Compounds of formula B1 can be obtained from commercial sources or prepared using methods known in the literature. 11 is a protecting group for an amino group, and any protecting group can be used as long as it does not interfere with the progress of the reaction according to the above Scheme 1. For example, a protecting group that cannot be deprotected by an acid or a fluoride ion is preferred. 11 Specific examples of the alkyl group include p-bromobenzoyl, optionally substituted benzoyl, pyridine carbonyl, and acetyl. The intramolecular cyclization reagent is not particularly limited, but diisopropyl azodicarboxylate and triphenylphosphine can be preferably used. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, and ketone solvents, and dichloromethane is preferably used.

[0180] Step 2 in Scheme 1 is a step of introducing an amine represented by Formula D1 into a compound represented by Formula C1 to obtain a compound represented by Formula E1. This step can be performed by stirring the reaction mixture in the presence of an amine-introducing reagent in a solvent at a temperature from −20° C. to near the boiling point of the solvent, preferably at a temperature from 0° C. to 180° C., for 15 minutes to 48 hours. The amine-introducing reagent is not particularly limited, but lithium chloride and DBU can be preferably used. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, and ketone solvents, and tetrahydrofuran is preferably used in this step.

[0181] Steps 3A and 3B of Scheme 1 are carried out by reacting a compound of formula E1 with PG 12 and / or PG 13 to obtain a compound represented by formula F1A or F1B. When R2 in formula E1 is alkyl, PG 13 If only R2 in formula E1 is hydrogen, then PG 12 and P.G. 13 is introduced to form a compound of formula F1B. This step can be performed by stirring the reaction mixture in the presence of a protecting group-introducing reagent in a solvent at a temperature of from −20° C. to about the boiling point of the solvent, preferably from 0° C. to 180° C., for 15 minutes to 48 hours. PG 12 is a protecting group for the amino group, and PG 13 is a protecting group for a carboxyl group or an imino group. Any protecting group can be used as long as it does not interfere with the progress of the reaction according to Scheme 1 above. For example, a protecting group that cannot be deprotected by an acid or a fluoride ion is preferred.12 Fmoc is preferably used as the PG 13 As for M [ka] Methyl, ethyl, or optionally substituted benzyl when M is [ka] In the case of PG, optionally substituted benzyl, Cbz or optionally substituted benzyloxycarbonyl is preferably used. 12 and P.G. 13 They may be introduced simultaneously or sequentially. When they are introduced sequentially, PG 12 and P.G. 13 You can install either one first, but PG 12 Then, PG 13 For the introduction of a protecting group, for example, the method described in "Greene's, 'Protective Groups in Organic Synthesis' (5th edition, John Wiley & Sons 2014)" can be used. 12 When is Fmoc, it is preferable to use (2,5-dioxopyrrolidin-1-yl)(9H-fluoren-9-yl)methyl carbonate and sodium carbonate for its introduction, and PG 13 When is methyl, it is preferred to use N,N'-diisopropylcarbodiimide, methanol, and N,N-dimethyl-4-aminopyridine for its introduction. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, and ketone solvents. Dioxane is preferably used for the introduction of Fmoc, and dichloromethane is preferably used for the introduction of methyl.

[0182] Steps 4A and 4B of Scheme 1 involve removing the acetonide from a compound of Formula F1A or Formula F1B, and preparing PG. 14 and P.G.15 to obtain a compound represented by formula G1A or G1B. The acetonide can be removed in the presence of an acid, and the protecting group can be introduced in the presence of a protecting group introducing reagent, by stirring the reaction mixture in a solvent at a temperature of from −20° C. to near the boiling point of the solvent, preferably from 0° C. to 180° C., for 15 minutes to 48 hours. PG 14 and P.G. 15 are each independently a protecting group for a hydroxyl group, and any protecting group can be used as long as it does not interfere with the progress of the reaction according to Scheme 1 above. For example, a silyl protecting group that can be deprotected by a fluoride ion can be preferably used. 14 and P.G. 15 It is preferable that these together form a divalent protecting group, and a specific example of such a protecting group is di-tert-butylsilyl. For example, the method described in "Greene's, 'Protective Groups in Organic Synthesis' (5th ed., John Wiley & Sons 2014)" can be used to remove the acetonide and introduce the protecting group, but TFA is preferred as the acid used to remove the acetonide. In addition, PG 14 and P.G. 15 When these are taken together to form di-tert-butylsilyl, it is preferable to use di-tert-butylsilyl bis(trifluoromethanesulfonate) for its introduction. Examples of the solvent used for removing acetonide include water and carboxylic acid solvents, and a mixed solvent of water and TFA is preferably used. 14 and P.G. 15 For the introduction of the formula (I), for example, halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, and amide solvents can be used, and DMF is preferably used.

[0183] Steps 5A and 5B of Scheme 1 are carried out by reacting a compound of formula G1A or G1B with PG 16 to obtain a compound represented by formula H1A or H1B.16 The introduction of can be carried out in the presence of a protecting group introduction reagent by stirring the reaction mixture in a solvent at a temperature of from −20° C. to near the boiling point of the solvent, preferably from 0° C. to 180° C., for 15 minutes to 48 hours. PG 16 is a protecting group for a hydroxyl group and / or an amino group, and any protecting group can be used as long as it does not interfere with the progress of the reaction according to the above Scheme 1. For example, a protecting group that cannot be deprotected by fluoride ions is preferred. 16 The protective group is preferably TOM. For example, the method described in "Greene's, 'Protective Groups in Organic Synthesis' (5th edition, John Wiley & Sons 2014)" can be used to introduce the protective group. 16 When is TOM, it is preferable to use DIPEA and (triisopropylsiloxy)methyl chloride for its introduction. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, and amide solvents, and dichloromethane is preferably used.

[0184] Steps 6A and 6B of Scheme 1 are steps for converting a compound of formula G1A or G1B into PG 14 and P.G. 15 to obtain a compound of formula I1A or I1B. 14 and P.G. 15 The removal of can be carried out by stirring the reaction mixture in the presence of a deprotecting reagent in a solvent at a temperature of from −20° C. to near the boiling point of the solvent, preferably from 0° C. to 180° C., for 15 minutes to 48 hours. The deprotection reagent is PG 14 and P.G. 15 Any reagent can be used as long as it can selectively remove only PG. 14 and P.G. 15 When these react together to form di-tert-butylsilyl, it is preferable to use a reagent that generates a fluoride ion, specifically, for example, a hydrogen fluoride pyridine complex, for its removal. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, and amide solvents, and THF is preferably used.

[0185] Steps 7A and 7B in Scheme 1 are steps in which a compound represented by formula I1A or I1B is phosphite-esterified, followed by oxidation, to obtain a compound represented by formula J1A or J1B. The phosphite-esterification can be carried out by stirring the reaction mixture in the presence of a phosphite-esterifying reagent in a solvent at a temperature of from -20°C to near the boiling point of the solvent, preferably from 0°C to 180°C, for 15 minutes to 48 hours. The oxidation can be carried out in the presence of an oxidation reagent in a solvent at a temperature of from -20°C to near the boiling point of the solvent, preferably from 0°C to 180°C, for 15 minutes to 48 hours. Although the compound may be isolated after the phosphite-esterification, it is preferable to carry out the phosphite-esterification reaction and the oxidation reaction in one pot. In formula J1A or J1B, PG 17 is a protecting group for a hydroxyl group, and any protecting group can be used as long as it does not interfere with the progress of the reaction according to the above scheme 1. 11 , P.G. 12 , P.G. 13 A protecting group that can be simultaneously deprotected is preferred. 17 Specific examples of the phosphite esterification reagent include cyanoethyl. A phosphite esterification reagent in which the hydroxyl group is protected with a protecting group may be used, or an unprotected phosphite esterification reagent may be used and then a protecting group introduced to the hydroxyl group. The introduction of a protecting group can be performed using, for example, the method described in "Greene's, 'Protective Groups in Organic Synthesis' (5th ed., John Wiley & Sons 2014)." When using a phosphite esterification reagent in which the hydroxyl group is protected with a cyanoethyl group, bis(2-cyanoethyl)-N,N-diisopropylaminophosphoramidite is preferably used as the phosphite esterification reagent. The oxidizing agent used for the oxidation following the phosphite esterification is not particularly limited, but tert-butyl hydroperoxide is preferably used. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, and nitrile solvents, and acetonitrile is preferably used.

[0186] Steps 8A and 8B of Scheme 1 are steps for converting a compound of formula J1A to PG 11 , P.G. 12、 PG 13 , and P.G. 17 or from the compound of formula J1B to obtain PG 11 , P.G. 13 , and P.G. 17 to obtain a compound represented by formula K1. These protecting groups can be removed by stirring the reaction mixture in a solvent in the presence of a deprotecting reagent at a temperature of from −20° C. to about the boiling point of the solvent, preferably at a temperature of from 0° C. to 180° C., for 15 minutes to 48 hours. Any deprotection reagent can be used as long as it can selectively remove the above-mentioned protecting groups. Specific examples of such reagents include a combination of bis(trimethylsilyl)acetamide and DBU. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, nitrile solvents, and amine solvents, and pyridine is preferably used.

[0187] Step 9 of Scheme 1 is the synthesis of a compound of formula K1 into PG 16 to obtain the compound of formula A. 16 The removal of can be carried out by stirring the reaction mixture in the presence of a deprotecting reagent in a solvent at a temperature of from −20° C. to near the boiling point of the solvent, preferably at a temperature of from 0° C. to 180° C., for 15 minutes to 48 hours. The deprotection reagent is PG 16 Any reagent can be used as long as it can selectively remove the fluorine-containing compound, and ammonium fluoride is preferably used. Examples of the solvent include water, halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, and nitrile solvents, and a mixed solvent of water and acetonitrile can be preferably used.

[0188] In certain embodiments, compounds of formula A can be prepared according to Scheme 2 below. Scheme 2: [ka] [ka] [ka] [ka]

[0189] Step 1 in Scheme 2 is a step of intramolecularly cyclizing a compound represented by formula B2 to obtain a compound represented by formula C2. This step can be performed by stirring the reaction mixture in the presence of an intramolecular cyclization reagent in a solvent at a temperature of from −20° C. to near the boiling point of the solvent, preferably from 0° C. to 180° C., for 15 minutes to 48 hours. Compounds of formula B2 can be obtained from commercial sources or prepared using methods known in the literature. 21 is a protecting group for an amino group, and any protecting group can be used as long as it does not interfere with the progress of the reaction according to Scheme 2 above. For example, a protecting group that cannot be deprotected by an acid or a fluoride ion is preferred. 21 Specific examples of such groups include Cbz, optionally substituted benzyloxycarbonyl, and optionally substituted benzyl. The intramolecular cyclization reagent is not particularly limited, but diisopropyl azodicarboxylate and triphenylphosphine can be preferably used. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, and ketone solvents, and dichloromethane is preferably used.

[0190] Step 2 in Scheme 2 is a step of introducing an amine represented by formula D2A or D2B into a compound represented by formula C2 to obtain a compound represented by formula E2A or E2B. This step can be performed by stirring the reaction mixture in the presence of an amine-introducing reagent in a solvent at a temperature from −20° C. to near the boiling point of the solvent, preferably at a temperature from 0° C. to 180° C., for 15 minutes to 48 hours. The amine-introducing reagent is not particularly limited, but lithium chloride and DBU can be preferably used. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, and ketone solvents, and THF is preferably used in this step.

[0191] Steps 3A and 3B of Scheme 2 involve removing the acetonide from a compound of formula E2A or E2B, and then PG 24 and P.G. 25 to obtain a compound represented by formula F2A or F2B. The acetonide can be removed in the presence of an acid, and the protecting group can be introduced in the presence of a protecting group introducing reagent, by stirring the reaction mixture in a solvent at a temperature of from −20° C. to about the boiling point of the solvent, preferably from 0° C. to 180° C., for 15 minutes to 48 hours. PG 24 and P.G. 25 are each independently a protecting group for a hydroxyl group, and any protecting group can be used as long as it does not interfere with the progress of the reaction according to Scheme 2 above. For example, a silyl protecting group that can be deprotected by a fluoride ion can be preferably used. 24 and P.G. 25It is preferable that these together form a divalent protecting group, and a specific example of such a protecting group is di-tert-butylsilyl. For example, the method described in "Greene's, 'Protective Groups in Organic Synthesis' (5th ed., John Wiley & Sons 2014)" can be used to remove the acetonide and introduce the protecting group, but TFA is preferred as the acid used to remove the acetonide. In addition, PG 24 and P.G. 25 When these are taken together to form di-tert-butylsilyl, it is preferable to use di-tert-butylsilyl bis(trifluoromethanesulfonate) for its introduction. Examples of the solvent used for removing acetonide include water and carboxylic acid solvents, and a mixed solvent of water and TFA is preferably used. 24 and P.G. 25 For the introduction of the formula (I), for example, halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, and amide solvents can be used, and DMF is preferably used.

[0192] Steps 4A and 4B of Scheme 2 are carried out by reacting a compound of formula F2A or F2B with PG 26 to obtain a compound represented by formula G2A or G2B. 26 The introduction of can be carried out in the presence of a protecting group introduction reagent by stirring the reaction mixture in a solvent at a temperature of from −20° C. to near the boiling point of the solvent, preferably from 0° C. to 180° C., for 15 minutes to 48 hours. PG 26 is a protecting group for a hydroxyl group, and any protecting group can be used as long as it does not interfere with the progress of the reaction according to Scheme 2 above. For example, a protecting group that is not deprotected by fluoride ions is preferred. 26The protecting group is preferably tetrahydropyranyl, tetrahydrofuranyl, or methoxymethyl. For example, the method described in "Greene's, Protective Groups in Organic Synthesis" (5th edition, John Wiley & Sons 2014) can be used to introduce the protecting group. 16 When is tetrahydropyranyl, it is preferable to use TFA and 3,4-dihydro-2H-pyran for its introduction. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, and amide solvents, and dichloromethane is preferably used.

[0193] Steps 5A and 5B of Scheme 2 are steps for converting a compound represented by formula G2A or G2B into PG 24 and P.G. 25 to obtain a compound of formula H2A or H2B. 24 and P.G. 25 The removal of can be carried out by stirring the reaction mixture in the presence of a deprotecting reagent in a solvent at a temperature of from −20° C. to near the boiling point of the solvent, preferably from 0° C. to 180° C., for 15 minutes to 48 hours. The deprotection reagent is PG 24 and P.G. 25 Any reagent can be used as long as it can selectively remove only PG. 24 and P.G. 25 When these react together to form di-tert-butylsilyl, it is preferable to use a reagent that generates a fluoride ion, specifically, for example, tetrabutylammonium fluoride, for its removal. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, and amide solvents, and THF is preferably used.

[0194] Steps 6A and 6B in Scheme 2 are steps in which a compound represented by formula H2A or H2B is phosphite-esterified, followed by oxidation, to obtain a compound represented by formula I2A or I2B. The phosphite-esterification can be carried out by stirring the reaction mixture in the presence of a phosphite-esterifying reagent in a solvent at a temperature of from -20°C to near the boiling point of the solvent, preferably from 0°C to 180°C, for 15 minutes to 48 hours. The oxidation can be carried out in the presence of an oxidation reagent in a solvent at a temperature of from -20°C to near the boiling point of the solvent, preferably from 0°C to 180°C, for 15 minutes to 48 hours. Although the compound may be isolated after the phosphite-esterification, it is preferable to carry out the phosphite-esterification reaction and the oxidation reaction in one pot. In formula I2A or I2B, PG 27 is a protecting group for a hydroxyl group, and any protecting group can be used as long as it does not interfere with the progress of the reaction according to Scheme 2 above. PG 21 , P.G. 22 , P.G. 23 A protecting group that can be simultaneously deprotected is preferred. 27 Specific examples of the phosphite esterification reagent include benzyl. A phosphite esterification reagent in which the hydroxyl group is protected with a protecting group may be used, or an unprotected phosphite esterification reagent may be used and then a protecting group introduced to the hydroxyl group. The introduction of a protecting group can be performed using, for example, the method described in "Greene's, 'Protective Groups in Organic Synthesis' (5th ed., John Wiley & Sons 2014)." When using a phosphite esterification reagent in which the hydroxyl group is protected with benzyl, dibenzyl N,N-diisopropylphosphoramidite is preferably used as the phosphite esterification reagent. The oxidizing agent used for the oxidation following the phosphite esterification is not particularly limited, but Dess-Martin periodinane is preferably used. Examples of the solvent include halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, and nitrile solvents, and acetonitrile is preferably used.

