DNA detection substrate, fet-type DNA sensor including the same, and method for manufacturing DNA detection substrate

Abstract

To provide a DNA detection substrate that suppresses partial hybridization and enables high-precision detection.SOLUTION: A DNA detection substrate 10 according to the present invention comprises: a conductive base material 11; and a sensing layer 12 in which multiple functionalized nucleic acid probes 12a, each including a single-stranded nucleotide sequence complementary to a target single-stranded nucleotide sequence, are immobilized on a surface 11a of the conductive base material 11. The surface of the sensing layer has a nanoporous structure exhibiting nanoscale depressions in planar view as measured by atomic force microscopy. Each functionalized nucleic acid probe includes, at its terminal end, a water-soluble capping molecule that is larger in size than the single-stranded nucleotide sequence.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention relates to a DNA detection substrate, an FET type DNA sensor including the same, and a method for manufacturing the DNA detection substrate.

Background Art

[0002] A DNA sensor that detects DNA using a field effect transistor (FET) (hereinafter referred to as an "FET type DNA sensor") is known. The FET type DNA sensor utilizes the fact that DNA molecules have a negative charge in a solution, immobilizes probe DNA on the surface of a gate electrode or the surface of a gate insulating film, and detects a change in surface charge density caused by hybridization of the probe DNA and target DNA by means of the field effect.

Prior Art Documents

Patent Documents

[0003]

Patent Document 1

Patent Document 2

Patent Document 3

Non-Patent Documents

[0004]

Non-Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0005] In an FET type DNA sensor, it is desirable that even DNA containing one different nucleotide sequence from the target DNA is not misdetected.

[0006] The present invention has been made in view of the above circumstances, and an object thereof is to provide a DNA detection substrate that suppresses partial hybridization and enables highly accurate detection, an FET type DNA sensor including the same, and a method for manufacturing the DNA detection substrate.

Means for Solving the Problems

[0007] In order to solve the above problems, the present invention provides the following means.

[0008] Aspect 1 of the present invention includes a conductive substrate, and a sensing layer on the surface of the conductive substrate, on which a plurality of functionalized nucleic acid probes each including a single-stranded nucleotide sequence complementary to a target single-stranded nucleotide sequence are immobilized. The surface of the sensing layer has a nanoporous structure that exhibits recesses in the nm size in plan view in measurement by an atomic force microscope. The functionalized nucleic acid probe has a size larger than that of the single-stranded nucleotide sequence at its tip and has a water-soluble capping molecule, and is a DNA detection substrate.

[0009] Aspect 2 of the present invention is the DNA detection substrate according to Aspect 1, wherein the average size (average diameter) of the recesses is 10 nm or more and 100 nm or less.

[0010] Aspect 3 of the present invention is the DNA detection substrate according to either Aspect 1 or Aspect 2, wherein the average depth of the recesses is 0.5 nm or more and 2 nm or less.

[0011] Aspect 4 of the present invention is the DNA detection substrate according to any one of Aspects 1 to 3, wherein the capping molecule is one selected from the group consisting of fluorescein, rhodamine, pyrazinacene, and porphyrin.

[0012] Aspect 5 of the present invention is an FET type DNA sensor including the DNA detection substrate according to any one of Aspects 1 to 4.

[0013] Aspect 6 of the present invention is a method for manufacturing a DNA detection substrate according to any one of Aspects 1 to 4, the method comprising: a step of preparing a functionalized nucleic acid probe; a pre-hybridization step of once hybridizing a target single-stranded nucleotide sequence and a single-stranded nucleotide sequence of the functionalized nucleic acid probe; a step of immobilizing the functionalized nucleic acid probe on a conductive substrate; and a de-hybridization step of de-hybridizing the double-stranded DNA paired in the pre-hybridization step.

Advantages of the Invention

[0014] According to the DNA detection substrate of the present invention, it is possible to provide a DNA detection substrate that suppresses partial hybridization and enables highly accurate detection.

