Method for modifying target site of double-stranded DNA possessed by cell

Abstract

To provide a method for modifying target site of double-stranded DNA possessed by a cell.SOLUTION: The present invention provides a method for modifying a target site of double-stranded DNA in a cell, the method comprising contacting a donor DNA containing a complex in which a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in a selected double-stranded DNA and a nucleobase converting enzyme or DNA glycosylase are bound, and a donor DNA containing an insertion sequence with the DNA, and replacing the target site with the insertion sequence or inserting the insertion sequence into the target site without cleaving at least one strand of the double-stranded DNA at the target site.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a method for modifying double-stranded DNA that enables modification of a target site within a specific region of double-stranded DNA possessed by a cell without double-strand cleavage of DNA (either without cleavage or with single-strand cleavage) using homologous recombination. using homologous recombination, which enables modification of a target site within a specific region of double-stranded DNA possessed by a cell.

Background Art

[0002] CRISPR (clustered regularly interspaced short palindromic repeats) and CRISPR associated (Cas) proteins are known to function as an adaptive immune system in bacteria by cleaving target DNA in a single-guide RNA (sgRNA)- and protospacer adjacent motif (PAM)-dependent manner. Cas9 nuclease derived from Streptococcus pyogenes has been widely used as a powerful genome editing tool in eukaryotes having a DNA double-strand break (DSB) repair pathway (for example, Non-Patent Document 1 and 2). During the repair of DSBs by the non-homologous end joining (NHEJ) pathway, small insertions and / or deletions (indels) are introduced into the target DNA, resulting in site-specific mutations or gene disruptions. Although the efficiency depends on the host cell, homologous recombination repair (HDR) can be promoted by providing donor DNA containing homologous arms for the target region for more accurate editing. However, in the above conventional methods, along with the cleavage of double-stranded DNA, unexpected genome modifications are involved Therefore, there are common problems such as strong cytotoxicity and side effects such as chromosomal translocations, which impair the reliability in gene therapy and result in extremely few viable cells due to nucleotide modifications. Also, homologous recombination using Cas9 nickase (nCas9) has been reported (Non-Patent Document References 1 and 2), the recombination induction efficiency is often very low compared to Cas9 nuclease (Non-Patent Document 3). Further, as far as the present inventors know, homologous recombination using Cas9 (dCas9) in which both nuclease activities are inactivated has not been reported.

[0003] Recently, base editing mediated by deaminase that directly edits nucleotides at the target gene locus without using donor DNA containing a homology arm for the target region has been demonstrated (for example, Patent Document 1, Non-Patent Documents 4 to 6). Since this technology utilizes DNA deamination instead of DNA cleavage mediated by nuclease, it has low toxicity to cells and can introduce mutations pinpointedly.

Prior Art Documents

Patent Documents

[0004]

Patent Document 1

Non-Patent Documents

[0005]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Summary of the Invention

Problems to be Solved by the Invention

[0006] However, since this technique uses deaminase, there are restrictions on the types of mutations that can be introduced and the mutation sites. Also, it was impossible to switch the orientation or combination of genes, or to knock in gene fragments. Therefore, an object of the present invention is to provide a novel DNA modification technique using a nucleic acid base-converting enzyme such as deaminase or DNA glycosylase that can switch the orientation or combination of genes and knock in gene fragments without being restricted by the types of mutations and mutation sites that can be introduced.

Means for Solving the Problems

[0007] For dividing cells, a particularly serious form of DNA damage is a disorder in which both strands of the DNA double strand are cleaved. As mechanisms for repairing this disorder, homologous recombination and non-homologous end joining are known. On the other hand, in the case of damage to one strand of the DNA double strand, mainly base excision repair, which is a mechanism for repairing damage caused by alkylation and deamination, and nucleotide excision repair (NER), which is a repair mechanism for relatively large-scale damage that distorts the double strand and extends over dozens of base pairs, are used for repair. Although the ratio etc. have not been verified, it is also known that complementary strand repair is induced even when one strand of the DNA double strand is damaged. are known.

[0008] However, the degree of the activity of complementary strand repair for base excision repair has not been sufficiently verified, and DNA editing by homologous recombination using base excision repair has not been actively carried out. Thus, as far as the present inventors are aware, there has been no such report on DNA editing. Under such circumstances, the present inventors considered that by causing deamination or depurination in intracellular DNA using a nucleobase conversion enzyme, complementary strand repair could be induced, and that homologous recombination-based DNA recombination might be achievable by contacting donor DNA with this DNA at this time. As a result of proceeding with research based on this concept, it was found that by contacting a complex in which a nucleic acid sequence recognition module and a nucleobase conversion enzyme are bound, and donor DNA containing an insertion sequence, with target DNA, homologous recombination of DNA is possible while suppressing cytotoxicity to cells. Moreover, in a preferred embodiment, surprisingly, homologous recombination activity close to 100% occurs at the target site. As a result of further research based on these findings, the present inventors completed the present invention.

[0009] That is, the present invention is as follows. [1] A method for modifying a target site of double-stranded DNA possessed by a cell, comprising contacting a complex in which a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in a selected double-stranded DNA and a nucleobase conversion enzyme or DNA glycosylase are bound, and donor DNA containing an insertion sequence, with the double-stranded DNA, and replacing the target site with the insertion sequence or inserting the insertion sequence into the target site without cleaving at least one strand of the double-stranded DNA at the target site. [2] The method according to [1], wherein the donor DNA contains a sequence homologous to an adjacent region of the target site. [3] The method according to [1] or [2], wherein the nucleic acid sequence recognition module is selected from the group consisting of a CRISPR-Cas system in which the DNA cleavage ability of at least one of Cas effector proteins is inactivated, a zinc finger motif, a TAL effector, and a PPR motif. [4] The method according to any one of [1] to [3], wherein the nucleic acid sequence recognition module is a CRISPR-Cas system in which only one of the two DNA cleavage abilities of the Cas effector protein is inactivated. The method according to any one of the above. [5] The method according to any one of [1] to [3], wherein the nucleic acid sequence recognition module is a CRISPR-Cas system in which both DNA cleavage abilities of the Cas effector protein are inactivated. [6] The method according to any one of [1] to [5], wherein the nucleic acid base conversion enzyme is a deaminase. [7] The method according to [6], wherein the deaminase is a cytidine deaminase. [8] The method according to [7], wherein the cytidine deaminase is PmCDA1. [9] The contact between the double-stranded DNA and the complex is carried out by introducing a nucleic acid encoding the complex into the cell. The method according to any one of [1] to [8].

[10] The method according to any one of [1] to [9], wherein the cell is a prokaryotic cell or a eukaryotic cell.

[11] The method according to

[10] , wherein the cell is a microbial cell.

[12] The method according to

[10] , wherein the cell is a plant cell, an insect cell or an animal cell.

[13] The method according to

[12] , wherein the animal cell is a vertebrate cell.

[14] The method according to

[13] , wherein the vertebrate cell is a mammalian cell. [Advantages of the Invention]

[0010] According to the present invention, there is provided a novel DNA modification technique using a nucleic acid base conversion enzyme such as a deaminase or a DNA glycosylase, which can switch the orientation and combination of genes or knock in gene fragments without being restricted by the type and site of mutations that can be introduced, and can modify a target site without cleaving double-stranded DNA. Therefore, the unexpected rearrangement and toxicity associated with cleavage can be suppressed to a low level, and the target site can be modified much more efficiently than conventional methods.

Brief Description of the Drawings

[0011]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

[0012] The present invention relates to a method for the preparation of double-stranded DNA (e.g., chromosomal DNA, mitochondrial DNA, The present invention relates to a method for producing a target DNA by inserting a target sequence contained in a foreign donor DNA into a target region of a double-stranded DNA (e.g., chloroplast DNA; hereinafter, these are collectively referred to as "genomic DNA"), without cleaving at least one of the strands of the double-stranded DNA. The present invention provides a method for modifying a target site of a double-stranded DNA (hereinafter, may be abbreviated as "the method of the present invention"). The method comprises the step of: and nucleic acid base conversion enzyme or DNA glycosylase (hereinafter referred to as "nucleic acid base conversion enzyme, etc."). The method includes contacting the double-stranded DNA with a complex in which the double-stranded DNA is bound to the inserted DNA (which may be a donor DNA containing an insertion sequence).

[0013] In the present invention, "modification" of double-stranded DNA means that a certain nucleotide (e.g., dA, dC, dG, or dT) or nucleotide sequence on the DNA strand is replaced with another nucleotide or nucleotide sequence, or that another nucleotide or nucleotide sequence is inserted between certain nucleotides on the DNA strand. Here, the double-stranded DNA to be modified is not particularly limited, but is preferably genomic DNA.

[0014] In the present invention, "donor DNA" means DNA containing an exogenous insertion sequence, and the donor DNA usually contains two types of sequences (hereinafter also referred to as "homology arms") that are homologous to the sequences of two regions (hereinafter also referred to as "adjacent regions") on the upstream and downstream sides of the target site, adjacent to the target site. When distinguishing each homology arm, it may be distinguished as a "5' homology arm" and a "3' homology arm". Further, the "target site" of double-stranded DNA means a region to be replaced with the insertion sequence contained in the donor DNA, or the nucleotides between which the insertion sequence is to be inserted, and the adjacent sequences are not included in the target site.

[0015] The sequence homologous to the adjacent region of the target site is not only a completely identical sequence, but also a sequence having an identity of preferably 80% or more (e.g., 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more) with respect to the completely identical sequence as long as homologous recombination can occur in the cell.