[0195] Steps 7A and 7B in Scheme 2 are steps for converting a compound represented by I2A into PG 21 , P.G. 22 , P.G. 23 , and P.G. 27 or from the compound of formula I2B to obtain PG 21 , P.G. 23 , and P.G. 27 to obtain a compound represented by formula J2. These protecting groups can be removed by stirring the reaction mixture in a solvent in the presence of a deprotecting reagent at a temperature of from −20° C. to about the boiling point of the solvent, preferably at a temperature of from 0° C. to 180° C., for 15 minutes to 48 hours. Any method can be used for deprotection as long as it can selectively remove the above-mentioned protecting group. Specific examples of such methods include catalytic hydrogenation. For catalytic hydrogenation, a Pd-based catalyst, such as palladium / carbon, can be preferably used. Examples of the solvent include water, alcohol-based solvents, halogenated solvents, ether-based solvents, benzene-based solvents, ester-based solvents, ketone-based solvents, nitrile-based solvents, and amine-based solvents, and a mixed solvent of water and methanol can be preferably used.

[0196] Step 8 of Scheme 2 is the synthesis of a compound of formula J2 into PG 26 to obtain the compound of formula A. 26 The removal of can be carried out by stirring the reaction mixture in the presence of a deprotecting reagent in a solvent at a temperature of from −20° C. to near the boiling point of the solvent, preferably at a temperature of from 0° C. to 180° C., for 15 minutes to 48 hours. The deprotection reagent is PG 26 Any reagent can be used as long as it can selectively remove the hydroxyl group, and hydrochloric acid is preferably used. Examples of the solvent include water, halogenated solvents, ether solvents, benzene solvents, ester solvents, ketone solvents, and nitrile solvents, and water is preferably used. All prior art documents cited in this specification are hereby incorporated by reference. [Example]

[0197] The present invention is further illustrated by, but not limited to, the following examples. The following abbreviations are used in the examples: AA Ammonium Acetate CH2CN cyanomethyl group DBU 1,8-diazabicyclo[5.4.0]-7-undecene DCM dichloromethane DIC N,N-diisopropylcarbodiimide DIPEA N,N-Diisopropylethylamine DMF Dimethylformamide DMSO dimethyl sulfoxide FA formic acid Fmoc 9-fluorenylmethyloxycarbonyl group F-Pnaz 4-(2-(4-fluorophenyl)acetamido)benzyloxycarbonyl group: [ka] HFIP 1,1,1,3,3,3-hexafluoro-2-propanol MeCN acetonitrile NMP N-methyl-2-pyrrolidone TEA Triethylamine TFA trifluoroacetic acid TFE 2,2,2-trifluoroethanol THF tetrahydrofuran

[0198] In this example, the following abbreviations were used: Gly or G (glycine), Ile or I (isoleucine), Leu or L (leucine), Phe or F (phenylalanine), Pro or P (proline), and Thr or T (threonine). In addition, the abbreviations listed in Table 2 were used.

[0199] [Table 2]

[0200] The LCMS analysis conditions are shown in Tables 3 and 3-1 below.

[0201] [Table 3] [Table 3-1]

[0202] Example 1. Synthesis of uridine-diphosphate for introducing a uridine unit into the 3' end of a tRNA fragment by the ligation method To introduce a uridine unit into the 3' end of the tRNA fragment by the ligation method, uridine-diphosphate (SS01, pUp) was synthesized according to the method described in the literature (Nucleic Acids Research 2003, 31(22), e145).

[0203] Synthesis of a mixture (Compound SS01, pUp) of ((2R,3S,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-3-(phosphonooxy)tetrahydrofuran-2-yl)methyl dihydrogen phosphate (Compound SS02) and ((2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-3-hydroxy-4-(phosphonooxy)tetrahydrofuran-2-yl)methyl dihydrogen phosphate (Compound SS03) [ka]

[0204] 1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (10 mg, 0.041 mmol) and pyrophosphate tetrachloride (56.6 μL, 0.409 mmol) were mixed in an ice bath. The reaction mixture was stirred at 0°C for 5 hours, and then ice-cold purified water (38 mL) and 1 M triethylammonium bicarbonate buffer (2 mL) were added under ice cooling. The mixture was purified by DEAE-Sephadex A-25 column chromatography (0.05 M triethylammonium bicarbonate buffer → 1 M triethylammonium bicarbonate buffer), and the collected solution was concentrated under reduced pressure. The resulting residue was purified by reverse-phase silica gel column chromatography (aqueous solution of 15 mM TEA and 400 mM HFIP / methanol solution of 15 mM TEA and 400 mM HFIP) to give an aqueous solution (100 μL, 40.30 mM) of a mixture of ((2R,3S,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-hydroxy-3-(phosphonooxy)tetrahydrofuran-2-yl)methyl dihydrogen phosphate (Compound SS02) and ((2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-3-hydroxy-4-(phosphonooxy)tetrahydrofuran-2-yl)methyl dihydrogen phosphate (Compound SS03) (Compound SS01, pUp). LCMS(ESI) m / z=403(MH)- Retention time: 1.79 minutes, 1.89 minutes (Analysis conditions LTQTEA / HFIP05_01)

[0205] Example 2. Synthesis of lysidine-diphosphate for introducing a lysidine unit into the 3' end of a tRNA fragment by the ligation method To introduce a lysidine unit into the 3' end of a tRNA fragment by ligation, lysidine diphosphate (SS04, pLp) was synthesized according to the following scheme. [ka]

[0206] Synthesis of N6-(4-(4-bromobenzamido)-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidin-2(1H)-ylidene)-L-lysine Compound 2,2,2-trifluoroacetate (Compound SS05) [ka]

[0207] Under a nitrogen atmosphere, a mixture of (((9H-fluoren-9-yl)methoxy)carbonyl)-L-lysine hydrochloride (813 mg, 2.01 mmol), lithium chloride (213 mg, 5.02 mmol), and N4-p-bromobenzoyl-2',3'-O-isopropylidene-O2,5'-cyclocytidine (300 mg, 0.67 mmol) synthesized as described in Org. Lett. 2012, 14(16), 4118-4121 was added to THF (6.7 mL) at room temperature. The mixture was cooled in an ice bath, and DBU (1.50 mL, 10.04 mmol) was added. The reaction mixture was stirred at 0°C for 1 hour and then purified by reverse-phase silica gel column chromatography (0.1% FA aqueous solution / 0.1% FA acetonitrile solution) to give N6-(4-(4-bromobenzamido)-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidin-2(1H)-ylidene)-L-lysine compound 2,2,2-trifluoroacetate salt (Compound SS05) (335.6 mg, 71%). LCMS(ESI) m / z=594(M+H)+ Retention time: 0.41 minutes (Analysis conditions SQDFA05_01)

[0208] Synthesis of N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidin-2(1H)-ylidene)-L-lysine Compound 2,2,2-trifluoroacetate (Compound SS06) [ka]

[0209] N6-(4-(4-bromobenzamido)-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidin-2(1H)-ylidene)-L-lysine compound 2,2,2-trifluoroacetate (compound SS05) (311.12 mg, 0.44 mmol) and (2,5-dioxopyrrolidin-1-yl)(9H-fluoren-9-yl)methyl carbonate (148.09 mg, 0.44 mmol) were dissolved in a mixed solvent of 1,4-dioxane (2.75 ml) and ultrapure water (1.65 ml) at room temperature. The mixture was cooled in an ice bath, and then sodium carbonate (186.22 mg, 1.76 mmol) was added, warmed to room temperature, and stirred at room temperature for 2 hours. The reaction mixture was concentrated, and the residue was purified by reverse-phase silica gel column chromatography (0.05% TFA aqueous solution / 0.05% TFA acetonitrile solution) to give N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidin-2(1H)-ylidene)-L-lysine compound 2,2,2-trifluoroacetate salt (compound SS06) (328.78 mg, 80%). LCMS(ESI) m / z=816(M+H)+ Retention time: 0.68 minutes (Analysis conditions SQDFA05_01)

[0210] Synthesis of methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidin-2(1H)-ylidene)-L-lysinate 2,2,2-trifluoroacetate (Compound SS07) [ka]

[0211] Under a nitrogen atmosphere, N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidin-2(1H)-ylidene)-L-lysine compound 2,2,2-Trifluoroacetic acid salt (compound SS06) (438.60 mg, 0.47 mmol) was dissolved in DCM (4.71 ml) at room temperature, and the mixture was cooled in an ice bath. N,N'-diisopropylcarbodiimide (221.40 μl, 1.41 mmol), methanol (382.07 μl, 9.42 mmol), and N,N-dimethyl-4-aminopyridine (11.51 mg, 0.09 mmol) were added, and the temperature was raised to room temperature, followed by stirring at room temperature for 2 hours. The reaction mixture was concentrated, and the residue was purified by reverse-phase silica gel column chromatography (0.05% TFA aqueous solution / 0.05% TFA acetonitrile solution) to give methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidin-2(1H)-ylidene)-L-lysinate 2,2,2-trifluoroacetate (compound SS07) (405.00 mg, 91%). LCMS(ESI) m / z 828(MH)- Retention time: 0.76 minutes (Analysis conditions SQDFA05_02)

[0212] Synthesis of methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidin-2(1H)-ylidene)-L-lysinate 2,2,2-trifluoroacetate (Compound SS08) [ka]

[0213] Methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyltetrahydrofuro[3,4-d][1,3]dioxol-4-yl)pyrimidin-2(1H)-ylidene)-L-lysinate 2,2,2-trifluoroacetate (compound SS07) (308.70 mg, 0.33 mmol) was dissolved in a mixed solvent of TFA (8.71 ml) and ultrapure water (4.36 ml) while cooling in an ice bath, and the mixture was stirred at room temperature for 45 minutes. The reaction mixture was concentrated to give the crude product, methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidin-2(1H)-ylidene)-L-lysinate 2,2,2-trifluoroacetate (compound SS08) (296.00 mg). The resulting crude product, methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidin-2(1H)-ylidene)-L-lysinate 2,2,2-trifluoroacetate (Compound SS08), was used directly in the next step. LCMS(ESI) m / z=790(M+H)+ Retention time: 0.70 minutes (Analysis conditions SQDFA05_02)

[0214] Synthesis of methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-hydroxytetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl)pyrimidin-2(1H)-ylidene)-L-lysinate (Compound SS09) [ka]

[0215] Under a nitrogen atmosphere, the crude product obtained in the previous step, methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidin-2(1H)-ylidene)-L-lysinate 2,2,2-trifluoroacetate (Compound SS08) (296.00 mg, 0.33 mmol), was dissolved in DMF (3.27 ml) at room temperature, and the mixture was cooled in an ice bath. Then, di-tert-butylsilyl bis(trifluoromethanesulfonate) (211.80 μl, 0.65 mmol) was added and the mixture was stirred in an ice bath for 1 hour. Further, di-tert-butylsilyl bis(trifluoromethanesulfonate) (158.85 μl, 0.49 mmol) was added and stirred in an ice bath for 30 minutes. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture, and the resulting mixture was extracted with DCM. The organic layer was washed with saturated brine. The resulting organic layer was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The resulting residue was purified by normal-phase silica gel column chromatography (normal hexane / ethyl acetate, dichloromethane / methanol) to give methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-hydroxytetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl)pyrimidin-2(1H)-ylidene)-L-lysinate (compound SS09) (273.80 mg, 90%, 2 steps). LCMS(ESI) m / z=928.5(MH)- Retention time: 0.92 minutes (Analysis conditions SQDFA05_02)

[0216] Synthesis of methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromo-N-(((triisopropylsilyl)oxy)methyl)benzamido)-1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(((triisopropylsilyl)oxy)methoxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)pyrimidin-2(1H)-ylidene)-L-lysinate (Compound SS10) [ka]

[0217] Under a nitrogen atmosphere, methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromobenzamido)-1-((4aR,6R,7R,7aS)-2,2-di-tert-butyl-7-hydroxytetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)pyrimidin-2(1H)-ylidene)-L-lysinate (compound SS09) (386.15 mg, 0.42 mmol) was dissolved in DCM (8.30 ml) at room temperature, and DIPEA (722.88 μl, 4.15 mmol) and (triisopropylsiloxy)methyl chloride (481.40 μl, 2.07 mmol) were added. The reaction mixture was stirred at 45°C for 3 hours, then returned to room temperature and DIPEA (722.88µL, 4.15mmol) and (triisopropylsiloxy)methyl chloride (481.40µL, 2.07mmol) were added. The reaction mixture was stirred at 45°C for 4 hours. After returning to room temperature, DMSO was added, and then DCM was removed by blowing nitrogen. The resulting DMSO solution was purified by reverse-phase silica gel column chromatography (0.05% TFA aqueous solution / 0.05% TFA acetonitrile solution). The obtained fraction was neutralized with saturated sodium bicarbonate, and the target compound was extracted with ethyl acetate. The obtained organic layer was dried over anhydrous sodium sulfate, filtered, and then concentrated under reduced pressure to give methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromo-N-(((triisopropylsilyl)oxy)methyl)benzamido)-1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(((triisopropylsilyl)oxy)methoxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)pyrimidin-2(1H)-ylidene)-L-lysinate (Compound SS10) (291.55 mg, 54%). LCMS(ESI) m / z=1303(M+H)+ Retention time: 0.84 minutes (Analysis conditions SQDFA50)

[0218] Synthesis of methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromo-N-(((triisopropylsilyl)oxy)methyl)benzamido)-1-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)pyrimidin-2(1H)-ylidene)-L-lysinate (Compound SS11) [ka]

[0219] Under a nitrogen atmosphere, methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromo-N-(((triisopropylsilyl)oxy)methyl)benzamido)-1-((4aR,6R,7R,7aR)-2,2-di-tert-butyl-7-(((triisopropylsilyl)oxy)methoxy)tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl)pyrimidin-2(1H)-ylidene)-L-lysinate (compound SS10) (141.55 mg, 0.11 mmol) was dissolved in THF (2.17 ml) at room temperature and cooled to -80°C. Hydrogen fluoride pyridine complex (~30% pyridine, ~70% hydrogen fluoride) (9.85 μL) diluted with pyridine (134.41 μL) was added at -80°C, and the reaction mixture was stirred at -15°C for 15 minutes. After cooling to -80°C, methoxytrimethylsilane (7.0 mL) was added, and the resulting mixture was purified by reverse-phase silica gel column chromatography (0.05% TFA aqueous solution / 0.05% TFA acetonitrile solution). The resulting fraction was neutralized with saturated sodium bicarbonate, and the target compound was extracted with ethyl acetate. The obtained organic layer was dried over anhydrous sodium sulfate, filtered, and then toluene was added thereto and concentrated under reduced pressure to obtain the crude product, methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromo-N-(((triisopropylsilyl)oxy)methyl)benzamido)-1-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)pyrimidin-2(1H)-ylidene)-L-lysinate (compound SS11) (61.53 mg). The resulting crude product, methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromo-N-(((triisopropylsilyl)oxy)methyl)benzamido)-1-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)pyrimidin-2(1H)-ylidene)-L-lysinate (compound SS11), was used directly in the next step. LCMS (ESI) m / z=1162.8 (M+H)+ Holding time: 3.69 minutes (analysis conditions SQDFA05long)

