Compositions, methods and uses of messenger RNA

Abstract

To provide methods and compositions for cancer treatment, particularly effective in reducing the size / volume of a tumor and inhibiting tumor growth.SOLUTION: In one embodiment, the present invention particularly provides a method for cancer treatment, the method comprising administering to a subject in need of cancer treatment a composition comprising an mRNA encoding a protein or a peptide encapsulated within a lipid nanoparticle at an effective dose and administration interval such that the size of a tumor is reduced or the growth of the tumor is inhibited.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit and priority of U.S. Provisional Patent Application No. 62 / 913,035, filed on October 9, 2019, the content of which is hereby incorporated by reference in its entirety.

Background Art

[0002] Cancer is the most common cause of death in many regions of the world, and more than 2.5 million cancer cases are diagnosed worldwide each year. Recent advances in the molecular biological understanding of cancer have shown that cancer is a genetic disorder that causes abnormal growth of affected cells. There are many cancer treatments, including surgery, chemotherapy, radiation therapy, gene therapy, as well as small molecules and protein molecules. However, these treatments often function by non - specific interactions with cellular targets, causing unwanted side effects and not treating the root of the disease. Cancer still shows high resistance to currently available treatments.

Summary of the Invention

Means for Solving the Problems

[0003] The present invention provides an improved mRNA therapeutic for the treatment of cancer. In particular, the methods described herein provide effective in vivo delivery of mRNA encoding immunomodulatory proteins or peptides useful in cancer immunotherapy.

[0004] In one aspect, the present invention is, inter alia, a method of treating cancer, comprising administering to a subject in need of cancer treatment a composition comprising mRNA encoding a protein or peptide encapsulated within lipid nanoparticles at an effective dose and dosing interval such that the size of the tumor is reduced or the growth of the tumor is inhibited.

[0005] In another aspect, the present invention provides a method for treating cancer, comprising administering to a subject in need of cancer treatment a composition comprising two or more mRNAs each encoding a protein or peptide encapsulated within one or more lipid nanoparticles at an effective dose and dosing interval such that the size of the tumor is reduced or the growth of the tumor is inhibited, wherein at least two of the two or more mRNAs each encode a different protein or peptide from the other mRNAs.

[0006] In some embodiments, the two or more mRNAs comprise a first mRNA encoding a first protein or peptide encapsulated within a first lipid nanoparticle and a second mRNA encoding a second protein or peptide encapsulated within a second lipid nanoparticle.

[0007] In some embodiments, at least one of the proteins or peptides modulates an immune response. In some embodiments, at least one of the proteins or peptides is IL-12, IL-2, IL-6, IL-15, STING, MCP-3, GM-CSF, FLT-3L, NLRP3, IFN-γ, TNF-α, NLRP1, CCL5, or a combination thereof.

[0008] In some embodiments, two of the two or more mRNAs each encode IL-12 and STING, respectively. In some embodiments, the two or more mRNAs comprise at least three mRNAs each encoding STING, IL-12, and GM-CSF, respectively. In some embodiments, the two or more mRNAs comprise at least four mRNAs each encoding STING, IL- 12, FLT-3L, and GM-CSF, respectively. In some embodiments, the two or more mRNAs comprise at least four mRNAs each encoding STING, IL-12, NLRP3, and GM-CSF, respectively. In some embodiments, the two or more mRNAs comprise at least four mRNAs each encoding STING, IL-12, IL-2, and GM-CSF, respectively.

[0009] In some embodiments, STING is a variant form of STING. In some embodiments, the variant form enables STING to be constitutively active.

[0010] In some embodiments, at least one of the protein or peptide does not modulate the immune response.

[0011] In some embodiments, the method provides a tumor growth inhibition rate of more than 50% compared to the control 7 days after administration of the first dose. In some embodiments, the method provides a tumor growth inhibition rate of more than 60% compared to the control 10 days after administration of the first dose. In some embodiments, the method provides a tumor growth inhibition rate of more than 70% compared to the control 10 days after administration of the first dose. In some embodiments, the method provides a tumor growth inhibition rate of more than 80% compared to the control 10 days after administration of the first dose. In some embodiments, the method provides a tumor growth inhibition rate of more than 80% compared to the control 20 days after administration of the first dose. In some embodiments, the method provides a tumor growth inhibition rate of more than 85% compared to the control 20 days after administration of the first dose. In some embodiments, the method provides a tumor growth inhibition rate of more than 90% compared to the control 20 days after administration of the first dose.

[0012] In some embodiments, administration of the composition results in a weight change rate of less than 15% in the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate of less than 10% in the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate of less than 5% in the subjects compared to the control.

[0013] In some embodiments, the control is a subject having an equivalent disease state without treatment. In some embodiments, the control is the weight of the subject before administration of the composition.

[0014] In some embodiments, the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEGylated lipids. In some embodiments, the lipid nanoparticles comprise cholesterol or one or more cholesterol-based lipids.

[0015] In some embodiments, the first lipid nanoparticles comprise a first cationic lipid, the second lipid nanoparticles comprise a second cationic lipid, and the first cationic lipid is different from the second cationic lipid.

[0016] In some embodiments, the one or more cationic lipids are selected from the group consisting of cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole-based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLin carbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino) pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), and combinations thereof. In some embodiments, the one or more cationic lipids comprise cKK-E12.

[0017] In some embodiments, the composition is administered intratumorally. In some embodiments, the composition is administered subcutaneously. In some embodiments, the composition is administered intradermally. In some embodiments, the composition is administered intravenously. In some embodiments, the composition is administered by intralung administration. In some embodiments, the composition is administered by spraying.

[0018] In some embodiments, the method comprises injecting a single dose. In some embodiments, the method comprises periodically injecting multiple doses. In some embodiments, the single dose or multiple doses range from about 0.1 μg to 100 mg of mRNA. In some embodiments, the single dose or multiple doses range from about 0.1 μg to 50 mg of mRNA. In some embodiments, the single dose or multiple doses range from about 0.1 μg to 25 mg of mRNA. In some embodiments, the single dose or multiple doses range from about 0.1 μg to 10 mg of mRNA. In some embodiments, the single dose or multiple doses range from 1 μg to 1 mg. In some embodiments, the single dose or multiple doses range from 1 μg to 100 μg of mRNA.

[0019] In some embodiments, the single dose is 0.1 μg or the multiple doses are 0.1 μg. In some embodiments, the single dose is 0.3 μg or the multiple doses are 0.3 μg. In some embodiments, the single dose is 0.5 μg or the multiple doses are 0.5 μg. In some embodiments, the single dose is 1 μg or the multiple doses are 1 μg. In some embodiments, the single dose is 5 μg or the multiple doses are 5 μg. In some embodiments, the single dose is 10 μg or the multiple doses are 10 μg. In some embodiments, the single dose is 25 μg or the multiple doses are 25 μg. In some embodiments, the single dose is 50 μg or the multiple doses are 50 μg. In some embodiments, the single dose is 100 μg or the multiple doses are 100 μg.

[0020] In some embodiments, the single dose or multiple doses are in the range of about 0.01 μg / kg to 10 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.01 μg / kg to 8 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.01 μg / kg to 6 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.01 μg / kg to 5 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.1 μg / kg to 5 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.1 μg / kg to 1 mg / kg (mRNA / body weight). In some embodiments, the single dose or multiple doses are in the range of about 0.1 μg / kg to 0.5 mg / kg (mRNA / body weight).

[0021] In some embodiments, each of the multiple doses contains the same dosage of mRNA. In some embodiments, each of the multiple doses contains different dosages of mRNA.

[0022] In some embodiments, each of the multiple doses is injected at intervals of 1 day to 3 weeks. In some embodiments, each of the multiple doses is injected daily. In some embodiments, each of the multiple doses is injected at 3-day intervals. In some embodiments, each of the multiple doses is injected weekly. In some embodiments, each of the multiple doses is injected at 10-day intervals. In some embodiments, each of the multiple doses is injected every other week. In some embodiments, each of the multiple doses is injected monthly. In some embodiments, each of the multiple doses is injected every other month.

[0023] In some embodiments, the mRNA comprises one or more modified nucleotides. In some embodiments, the mRNA comprises a 5' untranslated region (5'UTR) and / or a 3' untranslated region (3'UTR). In some embodiments, the mRNA comprises a 5' untranslated region (5'UTR). In some embodiments, the mRNA comprises a 3' untranslated region (3'UTR).

[0024] In some embodiments, administration of the composition activates T cells in a subject. In some embodiments, the method further comprises administering to the subject a composition comprising a checkpoint inhibitor. In some embodiments, the method does not comprise administering to the subject a composition comprising a checkpoint inhibitor. In some embodiments, the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof. In some embodiments, the checkpoint inhibitor inhibits PD1. In some embodiments, the checkpoint inhibitor inhibits PD-L1. In some embodiments, the checkpoint inhibitor inhibits CTLA-4. In some embodiments, the checkpoint inhibitor inhibits B7. In some embodiments, the checkpoint inhibitor inhibits BTLA. In some embodiments, the checkpoint inhibitor inhibits HVEM. In some embodiments, the checkpoint inhibitor inhibits TIM-3. In some embodiments, the checkpoint inhibitor inhibits GAL-9. In some embodiments, the checkpoint inhibitor inhibits LAG3. In some embodiments, the checkpoint inhibitor inhibits VISTA. In some embodiments, the checkpoint inhibitor inhibits KIR. In some embodiments, the checkpoint inhibitor inhibits 2B4. In some embodiments, the checkpoint inhibitor inhibits CD160. In some embodiments, the checkpoint inhibitor inhibits CGEN-15049. In some embodiments, the checkpoint inhibitor inhibits CHK1. In some embodiments, the checkpoint inhibitor inhibits CHK2. In some embodiments, the checkpoint inhibitor inhibits A2aR.

[0025] In some embodiments, one or more mRNAs are encapsulated within the same lipid nanoparticle. In some embodiments, one or more mRNAs are encapsulated within separate lipid nanoparticles.

[0026] In one aspect, the present invention provides a pharmaceutical composition for treating cancer, comprising one or more mRNAs encoding IL-12, IL-2, IL-6, IL-15, STING, MCP-3, GM-CSF, FLT-3L, NLRP3, IFN-γ, TNF-α, NLRP1, CCL5, or combinations thereof, wherein the one or more mRNAs are encapsulated within one or more lipid nanoparticles comprising at least one lipid nanoparticle comprising cKK-E12 as a cationic lipid.

[0027] In some embodiments, the one or more mRNAs encode IL-12 and STING. In some embodiments, the one or more mRNAs encode STING, IL-12, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, IL-12, FLT-3L, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, IL-12, NLRP3, and GM-CSF. In some embodiments, the one or more mRNAs encode STING, I L-12, IL-2 and GM-CSF.

[0028] In some embodiments, the composition further comprises additional mRNA encoding a checkpoint inhibitor. In some embodiments, the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or combinations thereof.

[0029] In some embodiments, the method results in an ascopar effect. In some embodiments, the method results in an abscopal effect.

[0030] In some embodiments, the method results in a tumor growth inhibition rate of more than 50% of untreated tumors compared to a control 7 days after administration of the first dose.

[0031] In some embodiments, the method results in a tumor growth inhibition rate of more than 60%, more than 70%, or more than 80% of untreated tumors, as compared to the control, 10 days after administration of the first dose.

[0032] In some embodiments, the method results in a tumor growth inhibition rate of more than 80%, more than 85%, or more than 90% of untreated tumors, as compared to the control, 20 days after administration of the first dose.

[0033] In some embodiments, the method increases the survival of a subject having cancer.

[0034] The drawings are for illustrative purposes only and not for limitation. BRIEF DESCRIPTION OF THE DRAWINGS

[0035]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5A

Figure 5B

Figure 5C

Figure 5D

Figure 5E

Figure 5F

Figure 5G

Figure 5H

Figure 5I

Figure 6

Figure 7

Figure 8

[0036] Definition To better understand the present invention, certain terms are first defined below. Additional definitions of the following terms and other terms are set forth throughout the specification.

[0037] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or parasites. In some embodiments, the animal can be a transgenic animal, a genetically engineered animal, and / or a clone.

[0038] Approximately or about: As used herein, the term "approximately" or "about" when applied to one or more values of interest refers to a value similar to the recited reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values that fall within 2 5%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less than that in either direction (greater or less) of the recited reference value, unless otherwise specified or apparent from the context (except when such a number exceeds 100% of a possible value).

[0039] Delivery: As used herein, the term "delivery" encompasses both local delivery and systemic delivery. For example, delivery of mRNA includes situations where the mRNA is delivered to a target tissue, its encoded protein is expressed, and is retained within that target tissue (also referred to as "local distribution" or "local delivery"), and situations where the mRNA is delivered to a target tissue, its encoded protein is expressed, and is secreted into the patient's circulatory system (e.g., serum), and is distributed systemically and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").

[0040] Encapsulation: As used herein, the term "encapsulation", or grammatical equivalents, refers to the process of confining individual mRNA molecules within nanoparticles.

[0041] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into polypeptide, the assembly of multiple polypeptides into intact proteins (e.g., enzymes), and / or the post-translational modification of the polypeptide or fully assembled protein (e.g., enzyme). In this context, the terms "expression" and "production" and grammatical equivalents are used interchangeably.

[0042] Half-life: As used herein, the term "half-life" is the time required for an amount such as the concentration or activity of a nucleic acid or protein to decrease to half of the value measured at the start of a period.

[0043] Improve, increase, or decrease: As used herein, "improve", "increase", or "decrease", or grammatical synonyms, refer to a value compared to a baseline measurement, e.g., a measurement in the same individual prior to the start of treatment described herein, or a measurement in a control subject (or control subjects) in the absence of the treatment described herein. A "control subject" is a subject suffering from the same disease form as the treated subject and of approximately the same age as the treated subject.

