Gene therapy for ocular disorders
Codon-optimized rAAV vectors delivering the LCA5 gene to the retina provide long-term correction of Leber congenital amaurosis symptoms, addressing the lack of effective treatments for this severe form of inherited blindness.
Patent Information
- Application Number
- JP2025068834
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2017-03-10
- Filing Date
- 2025-04-18
- Publication Date
- 2025-08-05
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
There is a need for effective treatments for Leber congenital amaurosis (LCA) caused by mutations in the LCA5 gene, which encodes reversillin, as current therapies do not adequately address this severe form of inherited blindness.
Development of codon-optimized recombinant adeno-associated virus (rAAV) vectors that deliver the LCA5 gene encoding reversillin to the retina via intravitreal or subretinal administration, leading to long-term clinical correction of LCA symptoms.
The rAAV vectors result in clinically meaningful correction of LCA symptoms for potentially over 10 years, restoring visual function and slowing or halting retinal degeneration.
Smart Images

Figure 2025114604000001_ABST
Abstract
Description
[Technical Field]
[0001] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with United States government support under Grant Nos. R21EY020662 and P30EY001583 from the National Eye Institute (NEI) / National Institutes of Health (NIH). The United States government has certain rights in this invention.
[0002] Incorporation of materials submitted electronically Applicants hereby incorporate by reference the sequence listing material submitted in electronic form, which is stored as a file entitled "UPN-16-7696PCT_Seq_Listing_ST25.txt." [Background technology]
[0003] One of the most severe groups of inherited blinding disorders is Leber congenital amaurosis (LCA; OMIM 204000). LCA is rare, occurring in 1:50,000 individuals, is usually inherited in an autosomal recessive manner, and is caused by mutations in one of at least 22 different genes (sph.uth.edu / RetNet / sum-dis.htm). Clinical features include severely abnormal vision (reduced visual acuity and visual field) in infancy or early childhood, nystagmus, and progressive loss of vision early in life. Clinical examination reveals loss of scotopic and photopic electroretinogram (ERG) responses, amaurosis, decreased light sensitivity, and retinal pigmentary changes. Currently, there is no approved treatment for LCA.
[0004] A form of LCA caused by mutations in RPE65, a gene encoding a 65 kDa protein in the retinal pigment epithelium (Redmond TM, Yu S, Lee E, Bok D, Hamasaki D, Chen N, et al. Rpe65 is necessary for production of 11-cis-vitamin B A in the retinal visual cycle. Nat Genet (1998) 20(4):344-51; Redmond T, Hamel C. Genetic analysis of RPE65: from human disease to mouse model. Methods in Enzymol (2000) 317:705-24, both of which are incorporated herein by reference.) has attracted considerable attention in recent years because it has been the subject of several clinical trials of gene augmentation therapies. Using adeno-associated virus (AAV) serotype 2, several groups have shown that delivery of a wild-type copy of RPE65 cDNA to the retinal pigment epithelium (RPE) is safe and can ameliorate numerous defects, including night blindness (3-9). A randomized, multicenter, phase 3 trial testing AAV2-hRPE65v2 (or voretigene neparvovec, funded by Spark Therapeutics, Philadelphia, PA) showed that subretinal injection of this reagent improved light sensitivity, visual field, and the ability to accurately and rapidly navigate visual stimuli across a range of luminance conditions (10, 11). The US Food and Drug Administration (FDA) granted marketing authorization for voretigene neparvovec-rzyl on December 19, 2017, making it one of the first gene therapy drugs approved in the United States. Progress in the development of treatments for LCA caused by mutations in RPE65, i.e., LCA2, paves the way for the development of treatments for most early-onset retinal degenerations caused by mutations in photoreceptor-specific genes, not just RPE-specific genes.
[0005] One of the most severe forms of this already severe condition (LCA) is caused by mutations in LCA5, a photoreceptor-specific gene that encodes reversillin (12-20). LCA5 mutations are estimated to account for approximately 2% of LCA cases, but may be more common in genetically isolated populations. (16) LCA5 mutations have also been identified as a cause of early-onset forms of other retinal degenerations, such as cone dystrophy and autosomal recessive retinitis pigmentosa (ARRP). (15,16,21) Summary of the Invention [Problem to be solved by the invention]
[0006] Therefore, there is a need for compositions useful for expressing reversilin in subjects in need thereof. [Means for solving the problem]
[0007] Embodiments described herein relate to compositions and methods relating to AAV gene therapy vectors for delivering human LCA5 to a subject in need thereof, which upon intravitreal or subretinal administration result in clinically meaningful correction of Leber congenital amaurosis (LCA) for long periods of time, potentially for 10 years or more.
[0008] In one aspect, a codon-optimized, modified nucleic acid sequence encoding human reversilin is provided. In one embodiment, the codon-optimized nucleic acid sequence is a variant of SEQ ID NO: 3 or SEQ ID NO: 2. In another embodiment, the codon-optimized nucleic acid sequence is SEQ ID NO: 3. In another embodiment, the nucleic acid sequence is codon-optimized for human expression.
[0009] In another aspect, an expression cassette is provided comprising a codon-optimized nucleic acid sequence encoding reversillin. In one embodiment, the expression cassette comprises the nucleic acid sequence of SEQ ID NO: 3, which encodes human reversillin. In yet another embodiment, the sequence encoding reversillin is located between the 5' and 3' AAV ITR sequences.