[0220] Synthesis of methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(1-((2R,3R,4R,5R)-4-((bis(2-cyanoethoxy)phosphoryl)oxy)-5-(((bis(2-cyanoethoxy)phosphoryl)oxy)methyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)-4-(4-bromo-N-(((triisopropylsilyl)oxy)methyl)benzamido)pyrimidin-2(1H)-ylidene)-L-lysinate (Compound SS12)

change

[0221] Under a nitrogen atmosphere, the crude product, methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(4-(4-bromo-N-(((triisopropylsilyl)oxy)methyl)benzamido)-1-((2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)pyrimidin-2(1H)-ylidene)-L-lysinate (compound SS11) (61.53 mg, 0.053 mmol) and 1H-tetrazole (44.48 mg, 0.64 mmol) were dissolved in acetonitrile (3.53 ml) at room temperature. The mixture was cooled in an ice bath and then treated with bis(2-cyanoethyl)-N,N-diisopropylamino Phosphoramidite (82.77 μL, 0.32 mmol) was added, and the mixture was warmed to room temperature and stirred at room temperature for 3 hours. tert-Butyl hydroperoxide, 5-6M in decane (303.92 μL, 3.17 mmol) was added and stirred at room temperature for 10 minutes. The reaction mixture was then concentrated, and the resulting residue was purified by normal phase silica gel column chromatography (normal hexane / ethyl acetate, dichloromethane / methanol) to obtain the crude product methyl ester. N2-(((9H-Fluoren-9-yl)methoxy)carbonyl)-N6-(1-((2R,3R,4R,5R)-4-((bis(2-cyanoethoxy)phosphoryl)oxy)-5-(((bis(2-cyanoethoxy)phosphoryl)oxy)methyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)-4-(4-bromo-N-(((triisopropylsilyl)oxy)methyl)benzamido)pyrimidin-2(1H)-ylidene)-L-lysinate (compound SS12) (54.33 mg) was obtained.The resulting crude product, methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(1-((2R,3R,4R,5R)-4-((bis(2-cyanoethoxy)phosphoryl)oxy)-5-(((bis(2-cyanoethoxy)phosphoryl)oxy)methyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)-4-(4-bromo-N-(((triisopropylsilyl)oxy)methyl)benzamido)pyrimidin-2(1H)-ylidene)-L-lysinate (Compound SS12), was used directly in the next step. LCMS(ESI) m / z=1534.9(M+H)+ Retention time: 3.62 minutes (Analysis conditions SQDFA05long)

[0222] Synthesis of N6-(1-((2R,3R,4R,5R)-4-(phosphonooxy)-5-((phosphonooxy)methyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)-4-((((triisopropylsilyl)oxy)methyl)amino)pyrimidin-2(1H)-ylidene)-L-lysine (Compound SS13) [ka]

[0223] Under a nitrogen atmosphere, the crude product, methyl N2-(((9H-fluoren-9-yl)methoxy)carbonyl)-N6-(1-((2R,3R,4R,5R)-4-((bis(2-cyanoethoxy)phosphoryl)oxy)-5-(((bis(2-cyanoethoxy)phosphoryl)oxy)methyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)-4-(4-bromo-N-(((triisopropylsilyl)oxy) (Hydroxy)methyl)benzamido)pyrimidin-2(1H)-ylidene)-L-lysinate (compound SS12) (54.33 mg, 0.035 mmol) was dissolved in pyridine (2.36 ml) at room temperature, and bis-(trimethylsilyl)acetamide (345.98 μl, 1.42 mmol) and DBU (84.64 μl, 0.57 mmol) were added and stirred at room temperature for 45 minutes. Ultrapure water was added to the reaction solution, which was then washed with diethyl ether and normal hexane. Toluene and acetonitrile were added to the resulting aqueous layer, and the mixture was concentrated under reduced pressure to give the crude product N6-(1-((2R,3R,4R,5R)-4-(phosphonooxy)-5-((phosphonooxy)methyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)-4-((((triisopropylsilyl)oxy)methyl)amino)pyrimidin-2(1H)-ylidene)-L-lysine (compound SS13). The resulting crude product N6-(1-((2R,3R,4R,5R)-4-(phosphonooxy)-5-((phosphonooxy)methyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)-4-((((triisopropylsilyl)oxy)methyl)amino)pyrimidin-2(1H)-ylidene)-L-lysine (compound SS13) was used directly in the next step. LCMS(ESI) m / z=904.7(M+H)+ Retention time: 0.79 minutes (Analysis conditions SQDFA05_02)

[0224] Synthesis of N6-(4-amino-1-((2R,3R,4S,5R)-3-hydroxy-4-(phosphonooxy)-5-((phosphonooxy)methyl)tetrahydrofuran-2-yl)pyrimidin-2(1H)-ylidene)-L-lysine (Compound SS04, pLp) [ka]

[0225] The crude product, methyl N6-(1-((2R,3R,4R,5R)-4-(phosphonooxy)-5-((phosphonooxy)methyl)-3-(((triisopropylsilyl)oxy)methoxy)tetrahydrofuran-2-yl)-4-((((triisopropylsilyl)oxy)methyl)amino)pyrimidin-2(1H)-ylidene)-L-lysine (compound SS13), was dissolved in a mixed solvent of acetonitrile (885 μl) and ultrapure water (885 μl) at room temperature, and ammonium fluoride (15.73 mg, 0.43 mmol) was added and the mixture was stirred at 60°C for 2.5 hours. The mixture was returned to room temperature, and ammonium fluoride (15.73 mg, 0.43 mmol) was added, followed by stirring at 60°C for 1 hour. The mixture was returned to room temperature, and the acetonitrile was removed by blowing nitrogen. The resulting aqueous solution was purified by reverse-phase silica gel column chromatography (aqueous solution of 15 mM TEA and 400 mM HFIP / methanol solution of 15 mM TEA and 400 mM HFIP) to obtain an aqueous solution (100 μl, 17.20 mM) of N6-(4-amino-1-((2R,3R,4S,5R)-3-hydroxy-4-(phosphonooxy)-5-((phosphonooxy)methyl)tetrahydrofuran-2-yl)pyrimidin-2(1H)-ylidene)-L-lysine (compound SS04, pLp). LCMS(ESI) m / z=530(MH)- Retention time: 1.64 minutes (Analysis conditions LTQTEA / HFIP05_02)

[0226] Example 3. Synthesis of lysidine-diphosphate for introducing a lysidine unit into the 3' end of a tRNA fragment by the ligation method (Alternative method) We improved the synthesis of lysidine diphosphate, which is used to introduce a lysidine unit to the 3' end of tRNA fragments by ligation. Specifically, lysidine-diphosphate (SS04, pLp) was synthesized according to the following scheme. [ka]

[0227] Synthesis of ((3aR,4R,12R,12aR)-2,2-dimethyl-3a,4,12,12a-tetrahydro-5H,8H-4,12-epoxy[1,3]dioxolo[4,5-e]pyrimido[2,1-b][1,3]oxazocin-8-ylidene)benzyl carbamate (compound SS24) [ka]

[0228] Under a nitrogen atmosphere, a mixture of the known compound 2',3'-O-isopropylidene-4-N-(benzyloxycarbonyl)-cytidine (718.2 mg, 1.72 mmol) and triphenylphosphine (474 ​​mg, 1.81 mmol) was added to DCM (17.2 mL) at room temperature. The mixture was cooled in an ice bath, and then diisopropyl azodicarboxylate (385 μL, 1.98 mmol) was added. The mixture was then warmed to room temperature and stirred at room temperature for 1.5 hours. The reaction mixture was concentrated, and toluene (20 mL) was added. The resulting precipitate was collected by filtration. The resulting solid was washed three times with toluene to give ((3aR,4R,12R,12aR)-2,2-dimethyl-3a,4,12,12a-tetrahydro-5H,8H-4,12-epoxy[1,3]dioxolo[4,5-e]pyrimido[2,1-b][1,3]oxazocin-8-ylidene)benzyl carbamate (compound SS24) (525.7 mg, 76%). LCMS(ESI) m / z=400.3(M+H)+ Retention time: 0.48 minutes (Analysis conditions SQDFA05_02)

[0229] Synthesis of benzyl (2S)-6-[[1-[(3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]-2-(benzyloxycarbonylamino)hexanoate;2,2,2-trifluoroacetic acid (compound SS25) [ka]

[0230] Under a nitrogen atmosphere, a mixture of ((3aR,4R,12R,12aR)-2,2-dimethyl-3a,4,12,12a-tetrahydro-5H,8H-4,12-epoxy[1,3]dioxolo[4,5-e]pyrimido[2,1-b][1,3]oxazocin-8-ylidene)benzylcarbamate (Compound SS24) (300 mg, 0.75 mmol) and lithium chloride (159 mg, 3.76 mmol) was added to THF (7.5 mL) at room temperature and cooled in an ice bath. To this mixture was added a mixture of benzyl ((benzyloxy)carbonyl)-L-lysinate benzenesulfonate (813 mg, 2.01 mmol) and DBU (673 μL, 4.51 mmol) in THF (7.5 mL) under ice bath conditions, and the reaction mixture was stirred at 0 °C for 30 min. DMSO was added to the reaction mixture in an ice bath, and the mixture was warmed to room temperature. The reaction mixture was concentrated to remove THF. The residue was purified by reverse-phase silica gel column chromatography (0.05% TFA aqueous solution / 0.05% TFA acetonitrile solution) to give benzyl (2S)-6-[[1-[(3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]-2-(benzyloxycarbonylamino)hexanoate; 2,2,2-trifluoroacetic acid (compound SS25) (726.6 mg) in quantitative yield. LCMS(ESI) m / z=768.6(MH)- Retention time: 0.74 minutes (Analysis conditions SQDFA05_02)

[0231] Synthesis of benzyl (2S)-2-(benzyloxycarbonylamino)-6-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoate;2,2,2-trifluoroacetic acid (compound SS26) [ka]

[0232] Benzyl (2S)-6-[[1-[(3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]-2-(benzyloxycarbonylamino)hexanoate; 2,2,2-trifluoroacetic acid (compound SS25) (281.1 mg, 0.318 mmol) was dissolved in a mixture of TFA (4.24 mL) and ultrapure water (2.12 mL) while cooling in an ice bath, and the mixture was stirred at room temperature for 50 minutes. Toluene and acetonitrile were added, and the reaction mixture was concentrated. This operation was repeated several times to distill off water and TFA, and the crude product, benzyl (2S)-2-(benzyloxycarbonylamino)-6-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoate; 2,2,2-trifluoroacetic acid (Compound SS26) (272.6 mg), was obtained. The resulting crude product, benzyl (2S)-2-(benzyloxycarbonylamino)-6-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoate; 2,2,2-trifluoroacetic acid (Compound SS26), was used directly in the next step. LCMS(ESI) m / z=728.5(MH)- Retention time: 0.69 minutes (Analysis conditions SQDFA05_02)

[0233] Synthesis of benzyl (2S)-6-[[1-[(4aR,6R,7R,7aS)-2,2-ditert-butyl-7-hydroxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]-2-(benzyloxycarbonylamino)hexanoate;2,2,2-trifluoroacetic acid (Compound SS27) [ka]

[0234] Under a nitrogen atmosphere, the crude product obtained in the previous step, benzyl (2S)-2-(benzyloxycarbonylamino)-6-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoate; 2,2,2-trifluoroacetic acid (Compound SS26) (258 mg, 0.306 mmol) was dissolved in DMF (3.06 mL), and the mixture was cooled in an ice bath. After that, di-tert-butylsilyl bis(trifluoromethanesulfonate) (396 μL, 1.22 mmol) was added and the mixture was stirred in an ice bath for 2 hours. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture in an ice bath, and the resulting mixture was purified by reverse-phase silica gel column chromatography (0.05% aqueous TFA / 0.05% TFA acetonitrile solution) to give benzyl (2S)-6-[[1-[(4aR,6R,7R,7aS)-2,2-ditert-butyl-7-hydroxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]-2-(benzyloxycarbonylamino)hexanoate; 2,2,2-trifluoroacetic acid (Compound SS27) (234.0 mg, 78%, 2 steps). LCMS(ESI) m / z=868.8(MH)- Retention time: 0.88 minutes (Analysis conditions SQDFA05_02)

[0235] Synthesis of benzyl (2S)-6-[[1-[(4aR,6R,7R,7aR)-2,2-ditert-butyl-7-tetrahydropyran-2-yloxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]-2-(benzyloxycarbonylamino)hexanoate;2,2,2-trifluoroacetic acid (Compound SS28) [ka]

[0236] Under a nitrogen atmosphere, benzyl (2S)-6-[[1-[(4aR,6R,7R,7aS)-2,2-ditert-butyl-7-hydroxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]-2-(benzyloxycarbonylamino)hexanoate; 2,2,2-trifluoroacetic acid (compound SS27) (30 mg, 0.03 mmol) and TFA (6.98 μL, 0.09 mmol) were dissolved in DCM (610 μL) at room temperature, and 3,4-dihydro-2H-pyran (83 μL, 0.915 mmol) was added. The reaction mixture was stirred at room temperature for 13 hours, and then toluene was added. The reaction mixture was concentrated to obtain the crude product, benzyl (2S)-6-[[1-[(4aR,6R,7R,7aR)-2,2-ditert-butyl-7-tetrahydropyran-2-yloxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]-2-(benzyloxycarbonylamino)hexanoate; 2,2,2-trifluoroacetic acid (compound SS28), as a mixture of diastereomers derived from the asymmetric carbon on the THP protection. The resulting crude product, benzyl (2S)-6-[[1-[(4aR,6R,7R,7aR)-2,2-ditert-butyl-7-tetrahydropyran-2-yloxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]-2-(benzyloxycarbonylamino)hexanoate; 2,2,2-trifluoroacetic acid (Compound SS28), was used directly in the next step. LCMS(ESI) m / z=952.8(MH)- Retention time: 3.17 minutes, 3.38 minutes (Analysis conditions SQDAA50long)

[0237] Synthesis of benzyl (2S)-2-(benzyloxycarbonylamino)-6-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoate (compound SS29) [ka]

[0238] Under a nitrogen atmosphere, the crude product obtained in the previous step, benzyl (2S)-6-[[1-[(4aR,6R,7R,7aR)-2,2-ditert-butyl-7-tetrahydropyran-2-yloxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxasilin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]-2-(benzyloxycarbonylamino)hexanoate;2,2,2-trifluoroacetic acid (compound SS28), was dissolved in THF (610 μL) at room temperature, and tetrabutylammonium fluoride (~1 mol / L tetrahydrofuran solution) (305 μL, ~0.305 mmol) was added at room temperature. The reaction mixture was stirred at room temperature for 30 minutes. DMSO was added to the reaction mixture, and the mixture was concentrated to remove the THF. The residue was purified by reverse-phase silica gel column chromatography (10 mM AA aqueous solution / 10 mM AA acetonitrile solution) to give benzyl (2S)-2-(benzyloxycarbonylamino)-6-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoate (compound SS29) (21.51 mg, 87%, 2 steps) as a mixture of diastereomers derived from the asymmetric carbon on the THP protection. LCMS(ESI) m / z=812.7(MH)- Retention time: 1.74 minutes (Analysis conditions SQDAA50long)

[0239] Synthesis of benzyl (2S)-2-(benzyloxycarbonylamino)-6-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-dibenzyloxyphosphoryloxy-5-(dibenzyloxyphosphoryloxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoate (Compound SS30) [ka]

[0240] Under a nitrogen atmosphere, (2S)-2-(benzyloxycarbonylamino)-6-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoate benzyl (compound SS29) (21.51 mg, 0.026 mmol) and 1H-tetrazole (22.22 mg, 0.317 mmol) were dissolved in acetonitrile (1.06 mL) at room temperature, and dibenzyl N,N-diisopropylphosphoramidite (53.2 μL, 0.159 mmol) was added and the mixture was stirred at room temperature for 1 hour. Dess-Martin periodinane (135 mg, 0.317 mmol) was added and the mixture was stirred at room temperature for 15 minutes. The reaction mixture was then purified by reverse-phase silica gel column chromatography (10 mM AA aqueous solution / 10 mM AA acetonitrile solution) to quantitatively obtain benzyl (2S)-2-(benzyloxycarbonylamino)-6-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-dibenzyloxyphosphoryloxy-5-(dibenzyloxyphosphoryloxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoate (compound SS30) (36.59 mg, 2 steps) as a mixture of diastereomers derived from the asymmetric carbon of the THP protection. LCMS(ESI) m / z=1332.8(MH)- Retention time: 3.08 minutes, 3.11 minutes (Analysis conditions SQDAA50long)