[0044] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment, such as in a test tube or reaction vessel, under cell culture, rather than within a multicellular organism.

[0045] In vivo: As used herein, the term "in vivo" refers to events that occur within multicellular organisms such as humans and non-human animals. In the context of cell type systems, the term can be used to mean events that occur within living cells (e.g., as the antonym of an in vitro system).

[0046] Local distribution or local delivery: As used herein, the terms "local distribution", "local delivery", or grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or local delivery requires a protein (e.g., an enzyme) encoded by mRNA that is translated and expressed within cells or has limited secretion and avoids entering the patient's circulatory system.

[0047] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" means a polynucleotide that encodes at least one polypeptide. The mRNA used herein includes both modified and unmodified RNA. The mRNA can include one or more coding regions and non-coding regions. mRN A may be purified from natural sources, produced using recombinant expression systems, and optionally further purified, chemically synthesized, etc. If desired, for example, in the case of chemically synthesized molecules, the mRNA may contain nucleoside analogs such as chemically modified bases or sugars, analogs with backbone modifications, etc. The mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, the mRNA comprises natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).

[0048] Patient: As used herein, the terms "patient" or "subject" refer to any organism to which a provided composition can be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Humans include pre-birth and post-birth forms.

[0049] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" refers to substances that, within the scope of sound medical judgment, are suitable for use in contact with human and animal tissues without undue toxicity, irritation, allergic response, or other problems or complications, and are commensurate with a reasonable benefit / risk ratio.

[0050] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Humans include prenatal and postnatal forms. In many embodiments, the subject is a human. A subject can be a patient, referring to a human who consults a healthcare provider for the diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient". A subject can be affected by or be susceptible to a disease or disorder, and may or may not exhibit symptoms of the disease or disorder.

[0051] Substantially: As used herein, the term "substantially" refers to a qualitative state that exhibits all or nearly all of the range or degree of the desired feature or characteristic. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, achieve completion and / or reach an absolute result. Thus, the term "substantially" is used herein to capture the inherent lack of potential perfection characteristic of many biological and chemical phenomena.

[0052] Systemic distribution or systemic delivery: As used herein, the terms "systemic distribution", "systemic delivery", or grammatical synonyms refer to a delivery or distribution mechanism or approach that affects the whole body or the entire organism. Typically, systemic distribution or systemic delivery is accomplished via the body's circulatory system, e.g., the bloodstream. Compare with the definition of "local distribution or local delivery".

[0053] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by the disease to be treated. In some embodiments, the target tissue includes tissues that exhibit pathological conditions, symptoms, or characteristics associated with the disease. In some embodiments, the target tissue includes tissues that exhibit pathological conditions, symptoms, or characteristics associated with the disease.

[0054] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, disorder, and / or condition in a subject afflicted with or susceptible to that disease, disorder, and / or condition when administered to the subject. One of ordinary skill in the art will understand that a therapeutically effective amount is typically administered by a dosing regimen that includes at least one unit dose.

[0055] Treat: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, improve, reduce, suppress, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment can be administered to a subject who does not exhibit symptoms of the disease and / or a subject who exhibits only early symptoms of the disease for the purpose of reducing the risk of developing the pathological condition associated with that disease. DETAILED DESCRIPTION OF THE INVENTION

[0056] The present invention provides an improved mRNA therapeutic agent for the treatment of cancer. In particular, the methods disclosed herein are effective to reduce or decrease the size, mass, and / or volume of a tumor or inhibit or delay tumor growth in a subject in need thereof by administering a composition comprising one or more mRNAs encoding a protein or peptide that directly or indirectly modulates an immune response at an effective dose and dosing interval. In some embodiments, the methods disclosed herein increase survival.

[0057] Various aspects of the present invention are described in detail in the following sections. The use of the sections is not meant to limit the present invention. Each section can be applied to any aspect of the present invention. In this application, the use of "or" means "and / or" unless otherwise stated.

[0058] Cancer Cancer cells express antigens that are generally not expressed by non-cancerous cells or tissues. These cancer antigens are not presented by antigen-presenting cells (APCs) in the same manner as viral antigens, i.e., in association with MHC-1 molecules that classify the antigens as foreign. However, cytotoxic T cells have the inherent property of differentiating and identifying mutant self-antigens and searching for and destroying cells having the mutant antigens. Therefore, one goal of cancer immunotherapy is to achieve optimal activation of cytotoxic T cells directed against mutant antigens. The methods and compositions according to the present invention are effective in inducing the subject's own cytotoxic T cells to generate an immune response necessary to destroy tumor cells.

[0059] Homeostasis of normal tissues is a highly regulated process of cell proliferation and cell death. Imbalances in cell or cell death proliferation can lead to a cancerous state (Solyanik et al., 1995, Stokke et al., 1997, Mumby and Walter, 1991, Natoli et al., 1998, Magi-Galluzzi et al., 1998). For example, cervical cancer, kidney cancer, lung cancer, pancreatic cancer, colorectal cancer, and brain cancer are just a few examples of the many cancers that can occur (Erlandsson, 1998, Kolmel, 1998, Mangray and King, 1998 , Gertig and Hunter, 1997, Mougin et al., 1998). In fact, due to the very high incidence of cancer, more than 500,000 people die annually in the United States due to cancer caused.

[0060] The maintenance of cell proliferation and cell death is at least partially regulated by proto-oncogenes. Proto-oncogenes can encode proteins that induce cell proliferation (e.g., sis, erbB, src, ras, and myc), proteins that inhibit cell proliferation (e.g., Rb, p53, NF1, and WT1), or proteins that regulate programmed cell death (e.g., bcl-2) (Ochi et al., 1998, Johnson and Hamdy, 1998, Liebermann et al., 1998). However, gene rearrangements or mutations to these proto-oncogenes convert the proto-oncogenes into potent cancer genes that cause cancer. In many cases, a single point mutation is sufficient to convert a proto-oncogene into a cancer gene. For example, mutations at codons 12 or 13 in the K-ras gene can convert a proto-oncogene into a cancer gene.

[0061] Currently, there are few effective treatment options for many common cancers. Treatment regimens for a particular individual vary depending on factors such as diagnosis, the stage at which the disease has developed, and the patient's age, gender, and overall health. The most common treatment options for cancer are surgery, radiation therapy, and chemotherapy. Surgery plays an important role in the diagnosis and treatment of cancer. Typically, a surgical approach is required for biopsy and removal of cancerous growths. However, if the cancer has metastasized and spread extensively, surgery has a low chance of cure and another approach is needed. Radiation therapy, chemotherapy, and immunotherapy are alternatives to surgical treatment of cancer (Mayer, 1998, Ohara 1998, Ho et al., 1998). Radiation therapy involves precisely targeting high-energy radiation to destroy cancer and is effective mainly in treating localized cancer cells rather than metastases, similar to the cells of surgery. Side effects of radiation therapy include skin irritation, difficulty swallowing, thirst, nausea, diarrhea, hair loss, and loss of vitality (Curran, 1998, Brizel, 1998).

[0062] Chemotherapy, which is cancer treatment with anticancer drugs, is another method of cancer treatment. The effectiveness of anticancer drug therapy is often limited because it is difficult to achieve drug delivery in all solid tumors (el-Kareh and Secomb, 1997). Chemotherapy strategies are based on the growth of solid tumors, and anticancer drugs are selected where the target cancer cells are rapidly dividing. Most chemotherapy approaches involve combinations of multiple anticancer drugs that have been shown to increase the response rates for various cancers. The main side effects of chemotherapy drugs are that they also affect normal tissue cells, which are likely to be affected as cells divide rapidly (e.g., bone marrow, gastrointestinal tract, reproductive system, and hair follicles). Other side effects of chemotherapy drugs are ulcers in the mouth, difficulty swallowing, thirst, nausea, diarrhea, vomiting, fatigue, bleeding, hair loss, and infections. Other forms of chemotherapy can be used to treat non-cancerous hyperproliferative disorders. These include the use of conventional chemotherapy agents such as methotrexate and cyclophosphamide for hyperproliferative diseases such as rheumatoid arthritis and psoriasis. Paw chemotherapy hyperproliferative diseases can also include immunosuppressive agents such as steroids, azathioprine, and cyclosporine, and immunomodulatory agents such as fumaric acid derivatives.

[0063] Immunotherapy, a rapidly evolving field of cancer research, is yet another option for treating certain types of cancer. For example, the immune system recognizes tumor cells as foreign substances and is thus selected as a target for destruction by the immune system. Unfortunately, the response is usually not sufficient to prevent most tumor growth. However, recently, the focus in the field of immunotherapy has been on developing ways to enhance or complement the natural defense mechanisms of the immune system.

[0064] As mentioned above, oncogenes play important roles in cancer biology. For example, the Rb tumor suppressor, p53, NF1, and WT1 are essential for maintaining the non-tumorigenic phenotype of cells (review by Soddu and Sacchi, 1998). All cancers Approximately 50% of them are associated with mutations in the p53 gene and have been found to lose their characteristics as the tumor suppressor p53 (see Levine et al., 1991, Vogelstein and Kinzler, 1992, Hartmann et al, 1996a, Hartmann et al, 1996b). Due to the high incidence of p53 gene mutations in cancer, many research groups have investigated p53 as a route for cancer treatment via gene transfer or replacement. The sis oncogene, erbB, src, ras, and myc, which encode proteins that induce cell proliferation, as well as the oncogenes of the Bcl-2 family that regulate programmed cell death, also play important roles in the non-tumorigenic phenotype of cells.

[0065] In some embodiments, the cancer is head cancer, neck cancer, ovarian cancer, breast cancer, colon cancer, prostate cancer, liver cancer, leukemia, glioma, melanoma, pancreatic cancer, testicular cancer, melanoma, bladder cancer, lung cancer, sarcoma, squamous cell carcinoma, small cell lung cancer, intraductal breast cancer, invasive lobular breast cancer, lobular carcinoma in situ, mucinous breast cancer, promyelocytic leukemia in peripheral blood, ovarian adenocarcinoma, ovarian adenocarcinoma metastatic to the abdominal cavity, prostatic adenocarcinoma, transitional cell carcinoma of the bladder, an epitheliod carcinoma in a pancreatic duct, adenocarcinoma of the pancreatic duct, adenocarcinoma of the cervical epithelium, cervical cancer, gastrointestinal cancer, genitourinary cancer, brain cancer, mesothelioma, renal cell carcinoma, gynecological cancer, or endometrial cancer.

[0066] Cancer treatment In one aspect, the present invention provides a method for treating cancer. The methods disclosed herein are effective in reducing or decreasing the size, mass, and / or volume of a tumor or inhibiting or delaying tumor growth in a subject in need thereof by administering a composition comprising one or more mRNAs encoding a protein or peptide that directly or indirectly modulates an immune response at an effective dosage and dosing interval. The methods disclosed herein are also effective in increasing the survival of the subject. For example, in some embodiments, the methods and compositions described herein can increase the survival of a subject suffering from cancer by about 1 month to 12 months, 1 year and 5 years, 5 years and 10 years, 10 years and 15 years.

[0067] In one aspect, the present invention relates to a method of treating cancer via administration of an mRNA encoding an immunomodulatory protein or peptide useful for cancer immunotherapy (IO). Immunomodulatory proteins or peptides include interleukin 1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-11, IL-12, IL-13, IL-15 / 15R, IL-18, IL-21, IL-27, macrophage inflammatory protein (MIP)-Iβ, MIP-la, monocyte chemoattractant protein (MCP)-1 MCP-3, macrophage colony stimulating factor (M-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), RANTES (CCL5), interferon (IFN)-γ, tumor necrosis factor (TNF)-α, granulocyte colony stimulating factor (G-CSF), cluster of differentiation (CD) 80, CD86, EFNα, IFNp, IFN, FMS-like tyrosine kinase 3 ligand (FLT3L), NLR family pyrin domain containing 1 (NLRP1), NLRP3, stimulator of interferon genes (STING), absent in melanoma 2 (AIM2), pyrin, interferon-induced protein 16 (IFI16), and OX40L.

[0068] Tumor size The method of treating cancer disclosed herein is effective in reducing the size of a tumor in a subject in need thereof as compared to a control. In some embodiments, the control is an untreated subject having an equivalent disease state. In some embodiments, the control is the subject prior to treatment. In some embodiments, administration of the composition results in a reduction in the size of the tumor as compared to the control, by Reduce the tumor size by at least 5% to 99%. In some embodiments, administration of the composition reduces the tumor size by at least 5% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 10% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 15% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 20% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 25% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 30% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 35% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 40% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 45% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 50% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 60% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 70% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 80% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 85% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 90% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 95% compared to the control. In some embodiments, administration of the composition reduces the tumor size by at least 99% compared to the control. In some embodiments, administration of the composition results in the disappearance of the tumor.

[0069] In some embodiments, administration of the composition reduces the size of the tumor 1 day after administration. In some embodiments, administration of the composition reduces the size of the tumor 2 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 4 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 5 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 7 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 10 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 12 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 15 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 18 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 20 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 25 days after administration. In some embodiments, administration of the composition reduces the size of the tumor 30 days after administration.

[0070] In some embodiments, administration of the composition results in a reduction in tumor size compared to the control during the treatment period. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 5 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 7 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 10 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 15 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 20 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 25 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 30 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 35 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 40 days. In some embodiments, administration of the composition results in a reduction in tumor size compared to the control for 45 days.