[0010] In yet another aspect, a recombinant adeno-associated virus (rAAV) vector is provided. The rAAV comprises an AAV capsid and a vector genome packaged therein. In one embodiment, the vector genome comprises: (a) an AAV 5' inverted terminal repeat (ITR) sequence, (b) a promoter, (c) a coding sequence encoding human reversillin; and (d) an AAV 3' ITR. In one embodiment, the rAAV vector further comprises expression control sequences directing expression of reversillin in a host cell. In a further embodiment, the reversillin sequence is the protein sequence of SEQ ID NO: 1. In one embodiment, the vector genome is the sequence from nt 1 to 4379 of SEQ ID NO: 8. In another embodiment, the vector genome is the sequence from nt 1 to 4368 of SEQ ID NO: 9. In yet another embodiment, the LCA5 coding sequence in any of the identified vector genomes is replaced with another LCA5 coding sequence described herein.
[0011] In another aspect, an aqueous suspension suitable for administration to a patient with LCA is provided. In one embodiment, the suspension comprises an aqueous suspension and about 1×10 10 GC or viral particles ~ approx. 1 x 10 13 The viral particles or viral particles / eye of GC include recombinant adeno-associated viruses (rAAV) described herein useful for the treatment of LCA.
[0012] In another aspect, the pharmaceutical composition comprises a pharmaceutically acceptable carrier, diluent, excipient, and / or adjuvant, as specifically described herein, and a nucleic acid sequence, a plasmid, a vector, or a viral vector, such as rAAV.
[0013] In another aspect, a method for treating Leber's congenital amaurosis caused by a defect in the reversillin gene (LCA5) and / or restoring visual function in a mammalian subject having LCA comprises delivering a recombinant AAV vector encoding reversillin described herein to a subject in need thereof via intravitreal, subretinal, or intravascular injection.
[0014] In another aspect, there is provided a use of an AAV vector described herein in treating Leber's congenital amaurosis caused by a defect in the reversillin gene (LCA5) and / or restoring visual function in a mammalian subject having LCA, comprising delivering a recombinant AAV vector encoding reversillin described herein to a subject in need thereof via intravitreal, subretinal, or intravascular injection.
[0015] Other aspects and advantages of the present invention will become apparent from the following detailed description of the invention. [Brief explanation of the drawings]
[0016] [Figure 1]Figure 1A shows the transgene cassettes used to generate the AAV7m8.CBA.hopt.LCA5 and AAV7m8.CBA.EGFP described herein. Figures 1B-1D provide an alignment of the human nucleic acid sequence of LCA5 (Native_LCA5) in SEQ ID NO: 2 with the codon-optimized LCA5 (Codon_optimized_LCA5) sequence in SEQ ID NO: 3. Figures 1E-1F provide a plasmid map and feature list for the pAAV.CMV.CBA.human codon-optimized levelsilin vector. The nucleic acid sequence is reproduced in SEQ ID NO: 8. Figures 1G-1H provide immunofluorescence analysis of eyes injected with AAV7m8-hopt-LCA5 at P5, and analysis performed at P15 shows levelsilin colocalizing with the base of tubulin-positive outer segments as described in Examples 1, 2, and 4. After intravitreal (IVT, Figure 1G) or subretinal (SR, Figure 1L) injection, reversillin was distributed throughout the retina and was nearly absent from photoreceptors at P95. In contrast, reversillin was absent in untreated P15 and P95 Lca5- / - retinas. SR, subretinal; IVT, intravitreal; (-) untreated Lca5- / -. Schematics illustrating the intravitreal injection scheme (Figure 1G) and subretinal injection scheme (Figure 1H) are provided. Figure 1I shows reversillin expression in both wild-type and Lca5- / - mice subretinally injected with the AAV.LCA5 vector at P20. [Figure 2]Figures 2A-2I show normalized pupillary reflex amplitude measured at 3 months of age for mice injected with AAV7m8.hopt-LCA5 compared with control (mock-injected) eyes of Lca5- / - mice treated with PN5 and PN15. Results are shown after (A) intravitreal and (B) subretinal injections or (C) untreated (-) control mice. (D) A graph shows the relative pupillary reflex amplitude (% of baseline pupil diameter) for the right eye of animals in each of the subgroups (A-C) and wild-type (C57B16) positive (+) control mice (E). Figures 2F and 2G are representative of the experimental scheme used to obtain the results shown in Figures 2A-2D. Figures 2H and 2I show a comparison of normalized pupillary reflex amplitude in experimental and control mice shown in Figures 2A-2D treated with PN5 versus PN15 via subretinal (SR, I) or intravitreal (IV, H) injection. *p<0.1; **p<0.05; ***p<0.01. [Figure 3] Figures 3A-3F show water maze results for AAV7m8.hopt-LCA5-injected and control (mock-injected) eyes of Lca5- / - mice treated at PN5 and PN15 and measured at 3 months of age, as described in Example 3. Figure 3A is a table showing the results of statistical analysis. Figure 3B is an illustration of typical results from the water maze test. Figure 3D is a bar graph showing the number of days until first successful training at PN5 or PN15 in Lca5- / - mice treated intravitreally or subretinally at birth with the AAV7m8.LCA5 vector. Wild-type mice served as controls. Figure 3D is a line graph of success rates at PN5 for various light intensities (x-axis) in Lca5- / - mice treated intravitreally at birth with the AAV7m8.LCA5 vector. Figure 3E is a line graph of the success rate at various light intensities (x-axis) in Lca5- / - mice treated subretinally at birth with the AAV7m8.LCA5 vector at PN5. Figure 3F is a line graph of the success rate at various light intensities (x-axis) in Lca5- / - mice treated intravitreally at birth with the AAV7m8.LCA5 vector at PN15. [Figure 4] 1 is a graph providing representative histology results after delivery of AAV7m8.hopt-LCA5 to Lca5gt / gt retinas at 5 days postnatal (PN). The graph shows the number of columns in the outer nuclear layer (ONL) after IVT or SR treatment with AAV.LCA5 and mock injection. [Figure 5] Figure 5A provides immunofluorescence results showing that rhodopsin (red) persists in treated (but not untreated) photoreceptors up to 3 months. Occasional photoreceptors are eGFP-positive (injection area identified by co-injection with AAV7m8.eGFP). Figures 5B–5D show that the multielectrode