Citrobacter portucalensis, hyaluronidase and preparation method and application of hyaluronidase

Abstract

To provide Citrobacter portucalensis, a hyaluronidase as well as preparation methods and applications of the hyaluronidase.SOLUTION: Disclosed herein is Citrobacter portucalensis strain HA2301, deposited in the China Center for Type Culture Collection on November 01, 2023 with the deposition number of CCTCC NO.M20232108. The invention further discloses a hyaluronidase and a preparation method and application thereof. According to the Citrobacter portucalensis, the hyaluronidase, preparation method and application thereof described in the invention, the Citrobacter portucalensis produces the hyaluronidase that enzymatically degrades high molecular weight sodium hyaluronate to prepare small molecular weight and oligomeric sodium hyaluronate.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention belongs to the technical field of biotransformation, and specifically relates to Citrobacter portucalensis, hyaluronidase, and a preparation method and use thereof.

Background Art

[0002] Hyaluronic acid (abbreviated as HA), also known as hyaluronate, is a chain polymer in which D-glucuronic acid and N-acetylglucosamine are alternately linked. It is a main component constituting the extracellular matrix and widely exists in living tissues such as skin, cartilage, joints, and vitreous body. It is a polymer having important physiological functions. It is divided into high molecular weight hyaluronic acid (HMWHA) and low molecular weight hyaluronic acid (LMWHA) according to its molecular weight. HMWHA inhibits the migration of endothelial cells, has anti-angiogenic activity, and promotes wound healing in the human body. LMWHA promotes the differentiation of endothelial cells, resists apoptosis, promotes the migration of cartilage, endothelial and other cells, and also plays an anti-inflammatory role. HA plays an important role in medical and pharmaceutical research due to its unique physicochemical properties.

[0003] Currently, low molecular weight HA is mainly prepared by decomposing high molecular weight hyaluronic acid into low molecular weight HA by physical, chemical, and enzymatic decomposition methods. In physical decomposition, usually, ultra-low molecular weight HA cannot be obtained. Chemical decomposition of HA: Chemical reagents may remain in the product, or the aldehyde groups and hydroxyl groups in the hyaluronic acid monomer may be modified. Therefore, in the chemical method, the structure of HA may be destroyed.

[0004] Due to its specificity, mild reaction conditions, and the invariant structure of polysaccharides, the enzymatic degradation method can obtain HA with different molecular weights by controlling different degradation times, making it ideal for the preparation of low-molecular-weight HA. Hyaluronidase (HAase) is a glycosidase that degrades high-molecular-weight hyaluronic acid into low-molecular-weight or oligomeric hyaluronic acid, and some HAases also have the ability to degrade chondroitin and heparin. In addition to being used for the preparation of low-molecular-weight or oligomeric HA, HAase can be used as a drug diffusing agent, which can degrade the HA in tissues, enhance tissue permeability, promote the diffusion of injections, and have less contamination. HAase can be divided into three categories: mammalian HAase, animal venom HAase, and microbial HAase according to the source.

[0005] Since the sources of HAase are very limited, existing technologies are mainly obtained by extraction from bovine testes, which is expensive and its application is quite limited. Enzyme sources derived from microorganisms are rich and diverse in enzymatic properties, easy for recombinant expression and with increased yields, so they will become the main source of enzyme preparations for future applications. Microbial enzyme production using microorganisms with fast growth and reproduction, short growth cycles, simple culture methods, abundant raw materials, low cost, and high economic benefits will undoubtedly replace extraction from animals in the future.

[0006] In view of the above events, the present invention proposes Citrobacter portucalensis, hyaluronidase, and its preparation method and uses. Citrobacter portucalensis can produce hyaluronidase, enzymatically degrade high-molecular-weight sodium hyaluronate, and prepare low-molecular-weight and oligomeric sodium hyaluronate.

Summary of the Invention

[0007] The first object of the present invention is to provide Citrobacter portucalensis that can produce hyaluronidase.

[0008] In order to achieve the above object, the adopted technical scheme is as follows.

[0009] Citrobacter portucalensis, the strain number of the Citrobacter portucalensis: HA2301, deposited with the China Center for Type Culture Collection on November 01, 2023, and the deposit number: CCTCC NO.M20232108.

[0010] Furthermore, the 16S rRNA nucleotide sequence of the Citrobacter portucalensis is SEQ ID NO.1.

[0011] The second object of the present invention is to provide a method for preparing hyaluronidase using the above Citrobacter portucalensis. The hyaluronidase prepared by this method has high enzyme activity, and the enzyme activity reaches a maximum of 6000 U / mL. The enzyme yield is high, which is suitable for large-scale industrial production of hyaluronidase and can replace the conventional hyaluronidase extracted from expensive animal tissues, and has broad application prospects in fields such as medicine and cosmetics.

[0012] In order to achieve the above object, the adopted technical scheme is as follows.

[0013] The method for preparing hyaluronidase is to prepare hyaluronidase using the above Citrobacter portucalensis.

[0014] Furthermore, in the preparation method, the bacterial liquid after culturing the Citrobacter portucalensis is centrifuged and then ground to obtain hyaluronidase.

[0015] Moreover, the rotation speed of the centrifugation treatment is 5000 - 12000 rpm, and the time is 5 - 10 min.

[0016] The third object of the present invention is to provide a hyaluronidase having high specificity for hyaluronic acid.

[0017] Hyaluronidase, whose amino acid sequence and nucleotide sequence are SEQ ID NO.2 and SEQ ID NO.3 respectively, is obtained by the above preparation method.