[0071] Inhibition of tumor growth The methods for treating cancer disclosed herein are effective in inhibiting or delaying tumor growth. The tumor growth inhibition rate is calculated as follows: (Average (C) - Average (T)) / Average (C) * 100%, where T is the tumor volume of the test group and C is the tumor volume of the control group, and the control is an untreated subject. In some embodiments, the method results in a tumor growth inhibition rate of more than 5% to more than 99% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 5% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 10% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 15% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 20% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 25% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 30% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 35% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 40% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 45% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 50% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 60% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 70% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 75% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 80% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 85% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 90% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 95% compared to the control. In some embodiments, the method results in a tumor growth inhibition rate of more than 99% compared to the control.

[0072] In some embodiments, the method results in inhibition of tumor growth 1 day after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 3 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 5 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 7 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 10 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 15 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 20 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 25 days after administration of the initial dose. In some embodiments, the method results in inhibition of tumor growth 30 days after administration of the initial dose.

[0073] In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control during the treatment period. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 1 day. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 5 days. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 7 days. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 10 days. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 15 days. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 20 days. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 25 days. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 30 days. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 35 days. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 40 days. In some embodiments, administration of the composition results in inhibition of tumor growth as compared to a control for 45 days as compared to a control, resulting in inhibition of tumor growth.

[0074] In some embodiments, the method results in a tumor growth inhibition rate of more than 50% when compared to the control 5 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 50% when compared to the control 7 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 60% when compared to the control 5 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 60% when compared to the control 7 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 50% when compared to the control 10 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 70% when compared to the control 5 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 70% when compared to the control 7 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 70% when compared to the control 10 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 80% when compared to the control 5 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 80% when compared to the control 7 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 80% when compared to the control 10 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 80% when compared to the control 15 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 80% when compared to the control 20 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 80% when compared to the control 25 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 85% when compared to the control 7 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 85% when compared to the control 15 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 85% when compared to the control 20 days after the administration of the first dose. In some embodiments, the method results in a tumor growth inhibition rate of more than 85% when compared to the control 25 days after the administration of the first dose.In some embodiments, the method results in a tumor growth inhibition rate of greater than 90% when compared to a control 7 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition rate of greater than 90% when compared to a control 15 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition rate of greater than 90% when compared to a control 20 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition rate of greater than 90% when compared to a control 25 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition rate of greater than 95% when compared to a control 7 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition rate of greater than 95% when compared to a control 15 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition rate of greater than 95% when compared to a control 20 days after administration of the initial dose. In some embodiments, the method results in a tumor growth inhibition rate of greater than 95% when compared to a control 25 days after administration of the initial dose.

[0075] In some embodiments, the method is effective to promote an anti-tumor effect (e.g., inducing T cell proliferation, inducing T cell infiltration into the tumor, inducing a memory T cell response, increasing the number of K cells, etc.) by administering the composition described herein. In one embodiment, the invention is a method of activating T cells in a subject in need of T cell activation, a method of inducing T cell proliferation in a subject in need of induction of T cell proliferation, a method of inducing T cell infiltration into a tumor of a subject in need of induction of T cell infiltration into the tumor, and / or a method of inducing a memory T cell response in a subject in need of induction of a memory T cell response, comprising administering to the subject the composition disclosed herein. In some embodiments, administration of the composition described herein activates T cells in the subject. T cell activation can be characterized by any method known in the art. In some embodiments, the activated T cells express CD4. In some embodiments, the activated T cells express CD8. In certain embodiments, the activated T cells express CD4 and CD8. In certain embodiments, the activated T cells are CD4+ T cells, CD8 + T cells, or CD4 + T cells and CD8 + It includes both T cells. In some embodiments, T cell activation includes increasing the number of tumor-infiltrating T cells. In certain embodiments, the number of tumor-infiltrating T cells in the tumor is at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 50-fold, or at least about 100-fold increased compared to the number of tumor-infiltrating T cells in the tumor before administration of the composition.

[0076] Body weight change Weight loss is commonly seen in cancer subjects. Alleviation of side effects including weight loss is an important part of cancer care and treatment. In some embodiments, administration of the composition results in a weight change rate in 60% to less than 1% of the subjects compared to the control. In some embodiments, the control is the weight of the subject before administration of the composition. In some embodiments, administration of the composition results in a weight change rate in less than 60% of the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate in less than 50% of the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate in less than 40% of the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate in less than 30% of the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate in less than 25% of the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate in less than 20% of the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate in less than 15% of the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate in less than 10% of the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate in less than 5% of the subjects compared to the control. In some embodiments, administration of the composition results in a weight change rate in less than 1% of the subjects compared to the control. In some embodiments, administration of the composition results in substantially no change in the weight of the subject compared to the control.

[0077] Complete success In cancer treatment, long-term efficacy is another important factor. In some embodiments, the method results in complete remission, partial remission, stable disease, partial response, or complete response. In some embodiments, complete response means that the signs of cancer have disappeared or that inhibition of tumor growth is maintained. In some embodiments, partial response means that the degree of damage to multiple tumors has decreased in response to treatment. The complete response rate is the percentage of subjects who show a complete response after administration of the composition. In some embodiments, the complete response rate is greater than 50%. In some embodiments, the complete response rate is greater than 60%. In some embodiments, the complete response rate is greater than 70%. In some embodiments, the complete response rate is greater than 80%. In some embodiments, the complete response rate is greater than 85%. In some embodiments, the complete response rate is greater than 90%. In some embodiments, the complete response rate is greater than 95%. In some embodiments, the complete response rate is greater than 99%.

[0078] Dosage and Administration Interval As used herein, the term "therapeutically effective amount" is primarily based on the total amount of mRNA contained in the vaccine composition of the present invention. Generally, a therapeutically effective amount is an amount sufficient to achieve a meaningful benefit to the subject (e.g., treating, modulating, curing, preventing, and / or delaying cancer or its symptoms). For example, a therapeutically effective amount may be an amount sufficient to achieve the desired therapeutic and / or prophylactic effect. Generally, the amount of a therapeutic agent (e.g., an mR NA) encoding a therapeutic protein or peptide) administered to a subject in need of treatment varies depending on the characteristics of that subject. Such characteristics include the subject's condition, disease severity, general health, age, gender, and weight. One of ordinary skill in the art will be able to readily determine an appropriate dosage based on these and other relevant factors. Additionally, both objective and subjective assays can optionally be used to identify the optimal dosage range.

[0079] Delivery vehicles containing mRNA can be administered and dosed in accordance with current medical practice, taking into account the clinical condition of the subject, the site of administration and the method of administration (e.g., including intratumoral, intravenous, and by injection, local and systemic), the dosing schedule, the age, sex, weight of the subject, and other factors relevant to clinicians in the art. An "effective amount" suitable for the purposes herein can be determined by such relevant considerations known to those of ordinary skill in the experimental clinical research, pharmacology, clinical, and medical arts. In some embodiments, the amount administered is effective to achieve at least some stabilization, improvement, or elimination of symptoms (e.g., reduction of tumor size and / or inhibition of tumor growth), as well as other metrics selected as appropriate measures of cancer progression, regression, or improvement by those of ordinary skill in the art.

[0080] In some embodiments, the method includes injecting a single dose. In some embodiments, the method includes periodically injecting multiple doses.

[0081] In some embodiments, suitable dosages range from 0.1 μg to 100 mg of mRNA. In some embodiments, single or multiple dosages range from 0.1 μg to 50 mg. In some embodiments, single or multiple dosages range from 0.1 μg to 25 mg. In some embodiments, single or multiple dosages range from 0.1 μg to 10 mg. In some embodiments, single or multiple dosages range from 1 μg to 1 mg. In some embodiments, single or multiple dosages range from 1 μg to 100 μg of mRNA. In some embodiments, single or multiple dosages are 0.1 μg. In some embodiments, single or multiple dosages are 0.3 μg. In some embodiments, single or multiple dosages are 0.5 μg. In some embodiments, single or multiple dosages are 1 μg. In some embodiments, single or multiple dosages are 5 μg. In some embodiments, single or multiple dosages are 7.5 μg. In some embodiments, single or multiple dosages are 10 μg. In some embodiments, single or multiple dosages are 15 μg. In some embodiments, single or multiple dosages are 20 μg. In some embodiments, single or multiple dosages are 25 μg. In some embodiments, single or multiple dosages are 30 μg. In some embodiments, single or multiple dosages are 40 μg. In some embodiments, single or multiple dosages are 50 μg. In some embodiments, single or multiple dosages are 100 μg. In some embodiments, single or multiple dosages are 1 mg. In some embodiments, single or multiple dosages are 5 mg. In some embodiments, single or multiple dosages are 7.5 mg. In some embodiments, single or multiple dosages are 10 mg. In some embodiments, single or multiple dosages are 20 mg. In some embodiments, single or multiple dosages are 30 mg. In some embodiments, single or multiple dosages are 50 mg.In some embodiments, the single dose or multiple doses are 100 mg.

[0082] In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 500 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 400 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 300 mg per kg of body weight. In some embodiments the therapeutically effective dose ranges from about 0.005 mg to 200 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 100 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 90 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 80 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 70 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 60 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 50 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 40 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 30 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 25 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 20 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 15 mg per kg of body weight. In some embodiments, the therapeutically effective dose ranges from about 0.005 mg to 10 mg per kg of body weight.

[0083] In some embodiments, the therapeutically effective dose of the composition is greater than about 0.1 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 0.5 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 1.0 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 3 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 5 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 10 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 15 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 20 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 30 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 40 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 50 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 60 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 70 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 80 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 90 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 100 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 150 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 200 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 250 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 300 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 350 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 400 mg per kg of body weight.In some embodiments, the therapeutically effective dose of the composition is greater than about 450 mg per kg of body weight. In some embodiments, the therapeutically effective dose of the composition is greater than about 500 mg per kg of body weight. In some embodiments, the therapeutically effective dose is 1.0 mg per kg of body weight. In some embodiments, a therapeutically effective dose of 1.0 mg per kg of body weight is administered subcutaneously, intramuscularly, or intravenously.

[0084] The methods provided by the present invention contemplate single and multiple administrations of a therapeutically effective amount of the therapeutic agent described herein. The composition can be administered at regular intervals depending on the nature, severity, and extent of the condition of the subject, such as the size of the tumor, the progression of metastasis, or the stage of the cancer. . In some embodiments, the therapeutically effective amount of the composition of the present invention may be administered regularly at regular intervals (e.g., daily, twice a week, once every four days, once a week, once every ten days, every other week, monthly, every other month, twice a month, once every 30 days, once every 28 days, or continuously).

[0085] In some embodiments, the liposomes and / or compositions provided are formulated to be suitable for the sustained release of the mRNA contained therein. Such sustained release compositions can be administered to a subject as appropriate with an extended dosing interval. For example, in some embodiments, the compositions of the invention are administered to a subject twice a day. In some embodiments, the composition is administered to the subject twice a day. In some embodiments, the composition is administered to the subject daily. In some embodiments, the composition is administered to the subject every other day. In some embodiments, the composition is administered to the subject twice a week. In some embodiments, the composition is administered to the subject once a week. In some embodiments, the composition is administered to the subject once every 7 days. In some embodiments, the composition is administered to the subject once every 10 days. In some embodiments, the composition is administered to the subject once every 14 days. In some embodiments, the composition is administered to the subject once every 28 days. In some embodiments, the composition is administered to the subject once every 30 days. In some embodiments, the composition is administered to the subject once every two weeks. In some embodiments, the composition is administered to the subject once every three weeks. In some embodiments, the composition is administered to the subject once every four weeks. In some embodiments, the composition is administered to the subject once a month. In some embodiments, the composition is administered to the subject twice a month. In some embodiments, the composition is administered to the subject once every six weeks. In some embodiments, the composition is administered to the subject once every eight weeks. In some embodiments, the composition is administered to the subject once every other month. In some embodiments, the composition is administered to the subject once every three months. In some embodiments, the composition is administered to the subject once every four months. In some embodiments, the composition is administered to the subject once every six months. In some embodiments, the composition is administered to the subject once every eight months. In some embodiments, the composition is administered to the subject once every nine months. In some embodiments, the composition is administered to the subject annually. Also contemplated are compositions and liposomes formulated for depot administration (e.g., intramuscular, subcutaneous, intravitreal) to effect either delivery or release of mRNA over an extended period of time.Preferably, the sustained release means employed is combined with a modification applied to the mRNA to enhance stability.

[0086] A therapeutically effective amount is generally administered in a dosing regimen that may include multiple unit doses. For any particular vaccine, the therapeutically effective amount and dosing interval (and / or appropriate unit doses within an effective dosing regimen) can vary, for example, depending on the route of administration and in combination with other pharmaceuticals. Also, the therapeutically effective amount (and / or unit dose) specific to any particular patient depends on the disorder being treated and the severity of the disorder; the activity of the particular vaccine agent employed; the particular composition employed; the patient's age, weight, general health, sex, and diet; the time of administration, route of administration, and / or rate of excretion or metabolism of the particular protein employed; the duration of the treatment; and various factors including similar factors well known in the medical arts.

[0087] In some embodiments, the initial dose and subsequent doses are the same amount. In some embodiments, the initial dose and subsequent doses are different amounts. In some embodiments, the initial dose is greater than the subsequent doses. In some embodiments, the initial dose is less than the subsequent doses. In some embodiments, each of the multiple doses contains the same dosage amount of mRNA. In some embodiments, each of the multiple doses contains a different dosage amount of mRNA.