[0016] The insertion sequence may contain, as necessary, a drug resistance gene (e.g., kanamycin resistance gene, ampicillin resistance gene, puromycin resistance gene, etc.), a thymidine kinase gene, a diphtheria toxin gene, etc., a selection marker sequence, a green fluorescent protein (GFP), a red fluorescent protein gene, a β-glucuronidase (GUS), a FLAG, etc., a reporter gene sequence, etc. This can be achieved. Also, before and after these genes, they may have LoxP sequences, FRT sequences, or transposon-specific terminal inverted sequences (PiggyBac Terminal Repeat) so that these genes can be excised after cell sorting or the like is completed. Preferred transposons include, for example, piggyBac, which is a transposon derived from Lepidoptera insects (Kaji, K. et al., Nature, 458: 771-775 (2009), Woltjen et al., Nature, 458: 766-770 (2009), WO 2010 / 012077). Alternatively, as described in Oji A et al., Sci Rep, 6: 31666 (2016), an expression vector containing the above drug resistance gene may be co-introduced and transient (for about several days) drug selection may be performed. Whether the inserted sequence is inserted into the target site or replaced with the target site can be confirmed by, in addition to decoding the sequence, screening the chromosomal DNA isolated and extracted from cells by Southern hybridization or PCR method. When the above drug resistance gene or the like is present in the donor DNA, it can also be confirmed using their expression as an indicator.

[0017] The donor DNA may be linear (e.g., synthetic double-stranded DNA), circular (e.g., plasmid DNA), single-stranded DNA (e.g., single-stranded oligodeoxynucleotide (ssODN)), or double-stranded DNA. The donor DNA can be appropriately designed according to the base length of the inserted sequence, the homologous recombination activity of the host cell, etc. For example, when the length of the inserted sequence is 100 bases or less, usually ssODN or synthetic double-stranded DNA is used, and when it is longer than that, usually synthetic double-stranded DNA or plasmid DNA is used. The length of the donor DNA is not particularly limited and can be appropriately designed according to the length of the inserted sequence, etc. The length of the inserted sequence is not particularly limited and can usually be appropriately designed according to the purpose in the range of 1 base length to tens of thousands of base lengths (e.g., in the case of ssODN, 100 bases or less (e.g., 70 bases or less, 50 bases or less)). Also, the length of each homology arm is not particularly limited. When the donor DNA is ssODN, usually those with a length of 10 bases to 150 bases are used. When the donor DNA is synthetic double-stranded DNA, usually those with a length of 10 to 5000 bases are used. When the donor DNA is plasmid DNA, usually those with a length of 100 bases to 5000 bases, preferably 500 bases to 1000 bases are used. These donor DNAs can be designed with reference to known literature (e.g., Ochiai H, Int J Mol Sci, 16:21128-21137 (2015), Hockemeyer D et al., Nat Biotefchnol, 27:851-857 (2009)).

[0018] In the present invention, the "nucleic acid sequence recognition module" means a molecule or molecular complex having the ability to specifically recognize and bind to a specific nucleotide sequence (i.e., the target nucleotide sequence) on a DNA strand. When the nucleic acid sequence recognition module binds to the target nucleotide sequence, a nucleic acid base conversion enzyme or the like linked to the module can specifically act on the site targeted by the nucleic acid base conversion enzyme or the like of double-stranded DNA (i.e., the target nucleotide sequence and the nucleotides in its vicinity).

[0019] As shown in the examples described below, it has been demonstrated that the target site can be modified by introducing a complex of a nucleic acid base-converting enzyme and a nucleic acid sequence recognition module and donor DNA into cells. Although not wishing to be bound by any theory, the mechanism of modification of the target site by this method is presumed as follows. The nucleic acid base-converting enzyme converts the base present at the site targeted into another base, and this converted base is removed by DNA glycosylase. The site without a base (apurinic / apyrimidic (AP) site) resulting from the depurination reaction is processed by enzymes downstream of the base excision repair (BER) pathway such as AP endonuclease, DNA polymerase, and DNA ligase. On the other hand, when BER is not completed and abnormal nucleotides or mismatched structures are present, the complementary strand repair pathway is also activated, and homologous recombination occurs between the target site and the region contained in the donor DNA, resulting in modification of the target site. Therefore, even when using DNA glycosylase, it is presumed that similar modifications will occur by causing depurination at the site targeted by the enzyme. Thus, not only nucleic acid base-converting enzymes but also DNA glycosylases can be applied to the method of the present invention. In the present invention, the "nucleic acid base-converting enzyme" means an enzyme that can convert a target nucleotide into another nucleotide without cleaving the DNA strand by catalyzing a reaction that converts a substituent on the purine or pyrimidine ring of a DNA base into another group or atom. In the present invention, the "DNA glycosylase" means an enzyme that hydrolyzes the N-glycosidic bond of DNA. DNA glycosylase originally plays a role of removing damaged bases from DNA in BER, but in the present invention, normal bases in DNA (i.e., dC, dT, dA, or dG, .

[0020]

[0021] respectively) can be the target of DNA glycosylase, and by causing depurination at the site targeted by DNA glycosylase, similar modifications can occur. or those that can act on those that have undergone epigenetic modification) are preferred. The present DNA glycosylases that do not originally react with normal bases or have low reactivity but have acquired reactivity with normal bases due to mutations or have improved reactivity are also included in the DNA glycosylases of the present invention and can be preferably used. The base-free site (apurinic / apyrimidic (AP) site) resulting from the depurination reaction by the enzyme is processed by enzymes downstream of the BER pathway such as AP endonuclease, DNA polymerase, and DNA ligase. In addition, "sufficiently low reactivity with DNA having an unstrained double helix structure" means that the depurination reaction in the region forming DNA having an unstrained double helix structure occurs only at a frequency at which cytotoxicity is suppressed to such an extent that it does not affect cell survival. Here, "DNA having an unstrained double helix structure" means that it is in a state of forming a strong double helix structure ( that is, unrelaxed double-helical DNA (or simply unrelaxed DNA)), and not only the state of single-stranded DNA in which the base pairs forming the pair are completely dissociated, but also the state of a relaxed double-stranded DNA in which the base pairs are formed but the double helix structure is loosened is not included. Examples of DNA glycosylases having sufficiently low reactivity with DNA having an unstrained double helix structure include DNA glycosylases that are inherently sufficiently low in reactivity with DNA having an unstrained double helix structure, and mutant DNA glycosylases into which mutations have been introduced to reduce reactivity with DNA having an unstrained double helix structure compared to the wild type. Furthermore a DNA glycosylase divided into two fragments, each fragment binds to one of the two nucleic acid sequence recognition modules divided into two to form two complexes, and both complexes are formed, and the two complexes are also included. DNA glycosylases having sufficiently low reactivity with DNA having an unstrained double helix structure include DNA glycosylases that are inherently sufficiently low in reactivity with DNA having an unstrained double helix structure, and mutant DNA glycosylases into which mutations have been introduced to reduce reactivity with DNA having an unstrained double helix structure compared to the wild type. Furthermore a DNA glycosylase divided into two fragments, each fragment binds to one of the two nucleic acid sequence recognition modules divided into two to form two complexes, and both complexes formed, and the two complexes formed bind to each other to form a functional DNA glycosylase are also included. Upon refolding, the nucleic acid sequence recognition module can specifically bind to the target nucleotide sequence, and the specific binding enables the DNA glycosylase, which is a split enzyme designed to be able to catalyze the depurination reaction The DNA glycosylase, which is a split enzyme designed to be able to catalyze the above reaction is also included in the "DNA glycosylase with sufficiently low reactivity to DNA with a stress-free double helix structure" in the present invention.

[0022] In the present invention, the "nucleic acid-modifying enzyme complex" means a molecular complex having a catalytic function for a nucleic acid base conversion reaction or a depurination reaction imparted with the ability to recognize a specific nucleotide sequence, which comprises a complex in which the above nucleic acid sequence recognition module is linked to a nucleic acid base-converting enzyme or a DNA glycosylase. Here, the "complex" includes not only those composed of multiple molecules, but also those having a nucleic acid sequence recognition module and a nucleic acid base-converting enzyme, etc. within a single molecule, such as a fusion protein. There is no particular limitation on the nucleic acid base-converting enzyme used in the present invention as long as it can catalyze the above reaction. Examples include deaminases belonging to the nucleic acid / nucleotide deaminase superfamily that catalyze a deamination reaction for converting an amino group to a carbonyl group. Preferably, there are cytidine deaminase that can convert cytosine or 5-methylcytosine to uracil or thymine respectively, adenosine deaminase that can convert adenine to hypoxanthine, guanosine deaminase that can convert guanine to xanthine, etc. More preferably, as the cytidine deaminase, there is activation-induced cytidine deaminase (hereinafter also referred to as AID), which is an enzyme that introduces mutations into immunoglobulin genes in the acquired immunity of vertebrates.

[0023] There is no particular limitation on the nucleic acid base-converting enzyme used in the present invention as long as it can catalyze the above reaction. Examples include deaminases belonging to the nucleic acid / nucleotide deaminase superfamily that catalyze a deamination reaction for converting an amino group to a carbonyl group. Preferably, there are cytidine deaminase that can convert cytosine or 5-methylcytosine to uracil or thymine respectively, adenosine deaminase that can convert adenine to hypoxanthine, guanosine deaminase that can convert guanine to xanthine, etc. More preferably, as the cytidine deaminase, there is activation-induced cytidine deaminase (hereinafter also referred to as AID), which is an enzyme that introduces mutations into immunoglobulin genes in the acquired immunity of vertebrates. are mentioned.

[0024] The origin of the nucleobase-converting enzyme is not particularly limited. For example, PmCDA1 (Petromyzon marinus cytosine deaminase 1) derived from lamprey, AID (Activation-induced cytidine deaminase; AICDA) derived from mammals (e.g., human, pig, cow, horse, monkey, etc.) can be used. For example, the nucleotide sequence and amino acid sequence of the cDNA of PmCDA1 can refer to GenBank accession No. EF094822 and ABO15149, respectively, and the nucleotide sequence and amino acid sequence of the cDNA of human AID can refer to GenBank accession No. NM_020661 and NP_065712, respectively. From the perspective of enzyme activity, PmCDA1 is preferred.