[0241] Synthesis of (2S)-2-amino-6-[[4-amino-1-[(2R,3R,4S,5R)-3-hydroxy-4-phosphonooxy-5-(phosphonooxymethyl)tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoic acid (compound SS04, pLp) [ka]

[0242] Benzyl (2S)-2-(benzyloxycarbonylamino)-6-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-dibenzyloxyphosphoryloxy-5-(dibenzyloxyphosphoryloxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoate (Compound SS30) (36.59 mg, 0.027 mmol) was dissolved in a mixed solvent of methanol (649 μL) and ultrapure water (152 μL) at room temperature, and palladium / carbon (Pd 10%) (5.84 mg, 5.48 μmol) was added under a nitrogen atmosphere. The mixture was stirred at room temperature for 18 hours under a hydrogen atmosphere. The reaction mixture was filtered through Celite and washed several times with ultrapure water. To the resulting filtrate (24.66 mL), 1 mol / L hydrochloric acid (2.74 mL, 2.74 mmol) was added and the mixture was allowed to stand at room temperature for 1 hour. The reaction mixture was filtered through Celite and washed several times with ultrapure water. The filtrate was lyophilized, and the resulting powder was dissolved again in ultrapure water (1.52 mL). The mixture was centrifuged and the supernatant was collected to obtain an aqueous solution of (2S)-2-amino-6-[[4-amino-1-[(2R,3R,4S,5R)-3-hydroxy-4-phosphonooxy-5-(phosphonooxymethyl)tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]hexanoic acid (compound SS04, pLp) (1.37 mL, 17.47 mM, 87%, 2 steps). LCMS(ESI) m / z=530.1(MH)- Retention time: 1.60 minutes (Analysis conditions LTQTEA / HFIP05_02) The column was replaced between the analysis of compound SS04 synthesized in Example 2 and the analysis of compound SS04 synthesized in Example 3. Compound SS04 synthesized in Example 2 was reanalyzed after the column replacement, and it was confirmed to be identical to compound SS04 synthesized in Example 3. The results are shown below. LCMS(ESI) m / z=530.1(MH)- Retention time: 1.60 minutes (Analysis conditions LTQTEA / HFIP05_02)

[0243] Example 4. Synthesis of Agmatidine-diphosphate for introducing an Agmatidine unit into the 3' end of a tRNA fragment by the ligation method To introduce an Agmatidine unit into the 3' end of a tRNA fragment by ligation, Agmatidine diphosphate (SS31, p(Agm)p) was synthesized according to the following scheme. [ka]

[0244] Synthesis of benzyl N-[(4-aminobutylamino)-(benzyloxycarbonylamino)methylene]carbamate hydrochloride (compound SS32) [ka]

[0245] Under a nitrogen atmosphere, 4N-HCl / 1,4-dioxane (3.63 mL) was added to the known compound N-[benzyloxycarbonylamino-[4-(tert-butoxycarbonylamino)butylamino]methylene]carbamate (241 mg, 0.483 mmol) in an ice bath. The mixture was then warmed to room temperature and stirred for 20 minutes. After adding n-hexane, the reaction mixture was concentrated to quantitatively obtain benzyl N-[(4-aminobutylamino)-(benzyloxycarbonylamino)methylene]carbamate; hydrochloride (compound SS32) (256.5 mg). LCMS(ESI) m / z=399.4(M+H)+ Retention time: 0.61 minutes (Analysis conditions SQDFA05_02)

[0246] Synthesis of benzyl N-[[4-[[1-[(3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]butylamino]-(benzyloxycarbonylamino)methylene]carbamate;2,2,2-trifluoroacetic acid (compound SS33) [ka]

[0247] Under a nitrogen atmosphere, THF (0.998 mL) was added to a mixture of benzyl N-[(4-aminobutylamino)-(benzyloxycarbonylamino)methylene]carbamate hydrochloride (SS32) (65.1 mg, 0.150 mmol) and DBU (112 μL, 0.748 mmol) at room temperature, and the mixture was cooled in an ice bath. To this mixture, a mixture of ((3aR,4R,12R,12aR)-2,2-dimethyl-3a,4,12,12a-tetrahydro-5H,8H-4,12-epoxy[1,3]dioxolo[4,5-e]pyrimido[2,1-b][1,3]oxazocin-8-ylidene)benzylcarbamate (compound SS24) (49.8 mg, 0.125 mmol) and lithium chloride (26.4 mg, 0.624 mmol) in THF (1.497 mL) was added under ice bath conditions. The reaction mixture was pulverized in an ultrasonic cleaner and then stirred under ice bath conditions for 60 minutes. DMSO was added to the reaction mixture under ice bath conditions. After warming to room temperature, the reaction mixture was concentrated and the THF was removed by distillation. The residue was purified by reverse-phase silica gel column chromatography (0.05% TFA aqueous solution / 0.05% TFA acetonitrile solution) to give benzyl N-[[4-[[1-[(3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]butylamino]-(benzyloxycarbonylamino)methylene]carbamate; 2,2,2-trifluoroacetic acid (Compound SS33) (74.0 mg, 65%). LCMS(ESI) m / z=796.6(MH)- Retention time: 0.78 minutes (Analysis conditions SQDFA05_02)

[0248] Synthesis of benzyl N-[benzyloxycarbonylamino-[4-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]butylamino]methylene]carbamate; 2,2,2-trifluoroacetic acid (compound SS34) [ka]

[0249] Benzyl N-[[4-[[1-[(3aR,4R,6R,6aR)-6-(hydroxymethyl)-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]butylamino]-(benzyloxycarbonylamino)methylene]carbamate; 2,2,2-trifluoroacetic acid (Compound SS33) (109.5 mg, 0.120 mmol) was dissolved in a mixed solvent of TFA (1.60 mL) and ultrapure water (0.80 mL) while cooling in an ice bath, and the mixture was stirred at room temperature for 45 minutes. Toluene was added and the reaction mixture was concentrated, and this procedure was repeated several times to distill off water and TFA, yielding the crude product benzyl N-[benzyloxycarbonylamino-[4-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]butylamino]methylene]carbamate; 2,2,2-trifluoroacetic acid (Compound SS34) (105 mg). The resulting crude product, benzyl N-[benzyloxycarbonylamino-[4-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]butylamino]methylene]carbamate; 2,2,2-trifluoroacetic acid (Compound SS34), was used directly in the next step. LCMS(ESI) m / z=756.5(MH)- Retention time: 0.71 minutes (Analysis conditions SQDFA05_02)

[0250] Synthesis of benzyl N-[[4-[[1-[(4aR,6R,7R,7aS)-2,2-ditert-butyl-7-hydroxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]butylamino]-(benzyloxycarbonylamino)methylene]carbamate;2,2,2-trifluoroacetic acid (Compound SS35) [ka]

[0251] Under a nitrogen atmosphere, the crude product obtained in the previous step, benzyl N-[benzyloxycarbonylamino-[4-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]butylamino]methylene]carbamate; 2,2,2-trifluoroacetic acid (Compound SS34) (105 mg, 0.120 mmol) was dissolved in DMF (1.20 mL), the mixture was cooled in an ice bath, and then di-tert-butylsilyl bis(trifluoromethanesulfonate) (78 μL, 0.241 mmol) was added and stirred in an ice bath for 1 hour. Further di-tert-butylsilyl bis(trifluoromethanesulfonate) (78 μL, 0.241 mmol) was added and stirred in an ice bath for 30 minutes. Further, di-tert-butylsilyl bis(trifluoromethanesulfonate) (19.5 μL, 0.060 mmol) was added, and the mixture was stirred in an ice bath for 15 minutes. A saturated aqueous solution of sodium bicarbonate was added to the reaction mixture in an ice bath, and the resulting mixture was purified by reverse-phase silica gel column chromatography (0.05% aqueous TFA / 0.05% TFA in acetonitrile) to give benzyl N-[[4-[[1-[(4aR,6R,7R,7aS)-2,2-ditert-butyl-7-hydroxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]butylamino]-(benzyloxycarbonylamino)methylene]carbamate; 2,2,2-trifluoroacetic acid (Compound SS35) (108.02 mg, 89%, 2 steps). LCMS(ESI) m / z=896.7(MH)- Retention time: 0.91 minutes (Analysis conditions SQDFA05_02)

[0252] Synthesis of benzyl N-[[4-[[1-[(4aR,6R,7R,7aR)-2,2-ditert-butyl-7-tetrahydropyran-2-yloxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]butylamino]-(benzyloxycarbonylamino)methylene]carbamate;2,2,2-trifluoroacetic acid (Compound SS36) [ka]

[0253] Under a nitrogen atmosphere, benzyl N-[[4-[[1-[(4aR,6R,7R,7aS)-2,2-ditert-butyl-7-hydroxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]butylamino]-(benzyloxycarbonylamino)methylene]carbamate; 2,2,2-trifluoroacetic acid (Compound SS35) (64.51 mg, 0.064 mmol) and 3,4-dihydro-2H-pyran (173 μL, 1.912 mmol) were dissolved in DCM (1.28 mL), and the mixture was cooled in an ice bath. TFA (14.60 μL, 0.191 mmol) was then added. The reaction mixture was warmed to room temperature and stirred for 22.5 hours, after which toluene was added and the reaction mixture was concentrated to obtain the crude product, benzyl N-[[4-[[1-[(4aR,6R,7R,7aR)-2,2-ditert-butyl-7-tetrahydropyran-2-yloxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]butylamino]-(benzyloxycarbonylamino)methylene]carbamate; 2,2,2-trifluoroacetic acid (Compound SS36), as a mixture of diastereomers derived from the asymmetric carbon on the THP protection. The resulting crude product, benzyl N-[[4-[[1-[(4aR,6R,7R,7aR)-2,2-ditert-butyl-7-tetrahydropyran-2-yloxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]butylamino]-(benzyloxycarbonylamino)methylene]carbamate; 2,2,2-trifluoroacetic acid (Compound SS36), was used directly in the next step. LCMS(ESI) m / z=980.9(MH)- Retention time: 3.51 minutes, 3.72 minutes (Analysis conditions SQDAA50long)

[0254] Synthesis of benzyl N-[benzyloxycarbonylamino-[4-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]butylamino]methylene]carbamate (compound SS37) [ka]

[0255] Under a nitrogen atmosphere, the crude product obtained in the previous step, benzyl N-[[4-[[1-[(4aR,6R,7R,7aR)-2,2-ditert-butyl-7-tetrahydropyran-2-yloxy-4a,6,7,7a-tetrahydro-4H-furo[3,2-d][1,3,2]dioxacillin-6-yl]-4-(benzyloxycarbonylamino)pyrimidin-2-ylidene]amino]butylamino]-(benzyloxycarbonylamino)methylene]carbamate; 2,2,2-trifluoroacetic acid (Compound SS36) was dissolved in THF (1.28 mL) at room temperature, and the mixture was cooled in an ice bath. Tetrabutylammonium fluoride (~1 mol / L tetrahydrofuran solution) (638 μL, ~0.638 mmol) was then added. The reaction mixture was warmed to room temperature and stirred for 30 minutes. DMSO was added to the mixture, and the mixture was concentrated to remove THF. The residue was purified by reverse-phase silica gel column chromatography (10 mM AA aqueous solution / 10 mM AA acetonitrile solution) to give N-[benzyloxycarbonylamino-[4-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]butylamino]methylene]benzylcarbamate (compound SS37) (40.62 mg, 76%, 2 steps) as a diastereomeric mixture derived from the asymmetric carbon of the THP-protected carbon. LCMS(ESI) m / z=840.7(MH)- Retention time: 2.27 minutes (Analysis conditions SQDAA50long)

[0256] Synthesis of benzyl N-[benzyloxycarbonylamino-[4-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-dibenzyloxyphosphoryloxy-5-(dibenzyloxyphosphoryloxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]butylamino]methylene]carbamate (compound SS38) [ka]

[0257] Under a nitrogen atmosphere, benzyl N-[benzyloxycarbonylamino-[4-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-hydroxy-5-(hydroxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]butylamino]methylene]carbamate (Compound SS37) (40.62 mg, 0.048 mmol) and 1H-tetrazole (40.6 mg, 0.579 mmol) were dissolved in toluene and concentrated. The residue was dissolved in acetonitrile (1.93 mL) at room temperature, and the mixture was cooled in an ice bath. Dibenzyl N,N-diisopropylphosphoramidite (97 μL, 0.289 mmol) was added and the reaction mixture was warmed to room temperature and stirred for 2.5 hours. Dess-Martin periodinane (246 mg, 0.579 mmol) was added and the mixture was stirred at room temperature for 15 minutes. The reaction mixture was then purified by reverse-phase silica gel column chromatography (10 mM AA aqueous solution / 10 mM AA acetonitrile solution) to give N-[benzyloxycarbonylamino-[4-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-dibenzyloxyphosphoryloxy-5-(dibenzyloxyphosphoryloxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]butylamino]methylene]benzyl carbamate (compound SS38) (59.66 mg, 91%, 2 steps) as a mixture of diastereomers derived from the asymmetric carbon on the THP protection. LCMS(ESI) m / z=1363.0(M+H)+ Retention time: 4.11 minutes, 4.14 minutes (Analysis conditions SQDAA05long)

[0258] Synthesis of dihydrogen phosphate [(2R,3S,4R,5R)-5-[4-amino-2-(4-guanidinobutylimino)pyrimidin-1-yl]-4-hydroxy-2-(phosphonooxymethyl)tetrahydrofuran-3-yl] (compound SS31, p(Agm)p) [ka]

[0259] N-[benzyloxycarbonylamino-[4-[[4-(benzyloxycarbonylamino)-1-[(2R,3R,4R,5R)-4-dibenzyloxyphosphoryloxy-5-(dibenzyloxyphosphoryloxymethyl)-3-tetrahydropyran-2-yloxy-tetrahydrofuran-2-yl]pyrimidin-2-ylidene]amino]butylamino]methylene]benzylcarbamate (compound SS38) (30.59 mg, 0.022 mmol) was dissolved in a mixed solvent of methanol (727 μL) and ultrapure water (171 μL) at room temperature, and palladium / carbon (Pd 10%) (4.78 mg, 4.49 μmol) was added under a nitrogen atmosphere. The mixture was stirred at room temperature under a hydrogen atmosphere for 7 hours. The reaction mixture was filtered through Celite and washed several times with ultrapure water. To the resulting filtrate (25 mL), 1 mol / L hydrochloric acid (2.78 mL, 2.78 mmol) was added and the mixture was left to stand at room temperature for 45 minutes. The reaction mixture was lyophilized, and the resulting powder was dissolved in ultrapure water, filtered through Celite, and washed several times with ultrapure water. The filtrate was lyophilized, and the resulting powder was dissolved in ultrapure water (1.7 mL). The mixture was centrifuged and the supernatant was collected to obtain an aqueous solution of dihydrogen phosphate [(2R,3S,4R,5R)-5-[4-amino-2-(4-guanidinobutylimino)pyrimidin-1-yl]-4-hydroxy-2-(phosphonooxymethyl)tetrahydrofuran-3-yl] (compound SS31, p(Agm)p) (1.61 mL, 12.11 mM, 87%, 2 steps). LCMS(ESI) m / z=514.1(MH)- Retention time: 1.58 minutes (Analysis conditions LTQTEA / HFIP05_02)

[0260] Example 5. Synthesis of pCpA-amino acid for use in cell-free translation system Aminoacylated pCpAs (SS14, SS15, SS16, SS39, and SS40) were synthesized according to the following scheme. [ka]