[0018] Furthermore, the upstream gene and downstream gene of the hyaluronidase gene are SEQ ID NO.4 and SEQ ID NO.5 respectively. The amino acid sequence of the conserved region of the hyaluronidase is SEQ ID NO.6. The nucleotide sequence of the ribosome binding site of the hyaluronidase is SEQ ID NO.7.

[0019] The fourth object of the present invention is to provide the use of the above hyaluronidase in the preparation of hyaluronic acid. The hyaluronidase can enzymatically decompose high molecular weight sodium hyaluronate to prepare low molecular weight and oligomeric sodium hyaluronate.

[0020] In order to achieve the above object, the technical scheme adopted is as follows.

[0021] It is the use of the above hyaluronidase in the preparation of hyaluronic acid.

[0022] Furthermore, the preparation method of the hyaluronic acid is to mix the above hyaluronidase with hyaluronic acid or sodium hyaluronate for enzymatic decomposition.

[0023] Moreover, the temperature of the enzymatic decomposition is 20 - 60°C, and the pH value is 3 - 10. The volume ratio of the hyaluronidase to hyaluronic acid or sodium hyaluronate is 1 - 5:5 - 15.

Advantages of the Invention

[0024] Compared with the prior art, the present invention has the following beneficial effects.

[0025] The present invention provides a wild-type Citrobacter portucalensis capable of producing hyaluronidase, which can produce hyaluronidase, and the hyaluronidase can enzymatically decompose high-molecular-weight hyaluronic acid or sodium hyaluronate to prepare low-molecular-weight and oligomeric sodium hyaluronate.

[0026] Moreover, in the technical scheme of the present invention, Citrobacter portucalensis has a high hyaluronidase-producing ability, can replace the conventional hyaluronidase extracted from expensive animal tissues, and has broad application prospects in fields such as medicine and cosmetics.

Brief Description of the Drawings

[0027]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Modes for Carrying Out the Invention

[0028] The Citrobacter portucalensis, hyaluronidase, preparation method and uses thereof of the present invention will be described in more detail. To achieve the intended invention objective, hereinafter, in connection with preferred embodiments, the Citrobacter portucalensis, hyaluronidase, preparation method and uses thereof according to the present invention, their specific embodiments, structures, features and their effects will be described in detail. In the following description, different "one embodiment" or "embodiment" does not necessarily mean the same embodiment. Furthermore, the specific features, structures or characteristics in one or more embodiments can be combined in any suitable form.

[0029] Before describing in detail the Citrobacter portucalensis, hyaluronidase, preparation method and uses thereof of the present invention, in order to obtain better effects, it is necessary to further explain the related background described in the present invention.

[0030] Currently, the preparation of low-molecular-weight HA mainly involves decomposing high-molecular-weight hyaluronic acid into low-molecular-weight HA by physical, chemical and enzymatic degradation methods. Physical degradation methods include heating, mechanical shearing, ultraviolet rays, ultrasonic waves, γ-ray irradiation and high-pressure homogenization, etc. Physical degradation methods have advantages such as clear principles, no need to add any reagents during the degradation process, simplified post-treatment processes, narrow Mr distribution range of the obtained low-molecular-weight HA, and good thermal stability. However, usually ultra-low-molecular-weight HA cannot be obtained.

[0031] The chemical decomposition methods of HA mainly include alkaline hydrolysis, acid hydrolysis, and oxidative decomposition. Chemical decomposition methods are low in cost and easy for large-scale production. However, chemical reagents may remain in the products. In addition, chemical decomposition, especially oxidative decomposition, may modify the aldehyde groups or hydroxyl groups in hyaluronic acid monomers, so the chemical method may destroy the HA structure.

[0032] Due to its specificity, mild reaction conditions, and the invariant structure of polysaccharides, the enzymatic decomposition method can obtain HA with different molecular weights by controlling different decomposition times, and is ideal for the preparation of low-molecular-weight HA. Hyaluronidase (HAase) is a glycosidase that decomposes high-molecular-weight hyaluronic acid into low-molecular-weight or oligomeric hyaluronic acid, and some HAases also have the ability to decompose chondroitin and heparin. In addition to being used for the preparation of low-molecular-weight or oligomeric HA, HAase can be used as a drug diffusing agent, decompose the HA in tissues, enhance the tissue permeability, promote the diffusion of injections, and have less contamination. HAase can be divided into three categories: mammalian HAase, animal venom HAase, and microbial HAase according to the source.

[0033] Enzyme sources derived from microorganisms are rich and diverse in enzymatic properties, easy for recombinant expression and with increased yields, so they will become the main source of enzyme preparations for future applications. Microbial enzyme production using microorganisms with fast growth and reproduction, short growth cycles, simple culture methods, abundant raw materials, low cost, and high economic merits will undoubtedly replace the extraction from animals in the future.