array (MEA) responses of rod and cone photoreceptors treated with AAV7m8.hopt-LCA5 in Lca5gt / gt are similar to those in wild-type (WT) retinas. (B) Response amplitude (the difference in firing rate before and after the flash) versus flash intensity data (not shown) measured from the average trace per flash. Responses from treated retinas are as high as 70% of those from WT retinas, while responses in untreated retinas are minimal or absent. (C) Response amplitudes from the retina in panel A for the first and second intensity series trials (before, during, and after the brightest light exposure at the end of the first trial, the stimulus series intensity increased by approximately 0.5 logs from scotopic to brightest photopic values during each intensity series trial). (D) Amplitudes of transient ON- (difference in firing rate before and after light onset), sustained ON- (difference between before light onset and offset), and OFF-responses (difference between before and after light offset) as a function of light intensity for the first and second intensity series trials. The light blue shaded area represents the range of WT responses (four retinas, mean ± standard deviation). The line-only trace shows the mean WT response amplitude. The horizontal arrow indicates the shift in sensitivity to the right due to exposure to the brightest light at the end of the first intensity series trial. Treated Lca5gt / gt and WT retinas show similar response / intensity dependence before and after bleaching, whereas the response of untreated Lca5gt / gt retinas becomes flatter. Circles with lines represent treated LCA5gt / gt. Triangles with lines represent control Lca5gt / gt. [Figure 6] Figures 6A-6E show that in untreated Lca5- / - retinas, there is massive cell death during photoreceptor degeneration early in life (and a delay in this degeneration after treatment with AAV.hopt.LCA5), as evidenced by (A) TUNEL assays (Figure 6A; Figure 6B-E, column 3) and (B) rhodopsin immunofluorescence analysis (Figure 6B-E, columns 1, 3, and 4). [Figure 7] Figures 7A-7D show that outer segments were present in AAV7m8.hopt.LCA5-treated Lca5- / - retinas but not in control Lca5- / - retinas. Transmission electron microscopy evaluation of AAV7m8.hopt.LCA5-injected retinas shows that in 3-month-old Lca5- / - mice, both rod and cone photoreceptor outer segments comprise stacked discs and connected cilia. Such structures were absent in untreated Lca5- / - retinas. (A, B) PN80 after intravitreal injection of AAV7m8p643 (codon-optimized levillin) at PN5. Representative photographs; (A1-A3): 12K resolution, merged photograph showing rows of photoreceptors, rod photoreceptors (arrowheads), cone photoreceptors (arrows), and many mitochondria (asterisks) in photoreceptors; (B), 20K resolution; (Bl) cross section of a cilium showing the 9+0 structure of microtubules and the membranous disc of rod-derived OS (arrow); (C) 30K resolution, basal body (arrowhead); (C1) sagittal section of a connecting cilium; (D) 12K resolution, no photoreceptors remain in the ONL; (D1) pyknotic nuclei of dying cells (arrowheads); (D2) floating remnants of dead organelles, including undulating ER (arrow). [Figure 8] Shown are the pupillary light responses of one retina in an adult male with LCA5 (red trace - upper line) with temporal characteristics similar to those of an age-matched male with normal vision (blue trace - lower line). The amplitude of constriction was reduced in the LCA5 patient compared to the normal individual. [Figure 9]Table 1 shows the thickness of various retinal layers, showing that outer nuclear layer (ONL) thickness remained constant for at least 3 months in treated (*) retinas compared to control retinas. No clear trend was observed in the other retinal layers (outer plexiform layer, OPL; inner nuclear layer, INL; inner plexiform layer, IPL). At each time point, the bars from left to right represent the thickness of the ONL, OPL, INL, and IPL, respectively. [Figure 10] 10 provides the results of light-mediated changes in the location of phototransduction-specific molecules after injection of AAV7m8.hopt.LCA5. [Figure 11] 11A-11B provide a plasmid map and a list of features of the pAAV.CMV.CBA.human native level cytosine vector, the nucleic acid sequence of which is reproduced in SEQ ID NO:9. [Figure 12]Figures 12A-12F show the rescued cilia phenotype in homozygous human LCA5 p.(Q279*) iPSC-RPE after treatment with AAV7m8.hopt-LCA5. (A) Confocal images show the hexagonal morphology of mature RPE cells, along with immunofluorescence-detectable RPE markers ZO-1 and MITF. Phase contrast (PC) images display the structure of iPSC-RPE cultures of RPE derived from both healthy individuals and LCA5 patients. (B) Quantitative real-time PCR (qRT-PCR) of LCA5 mRNA expression in normal-vision control RPE and RPE derived from an LCA5 patient. GAPDH was used to normalize expression levels. (C) Western blot analysis shows endogenous (*) levels of cilia protein in normal-vision control cells untreated ("-") or treated with AAV7m8.eGFP ("G"). Endogenous levilarin is not observed in untreated or AAV7m8.GFP-treated LCA5-affected cells. Stable levels of levilarin are present after infection of cells from both normal subjects and LCA5 carriers ("L") with AAV7m8.LCA5. Immunofluorescence analysis demonstrates the presence of Arl13b-positive primary cilia in normal-vision (D) and LCA5-derived (E) iPSC-RPE. levilarin is present in normal-vision control cells and LCA5-affected cells treated with AAV7m8.LCA5 (but not AAV7m8.eGFP). (F) Quantitative analysis of the number of cilia per cell in normal-vision vs. LCA5-iPSC-RPE demonstrates the rescue of ciliogenesis after treatment of LCA5-iPSC-RPE cells with AAV7m8.LCA5 (but not AAV7m8.eGFP). DETAILED DESCRIPTION OF THE INVENTION
[0017] The methods and compositions described herein include compositions and methods for delivering the LCA5 nucleic acid sequence encoding the Reversillin protein to a subject in need of treatment for Leber's congenital amaurosis (LCA). In some embodiments, such compositions involve codon optimization of the Reversillin coding sequence. This may be desirable because lower doses of the reagent may be used, thereby increasing the efficacy and, therefore, safety of the product. Also encompassed herein are compositions containing the native Reversillin coding sequence, as set forth in SEQ ID NO:2.