[0088] Compositions of the Invention In one aspect, the present invention relates to a method of treating cancer via administration of a composition comprising one or more mRNAs encoding a protein or peptide encapsulated within a lipid nanoparticle. In one aspect, the present invention provides a pharmaceutical composition for treating cancer, comprising one or more mRNAs each encoding an immunomodulatory protein or peptide, wherein the one or more mRNAs are encapsulated within a lipid nanoparticle. In some embodiments, the pharmaceutical composition comprises two or more mRNAs encoding one or more checkpoint inhibitors. of mRNA, and the one or more mRNAs are encapsulated within a lipid nanoparticle.

[0089] mRNA In some embodiments, one or more mRNAs encode immunomodulatory proteins or peptides useful for cancer immunotherapy (IO). Immunomodulatory proteins or peptides include interleukin 1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, IL-11, IL-12, IL-13, IL-15 / 15R, IL-18, IL-21, IL-27, macrophage inflammatory protein (MIP)-Iβ, MIP-la, monocyte chemoattractant protein (MCP)-1 MCP-3, macrophage colony-stimulating factor (M-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), RANTES (CCL5), interferon (IFN)-γ, tumor necrosis factor (TNF)-α, granulocyte colony-stimulating factor (G-CSF), cluster of differentiation (CD) 80, CD86, EFNα, IFNp, IFN, FMS-like tyrosine kinase 3 ligand (FLT3L), NLR family pyrin domain-containing 1 (NLRP1), NLRP3, absent in melanoma 2 (AIM2), pyrin, IFN-induced protein 16 (IFI16), and OX40L.

[0090] In some embodiments, one or more mRNAs are codon-optimized. In some embodiments, the protein or peptide encoded by the mRNA is wild-type. In some embodiments, the protein or peptide encoded by the mRNA contains mutations or modifications. In some embodiments, STING contains the R293M mutation. In some embodiments, NLRP3 contains the D301N mutation.

[0091] In some embodiments, the protein or peptide encoded by the mRNA modulates the immune response. In some embodiments, the protein or peptide is a fragment or full-length cytokine. In some embodiments, a suitable protein or peptide is IL-1. In some embodiments, a suitable protein or peptide is IL-2. In some embodiments, a suitable protein or peptide is IL-3. In some embodiments, a suitable protein or peptide is IL-4. In some embodiments, a suitable protein or peptide is IL-5. In some embodiments, a suitable protein or peptide is IL-6. In some embodiments, a suitable protein or peptide is IL-7. In some embodiments, a suitable protein or peptide is IL-8. In some embodiments, a suitable protein or peptide is IL-10. In some embodiments, a suitable protein or peptide is IL-11. In some embodiments, a suitable protein or peptide is IL-12. In some embodiments, a suitable protein or peptide is IL-13. In some embodiments, a suitable protein or peptide is IL-15 / 15R. In some embodiments, a suitable protein or peptide is IL-18. In some embodiments, a suitable protein or peptide is IL-21. In some embodiments, a suitable protein or peptide is IL-27. In some embodiments, a suitable protein or peptide is MIP-Iβ. In some embodiments, a suitable protein or peptide is MIP-la. In some embodiments, a suitable protein or peptide is monocyte chemoattractant protein (MCP)-1. In some embodiments, a suitable protein or peptide is MCP-3. In some embodiments, a suitable protein or peptide is M-CSF. In some embodiments, a suitable protein or peptide is GM-CSF. In some embodiments, a suitable protein or peptide is The protein or peptide is RANTES or CCL5. In some embodiments, a suitable protein or peptide is IFN-γ. In some embodiments, a suitable protein or peptide is TNF-α. In some embodiments, a suitable protein or peptide is G-CSF. In some embodiments, a suitable protein or peptide is CD80. In some embodiments, a suitable protein or peptide is CD86. In some embodiments, a suitable protein or peptide is EFNα. In some embodiments, a suitable protein or peptide is IFNp. In some embodiments, a suitable protein or peptide is IFN. In some embodiments, a suitable protein or peptide is FLT3L. In some embodiments, a suitable protein or peptide is NLRP1. In some embodiments, a suitable protein or peptide is NLRP3. In some embodiments, a suitable protein or peptide is STING. In some embodiments, a suitable protein or peptide is AIM2. In some embodiments, a suitable protein or peptide is pyrin. In some embodiments, a suitable protein or peptide is IFI16. In some embodiments, a suitable protein or peptide is OX40L.

[0092] In some embodiments, one or more mRNAs encode IL-12 and STING. In some embodiments, one or more mRNAs encode STING, IL-12, and GM-CS. In some embodiments, one or more mRNAs encode STING, IL-12, FLT-3L, and GM-CSF. In some embodiments, one or more mRNAs encode STING, IL-12, NLRP3, and GM-CSF. In some embodiments, one or more mRNAs encode STING, IL-12, IL-2 and GM-CSF.

[0093] In one aspect, the present invention provides a method for treating cancer, comprising administering to a subject in need of cancer treatment a composition comprising two or more mRNAs each encoding a protein or peptide encapsulated within lipid nanoparticles at an effective dose and dosing interval such that the size of the tumor is reduced or the growth of the tumor is inhibited. In some embodiments, each of the two or more mRNAs encodes an immunomodulatory enzyme and / or a checkpoint inhibitor. In some embodiments, the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof. In some embodiments, a suitable checkpoint inhibitor inhibits PD1. In some embodiments, a suitable checkpoint inhibitor inhibits PD-L1. In some embodiments, a suitable checkpoint inhibitor inhibits CTLA-4. In some embodiments, a suitable checkpoint inhibitor inhibits B7. In some embodiments, a suitable checkpoint inhibitor inhibits BTLA. In some embodiments, a suitable checkpoint inhibitor inhibits HVEM. In some embodiments, a suitable checkpoint inhibitor inhibits TIM-3. In some embodiments, a suitable checkpoint inhibitor inhibits GAL-9. In some embodiments, a suitable checkpoint inhibitor inhibits LAG3. In some embodiments, a suitable checkpoint inhibitor inhibits VISTA. In some embodiments, a suitable checkpoint inhibitor inhibits KIR. In some embodiments, a suitable checkpoint inhibitor inhibits 2B4. In some embodiments, a suitable checkpoint inhibitor inhibits CD160. In some embodiments, a suitable checkpoint inhibitor inhibits CGEN-15049. In some embodiments, a suitable checkpoint inhibitor inhibits CHK1. In some embodiments, a suitable checkpoint inhibitor inhibits CHK2. In some embodiments, a suitable checkpoint inhibitor inhibits A2aR. In some In that embodiment, the checkpoint inhibitor is an antagonist against PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof. In some embodiments, the checkpoint inhibitor is an antibody or a fragment thereof. In some embodiments, the antibody or the fragment thereof is humanized. In some embodiments, the composition comprises a checkpoint inhibitor.

[0094] Synthesis of mRNA The mRNA according to the present invention can be synthesized according to any of various known methods. For example, the mRNA according to the present invention can be synthesized via in vitro transcription (IVT). Briefly, IVT often involves a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAseI, pyrophosphatase, and / or an RNAse inhibitor. The exact conditions will vary depending on the specific application. Exemplary mRNA construct design Construct design: X-mRNA coding region-Y 5’ and 3’ UTR sequences: X (5’ UTR sequence) = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 1) Y (3’ UTR sequence) = CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 2) or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 3)

[0095] Using the present invention, mRNAs of various lengths can be delivered. In some embodiments, the present invention is used to deliver in vitro synthesized mRNAs having a length of about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or more. In some embodiments, the present invention is used to deliver in vitro synthesized mRNAs in the range of about 1-20 kb, about 1-15 kb, about 1-10 kb, about 5-20 kb, about 5-15 kb, about 5-12 kb, about 5-10 kb, about 8-20 kb, or about 8-15 kb.

[0096] In some embodiments, for the preparation of mRNA according to the present invention, the DNA template is transcribed in vitro. Suitable DNA templates typically have a promoter for in vitro transcription, such as a T3, T7, or SP6 promoter, followed by the desired nucleotide sequence and termination signal of the desired mRNA.

[0097] Synthesis of mRNA using SP6 RNA polymerase In some embodiments, the mRNA is produced using SP6 RNA polymerase. SP6 RNA polymerase has high sequence specificity for the SP6 promoter sequence It is a DNA-dependent RNA polymerase. SP6 polymerase catalyzes the 5'→3' in vitro synthesis of RNA with either single-stranded DNA or double-stranded DNA downstream of its promoter, and incorporates natural ribonucleotides and / or modified ribonucleotides and / or labeled ribonucleotides into the polymerization transcript. Examples of such labeled ribonucleotides include biotin, fluorescein, digoxigenin, aminoallyl, and isotope-labeled nucleotides.

[0098] The sequence of bacteriophage SP6 RNA polymerase was first described as having the following amino acid sequence (GenBank: Y00105.1). MQDLHAIQLQLEEEMFNGGIRRFEADQQRQIAAGSESDTAWNRRLLSELIAPMAEGIQAYKEEYEGKKGRAPRALAFLQCVENEVAAYITMKVVMDMLNTDATLQAIAMSVAERIEDQVRFSKLEGHAAKYFEKVKKSLKASRTKSYRHAHNVAVVAEKSVAEKDADFDRWEAWPKETQLQIGTTLLEILEGSVFYNGEPVFMRAMRTYGGKTIYYLQTSESVGQWISAFKEHVAQLSPAYAPCVIPPRPWRTPFNGGFHTEKVASRIRLVKGNREHVRKLTQKQMPKVYKAINALQNTQWQINKDVLAVIEEVIRLDLGYGVPSFKPLIDKENKPANPVPVEFQHLRGRELKEMLSPEQWQQFINWKGECARLYTAETKRGSKSAAVVRMVGQARKYSAFESIYFVYAMDSRSRVYVQSSTLSPQSNDLGKALLRFTEGRPVNGVEALKWFCINGANLWGWDKKTFDVRVSNVLDEEFQDMCRDIAADPLTFTQWAKADAPYEFLAWCFEYAQYLDLVDEGRADEFRTHLPVHQDGSCSGIQHYSAMLRDEVGAKAVNLKPSDAPQDIYGAVAQVVIKKNALYMDADDATTFTSGSVTLSGTELRAMASAWDSIGITRSLTKKPVMTLPYGSTRLTCRESVIDYIVDLEEKEAQKAVAEGRTANKVHPFEDDRQDYLTPGAAYNYMTALIWPSISEVVKAPIVAMKMIRQLARFAAKRNEGLMYTLPTGFILEQKIMATEMLRVRTCLMGDIKMSLQVETDIVDEAAMMGAAAPNFVHGHDASHLILTVCELVDKGVTSIAVIHDSFGTHADNTLTLRVALKGQMVAMYIDGNALQKLLEEHEVRWMVDTGIEVPEQGEFDLNEIMDSEYVFA (SEQ ID NO: 4).

[0099] The SP6 RNA polymerase suitable for the present invention may be any enzyme having substantially the same polymerase activity as bacteriophage SP6 RNA polymerase. Thus, in some embodiments, the SP6 RNA polymerase suitable for the present invention is modified from SEQ ID NO: 4. For example, a suitable SP6 RNA polymerase may contain one or more amino acid substitutions, deletions, or additions. In some embodiments, a suitable SP6 RNA polymerase has an amino acid sequence that is about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 75%, 70%, 65%, or 60% identical or homologous to SEQ ID NO: 4. In some embodiments, a suitable SP6 RNA polymerase is a truncated protein (from the N-terminus, C-terminus, or internally), but retains polymerase activity. In some embodiments, a suitable SP6 RNA polymerase is a fusion protein.

[0100] The SP6 RNA polymerase suitable for the present invention may be, for example, a commercially available product from Aldevron, Ambion, New England Biolabs (NEB), Promega, and Roche. SP6 may be ordered and / or custom designed from commercial or non-commercial sources according to the amino acid sequence of SEQ ID NO: 4 described herein, or a variant of SEQ ID NO: 4. SP6 may be a polymerase of standard fidelity, or may be a high-fidelity / high-efficiency / high-capacity one modified to enhance RNA polymerase activity (e.g., mutation of the SP6 RNA polymerase gene, or post-translational modification of the SP6 RNA polymerase itself). Examples of such modified SP6s include Ambion's SP6 RNA Polymerase-Plus™, NEB's HiScribe SP6, and Promega's RiboMAX™ and Riboprobe® systems.

[0101] ​In some embodiments, a suitable SP6 RNA polymerase is a fusion protein. For example, the SP6 RNA polymerase can include one or more tags to facilitate enzyme isolation, purification, or solubility. Suitable tags can be located at the N-terminus, C-terminus, and / or internally. Non-limiting examples of suitable tags include calmodulin-binding protein (CBP), Fasciola hepatica 8-kDa antigen (Fh8), FLAG tag peptide, glutathione-S-transferase (GST), histidine tag (e.g., hexahistidine tag (His6)), maltose-binding protein (MBP), N-utilization substance (NusA), small ubiquitin-like modifier (SUMO) fusion tag, streptavidin-binding peptide (STREP), tandem affinity purification (TAP), and thioredoxin (TrxA). Other tags can be used in the present invention. These and other fusion tags are described, for example, in Costa et al. Frontiers in Microbiology 5(2014):63 and PCT / US16 / 57044, the contents of which are incorporated herein by reference in their entirety. In certain embodiments, the His tag is located at the N-terminus of SP6.