Brief Description of the Drawings

[0015]

Figure 1

Figure 2

Figure 3

Figure 4A

Figure 4B

Figure 4C

Figure 4D

Figure 5

Figure 6A

Figure 6B

Figure 6C

Figure 7A

Figure 7B

Figure 8

Figure 9A

Figure 9B

Figure 9C

Mode for Carrying Out the Invention

[0016] Hereinafter, the present invention will be described in detail with appropriate reference to the drawings. The drawings used in the following description may show the characteristic parts enlarged for the sake of easy understanding of the characteristics, and the dimensional ratios of each component may be different from the actual ones. The dimensions and the like exemplified in the following description are merely examples, and the present invention is not limited thereto, and can be appropriately modified and implemented within the scope where the effects of the present invention are achieved. Hereinafter, unless otherwise specified, the configuration described in one embodiment may be applied to other embodiments.

[0017] (DNA Detection Substrate and FET-Type DNA Sensor Comprising the Same) FIG. 1 is a schematic cross-sectional view of a DNA detection substrate for an FET-type DNA sensor according to an embodiment of the present invention. FIG. 2 is a diagram showing an example of a functionalized nucleic acid probe. FIG. 3 is a schematic cross-sectional view showing an example of the overall configuration of an FET-type DNA sensor including the DNA detection substrate shown in FIG. 1 as a sensing unit.

[0018] The DNA detection substrate 10 for the FET-type DNA sensor shown in FIG. 1 includes a conductive substrate 11 and a sensing layer 12 in which a plurality of functionalized nucleic acid probes 12a each containing a single-stranded nucleotide sequence complementary to the target single-stranded nucleotide sequence are immobilized on the surface 11a of the conductive substrate 11. Here, the "single-stranded nucleotide sequence" is a single-stranded DNA fragment or RNA fragment having a predetermined nucleotide sequence, and the "complementary single-stranded nucleotide sequence" of the functionalized nucleic acid probe 12a is designed such that the "target single-stranded nucleotide sequence" and its predetermined nucleotide sequences can be bonded to each other by hydrogen bonds.

[0019] Examples of the material of the conductive substrate 11 include metals such as gold (Au), silver (Ag), platinum (Pt), palladium (Pd), aluminum (Al), chromium (Cr), and titanium (Ti), a structure in which these metals are laminated (for example, an Au layer formed on a Cr plate), and a semiconductor such as doped silicon.

[0020] The functionalized nucleic acid probe has, at its tip, a size larger than that of the single-stranded nucleotide sequence and a water-soluble capping molecule. Here, when comparing the "sizes" of the "single-stranded nucleotide sequence" and the "capping molecule", the radius of gyration of the molecule can be used. The radius of gyration can be determined by experimental methods such as the light scattering method, small-angle neutron scattering, small-angle X-ray scattering, etc., or by various simulations (see, for example, Patent Document 2, Patent Document 3, and Non-Patent Document 1). Let the radius of gyration of the "single-stranded nucleotide sequence" be R GN and the radius of gyration of the "capping molecule" be R GC Then, R GC / R GN is, for example, greater than 1 and less than or equal to 10. The lower limit of R GC / R GN can be 1.5, or can be 2. Also, the upper limit of R GC / R GN can be 8, or can be 7, or can be 6, or can be 5.

[0021] Figure 2 is a diagram showing an example of a functionalized nucleic acid probe. The functionalized nucleic acid probe 12a has, at its tip (the end opposite to the end that binds to the conductive substrate 11), a capping molecule 1 having a size larger than that of the predetermined single-stranded nucleotide sequence 3. The capping molecule 1 has a function of blocking molecules that are not the target single-stranded nucleotide sequence to be detected from approaching the nucleotide sequence 3 in the functionalized nucleic acid probe 12a, and in that sense, it may be referred to as a blocking molecule hereinafter. By having the capping molecule 1, the functionalized nucleic acid probe 12a suppresses partial hybridization and has high selectivity. Also, the capping molecule 1 is water-soluble.

[0022] The capping molecule 1 is not particularly limited as long as it is larger in size than the nucleotide sequence 3 of the functionalized nucleic acid probe 12a and is water-soluble. Examples include chromophores (fluorescein-based, rhodamine-based), pyrazinacene, porphyrin, and the like. A capping molecule that inhibits partial hybridization due to steric hindrance is selected. In the example shown in Fig. 2, fluorescein amidite (FAM) is selected as the capping molecule 1. FAM is selected for its pH sensitivity rather than fluorescence and is suitable for inhibiting partial hybridization due to steric hindrance.