[0018] The technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to publications which provide such persons with general guidance to many of the terms used in this application. The definitions set forth herein are provided for the purpose of clarifying the description of the components and compositions described herein and are not intended to be limiting of the invention as claimed.
[0019] "Reversillin" is encoded by the LCA5 gene on chromosome 6ql4 and is a ciliary protein that localizes to the connecting cilia of photoreceptors and to microtubules, centrioles, and primary villi in cultured mammalian cells.
[0020] Reversillin is widely expressed throughout development and is found in the cilia of cultured cells as well as in the connecting cilia of mature photoreceptor cells. The connecting cilia are narrow structures between the photoreceptor inner segment, which houses the cell's biosynthetic machinery, and the outer segment, which contains the opsin-driven visual cascade. The connecting cilia function as conduits, supporting the bidirectional exchange of proteins and vesicles along ciliary microtubule tracks in a process known as intraflagellar transport (IFT). Applying quantitative affinity proteomics to a genetically engineered Lca5 mouse model, Boldt et al. demonstrated that loss of Lca5 function disrupts IFT, resulting in defects in photoreceptor outer segment development and impaired interaction between arrestins and opsins. Lca5 null (Lca5gt / gt) mice exhibit no cone or rod ERG responses, and by 19 years and 2 months of age, they undergo early progressive retinal degeneration with only a single row of dispersed nuclei in the outer nuclear layer (ONL) (compared to 8–10 rows of adjacent cells in the wild-type mouse retina).
[0021] Mutations in LCA5 cause a hereditary retinal degeneration called Leber congenital amaurosis (LCA). The phenotype in affected individuals is limited to the eye and leads to blindness. Of the six families studied by den Hollander, five had homozygous nonsense and frameshift mutations, and one family had a complete absence of LCA5 transcripts. Reversilin cDNA, or a nucleic acid encoding a codon-optimized version thereof, is appropriately sized to fit into an adeno-associated virus (AAV) vector. See, for example, the sequences in Figures 1A, 1E-1F, and 11A-11B. As described in the Examples below, rAAV-mediated gene augmentation strategies have been shown to correct retinal degeneration caused by LCA5 mutations. Such therapy is particularly advantageous when wild-type or optimized copies of the gene are delivered early in life, e.g., during childhood or early postnatal life. Furthermore, this intravitreal or subretinal administration used in certain embodiments efficiently delivers genes to target cells (eg, photoreceptors).
[0022] The reversillin gene, LCA5, encodes reversillin, a 697-amino acid protein thought to be involved in centrosomal or ciliary function and in minus-end-directed microtubule transport. As used herein, the terms "LCA5" and "reversillin" are used interchangeably when referring to the coding sequence. Naturally occurring nucleic acid sequences encoding human reversillin are reported in NCBI Reference Sequence NM_181714.3 (transcript variant 1), NM_001122769.2 (transcript variant 2), XM_011535504.1 (transcript variant XI), and XM_005248665.4 (transcript variant X2), and are reproduced herein as SEQ ID NOs: 4, 5, 6, and 7, respectively. The native human amino acid sequence of reversillin is reproduced herein as SEQ ID NO: 1 (NCBI Reference Sequence: NP_001116241.1 or NP_859065.2 and UniProtKB / Swiss-Prot ID: Q86VQ0-1). Mutations in the LCA5 gene are associated with Leber's congenital amaurosis (LCA). In certain embodiments, the terms "LCA5" and "reversillin" are used interchangeably.
[0023] Leber congenital amaurosis (LCA) is an eye disorder that primarily affects the retina, a specialized tissue at the back of the eye that detects light and color. People with this disorder usually have severe vision problems from infancy. The vision loss tends to stabilize, but can worsen very slowly over time. Leber congenital amaurosis can also be accompanied by other vision problems, such as increased sensitivity to light (photophobia), involuntary eye movements (nystagmus), and extreme farsightedness (hyperopia). The pupil, which normally expands and contracts in response to the amount of light entering the eye, may no longer respond normally to light. Instead, it may expand and contract more slowly than normal or may not respond at all. Furthermore, the clear, front covering of the eye (cornea) may become cone-shaped and abnormally thin, a condition known as keratoconus. A specific behavior, called Franceschetti's finger sign, is characteristic of Leber congenital amaurosis. This sign consists of poking, pushing, and rubbing the eye with the knuckles or fingers. Researchers speculate that this behavior may be related to the sunken eyes and keratoconus in affected children. Rarely, developmental delays and intellectual disability have been reported in people with characteristics of Leber congenital amaurosis. However, researchers are uncertain whether these individuals actually have Leber congenital amaurosis or another syndrome with similar signs and symptoms. At least 13 types of Leber congenital amaurosis have been reported. These types are distinguished by their genetic causes, patterns of vision loss, and associated eye abnormalities.
[0024] The terms "percent (%) identity," "sequence identity," "percent sequence identity," or "percent identical," in the context of nucleic acid sequences, refer to the residues in two sequences that are the same when aligned for correspondence. The length of sequence identity comparison may be desired to cover the entire length of a genome, the entire length of a gene coding sequence, or a fragment of at least about 500-5000 nucleotides. However, identity over smaller fragments, e.g., at least about 9 nucleotides, usually at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 or more nucleotides, may also be desired.