[0025] The DNA glycosylase used in the present invention hydrolyzes the N-glycosidic bond of DNA to produce a base There is no particular limitation as long as it can catalyze the reaction for cleavage, but in terms of enhancing the versatility as a genome editing technique, those that can act on normal bases (i.e., dC, dT, dA, or dG, or those that have undergone epigenetic modifications, such as 5-methylcytosine, etc.) are preferred. Examples of such enzymes include, for example, enzymes having CDG activity that catalyze the reaction for cleavage of cytosine, enzymes having TDG activity that catalyze the reaction for cleavage of thymine, enzymes having activity (5-mCDG activity) that catalyze the reaction for cleavage of 5-methylcytosine, etc. Specifically, thymine DNA glycosylase, oxoguanine glycosylase, alkyladenine DNA glycosylase (e.g., yeast 3-methyladenine-DNA glycosylase (MAG1), etc.) can be mentioned. The present inventor has previously reported that by using a DNA glycosylase with sufficiently low reactivity to unrelaxed DNA with a non-distorted double helix structure, cytotoxicity can be reduced and the target sequence can be efficiently modified (International Publication No. 2016 / 072399). Therefore, as the DNA glycosylase, it is preferable to use a DNA glycosylase with sufficiently low reactivity to unrelaxed DNA with a non-distorted double helix structure. Examples of such DNA glycosylases include mutants of UNG (uracil-DNA glycosylase) having cytosine-DNA glycosylase (CDG) activity and / or thymine-DNA glycosylase (TDG) activity, and UDG mutants derived from vaccinia virus, as described in International Publication No. 2016 / 072399.

[0026] Specific examples of the mutant of the above-mentioned UNG include the N222D / L304A double mutant of yeast UNG1, N222D / R308E Double mutants, such as N222D / R308C double mutant, Y164A / L304A double mutant, Y164A / R308E double mutant, Y164A / R308C double mutant, Y164G / L304A double mutant, Y164G / R308E double mutant, Y164G / R308C double mutant, N222D / Y164A / L304A triple mutant, N222D / Y164A / R308E triple mutant, N222D / Y164A / R308C triple mutant, N222D / Y164G / L304A triple mutant, N222D / Y164G / R308E triple mutant, N222D / Y164G / R308C triple mutant, etc. When using another UNG instead of yeast UNG1, mutants with similar mutations introduced into the corresponding amino acids of the above mutants can be used. For example, for the mutations of E. coli UNG corresponding to the Y164A or Y164G mutations of yeast UNG1, which are mutations conferring TDG activity, Y66A or Y66G can be mentioned; for the mutations of human UNG, Y147A or Y147G can be mentioned. For the mutations of E. coli UNG corresponding to the N222D mutation of yeast UNG1, which is a mutation conferring CDG activity, N123D can be mentioned; for the mutations of human UNG, N204D can be mentioned. For the mutations of E. coli UNG corresponding to the L304A, R308E or R308C mutations of yeast UNG1, which result in a decrease in reactivity to DNA in the stress-free double helix structure, L191A, R195E or R195C can be mentioned; for the mutations of human UNG, L272A, R276E or R276C can be mentioned. Examples of UDG mutants derived from vaccinia virus include N120D mutant (conferring CDG activity), Y70G mutant (conferring TDG activity), Y70A mutant (conferring TDG activity), N120D / Y70G double mutant, N120D / Y70A double mutant, etc. Alternatively, it may be a split enzyme that is a DNA glycosylase divided into two fragments, each fragment binds to one of the two split nucleic acid sequence recognition modules to form two complexes, and when both complexes refold, the nucleic acid sequence recognition module can specifically bind to the target nucleotide sequence, and the DNA glycosylase is designed to be able to catalyze the depurination reaction by this specific binding.Split enzymes can be designed and produced, for example, with reference to the descriptions in International Publication No. 2016 / 072399, Nat Biotechnol. 33(2): 139-142 (2015), and PNAS 112(10): 2984-2989 (2015).

[0027] The origin of UNG is not particularly limited, and examples of UDG that can be used include ung derived from Escherichia coli (Varshney, U. et al. (1988) J. Biol. Chem., 263, 7776-7784), UNG1 or UNG2 derived from yeast or mammals (e.g., humans, mice, pigs, cattle, horses, monkeys, etc.), and UDG derived from viruses (e.g., Poxviridae (vaccinia virus, etc.), Herpesviridae, etc.).

[0028] Double-stranded DNA recognized by the nucleic acid sequence recognition module of the nucleic acid modifying enzyme complex of the present invention. The target nucleotide sequence in is not particularly limited as long as the module can specifically bind thereto, It can be any sequence in double-stranded DNA. The length of the target nucleotide sequence is determined by the nucleic acid sequence recognition. It is sufficient that the module specifically binds, e.g., in mammalian genomic DNA. When a mutation is introduced into a specific site, the length is 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 17 nucleotides or more, depending on the genome size. The upper limit of the length is not particularly limited, but is preferably 25 nucleotides or less, more preferably 22 nucleotides or less. As shown in the examples below, high modification efficiency was demonstrated in all experimental systems in which the target nucleotide sequence exists in the target site, in a sequence homologous to the homology arm, and in a region containing a portion of the sequence homologous to the homology arm. Therefore, the target nucleotide sequence may be present in the target site, in at least a portion of the sequence homologous to the homology arm, or in the vicinity of the sequence homologous to the homology arm.

[0029] As the nucleic acid sequence recognition module of the nucleic acid-modifying enzyme complex of the present invention, for example, at least one DNA cleavage ability of a Cas effector protein (also referred to as a Cas nuclease) in a CRISPR-Cas system (hereinafter also referred to as "CRISPR-mutant Cas") is inactivated, a zinc finger motif, a TAL (transcription activator-like) effector, a PPR (pentatricopeptide repeat) motif, etc., and in addition, a DNA-binding domain of a protein that can specifically bind to DNA, such as a restriction enzyme, a transcription factor, an RNA polymerase, etc., and a fragment that does not have a DNA double-strand cleavage ability can be used, but is not limited thereto. Preferably, CRISPR-mutant Cas, a zinc finger motif, a TAL effector, a PPR motif, etc. are mentioned. In the present specification, the Cas effector protein in which at least one of the above DNA cleavage abilities is inactivated is also referred to as a mutant of the Cas effector protein.

[0030] The zinc finger motif is a structure in which 3 to 6 different Cys2His2-type zinc finger units (one finger recognizes about 3 bases) are linked, and can recognize a target nucleotide sequence of 9 to 18 bases. The zinc finger motif can be prepared by known methods such as the Modular assembly method (Nat Biotechnol (2002) 20: 135-141), the OPEN method (Mol Cell (2008) 31: 294-301), the CoDA method (Nat Methods (2011) 8: 67-69), the Escherichia coli one-hybrid method (Nat Biotechnol (2008) 26:695-701), etc. For details on the production of the zinc finger motif, reference can be made to Japanese Patent No. 4968498.

[0031] The TAL effector has a repetitive structure of modules with about 34 amino acids as a unit. Furthermore, the binding stability and base specificity are determined by the 12th and 13th amino acid residues (referred to as RVDs) of one module. Since each module has a high degree of independence, it is possible to create a TAL effector specific to a target nucleotide sequence simply by connecting the modules. This is the case. For the production of TAL effectors, production methods using open resources (REAL method (Curr Protoc Mol Biol (2012) Chapter 12: Unit 12.15), FLASH method (Nat Biotechnol (2012) 30: 460-465), Golden Gate method (Nucleic Acids Res (2011) 39: e82), etc.) have been established, and it is possible to relatively easily design a TAL effector for a target nucleotide sequence. For details on the production of TAL effectors, reference can be made to Japanese Patent Application Laid-Open No. 2013-513389.

[0032] The PPR motif consists of 35 amino acids and is configured to recognize a specific nucleotide sequence by a series of PPR motifs that recognize one nucleic acid base. Only the 1st, 4th, and ii(-2)th amino acids of each motif recognize the target base. Since there is no dependence on the motif composition and there is no interference from the motifs on both sides, similar to TAL effectors, it is possible to create a PPR protein specific to a target nucleotide sequence simply by connecting the PPR motifs. For details on the production of PPR motifs, reference can be made to Japanese Patent Application Laid-Open No. 2013-128413.

[0033] In addition, when using fragments such as restriction enzymes, transcription factors, and RNA polymerases, since the DNA-binding domains of these proteins are well-known, it is possible to easily design and construct a fragment that contains the domain and does not have the ability to cleave DNA duplexes.

[0034] ​​​Any of the above nucleic acid sequence recognition modules can also be provided as a fusion protein with the above nucleic acid base conversion enzyme or the like, or a protein binding domain such as an SH3 domain, a PDZ domain, a GK domain, or a GB domain and its binding partner are fused to the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme or the like, respectively, and provided as a protein complex through the interaction between the domain and its binding partner. Alternatively, an intein can be fused to the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme or the like, respectively, and the two can be ligated by ligation after each protein synthesis.

[0035] Contact between the nucleic acid modification enzyme complex of the present invention comprising a complex (including a fusion protein) in which a nucleic acid sequence recognition module and a nucleic acid base conversion enzyme or the like are bound, and double-stranded DNA is carried out by introducing a nucleic acid encoding the complex into a cell having the double-stranded DNA (e.g., genomic DNA). In the present specification, the nucleic acid encoding the nucleic acid modification enzyme complex includes a base sequence encoding a nucleic acid sequence recognition module and a base sequence encoding a nucleic acid base conversion enzyme or DNA glycosylase. When the nucleic acid sequence recognition module is a CRISPR-Cas system, it further includes a sequence encoding a guide RNA. Therefore, the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme or the like are preferably prepared as nucleic acids encoding them in a form such that they can form a complex in a host cell after translation into proteins using a nucleic acid encoding their fusion protein, or using a binding domain, an intein, or the like. Here, the nucleic acid may be DNA or RNA. In the case of DNA, it is preferably double-stranded DNA and is provided in the form of an expression vector placed under the control of a promoter functional in a host cell. In the case of RNA, it is preferably single-stranded RNA. Accordingly, the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme or the like are preferably prepared as nucleic acids encoding them in a form such that they can form a complex in a host cell after translation into proteins using a nucleic acid encoding their fusion protein, or using a binding domain, an intein, or the like. Here, the nucleic acid may be DNA or RNA. In the case of DNA, it is preferably double-stranded DNA and is provided in the form of an expression vector placed under the control of a promoter functional in a host cell. In the case of RNA, it is preferably single-stranded RNA. The complex of the present invention in which a nucleic acid sequence recognition module and a nucleic acid base conversion enzyme or the like are bound does not involve double-strand break (DSB) of DNA, and thus enables genome editing with low toxicity. The method of the present invention does not involve double-strand break (DSB) of DNA, and thus enables genome editing with low toxicity. The method of the present invention It can be applied to a wide range of biological materials. Therefore, cells into which nucleic acids encoding a nucleic acid sequence recognition module and / or a nucleic acid base conversion enzyme, etc. are introduced can include cells of all biological species, ranging from cells of bacteria such as Escherichia coli, which are prokaryotes, and microorganisms such as yeast, which are lower eukaryotes, to cells of higher eukaryotes such as vertebrates including mammals such as humans, insects, and plants.