[0034] Currently, microbial-derived HAase is mainly produced by the expression of bacteria, such as Fusobacterium, Micrococcus, Streptococcus, and Streptomyces. It acts on β-1,4 glycosidic bonds and is decomposed by a β-elimination mechanism. The available substrates include hyaluronic acid, chondroitin, and chondroitin sulfate, and 2-(acetylamino)-2-deoxy-D-glucose is the main product. Gram-positive bacteria that produce HAase include Streptococcus pneumoniae, Streptococcus intermidius, Streptococcus constellatus, Clostridium, Clostridium perfringens, Clostridium septicum, Clostridium chauvoei, Mycoplasma, Propionibacterium acnes, Streptococcus cyanogenus, Peptostreptococcus, Propionibacterium granulosum, and Streptococcus zooepidemicus. Gram-negative bacteria that produce hyaluronidase include Aeromonas, Vibrio, Beneckea, Bacillus vulgaris, Bacteroides fragilis, Bacteroides ovatus, Streptobacillus, Bacteroides asaccharolyticus, dead bacteria Fusobacterium, Treponema, and Treponema pertenue. The HAase expressed by Gram-negative bacteria is not released extracellularly and is not involved in the pathogenic process. In contrast, the HAase expressed by Gram-positive bacteria exacerbates wound infections in humans and animals, but whether the role of this enzyme is to promote bacterial spread or bacterial invasion has not yet been investigated. Candida and Coccidioides paraensis are pathogenic fungi that are easily infective to humans. These fungi have the ability to secrete and produce various enzymes, including hyaluronidase, and cause secondary infections in the body's mucous membranes, skin, adrenal glands, and lymph node regions. Hyaluronidase and chondroitinase play important roles in the pathogenicity of Candida and Coccidioides paraensis. Fungi that have been identified so far to produce HAase include Candida albicans, Candida parapsilosis, Penicillium funiculosum, and Candida tropicalis.

[0035] Most of the HAase-producing bacteria reported in the literature are pathogenic. They use the produced HAase to degrade the host's HA, lower the viscosity, disrupt the defense system, and cause skin and mucosal infections in animals or humans. Most bacterial-derived HAases also act on chondroitin sulfate and chondroitin, thus further promoting the spread of toxins. Therefore, when they were discovered in 1928, they were called "spreading factors". Bacterial-derived HAases are easy to isolate and purify, have high application value, and a promising market outlook. Hyaluronidase was discovered in the 1970s, commercialized, and widely used, but it is too expensive for large-scale preparation.

[0036] The most common current HAase-producing strain is Streptococcus, and it has been reported in the literature that this strain has good genetic stability. By fermenting and culturing it, HAase with high degradation activity for hyaluronic acid is purified from the fermentation broth. Preliminary isolation and purification of HAase were carried out from the fermentation broth of Arthrobacter nicotinovorans, and its enzyme properties were investigated. The crude enzyme solution was desalted by ultrafiltration concentration using a hollow fiber membrane with a molecular weight of 6000, freeze-dried into a powder to obtain hyaluronidase, the crude enzyme solution was purified by column chromatography separation, and the activities of the crude enzyme and the purified enzyme were measured. As a result of studying the enzyme properties of this hyaluronidase, a new hyaluronidase with high stability, high activity, less affected by the environment, and easy to isolate and purify was isolated from the fermentation broth of Arthrobacter nicotinovorans, providing an important experimental basis for the development of hyaluronidase. The production of HAase by Arthrobacter, Streptomyces, etc. has also been reported in the literature.

[0037] The hyaluronidase produced by microorganisms is easy to isolate and purify and has potential. Currently, many microorganisms including bacteria and a few fungi can produce hyaluronidase. For example, Bloomage Freda Biotechnology Co., Ltd. introduced the HAase gene derived from Hill into Streptococcus zooepidemicus as a host and secreted and expressed it. The enzyme activity secreted in a shake flask was up to 21333 U / mL at most. For example, the wild-type hyaluronidase-producing Bacillus has an enzyme activity of 10000 U / mL at most.

[0038] After understanding the related background described in the present invention, the Citrobacter portucalensis, hyaluronidase, and its preparation method and uses of the present invention will be further described in detail below in connection with specific examples.

[0039] The technical scheme of the present invention is as follows. Citrobacter portucalensis, wherein the strain number of the Citrobacter portucalensis is HA2301, which was deposited with the China Center for Type Culture Collection on November 01, 2023, and the deposit number is CCTCC NO.M20232108. Preferably, the 16S rRNA nucleotide sequence of the Citrobacter portucalensis is SEQ ID NO.1.

[0040] In the above technical scheme, the present invention isolated a yeast strain capable of producing hyaluronidase, but there has been no report on Citrobacter portucalensis producing hyaluronidase so far. The biological classification of Citrobacter portucalensis described in the present invention is Bacteria, Pseudomonadota, Gammaproteobacteria, Enterobacterales, Enterobacteriaceae, Citrobacter, Citrobacter_portucalensis. The preparation method of hyaluronidase is to prepare hyaluronidase using the above-mentioned Citrobacter portucalensis, which can be used for the preparation of low-molecular-weight hyaluronic acid.

[0041] In the above technical scheme, the hyaluronidase produced by Citrobacter portucalensis described in the present invention has high specificity for hyaluronic acid, and the enzyme production characteristics are that the enzyme activity is 1000 - 10000 U / mL (the hyaluronidase activity measured when using high molecular weight sodium hyaluronate as the substrate). Preferably, the preparation method is to obtain hyaluronidase by centrifuging and pulverizing the bacterial liquid after culturing the above-mentioned Citrobacter portucalensis.

[0042] In the above technical scheme, the culture process for obtaining the bacterial liquid is as follows: (1) Inoculate Citrobacter portucalensis into a liquid seed culture medium for seed culture to obtain a seed liquid; (2) Scrape the seed liquid onto a solid medium for solid culture to obtain a single colony; (3) Inoculate the single colony into a liquid fermentation medium for growth culture to obtain a Citrobacter portucalensis bacterial liquid. In the process of seed culture, the temperature is 10 - 60°C, the rotation speed is 50 - 300 rpm, and the time is 10 - 30 h. Preferably, the temperature is preferably 37°C, the rotation speed is preferably 150 rpm, and the time is preferably 12 h. In the process of solid culture, the temperature is 10 - 60°C, and the time is 10 - 30 h. Preferably, the temperature is preferably 37°C, and the time is preferably 12 h. In the process of growth culture, the temperature is 10 - 60°C, the rotation speed is 50 - 300 rpm, and the time is 10 - 30 h. Preferably, the temperature of growth culture is preferably 37°C, the rotation speed is preferably 250 rpm, and the time is preferably 12 h.