[0102] SP6 promoter Any promoter that can be recognized by SP6 RNA polymerase can be used in the present invention. Typically, the SP6 promoter contains 5’ATTTAGGTGACACTATAG-3’ (SEQ ID NO: 5). Variants of the SP6 promoter have been discovered and / or engineered to optimize the recognition and / or binding of SP6 to the promoter. Non-limiting variants include, but are not limited to: 5’-ATTTAGGGGACACTATAGAAGAG-3’, 5’-ATTTAGGGGACACTATAGAAGG-3’, 5’-ATTTAGGGGACACTATAGAAGGG-3’, 5’-ATTTAGGTGACACTATAGAA-3’, 5’-ATTTAGGTGACACTATAGAAGA-3’, 5’-ATTTAGGTGACACTATAGAAGAG-3’, 5’-ATTTAGGTGACACTATAGAAGG-3’, 5’-ATTTAGGTGACACTATAGAAGGG-3’, 5’-ATTTAGGTGACACTATAGAAGNG-3’, and 5’-CATACGATTTAGGTGACACTATAG-3’ (SEQ ID NOs: 6-15).

[0103] Furthermore, an SP6 promoter suitable for the present invention can be about 95%, 90%, 85%, 80%, 75%, or 70% identical or homologous to any one of SEQ ID NOs: 5-15. Furthermore, an SP6 promoter useful in the present invention can contain one or more additional nucleotides 5’ and / or 3’ relative to any of the promoter sequences described herein.

[0104] DNA template Typically, the DNA template is either completely double-stranded or nearly single-stranded with a double-stranded SP6 promoter sequence.

[0105] Linearized plasmid DNA (linearized via one or more restriction enzymes), linearized genomic DNA fragments (via restriction enzymes and / or physical means), PCR products, and / or synthetic DNA oligonucleotides are (and in the correct orientation) two upstream of the DNA sequence to be transcribed It can be used as a template for in vitro transcription using SP6, provided that it contains the native SP6 promoter.

[0106] In some embodiments, the linearized DNA template has blunt ends.

[0107] In some embodiments, the DNA sequence to be transcribed may be optimized to promote more efficient transcription and / or translation. For example, the DNA sequence can be optimized with respect to cis-regulatory elements (e.g., TATA box, termination signal, and protein binding sites), artificial recombination sites, Chi sites, CpG dinucleotide content, negative CpG islands, GC content, polymerase slippage sites, and / or other elements related to transcription; the DNA sequence can be optimized with respect to cryptic splice sites, mRNA secondary structure, mRNA stable free energy, repetitive sequences, RNA instability motifs, and / or other elements related to mRNA processing and stability; the DNA sequence can be optimized with respect to codon usage frequency bias, codon adaptation, internal Chi sites, ribosome binding sites (e.g., IRES), premature polyA sites, Shine-Dalgarno (SD) sequences, and / or other elements related to translation; and / or the DNA sequence can be optimized with respect to codon context, codon-anticodon interactions, translational pause sites, and / or other elements related to protein folding. Optimization methods known in the art, such as GeneOptimizer and OptimumGene™ by ThermoFisher, may be used in the present invention, which are described in US2011 / 0081708, the content of which is hereby incorporated by reference in its entirety.

[0108] In some embodiments, the DNA template includes 5' and / or 3' untranslated regions. In some embodiments, the 5' untranslated region includes one or more elements that affect mRNA stability or translation, such as iron-responsive elements. In some embodiments, the 5' untranslated region can be about 50 to 500 nucleotides in length.

[0109] In some embodiments, the 3' untranslated region includes one or more of a polyadenylation signal, a binding site for a protein that affects the positional stability of the mRNA in the cell, or one or more binding sites for miRNAs. In some embodiments, the 3' untranslated region can be 50 to 500 nucleotides or longer in length.

[0110] Exemplary 3' and / or 5' UTR sequences can be obtained from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzymes) to increase the stability of sense mRNA molecules. For example, the 5' UTR sequence can include a partial sequence or a fragment of the CMV immediate early 1 (IE1) gene to improve nuclease resistance and / or improve the half-life of the polynucleotide. To further stabilize the polynucleotide, inclusion of a sequence encoding human growth hormone (hGH) or a fragment thereof at the 3' end or untranslated region of the polynucleotide (e.g., mRNA) is also contemplated. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to their unmodified counterparts, including, for example, modifications made to improve the resistance of such polynucleotides to in vivo nuclease digestion.

[0111] Large-scale mRNA synthesis The present invention relates to the large-scale production of wild-type or codon-optimized mRNA. In some embodiments, the methods according to the present invention produce at least 100 mg, 150 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 80 Synthesize 0 mg, 900 mg, 1 g, 5 g, 10 g, 25 g, 50 g, 75 g, 100 g, 250 g, 500 g, 750 g, 1 kg, 5 kg, 10 kg, 50 kg, 100 kg, 1000 kg, or more of mRNA. As used herein, the term "batch" refers to the quantity or amount of mRNA synthesized at one time, e.g., produced according to a single manufacturing setting. A batch may refer to the amount of mRNA synthesized in one reaction that occurs via a single aliquot of enzyme and / or a single aliquot of DNA template for continuous synthesis under one set of conditions. mRNA synthesized in a single batch does not include mRNA synthesized at different times that are combined to achieve the desired amount. Generally, the reaction mixture includes SP6 RNA polymerase, a linear DNA template, and an RNA polymerase reaction buffer (which may or may not contain ribonucleotides or may require the addition of ribonucleotides).

[0112] According to the present invention, typically, 1 to 100 mg of SP6 polymerase per gram (g) of the produced mRNA is used. In some embodiments, about 1 to 90 mg, 1 to 80 mg, 1 to 60 mg, 1 to 50 mg, 1 to 40 mg, 10 to 100 mg, 10 to 80 mg, 10 to 60 mg, 10 to 50 mg of SP6 polymerase per gram of the produced mRNA is used. In some embodiments, about 5 to 20 mg of SP6 polymerase is used to produce about 1 gram of mRNA. In some embodiments, about 0.5 to 2 grams of SP6 polymerase is used to produce about 100 grams of mRNA. In some embodiments, about 5 to 20 grams of SP6 polymerase is used for about 1 kilogram of mRNA. In some embodiments, at least 5 mg of SP6 polymerase is used to produce at least 1 gram of mRNA. In some embodiments, at least 500 mg of SP6 polymerase is used to produce at least 100 grams of mRNA. In some embodiments, at least 5 grams of SP6 polymerase is used to produce at least 1 kilogram of mRNA. In some embodiments, about 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of plasmid DNA per gram of the produced mRNA is used. In some embodiments, about 10 to 30 mg of plasmid DNA is used to produce about 1 gram of mRNA. In some embodiments, about 1 to 3 grams of plasmid DNA is used to produce about 100 grams of mRNA. In some embodiments, about 10 to 30 grams of plasmid DNA is used for about 1 kilogram of mRNA. In some embodiments, at least 10 mg of plasmid DNA is used to produce at least 1 gram of mRNA. In some embodiments, at least 1 gram of plasmid DNA is used to produce at least 100 grams of mRNA. In some embodiments, at least 10 grams of plasmid DNA is used to produce at least 1 kilogram of mRNA.

[0113] In some embodiments, the concentration of SP6 RNA polymerase in the reaction mixture can be about 1 to 100 nM, 1 to 90 nM, 1 to 80 nM, 1 to 70 nM, 1 to 60 nM, 1 to 50 nM, 1 to 40 nM, 1 to 30 nM, 1 to 20 nM, or about 1 to 10 nM. In certain embodiments, the concentration of SP6 RNA polymerase is about 10 to 50 nM, 20 to 50 nM, or 30 to 50 nM. A concentration of SP6 RNA polymerase of 100 to 10,000 units / ml can be used, and by way of example, concentrations of 100 to 9,000 units / ml, 100 to 8,000 units / ml, 100 to 7,000 units / ml, 100 to 6,000 units / ml, 100 to 5,000 units / ml, 100 to 1,000 units / ml, 200 to 2,000 units / ml, 500 to 1,000 units / ml, 500 to 2,000 units / ml, 500 to 3,000 units / ml, 500 to 4,000 units / ml, 500 to 5,000 units / ml, 500 to 6,000 units / ml, 1,000 to 7,500 units / ml, and 2,500 to 5,000 units / ml can be used. can be.

[0114] The concentration of each ribonucleotide (e.g., ATP, UTP, GTP, and CTP) in the reaction mixture is from about 0.1 mM to about 10 mM, such as, for example, from about 1 mM to about 10 mM, from about 2 mM to about 10 mM, from about 3 mM to about 10 mM, from about 1 mM to about 8 mM, from about 1 mM to about 6 mM, from about 3 mM to about 10 mM, from about 3 mM to about 8 mM, from about 3 mM to about 6 mM, from about 4 mM to about 5 mM. In some embodiments, each ribonucleotide is at about 5 mM in the reaction mixture. In some embodiments, the total concentration of rNTPs (e.g., a combination of ATP, GTP, CTP and UTP) used in the reaction ranges from 1 mM to 40 mM. In some embodiments, the total concentration of rNTPs (e.g., a combination of ATP, GTP, CTP and UTP) used in the reaction ranges from 1 mM to 30 mM, or from 1 mM to 28 mM, or from 1 mM to 25 mM, or from 1 mM to 20 mM. In some embodiments, the total rNTPs concentration is less than 30 mM. In some embodiments, the total rNTPs concentration is less than 25 mM. In some embodiments, the total rNTPs concentration is less than 20 mM. In some embodiments, the total rNTPs concentration is less than 15 mM. In some embodiments, the total rNTPs concentration is less than 10 mM.

[0115] The RNA polymerase reaction buffer typically contains salts / buffers such as Tris, HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium phosphate, sodium chloride, and magnesium chloride.

[0116] The pH of the reaction mixture may be between about 6 and 8.5, 6.5 and 8.0, 7.0 and 7.5, and in some embodiments, the pH is 7.5.

[0117] Combine a linear or linearized DNA template (e.g., as described above and in an amount / concentration sufficient to provide the desired amount of RNA), an RNA polymerase reaction buffer, and SP6 RNA polymerase to form a reaction mixture. Incubate the reaction mixture at about 37 °C to about 42 °C for 30 minutes to 6 hours, such as, for example, about 60 to about 90 minutes.

[0118] In some embodiments, about 5 mM NTP, about 0.05 mg / mL SP6 polymerase, and about 0.1 mg / ml DNA template in a suitable RNA polymerase reaction buffer (final reaction mixture pH of about 7.5) are incubated at about 37°C to about 42°C for 60 to 90 minutes.

[0119] In some embodiments, the reaction mixture contains a linearized double-stranded DNA template, along with an SP6 polymerase-specific promoter, SP6 RNA polymerase, RNase inhibitor, pyrophosphatase, 29 mM NTP, 10 mM DTT, and a reaction buffer (800 mM HEPES, 20 mM spermidine, 250 mM MgCl2, pH 7.7 for 10x), and sufficient quantity (QS) of RNase-free water to bring it to the desired reaction volume, and then this reaction mixture is incubated at 37°C for 60 minutes. Next, the polymerase reaction is quenched by adding DNase I and DNase I buffer (100 mM Tris-HCl, 5 mM MgCl2 and 25 mM CaCl2, pH 7.6 for 10x) to facilitate digestion of the double-stranded DNA template in preparation for purification. This embodiment has been shown to be sufficient to produce 100 grams of mRNA.

[0120] In some embodiments, the reaction mixture contains NTP at a concentration in the range of 1 to 10 mM, DNA template at a concentration in the range of 0.01 to 0.5 mg / ml, and SP6 RNA polymerase at a concentration in the range of 0.01 to 0.1 mg / ml. For example, the reaction mixture contains NTP at a concentration of 5 mM, DNA template at a concentration of 0.1 mg / ml, and SP6 RNA polymerase at a concentration of 0.05 mg / ml.

[0121] Nucleotide The mRNA according to the present invention may be produced using various naturally occurring or modified nucleosides. In some embodiments, the mRNA is a natural nucleoside (e.g., adenosine, guanosine, cytidine, uridine), a nucleoside analog (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine (e.g., N-1-methyl-pseudouridine), 2-thiouridine and 2-thiocytidine), a chemically modified base, a biologically modified base (e.g., a methylated base), an intercalated base, a modified sugar (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or a modified phosphate group (e.g., phosphorothioate and 5'-N-phosphoramidite linkages), or comprises the same.

[0122] In some embodiments, the mRNA comprises one or more non-standard nucleotide residues. Non-standard nucleotide residues can include, for example, 5-methyl-cytidine (“5mC”), pseudouridine (“ψU”), and / or 2-thio-uridine (“2sU”). For considerations regarding such residues and their incorporation into mRNA, see, for example, U.S. Patent No. 8,278,036 or WO2011 / 012316. The mRNA may be an RNA defined as an RNA in which 25% of the U residues are 2-thio-uridine and 25% of the C residues are 5-methylcytidine. Teachings regarding the use of RNA are disclosed in U.S. Patent Application Publication No. 2012 / 0195936 and International Publication No. 2011 / 012316, both of which are hereby incorporated by reference in their entirety. The presence of non-standard nucleotide residues can make the mRNA more stable and / or less immunogenic than a control mRNA having the same sequence but containing only standard residues. In further embodiments, the mRNA can comprise one or more non-standard nucleotide residues selected from isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine cytosine, as well as combinations of these modifications and other nucleobase modifications. Some embodiments may further include additional modifications to the furanose ring or nucleobase. Additional modifications can include, for example, sugar modifications or substitutions (e.g., one or more of 2'-O-alkyl modifications, locked nucleic acids (LNAs)). In some embodiments, the RNA may be complexed or hybridized with additional polynucleotides and / or peptide polynucleotides (PNAs). In some embodiments where the sugar modification is a 2'-O-alkyl modification, such modifications can include, but are not limited to, 2'-deoxy-2'-fluoro modification, 2'-O-methyl modification, 2'-O-methoxyethyl modification, and 2'-deoxy modification.In some embodiments, any of these modifications may be present in 0 to 100% of the nucleotides, for example, 0%, 1%, 10%, 25%, 50%, 75%, 85%, 90%, 95%, or more than 100% of the constituent nucleotides, either individually or in combination.