[0036] DNA encoding a nucleic acid sequence recognition module such as a zinc finger motif, TAL effector, PPR motif, etc. can be obtained by any of the methods described above for each module. DNA encoding a sequence recognition module such as a restriction enzyme, transcription factor, RNA polymerase, etc. can be cloned, for example, based on their cDNA sequence information, by synthesizing an oligo DNA primer so as to cover the region encoding the desired portion (the portion including the DNA binding domain) of the protein, and using the total RNA or mRNA fraction prepared from the cells producing the protein as a template and amplifying it by RT-PCR method. DNA encoding a nucleic acid base conversion enzyme or the like (i.e., DNA encoding a nucleic acid base conversion enzyme or DNA encoding DNA glycosylase) can also be cloned by synthesizing an oligo DNA primer based on the cDNA sequence information of the enzyme to be used, and amplifying the DNA by RT-PCR using total RNA or an mRNA fraction prepared from a cell that produces the enzyme as a template. For example, the DNA encoding lamprey PmCDA1 can be cloned from lamprey-derived mRNA by RT-PCR, by designing suitable primers for the upstream and downstream of the CDS based on the cDNA sequence (accession No. EF094822) registered in the NCBI database. Furthermore, the DNA encoding human AID can be cloned, for example, from human lymph node-derived mRNA by RT-PCR, by designing suitable primers for the upstream and downstream of the CDS based on the cDNA sequence (accession No. AB040431) registered in the NCBI database. Furthermore, donor DNA can also be cloned in the same manner as above, based on the sequence information of the target site, etc. The cloned DNA may be used as is, or optionally digested with restriction enzymes or digested with an appropriate Linker and / or nuclear localization signal (if the double-stranded DNA of interest is mitochondrial or chloroplast DNA) In the case of the fusion protein, the DNA encoding the fusion protein can be prepared by adding an organelle targeting signal to the fusion protein and then ligating the fusion protein to a DNA encoding a nucleic acid sequence recognition module. Alternatively, the fusion protein can be prepared by ligating the fusion protein to a DNA encoding a nucleic acid sequence recognition module and a DNA encoding a nucleic acid base conversion enzyme or the like. Alternatively, a DNA encoding a binding domain or its binding partner may be fused to each of the DNAs, or a DNA encoding a separate intein may be fused to both of the DNAs, so that the nucleic acid sequence recognition and conversion module and the nucleic acid base conversion enzyme, etc. can form a complex after translation in the host cell. In these cases, a complex may be formed by fusing a DNA encoding a binding domain or its binding partner to each of the DNAs, or a DNA encoding a separate intein to both of the DNAs. , a linker and / or a nuclear localization signal can be linked. Also, the donor DNA may be prepared as a single DNA, or provided as a single DNA together with a nucleic acid encoding a nucleic acid sequence recognition module and / or a nucleic acid base conversion enzyme, etc. It may be provided as a single DNA with the nucleic acid encoding .

[0037] For the DNA encoding the nucleic acid sequence recognition module, the DNA encoding the nucleic acid base conversion enzyme, etc., and the donor DNA, it is also possible to construct the DNA encoding its full length by chemically synthesizing the DNA strand or connecting the oligonucleotide DNA short strands that are partially overlapping and synthesized using the PCR method or the Gibson Assembly method. When the donor DNA is a single-stranded nucleic acid, as a method other than chemically synthesizing the DNA strand, for example, the plasmid DNA containing the DNA is digested with a restriction enzyme to make it single-stranded, RNA is synthesized with RNA polymerase, then cDNA is synthesized with reverse transcriptase, and the RNA strand is degraded with RNaseH. Alternatively, it can also be prepared by digesting the plasmid containing the donor DNA with a nickase-type restriction enzyme and through separation and purification by electrophoresis. The advantage of constructing the full-length DNA by chemical synthesis or in combination with the PCR method or the Gibson Assembly method is that the codons to be used can be designed over the entire length of the CDS according to the host into which the DNA is to be introduced. When expressing heterologous DNA, by converting the DNA sequence into codons with a high usage frequency in the host organism, an increase in the protein expression level can be expected. Data on the codon usage frequency in the host to be used can be obtained, for example, from the Genetic Code Usage Frequency Database (http: / / www.kazusa.or.jp / codon / index.html) published on the homepage of the Kazusa DNA Research Institute, or references to documents recording the codon usage frequency in each host may also be used. Referring to the obtained data and the DNA sequence to be introduced, those codons with a low usage frequency in the host among the codons used in the DNA sequence may be converted into codons with a high usage frequency that encode the same amino acid. Also, when the target site is a site other than the target nucleotide sequence and the PAM sequence, even after modification Since these sequences remain and nucleic acid base conversion reactions or de - base reactions may occur due to nucleic acid - modifying enzymes, etc., the donor DNA is designed so as to remove these sequences, or silent mutations are preferably introduced into the target nucleotide sequence or PAM sequence on the homology arm. It is preferable.

[0038] An expression vector containing DNA encoding a nucleic acid sequence recognition module and / or a nucleic acid base - converting enzyme, etc. can be produced, for example, by ligating the DNA downstream of a promoter in an appropriate expression vector. Examples of expression vectors include plasmids derived from Escherichia coli (e.g., pBR322, pBR325, pUC12, pUC13); plasmids derived from Bacillus subtilis (e.g., pUB110, pTP5, pC194); plasmids derived from yeast (e.g., pSH19, pSH15); insect - cell expression plasmids (e.g., pFast - Bac); animal - cell expression plasmids (e.g., pA1 - 11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo); bacteriophages such as λ - phage; insect - virus vectors such as baculovirus (e.g., BmNPV, AcNPV); animal - virus vectors such as retrovirus, vaccinia virus, adenovirus, etc. As the promoter, any promoter may be used as long as it is appropriate for the host used for gene expression. In the conventional method involving DSB, the survival rate of host cells may be significantly reduced due to toxicity, so it is desirable to use an inducible promoter to increase the number of cells until the induction starts. However, since sufficient cell growth can be obtained even when the nucleic acid - modifying enzyme complex of the present invention is expressed, a constitutive promoter can also be used without limitation. For example, when the host is an animal cell, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV - TK (herpes simplex virus thymidine kinase) A (stimidine kinase) promoter or the like is used. Among them, a CMV promoter, an SR α promoter or the like is preferable. When the host is Escherichia coli, a trp promoter, a lac promoter, a recA promoter, a λP L promoter, an lpp promoter, a T7 promoter or the like is preferable. When the host is a Bacillus bacterium, an SPO1 promoter, an SPO2 promoter, a penP promoter or the like is preferable. When the host is yeast, a Gal1 / 10 promoter, a PHO5 promoter, a PGK promoter, a GAP promoter, an ADH promoter or the like is preferable. When the host is an insect cell, a polyhedrin promoter, a P10 promoter or the like is prefe rable. When the host is a plant cell, a CaMV35S promoter, a CaMV19S promoter, a NOS promo ter or the like is preferable.

[0039] As the expression vector, in addition to the above, if desired, an enhancer, a splicing signal, a terminator, a polyA addition signal, a selection marker such as a drug resistance gene, an auxotrophic complementation gene, an origin of replication, etc. can be used.

[0040] The RNA encoding the nucleic acid sequence recognition module and / or the nucleic acid base conversion enzyme etc. can be prepared, for example, by transcribing it into mRNA in a known in vitro transcription system using as a template a vector encoding the DNA encoding the nucleic acid sequence recognition module and / or the nucleic acid base conversion enzyme etc. described above.

[0041] By introducing an expression vector containing the DNA encoding the nucleic acid sequence recognition module and / or the nucleic acid base conversion enzyme etc. into a host cell and culturing the host cell, a complex of the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme etc. can be expressed intracellularly. Examples of hosts include bacteria of the genus Escherichia, bacteria of the genus Bacillus, yeast, insect cells, insects, animal cells, and the like. Examples of bacteria of the genus Escherichia include Escherichia coli K12·DH1 [Proc. Natl. Acad. Sci. USA, 60, 160 (1968)], Escherichia coli JM103 [Nucleic Acids Research, 9, 309 (1981)], Escherichia coli JA221 [Journal of Molecular Biology, 120, 517 (1978)], Escherichia coli HB101 [Journal of Molecular Biology, 41, 459 (1969)], Escherichia coli C600 [Genetics, 39, 440 (1954)], and the like. Examples of bacteria of the genus Bacillus include Bacillus subtilis MI114 [Gene, 24, 255 (1983)], Bacillus subtilis 207-21 [Journal of Biochemistry, 95, 87 (1984)], and the like. Examples of yeast include Saccharomyces cerevisiae AH22, AH22R - , NA87-11A, DKD-5D, 20B-12, Schizosaccharomyces pombe NCYC1913, NCYC2036, Pichia pastoris KM71, and the like.

[0042] Examples of insect cells include, for example, when the virus is AcNPV, cell lines derived from larvae of the noctuid moth (Spodoptera frugiperda cell; Sf cell), MG1 cells derived from the midgut of Trichoplusia ni, High Five derived from the eggs of Trichoplusia ni TMCells such as cells derived from Mamestra brassicae, cells derived from Estigmena acrea, etc. are used. When the virus is BmNPV, as insect cells, cell lines derived from silkworms (Bombyx mori N cells; BmN cells), etc. are used. As the Sf cells, for example, Sf9 cells (ATCC CRL1711), Sf21 cells [ibid., In Vivo, 13, 213-217 (1977)], etc. are used. As insects, for example, silkworm larvae, Drosophila, crickets, etc. are used [Nature, 315, 592 (1985)].