[0025] The percent identity of amino acid sequences spanning the entire length of a protein, polypeptide, about 32 amino acids, about 330 amino acids, or peptide fragments thereof, or the corresponding nucleic acid sequence-encoding sequence, can be readily determined. Suitable amino acid fragments are at least about 8 amino acids in length and can be up to about 700 amino acids. Generally, when referring to "identity," "homology," or "similarity" between two different sequences, the "identity," "homology," or "similarity" is determined with respect to "aligned" sequences. "Aligned" sequences or "alignment" refers to multiple nucleic acid or protein (amino acid) sequences compared to a reference sequence, which often includes modifications such as missing or added bases or amino acids.
[0026] Identity can be determined by preparing an alignment of sequences and using various algorithms and / or computer programs known in the art or commercially available (e.g., BLAST, ExPASy; ClustalO; FASTA; e.g., using the Needleman-Wunsch algorithm, Smith-Waterman algorithm). Alignment can be performed using any of a variety of publicly available or commercially available multiple sequence alignment programs. Available sequence alignment programs for amino acid sequences include, for example, "Clustal Omega," "Clustal X," "MAP," "PIMA," "MSA," "BLOCKMAKER," "MEME," and "Match-Box." Generally, all of these programs are used with default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can use other algorithms or computer programs that provide at least the same level of identity or alignment as that provided by the referenced algorithms and programs. See, for example, JD Thomson et al., Nucl. Acids. Res., "A comprehensive comparison of multiple sequence alignments," 27(13):2682-2690 (1999).
[0027] For nucleic acid sequences, multiple sequence alignment programs are also available. Examples of suitable programs include "Clustal Omega," "Clustal W," "CAP Sequence Assembly," "BLAST," "MAP," and "MEME," which are available via web servers on the Internet. Other sources of such programs are known to those of skill in the art. Alternatively, the Vector NTI utility may be used. Numerous algorithms known in the art can be used to measure nucleotide sequence identity, including those included in the programs described above. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG Version 6.1. Fasta™ provides alignments and percent sequence identity of the best overlapping regions between the query and search sequences. For example, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with default parameters (word size of 6 and NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, which is incorporated herein by reference.
[0028] In one aspect, a codon-optimized, modified nucleic acid sequence encoding human lectin is provided. Preferably, the codon-optimized lectin coding sequence has less than about 80% identity, preferably about 75% or less identity, to the full-length native lectin coding sequence (FIGS. 1B-1D, SEQ ID NO: 2). In one embodiment, the codon-optimized lectin coding sequence has about 74% identity to the native lectin coding sequence of SEQ ID NO: 2. In one embodiment, the codon-optimized lectin coding sequence is characterized by an improved translation rate compared to native lectin after AAV-mediated delivery (e.g., rAAV). In one embodiment, the codon-optimized ribosomal cytosine coding sequence shares about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61% or less identity to the full-length native ribosomal cytosine coding sequence of SEQ ID NO: 2. In one embodiment, the codon-optimized nucleic acid sequence is a variant of SEQ ID NO: 3. In another embodiment, the codon-optimized nucleic acid sequence shares about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61% or more identity with SEQ ID NO: 3. In one embodiment, the codon-optimized nucleic acid sequence is SEQ ID NO: 3. In another embodiment, the nucleic acid sequence is codon-optimized for human expression. In another embodiment, the reversilin coding sequence is from nt 1883 to nt 3976 of SEQ ID NO: 8. In other embodiments, different levels of the silencing coding sequence are selected.
[0029] Codon-optimized coding regions can be designed in a variety of different ways. This optimization can be achieved using methods available online (e.g., GeneArt), published methods, or by companies that provide codon optimization services, e.g., DNA2.0 (Menlo). Codon optimization may be performed using a codon optimization algorithm (e.g., a codon optimization algorithm based on ...
[0030] Numerous options are available for making the actual codon changes or synthesizing the codon-optimized coding region designed as described herein. Such modifications or synthesis can be performed using standard and routine molecular biology procedures well known to those skilled in the art. In one approach, a series of complementary oligonucleotide pairs, each 80-90 nucleotides in length and spanning the length of the desired sequence, are synthesized using standard methods. These oligonucleotide pairs are synthesized in sequence to anneal together, forming 80-90 base pair double-stranded fragments containing cohesive ends, e.g., each oligonucleotide in the pair is synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10, or more bases beyond the region complementary to the other oligonucleotide in the pair. The single-stranded end of each pair of oligonucleotides is designed to anneal to the single-stranded end of the other pair of oligonucleotides. These oligonucleotide pairs are annealed, and then approximately 5-6 of these double-stranded fragments are annealed together via their cohesive single-stranded ends and ligated together. The construct is then cloned into a standard bacterial cloning vector, such as the TOPO® vector available from Invitrogen Corporation, Carlsbad, Calif. The construct is then sequenced by standard methods. Several of these constructs are prepared, consisting of 5-6 fragments of 80-90 base pair fragments ligated together, i.e., approximately 500 base pair fragments, so that the entire desired sequence is represented in a series of plasmid constructs. The inserts of these plasmids are then cut with appropriate restriction enzymes and ligated to form the final construct. The final construct is then cloned into a standard bacterial cloning vector and sequenced. Further methods will be readily apparent to those skilled in the art. Additionally, gene synthesis is readily available commercially.
[0031] By "modified" is meant assembling a nucleic acid sequence encoding a Reversillin protein described herein and placing it into a suitable genetic element, e.g., naked DNA, phage, transposon, cosmid, episome, etc., so that the Reversillin sequence carried therein can be transferred into a host cell, e.g., to generate a non-viral delivery system (e.g., an RNA-based system, naked DNA, etc.), or to generate a viral vector in a packaging host cell and / or for delivery to a host cell in a subject. In one embodiment, the genetic element is a plasmid. Methods used to generate such modified constructs are known to those skilled in the art of nucleic acid manipulation and involve genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).