[0023] The single-stranded nucleotide sequence 3 is a part that bears the recognition function of a molecule where pairing with a complementary target single-stranded nucleotide sequence occurs. The single-stranded nucleotide sequence 3 is a synthetic (including chemical synthesis or recombinant synthesis) or natural isolated single-stranded deoxyribonucleic acid (DNA) or single-stranded ribonucleic acid (RNA), and may hereinafter be referred to as ssDNA or ssRNA, respectively. The length is at least 10 nt to 80 nt. The probe nucleic acid and the target nucleic acid can have the same length or a comparable length. The result shown in Fig. 4 described later is an example of ssDNA with a length of 23 nt.

[0024] In order to chemically bond and immobilize the functionalized nucleic acid probe 12a to the conductive substrate 11, the 5'-end or 3'-end of the nucleotide sequence 3 is modified at the bonding portion 4. The bonding portion 4 is designed to have a chemical bond using a conjugation chemistry method such as a thiol-gold bond (coupling), a biotin-avidin bond, a cysteine-maleimide bond, a click chemistry cross-linking bond, a gold or substance-binding peptide, a covalent bond between proteins by SpyTag-SpyCatcher technology, or an antibody-antigen bond between the conductive substrate 11. In the example shown in Fig. 2, the bonding portion 4 has a thiol group for a thiol-gold bond.

[0025] The linker part 2 is a part that connects the capping molecule 1 and the nucleotide sequence 3, and there are no particular limitations. For example, it may be composed of at least one of carbon (C), nitrogen (N), oxygen (O), and sulfur (S), and preferably composed of carbon (C). The linker part 2 can be composed of 2 to 20 or more atoms, and preferably composed of 6 atoms.

[0026] The FET-type DNA sensor 100 shown in FIG. 3 includes a sensing unit 10A that detects a DNA fragment or an RNA fragment to be detected, and a detection unit 20 that converts the information detected by the sensing unit 10A into an electrical signal by the action of a field effect transistor (FET) and detects it. The FET-type DNA sensor 100 is used by being immersed in a sample solution 50. A DNA detection substrate 10 can be used as the sensing unit 10A. The FET-type DNA sensor 100 detects the DNA to be detected contained in the sample solution 50 in the sensing unit 10A, and by converting the detected information into an electrical signal by the detection unit 20, the presence and concentration of the DNA to be detected in the sample solution can be detected. The FET-type DNA sensor 100 is supported by a support substrate 40.

[0027] The FET-type DNA sensor 100 shown in FIG. 3 includes the configuration of a field effect transistor (source electrode, drain electrode, gate electrode), but the configuration of the field effect transistor is not limited to the configuration in which the source electrode, drain electrode, and gate electrode as shown in FIG. 3 are arranged on the same plane (coplanar type), and a configuration with a known configuration can be used. For example, in terms of the configuration focusing on the gate electrode, in addition to the coplanar gate type configuration, a top gate type configuration, a bottom gate configuration, etc. can be adopted.

[0028] The sensing unit 10A includes a conductive substrate 11 as a gate electrode, and a sensing layer 12 in which a plurality of functionalized nucleic acid probes 12a containing a single-stranded nucleotide sequence complementary to the single-stranded nucleotide sequence to be detected are immobilized on the surface 11a of the conductive substrate 11.

[0029] The detection unit 20 is electrically connected to the sensing unit 10A, and is an element that detects a change in the charge density on the gate electrode 11A resulting from the hybridization of the single-stranded nucleotide sequence to be detected and the complementary single-stranded nucleotide sequence of the sensing unit 10A. The detection unit 20 includes a source electrode 31 and a drain electrode 32 formed on the surface of a semiconductor substrate (semiconductor layer) 30, and a gate insulating film 33 formed thereon.

[0030] The material of the semiconductor substrate 30 is not particularly limited, and known semiconductors such as Si, organic semiconductors, carbon semiconductors (for example, carbon nanotubes, graphene semiconductors, etc.) can be appropriately selected and used.