[0043] As animal cells, for example, monkey COS-7 cells, monkey Vero cells, Chinese hamster ovary (CHO) cells, CHO cells deficient in the dhfr gene, mouse L cells, mouse AtT-20 cells, mouse melanoma cells, rat GH3 cells, cells derived from human fetal kidney (e.g., HEK293 cells), cells derived from human liver cancer (e.g., HepG2), cell lines such as human FL cells, pluripotent stem cells such as human and other mammalian iPS cells and ES cells, and primary cultured cells prepared from various tissues are used. Furthermore, zebrafish embryos, African clawed frog oocytes, etc. can also be used.

[0044] As plant cells, suspension-cultured cells, callus, protoplasts, leaf sections, root sections, etc. prepared from various plants (for example, grains such as rice, wheat, and corn, commercial crops such as tomatoes, cucumbers, and eggplants, horticultural plants such as carnations and marigolds, experimental plants such as tobacco and Arabidopsis thaliana, etc.) are used.

[0045] The introduction of the expression vector can be carried out according to known methods (e.g., the lysozyme method, the competent method, the PEG method, the CaCl2 coprecipitation method, the electroporation method, the microinjection method, the particle gun method, the lipofection method, the Agrobacterium method, etc.) depending on the type of host. The donor DNA can also be introduced into cells by a similar method. When the expression vector and the donor DNA are introduced as different molecules, the introduction of the expression vector and the donor DNA may be carried out simultaneously or at different times. E. coli can be transformed according to the methods described, for example, in Proc. Natl. Acad. Sci. USA, 69, 2110 (1972) and Gene, 17, 107 (1982). Bacillus spp. can have vectors introduced according to the methods described, for example, in Molecular & General Genetics, 168, 111 (1979). Yeast can have vectors introduced according to the methods described, for example, in Methods in Enzymology, 194, 182 - 187 (1991) and Proc. Natl. Acad. Sci. USA, 75, 1929 (1978). Insect cells and insects can have vectors introduced according to the methods described, for example, in Bio / Technology, 6, 47 - 55 (1988). Animal cells can have vectors introduced according to the methods described, for example, in Cell Engineering Separate Volume 8 New Cell Engineering Experimental Protocols, 263 - 267 (1995) (published by Shujunsha) and Virology, 52, 456 (1973).

[0046] The culture of cells into which the vector and the donor DNA have been introduced can be carried out according to known methods depending on the type of host. and. For example, when culturing Escherichia coli or Bacillus bacteria, a liquid medium is preferably used as the medium for culturing. Further, the medium preferably contains a carbon source, a nitrogen source, inorganic substances, etc. necessary for the growth of the transformant. Here, examples of the carbon source include glucose, dextrin, soluble starch, sucrose, etc.; examples of the nitrogen source include inorganic or organic substances such as ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract; examples of the inorganic substances include calcium chloride, sodium dihydrogen phosphate, magnesium chloride, etc. Further, yeast extract, vitamins, growth promoting factors, etc. may be added to the medium. The pH of the medium is preferably about 5 to about 8. As the medium for culturing Escherichia coli, for example, M9 medium containing glucose and casamino acids [Journal of Experiments in Molecular Genetics, 431 - 433, Cold Spring Harbor Laboratory, New York 1972] is preferred. If necessary, in order to make the promoter work efficiently, a drug such as 3β-indolylacrylic acid may be added to the medium. The culturing of Escherichia coli is usually carried out at about 15 to about 43 °C. If necessary, aeration or stirring may be carried out. The culturing of Bacillus bacteria is usually carried out at about 30 to about 40 °C. If necessary, aeration or stirring may be carried out. As the medium for culturing yeast, for example, Burkholder minimal medium [Proc. Natl. Acad. Sci. USA, 77, 4505 (1980)] and SD medium containing 0.5% casamino acids [Proc. Natl. Acad. Sci. USA, 81, 5330 (1984)] etc. can be mentioned. The pH of the medium is preferably about 5 to about 8. The culturing is usually carried out at about 20 °C to about 35 °C. If necessary, aeration or stirring may be carried out. When culturing insect cells or insects, as the medium, for example, Grace's Insect Medium [Nature, 195, 788 (1962)] supplemented with appropriate additives such as 10% heat-inactivated bovine serum is used. The pH of the medium is preferably about 6.2 to about 6.4. The culture is usually carried out at about 27°C. Aeration and stirring may be carried out as necessary. When culturing animal cells, as the medium, for example, Minimum Essential Medium (MEM) [Science, 122, 501 (1952)] containing about 5 to about 20% fetal bovine serum, Dulbecco's Modified Eagle Medium (DMEM ) [Virology, 8, 396 (1959)], RPMI 1640 medium [The Journal of the American Medical Association, 199, 519 (1967)], 199 medium [Proceeding of the Society for the Biological Medicine, 73, 1 (1950)], etc. are used. The pH of the medium is preferably about 6 to about 8. The culture is usually carried out at about 30°C to about 40°C. Aeration and stirring may be carried out as necessary. As the medium for culturing plant cells, MS medium, LS medium, B5 medium, etc. are used. The pH of the medium is preferably about 5 to about 8. The culture is usually carried out at about 20°C to about 30°C. Aeration and stirring may be carried out as necessary. As described above, a complex of a nucleic acid sequence recognition module and a nucleic acid base conversion enzyme, etc., that is, a nucleic acid-modifying enzyme complex can be expressed intracellularly.

[0047] The introduction of RNA encoding a nucleic acid sequence recognition module and / or a nucleic acid base conversion enzyme, etc. into a host cell can be carried out by the microinjection method, the lipofection method, etc. The RNA introduction can be repeated once or multiple times (for example, 2 to 5 times) at appropriate intervals.

[0048] It is not easy to create a large number of zinc finger motifs that actually function because the efficiency of creating zinc fingers that specifically bind to target nucleotide sequences is not high, and the selection of zinc fingers with high binding specificity is complicated. Effector and PPR motifs have higher autonomy in target nucleic acid sequence recognition than zinc finger motifs. Although this method offers great flexibility, it requires designing and constructing a large protein each time in response to the target nucleotide sequence, which leaves problems in terms of efficiency. In contrast, the CRISPR-Cas system recognizes a target double-stranded DNA sequence using a guide RNA that is complementary to the target nucleotide sequence, so any sequence can be targeted simply by synthesizing an oligo DNA that can specifically hybridize with the target nucleotide sequence. Therefore, in a more preferred embodiment of the present invention, a CRISPR-Cas system (CRISPR-mutant Cas) in which the DNA cleavage ability of only one or both of the Cas effector proteins is inactivated is used as the nucleic acid sequence recognition module.

[0049] The nucleic acid sequence recognition module of the present invention using CRISPR-mutated Cas is provided as a complex of CRISPR-RNA (crRNA) containing a sequence complementary to the target nucleotide sequence, trans-activating RNA (tracrRNA) necessary for recruiting the mutant Cas effector protein as necessary (if tracrRNA is necessary, it can be provided as a chimeric RNA with crRNA), and the mutant Cas effector protein. RNA molecules consisting of crRNA alone or chimeric RNA of crRNA and tracrRNA, which are combined with the mutant Cas effector protein to constitute the nucleic acid sequence recognition module, are collectively referred to as "guide RNA". The same applies when a CRISPR / Cas system without mutation is used.

[0050] The Cas effector protein used in the present invention forms a complex with a guide RNA and binds to a target nucleotide sequence in a target gene and a protospacer adjacent motif (PAM) adjacent thereto There is no particular limitation as long as it can recognize and bind to (0), but preferably it is Cas9 (also referred to as Cas9 nuclease) or Cpf1 (also referred to as Cpf1 nuclease). Examples of Cas9 include Cas9 derived from Streptococcus pyogenes (SpCas9; PAM sequence NGG (N is A, G, T, or C; the same applies hereinafter)), Cas9 derived from Streptococcus thermophilus (StCas9; PAM sequence NNAGAAW), Cas9 derived from Neisseria meningitidis (MmCas9; PAM sequence NNNNGATT), etc., but it is not limited thereto. Preferably, it is SpCas9 with fewer constraints by PAM (substantially 2 bases, and theoretically it can be targeted almost anywhere on the genome). Examples of Cpf1 include Cpf1 derived from Francisella novicida (FnCpf1; PAM sequence NTT), Cpf1 derived from Acidaminococcus sp. (AsCpf1; PAM sequence NTTT), Cpf1 derived from Lachnospiraceae bacterium (LbCpf1; PAM sequence NTTT), etc., but it is not limited thereto. As the mutant Cas effector protein (which may be abbreviated as mutant Cas) used in the present invention, those in which the ability to cleave both strands of double-stranded DNA of the Cas effector protein is inactivated and those having nickase activity in which only the ability to cleave one strand is inactivated can both be used. For example, in the case of SpCas9, the D10A mutant lacking the ability to cleave the strand opposite to the strand forming the complementary strand with the guide RNA (therefore having nickase activity against the strand forming the complementary strand with the guide RNA) in which the 10th Asp residue is converted to an Ala residue, or the H840A mutant lacking the ability to cleave the strand forming the complementary strand with the guide RNA (therefore having nickase activity against the strand opposite to the strand forming the complementary strand with the guide RNA) in which the 840th His residue is converted to an Ala residue, and furthermore, its double mutant (dCas9) can be used.In the case of FnCpf1, mutants lacking the ability to cleave both strands, in which the 917th Asp residue is converted to an Ala residue (D917A) or the 1006th Glu residue is converted to an Ala residue (E1006A), can be used. As long as at least one strand of the double-stranded DNA lacks the ability to be cleaved, other mutant Cas can be used in the same manner.