[0123] Post-synthesis processing Typically, a 5' cap and / or a 3' tail may be added after synthesis. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of the "tail" serves to protect the mRNA from exonucleolytic degradation. perform.

[0124] The 5' cap is typically added as follows. First, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates. Then, guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyl transferase, resulting in a 5'5'5 triphosphate linkage. Then, the 7-nitrogen of guanine is methylated by methyl transferase. Examples of cap structures include, but are not limited to, m7G(5')ppp(5'(A,G(5')ppp(5')A and G(5')ppp(5')G). Additional cap structures are described in published U.S. Patent Application No. 2016 / 0032356 and U.S. Provisional Patent Application No. 62 / 464,327, filed on February 27, 2017, which are incorporated herein by reference.

[0125] The tail structure typically includes a poly(A) tail and / or a poly(C) tail. The poly-A tail or poly-C tail on the 3’ end of the mRNA typically contains at least 50 adenosine nucleotides or cytosine nucleotides, at least 150 adenosine nucleotides or cytosine nucleotides, at least 200 adenosine nucleotides or cytosine nucleotides, at least 250 adenosine nucleotides or cytosine nucleotides, at least 300 adenosine nucleotides or cytosine nucleotides, at least 350 adenosine nucleotides or cytosine nucleotides, at least 400 adenosine nucleotides or cytosine nucleotides, at least 450 adenosine nucleotides or cytosine nucleotides, at least 500 adenosine nucleotides or cytosine nucleotides, at least 550 adenosine nucleotides or cytosine nucleotides, at least 600 adenosine nucleotides or cytosine nucleotides, at least 650 adenosine nucleotides or cytosine nucleotides, at least 700 adenosine nucleotides or cytosine nucleotides, at least 750 adenosine nucleotides or cytosine nucleotides, at least 800 adenosine nucleotides or cytosine nucleotides, at least 850 adenosine nucleotides or cytosine nucleotides, at least 900 adenosine nucleotides or cytosine nucleotides, at least 950 adenosine nucleotides or cytosine nucleotides, or at least 1 kb of adenosine nucleotides or cytosine nucleotides, respectively.In some embodiments, the polyA tail or polyC tail each comprises from about 10 to 800 adenosine nucleotides or cytosine nucleotides (e.g., from about 10 to 200 adenosine nucleotides or cytosine nucleotides, from about 10 to 300 adenosine nucleotides or cytosine nucleotides, from about 10 to 400 adenosine nucleotides or cytosine nucleotides, from about 10 to 500 adenosine nucleotides or cytosine nucleotides, from about 10 to 550 adenosine nucleotides or cytosine nucleotides, from about 10 to 600 adenosine nucleotides or cytosine nucleotides, from about 50 to 600 adenosine nucleotides or cytosine nucleotides, from about 100 to 600 adenosine nucleotides or cytosine nucleotides, from about 150 to 600 adenosine nucleotides or cytosine nucleotides, from about 200 to 600 adenosine nucleotides or cytosine nucleotides, from about 250 to 600 adenosine nucleotides or cytosine nucleotides, from about 300 to 600 adenosine nucleotides or cytosine nucleotides, from about 350 to 600 adenosine nucleotides or cytosine nucleotides, from about 400 to 600 adenosine nucleotides or cytosine nucleotides, from about 450 to 600 adenosine nucleotides or cytosine nucleotides, from about 500 to 600 adenosine nucleotides or cytosine nucleotides, from about 10 to 150 adenosine nucleotides or cytosine nucleotides, from about 10 to 100 adenosine nucleotides or cytosine nucleotides, from about 20 to 7. It can be 0 adenosine nucleotides or cytosine nucleotides, or about 20 - 60 adenosine nucleotides or cytosine nucleotides. In some embodiments, the tail structure includes a combination of poly(A) tails and poly(C) tails having various lengths described herein. In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides. In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.

[0126] As described herein, the addition of a 5' cap and / or a 3' tail facilitates the detection of abortive transcripts generated during in vitro synthesis because, without capping and / or tailing, the size of those prematurely aborted mRNA transcripts may be too small to be detected. Thus, in some embodiments, the 5' cap and / or the 3' tail are added to the synthetic mRNA before the mRNA is tested for purity (e.g., the level of abortive transcripts present in the mRNA). In some embodiments, the 5' cap and / or the 3' tail are added to the synthetic mRNA before the mRNA is purified as described herein. In some embodiments, the 5' cap and / or the 3' tail are added to the synthetic mRNA after the mRNA is purified as described herein.

[0127] The mRNA synthesized according to the present invention can be used without further purification. In particular, the mRNA synthesized according to the present invention can be used without a step of removing shortmers. In some embodiments, the mRNA synthesized according to the present invention may be further purified. Various methods can be used to purify the mRNA synthesized according to the present invention. For example, purification of mRNA can be performed using centrifugation, filtration, and / or chromatography methods. In some embodiments, the synthesized mRNA is purified by ethanol precipitation or filtration or chromatography, or gel purification or any other suitable means. In some embodiments, the mRNA is purified by HPLC. In some embodiments, the mRNA is extracted with a standard phenol:chloroform:isoamyl alcohol solution well-known to those skilled in the art. In some embodiments, the mRNA is purified using tangential flow filtration. Suitable purification methods include those described in US2016 / 0040154, US2015 / 0376220, PCT application PCT / US18 / 19954 entitled "METHODS FOR PURIFICATION OF MESSENGER RNA" filed on February 27, 2018, and PCT application PCT / US18 / 19978 entitled "METHODS FOR PURIFICATION OF MESSENGER RNA" filed on February 27, 2018, all of which are incorporated herein by reference and can be used to practice the present invention.

[0128] In some embodiments, the mRNA is purified before capping and tailing. In some embodiments, the mRNA is purified after capping and tailing. In some embodiments, the mRNA is purified before and after capping and tailing.

[0129] In some embodiments, the mRNA is purified by centrifugation either before or after capping and tailing, or both before and after capping and tailing.

[0130] In some embodiments, the mRNA is purified by filtration either before or after capping and tailing, or both before and after capping and tailing.

[0131] In some embodiments, the mRNA is purified by tangential flow filtration (TFF) either before or after capping and tailing, or both before and after capping and tailing.

[0132] In some embodiments, the mRNA is purified by chromatography either before or after capping and tailing, or both before and after capping and tailing.

[0133] Characterization of mRNA Full-length or truncated transcripts of the mRNA may be detected and quantified using any method available in the art. In some embodiments, the synthesized mRNA molecules are detected using blotting, capillary electrophoresis, chromatography, fluorescence, gel electrophoresis, HPLC, silver staining, spectroscopy, ultraviolet (UV), or UPLC, or combinations thereof. Other detection methods known in the art are included in the present invention. In some embodiments, the synthesized mRNA molecules are detected using UV absorption spectroscopy with separation by capillary electrophoresis. In some embodiments, the mRNA is first denatured by glyoxal dye prior to gel electrophoresis ("glyoxal gel electrophoresis"). In some embodiments, the synthesized mRNA is characterized before capping or tailing. In some embodiments, the synthesized mRNA is characterized after capping and tailing.

[0134] In some embodiments, the mRNA produced by the methods disclosed herein contains less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.1% impurities, in addition to the full-length mRNA. The impurities include IVT contaminants such as proteins, enzymes, free nucleotides, and / or shortmers.

[0135] In some embodiments, the mRNA produced according to the present invention is substantially free of shortmers or truncated transcripts. In particular, the mRNA produced according to the present invention contains undetectable levels of shortmers or truncated transcripts by capillary electrophoresis or glyoxal gel electrophoresis. As used herein, the term "shortmer" or "truncated transcript" refers to any transcript smaller than the full length. In some embodiments, the "shortmer" or "truncated transcript" is less than 100 nucleotides in length, less than 90 nucleotides in length, less than 80 nucleotides in length, less than 70 nucleotides in length, less than 60 nucleotides in length, less than 50 nucleotides in length, less than 40 nucleotides in length, less than 30 nucleotides in length, less than 20 nucleotides in length, or less than 10 nucleotides in length. In some embodiments, the shortmer is detected or quantified after addition of the 5'-cap and / or 3'-polyA tail.

[0136] Delivery vehicle According to the present invention, the mRNA encoding the protein or peptide described herein (e.g., the full length, fragment, or portion of the protein or peptide) may be delivered as naked RNA (not packaged), or may be delivered via a delivery vehicle. As used herein, the terms "delivery vehicle", "transfer vehicle", "nanoparticle", or grammatical synonyms are used interchangeably.

[0137] The delivery vehicle is combined with one or more additional nucleic acids, carriers, targeting ligands or stabilizing reagents It may be formulated in a pharmacological composition combined with or mixed with a suitable excipient. Techniques of drug formulation and administration can be found in “Remington’s Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., latest edition. A particular delivery vehicle is selected based on its ability to facilitate transfection of the nucleic acid into the target cells.

[0138] In some embodiments, a delivery vehicle containing one or more mRNAs is administered by intravenous, intratumoral, intradermal, subcutaneous, intramuscular, intraperitoneal, epidural, intrathecal, or pulmonary delivery including, for example, inhalation. In some embodiments, the mRNA is expressed in the tissue where the delivery vehicle is administered. Additional teachings of pulmonary delivery and nebulization are described in related international application PCT / US17 / 61100, filed Nov. 10, 2017, by the applicant entitled “NOVEL ICE-BASED LIPID NANOPARTICLE FORMULATION FOR DELIVERY OF MRNA,” and U.S. Provisional Patent Application No. 62 / 507,061, each of which is incorporated by reference in its entirety.

[0139] In some embodiments, an mRNA encoding a protein or peptide may be delivered via a single delivery vehicle. In some embodiments, an mRNA encoding a protein or peptide may be delivered via one or more delivery vehicles of different compositions, each. In some embodiments, one or more mRNAs are encapsulated within the same lipid nanoparticle. In some embodiments, one or more mRNAs are encapsulated within separate lipid nanoparticles.

[0140] According to various embodiments, suitable delivery vehicles include, but are not limited to, polymeric carriers such as polyethyleneimine (PEI), lipid nanoparticles, and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, exosomes of both natural and synthetic origin, natural lamellar bodies, synthetic lamellar bodies, and semi-synthetic lamellar bodies, nanoparticles, calcium phosphate-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline microparticles, semiconductor nanoparticles, poly(D-arginine), sol-gel, nanodendrimer, starch-based delivery systems, micelles, emulsions, niosomes, multi-domain block polymers (vinyl polymers, polypropylacrylic acid polymers, dynamic multivalent aggregates), dry powder formulations, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, and other vectorial tags. Also contemplated as suitable transport vehicles is the use of bionanocapsules and other viral capsid protein assemblies. (See Hum. Gene Ther. 2008 September;19(9):887-95.)

[0141] Liposome delivery vehicle In some embodiments, a suitable delivery vehicle is a liposomal delivery vehicle, such as, for example, lipid nanoparticles. As used herein, liposomal delivery vehicles, such as, for example, lipid nanoparticles, are typically characterized as microscopic vesicles having an internal aqueous space isolated from the external medium by one or more bilayer membranes. The bilayer membrane of a liposome is typically formed by amphiphilic molecules such as lipids of synthetic or natural origin that include spatially separated hydrophilic and hydrophobic domains (Lasic, Trends Biotechnol., 16:307-321, 1998). The bilayer membrane of a liposome may also be formed by amphiphilic polymers and surfactants (e.g., polymelrosomes, niosomes, etc.). In the context of the present invention, liposomal delivery vehicles typically serve to transport the desired mRNA to target cells or tissues. In some embodiments, the nanoparticle delivery vehicle is a liposome. In some embodiments, the liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol -based lipids, and one or more PEG-modified lipids. In some embodiments, the liposome comprises three or fewer distinct lipid components. In some embodiments, one distinct lipid component is a sterol-based cationic lipid.

[0142] Cationic lipid In some embodiments, the liposome may comprise one or more cationic lipids. As used herein, the phrase "cationic lipid" refers to any of a number of lipid species that have a net positive charge at a selected pH, such as physiological pH. A number of cationic lipids have been described in the literature and many of them are commercially available. Suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. WO 2010 / 053572 (e.g., CI 2-200 described in paragraph

[0225] ) and International Patent Publication No. WO 2012 / 170930, both of which are incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention use lipid nanoparticles comprising ionizable cationic lipids such as, for example, (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-triene-1-amine (HGT5001), and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-triene-1-amine (HGT5002), as described in U.S. Provisional Patent Application No. 61 / 617,468, filed March 29, 2012, which is incorporated herein by reference.

[0143] In some embodiments, the liposomes provided comprise cationic lipids described in WO2013 / 063468 and in a U.S. provisional application filed on the same date as the present application and entitled "Lipid Formulations for Delivery of Messenger RNA", both of which are incorporated herein by reference.

[0144] In some embodiments, the cationic lipid is a compound of formula I-c1-a: [Chemical Formula] , or a pharmaceutically acceptable salt thereof, wherein each R 2 is independently hydrogen or C 1-3 alkyl, each q is independently from 2 to 6, each R' is independently hydrogen or C 1-3 alkyl, each R L is independently C 8-12 alkyl.

[0145] In some embodiments, each R 2 is independently hydrogen, methyl or ethyl. In some embodiments, each R 2 is independently hydrogen or methyl. In some embodiments, each R 2 is hydrogen.

[0146] In some embodiments, each q is independently from 3 to 6. In some embodiments, each q is independently from 3 to 5. In some embodiments, each q is 4.