[0261] Synthesis of (S)-1-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)piperidine-2-carboxylic acid (compound SS17, F-Pnaz-Pic2-OH) [ka]

[0262] Under a nitrogen atmosphere, a mixture of (S)-piperidine-2-carboxylic acid (42.6 mg, 0.33 mmol) and (4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl carbonate (compound ts11) (140 mg, 0.44 mmol) synthesized by the method described in patent document (WO2018143145A1) was added to DMF (330 μL) at room temperature. After stirring at room temperature for 5 minutes, triethylamine (105.6 μL, 2.25 mmol) was added at 0 °C. The reaction mixture was stirred at room temperature for 30 minutes and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to give (S)-1-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)piperidine-2-carboxylic acid (compound SS17, F-Pnaz-Pic2-OH) (92 mg, 67%). LCMS(ESI) m / z=413(MH)- Retention time: 0.70 minutes (Analysis conditions SQDFA05_01)

[0263] (S)-Piperidine-1,2-dicarboxylic acid 1-(4-(2-(4-fluorophenyl)acetamido)benzyl) 2-(cyanomethyl) (compound SS18, F-Pnaz-Pic2-OCH 2 Synthesis of CN [ka]

[0264] Under a nitrogen atmosphere, ((S)-1-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)piperidine-2-carboxylic acid (compound SS17, F-Pnaz-Pic2-OH) (30 mg, 0.072 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (20.23 μL, 0.116 mmol) were dissolved in acetonitrile (90 μL), and 2-bromoacetonitrile (5.34 μL, 0.080 mmol) was added at 0° C., followed by stirring at room temperature for 2 hours. The reaction mixture was concentrated, and the crude product (S)-piperidine-1,2-dicarboxylic acid 1-(4-(2-(4-fluorophenyl)acetamido)benzyl) 2-(cyanomethyl) (Compound SS18, F-Pnaz-Pic-OCHCN) was obtained. The obtained crude product was dissolved in acetonitrile (2.00 mL) and used directly in the next step. LCMS(ESI) m / z=452(MH)- Retention time: 0.79 minutes (Analysis conditions SQDFA05_01)

[0265] Synthesis of (2S)-piperidine-1,2-dicarboxylic acid 1-(4-(2-(4-fluorophenyl)acetamido)benzyl) 2-((2R,3S,4R,5R)-2-(((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purin-9-yl)-4-hydroxytetrahydrofuran-3-yl) (compound SS14, F-Pnaz-Pic2-pCpA) [ka]

[0266] In buffer solution A (40 mL) was dissolved ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate (compound pc01) (113 mg, 0.156 mmol), which was synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310). 1-(4-(2-(4-fluorophenyl)acetamido)benzyl (S)-piperidine-1,2-dicarboxylate A solution of 2-(cyanomethyl) (compound SS18, F-Pnaz-Pic2-OCH2CN) (35.4 mg, 0.078 mmol) in acetonitrile (2.00 mL) was added and stirred at room temperature for 150 minutes. The reaction solution was cooled to 0°C, and then trifluoroacetic acid (2.00 mL) was added. After stirring at 0°C for 45 minutes, the reaction solution was purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to obtain the title compound (compound SS14, F-Pnaz-Pic2-pCpA) (6.0 mg, 7.3%). LCMS(ESI) m / z=1047.5(MH)- Retention time: 0.50 minutes (Analysis conditions SQDFA05_01)

[0267] Buffer A was prepared as follows. Acetic acid was added to an aqueous solution of N,N,N-trimethylhexadecan-1-aminium chloride (6.40 g, 20 mmol) and imidazole (6.81 g, 100 mmol) to obtain Buffer A (1 L) with a pH of 8 and a concentration of 20 mM N,N,N-trimethylhexadecan-1-aminium and 100 mM imidazole.

[0268] Synthesis of O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-L-serine (compound SS19, F-Pnaz-SPh2Cl-OH) [ka]

[0269] Under a nitrogen atmosphere, DMSO (15 mL) and triethylamine (0.95 g, 9.42 mmol) were added to a mixture of O-(2-chlorophenyl)-L-serine (compound aa63) (1.25 g, 5.80 mmol) synthesized by the method described in patent document (WO2018225864) and carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl (compound ts11) (2 g, 4.71 mmol) synthesized by the method described in patent document (WO2018143145A1) at room temperature. The reaction mixture was stirred at room temperature for 16 hours and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to give O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-L-serine (compound SS19, F-Pnaz-SPh2Cl-OH) (1.8 g, 73%). LCMS(ESI) m / z=523(M+Na)+ Retention time: 1.26 minutes (Analysis conditions SMD method 1)

[0270] Cyanomethyl O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-L-serinate (compound SS20, F-Pnaz-SPhCl-OCH 2 Synthesis of CN [ka]

[0271] Under a nitrogen atmosphere, O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-L-serine (compound SS19, F-Pnaz-SPhCl-OH) (800 mg, 1.60 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (0.412 g, 3.19 mmol) were dissolved in DCM (15 mL), and 2-bromoacetonitrile (760 mg, 6.34 mmol) was added at room temperature, followed by stirring at room temperature for 16 hours. The reaction mixture was concentrated and purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to give cyanomethyl O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-L-serinate (compound SS20, F-Pnaz-SPhCl-OCHCN) (220 mg, 26%). The resulting product was dissolved in acetonitrile (5 mL) and used in the next step. LCMS(ESI) m / z=562(M+Na)+ Retention time: 1.15 minutes (Analysis conditions SMD method 2)

[0272] Synthesis of (2R,3S,4R,5R)-2-(((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purin-9-yl)-4-hydroxytetrahydrofuran-3-yl O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-L-serinate (Compound SS15, F-Pnaz-SPh2Cl-pCpA) [ka]

[0273] In Buffer A (100 mL), ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogen phosphate (Compound pc01) (400 mg, 0.55 mmol) was dissolved, and cyanomethyl A solution of O-(2-chlorophenyl)-N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-L-serinate (compound SS20, F-Pnaz-SPh2Cl-OCH2CN) (220 mg, 0.41 mmol) in acetonitrile (5 mL) was added dropwise over 15 minutes using a syringe pump, followed by stirring at room temperature for 5 minutes. Subsequently, trifluoroacetic acid (2.3 mL) was added to the reaction mixture. The reaction mixture was lyophilized and then purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to yield the title compound (compound SS15, F-Pnaz-SPh2Cl-pCpA) (20.7 mg, 2%). LCMS(ESI) m / z=1133.4(MH)- Retention time: 0.55 minutes (Analysis conditions SQDFA05_01)

[0274] Synthesis of (S)-2-(methylamino)-4-phenylbutanoic acid (compound SS21, MeHph-OH) [ka]

[0275] (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (compound aa11) (150 mg, 0.361 mmol) synthesized by the method described in patent document (WO2018225864) DCM (903 μL), water (903 μL) and piperidine (178 μL, 1.805 mmol) were added at room temperature. The reaction mixture was stirred at room temperature for 30 minutes and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain ((S)-2-(methylamino)-4-phenylbutanoic acid (compound SS21, MeHph-OH) (55 mg, 79%). LCMS(ESI) m / z=192(MH)- Retention time: 0.15 minutes (Analysis conditions SQDFA05_02)

[0276] Synthesis of (S)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (compound SS22, F-Pnaz-MeHph-OH) [ka]

[0277] Under a nitrogen atmosphere, DMSO (727 μL) was added to a mixture of ((S)-2-(methylamino)-4-phenylbutanoic acid (compound SS21, MeHph-OH) (35.1 mg, 0.182 mmol) and (4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl carbonate (compound ts11) (85 mg, 0.20 mmol) synthesized by the method described in patent document (WO2018143145A1) at room temperature. Triethylamine (76 μL) , 0.545 mmol) was added at 50° C. The reaction mixture was stirred at 40° C. for 16 hours and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to obtain (S)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (compound SS22, F-Pnaz-MeHph-OH) (80 mg, 92%). LCMS(ESI) m / z=477(MH)- Retention time: 0.85 minutes (Analysis conditions SQDFA05_02)

[0278] (S)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoate cyanomethyl ester (compound SS23, F-Pnaz-MeHph-OCH 2 Synthesis of CN [ka]

[0279] Under a nitrogen atmosphere, acetonitrile (533 μL) was added to a mixture of (S)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (compound SS22, F-Pnaz-MeHph-OH) (77 mg, 0.16 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (31 μL, 0.176 mmol) at room temperature. 2-Bromoacetonitrile (86 μL, 1.280 mmol) was then added at room temperature, and the reaction mixture was stirred at 40° C. for 1 hour. The reaction mixture was concentrated to obtain the crude product, cyanomethyl (S)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoate (compound SS23, F-Pnaz-MeHph-OCHCN). The obtained crude product was dissolved in acetonitrile (5.00 mL) and used as it was in the next step. LCMS(ESI) m / z=516(MH)- Retention time: 0.92 minutes (Analysis conditions SQDFA05_02)

[0280] Synthesis of (2S)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoic acid (2R,3S,4R,5R)-2-(((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purin-9-yl)-4-hydroxytetrahydrofuran-3-yl (compound SS16, F-Pnaz-MeHph-pCpA) [ka]

[0281] In Buffer A (100 mL) was added dihydrogen phosphate ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl (S)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoate cyanomethyl (Compound pc01) (127 mg, 0.176 mmol) was dissolved in the solution, and an acetonitrile solution (5.00 mL) of (S)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)(methyl)amino)-4-phenylbutanoate cyanomethyl (Compound SS23, F-Pnaz-MeHph-OCHCN) (83 mg, 0.16 mmol) was added, followed by stirring at room temperature for 1 hour. The reaction solution was cooled to 0°C, and then trifluoroacetic acid (5.00 mL) was added. After stirring the reaction mixture at 0°C for 1 hour, the mixture was purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid solution / 0.05% trifluoroacetic acid-acetonitrile solution) and then further purified by reverse-phase silica gel column chromatography (0.1% aqueous formic acid solution / 0.1% formic acid-acetonitrile solution) to obtain the title compound (Compound SS16, F-Pnaz-MeHph-pCpA) (26 mg, 14.6%). LCMS(ESI) m / z=1111.5(MH)- Retention time: 0.64 minutes (Analysis conditions SQDFA05_02)

[0282] Synthesis of (S)-3-(3-chlorophenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid (compound SS41, F-Pnaz-F3Cl-OH) [ka]

[0283] Under a nitrogen atmosphere, a mixture of (S)-2-amino-3-(3-chlorophenyl)propanoic acid (H-Phe(3-Cl)—OH) (2.17 g, 10.87 mmol) synthesized by the method described in patent document (WO2018225864) and carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl (compound ts11) (3.0 g, 7.07 mmol) synthesized by the method described in patent document (WO2018143145A1) was added at room temperature with DMSO (15 mL) and triethylamine (1.43 g, 14.13 mmol). The reaction mixture was stirred at room temperature for 16 hours and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to give (S)-3-(3-chlorophenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid (compound SS41, F-Pnaz-F3Cl-OH) (0.7 g, 20%). LCMS(ESI) m / z=507(M+Na)+ Retention time: 1.06 minutes (Analysis conditions SMD method 3)

[0284] (S)-3-(3-chlorophenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid cyanomethyl ester (compound SS42, F-Pnaz-F3Cl-OCH 2 Synthesis of CN [ka]

[0285] Under a nitrogen atmosphere, (S)-3-(3-chlorophenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid (compound SS41, F-Pnaz-F3Cl-OH) (650 mg, 1.34 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (0.346 g, 2.68 mmol) were dissolved in DCM (28 mL), and 2-bromoacetonitrile (640 mg, 5.34 mmol) was added at room temperature, followed by stirring at room temperature for 48 hours. The reaction mixture was concentrated and purified by normal phase silica gel column chromatography (ethyl acetate / petroleum ether) to obtain cyanomethyl (S)-3-(3-chlorophenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoate (compound SS42, F-Pnaz-F3Cl-OCH2CN) (330 mg, 47%). LCMS(ESI) m / z=546(M+Na)+ Retention time: 1.13 minutes (Analysis conditions SMD method 3)

[0286] Synthesis of (2S)-3-(3-chlorophenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoic acid (2R,3S,4R,5R)-2-(((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purin-9-yl)-4-hydroxytetrahydrofuran-3-yl (compound SS39, F-Pnaz-F3Cl-pCpA) [ka]

[0287] Into buffer solution A (100 mL) was added ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl) dihydrogen phosphate, synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310). Methyl (Compound pc01) (552 mg, 0.76 mmol) was dissolved in the solution, and a solution of (S)-3-(3-chlorophenyl)-2-((((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)amino)propanoate cyanomethyl (Compound SS42, F-Pnaz-F3Cl-OCH2CN) (200 mg, 0.38 mmol) in acetonitrile (5 mL) was added dropwise over 15 minutes using a syringe pump, followed by stirring at room temperature for 30 minutes. Trifluoroacetic acid (2.3 mL) was added to the reaction solution. The reaction solution was lyophilized and then purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to yield the title compound (Compound SS39, F-Pnaz-F3Cl-pCpA) (25.3 mg, 1%). LCMS(ESI) m / z=1117.4(MH)- Retention time: 0.55 minutes (Analysis conditions SQDFA05_01)

[0288] Synthesis of N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-isopentyl-L-serine (compound SS43, F-Pnaz-SiPen-OH) [ka]

[0289] Under a nitrogen atmosphere, a mixture of O-isopentyl-L-serine (H-Ser(iPen)-OH) (1 g, 5.71 mmol), a compound described in patent document (WO2018225864), and carbonate-(4-nitrophenyl)-4-(2-(4-fluorophenyl)acetamido)benzyl (compound ts11) (2 g, 4.71 mmol), synthesized by the method described in patent document (WO2018143145A1), was added with DMSO (15 mL) and triethylamine (1.3 mL, 9.42 mmol) at room temperature. The reaction mixture was stirred at room temperature for 16 hours and then purified by reverse-phase silica gel column chromatography (0.1% formic acid aqueous solution / 0.1% formic acid acetonitrile solution) to give N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-isopentyl-L-serine (compound SS43, F-Pnaz-SiPen-OH) (1.8 g, 83%). LCMS(ESI) m / z=483(M+Na)+ Retention time: 1.04 minutes (Analysis conditions SMD method 3)

[0290] Cyanomethyl N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-isopentyl-L-serinate (compound SS44, F-Pnaz-SiPen-OCH 2 Synthesis of CN [ka]

[0291] Under a nitrogen atmosphere, N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-isopentyl-L-serine (compound SS43, F-Pnaz-SiPen-OH) (1.8 g, 3.91 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (1 g, 7.74 mmol) were dissolved in DCM (40 mL), and 2-bromoacetonitrile (1.9 g, 15.84 mmol) was added at room temperature and stirred at room temperature for 48 hours. The reaction mixture was concentrated and purified by normal phase silica gel column chromatography (ethyl acetate / petroleum ether) to obtain cyanomethyl N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-isopentyl-L-serinate (compound SS44, F-Pnaz-SiPen-OCHCN) (1.6 g, 82%). LCMS(ESI) m / z=522(M+Na)+ Retention time: 1.35 minutes (Analysis conditions SMD method 4)

[0292] Synthesis of (2R,3S,4R,5R)-2-(((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-purin-9-yl)-4-hydroxytetrahydrofuran-3-yl N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-isopentyl-L-serinate (Compound SS40, F-Pnaz-SiPen-pCpA) [ka]

[0293] Into 100 mL of buffer solution A was dissolved 400 mg of ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogenphosphate (compound pc01) (0.55 mmol), which had been synthesized by the method described in the literature (Helv. Chim. Acta, 90, 297-310). A solution of N-(((4-(2-(4-fluorophenyl)acetamido)benzyl)oxy)carbonyl)-O-isopentyl-L-serinate (compound SS44, F-Pnaz-SiPen-OCHCN) (139 mg, 0.28 mmol) in acetonitrile (5 mL) was added dropwise over 15 minutes using a syringe pump, and the mixture was stirred at room temperature for 3 hours. Trifluoroacetic acid (2.3 mL) was added to the reaction solution. The reaction solution was lyophilized and then purified by reverse-phase silica gel column chromatography (0.05% aqueous trifluoroacetic acid / 0.05% trifluoroacetic acid acetonitrile) to give the title compound (compound SS40, F-Pnaz-SiPen-pCpA) (39.5 mg, 3%). LCMS(ESI) m / z=1093.5(MH)- Retention time: 0.55 minutes (Analysis conditions SQDFA05_01)