[0051] DNA encoding a Cas effector protein (including mutant Cas, the same applies hereinafter) can be obtained from cells producing the enzyme by the same method as described above for DNA encoding an inhibitor of base excision repair. cloned from. Also, mutant Cas can be obtained by introducing mutations into the DNA encoding cloned Cas using a site-directed mutagenesis method known per se so as to convert amino acid residues at positions essential for DNA cleavage activity (for example, in the case of SpCas9, the 10th Asp residue and the 840th His residue, in the case of FnCpf1, the 917th Asp residue, the 1006th Glu residue, etc., but not limited to these). Alternatively, DNA encoding a Cas effector protein can be constructed as DNA having a codon usage suitable for expression in the host cell used by chemical synthesis, the PCR method, or a combination with the Gibson Assembly method, by the same method as described above for DNA encoding a nucleic acid sequence recognition module or DNA encoding a nucleic acid base conversion enzyme. or 840th His residue, in the case of FnCpf1, the 917th Asp residue, the 1006th Glu residue, etc. are included, but not limited to these). can be obtained by introducing mutations so as to convert (but not limited to these) amino acid residues at positions essential for DNA cleavage activity into other amino acids. The obtained DNA encoding a Cas effector protein and / or a nucleic acid modifying enzyme and / or an inhibitor of base excision repair can be inserted downstream of the promoter of the same expression vector as described above according to the target cell.

[0052] can be inserted downstream of the promoter of the same expression vector as described above according to the target cell.

[0053] ​​On the one hand, the DNA encoding the guide RNA contains a nucleotide sequence complementary to the target nucleotide sequence (also referred to herein as the "targeting sequence"), such as a crRNA sequence (e.g., a site that recruits FnCpf1 as a Cas effector protein, with SEQ ID NO: 1; AAUU on the 5' side of the targeting sequence UGUU UCUAC U-containing crRNA can be used, and the underlined sequences form base pairs with each other to form a stem-loop structure) coding GUAGA sequence, or an oligo DNA sequence obtained by ligating a crRNA coding sequence and, if necessary, a known tracrRNA coding sequence (e.g., when recruiting Cas9 as a Cas effector protein, the tracrRNA coding sequence such as gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt; SEQ ID NO: 2, or gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtggtgctttt; SEQ ID NO: 3) can be designed and chemically synthesized using a DNA / RNA synthesizer. Here, the "target strand" refers to the strand that hybridizes with the crRNA of the target nucleotide sequence, and the strand that becomes single-stranded by the hybridization of the target strand and the crRNA with the opposite strand is referred to as the "non-targeted strand". When representing the target nucleotide sequence by one strand (e.g., when representing the PAM sequence or the positional relationship between the target nucleotide sequence and the PAM), it shall be represented by the sequence of the non-targeted strand.

[0054] ​The length of the targeting array is not particularly limited as long as it can specifically bind to the target nucleotide sequence. For example, it is 15 to 30 nucleotides, preferably 18 to 25 nucleotides.

[0055] The design of the targeting array can be carried out, for example, when using Cas9 as the Cas effector protein by using publicly available guide RNA design websites (such as CRISPR Design Tool, CRISPRdirect, etc.) to list up a 20-mer sequence adjacent to PAM (for example, NGG in the case of SpCas9) on the 3'-side from the CDS sequence of the target gene, and selecting a sequence that causes an amino acid change in the protein encoded by the target gene when C within 7 nucleotides from the 5'-end is converted to T in the 3'-direction. Also, when using targeting arrays of lengths other than 20-mers, sequences can be appropriately selected. From among these candidates, a candidate sequence with a small number of off-target sites in the target host genome can be used as the targeting array. If the guide RNA design software used does not have a function to search for off-target sites in the host genome, for example, for 8 to 12 nucleotides on the 3'-side of the candidate sequence (the seed sequence with high ability to identify the target nucleotide sequence), a Blast search can be performed against the host genome to search for off-target sites. When there is no function to search for off-target sites in the host genome in the guide RNA design software used, for example, for 8 to 12 nucleotides on the 3'-side of the candidate sequence (the seed sequence with high ability to identify the target nucleotide sequence), a Blast search can be performed against the host genome to search for off-target sites.

[0056] The DNA encoding the guide RNA can also be inserted into the same expression vector as described above. As the promoter, it is preferable to use a pol III-based promoter (e.g., SNR6, SNR52, SCR1, RPR1, U3, U6, H1 promoter, etc.) and a terminator (e.g., poly T sequence (T6 sequence, etc.)). This is preferred.

[0057] The DNA encoding the guide RNA (crRNA or crRNA-tracrRNA chimera) is the target nucleotide An oligo that links an array complementary to the target strand of the array with a known tracrRNA sequence (when recruiting Cas9) or the direct repeat sequence of crRNA (when recruiting Cpf1) The gRNA sequence can be designed and chemically synthesized using a DNA / RNA synthesizer.

[0058] DNA or RNA encoding mutant Cas and / or a nucleobase conversion enzyme, etc., and guide RNA-tracrRNA or DNA encoding the same can be introduced into host cells by the same method as above according to the host. It can be introduced.

[0059] Conventional artificial nucleases involve DNA double-strand breaks (DSBs), so targeting sequences within the genome causes growth inhibition and cell death presumably due to random chromosomal breaks (off-target cleavage). In the present invention, modification of the target site is performed using a conversion reaction (particularly a deamination reaction) or a depurination reaction of substituents on DNA bases and the subsequent repair mechanism instead of DNA cleavage, so a significant reduction in toxicity can be achieved.

[0060] In the method of the present invention, it is also possible to modify the target site using a plurality of target nucleotide sequences at different positions. Therefore, in one embodiment of the present invention, two or more nucleic acid sequence recognition modules that specifically bind to different target nucleotide sequences can be used. In this case, each one of these nucleic acid sequence recognition modules and a nucleobase conversion enzyme, etc. form a nucleic acid modification enzyme complex. Here, a common one can be used as the nucleobase conversion enzyme, etc. For example, when using the CRISPR-Cas system as the nucleic acid sequence recognition module, a complex of a Cas effector protein and a nucleobase conversion enzyme, etc. (including a fusion protein) (mu) uses common materials, and as guide RNAs (crRNA or crRNA-tracrRNA chimeras), two or more crRNAs that form complementary strands with different target nucleotide sequences, or chimeric RNAs of each of two or more crRNAs and tracrRNA can be prepared and used. On the other hand, when using a zinc finger motif or a TAL effector as the nucleic acid sequence recognition module For example, a nucleic acid base conversion enzyme or the like can be fused to each nucleic acid sequence recognition module that specifically binds to a different target nucleotide.

[0061] In order to express the nucleic acid-modifying enzyme complex of the present invention in a host cell, an expression vector containing DNA encoding the nucleic acid-modifying enzyme complex is introduced into the host cell as described above, but efficiently In order to introduce mutations, it is desirable that the expression of the nucleic acid-modifying enzyme complex be maintained at a certain level or higher for a certain period or longer. From this perspective, it is certain that the expression vector is integrated into the host genome, but the continuous expression of the nucleic acid-modifying enzyme complex increases the risk of off-target cleavage. Therefore, after successfully achieving the modification of the target site, it is preferably removed promptly. As a means for removing the DNA integrated into the host genome, the Cre-loxP system Methods using the FLP-FRT system or methods using transposons can be mentioned.

[0062] Alternatively, by transiently expressing the nucleic acid-modifying enzyme complex of the present invention in a host cell for only the period required for a nucleic acid reaction to occur at a desired time and for the modification of the target site to be fixed, the risk of off-target cleavage can be avoided while efficiently realizing the editing of the host genome. Those skilled in the art can appropriately determine a suitable expression induction period based on the culture conditions used and the like. The expression induction period of the nucleic acid encoding the nucleic acid-modifying enzyme complex of the present invention may be extended beyond the above-mentioned "period required for the modification of the target site to be fixed" as long as it does not cause side effects to the host cell.

[0063] As a means for transiently expressing the nucleic acid-modifying enzyme complex of the present invention for a desired period at a desired time, a construct (expression vector) containing a nucleic acid encoding the nucleic acid-modifying enzyme complex (in the mutant CRISPR-Cas system, DNA encoding a guide RNA and DNA encoding a Cas effector protein, a nucleic acid-modifying enzyme, etc.) in a form in which the expression period can be controlled is prepared and introduced into a host. Examples of the "form in which the expression period can be controlled" include those in which the nucleic acid encoding the nucleic acid-modifying enzyme complex of the present invention is placed under the control of an inducible regulatory region. The "inducible regulatory region" is not particularly limited, and examples include an operon of a temperature-sensitive (ts) mutant repressor and an operator controlled thereby. Examples of the ts mutant repressor include, but are not limited to, a ts mutant of the cI repressor derived from λ phage. In the case of the λ phage cI repressor (ts), it binds to the operator and suppresses downstream gene expression at 30°C or lower (e.g., 28°C), but dissociates from the operator at a high temperature of 37°C or higher (e.g., 42°C), so gene expression is induced. Therefore, host cells into which a nucleic acid encoding a nucleic acid-modifying enzyme complex has been introduced are usually cultured at 30°C or lower, the temperature is raised to 37°C or higher at an appropriate time and cultured for a certain period to perform homologous recombination, and after a mutation has been introduced into the target gene, the temperature is quickly returned to 30°C or lower, whereby the period during which the expression of the target gene is suppressed can be minimized, and even when targeting an essential gene in a host cell, editing can be efficiently performed while suppressing side effects. When using a temperature-sensitive mutation, for example, a temperature-sensitive mutant of a protein required for autonomous replication of the vector is loaded onto a vector containing DNA encoding the nucleic acid-modifying enzyme complex of the present invention By doing so, after the expression of the nucleic acid-modifying enzyme complex, autonomous replication immediately becomes impossible, and as the cell divides, the vector naturally drops out. Examples of such temperature-sensitive mutant proteins include, but are not limited to, temperature-sensitive mutants of Rep101 ori required for the replication of pSC101 ori. Rep101 ori (ts) acts on pSC101 ori at 30°C or lower (e.g., 28°C) to enable autonomous replication of the plasmid, but loses its function at 37°C or higher (e.g., 42°C), and the plasmid can no longer replicate autonomously. Therefore, by using in combination with the cI repressor (ts) of the above λ phage, transient expression of the nucleic acid-modifying enzyme complex of the present invention and plasmid removal can be carried out simultaneously.