[0147] In some embodiments, each R' is independently hydrogen, methyl, or ethyl. In some embodiments, each R' is independently hydrogen or methyl. In some embodiments, each R' is independently hydrogen.

[0148] In some embodiments, each R L is independently C 8-12 alkyl. In some embodiments, each R L is independently n-C 8-12 alkyl. In some embodiments, each R L is independently C 9-11 alkyl. In some embodiments, each R L is independently n-C 9-11 alkyl. In some embodiments, each R L is independently C 10 alkyl. In some embodiments, each RL is independently n-C 10 alkyl.

[0149] In some embodiments, each R 2 is independently hydrogen or methyl, each q is independently 3 to 5, each R' is independently hydrogen or methyl, and each R L is independently C 8-12 alkyl.

[0150] In some embodiments, each R 2 is hydrogen, each q is independently 3 to 5, each R' is hydrogen, and each R L is independently C 8-12 alkyl.

[0151] In some embodiments, each R 2 is hydrogen, each q is 4, each R' is hydrogen, and each R L is independently C 8-12 alkyl.

[0152] In some embodiments, the cationic lipid is a compound of Formula I-g:

Chemical formula

[0153] In certain embodiments, the liposomes provided include the cationic lipid cKK-E12 or (3,6-bis(4-(bis(2-hydroxydecyl)amino)butyl)piperazine-2,5-dione). The structure of cKK-E12 is shown below.

Chemical formula

[0154] Further exemplary cationic lipids include the cationic lipid of Formula I:

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

[0155] In some embodiments, one or more cationic lipids may be N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride, i.e., "DOTMA" (Feigner et al. (Proc. Nat’l Acad. Sci. 84, 7413 (1987), U.S. Patent No. 4,897,355). DOTMA may be formulated alone or in combination with a neutral lipid, dioleoylphosphatidylethanolamine, i.e., "DOPE", or other cationic or non-cationic lipids into a liposomal delivery vehicle or lipid nanoparticle, and such liposomes can be used to enhance the delivery of nucleic acids to target cells. Other suitable cationic lipids include, for example, 5-carboxyspermidine dioctadecylamide, i.e., "DOGS", 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-l-propanaminium, i.e., "DOSPA" (Behr et al. Proc. Nat.’l Acad. Sci. 86, 6982 (1989), U.S. Patent No. 5,171,678, U.S. Patent No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane, i.e., "DODAP", 1,2-dioleoyl-3-trimethylammonium-propane, i.e., "DOTAP".

[0156] As further exemplary cationic lipids, 1,2-distearyloxy-N,N-dimethyl-3-aminopropane, namely "DSDMA", 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane, namely "DODMA", 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane, namely "DLinDMA", 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane, namely "DLenDMA", N-dioleyl-N,N-dimethylammonium chloride, namely "DODAC", N,N-distearyl-N,N-dimethylammonium bromide, namely "DDAB", N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide, namely "DMRIE", 3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-octadecadienooxy)propane, namely "CLinDMA", 2-(5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-1-(cis,cis-9',12'-octadecadienooxy)propane, namely "CpLinDMA", N,N-dimethyl-3,4-dioleyloxybenzylamine, namely "DMOBA", 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane, namely "DOcarbDAP", 2,3-dilinoleoyloxy-N,N-dimethylpropylamine, namely "DLinDAP", 1,2-N,N'-dilino -Dimethylaminopropane, namely "DLincarbDAP", 1,2-dilinoleoyl-carbamoyl-3-dimethylaminopropane, namely "DLinCDAP", 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane, namely "DLin-DMA", 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane, namely "DLin-K-XTC2-DMA", and 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine (DLin-KC2-DMA) (see WO2010 / 042877; Semple et al., Nature Biotech. 28:172-176 (2010)), or mixtures thereof. (Heyes, J., et al., J Controlled Release 107:276-287 (2005), Morrissey, D.V., et al., Nat. Biotechnol. 23(8):1003-1007 (2005), PCT Publication No. WO2005 / 121348A1). In some embodiments, one or more of the cationic lipids comprise at least one of an imidazole moiety, a dialkylamino moiety, or a guanidium moiety.

[0157] In some embodiments, one or more cationic lipids are XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraene-19-yl 4-(dimethylamino)butanoate)), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine)), NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-didecyl-4,7,10,13-tetraazhexadecane-1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammonium propane), HGT4003 (WO2012 / 170889, the teachings of which are incorporated herein by reference in their entirety), ICE (WO2011 / 068810, the teachings of which are incorporated herein by reference in their entirety), HGT5000 (U.S. Provisional Patent Application No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety) or HGT5001 (cis or trans) (Provisional Patent Application No. 61 / 617,468), amino alcohol lipidoids such as lipidoids disclosed in WO2010 / 053572, DOTAP (1,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. “Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids” J. Contr. Rel. 2005, 107, 276-287), DLin-KC2-DMA (Semple, S.C. et al. “Rational Design of Cationic Lipids for siRNA Delivery” Nature Biotech. 2010, 28, 172-176), C12-200 (Love, K.T. et al.It may be selected from "Lipid-like materials for low-dose in vivo gene silencing" PNAS 2010, 107, 1864-1869).

[0158] Sterol cationic lipid In some embodiments, the sterol-based cationic lipid is a dialkylamino-containing sterol-based cationic lipid, an imidazole-containing sterol-based cationic lipid, and a guanidinium-containing sterol-based cationic lipid. For example, certain embodiments are directed to compositions comprising one or more sterol-based cationic lipids containing imidazole , for example, imidazole cholesterol ester or "ICE" lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, shown by the following structure (II). In certain embodiments, lipid nanoparticles for the delivery of RNA encoding a functional protein (e.g., mRNA) may comprise one or more imidazole-based cationic lipids, for example, imidazole cholesterol ester or "ICE" lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, shown by the structure (II). [Chemical formula]

[0159] In some embodiments, the percentage of cationic lipid in the liposome can be greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, or greater than 70%. In some embodiments, the cationic lipid constitutes about 30-50% by weight of the liposome (e.g., about 30-45% by weight, about 30-40% by weight, about 35-50% by weight, about 35-45% by weight, or about 35-40% by weight). In some embodiments, the cationic lipid (e.g., ICE lipid) constitutes about 30%, about 35%, about 40%, about 45%, or about 50% of the liposome in molar ratio.

[0160] Non-cationic / helper lipid In some embodiments, the provided liposomes contain one or more non-cationic ("helper") lipids. As used herein, the phrase "non-cationic lipid" means any neutral lipid, zwitterionic lipid, or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that carry a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include, but are not limited to, distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylcholine (DOPC), dipalmitoyl phosphatidylcholine (DPPC), dioleoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), dioleoyl phosphatidylethanolamine (DOPE), palmitoyl oleoyl phosphatidylcholine (POPC), palmitoyl oleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), or a combination thereof. Examples include mixtures thereof.

[0161] In some embodiments, such non-cationic lipids can be used alone, but are preferably used in combination with other lipids, such as cationic lipids. In some embodiments, the non-cationic lipid can be present in the liposome in a molar ratio of about 5% to about 90%, or about 10% to about 70% of the total lipids. In some embodiments, the non-cationic lipid is a neutral lipid, i.e., a lipid that does not carry a net charge under the conditions under which the composition is formulated and / or administered. In some embodiments, the proportion of non-cationic lipid in the liposome can be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0162] Cholesterol-based lipids In some embodiments, the liposomes provided contain one or more cholesterol-based lipids. By way of example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), l,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179, 280 (1991), Wolf et al. BioTechniques 23, 139 (1997), U.S. Patent No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid can be present in the liposome in a molar ratio of about 2% to about 30%, or about 5% to about 20% of the total lipids. In some embodiments, the percentage of cholesterol-based lipid in the lipid nanoparticles can be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0163] PEG-modified lipids The use of derivatized lipids such as polyethylene glycol (PEG)-modified phospholipids and derivatized ceramides (PEG-CER) including N-octanoyl-sphingosine-1-[succinyl (methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide) is also contemplated by the present invention, either alone or preferably in combination with other lipid formulations including a delivery vehicle (e.g., lipid nanoparticles). The contemplated PEG-modified lipids include, but are not limited to, polyethylene glycol chains up to S kDa in length covalently attached to lipids having an alkyl chain of length C6 - C 20 The addition of such components can prevent aggregation of the complex, increase circulation lifetime, and provide a means for increasing delivery of the lipid-nucleic acid composition to the target tissue (Klibanov et al. (1990) FEBS Letters, 268(1):235 - 237). Alternatively, these components can be selected to be rapidly exchanged out of the formulation in vivo (see U.S. Patent No. 5,885,613). Certain useful exchangeable lipids are PEG-ceramides having shorter acyl chains (e.g., C14 or C18). The PEG-modified phospholipids and derivatized lipids of the present invention can be included in a molar ratio of about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipids present in the liposomal delivery vehicle.

[0164] According to various embodiments, the selection of cationic lipids, non-cationic lipids, and / or PEG-modified lipids, including lipid nanoparticles, and the selection of the relative molar ratios of these lipids to each other are made based on the properties of the lipids selected, the nature of the intended target cells, and the properties of the MCNA to be delivered. Additional considerations include, for example, the degree of saturation of the alkyl chains of the lipids selected, as well as size, charge, pH, pKa, fusogenicity, and toxicity. Thus, the molar ratios can be adjusted accordingly.

[0165] Polymer In some embodiments, a suitable delivery vehicle uses a polymer as a carrier, alone It is formulated alone or in combination with other carriers containing various lipids described herein. Thus, in some embodiments, the liposomal delivery vehicles used herein also include nanoparticles containing polymers. Suitable polymers include, for example, polyacrylates, polyalkyl cyanoacrylates, polylactides, polylactide-polyglycolide copolymers, polycaprolactones, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrins, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is included, the PEI can be branched PEI having a molecular weight in the range of 10-40 kDa, for example, 25 kDa branched PEI (Sigma #408727).

[0166] The liposomes suitable for the present invention can contain one or more of the cationic lipids, non-cationic lipids, cholesterol lipids, PEG-modified lipids, and / or polymers described herein in various proportions. As non-limiting examples, suitable liposomal formulations can include combinations selected from cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; ICE, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, and DMG-PEG2K.

[0167] In various embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) constitutes about 30-60% (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome in molar ratio. In some embodiments, the percentage of the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) is about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% or more of the liposome in molar ratio.

[0168] In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid can be about 30-60:25-35:20-30:1-15, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is approximately 40:30:20:10, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is approximately 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is approximately 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is approximately 50:25:20:5.

[0169] Ratio of individual lipid components In embodiments where the lipid nanoparticles contain three or fewer distinct components of lipid, the ratio of the total lipid content (i.e., the ratio of lipid component (1):lipid component (2):lipid component (3)) can be expressed as x:y:z, (y + z) = 100 - x.

[0170] In some embodiments, each of "x", "y", and "z" represents the mole percent of three distinct components of lipid, and the ratio is a molar ratio.

[0171] In some embodiments, each of "x", "y", and "z" represents the weight percent of three distinct components of lipid, and the ratio is a weight ratio.

[0172] In some embodiments, lipid component (1) represented by the variable "x" is a sterol-based cationic lipid.

[0173] In some embodiments, lipid component (2) represented by the variable "y" is a helper lipid.

[0174] In some embodiments, the lipid component (3) represented by the variable "z" is a PEG lipid.

[0175] In some embodiments, the variable "x" representing the mole percent of the lipid component (1) (e.g., a sterol-based cationic lipid) is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0176] In some embodiments, the variable "x" representing the mole percent of the lipid component (1) (e.g., a sterol-based cationic lipid) is about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less. In an embodiment, the variable "x" is about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less.

[0177] In some embodiments, the variable "x" representing the mole percent of the lipid component (1) (e.g., a sterol-based cationic lipid) is at least about 50% to less than about 95%, at least about 50% to less than about 90%, at least about 50% to less than about 85%, at least about 50% to less than about 80%, at least about 50% to less than about 75%, at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%. In an embodiment, the variable "x" is at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%.

[0178] In some embodiments, the variable "x" representing the weight percent of the lipid component (1) (e.g., a sterol-based cationic lipid) is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.

[0179] In some embodiments, the variable "x" representing the weight percentage of lipid component (1) (e.g., a sterol-based cationic lipid) is about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less. In an embodiment, the variable "x" is about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less.

[0180] In some embodiments, the variable "x" representing the weight percentage of lipid component (1) (e.g., a sterol-based cationic lipid) is at least about 50% to less than about 95%, at least about 50% to less than about 90%, at least about 50% to less than about 85%, at least about 50% to less than about 80%, at least about 50% to less than about 75%, at least about 50% to less than about 70%, at least about 50% to less than about 65%, at least about 50% to less than about 60%. In an embodiment, the variable "x" is at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%.

[0181] In some embodiments, the molar percentage of lipid component (3) (e.g., a PEG lipid) represented by the variable "z" is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or 25% or less. In some embodiments, the molar percentage of lipid component (3) (e.g., a PEG lipid) represented by the variable "z" is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%. In an embodiment, the molar percentage of lipid component (3) (e.g., a PEG lipid) represented by the variable "z" is about 1% to about 10%, about 2% to about 10%, about 3% to about 10%, about 4% to about 10%, about 1% to about 7.5%, about 2.5% to about 10%, about 2.5% to about 7.5%, about 2.5% to about 5%, about 5% to about 7.5%, or about 5% to about 10%.