[0043] In the above technical scheme, Citrobacter portucalensis has a wide substrate metabolism spectrum. It can utilize carbon sources such as glucose, maltose, galactose, xylose, glycerol, sucrose, lactose, melibiose and melezitose, and can utilize nitrogen sources such as urea, ammonia, ammonium salts, nitric acid, yeast extract and peptone salts. Cultivation of the above-mentioned Citrobacter portucalensis with different substrates can all produce hyaluronidase. Preferably, the liquid seed culture medium and the liquid fermentation culture medium per liter consist of the following components by weight: 1 - 20 g of peptone, 1 - 10 g of yeast powder, 1 - 10 g of sodium chloride and 100 - 2000 mL of water, and the pH value is 3 - 10. The solid culture medium per liter consists of the following components by weight: 1 - 20 g of peptone, 1 - 10 g of yeast powder, 1 - 10 g of sodium chloride, 15 - 25 g of agar powder and 100 - 2000 mL of water, and the pH value is 3 - 10. In the present invention, the pH is adjusted using any one or more of hydrochloric acid, sodium hydroxide and phosphoric acid. More preferably, the rotation speed of the above-mentioned centrifugation treatment is 5000 - 12000 rpm, and the time is 5 - 10 min.

[0044] In the above technical scheme, the centrifugation conditions are preferably centrifugation at 8000 rpm for 5 min. The amino acid sequence and nucleotide sequence of hyaluronidase are SEQ ID NO.2 and SEQ ID NO.3 respectively, and it is obtained by the above preparation method. Preferably, the upstream gene and downstream gene of the above-mentioned hyaluronidase gene are SEQ ID NO.4 and SEQ ID NO.5 respectively, Predict the conserved structure of the above-mentioned hyaluronidase, and the amino acid sequence of the obtained conserved region is SEQ ID NO.6.

[0045] In the above technical scheme, the promoter of the above-mentioned hyaluronidase gene is ATG, and the terminator is TAG. The nucleotide sequence of the ribosome binding site of the hyaluronidase is SEQ ID NO.7. It is the use of the above hyaluronidase in the preparation of hyaluronic acid. Preferably, the method for preparing the hyaluronic acid is to perform enzymatic degradation by mixing the above hyaluronidase with hyaluronic acid or sodium hyaluronate.

[0046] In the above technical scheme, the present invention can cut high molecular weight sodium hyaluronate of 1000000Da into 10000Da in 12 hours using the above hyaluronidase, and can be applied to industrial production, replacing the hyaluronidase extracted from expensive animal tissues, and has broad application prospects in the fields of medicine and cosmetics. More preferably, the temperature of the enzymatic degradation is 20 - 60°C, and the pH value is 3 - 10. The volume ratio of the hyaluronidase to hyaluronic acid or sodium hyaluronate is 1 - 5:5 - 15. More preferably, the temperature of the enzymatic degradation is 37°C, and the pH value is 6.5.

[0047] In the above technical scheme, the crude enzyme solution of Citrobacter portucalensis can enzymatically degrade sodium hyaluronate with a high molecular weight of 100WDa into 85000Da in 1 hour at this ratio.

Example

[0048] The steps for screening and validating Citrobacter portucalensis are as follows.

[0049] (1) Inoculate the deposited strain into a number of shake flasks containing liquid seed medium, and culture it on a shaker for 12 hours under the conditions of a temperature of 37°C and a rotation speed of 150 rpm to obtain a seed solution.

[0050] (2) Scrape the inoculum solution obtained in step (1) onto a solid medium and culture it at 37 °C for 12 hours to obtain single colonies.

[0051] (3) Collect the single colonies obtained in step (2), inoculate them into a liquid fermentation medium, and perform growth culture at 37 °C and 150 rpm for 12 hours. The components of the above inoculum medium and liquid fermentation medium include peptone with a mass% content of 2%, yeast powder with a mass% content of 1%, sodium chloride with a mass% content of 2%, and distilled water. The components of the above solid medium include peptone with a mass% content of 2%, yeast powder with a mass% content of 1%, sodium chloride with a mass% content of 2%, agar powder with a mass% content of 2%, and distilled water.

[0052] (4) Collect the bacterial solution prepared in step (3), centrifuge it at 8000 rpm for 5 min to obtain a bacterial cell precipitate, and pulverize it.

[0053] (5) The validation by the hyaluronic acid plate method is specifically operated as follows: Add 2% agar powder by mass% and 0.2 g of sodium hyaluronate with a molecular weight of 1,000,000 Da to 100 mL of distilled water, and perform autoclave sterilization. Under stirring at a constant speed, add 10 mL of 5% bovine serum albumin (BSA) stock solution to the medium by sterile filtration, and shake well. Pour the medium into plates and store at 4 °C. Use an Oxford cup to punch holes in the medium. Add 100 μL of the bacterial solution to the wells. React the plates at 37 °C for 24 hours. The next day, wash with 2N acetic acid for at least 15 min. A clear halo appeared around the wells, indicating the degradation of HA.

[0054] (6) Screen the strains that showed a clear halo on the hyaluronic acid plate to obtain Citrobacter_portucalensis.