[0031] The gate insulating film 33 is provided on the surface of the portion of the semiconductor substrate 30 sandwiched between the source electrode 31 and the drain electrode 32, and can be formed of an oxide or nitride such as SiO2, Si3N4 (SiNx), Ta2O5, Al2O3, etc. The gate insulating film 33 may be formed of a plurality of insulating films.

[0032] The source electrode 31 and the drain electrode 32 are electrically connected to a power source 41 and a current meter 42, and are configured to measure the drain current I SD flowing from the source electrode 31 to the drain electrode 32.

[0033] When the charge density on the gate electrode 11A changes, the magnitude of the drain current I SD changes through the conductive sample solution 50 and the gate insulating film 33. By detecting this change in the drain current I SD , the change in the charge density on the gate electrode 11A can be electrically measured. Also, the drain current ISD While keeping it constant, as the charge density on the gate electrode 11A changes, the gate voltage V G is changed, and by measuring the change in this gate voltage V G , the change in the charge density on the gate electrode 11A may be electrically measured.

[0034] (Method for manufacturing a DNA detection substrate) Fig. 4A shows the steps of the method for manufacturing a DNA detection substrate according to the present invention. In the DNA detection substrate shown in Fig. 4A, an example is shown in which a functionalized nucleic acid probe having a fluorescein amidite (FAM) as a capping molecule at the tip of a single-stranded nucleotide sequence (ssDNA) having a length of 23 nt and a thiol group at its end is used. Such a functionalized nucleic acid probe can be used by immobilizing a commercially available molecule on a conductive substrate.

[0035] (1) Step of purifying the functionalized nucleic acid probe (purification step) The free functionalized nucleic acid probe is dissolved in a buffer containing an arbitrary combination of salts. The buffer may contain salts such as Nalco or KC1, a pH buffer, Tris-HCl, polyvalent cation cofactors such as Mg, Mn, Ca, Co, Zn, Ni, Fe or Cu, or other ions, surfactants such as Tween, chelating agents such as EDTA, reducing agents such as DTT or TCEP, and solvents such as betaine or DMSO in any combination. Volume condensing agents such as PEG, and other components typical of buffers used for polymerase enzymes in molecular biology applications, are known to those skilled in the field of molecular biology. As exemplified, when one end of ssDNA or ssRNA is modified with a thiol functional group, immediately before use, it is treated with DTT at a temperature higher than the melting temperature of the selected ssDNA at the same concentration for 5 to 60 minutes (preferably 10 minutes) to cleave the existing disulfide bonds, and desalted and purified using a size exclusion chromatography column equilibrated with the selected buffer.

[0036] (2) Step of prehybridizing the complementary target ssDNA and the ssDNA of the functionalized nucleic acid probe (prehybridization step) 1 to 10 μM (preferably 1 to 5 μM, more preferably 1 to 3 μM, even more preferably 2 μM) of the DTT-treated, desalted, purified, and chemically modified ssDNA in buffer and 1 to 10 μM (preferably 1 to 5 μM, more preferably 1 to 3 μM, even more preferably 2 μM) of the complementary target ssDNA in buffer are mixed at 30°C to 60°C (preferably 45°C) for 30 to 240 minutes (preferably 60 minutes) to obtain a double-stranded DNA probe. This step is performed before the incubation. The scanning electron microscope (SEM) image of the sensing layer surface indicated by reference sign A in Fig. 4A is an example in which the step (2) was performed at 45°C for 1 hour using PBS diluted 100-fold.

[0037] (3) Step of immobilizing the functionalized nucleic acid probe on the conductive substrate (incubation step) As the conductive substrate, one made of the material as described above can be used. In this example, an example using an Au substrate will be described. Incubate at a temperature of 20°C to 50°C (preferably 25°C) for 1 to 48 hours (preferably 18 to 36 hours, more preferably 24 hours) in a buffer at a concentration of 1 to 10 μM (preferably 1 to 5 μM, more preferably 1 to 3 μM, even more preferably 2 μM). The SEM image indicated by reference sign A in Fig. 4A is an example in which the step (3) was performed at 25°C for 24 hours using PBS diluted 100-fold.