[0064] In addition, the DNA encoding the nucleic acid-modifying enzyme complex of the present invention is introduced into a host cell under the control of an inducible promoter (e.g., lac promoter (induced by IPTG), cspA promoter (induced by cold shock), araBAD promoter (induced by arabinose), etc.), and an inducer is added to (or removed from) the medium at an appropriate time to induce the expression of the nucleic acid-modifying enzyme complex, followed by culturing for a certain period to perform a nucleic acid modification reaction. After a mutation is introduced into the target gene, transient expression of the nucleic acid-modifying enzyme complex can be achieved.

[0065] Hereinafter, the present invention will be described by way of examples. However, the present invention is not limited to these examples.

Examples

[0066] <Cell Line, Culture, Transformation, and Expression Induction of Saccharomyces cerevisiae> Using the budding yeast Saccharomyces cerevisiae BY4741 strain (requiring leucine and uracil), it was cultured in a Dropout composition according to the nutritional requirements of standard YPDA medium or SD medium. Cultivation Between 25°C and 30°C, static culture on an agar plate or shaking culture in a liquid medium was performed. Transformation was carried out using the lithium acetate method, and selection was performed in SD medium adjusted to appropriate auxotrophy. For induction of expression by galactose, after pre-culturing overnight in an appropriate SD medium, the cells were subcultured into SR medium with the carbon source changed from 2% glucose to 2% raffinose and cultured overnight, and then further subcultured into SGal medium with the carbon source changed to 0.2% galactose and cultured for 3 hours to two nights for expression induction. For the measurement of viable cell count and Can1 mutation rate, the cell suspension was appropriately diluted and spread on SD plate medium and SD-Arg + 60 mg / l Canavanine plate medium or SD + 300 mg / l Canavanine plate medium, and the number of colonies that appeared after 3 days was counted as the viable cell count. Using the number of viable colonies on the SD plate as the total cell count and the number of viable colonies on the Canavanine plate as the number of resistant mutants, the mutation rate was calculated and evaluated. The mutation-introduced site was identified by amplifying the DNA fragment containing the target gene region of each strain by colony PCR method and then performing DNA sequencing and alignment analysis based on the sequence of Saccharomyces Genome Database (http: / / www.yeastgenome.org / ).

[0067] <Cell line, culture, and expression induction of animal cells> Human embryonic kidney-derived cells (HEK293T cells) were cultured at 37°C and 5% CO2 using DME-glutamax medium (Thermo Fisher Scientific) supplemented with 10 μg / mL puromycin (Life Technologies) and 10% fetal bovine serum (FBS) (Biosera, Nuaille, France). 5% trypsin was used for cell harvesting. HEK293T cells stored in a deep freezer were thawed in a 37°C water bath and seeded into a 75 T-flask to a density of 5x10 6 cells. After culturing for 1 - 3 days, the cells were harvested and adjusted to 0.5x10 5They were seeded into each well of a 24-well plate to achieve cells / well. After culturing for 1 - 3 days, for the cells in each well in a 60 - 80% confluent state, the following plasmids (effector plasmid and reporter plasmid) at 500 ng / well each (total 1 μg / well), 200 nM donor DNA, and 1.5 μl of FugeneHD (Promega) were used for transfection. The donor DNA used in each example is shown in Table 1. 72 hours after transfection, the cells were collected, and the fluorescence of iRFP and EGFP was detected using FACS. From the number of detected cells, the recombination efficiency (%) was calculated by the following formula.

[0068]

Table 1

[0069]

Equation

[0070] <Nucleic acid manipulation> DNA was processed and constructed by any of PCR method, restriction enzyme treatment, ligation, Gibson Assembly method, and artificial chemical synthesis. The plasmids used the pRS415 for leucine selection and pRS426 for uracil selection as the backbone of yeast - E. coli shuttle vectors. The plasmids were amplified in E. coli strain XL - 10 gold or DH5α and introduced into yeast by the lithium acetate method.

[0071] <Construction of constructs for budding yeast> Sequences such as homology arms, guide RNAs, and inserted sequences were designed with reference to the yeast genome database (https: / / www.yeastgenome.org / ). Vector construction was carried out according to the method described in Nishida K. et al., Science 16:353(6305) (2016) doi: 10.1126 / science.aaf8729. The 1 x gRNA vector corresponds to a vector in which the nucleotide sequence from position 5871 to 5890 of the sequence of SEQ ID NO: 15 was replaced with the complementary sequence of the target nucleotide sequence of L86 or M4. The 2 x gRNA vector is one in which the nucleotide sequence from position 2638 to 2657 of the sequence of SEQ ID NO: 16 was replaced with the complementary sequence of the target nucleotide sequence of any one of L86, L87, L88, L93, and R90, and the nucleotide sequence from position 6293 to 6312 of SEQ ID NO: 16 was replaced with the complementary sequence of the target nucleotide sequence of any one of L87, R89, R90, R91, and R92. The above target nucleotides are as follows. L86: CGAACAGAGTAAACCGAATC (SEQ ID NO: 17) L87: AGCACTATCAAGGCTAATAA (SEQ ID NO: 18) L88: GCGAACTTGAAGAATAACCA (SEQ ID NO: 19) R89: TCACCTAACTCAGACATTAT (SEQ ID NO: 20) R90: TTGCTGATTCTATTTACAAA (SEQ ID NO: 21) R91: GCAAACTCTATTCTTGGTGC (SEQ ID NO: 22) R92: ACCAGAGTATCATCCATGTC (SEQ ID NO: 23) L93: AATTCGGACACTTTAGGGTT (SEQ ID NO: 24) M4: AGATATTATACCTGGACCCC (SEQ ID NO: 25)

[0072] <Construction of constructs for animal cells> The pcDNA3.1 vector backbone and the sequences of CMV, PmCDA1, Cas9, H1, and sgRNA are derived from the paper by Nishida et al 2016. Each mutation was introduced by the PCR method. The EF1, iRFP, and mEGFP fragments were prepared by artificial gene synthesis. The fragments were inserted and replaced by Gibson assembly or ligation reaction.

[0073] The sequences of the prepared vectors SY4 (H1_sgRNA, CMV_mEGFP) (reporter plasmid), vector SY45 (CMV_Cas9-PmCDA1, EF1_iRFP), and vector SY45 (CMV_Cas9, EF1_iRFP) are shown by SEQ ID NOs: 42 to 44, respectively. Vector SY45 (CMV_nCas9(D10A)-PmCDA1, EF1_iRFP) corresponds to the sequence in which the bases at positions 770 to 772 are replaced with gct in SEQ ID NO: 43. Vector SY45 (CMV_nCas9(H840A)-PmCDA1, EF1_iRFP) corresponds to the sequence in which the bases at positions 3260 to 3262 are replaced with gct in SEQ ID NO: 43. Vector SY45 (CMV_dCas9-PmCDA1, EF1_iRFP) corresponds to the sequence in which the bases at positions 770 to 772 and the bases at positions 3260 to 3262 are replaced with gct in SEQ ID NO: 43. Also, vector SY45 (CMV_nCas9(D10A), EF1_iRFP) corresponds to the sequence in which the bases at positions 3724 to 3726 are replaced with gct in SEQ ID NO: 44. Vector SY45 (CMV_nCas9(H840A), EF1_iRFP) corresponds to the sequence in which the bases at positions 6214 to 6216 are replaced with gct in SEQ ID NO: 44. Vector SY45 (CMV_dCas9, EF1_iRFP) corresponds to the sequence in which the bases at positions 3724 to 3726 and the bases at positions 6214 to 6216 are replaced with gct in SEQ ID NO: 44.

[0074] <Sequencing of Cellular DNA> iRFP-positive cells were sorted by FACS. Then, genomic DNA and the introduced plasmid DNA were extracted. Subsequently, the following samples were prepared, and PCR was performed under the following conditions to amplify the target region. Sample preparation: 1 μL of gDNA 1 μL of each primer 5 μL of rTaq 10x Buffer 3 μL of 25 mM MgCl2 5 μL of 2 mM dNTP 0.5 μL of rTaq (TOYOBO) ddH 2 O 33.5 μL Total: 50 μL PCR conditions: After maintaining at 94°C for 2 minutes, 33 cycles of 45 seconds at 94°C, 45 seconds at 55°C, and 1 minute 30 seconds at 72°C were performed, and finally, it was maintained at 72°C for 5 minutes. The following SY157 and SY182 were used as primers for amplification. The size of the amplification product is 1554 bp. SY157: TTCTGCTTGTCGGCCATGAT (SEQ ID NO: 47) SY182: AGGCAAGGCTTGACCGACAATT (SEQ ID NO: 48) The amplification products were excised and purified using Fastgene. Then, each purified product and pGEM-t easy vector were TA-cloned, and Escherichia coli (JM109) was transformed with the vector. Next, 24 colonies were picked for each sample (with blue-white screening), and the plasmid DNA was purified by Mini prep (using Fastgene).

[0075] Next, the following sequencing mixture was prepared and outsourced to Genewiz to obtain sequence information. 。 2.5 μL of each sample 2.5 μL of primer SY157 (10 pmol / μL) ddH 2 O 10 μL Total: 15 μL Finally, the obtained array information was aligned using Snapgene.

[0076] Example 1: Insertion of an Inserted Sequence into a Target Site Using dCas9-CDA or nCas9-CDA and Donor DNA The budding yeast BY4741 strain was co-transformed with plasmid vectors 1525 (where the 6036th base of SEQ ID NO: 4 is g and the 6037th base is c) or 1526 (where the 6036th base of SEQ ID NO: 4 is c and the 6037th base is a), and 1059 (SEQ ID NO: 5) or 1149 (corresponding to a vector in which the 3890th to 3909th base sequence of the SEQ ID NO: 5 sequence was replaced with TCCAATAACGGAATCCAACT (SEQ ID NO: 6)), and selected on a nutrient-deficient medium (SD-Leu-Ura). It was cultured overnight in an S-Leu-Ura 2% raffinose medium. It was diluted 1 / 32 into an S-Leu-Ura 2% raffinose + 0.02% galactose medium and cultured overnight at 30°C. It was spotted on SD-Ura-Leu and SD-Ura-Leu + Canavanine plates at a 10-fold dilution. After two days, Canavanine-resistant colonies were subjected to sequence analysis. As a result, the insertion of mutations into the target site was confirmed (Figure 2).