[0032] As used herein, the term "host cell" may refer to a packaging cell line that produces recombinant AAV from a production plasmid. Alternatively, the term "host cell" may refer to any target cell in which expression of a coding sequence is desired. Thus, "host cell" refers to a prokaryotic or eukaryotic cell containing exogenous or heterologous DNA introduced into the cell by any means, such as electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion, high-speed DNA-coated pellets, viral infection, and protoplast fusion. In certain embodiments herein, the term "host cell" refers to a cell used to produce and package a viral vector or recombinant virus. In other aspects herein, the term "host cell" refers to cultures of ocular cells from various mammalian species for in vitro evaluation of the compositions described herein. In still other embodiments, the term "host cell" is intended to refer to the ocular cells of a subject treated in vivo for LCA.
[0033] As used herein, the term "ocular cell" refers to any cell within the eye or associated with ocular function. The term may refer to any one of photoreceptor cells, including rod photoreceptors, cone photoreceptors, and light-sensitive ganglion cells, retinal pigment epithelial (RPE) cells, Müller cells, choroidal cells, bipolar cells, horizontal cells, and amacrine cells. In some embodiments, the ocular cell is a photoreceptor cell. In other embodiments, the ocular cell is a cone photoreceptor. In another embodiment, the ocular cell is a rod photoreceptor.
[0034] In some embodiments, the nucleic acid sequence encoding reversillin further comprises a nucleic acid encoding a tag polypeptide covalently linked thereto. The tag polypeptide may be selected from known "epitope tags," including, but not limited to, myc tag polypeptide, glutathione-S-transferase tag polypeptide, green fluorescent protein tag polypeptide, myc-pyruvate kinase tag polypeptide, His6 tag polypeptide, influenza virus hemagglutinin tag polypeptide, Flag tag polypeptide, and maltose binding protein tag polypeptide.
[0035] In another aspect, an expression cassette is provided comprising a nucleic acid sequence encoding reversillin. In one embodiment, the sequence is a codon-optimized sequence. In another embodiment, the codon-optimized nucleic acid sequence is SEQ ID NO: 3, which encodes human reversillin.
[0036] As used herein, "expression cassette" refers to a nucleic acid molecule that includes coding sequences for a levelsillin protein, a promoter, and may include other regulatory sequences therefor, which can be packaged into the capsid of a viral vector (e.g., a viral particle). Generally, such expression cassettes for generating viral vectors include the LCA5 sequence described herein flanked by packaging signals from the viral genome and other expression control sequences, as described herein. For example, for AAV viral vectors, these packaging signals are the 5' inverted terminal repeats (ITRs) and 3' ITRs. When packaged into an AAV capsid, the expression cassette together with the ITRs may be referred to herein as a "recombinant AAV (rAAV) genome" or "vector genome." In one embodiment, an expression cassette includes a codon-optimized nucleic acid sequence encoding a levelsillin protein. In one embodiment, the cassette provides a codon-optimized LCA5 sequence operably associated with expression control sequences that direct expression of the codon-optimized nucleic acid sequence encoding levelsillin in a host cell. In one embodiment, the vector genome is the sequence of nt 1-4379 of SEQ ID NO: 8. In another embodiment, the vector genome is the sequence of nt 1-4368 of SEQ ID NO: 9. In yet another embodiment, the LCA5 coding sequence in any of the identified vector genomes is replaced with another LCA5 coding sequence described herein.
[0037] In another embodiment, an expression cassette for use in an AAV vector is provided. In this embodiment, the AAV expression cassette comprises at least one AAV inverted terminal repeat (ITR) sequence. In another embodiment, the expression cassette comprises a 5' ITR sequence and a 3' ITR sequence. In one embodiment, the 5' and 3' ITRs flank a codon-optimized nucleic acid sequence encoding a levelsilin gene, and optionally include additional sequences that direct expression of the codon-optimized nucleic acid sequence encoding a levelsilin gene in a host cell. Thus, as described herein, an AAV expression cassette is meant to describe an expression cassette as described above that is flanked at its 5' end by a 5' AAV inverted terminal repeat (ITR) sequence and at its 3' end by a 3' AAV ITR sequence. Thus, the rAAV genome contains the minimal sequences required for packaging the expression cassette into an AAV viral particle, i.e., the AAV 5' and 3' ITRs. The AAV ITRs can be obtained from the ITR sequences of any AAV, as described herein. These ITRs are used to express the resulting recombinant AAV gene. The ITRs may be from the same AAV source as the capsid used in the AV, or from a different AAV source (to generate AAV pseudotypes). In some embodiments, the ITR sequences from AAV2, or a deleted version thereof (ΔITR), are used for convenience and to facilitate regulatory approval. However, ITRs from other AAV sources may be selected. If the source of the ITRs is AAV2 and the AAV capsid is from another AAV source, the resulting vector may be referred to as a pseudotype. Generally, the AAV vector genome includes the AAV 5' ITR, a reversilin coding sequence, any regulatory sequences, and the AAV 3' ITR. However, other configurations of these elements may also be suitable. A shortened version of the 5' ITR, termed ΔITR, has been described in which the D sequence and terminal resolution site (trs) are deleted. In other embodiments, full-length AAV 5' and 3' ITRs are used. Each rAAV genome can then be introduced into a production plasmid.
[0038] As used herein, the terms "regulatory sequence," "transcriptional control sequence," or "expression control sequence" refer to DNA sequences, such as initiation sequences, enhancer sequences, and promoter sequences, that induce, repress, or control the transcription of protein-coding nucleic acid sequences operably linked to them.
[0039] As used herein, the terms "operably linked" or "operably associated" refer to both expression control sequences adjacent to the nucleic acid sequence encoding reversillin and / or expression control sequences that control its transcription and expression, either in trans or at a distance.
[0040] In certain aspects, vectors are provided that include any of the expression cassettes described herein. As described herein, such vectors can be plasmids of various origins and are useful in certain embodiments for the generation of recombinant replication-defective viruses, as further described herein.