[0055] The Citrobacter portucalensis was deposited as a biological material. Its taxonomic name is Citrobacter sp, strain number: HA2301. It was deposited with the China Center for Type Culture Collection on November 1, 2023 (Wuhan University, Wuhan, China), and the deposit number is CCTCC NO.M20232108.

Example

[0056] The Citrobacter portucalensis screened in Example 1 was observed to have colonies that were off-white, round, with a moist surface and irregular edges on a solid medium plate (LB). The results of culturing for 12 hours are shown in Figure 1.

[0057] The degradation ability of hyaluronidase against hyaluronic acid was validated by the plate method: Add 2% agar powder by mass content and 0.2 g of sodium hyaluronate with a molecular weight of 1,000,000 Da to 100 mL of distilled water and sterilize by autoclaving. Under stirring at a constant speed, add 10 mL of 5% bovine serum albumin (BSA) stock solution to the medium by sterile filtration and shake well. Pour the medium into plates and store at 4°C. Use an Oxford cup to punch holes in the medium. Add 100 μL of the bacterial solution to the wells. React the plates at 37°C for 24 hours. The next day, wash with 2N acetic acid for at least 15 min.

[0058] The results are shown in Figure 2, and a clear halo appeared around the wells, indicating the degradation of HA.

Example

[0059] Example 3: Preparation of a crude hyaluronic acid enzyme solution from a Citrobacter portucalensis bacterial solution The specific steps are as follows.

[0060] (1) The Citrobacter portucalensis screened in Example 1 was collected, inoculated into a liquid inoculum medium, and cultured in a shaker for 12 hours at a temperature of 37°C and a rotation speed of 150 rpm to obtain an inoculum solution. The components of the liquid inoculum medium consist of 10 g of peptone, 5 g of yeast powder, 5 g of sodium chloride, and 1000 mL of water per liter, and the pH value is 6.5.

[0061] (2) The inoculum solution obtained in step (1) was collected, scribed on a solid medium, and cultured at a temperature of 37°C for 12 hours to obtain single colonies. The components of the solid medium consist of 10 g of peptone, 5 g of yeast powder, 5 g of sodium chloride, 20 g of agar powder, and 1000 mL of water per liter, and the pH value is 6.5.

[0062] (3) The single colonies obtained in step (2) were inoculated into a liquid fermentation medium and cultured for 12 hours at a temperature of 37°C and 250 rpm for growth culture to obtain a bacterial solution. The components of the liquid fermentation medium per liter consist of 10 g of peptone, 5 g of yeast powder, 5 g of sodium chloride, and 1000 mL of water, and the pH value is 6.5.

[0063] (4) The Citrobacter portucalensis bacterial solution obtained in step (3) was centrifuged at 8000 rpm for 5 min to obtain a cell precipitate, which was pulverized to obtain a crude enzyme solution. The pH of the liquid inoculum medium, solid medium, and liquid fermentation medium is adjusted using one or more of hydrochloric acid, sodium hydroxide, and phosphoric acid.

[0064] (5) Centrifugation was carried out at 5000, 7000, 10000, and 12000 rpm for 5 min, and at 8000 rpm for 6, 7, 8, 9, and 10 min, respectively, to obtain cell precipitates in each case, which were pulverized to obtain crude enzyme solutions.

Example

[0065] Example 4: Measurement of the optimal conditions of the crude hyaluronic acid enzyme solution obtained in Example 3 The specific steps are as follows.

[0066] Take 1 mL of the bacterial solution of Citrobacter_portucalensis respectively, centrifuge to obtain bacterial cell precipitate, discard the supernatant, resuspend the cells with 100 μL of sterile water, grind the cells with a cell crusher for 20 min, put 100 μL of crude enzyme solution and 800 μL of 2 mg / mL 100 kDa sodium hyaluronate solution into test tubes respectively, and add 100 μL each of the prepared sodium citrate buffer solutions with different pH values (4.5, 5.0, 5.5, 6.0, 6.5, 7.0 and 7.5) into the test tubes, and react in a water bath at 38 °C for 1 hour. Then, take it out and inactivate it in a boiling water bath for 5 min, add 2 mL of DNS, after 6 min in the boiling water bath, cool it immediately in an ice bath after taking it out, and measure the OD as shown in Figure 3 540 Measure the absorbance.

[0067] Add 100 μL of the prepared sodium citrate buffer solution with pH 6 to the test tube, react in a water bath at different temperatures (30 °C, 31 °C, 32 °C, 33 °C, 34 °C, 35 °C, 36 °C, 37 °C, 38 °C, 39 °C and 40 °C) for 1 hour respectively, then take it out and inactivate it in a boiling water bath for 5 min, add it to 2 mL of DNS, after 6 min in the boiling water bath, cool it immediately in an ice bath after taking it out, and measure the OD as shown in Figure 4 540 Measure the absorbance.

[0068] As can be seen from Figure 3 and Figure 4, the optimal pH of the intracellular hyaluronidase of Citrobacter_portucalensis is 5.5, and the optimal temperature is 37 °C.

Example

[0069] Example 5: Measurement of the enzyme activity of the crude hyaluronic acid enzyme solution As a method, the amount of reducing sugar produced by the degradation of hyaluronic acid by hyaluronidase is measured by the 3,5-dinitrosalicylic acid (DNS) colorimetric method. Enzyme activity is defined as the amount of enzyme required to release 1 μg of glucose reducing equivalent of reducing sugar from hyaluronic acid per hour at pH 5.5 and 38 °C.