[0038] (4) Step of performing dehybridization of the double-stranded DNA probe (dehybridization step) (3) After the immobilization process, first, the substrate is rinsed with deionized (DI) water to remove double-stranded DNA probes not immobilized on the Au substrate. Then, it is incubated in pure water at 50 - 100 °C (preferably 70 °C) for 60 - 300 minutes (preferably 120 minutes) to release the hybrids of the double-stranded DNA probes, forming a sensing layer on which multiple single-stranded DNA probes (functionalized nucleic acid probes) are immobilized, and a DNA detection substrate as shown in Fig. 1 is obtained. The surface of the sensing layer thus obtained has a structure with nm-sized depressions in plan view (hereinafter sometimes referred to as a "nanoporous structure"). The SEM image indicated by symbol A in Fig. 4A is an example in which the process of (4) was carried out at 80 °C for 2 hours using deionized water.

[0039] Adjust the average size (average diameter) of the depressions to be 10 nm or more and 100 nm or less. The lower limit of the average size of these depressions may be 15 nm, and the upper limit may be 80 nm. Also, adjust the average depth of the depressions to be 0.5 nm or more and 2 nm or less. The upper limit of the average depth of the depressions may be 1.5 nm, or 1 nm.

[0040] As described above, what is indicated by symbol A in Fig. 4A is an SEM image of the surface of the sensing layer. The scanning electron microscope used was an SEM S-4800 (manufactured by Hitachi, Ltd.), and the observation was carried out at 5 - 10 kV. As will be described later, when the surface of the sensing layer is measured in tapping mode using AFM, the functionalized nucleic acid probes are arranged and immobilized so as to have a nanoporous structure showing depressions with a diameter of about several tens of nm and a depth of about 1 nm.

[0041] The manufacturing method shown in Fig. 4B is an example of obtaining a substrate obtained by performing the steps (1) to (3) in Fig. 4B using a single-stranded DNA probe that differs from the manufacturing method of Fig. 4A in that it does not have fluorescein amidite (FAM) as a capping molecule at the tip of a single-stranded nucleotide sequence (ssDNA) with a length of 23 nt. In this example, the step (1) is a prehybridization step, the step (2) is an incubation step, and the step (3) is a dehybridization step. The step (1) was performed at 45°C for 1 hour using PBS diluted 100-fold, the step (2) was performed at 25°C for 24 hours using PBS diluted 100-fold, and the step (3) was performed at 80°C for 2 hours using deionized water. What is indicated by the symbol B in Fig. 4B is the SEM image of the obtained substrate surface. It can be seen from the SEM image that the single-stranded DNA probes are aggregated and in a lump shape.

[0042] In the manufacturing method shown in Fig. 4C, the same single-stranded DNA probe as in the manufacturing method of Fig. 4A was used, but it differed from the manufacturing method of Fig. 4A in that the prehybridization step and the dehybridization step in Fig. 4A were not performed. In this example, the step (1) in Fig. 4C is an incubation step, and this step was performed at 25°C for 24 hours using PBS diluted 100-fold. What is indicated by the symbol C in Fig. 4C is the SEM image of the obtained substrate surface. It seems from the SEM image that the single-stranded DNA probes are randomly stacked on the substrate to form a single-stranded DNA probe layer.

[0043] In the manufacturing method shown in Fig. 4D, similar to the manufacturing method shown in Fig. 4B, a single-stranded DNA probe was used that differed from the manufacturing method of Fig. 4A in that it did not have fluorescein amidite (FAM) as a capping molecule at the tip of the 23-nt single-stranded nucleotide sequence (ssDNA). Also, similar to the manufacturing method shown in Fig. 4C, the pre-hybridization step and the de-hybridization step in Fig. 4A were not performed. In this example, the step (1) in Fig. 4C was an incubation step, and this step was performed at 25 °C for 24 hours using PBS diluted 100-fold. What is indicated by the symbol D in Fig. 4D is the SEM image of the obtained substrate surface. From the SEM image, it can be seen that the aggregated single-stranded DNA probes are scattered on the substrate.