[0041] As used herein, a "vector" refers to a nucleic acid molecule into which an exogenous, heterologous, or modified nucleic acid transgene can be inserted, which can then be introduced into a suitable host cell. These vectors preferably have one or more origins of replication and one or more sites into which recombinant DNA can be inserted. These vectors often have a means by which vector-containing cells can be selected from vector-free cells, e.g., by encoding a drug resistance gene. Common vectors include plasmids, viral genomes, and "artificial chromosomes" (primarily in yeast and bacteria). Specific plasmids are described herein.
[0042] In some embodiments, the vectors are non-viral plasmids containing expression cassettes as described herein, e.g., "naked DNA," "naked plasmid DNA," RNA, and mRNA, linked to various compositions and nanoparticles, e.g., micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan compositions, and other polymer-, lipid-, and / or cholesterol-based nucleic acid conjugates, and other constructs described herein. See, e.g., X. Su et al., Mol. Pharmaceutics, 2011, 8(3), pp. 774-787; Web Publication: March 21, 2011; WO2013 / 182683, WO2010 / 053572, and WO2012 / 170930, the entire contents of which are incorporated herein by reference. Such non-viral recombinant vectors can be administered by the routes described herein. Viral or non-viral vectors can be formulated with physiologically acceptable carriers for use in gene transfer and gene therapy applications.
[0043] In another embodiment, the vector is a viral vector containing an expression cassette as described herein. A "viral vector" is defined as a replication-deficient virus containing an exogenous or heterologous LCA5 transgene. In certain embodiments, the expression cassettes described herein may be modified with plasmids used for drug delivery or viral vector construction. Suitable viral vectors are preferably replication-deficient and selected to target ocular cells. Viral vectors may include any virus suitable for gene therapy, including, but not limited to, adenovirus, herpesvirus, lentivirus, retrovirus, parvovirus, and the like. However, for ease of understanding, adeno-associated virus will be referred to herein as an exemplary viral vector.
[0044] A "replication-defective virus" or "viral vector" refers to a synthetic or recombinant viral particle in which an expression cassette containing a gene of interest is packaged into a viral capsid or envelope, and in which any viral genomic sequences packaged within the viral capsid or envelope are also replication-defective; i.e., they are unable to produce progeny virions but retain the ability to infect target cells. In certain embodiments, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be modified to be "gutless," containing only the transgene of interest flanked by signals required for amplification and packaging of the artificial genome), but these genes can be supplied during production. Therefore, it is considered safe for use in gene therapy because replication and infection by progeny virions cannot occur unless the viral enzymes required for replication are present.
[0045] In another embodiment, a recombinant adeno-associated virus (rAAV) vector is provided. The rAAV compromises the AAV capsid and the vector genome packaged therein. The vector genome, in one embodiment, comprises (a) an AAV 5' inverted terminal repeat (ITR) sequence; (b) a promoter; (c) a coding sequence encoding human levelsilin; and (d) an AAV 3' ITR. In another embodiment, the vector genome is an expression cassette described herein. In one embodiment, the LCA5 sequence encodes a full-length levelsilin protein. In one embodiment, the levelsilin sequence is the protein sequence of SEQ ID NO: 1. In another embodiment, the coding sequence is SEQ ID NO: 3 or a variant thereof.
[0046] Adeno-associated viruses (AAVs), members of the parvovirus family, are small, non-enveloped, icosahedral viruses with single-stranded, linear DNA genomes ranging from 4.7 kilobases (kb) to 6 kb. Known AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9. The ITRs or other AAV components can be readily isolated or modified from AAVs using techniques available to those skilled in the art. Such AAVs can be isolated, modified, or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA). Alternatively, these AAV sequences can be modified synthetically or by other suitable means by reference to published sequences available in the literature or databases such as GenBank and PubMed. By modifying the AAV virus using conventional molecular biology techniques, these particles can be optimized to enable cell-specific delivery of nucleic acid sequences, minimize immunogenicity, tailor stability and particle lifetime, efficient degradation, and precise delivery to the nucleus.
[0047] AAV fragments can be readily utilized in a variety of vector systems and host cells. Desired AAV fragments include the cap protein, including vp1, vp2, vp3, and hypervariable regions, and the rep protein, including rep78, rep68, rep52, and rep40, and the sequences encoding these proteins. Such fragments can be used alone or in combination with other AAV fragments. Artificial AAV serotypes may be used in combination with AAV serotype sequences or fragments of the present invention, or in combination with elements derived from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, but are not limited to, AAVs comprising non-native capsid proteins. Such artificial capsids may be generated by any suitable technique using novel AAV sequences of the present invention (e.g., fragments of the vp1 capsid protein) in combination with another AAV serotype (known or novel), non-contiguous portions of the same AAV serotype, non-AAV viral sources, or heterologous sequences that may be obtained from non-viral sources. Artificial AAV serotypes may be, but are not limited to, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. In certain embodiments, vectors include the AAV8 cap and / or rep sequences of the present invention. See, e.g., U.S. Patent Application Publication No. US2009 / 02270030, incorporated herein by reference.