[0070] Specifically, the measurement principle of the above enzyme activity is as follows: when 3,5-dinitrosalicylic acid is heated under alkaline conditions, it reacts with reducing sugar, and 3,5-dinitrosalicylic acid is reduced to 3-amino-5-nitrosalicylic acid of brown color. The red substance has a specific absorption peak and can be detected by a detector at 540 nm. At the same time, the reducing sugar is oxidized to saccharic acid and other substances. Within a certain range, the amount of reducing sugar is linearly related to the color intensity of the brown substance.

[0071] The specific operation procedure is as follows.

[0072] Preparation of DNS solution: Weigh (10 ± 0.1) g of 3,5-dinitrosalicylic acid, put it into about 600 mL of water, gradually add 10 g of sodium hydroxide, stir and dissolve it in a 50 °C water bath (magnetic force). Then, sequentially add 200 g of sodium potassium tartrate, 2 g of phenol, and 5 g of anhydrous sodium sulfite. After all are dissolved and clarified, cool to room temperature, make up to 1000 mL with water, and filter. Store it in a brown reagent bottle and place it in the dark for 7 days for preparation (preparation of DNS reagent according to the standard of the Ministry of Light Industry).

[0073] The total volume of the reaction system is 3 mL. Add 0 μL, 50 μL, 100 μL, 150 μL, and 200 μL of glucose standard solution (2 mg / mL) to 2 mL of DNS solution respectively, make up to 3 mL with water, boil in a boiling water bath for 10 min, cool to room temperature, make up to 10 mL with water, measure the absorbance at 540 nm, and prepare a standard curve with the absorbance on the horizontal axis and the glucose mass concentration on the vertical axis (shown in Figure 11).

[0074] The measurement procedure for the crude hyaluronic acid enzyme solution sample is as follows.

[0075] Prepare the following reagents: an aqueous solution of 2 mg / mL sodium hyaluronate (molecular weight 1000 kDa), and a 50 mmol / L sodium citrate buffer solution with a pH of 6.0. For a 1 mL reaction system: 800 μL of the sodium hyaluronate aqueous solution, 100 μL of the crude hyaluronidase solution, and make up to 1 mL with the sodium citrate buffer solution. React in a water bath at 37 °C for 1 hour. Use 1 mL of the reaction sample instead of the glucose standard solution, and use 100 μL of sterilized water instead of the crude hyaluronidase solution as a blank control. Measure the absorbance, substitute it into the standard curve, and determine the glucose mass concentration of the reducing equivalent.

[0076] When measuring Citrobacter portucalensis of the present invention by the above DNS method, the enzyme activity reached 9600 U / mL.

Example

[0077] In the enzyme activity measurement procedure in Example 5, measure the enzyme activity of Bacillus in the laboratory. The enzyme activity reached a maximum of 4000 U / ml, which was lower compared to the enzyme activity of Citrobacter.

Example

[0078] Collect a single colony of Citrobacter portucalensis in Example 1 into an EP tube, extract DNA using a yeast strain DNA extraction kit as a template, perform PCR amplification, validate the success or failure of the amplification by agarose gel electrophoresis, and send the sample for nucleotide sequencing. The kits and gene amplification reagents used were purchased from Shanghai Biotechnology Co., Ltd.

[0079] The upstream primer 16S rRNA1 (TCCGTAGGTGAACCTGCGG) and the downstream primer 16S rRNA4 (TCCTCCGCTTATTGATATGC) were used.

[0080] Amplification procedure: The reaction system is 50 μL (1 μL of upstream primer, 1 μL of downstream primer, 25 μL of 2× Taq PCR Master mix, 1 μL of DNA template, 22 μL of dd H2O).

[0081] Reaction conditions: Pre-denaturation at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 55°C for 40 s, extension at 72°C for 1 min, and finally extension at 72°C for 10 min. Purification, cloning, and nucleotide sequencing of the PCR product were performed by Shanghai Biotechnology Co., Ltd. The nucleotide sequencing results of the 16S rRNA gene were compared for homology in the NCBI database to obtain the identification results (Query Cover was 100%, Per.ident was 100%), and it was confirmed to be Citrobacter portucalensis.

[0082] The 16S rRNA sequence of Citrobacter portucalensis is SEQ ID NO.1, that is, the sequence is <210>1.

[0083] The phylogenetic tree analysis of the 16S rRNA sequence of the strain of the present invention is shown in Figure 5. Its gene sequence was compared using the BLAST program of the National Center for Biotechnology Information (NCBI) in the United States. The gene sequence of the 16S rRNA of the strain of the present invention has high homology with the partial 16S rRNA gene sequence of Citrobacter portucalensis registered in NCBI. A large number of literature studies were compared, and no reports on hyaluronidase production by strains with similar homology were found for this yeast strain.

Example

[0084] The Citrobacter portucalensis of the present invention was sent for whole-genome triple nucleotide sequencing (nucleotide sequencing was performed by Shanghai Majorbio Bio-pharm Technology Co., Ltd.), and analyzed using the Kyoto Encyclopedia of Genes and Genomes (https: / / www.kegg.jp / ). The genome length of the strain was 5358987 bp, the G + C% content was 51.66%, there was 1 chromosome, the number of genes was 5050, and the number of pathogenic genes was 654.

Example

[0085] The whole gene sequence was analyzed using BLAST in the Kyoto Encyclopedia of Genes and GeNomes (https: / / www.kegg.jp / ). The analyzed gene sequence of hyaluronidase is shown in SEQ ID NO.3 (<210>3).

Example

[0086] The crude enzyme solution described in Example 3 was subjected to polyacrylamide gel electrophoresis as follows.