[0294] Example 6. Synthesis of BdpFL-Phe-pCpA (MT01) Synthesis of (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborin-3-yl)propanoyl)-L-phenylalanine (compound MT02, BdpFL-Phe-OH) [ka]

[0295] Under a nitrogen atmosphere, a solution of 3-(2-carboxyethyl)-5,5-difluoro-7,9-dimethyl-5H-5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborin-4-ium (200 mg, 0.685 mmol) and 1-hydroxypyrrolidine-2,5-dione (87 mg, 0.753 mmol) in NMP (4.5 mL) was added with DIC (0.128 mL, 0.822 mmol) at room temperature and stirred overnight at 40 °C. After returning to room temperature, L-phenylalanine (113 mg, 0.685 mmol) and TEA (0.191 mL, 1.369 mmol) were added to the reaction mixture and stirred overnight at 40 °C. The reaction mixture was purified by reverse-phase column chromatography (0.1% FA MeCN / HO) to obtain (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborin-3-yl)propanoyl)-L-phenylalanine (compound MT02, BdpFL-Phe-OH) (102 mg, 34% yield). LCMS(ESI) m / z=438.3(MH)- Retention time: 0.78 minutes (Analysis conditions SQDFA05_02)

[0296] (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborin-3-yl)propanoyl)-L-phenylalanine cyanomethyl ester (compound MT03, BdpFL-Phe-OCH 2 Synthesis of CN [ka]

[0297] Under a nitrogen atmosphere, (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborin-3-yl)propanoyl)-L-phenylalanine (50 mg, 0.114 mmol) and N-ethyl-isopropylpropan-2-amine (DIPEA) (31.0 μL, 0.177 mmol) were dissolved in acetonitrile (500 μL), and 2-bromoacetonitrile (12 μL, 0.177 mmol) was added at 0°C. The mixture was then stirred at 40°C for 3 hours. The reaction mixture was concentrated to give (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborin-3-yl)propanoyl)-L-phenylalanine cyanomethyl ester (compound MT02, BdpFL-Phe-OCH2CN) as a crude product, which was used directly in the next step. LCMS(ESI) m / z=477.3(MH)- Retention time: 0.86 minutes (Analysis conditions SQDFA05_01)

[0298] 3-(3-(((2S)-1-(((2R,3S,4R,5R)-2-(((((2R,3S,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl)-5-(6-amino-9H-pyrimidin-1(2H)-yl)-4-hydroxy-2-((phosphonooxy)methyl)tetrahydrofuran-3-yl)oxy)(hydroxy)phosphoryl)oxy)methyl) Synthesis of (4-hydroxytetrahydrofuran-3-yl)oxy)-1-oxo-3-phenylpropan-2-yl)amino)-3-oxopropyl)-5,5-difluoro-7,9-dimethyl-5H-5λ4-dipyrrolo[1,2-c:2',1'-f][1,3,2]diazaborin-4-ium (compound MT01, BdpFL-Phe-pCpA) [ka]

[0299] In Buffer A (11.3 mL), ((2R,3R,4R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-(((((2R,3S,4R,5R)-5-(6-amino-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl)methoxy)(hydroxy)phosphoryl)oxy)-4-((tetrahydrofuran-2-yl)oxy)tetrahydrofuran-2-yl)methyl dihydrogen phosphate (Compound pc01) (33.2 mg, 0.046 mmol) was dissolved, and (3-(5,5-difluoro-7,9-dimethyl-5H-4λ4,5λ4-dipyrrolo[1,2-c:2′,1′-f][1,3,2]diazaborin-3-yl)propanoyl)-L-phenylalanine A solution (0.13 mL) of the cyanomethyl ester (compound MT03, BdpFL-Phe-OCHCN) (11 mg, 0.023 mmol) in acetonitrile was added, followed by stirring at room temperature for 45 minutes. TFA (0.56 mL) was added to the reaction mixture at 0°C, and the mixture was stirred for 5 minutes, followed by stirring at room temperature for 10 minutes. The reaction mixture was purified by reverse-phase silica gel column chromatography (0.05% TFA MeCN / HO) to obtain the title compound (compound MT01, BdpFL-Phe-pCpA) (2.1 mg, 8.5% yield). LCMS(ESI) m / z=1072.5(MH)- Retention time: 0.56 minutes (Analysis conditions SQDFA05_02)

[0300] Example 7. Synthesis of (2S,3R)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-((tetrahydro-2H-pyran-2-yl)oxy)butanoic acid (Fmoc-Thr(THP)-OH) for use in peptide synthesis of LCT-12 using a peptide synthesizer [ka]

[0301] Toluene (50 mL) was added to a mixture of (2S,3R)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-hydroxybutanoic acid monohydrate (Fmoc-Thr-OH monohydrate, purchased from Tokyo Chemical Industry Co., Ltd., 5.0 g, 13.9 mmol) and pyridinium p-toluenesulfonate (PPTS, 0.175 g, 0.70 mmol). The water content was then removed by azeotropy. To the resulting residue, ultra-dehydrated tetrahydrofuran (THF, 28 mL) and 3,4-dihydro-2H-pyran (8.8 mL, 97 mmol) were added and the mixture was stirred at 50 °C for 4 hours under a nitrogen atmosphere. After confirming the disappearance of the starting materials by LCMS (SQDFA05), the mixture was cooled to 25 °C and ethyl acetate (30 mL) was added. Subsequently, saturated aqueous sodium chloride solution (30 mL) was added to wash the organic layer, and the aqueous layer was extracted with ethyl acetate (30 mL). All the obtained organic layers were combined and washed twice with saturated aqueous sodium chloride solution (30 mL). The organic layer was dried over sodium sulfate, and the solvent was evaporated under reduced pressure to obtain a crude product (9.3 g).

[0302] 4.65 g of the resulting crude product was dissolved in tetrahydrofuran (THF, 30 mL) and then 1.0 M phosphate buffer (30 mL) adjusted to pH 8.0 was added. This mixture was stirred at 50°C for 4 hours. After cooling to 25°C, ethyl acetate (30 mL) was added, and the organic and aqueous layers were separated. After extraction with ethyl acetate (30 mL) into the aqueous layer, all the resulting organic layers were combined and washed twice with saturated aqueous sodium chloride (30 mL). The organic layer was dried over sodium sulfate, the solvent was evaporated under reduced pressure, and the mixture was further dried under reduced pressure at 25°C for 30 minutes.

[0303] The resulting residue was dissolved in diethyl ether (50 mL), followed by the addition of heptane (50 mL). Diethyl ether was distilled off under controlled reduced pressure (~100 hPa), and the resulting mixture was filtered to obtain a solid. This heptane washing procedure was repeated twice. The resulting solid was dried under reduced pressure at 25°C for 2 hours to obtain the sodium salt of Fmoc-Thr(THP)-OH (2.80 g, 6.26 mmol).

[0304] Ethyl acetate (50 mL) and 0.05 M aqueous phosphoric acid (pH 2.1) (140 mL) were added to the entire sodium salt of Fmoc-Thr(THP)-OH obtained, and the mixture was stirred at 25°C for 5 minutes. The organic and aqueous layers were then separated. Ethyl acetate (50 mL) was added to the aqueous layer for extraction, and all the resulting organic layers were combined and washed twice with saturated aqueous sodium chloride (50 mL). The organic layer was dried over sodium sulfate, and the solvent was evaporated under reduced pressure. The residue was dried under reduced pressure at 25°C for 2 hours. The resulting solid was then dissolved in t-butyl methyl ether (TBME, 50 mL), and the solvent was evaporated under reduced pressure. Further drying at 25°C under reduced pressure with a pump gave (2S,3R)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-((tetrahydro-2H-pyran-2-yl)oxy)butanoic acid (Fmoc-Thr(THP)-OH, 2.70 g, 30 mol% t-butyl methyl ether (TBME) remaining) as a diastereomeric mixture derived from the asymmetric carbon of the THP protection. The obtained Fmoc-Thr(THP)-OH was stored in a freezer at -25°C. LCMS(ESI)m / z=424.2(M−H)- Retention time: 0.84 minutes, 0.85 minutes (Analysis conditions SQDFA05_01)

[0305] Example 8. Synthesis of peptide (LCT-12) with BdpFL at the N-terminus for use as a standard for LC / MS [ka]

[0306] Peptide elongation was carried out using a peptide synthesizer with 2-chlorotriethyl resin (100 mg) loaded with Fmoc-Ala-OH and the Fmoc amino acids Fmoc-Gly-OH, Fmoc-Thr(THP)-OH, Fmoc-Ile-OH, Fmoc-Phe-OH, and Fmoc-Pro-OH (amino acid abbreviations are described elsewhere in this specification). Peptide elongation was carried out according to the Fmoc peptide synthesis method ( WO2013100132B2 ). After peptide elongation, the N-terminal Fmoc group was removed on the peptide synthesizer, and the resin was washed with DCM. The resin was added with TFE / DCM (1:1, v / v, 2 mL) and shaken for 1 hour to cleave the peptide from the resin. After the reaction was complete, the solution in the tube was filtered through a synthesis column to remove the resin, which was then washed twice with TFE / DCM (1:1, v / v, 1 mL). All extracts were combined, DMF (2 mL) was added, and the mixture was concentrated under reduced pressure. The resulting residue was dissolved in NMP (0.5 mL), and one-quarter of the solution (125 μL) was used in the next reaction. BdpFL succinimide ester (140 μL), prepared at 76.5 mM, was added to the NMP solution of the peptide at room temperature, stirred overnight at 40°C, and then concentrated under reduced pressure. The resulting residue was dissolved in 0.05 M tetramethylammonium hydrogen sulfate in HFIP (1.2 mL, 0.060 mmol) and stirred at room temperature for 2 hours. The reaction mixture was purified by reverse-phase silica gel column chromatography (0.1% FA MeCN / HO) to obtain the title compound (LCT-12) (0.3 mg). The amino acid sequence of LCT-12 is shown in SEQ ID NO: 53. LCMS(ESI) m / z=1972.9(MH)- Retention time: 0.74 minutes (Analysis conditions SQDFA05_01)

[0307] Example 9 Preparation of tRNA-CA by ligation reaction Various tRNA-CAs were prepared by ligating a tRNA5' fragment, pNp (pUp, pLp, or p(Agm)p), and a tRNA3' fragment using the procedure described below. The tRNA5' fragment and tRNA3' fragment were chemically synthesized (Gene Design Inc.). The sequences of each tRNA fragment and full-length tRNA, along with the sample combinations used in the ligation, are shown below (Table 4). SEQ ID NO: 54 (FR-1) tRNA(Glu)5' RNA sequence GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU SEQ ID NO: 55 (FR-2) tRNA(Glu)3'ga RNA sequence GA ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 56 (UR-1) lig-tRNA(Glu)uga-CA RNA sequence GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU UGA ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 57 (LR-1) tRNA(Glu)Lga-CA RNA sequence GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU LGA ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 58 (FR-3) tRNA(Glu)3'ag RNA sequence AG ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 59 (LR-2) tRNA(Glu)Lag-CA RNA sequence GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU LAGACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 60 (FR-4) tRNA(Glu)3'ac RNA sequence AC ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 61 (LR-3) tRNA(Glu)Lac-CA RNA sequence GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU LAC ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 62 (FR-5) tRNA(Glu)3'cc RNA sequence CC ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 63 (LR-4) tRNA(Glu)Lcc-CA RNA sequence GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU LCC ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 132 (FR-6) tRNA(Asp)5' RNA sequence GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUU SEQ ID NO: 133 (FR-7) tRNA(Asp)3'ag RNA sequence AG GUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC SEQ ID NO: 134 (LR-5) tRNA(Asp)Lag-CA RNA sequence GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUU LAG GUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC SEQ ID NO: 135 (FR-8) tRNA(AsnE2) 5' RNA sequence GGCUCUGUAGUUCAGUCGGUAGAACGGCGGAUU SEQ ID NO: 136 (FR-9) tRNA(AsnE2)3'ag RNA sequence AG GUUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGC SEQ ID NO: 137 (LR-6) tRNA(AsnE2)Lag-CA RNA sequence GGCUCUGUAGUUCAGUCGGUAGAACGGCGGAUU LAG GUUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGC SEQ ID NO: 139 (FR-10) tRNA(Glu)3'cg RNA sequence CG ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 140 (LR-7) tRNA(Glu)Lcg-CA RNA sequence GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU LCG ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 141 (FR-11) tRNA(Glu)3'au RNA sequence AU ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 142 (LR-8) tRNA(Glu)Lau-CA RNA sequence GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU LAU ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC SEQ ID NO: 138 (AR-1) tRNA(Glu)(Agm)ag-CA RNA sequence GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU (Agm)AG ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC

[0308] [Table 4]

[0309] Ligation of the tRNA fragment 5' to pNp (pUp, pLp, or p(Agm)p) was carried out by incubating the reaction solution containing 50 mM HEPES-KOH (pH 7.5), 20 mM MgCl2, 1 mM ATP, 0.125–0.25 mM pNp (pUp, pLp, or p(Agm)p), 25 μM tRNA 5' fragment, 0.6 U / μL T4 RNA ligase (New England Biolabs), and 10% DMSO overnight at 15°C. The ligation product was extracted with phenol and chloroform and recovered by ethanol precipitation.

[0310] To prevent unreacted tRNA5' fragments from being carried over to the next ligation reaction, the ribose at the 3' end of the tRNA5' fragment was cleaved with sodium periodate (NaIO4). Specifically, the cleavage reaction was carried out by incubating the mixture on ice in the dark for 30 minutes in the presence of 10 μM ligation product and 10 mM sodium periodate. After the reaction, 1 / 10 the volume of 100 mM glucose was added and the mixture was incubated on ice in the dark for 30 minutes to decompose the excess sodium periodate. The reaction product was recovered by ethanol precipitation.

[0311] The ligation product after periodate treatment was treated with T4 PNK (T4 polynucleotide kinase) to phosphorylate the 5' end and dephosphorylate the 3' end. The reaction solution, consisting of 10 μM periodate-treated ligation product, 50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 5 mM DTT, 300 μM ATP, and 0.5 U / μL T4 PNK (TaKaRa), was left at 37°C for 30 to 60 minutes. The reaction product was extracted with phenol and chloroform and recovered by ethanol precipitation.

[0312] The PNK-treated reaction product was ligated with the tRNA 3' fragment. First, a solution containing 10 μM PNK-treated reaction product, 10 μM tRNA 3' fragment, 50 mM HEPES-KOH (pH 7.5), and 15 mM MgCl2 was heated at 65°C for 7 minutes and then allowed to stand at room temperature for 30 minutes to 1 hour to allow annealing between the PNK-treated reaction product and the tRNA 3' fragment. Next, T4 PNK treatment was performed to phosphorylate the 5' end of the tRNA 3' fragment. T4 PNK treatment was performed by adding DTT (final concentration 3.5 mM), ATP (final concentration 300 μM), and T4 PNK (final concentration 0.5 U / μL) to the annealed solution and allowing it to stand at 37°C for 30 minutes. Next, T4 RNA ligase (New England Biolabs) was added to this solution to a final concentration of 0.9 U / μL, and the mixture was left to stand at 37°C for 30 to 40 minutes to carry out the ligation reaction. The ligation product was extracted with phenol and chloroform and recovered by ethanol precipitation.

[0313] The tRNA-CA prepared by the ligation method was purified by high-performance reverse-phase chromatography (HPLC) (15 mM TEA and 400 mM HFIP in water / 15 mM TEA and 400 mM HFIP in methanol), and then confirmed to have the desired length by denaturing urea 10% polyacrylamide gel electrophoresis.