[0077] Example 2: Construction of a Recombination Evaluation System The plasmid vector 1548 (SEQ ID NO: 7) was transformed into the BY4741 strain with a DNA fragment treated with SmaI / HpaI and selected on an SD-Ura medium. Sequence analysis confirmed the integration into the Ade1 region.

[0078] Example 3: Demonstration Experiment of a Recombination Reaction Using the Recombination Evaluation System Any of the above plasmid vectors was transformed into the experimental strain for demonstration and selected on SD-Leu-Ura medium. It was cultured overnight in S-Leu-Ura 2% raffinose medium. It was diluted 1 / 32 in S-Leu 2% raffinose + 0.02% (or 0.2%) galactose medium and cultured overnight at 30°C for 5 generations. For 20 generations, the 1 / 32 dilution was repeated 4 times in total. It was spotted on an SD-Leu plate at a 10-fold dilution, and the number and color of colonies were evaluated 2 days later. As a result, colonies that had recovered the Ade1 function and turned white appeared at a high frequency, indicating the induction of homologous recombination at the target site by the method of the present invention (Figure 4).

[0079] Example 4: Demonstration Experiment of Knock-In or Knock-Out According to the Present Invention The budding yeast BY4741 strain was double-transformed with plasmid vector 1251 (SEQ ID NO: 8) and a 2x gRNA vector and selected by a auxotrophic medium (SD-Leu-Ura). It was cultured overnight in S-Leu-Ura 2% raffi nose medium. It was diluted 1 / 32 in S-Leu-Ura 2% raffinose + 0.2% galactose medium and cultured overnight at 30°C. It was spotted on SD-Ura-Leu and SD-Ura-Leu (+Canavanine) plates at a 10-fold dilution, and Canavanine-resistant colonies were subjected to sequence analysis 2 days later. As a result, knock-in was achieved with high efficiency by the method of the present invention (Figure 6).

[0080] Example 5: Demonstration Experiment of a Recombination Reaction in Animal Cells Using single-stranded oligo DNA (70 bases long) (Table 1) as donor DNA, it was verified whether a recombination reaction occurs in animal cells (HEK293T cells). A schematic diagram of the experiment is shown in Fig. 7. As the reporter plasmid, vector SY4 (H1_sgRNA, CMV_mEGFP) was used, and as the effector plasmid, vector SY45 (CMV_Cas9-PmCDA1, EF1_iRFP), vector SY45 (CMV_nCas9(D10A)-PmCDA1, EF1_iRFP), vector SY45 (CMV_nCas9(H840A)-PmCDA1, EF1_iRFP), vector SY45 (CMV_dCas9-PmCDA1, EF1_iRFP), vector SY45 (CMV_Cas9, EF1_iRFP), vector SY45 (CMV_nCas9(D10A), EF1_iRFP), vector SY45 (CMV_nCas9(H840A), EF1_iRFP) or vector SY45 (CMV_dCas9, EF1_iRFP) was used. When Fw2 and Fw3 were used as donor DNA If homologous recombination occurred successfully, as a result, a start codon would occur in the sequence encoding EGFP, and thus the expression of EGFP would be observed. Fw1 is a donor DNA designed so that no start codon would occur in the sequence encoding EGFP even if homologous recombination occurred, and it was used as a negative control . Fw3 has one base substitution (c→g) in the homology arm of Fw2. It was used to verify whether a homologous recombination reaction would occur even when the homology arm is not completely homologous to the adjacent region of the target site, and to verify whether mutations at multiple different positions can also be introduced. The results are shown in Fig. 8. When nCas9-pmCDA1 was used, the homologous recombination efficiency was higher than when nCas9 was used, and it was shown to exhibit a homologous recombination efficiency equal to or higher than that when Cas9 was used. Also, when dCas9-pmCDA1 was used, significant homologous recombination was observed. As donor DNA

[0081] ​​​No significant difference in the homologous recombination rate was observed between the cases using Fw2 and Fw3.

[0082] Example 6: Verification of the Influence on the Homologous Recombination Reaction by the Base Number of Donor DNA and the Type of Complementary Strand (Forward (Fw) or Reverse (Rv)) Reaction Using single-stranded oligo DNA (50 bases long) (Table 1) as donor DNA, it was verified whether a recombination reaction occurs in animal cells (HEK293T cells). A schematic diagram of the experiment is shown in Fig. 9. As the reporter plasmid, vector SY4 (H1_sgRNA, CMV_mEGFP) was used, and as the effector plasmid, vector SY45 (CMV_nCas9(D10A))-PmCDA1, EF1_iRFP) or vector SY45 (CMV_nCas9(H840A))-PmCDA1 was used.

[0083] The results are shown in Fig. 10. Homologous recombination is possible even with 50-base-long single-stranded oligo DNA, the complementary strand can undergo homologous recombination with either Fw or Rv, and it was shown that nCas9 can undergo homologous recombination with either version of nCas9(D10A) and nCas9(H840A).

[0084] Example 7: Verification of the Homology Arm of Donor DNA Using donor DNA (Table 1) with homology arms for different homologous regions, the change in the efficiency of the homologous recombination reaction due to the homologous region was verified. A schematic diagram of the experiment is shown in Fig. 11. As the reporter plasmid, vector SY4 (H1_sgRNA, CMV_mEGFP) was used, and as the effector plasmid, vector SY45 (CMV_nCas9(D10A))-PmCDA1, EF1_iRFP) or vector SY45 (CMV_nCas9(H840A))-PmCDA1 was used.

[0085] The results are shown in Fig. 12. When focusing on the site where nicks in the homologous region occur or the deaminase site by PmCDA1, by designing the donor DNA such that the 3'-side homologous arm of the region is longer than the 5'-side homologous arm, the efficiency of homologous recombination is improved, as shown.

[0086] Example 8: Verification of Modifications in the DNA of Mammalian Cells Using the same gRNA and donor DNA as in the experiment using Fw2 of Example 5, the modification in DNA was verified. The results are shown in Table 2 below. When using nCas9(D10A)-PmCDA1 and nCas9(H840A)-PmCDA1, compared with the case of using Cas9, the generation of Indel, which is a by-product, was significantly suppressed, that is, it was demonstrated that the cytotoxicity was reduced. Note that the term "DNA" used in this example includes both genomic DNA and plasmid DNA.

[0087]

Table 2

[0088] From the above, when using nCas9-CDA, the efficiency of homologous recombination is at least comparable to that of using Cas9, and it is also possible to avoid the Indel as a by-product and the high cytotoxicity that occur when using Cas9. Therefore, the method using nCas9-CDA can be more beneficial and useful than the conventional method. Furthermore, by using nCas9-CDA, higher efficiency can be achieved than nCas9 that is used for the purpose of avoiding the above problems that occur when using Cas9.

[0089] This application is based on Japanese Patent Application No. 2018-059073 (filing date: March 26, 2018), the content of which is incorporated herein in its entirety.​​​​​​​

Industrial Applicability

[0090] According to the present invention, there is provided a novel DNA modification technique using a nucleic acid base conversion enzyme such as deaminase or DNA glycosylase, which can switch the orientation and combination of genes or knock in gene fragments without being restricted by the type and site of mutations that can be introduced, and can modify the target site without cleaving double-stranded DNA. Since the DNA modification technique of the present invention can modify the target site without cleaving double-stranded DNA, unintended rearrangements and toxicity associated with cleavage can be suppressed to a low level, and moreover, the target site can be modified much more efficiently than conventional methods, so it is extremely useful.

Claims

1. A complex in which a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in a selected double-stranded DNA used in a method for modifying a target site of double-stranded DNA possessed by a cell is bound to a nucleic acid base conversion enzyme or a DNA glycosylase, and the method involves contacting the double-stranded DNA with the complex and a donor DNA containing an insertion sequence, and replacing the target site with the insertion sequence or inserting the insertion sequence into the target site without cleaving at least one strand of the double-stranded DNA at the target site.

2. The complex according to claim 1, wherein the donor DNA contains a sequence homologous to an adjacent region of the target site.

3. The complex according to claim 1 or 2, wherein the nucleic acid sequence recognition module is selected from the group consisting of a CRISPR-Cas system in which at least one DNA cleavage ability of a Cas effector protein is inactivated, a zinc finger motif, a TAL effector, and a PPR motif.

4. The complex according to any one of claims 1 to 3, wherein the nucleic acid sequence recognition module is a CRISPR-Cas system in which only one of the two DNA cleavage abilities of a Cas effector protein is inactivated.

5. The complex according to any one of claims 1 to 3, wherein the nucleic acid sequence recognition module is a CRISPR-Cas system in which both DNA cleavage abilities of a Cas effector protein are inactivated.

6. The complex according to any one of claims 1 to 5, wherein the nucleic acid base conversion enzyme is a deaminase.

7. The complex according to claim 6, wherein the deaminase is a cytidine deaminase.

8. The complex according to claim 7, wherein the cytidine deaminase is PmCDA1.

9. The complex according to any one of claims 1 to 8, wherein the contact between the double-stranded DNA and the complex is carried out by introducing a nucleic acid encoding the complex into the cell.

10. The complex according to any one of claims 1 to 9, wherein the cell is a prokaryotic cell.

11. The complex according to any one of claims 1 to 9, wherein the cell is a eukaryotic cell.

12. The complex according to any one of claims 1 to 11, wherein the cell is a microbial cell.

13. The complex according to claim 11, wherein the eukaryotic cell is a plant cell, an insect cell, or an animal cell.

14. The complex according to claim 13, wherein the animal cell is a vertebrate cell.

15. The complex according to claim 14, wherein the vertebrate cell is a mammalian cell.

Images