[0087] (1) Gel preparation (separating gel: 4 mL of 30% acr / bis solution, 2.6 mL of 1.5 M Tris-HCl (pH 8.8), 100 μL of 10% SDS, 100 μL of 10% ammonium persulfate, 3.3 mL of distilled water were mixed, and finally 4 μL of TEMED was added and shaken well immediately. Stacking gel: 0.83 mL of 30% acr / bis solution, 0.675 mL of 1 M Tris-HCl buffer (pH 6.8), 50 μL of 10% SDS, 75 μL of 10% ammonium persulfate, 3.42 mL of distilled water were mixed, and finally 6 μL of TEMED was added and shaken well immediately. The above are volume % contents).

[0088] (2) Sample preparation: 160 μL of the crude enzyme solution was taken and added to 40 μL of 5×SDS-PAGE protein sample loading buffer, and boiled in a boiling water bath for 10 min.

[0089] (3) Sample loading: When the gel was completely solidified, the gel holder was removed, the comb was pulled out vertically upward, the holder was removed, and the gel was fixed in the electrophoresis tank together with the front and rear glassware. 1× electrophoresis buffer was added to the electrophoresis tank until it exceeded the sample loading chamber. 5 μL of marker and 25 μL of the sample were spotted separately.

[0090] (4) Electrophoresis: Adjust 90V concentrated gel electrophoresis. After the indicator enters the separation gel, adjust it to 120V separation gel electrophoresis and perform electrophoresis until it turns blue up to 1 cm from the bottom of the gel plate.

[0091] (5) Staining and decolorization: After electrophoresis, take it out from the gel chamber, pry open the glass plate to take out the gel, peel off the gel, and stain the gel with Coomassie Brilliant Blue for gel (1 g Coomassie Brilliant Blue R-250, 450 mL methanol, 100 mL glacial acetic acid, 450 mL distilled water) on a shaker for 30 - 60 min. Decolorize the stained gel with acetic acid decolorizing solution (100 mL acetic acid, 100 mL methanol, 800 mL water) until the background becomes colorless.

[0092] The results are shown in Figure 6. After crushing the bacterial cells, there is a distinct band between 75 - 100 kDa, while there is no distinct band in the supernatant. Therefore, it is considered that the hyaluronidase of this strain is an intracellular enzyme.

Example

[0093] The hyaluronidase gene obtained in Example 8 was input into NCBI and compared. As a result, the amino acid sequence is shown in SEQ ID NO.2 (<210>2).

Example

[0094] The hyaluronidase gene obtained in Example 8 was input into the RCSB Protein Data Bank (https: / / www.rcsb.org / ). The predicted three-dimensional structure diagram of hyaluronidase is shown in Figure 7. As can be seen from Figure 7, this model is similar to the enzyme protein structure of the PL8 family and has the same catalytic mechanism.

Example

[0095] The results predicted using Expasy (https: / / www.expasy.org / ) showed that the molecular weight of the above hyaluronidase was 44 KDa. When the amino acid sequence of hyaluronidase was input for analysis, the theoretical isoelectric point of the above hyaluronidase was 8.68.

Example

[0096] Using the CD-search (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) tool in the National Center for Biotechnology Information, the conserved structure of the above hyaluronidase gene was analyzed, and the obtained conserved region is shown in SEQ ID NO.8 (<210>6).

Example

[0097] Searching for hyaluronidase gene sequences from different reported species in a large database and performing homology comparison, as shown in Figure 8, it was found that the enzyme has no significant similarity with other reported hyaluronidase genes.

Example

[0098] The results of inputting and comparative analysis of the hyaluronidase gene of Example 8 into the National Center for Biotechnology Information (https: / / www.ncbi.nlm.nih.gov / ) showed that the promoter of the gene is ATG, the terminator is TGA, the upstream gene of the hyaluronidase gene is shown in SEQ ID NO.4 (<210>4), and the downstream gene is shown in SEQ ID NO.5 (<210>5).

[0099] As a result of gene analysis using the JASPAR-A database of transcription factor binding profiles (https: / / jaspar.genereg.net / ), the ribosome binding site of the gene is SEQ ID NO.7 (<210>7): GAGAGGTTAGAGT.

Example

[0100] 5 mL of the crude enzyme solution was mixed with 15 mL of sodium hyaluronate with a concentration of 2 mg / mL and a high molecular weight of 100 kDa, and the reaction was carried out. The molecular weight was measured every 2 hours using a 0.45 mm Ubbelohde viscometer, and the molecular weight size was measured using the calculation formula of the Ubbelohde viscometer.

[0101] Combined with the result diagram of the relationship between the intrinsic viscosity and time of the enzymatic degradation of sodium hyaluronate by hyaluronidase in Figure 9, the high molecular weight sodium hyaluronate was enzymatically degraded to 10,000 Da after 12 hours.

Example

[0102] The crude enzyme solution was mixed with sodium hyaluronate with a concentration of 2 mg / mL and a high molecular weight of 100 kDa, and the reaction was carried out. The reaction conditions are as follows.

[0103] (1) 5, 25, 30, and 75 mL of sodium hyaluronate were added to 5 mL of the crude enzyme solution respectively, and the mixture was reacted under the conditions of 37 °C and pH 6.5. When the molecular weight was measured using a 0.45 mm Ubbelohde viscometer and high temperature gel chromatography (GPC) every 4 hours, it was found that all of them could be enzymatically degraded to produce low molecular weight hyaluronic acid.

[0104] (2) 5 mL of the crude enzyme solution was added to 15 mL of sodium hyaluronate, and enzymatic degradation was carried out at room temperature at pH values of 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, and 10. When the molecular weight was measured using a 0.45 mm Ubbelohde viscometer and high-temperature gel chromatography (GPC) every 4 hours, it was found that both could be enzymatically decomposed to produce low-molecular-weight hyaluronic acid. Among them, when the pH value was 6.5, the effect of enzymatic decomposition was the best.