[0314] Example 10 RNase T 1 Analysis of tRNA fragments cleaved by Various tRNA-CAs prepared using the ligation reaction were fragmented with RNase and analyzed, confirming that U, L, or (Agm) introduced by pUp, pLp, or p(Agm)p was introduced at the intended site. The sequence number of each tRNA-CA and the combination of the sequence of the RNA fragment containing U, L, or (Agm) introduced in pUp, pLp, or p(Agm)p are shown in Table 5 below.

[0315] [Table 5]

[0316] A reaction solution containing 10 μM tRNA-CA, 5 U / μL RNase T1 (Epicentre or ThermoFisher Scientific), and 10 mM ammonium acetate (pH 5.3) was incubated at 37°C for 1 hour to specifically cleave the RNA at the 3' end of the G base, and RNA fragments containing U, L, or (Agm) introduced by pUp, pLp, or p(Agm)p were analyzed.

[0317] CCCU U Gp LCMS(ESI) m / z=944((M-2H) / 2)- Retention time: 4.22 minutes (Analysis conditions LTQTEA / HFIP05_03) By comparing the mass chromatogram with that of the fragment (CCCUGp) expected when pUp is not ligated, it was confirmed that ligation of pUp had progressed to a large extent (Figure 1).

[0318] CCCU L Gp LCMS(ESI) m / z=1008((M-2H) / 2)- Retention time: 2.34 minutes (Analysis conditions LTQTEA / HFIP05_03) The fragment expected when pLp is not ligated (CCCUGp) and the fragment expected when uridine is substituted for lysidine (CCCU U By comparing the mass chromatogram with that of Gp, it was confirmed that the ligation of pLp had progressed to a large extent (Figure 2).

[0319] CCCU L AGp LCMS(ESI) m / z=1172((M-2H) / 2)- Retention time: 3.81 minutes (Analysis conditions LTQTEA / HFIP05_03) The expected fragment when pLp is not ligated (CCCUAGp) and the expected fragment when uridine is substituted for lysidine (CCCU U By comparing the mass chromatogram with that of AGp, it was confirmed that the ligation of pLp had progressed to a large extent (Figure 3).

[0320] CCCU L ACACGp (SEQ ID NO: 197) LCMS(ESI) m / z=1642((M-2H) / 2)- Retention time: 5.78 minutes (Analysis conditions LTQTEA / HFIP05_03) The expected fragment when pLp is not ligated (CCCUACACGp) and the expected fragment when uridine is substituted for lysidine (CCCU U A comparison with the mass chromatogram of ACACGp (SEQ ID NO: 198) confirmed that ligation of most of the pLp had progressed (FIG. 4).

[0321] CCCU L CCACGp (SEQ ID NO: 199) LCMS(ESI) m / z=1630((M-2H) / 2)- Retention time: 5.64 minutes (Analysis conditions LTQTEA / HFIP05_03) The expected fragment when pLp is not ligated (CCCUCCACGp) and the expected fragment when uridine is substituted for lysidine (CCCU U By comparing this with the mass chromatogram of CCACGp (SEQ ID NO: 200), it was confirmed that ligation of most of the pLp had progressed (FIG. 5).

[0322] CUU L AGp LCMS(ESI) m / z=1020((M-2H) / 2)- Retention time: 3.84 minutes (Analysis conditions LTQTEA / HFIP05_03) Since the molecular weight of the fragment (CUUAGp) expected when pLp is not ligated and the fragment (UUCAGp) derived from another part of the RNA are the same, analysis of unfragmented RNA was also performed. pGGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUU L AGGUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC (SEQ ID NO: 134) LCMS(ESI) m / z=1109((M-22H) / 22)- Retention time: 3.92 minutes (Analysis conditions LTQTEA / HFIP05_01) By comparing the mass chromatograms of the RNA expected when pLp was not ligated with those of the RNA expected when uridine was used instead of lysidine, it was confirmed that the majority of pLp had been ligated (Figure 6).

[0323] AUU L AGp LCMS(ESI) m / z=1032((M-2H) / 2)- Retention time: 4.16 minutes (Analysis conditions LTQTEA / HFIP05_03) By comparing the mass chromatograms of the fragment (AUUAGp) expected when pLp is not ligated with the fragment (AUUUAGp) expected when uridine is used instead of lysidine, it was confirmed that ligation of most of the pLp had progressed (Figure 7).

[0324] CCCU L CGp LCMS(ESI) m / z=1160((M-2H) / 2)- Retention time: 4.21 minutes (Analysis conditions LTQTEA / HFIP05_03) By comparing the mass chromatograms of the fragment (CCCUCGp) expected when pLp is not ligated with those of the fragment (CCCUUCGp) expected when uridine is used instead of lysidine, it was confirmed that ligation of most of the pLp had progressed (Figure 8).

[0325] CCCU L AUACGp (SEQ ID NO: 202) LCMS(ESI) m / z=1642((M-2H) / 2)- Retention time: 5.95 minutes (Analysis conditions LTQTEA / HFIP05_03) By comparing the mass chromatograms of the fragment (CCCUAUACGp) expected when pLp is not ligated with the fragment (CCCUAUACGp / SEQ ID NO: 203) expected when uridine is substituted for lysidine, it was confirmed that ligation of most of the pLp had progressed (Figure 9).

[0326] CCCU (Agm) AGp LCMS(ESI) m / z=1164((M-2H) / 2)- Retention time: 4.02 minutes (Analysis conditions LTQTEA / HFIP05_03) By comparing the mass chromatograms of the fragment (CCCUAGp) expected when p(Agm)p is not ligated with the fragment (CCCUUAGp) expected when uridine is used instead of agmatidine, it was confirmed that ligation of most of p(Agm)p had progressed (Figure 10).

[0327] Example 11 Synthesis of aminoacyl-tRNA tRNAs (SEQ ID NO: 77 (TR-1) to SEQ ID NO: 89 (TR-13), SEQ ID NO: 153 (TR-14) to SEQ ID NO: 162 (TR-23)) were synthesized from template DNAs (SEQ ID NO: 64 (D-1) to SEQ ID NO: 76 (D-13), SEQ ID NO: 143 (D-26) to SEQ ID NO: 152 (D-35)) by in vitro transcription using T7 RNA polymerase, and purified using an RNeasy kit (Qiagen).

[0328] Template DNA SEQ ID NO: 64 (D-1) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT AGA ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 65 (D-2) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT TGA ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 66 (D-3) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT CGA ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 67 (D-4) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT AAG ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 68 (D-5) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT TAG ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 69 (D-6) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT CAG ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 70 (D-7) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT AAC ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 71 (D-8) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT TAC ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 72 (D-9) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT CAC ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 73 (D-10) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT GCC ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 74 (D-11) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT TCC ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 75 (D-12) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT CCC ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 76 (D-13) DNA sequence: GGCGTAATACGACTCACTATAGGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCT CAT AACCCGAAGATCGTCGGTTCAAATCCGGCCCCGCAAC Template DNA SEQ ID NO: 143 (D-26) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCTT aag GTGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA SEQ ID NO: 144 (D-27) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCTT Tag GTGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA SEQ ID NO: 145 (D-28) DNA sequence: GGCGTAATACGACTCACTATAGGAGCGGTAGTTCAGTCGGTTAGAATACCTGCTT cag GTGCAGGGGGTCGCGGGTTCGAGTCCCGTCCGTTCCGC Template DNA SEQ ID NO: 146 (D-29) DNA sequence: GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGATT aag GTTCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGC Template DNA SEQ ID NO: 147 (D-30) DNA sequence: GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGATT tag GTTCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGC Template DNA SEQ ID NO: 148 (D-31) DNA sequence: GGCGTAATACGACTCACTATAGGCTCTGTAGTTCAGTCGGTAGAACGGCGGATT cag GTTCCGTATGTCACTGGTTCGAGTCCAGTCAGAGCCGC Template DNA SEQ ID NO: 149 (D-32) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT gcg ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 150 (D-33) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT ccg ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 151 (D-34) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT aau ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC Template DNA SEQ ID NO: 152 (D-35) DNA sequence: GGCGTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCT cau ACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGC

[0329] tRNA SEQ ID NO: 77 (TR-1) tRNA(Glu)aga-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU AGA ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO: 78 (TR-2) tRNA(Glu)uga-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU UGA ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO: 79 (TR-3) tRNA(Glu)cga-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU CGA ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO: 80 (TR-4) tRNA(Glu)aag-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU AAGACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:81(TR-5) tRNA(Glu)uag-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU UAG ACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:82(TR-6) tRNA(Glu)cag-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU CAG ACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:83(TR-7) tRNA(Glu)aac-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU AAC ACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:84(TR-8) tRNA(Glu)uac-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU UAC ACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:85(TR-9) tRNA(Glu)cac-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU CAC ACGGCGGUAAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO:86(TR-10) tRNA(Glu)gcc-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU GCCACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO: 87 (TR-11) tRNA(Glu)ucc-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU UCC ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO: 88 (TR-12) tRNA(Glu)ccc-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU CCC ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO: 89 (TR-13) tRNA(fMet)cau-CA RNA sequence: GGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCU CAU AACCCGAAGAUCGUCGGUUCAAAUCCGGCCCCGCAA tRNA SEQ ID NO: 153 (TR-14) tRNA(Asp)aag-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUU aag GUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA SEQ ID NO: 154 (TR-15) tRNA(Asp)uag-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUU uag GUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA SEQ ID NO: 155 (TR-16) tRNA(Asp)cag-CA RNA sequence: GGAGCGGUAGUUCAGUCGGUUAGAAUACCUGCUU cagGUGCAGGGGGUCGCGGGUUCGAGUCCCGUCCGUUCCGC tRNA SEQ ID NO: 156 (TR-17) tRNA(AsnE2)aag-CA RNA sequence: GGCUCUGUAGUUCAGUCGGUAGAACGGCGGAUU aag GUUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGC tRNA SEQ ID NO: 157 (TR-18) tRNA(AsnE2)uag-CA RNA sequence: GGCUCUGUAGUUCAGUCGGUAGAACGGCGGAUU uag GUUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGC tRNA SEQ ID NO: 158 (TR-19) tRNA(AsnE2)cag-CA RNA sequence: GGCUCUGUAGUUCAGUCGGUAGAACGGCGGAUU cag GUUCCGUAUGUCACUGGUUCGAGUCCAGUCAGAGCCGC tRNA SEQ ID NO: 159 (TR-20) tRNA(Glu)gcg-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU gcg ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO: 160 (TR-21) tRNA(Glu)ccg-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU ccg ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO: 161 (TR-22) tRNA(Glu)aau-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU aauACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC tRNA SEQ ID NO: 162 (TR-23) tRNA(Glu)cau-CA RNA sequence: GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCU cau ACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGC

[0330] Preparation of aminoacyl-tRNA mixture using aminoacyl-pCpA A reaction mixture containing 25 μM transcribed tRNA(Glu)aga-CA (SEQ ID NO: 77 (TR-1)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl, 1 mM ATP, 0.6 unit / μl T4 RNA ligase (New England Bio Labs), and 0.25 mM aminoacylated pCpA (a DMSO solution of compound TS24 synthesized by the method described in patent document (WO2018143145A1)) was diluted with nuclease-free water and subjected to a ligation reaction at 15°C for 45 minutes. However, before adding T4 RNA ligase and aminoacylated pCpA, the reaction mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to allow the tRNA to refold. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol / chloroform to prepare compound AAtR-1. Similarly, aminoacylated pCpA (SS15) was ligated to transcribed tRNA(Glu)uga-CA (SEQ ID NO: 78 (TR-2)) using the same method described above. Sodium acetate was added to the ligation reaction mixture to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-2. Similarly, ligation of lig-tRNA(Glu)uga-CA (SEQ ID NO: 56 (UR-1)) with aminoacylated pCpA (SS15) was performed as described above. Sodium acetate was added to the ligation reaction mixture to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-3. Similarly, tRNA(Glu)Lga-CA (SEQ ID NO: 57(LR-1)) was ligated with aminoacylated pCpA(SS15) as described above. Sodium acetate was added to the ligation reaction mixture to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-4. Similarly, transcribed tRNA(Glu)cga-CA (SEQ ID NO: 79 (TR-3)) was ligated with aminoacylated pCpA (ts14; synthesized by the method described in patent document (WO2018143145A1)) as described above. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-5.

[0331] Equal amounts of the phenol-chloroform extracts of the three compounds AAtR-1, AAtR-2, and AAtR-5 were mixed, and the aminoacylated tRNA mixture (a mixture of compounds AAtR-1, AAtR-2, and AAtR-5) was recovered by ethanol precipitation.

[0332] Equal amounts of the phenol-chloroform extracts of the three compounds AAtR-1, AAtR-3, and AAtR-5 were mixed, and the aminoacylated tRNA mixture (a mixture of compounds AAtR-1, AAtR-3, and AAtR-5) was recovered by ethanol precipitation.

[0333] Equal amounts of the phenol-chloroform extracts of the three compounds AAtR-1, AAtR-4, and AAtR-5 were mixed, and the aminoacylated tRNA mixture (a mixture of compounds AAtR-1, AAtR-4, and AAtR-5) was recovered by ethanol precipitation.

[0334] A reaction mixture containing 25 μM transcribed tRNA(Glu)aag-CA (SEQ ID NO: 80(TR-4)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl, 1 mM ATP, 0.6 unit / μL T4 RNA ligase (New England BioLab), and 0.25 mM aminoacylated pCpA (ts14 in DMSO) was diluted with nuclease-free water and subjected to ligation for 45 minutes at 15°C. However, prior to the addition of T4 RNA ligase and aminoacylated pCpA, the reaction mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to allow for tRNA refolding. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol / chloroform to prepare compound AAtR-6. Similarly, transcribed tRNA(Glu)uag-CA (SEQ ID NO: 81(TR-5)) was ligated with aminoacylated pCpA(SS14) as described above. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-7. Similarly, tRNA(Glu)Lag-CA (SEQ ID NO: 59(LR-2)) was ligated with aminoacylated pCpA(SS14) as described above. Sodium acetate was added to the ligation reaction mixture to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-8. Similarly, aminoacylated pCpA (TS24) was ligated to transcribed tRNA(Glu)cag-CA (SEQ ID NO: 82 (TR-6)) using the same method described above. Sodium acetate was added to the ligation reaction mixture to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-9.

[0335] Equal amounts of the phenol-chloroform extracts of the three compounds AAtR-6, AAtR-7, and AAtR-9 were mixed, and the aminoacylated tRNA mixture (a mixture of compounds AAtR-6, AAtR-7, and AAtR-9) was recovered by ethanol precipitation.

[0336] Equal volumes of the phenol-chloroform extracts of the three compounds AAtR-6, AAtR-8, and AAtR-9 were mixed, and the aminoacylated tRNA mixture (a mixture of compounds AAtR-6, AAtR-8, and AAtR-9) was recovered by ethanol precipitation.

[0337] A reaction mixture containing 25 μM transcribed tRNA(Glu)aac-CA (SEQ ID NO: 83(TR-7)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl, 1 mM ATP, 0.6 unit / μL T4 RNA ligase (New England BioLab), and 0.25 mM aminoacylated pCpA (ts14 in DMSO) was diluted with nuclease-free water and subjected to ligation for 45 minutes at 15°C. However, prior to the addition of T4 RNA ligase and aminoacylated pCpA, the reaction mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to allow for tRNA refolding. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol / chloroform to prepare compound AAtR-10. Similarly, transcribed tRNA(Glu)uac-CA (SEQ ID NO: 84 (TR-8)) was ligated with aminoacylated pCpA (SS14) as described above. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-11. Similarly, tRNA(Glu)Lac-CA (SEQ ID NO: 61(LR-3)) was ligated with aminoacylated pCpA(SS14) as described above. Sodium acetate was added to the ligation reaction mixture to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-12. Similarly, transcribed tRNA(Glu)cac-CA (SEQ ID NO: 85 (TR-9)) was ligated with aminoacylated pCpA (TS24) as described above. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-13.