[0044] It was found that in the manufacturing methods shown in Figs. 4B to 4D, a sensing layer having a nanoporous structure was not formed on the surface.

[0045] Fig. 5 is a conceptual diagram showing an example of detecting the change in the charge density on the gate electrode surface as a change in the characteristics of the FET-type DNA sensor's gate voltage V G -drain current I SD characteristics. With a constant voltage V SD applied between the source electrode and the drain electrode, the gate voltage V G is gradually increased, and attention is paid to the magnitude of the drain current I SD flowing through the semiconductor substrate 30. The field-effect transistor can take two states, ON and OFF. Before hybridization, the I SD -V G characteristics are the characteristics shown by the symbol C1 in Fig. 5, where the gate voltage V G <V th1 is OFF, and the gate voltage V G >V th1 is ON. V th1 is defined as the threshold voltage, which is the minimum gate voltage required for the semiconductor layer to have conductivity. V th1 is sensitive to chemical changes in the system.

[0046] In a buffer solution, since DNA fragments are negatively charged, when hybridization occurs at the gate electrode 11A, the charge density on the surface of the gate electrode changes. Accordingly, the I SD -V G characteristic becomes the characteristic indicated by reference symbol C2 in FIG. 5, and the threshold voltage shifts by ΔV with respect to V th1 and becomes V th2 . Since the shift amount ΔV of the threshold voltage depends on the change in the charge density on the surface of the gate electrode, hybridization can be evaluated by measuring ΔV.

Example

[0047] Hereinafter, the present invention will be described by way of examples, but the present invention is not limited to the following examples.

[0048] (Fabrication of FET-Type DNA Sensor) Regioregular P3HT (molecular weight: 27,000 - 45,000) was dissolved in dichlorobenzene at a concentration of 10 mg / mL, and deposited by spin coating on the drain-source channel region of the comb-shaped gold electrode of an electrode substrate (manufactured by Tromedrop Sense Co., Ltd.) having a coplanar gate and a comb-shaped gold electrode with a 30-μm band / gap dimension. Then, it was annealed at 800°C for 1 hour under vacuum to form the semiconductor layer 30 (see FIG. 3).

[0049] Next, a 23-nt ssDNA (manufactured by IDT (Integrated DNA Technologies), T1 "ATCGCGTATACGGCTAATCGAAA") having fluorescein amidite (FAM) as a capping molecule at the tip and a thiol group at its end was diluted with 100 μM PBS to a concentration of 20 μM, and mixed with dithiothreitol (100 μL at 20 μM) at 45°C for 10 minutes to cleave the disulfide bond. Subsequently, the solution was purified through a NAP-10 column (manufactured by Cytiva). Next, the ssDNA probe solution (30 μL at 1.33 μM) was dropped onto the gate electrode of the FET and incubated at 25°C for 24 hours. The FET was rinsed with deionized water and then incubated in deionized water at 80°C for 2 hours to remove impurities.

[0050] <Selectivity evaluation> Figures 6A to 6C are conceptual diagrams of a solution containing no DNA fragment (PBS only) as a reference, a solution containing a competitive ssDNA with only one nucleotide different from T1 "ATCGCGTATACGGCTAATCGAAA", and a solution containing the ssDNA of the competitive ssDNA and T1 "ATCGCGTATACGGCTAATCGAAA", respectively. Also, Figures 7A and 7B show the results of evaluating the selectivity of the obtained FET-type DNA sensor (see Figure 4A) and the results of evaluating the selectivity of the conventional FET-type DNA sensor obtained by the manufacturing method of Figure 4D, respectively. The I SD -V G characteristic curves are, in order from the left, the results of measurement in the solution shown in Figure 6A, then incubation in the solution shown in Figure 6B, followed by vigorous washing with deionized water, addition of PBS, and I SD -V G measurement. The results of repeating the same steps with a competitive ssDNA pool to which the target ssDNA was added and then performing I SD -V G measurement are shown.

[0051] In Figure 7A, the middle I SD -V GIn the characteristic curve, the threshold voltage has not shifted, but the I on the right side SD -V G In the characteristic curve, the threshold voltage has shifted. This is the result of the fact that the FET-type DNA sensor of the present invention is suppressed from causing partial hybridization with a competing ssDNA having only one different nucleotide, and hybridization occurs with a target ssDNA having a completely matching nucleotide sequence.