[0105] (3) 5 ml of the crude enzyme solution was added to 15 ml of sodium hyaluronate and enzymatically decomposed at pH 6.5 and 20, 25, 30, 35, 37, 40, 45, 50, 60 °C. When the molecular weight was measured using a 0.45 mm Ubbelohde viscometer and high-temperature gel chromatography (GPC) every 4 hours, it was found that both could be enzymatically decomposed to produce low-molecular-weight hyaluronic acid. Among them, when the temperature was 37 °C, the effect of enzymatic decomposition was the best.

Example

[0106] The bacterial solution (cultured for 12 hours) and 1 g / 100 mL sodium hyaluronate were uniformly mixed at a volume ratio of 1:5, 1:10, 1:15, and 1:20. For example, 8 mL, 4 mL, 2.67 mL, and 2 mL of the bacterial solution were added to centrifuge tubes containing 40 mL of the hyaluronic acid solution, respectively, and shaken well. The reaction was carried out under the condition of 37 °C, and sampling was performed at 0 h, 2 h, 4 h, 6 h, 8 h, 10 h, and 12 h, respectively, followed by agarose gel electrophoresis.

[0107] Agarose gel electrophoresis method: TBE (Tris borate) concentrated stock solution (5×): 54 g of Tris base, 27.5 g of boric acid, 20 ml of 0.5 mol / L EDTA were uniformly dissolved in sterile water, and the pH was adjusted to 8.0 with NaOH, and the solution volume was made 1 L.

[0108] Preparation of 1% agarose gel: (1) Measure 100 mL of 1× TBE buffer solution with a graduated cylinder, put it into a 250 mL wide-mouth bottle, weigh 1.0 g of agarose and put it into it, shake well, and heat it in a microwave oven for 3 min to completely dissolve it. (2) Gel plate preparation: Pour the melted gel into an organic glass tank with a comb inserted in advance, leave it at room temperature for 30 min, wait for the gel to cool and solidify, then carefully pull out the comb, and put the organic glass tank and the gel into the electrophoresis tank. Add 1×TAE buffer into the electrophoresis tank to exceed the gel plane. At this time, the voltages at both ends of the gel are equal to the applied voltage, and the electrophoresis efficiency is increased. (3) Spotting: Mix the sodium hyaluronate sample and Loading Buffer at a ratio of 10:3, and add the whole amount to the sampling well with a pipette gun. (4) Electrophoresis: Turn on the power of the electrophoresis apparatus, set the voltage to 80 V, and perform electrophoresis until the dye is 1 - 2 cm away from the front end of the gel (about 2 hours), then turn off the power of the electrophoresis apparatus to stop electrophoresis. (5) Staining and observation: Immerse the gel in the toluidine blue staining solution for 2 hours, then take out the gel and decolorize it with distilled water for 5 hours (do not decolorize overnight), and detect the electrophoresis using UV light with a fully automatic gel imager.

[0109] As shown in Figure 10, the crude enzyme solution can be decomposed from 1000 kDa to about 80 kDa in molecular weight at a ratio of 1:5 over 1 hour. After decomposition for 5 hours, the molecular weight is 16 kDa.

[0110] As described above, the preferred embodiments of the present invention have been described. However, in any aspect, the embodiments of the present invention are not limited. Any simple changes, equivalent changes, and modifications to the above embodiments based on the technical entity of the embodiments of the present invention are still included within the scope of the technical scheme of the embodiments of the present invention.

Claims

1. Citrobacter portucalensis, characterized in that it has strain number: HA2301, deposited at the China Typical Culture Depository Center on November 1, 2023, and has deposit number: CCTCC NO. M20232108.

2. 2. The Citrobacter portucalensis of claim 1, wherein the 16S rRNA nucleotide sequence of the Citrobacter portucalensis is SEQ ID NO.

3. A method for preparing hyaluronidase, comprising preparing hyaluronidase using Citrobacter portucalensis according to claim 1 or 2.

4. The preparation method according to claim 3, characterized in that the hyaluronidase is obtained by centrifuging and pulverizing a bacterial liquid obtained after culturing the Citrobacter portucalensis according to claim 1 or 2.

5. The rotation speed of the centrifugation process is 5000 to 12000 rpm, and the time is 5 to 10 minutes.

5. The method according to claim 4 .

6. A hyaluronidase having an amino acid sequence and a nucleotide sequence of SEQ ID NO. 2 and SEQ ID NO. 3, respectively, which is obtained by the preparation method according to claim 3.

7. The upstream and downstream genes of the hyaluronidase gene are SEQ ID NO. 4 and SEQ ID NO. 5, respectively; The amino acid sequence of the conserved region of the hyaluronidase is SEQ ID NO. 6; The hyaluronidase of claim 6, wherein the nucleotide sequence of the ribosome binding site of the hyaluronidase is SEQ ID NO.

8. Use of the hyaluronidase described in claim 6 in the preparation of hyaluronic acid.

9. The use according to claim 8, characterized in that the method for preparing hyaluronic acid comprises mixing the hyaluronidase according to claim 6 with hyaluronic acid or sodium hyaluronate to carry out enzymatic degradation.

10. The temperature of the enzymatic degradation is 20-60° C., and the pH value is 3-10. The use according to claim 9, wherein the volume ratio of the hyaluronidase to hyaluronic acid or sodium hyaluronate is 1-5:5-15.

Images