[0182] In some embodiments, the variable “z” representing the weight percentage of the lipid component (3) (e.g., PEG lipid) is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or 25% or less. In some embodiments, the variable “z” representing the weight percentage of the lipid component (3) (e.g., PEG lipid) is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%. In embodiments, the variable “z” representing the weight percentage of the lipid component (3) (e.g., PEG lipid) is about 1% to about 10%, about 2% to about 10%, about 3% to about 10%, about 4% to about 10%, about 1% to about 7.5%, about 2.5% to about 10%, about 2.5% to about 7.5%, about 2.5% to about 5%, about 5% to about 7.5%, or about 5% to about 10%.

[0183] For a composition having only three distinct lipid components, the variables “x”, “y”, and “z” can be in any combination as long as the sum of the three variables is 100% of the total lipid content.

[0184] Formulation of Liposomes Encapsulating mRNA The liposomal delivery vehicle for use in the compositions of the present invention can be prepared by various techniques currently known in the art. The liposomes for use in the provided compositions can be prepared by various techniques currently known in the art. For example, multilamellar vesicles (MLVs) can be prepared according to the prior art by dissolving lipids in a suitable solvent, depositing the selected lipids on the inner wall of a suitable container or vessel, and then evaporating the solvent to leave a thin film inside the vessel or by spray drying, etc. Subsequently, an aqueous phase can be added to the vessel while vortexing, and as a result, MLVs can be formed. Next, unilamellar vesicles (ULVs) can be formed by homogenization, sonication, or extrusion of the multilamellar vesicles. In addition, unilamellar vesicles can be formed by surfactant removal techniques.

[0185] In certain embodiments, the provided composition comprises liposomes, in which case the mRNA associates on both surfaces of the liposomes and is encapsulated within the liposomes. For example, during the preparation of the compositions of the present invention, cationic liposomes can associate with the mRNA by electrostatic interactions. For example, during the preparation of the compositions of the present invention, cationic liposomes can associate with the mRNA by electrostatic interactions.

[0186] In some embodiments, the compositions and methods of the present invention comprise mRNA encapsulated in liposomes. In some embodiments, one or more mRNA species can be encapsulated in the same liposome. In some embodiments, one or more mRNA species can be encapsulated in different liposomes. In some embodiments, the mRNA is encapsulated in one or more liposomes that differ in their lipid composition, molar ratio of lipid components, size, charge (zeta potential), targeting ligand, and / or combinations thereof. In some embodiments, one or more liposomes can have different compositions of sterol-based cationic lipids, neutral lipids, PEG-modified lipids, and / or combinations thereof. In some embodiments, one or more liposomes can have different molar ratios of sterol-based cationic lipids, neutral lipids, and PEG-modified lipids used to make the liposomes.

[0187] ​The process of incorporating the desired mRNA into liposomes is often referred to as "loading". Exemplary methods are described in Lasic, et al., FEBS Lett., 312:255-258, 1992, which is incorporated herein by reference. Nucleic acids incorporated into liposomes can be located entirely or partially within the internal space of the liposome, i.e., within the lipid bilayer of the liposome, or can associate with the outer surface of the liposome membrane. The incorporation of nucleic acids into liposomes is also referred to herein as "encapsulation", where the nucleic acid is completely enclosed within the internal space of the liposome. The purpose of incorporating mRNA into a delivery vehicle such as, for example, a liposome, is often to protect the nucleic acid from enzymes or chemicals that degrade the nucleic acid and / or from systems or receptors that would result in rapid excretion of the nucleic acid. Thus, in some embodiments, a suitable delivery vehicle can enhance the stability of the mRNA contained therein and / or facilitate delivery of the mRNA to target cells or tissues.

[0188] Suitable liposomes according to the present invention can be made in a variety of sizes. In some embodiments, the liposomes provided can be made smaller than conventionally known mRNA-encapsulating liposomes. In some embodiments, as the size of the liposome decreases, the delivery efficiency of the mRNA increases. The appropriate size of the liposome can be selected considering the site of the target cell or tissue and, to some extent, the intended use of the liposome being made.

[0189] In some embodiments, liposomes of an appropriate size are selected to promote the systemic distribution of the antibody encoded by the mRNA. In some embodiments, it may be desirable to limit the transfection of mRNA to specific cells or tissues. For example, for targeting hepatocytes, the liposomes may be sized such that their dimensions are smaller than the fenestrations of the endothelial layer that covers the hepatic sinusoids of the liver. In such cases, the liposomes would be able to easily penetrate the endothelial fenestrations and reach the target hepatocytes.

[0190] Alternatively or additionally, the liposomes may be sized such that the dimensions of the liposomes are sufficient to limit distribution into certain cells or tissues or to not distribute therein intentionally.

[0191] For sizing a liposome population, various other methods known in the art can be utilized. One such sizing method is described in U.S. Patent No. 4,737,323, which is incorporated herein by reference. Sonication of a liposome suspension by either bath sonication or probe sonication results in size reduction down to small ULVs with diameters of less than about 0.05 micrometers. Homogenization is another method that utilizes shear energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, MLVs are recycled using a standard emulsion homogenizer until the selected liposome size, typically a size of about 0.1 - 0.5 micrometers, is observed. The size of the liposomes can be calculated by quasi-elastic light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421 - 150 (1981), which is incorporated herein by reference. The average liposome diameter can be reduced by sonicating the formed liposomes. Intermittent sonication cycles can be alternated with QELS evaluation to lead to efficient liposome synthesis.

Example

[0192] While certain compounds, compositions, and methods of the invention have been specifically described according to certain embodiments, the following examples serve only to illustrate the compounds of the invention and are not intended to limit it.

[0193] Example 1. Formulation of mRNA-Loaded LNPs for Cancer Therapy This example provides exemplary mRNA-loaded lipid nanoparticles (LNPs) used in an in vivo efficacy test for cancer treatment.

[0194] As shown in Table 1, messenger RNAs encoding codon-optimized, wild-type, or mutant IL-2, IL-12, STING, GM-CSF, FLT-3L, NLRP3, or combinations thereof were prepared and encapsulated within LNPs containing cKK-E12. As a negative control, firefly luciferase (FFL) mRNA was encapsulated within the LNPs. [Table 1]

[0195] Example 2. Test Design for In Vivo Efficacy of mRNA-LNP in MC38 Mouse Model This example describes a test design for preclinically evaluating the in vivo therapeutic efficacy of mRNA-LNP in the treatment of a subcutaneous MC38 mouse colon cancer syngeneic mouse model.

[0196] MC-38 (mouse colorectal cancer cell line) tumors were subcutaneously transplanted into immunocompetent mice. Serum was collected 3 - 4 days before tumor inoculation and at the time of sacrifice. When the transplanted tumors grew to a size of 60 - 80 (mm 3 )(day 1, d1), various mRNA-LNPs prepared as described in Example 1 were injected intratumorally into the mice. As shown in Table 2, six injections were made over 20 days at 4-day intervals. Groups B and C were administered a single agent, while groups D - H were administered a combination of agents. Groups A and I were administered physiological saline and FFL mRNA-LNP, respectively, as negative controls. The mice were monitored, and tumor volume was measured throughout the study until day 46 or until the tumor size exceeded 3000 mm 3 . [Table 2]

[0197] Example 3. In Vivo Antitumor Efficacy of mRNA-LNP in MC38 Mouse Model This example demonstrates the in vivo efficacy of the mRNA-LNP prepared according to the present invention in reducing tumor size and inhibiting tumor growth.

[0198] Tumor volume was measured at the indicated time points as shown in Figure 1 and Table 3. The endpoint of the test was either death of the animal or the tumor volume reaching 3000 mm 3 .

[0199] Figure 1 shows that the average tumor volume of mice in groups B - H was significantly smaller than that of mice in group A or I. Most of the mice in groups A and I died before the end of the test or had a tumor volume exceeding 3000 mm 3 . At the end of the test (d46), the complete response (CR) rates were 100% in group B, 30% in group C, 90% in group D, 80% in group E, 90% in group F, 70% in group G, and 70% in group H (see Figures 5B - 5G). In particular, in mice of groups B - H, tumor growth was significantly delayed compared to the negative control. See Tables 3 - 6. Furthermore, the rate of change in body weight of groups B - H was significantly lower compared to group A or I (Figure 6).

Table 3

[0200] The average tumor volume of each group was compared with the control group (group A). Specifically, the tumor volume (T) of the test group was divided by the tumor volume (C) of the control group at each time point, and the percentage was plotted as shown in Figure 2. Furthermore, the inhibition rate of tumor volume was calculated for each group as follows: ((average(C) - average(T)) / average(C))×100%, and plotted as shown in Figure 3 and Table 4. The tumor volumes of each mouse in groups B - H measured on day 46 were plotted as shown in Figure 4. The average value of each group is shown.

Table 4

Table 5

Table 6

[0201] Overall, this example demonstrates that the mRNA-LNP prepared according to the present invention is effective in anti-tumor activity in vivo and cancer treatment.

[0202] μμ Example 4. In an animal model, administration of constitutively active STING mRNA encapsulated in lipid nanoparticles delays tumor growth and improves survival The effects of tumor growth and administration of lipid-encapsulated constitutively active STING mRNA on animals were evaluated. For these studies, MC38 tumor cells were inoculated into a mouse model (N = 10), and the cells were grown in the animal model to form tumors. Subsequently, lipid-encapsulated mRNA optimized for codons and containing constitutively active STING was administered to the animal model. The lipid nanoparticles were formulated using the cationic lipid of formula I (shown in the above description) and 1.5% PEG Animals received intratumoral doses of 5 μg of lipid-encapsulated mRNA every 4 days. Data from these tests are shown in Figure 7. As shown in Figure 7, animals administered constitutively active STING mRNA had less tumor growth compared to vehicle-only controls and compared to additional negative controls. These data indicate that administration of lipid-encapsulated constitutively active STING reduces tumor growth and delays the tumor growth profile. These data further indicate that lipid-encapsulated mRNA encoding constitutively active STING is a promising stand-alone therapeutic agent for cancer treatment.

[0203] Additional tests were performed using the above-described MC38 mouse tumor model to evaluate the survival of the animal model after administration of lipid-encapsulated constitutively active STING to the animals. For these tests, the test groups included: one group of animals was administered lipid-encapsulated constitutively active STING mRNA, and another group of mice was administered constitutively active STING mRNA in combination with a PD-1 monoclonal antibody. Data from these tests showed that administration of lipid-encapsulated constitutively active STING mRNA improved the survival of the animal model without adding the PD-1 monoclonal antibody (Figure 8). Considering the overall situation, these data indicate that administration of lipid-encapsulated constitutively active STING mRNA reduces and delays tumor growth and improves survival.

[0204] Equivalents One of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above description, but rather is as set forth in the following claims.

Claims

1. A pharmaceutical composition for treating cancer, comprising mRNA encoding stimulator of interferon genes (STING), wherein the mRNA is encapsulated in lipid nanoparticles comprising cationic lipids, non-cationic lipids, cholesterol-based lipids, and polyethylene glycol (PEG)-modified lipids.

2. The pharmaceutical composition of claim 1, wherein STING is a constitutively active mutant form.

3. 3. The pharmaceutical composition according to claim 1, wherein the cationic lipid, non-cationic lipid, cholesterol-based lipid, and PEG-modified lipid in the lipid nanoparticles are in a molar ratio of 30-60:25-35:20-30:1-15, respectively.

4. The PEG-modified lipid has a length of C 6 ~C 20 4. The pharmaceutical composition of claim 1, comprising a PEG chain of up to 5 kDa in length covalently attached to a lipid having an alkyl chain.

5. The pharmaceutical composition according to claim 4, wherein the molar ratio of the PEG-modified lipid is 1.5% to 2.5%.

6. Non-cationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl oleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dioleoyl ...

6. The pharmaceutical composition of claim 1, wherein the phosphatidylcholinesterase inhibitor is selected from the group consisting of 16-O-tolylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethylphosphatidylethanolamine, 18-1-transphosphatidyl-ethanolamine, and 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE).

7. The pharmaceutical composition of any one of claims 1 to 6, further comprising an additional mRNA encoding a checkpoint inhibitor.

8. 8. The pharmaceutical composition of claim 7, wherein the checkpoint inhibitor inhibits PD1, PD-L1, CTLA-4, B7, BTLA, HVEM, TIM-3, GAL-9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK1, CHK2, A2aR, or a combination thereof.

9. The pharmaceutical composition according to any one of claims 1 to 8, further comprising an additional mRNA encoding IL-12.

10. The pharmaceutical composition of any one of claims 1 to 8, comprising at least four mRNAs encoding STING, IL-12, FLT-3L and GM-CSF, respectively.

11. The pharmaceutical composition of any one of claims 1 to 8, comprising at least four mRNAs encoding STING, IL-12, NLRP3 and GM-CSF, respectively.

12. The pharmaceutical composition of any one of claims 1 to 8, comprising at least four mRNAs encoding STING, IL-12, IL-2 and GM-CSF, respectively.

13. 13. The pharmaceutical composition of any one of claims 1 to 12 for use in a method for treating cancer in a subject in need thereof, wherein the pharmaceutical composition is administered in an amount and at an interval effective to reduce tumor size or inhibit tumor growth.

14. 14. The pharmaceutical composition of claim 13, wherein the method comprises administering the pharmaceutical composition to the subject by intratumoral injection.

15. 15. The pharmaceutical composition of claim 13 or 14, wherein the cancer is a solid tumor, and optionally the solid tumor is head cancer, neck cancer, ovarian cancer, breast cancer, colon cancer, prostate cancer, liver cancer, glioma, melanoma, pancreatic cancer, testicular cancer, bladder cancer, lung cancer, sarcoma, squamous cell carcinoma, cervical cancer, gastrointestinal cancer, brain cancer, mesothelioma, renal cell carcinoma, or endometrial cancer.

Images