[0052] In FIG. 7B, the middle I SD -V G characteristic curve and the right-side I SD -V G In both characteristic curves, the threshold voltage has shifted. This is the result of partial hybridization occurring between the conventional FET-type DNA sensor and a competing ssDNA having only one different nucleotide, and hybridization occurring with both the competing ssDNA and the target ssDNA.

[0053] Thus, partial hybridization, which occurred in the conventional FET-type DNA sensor, was suppressed in the FET-type DNA sensor of the present invention.

[0054] FIG. 8 shows the results of evaluating the selectivity of the FET-type DNA sensor (A) of the present invention and the conventional FET-type DNA sensor (D) by the selectivity S defined by the following formula (1). The error bars are the standard deviations of three measurement cycles.

[0055]

Equation

[0056] In the formula, V th0 is the threshold voltage obtained by extrapolating the I SD -V G characteristic curve obtained in the solution shown in FIG. 6A, and V th1 is the threshold voltage obtained by extrapolating the I SD -V G characteristic curve obtained in the solution shown in FIG. 6B, and V th2I obtained from the solution shown in FIG. 6C SD -V G is the threshold voltage obtained by extrapolating the characteristic curve. The closer the selection ratio S is to 100%, the better the discrimination of the target ssDNA from the background. On the other hand, as the selection ratio S approaches 0%, it becomes difficult to discriminate the target ssDNA from the background.

[0057] FIGS. 9A to 9C are diagrams showing a typical AFM image of the surface of the sensing layer measured in the tapping mode of an atomic force microscope (SPI-4000, manufactured by Hitachi High-Technologies Corporation) and the result of a line scan for examining the depth of the recesses visible in the AFM image. The AFM measurement in the tapping mode was performed under the conditions of T = 3.8 μm, W = 28 μm, L = 125 μm, C = 29 N / m, and f = 283 kHz.

[0058] From the results shown in FIGS. 9A to 9C, the average size (average diameter) of the recesses was 49.1 μm ± 11.1 μm, and the average depth of the recesses was 1.06 nm ± 0.16 nm.

Explanation of Symbols

[0059] 1 Capping molecule 3 Single-stranded nucleotide sequence 10 DNA detection substrate 10A Sensing part 11 Conductive substrate 11A Gate electrode 12 Sensing layer 12a Functionalized nucleic acid probe 20 Detection part 30 Semiconductor substrate (semiconductor layer) 31 Source electrode 32 Drain electrode 100 FET type DNA sensor

Claims

1. A conductive substrate, and a sensing layer in which a plurality of functionalized nucleic acid probes each containing a single-stranded nucleotide sequence complementary to a target single-stranded nucleotide sequence are immobilized on the surface of the conductive substrate. The surface of the sensing layer has a nanoporous structure showing recesses in the size of nm in plan view in measurement by an atomic force microscope. The functionalized nucleic acid probe has, at its tip, a size larger than the single-stranded nucleotide sequence and a water-soluble capping molecule, and is a DNA detection substrate.

2. The DNA detection substrate according to Claim 1, wherein the average size of the recesses is 10 nm or more and 100 nm or less.

3. The DNA detection substrate according to Claim 2, wherein the average depth of the recesses is 0.5 nm or more and 2 nm or less.

4. The DNA detection substrate according to Claim 1, wherein the capping molecule is one selected from the group consisting of fluorescein, rhodamine, pyrazinacene, and porphyrin.

5. An FET-type DNA sensor comprising the DNA detection substrate according to any one of Claims 1 to 4.

6. A method for manufacturing the DNA detection substrate according to any one of Claims 1 to 4, comprising: a step of preparing a functionalized nucleic acid probe; a pre-hybridization step of once hybridizing a target single-stranded nucleotide sequence and a single-stranded nucleotide sequence possessed by the functionalized nucleic acid probe; a step of immobilizing the functionalized nucleic acid probe on a conductive substrate; and a de-hybridization step of de-hybridizing the double-stranded DNA paired in the pre-hybridization step.

Images