[0338] Equal amounts of the phenol-chloroform extracts of the three compounds AAtR-10, AAtR-11, and AAtR-13 were mixed, and the aminoacylated tRNA mixture (a mixture of compounds AAtR-10, AAtR-11, and AAtR-13) was recovered by ethanol precipitation.

[0339] Equal amounts of the phenol-chloroform extracts of the three compounds AAtR-10, AAtR-12, and AAtR-13 were mixed, and the aminoacylated tRNA mixture (a mixture of compounds AAtR-10, AAtR-12, and AAtR-13) was recovered by ethanol precipitation.

[0340] A reaction mixture containing 25 μM transcribed tRNA(Glu)gcc-CA (SEQ ID NO: 86 (TR-10)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl, 1 mM ATP, 0.6 unit / μL T4 RNA ligase (New England BioLab), and 0.25 mM aminoacylated pCpA (TS24 in DMSO) was diluted with nuclease-free water and subjected to ligation at 15°C for 45 minutes. However, prior to the addition of T4 RNA ligase and aminoacylated pCpA, the reaction mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to allow for tRNA refolding. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol / chloroform to prepare compound AAtR-14. Similarly, aminoacylated pCpA (SS14) was ligated to transcribed tRNA(Glu)ucc-CA (SEQ ID NO: 87 (TR-11)) using the same method described above. Sodium acetate was added to the ligation reaction mixture to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-15. Similarly, tRNA(Glu)Lcc-CA (SEQ ID NO: 63(LR-4)) was ligated with aminoacylated pCpA(SS14) as described above. Sodium acetate was added to the ligation reaction mixture to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-16. Similarly, transcribed tRNA(Glu)ccc-CA (SEQ ID NO: 88 (TR-12)) was ligated with aminoacylated pCpA (SS16) as described above. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol and chloroform to prepare compound AAtR-17.

[0341] The three phenol-chloroform extracts of compounds AAtR-14, AAtR-15, and AAtR-17 were mixed in a ratio of 1:2:1, and the aminoacylated tRNA mixture (a mixture of compounds AAtR-14, AAtR-15, and AAtR-17) was recovered by ethanol precipitation.

[0342] The phenol-chloroform extracts of three compounds, AAtR-14, AAtR-16, and AAtR-17, were mixed in a 1:2:1 ratio, and the aminoacylated tRNA mixture (a mixture of compounds AAtR-14, AAtR-16, and AAtR-17) was recovered by ethanol precipitation.

[0343] The aminoacylated tRNA mixture was dissolved in 1 mM sodium acetate immediately before addition to the translation mixture.

[0344] To prepare compound AAtR-19, a reaction mixture containing 25 μM transcribed tRNA(Asp)aag-CA (SEQ ID NO: 153 (TR-14)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl , 1 mM ATP, 0.6 unit / μl T4 RNA ligase (New England Bio Labs), and 0.25 mM aminoacylated pCpA (a DMSO solution of compound ts14 synthesized according to the method described in patent document WO2018143145A1) was diluted with nuclease-free water and subjected to a ligation reaction at 15°C for 45 minutes. However, before adding T4 RNA ligase and aminoacylated pCpA, the reaction mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to allow the tRNA to refold. Similarly, to prepare compound AAtR-20, aminoacylated pCpA(SS15) was ligated to transcribed tRNA(Asp)uag-CA (SEQ ID NO: 154 (TR-15)) by the above-mentioned method. Similarly, to prepare compound AAtR-21, tRNA(Asp)Lag-CA (SEQ ID NO: 134 (LR-5)) was ligated with aminoacylated pCpA (SS15) by the method described above. Similarly, to prepare compound AAtR-22, aminoacylated pCpA (TS24) was ligated to transcribed tRNA(Asp)cag-CA (SEQ ID NO: 155 (TR-16)) by the above-mentioned method. After each ligation reaction, 0.3 M sodium acetate was added, followed by the addition of phenol-chloroform solution. The ligation products were then mixed, and the mixture was subjected to phenol-chloroform extraction and ethanol precipitation for recovery. Specifically, three types of ligation products, AAtR-19, AAtR-20, and AAtR-22, were mixed in equal amounts with 0.3 M sodium acetate and phenol-chloroform solution, and then extracted with phenol-chloroform and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of AAtR-19, AAtR-20, and AAtR-22). Similarly, three types of ligation products, AAtR-19, AAtR-21, and AAtR-22, were mixed in equal amounts with 0.3 M sodium acetate and phenol-chloroform solution, and then extracted with phenol-chloroform and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of AAtR-19, AAtR-21, and AAtR-22).

[0345] To prepare compound AAtR-23, a reaction solution containing 25 μM transcribed tRNA(AsnE2)aag-CA (SEQ ID NO: 156 (TR-17)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl2, 1 mM ATP, 0.6 unit / μL T4 RNA ligase (New England Bio Labs), and 0.25 mM aminoacylated pCpA (a DMSO solution of compound ts14 synthesized according to the method described in patent document WO2018143145A1) was prepared by diluting the solution with nuclease-free water, and the ligation reaction was carried out at 15 °C for 45 minutes. However, before adding T4 RNA ligase and aminoacylated pCpA, the reaction solution was heated at 95 °C for 2 minutes and then left at room temperature for 5 minutes to allow the tRNA to refold. Similarly, to prepare compound AAtR-24, transcribed tRNA(AsnE2)uag-CA (SEQ ID NO: 157 (TR-18)) was ligated with aminoacylated pCpA (SS15) by the method described above. Similarly, to prepare compound AAtR-25, tRNA(AsnE2)Lag-CA (SEQ ID NO: 137(LR-6)) was ligated with aminoacylated pCpA(SS15) by the above-mentioned method. Similarly, to prepare compound AAtR-26, aminoacylated pCpA (TS24) was ligated to transcribed tRNA(AsnE2)cag-CA (SEQ ID NO: 158 (TR-19)) by the above-mentioned method. After each ligation reaction, 0.3 M sodium acetate was added, followed by the addition of phenol-chloroform solution. The ligation products were then mixed, and the mixture was subjected to phenol-chloroform extraction and ethanol precipitation for recovery. Specifically, three types of ligation products, compound AAtR-23, compound AAtR-24, and compound AAtR-26, were mixed in equal amounts with 0.3 M sodium acetate and phenol-chloroform solution, and then extracted with phenol-chloroform and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-23, compound AAtR-24, and compound AAtR-26). Similarly, three types of ligation products, AAtR-23, AAtR-25, and AAtR-26, were mixed in equal amounts with 0.3 M sodium acetate and phenol-chloroform solution, extracted with phenol-chloroform, and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of AAtR-23, AAtR-25, and AAtR-26).

[0346] To prepare compound AAtR-6, a reaction mixture containing 25 μM transcribed tRNA(Glu)aag-CA (SEQ ID NO: 80(TR-4)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl, 1 mM ATP, 0.6 unit / μL T4 RNA ligase (New England BioLab), and 0.25 mM aminoacylated pCpA (ts14 in DMSO) was diluted with nuclease-free water and allowed to ligate for 45 minutes at 15°C. However, prior to the addition of T4 RNA ligase and aminoacylated pCpA, the reaction mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to allow for tRNA refolding. Similarly, to prepare compound AAtR-9, aminoacylated pCpA (TS24) was ligated to transcribed tRNA(Glu)cag-CA (SEQ ID NO: 82 (TR-6)) by the above-mentioned method. Similarly, to prepare compound AAtR-27, aminoacylated pCpA(SS16) was ligated to transcribed tRNA(Glu)uag-CA (SEQ ID NO: 81(TR-5)) by the above-mentioned method. Similarly, to prepare compound AAtR-28, tRNA(Glu)Lag-CA (SEQ ID NO: 59 (LR-2)) was ligated with aminoacylated pCpA (SS16) by the above-mentioned method. Similarly, to prepare compound AAtR-29, aminoacylated pCpA(SS39) was ligated to transcribed tRNA(Glu)uag-CA (SEQ ID NO: 81(TR-5)) by the above-mentioned method. Similarly, to prepare compound AAtR-30, tRNA(Glu)Lag-CA (SEQ ID NO: 59 (LR-2)) was ligated with aminoacylated pCpA (SS39) by the method described above. Similarly, to prepare compound AAtR-31, aminoacylated pCpA(SS40) was ligated to transcribed tRNA(Glu)uag-CA (SEQ ID NO: 81(TR-5)) by the above-mentioned method. Similarly, to prepare compound AAtR-32, tRNA(Glu)Lag-CA (SEQ ID NO: 59 (LR-2)) was ligated with aminoacylated pCpA (SS40) by the method described above. After each ligation reaction, 0.3 M sodium acetate was added, followed by the addition of phenol-chloroform solution. The ligation products were then mixed, and either as a mixture or individually, they were subjected to phenol-chloroform extraction and ethanol precipitation, and then recovered. Specifically, three types of ligation products, compound AAtR-6, compound AAtR-27, and compound AAtR-9, were mixed in equal amounts with 0.3 M sodium acetate and phenol-chloroform solution, and then extracted with phenol-chloroform and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-6, compound AAtR-27, and compound AAtR-9). Similarly, three types of ligation products, compound AAtR-6, compound AAtR-28, and compound AAtR-9, were mixed in equal amounts with 0.3 M sodium acetate and phenol-chloroform solution, extracted with phenol-chloroform, and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-6, compound AAtR-28, and compound AAtR-9). Similarly, three types of ligation products (compounds AAtR-6, AAtR-29, and AAtR-9) were mixed in equal volumes with 0.3 M sodium acetate and phenol-chloroform solution, extracted with phenol-chloroform, and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of compounds AAtR-6, AAtR-29, and AAtR-9). Similarly, three types of ligation products, AAtR-6, AAtR-30, and AAtR-9, were mixed in equal amounts with 0.3 M sodium acetate and phenol-chloroform solution, extracted with phenol-chloroform, and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of AAtR-6, AAtR-30, and AAtR-9). Similarly, three types of ligation products, compound AAtR-6, compound AAtR-31, and compound AAtR-9, were mixed in equal amounts with 0.3 M sodium acetate and phenol-chloroform solution, and then extracted with phenol-chloroform and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-6, compound AAtR-31, and compound AAtR-9). Similarly, three types of ligation products, compound AAtR-6, compound AAtR-32, and compound AAtR-9, were mixed in equal volumes with 0.3 M sodium acetate and phenol-chloroform solution, and then extracted with phenol-chloroform and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-6, compound AAtR-32, and compound AAtR-9). The ligation product of compound AAtR-9 was added with 0.3 M sodium acetate, and then phenol-chloroform solution was added. The solution was subjected to phenol-chloroform extraction and ethanol precipitation to prepare aminoacylated tRNA.

[0347] To prepare compound AAtR-33, a reaction mixture containing 25 μM transcribed tRNA(Glu)gcg-CA (SEQ ID NO: 159 (TR-20)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl, 1 mM ATP, 0.6 unit / μl T4 RNA ligase (New England Bio Labs), and 0.25 mM aminoacylated pCpA (a DMSO solution of compound TS24 synthesized according to the method described in patent document WO2018143145A1) was diluted with nuclease-free water and subjected to ligation at 15°C for 45 minutes. However, before adding T4 RNA ligase and aminoacylated pCpA, the reaction mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to allow the tRNA to refold. Similarly, to prepare compound AAtR-34, tRNA(Glu)Lcg-CA (SEQ ID NO: 140(LR-7)) was ligated with aminoacylated pCpA(SS14) by the method described above. Similarly, to prepare compound AAtR-35, aminoacylated pCpA(ts14) was ligated to transcribed tRNA(Glu)ccg-CA (SEQ ID NO: 160 (TR-21)) by the above-mentioned method. Similarly, to prepare compound AAtR-36, aminoacylated pCpA(ts14) was ligated to transcribed tRNA(Glu)aau-CA (SEQ ID NO: 161 (TR-22)) by the above-mentioned method. Similarly, to prepare compound AAtR-37, tRNA(Glu)Lau-CA (SEQ ID NO: 142 (LR-8)) was ligated with aminoacylated pCpA (SS14) by the method described above. Similarly, to prepare compound AAtR-38, aminoacylated pCpA (TS24) was ligated to transcribed tRNA(Glu)cau-CA (SEQ ID NO: 162 (TR-23)) by the above-mentioned method. After each ligation reaction, 0.3 M sodium acetate was added, followed by the addition of phenol-chloroform solution. The ligation products were then mixed, and either as a mixture or individually, they were subjected to phenol-chloroform extraction and ethanol precipitation, and then recovered. Specifically, two types of ligation products, compound AAtR-33 and compound AAtR-35, were mixed in equal amounts with 0.3 M sodium acetate and phenol-chloroform solution, and then extracted with phenol-chloroform and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-33 and compound AAtR-35). Similarly, two ligation products, compound AAtR-36 and compound AAtR-38, were mixed in equal volumes with 0.3 M sodium acetate and phenol-chloroform solution, extracted with phenol-chloroform, and precipitated with ethanol to prepare an aminoacylated tRNA mixture (a mixture of compound AAtR-36 and compound AAtR-38). 0.3 M sodium acetate was added to each ligation product of compound AAtR-34 and compound AAtR-37, and a phenol-chloroform solution was added to the solution, which was then subjected to phenol-chloroform extraction and ethanol precipitation to prepare aminoacylated tRNA.

[0348] To prepare compound AAtR-6, aminoacylated pCpA(ts14) was ligated to transcribed tRNA(Glu)aag-CA (SEQ ID NO: 80(TR-4)) by the method described above. Similarly, to prepare compound AAtR-9, tRNA(Glu)cag-CA (SEQ ID NO: 82 (TR-6)) was ligated with aminoacylated pCpA (TS24) by the method described above. After each ligation reaction, 0.3 M sodium acetate was added to the solution, and then phenol-chloroform solution was added. The ligation products were mixed at a ratio of 1:2, and the mixture was subjected to phenol-chloroform extraction and ethanol precipitation, and then recovered. Specifically, 0.3 M sodium acetate was added to the two ligation products of compounds AAtR-6 and AAtR-9, and a phenol-chloroform solution was added to the resulting solution, which was mixed in a 1:2 ratio. Phenol-chloroform extraction and ethanol precipitation were then performed to prepare an aminoacylated tRNA mixture (a mixture of compounds AAtR-6 and AAtR-9).

[0349] To prepare compound AAtR-39, aminoacylated pCpA (SS15) was ligated to transcribed tRNA(Glu)uag-CA (SEQ ID NO: 81 (TR-5)) by the method described above. Similarly, to prepare compound AAtR-40, tRNA(Glu)(Agm)ag-CA (SEQ ID NO: 138 (AR-1)) was ligated with aminoacylated pCpA (SS15) by the method described above. After each ligation reaction, 0.3 M sodium acetate was added to the solution, followed by the addition of a phenol-chloroform solution, followed by phenol-chloroform extraction and ethanol precipitation, and the product was recovered.

[0350] Preparation of initiator aminoacyl-tRNA using aminoacyl-pCpA A reaction mixture containing 25 μM transcribed tRNA(fMet)cau-CA (SEQ ID NO: 89 (TR-13)), 50 mM HEPES-KOH pH 7.5, 20 mM MgCl, 1 mM ATP, 0.6 unit / μl T4 RNA ligase (New England BioLab), and 0.25 mM aminoacylated pCpA (MT01 in DMSO) was diluted with nuclease-free water and allowed to ligate for 45 minutes at 15°C. However, prior to the addition of T4 RNA ligase and aminoacylated pCpA, the reaction mixture was heated at 95°C for 2 minutes and then left at room temperature for 5 minutes to allow for tRNA refolding. Sodium acetate was added to the ligation reaction solution to a concentration of 0.3 M, and the mixture was extracted with phenol / chloroform. The initiator aminoacyl-tRNA (compound AAtR-18) was rec...

Claims

[Claim 1] The invention described herein.

Images