[0048] As used herein, the term "AAV" or "AAV serotype" refers to the numerous naturally occurring and available adeno-associated viruses, as well as man-made AAVs. Among the well-characterized AAVs isolated or engineered from humans or non-human primates (NHPs), human AAV2 was the first AAV developed as a gene transfer vector; it has been widely utilized for effective gene transfer experiments in various target tissues and animal models. Unless otherwise specified, the AAV capsid, ITRs, and other selected AAV components described herein can be readily selected from any AAV, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7M8, and AAVAnc80, any variant of a known or described AAV, or an undiscovered AAV, or a variant or mixture thereof. See, e.g., WO2005 / 033321, which is incorporated herein by reference. In another embodiment, the AAV capsid is an AAV8bp capsid that preferentially targets bipolar cells. See WO2014 / 024282, which is incorporated herein by reference. In another embodiment, the AAV capsid is an AAV7m8 capsid, which has shown preferential delivery to the outer retina. The AAV7m8 capsid nucleic acid sequence is reproduced in SEQ ID NO: 11, and the amino acid sequence is reproduced in SEQ ID NO: 12. See Dalkara et al., "In Vivo-Directed Evolution of a New Adeno-Associated Virus for Therapeutic Outer Retinal Gene Delivery from the Vitreous," Sci Transl Med 5, 189ra76 (2013), which is incorporated herein by reference.
[0049] As used herein, an "AAV7m8 capsid" refers to a self-assembling AAV capsid composed of multiple AAV7m8 vp (variable protein) proteins. These AAV7m8 vp proteins are typically expressed as alternative splice variants encoded by the nucleic acid sequence of SEQ ID NO:11, or a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical thereto and encoding the vp1 amino acid sequence of SEQ ID NO:12. These splice variants result in proteins of different lengths of SEQ ID NO:12. In a specific embodiment, "AAV7m8 capsid" includes an AAV having an amino acid sequence 99% identical to SEQ ID NO:12.
[0050] In another embodiment, the rAAV capsid is selected from an AAV8 capsid or variant thereof, an AAV6 capsid or variant thereof, an AAV9 capsid or variant thereof, an AAV7 capsid or variant thereof, an AAV5 capsid or variant thereof, an AAV2 capsid or variant thereof, an AAV1 capsid or variant thereof, an AAV3 capsid or variant thereof, and an AAV4 capsid or variant thereof. In one embodiment, a recombinant adeno-associated virus (rAAV) comprising an AAV7m8 capsid and an expression cassette described herein is provided. A vector is provided, the expression cassette comprising a nucleic acid sequence encoding Reversillin, an inverted terminal repeat sequence, and an expression control sequence that directs expression of Reversillin in a host cell.
[0051] In a further embodiment, recombinant adeno-associated virus (AAV) vectors are provided for delivery of the LCA5 constructs and optimized sequences described herein. Adeno-associated virus (AAV) viral vectors are AAV DNase-resistant particles containing an AAV protein capsid that packages a nucleic acid sequence for delivery to target cells. The AAV capsid is composed of 60 capsid protein subunits, VP1, VP2, and VP3, arranged in icosahedral symmetry in a ratio of approximately 1:1:10 to 1:1:20, depending on the AAV selected. AAV may be selected as a source of capsid for the AAV viral vectors defined above. See, e.g., U.S. Published Patent Application No. 2007-0036760-A1; U.S. Published Patent Application No. 2009-0197338-A1; and EP 1310571. Also, WO2003 / 042397 (AAV7 and other simian AAVs), U.S. Pat. No. 7,790,449 and U.S. Pat. No. 7,282,199 (AAV8), WO2005 / 033321 and U.S. Pat. No. 7,906,111 (AAV9), and WO2006 / 110689 and WO2003 / 042397 (rh.10), and (Dalkara D, Byrne LC, Klimczak RR, Visel See also M, Yin L, Merigan WH, et al. In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous, Sci Transl Med (2013) 5(189):189ra76. doi:10.1126 / scitranslmed.3005708. (AAV7m8), each of which is incorporated herein by reference. These references also describe other AAV capsids that may be selected to generate AAV, and are also incorporated herein by reference. In some embodiments, an AAV cap for use in a viral vector can be generated by mutagenesis (i.e., by insertion, deletion, or substitution) of one of the AAV capsids described above or its encoding nucleic acid. In some embodiments, the AAV capsid is chimeric and contains domains from two, three, or more of the above-described AAV capsid proteins. In some embodiments, the AAV capsid is a mosaic of Vp1, Vp2, and Vp3 monomers from two or three different AAV or recombinant AAVs. In some embodiments, the rAAV composition contains two or more of the above-described Caps.
[0052] As used herein, the term variant, with respect to AAV, refers to any AAV sequence derived from a known AAV sequence that shares at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% or more sequence identity with the amino acid or nucleic acid sequence. In another embodiment, the AAV capsid includes a variant that can vary by up to about 10% from a described or known AAV capsid sequence. That is, the AAV capsid shares about 90% identity to about 99.9% identity, about 95% to about 99% identity, or about 97% to about 98% identity with an AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with an AAV capsid. When determining percent identity of an AAV capsid, comparison can be made to any of the variable proteins (e.g., vpl, vp2, or vp3). In one embodiment, the AAV capsid shares at least 95% identity with AAV7m8 for vpl, vp2, or vp3. In another embodiment, the capsid is similar to the AAV7m8 capsid described in Kay et al., targo, published online April 26, 2013, and incorporated herein by reference. The AAV8 capsid has the mutations Y447F, Y733F, and T494V (also known as "AAV8(C&G+T494V)" and "rep2-cap8(Y447F+733F+T494V)"), which is described in "Etching Photoreceptors via Intravitreal Delivery Using Novel, Capsid-Mutated AAV Vectors," PLoS One. 2013;8(4):e62097.
[0053] In some embodiments, it may be desirable to utilize an AAV capsid that exhibits tropism for a desired target cell, such as a photoreceptor (e.g., rod and / or cone), RPE, or other ocular cell. In some embodiments, the AAV capsid is a tyrosine capsid mutant in which certain surface-exposed tyrosine residues are substituted with phenylalanine (F). Such AAV mutants are described, for example, in Mowat et al., "Tyrosine capsid-mutant AAV vectors for gene delivery to the canine retina from a subretinal or intravitreal approach," Gene Therapy 21, 96-105 (January 2014), which is incorporated herein by reference.
[0054] As used herein, the term "artificial AAV" refers to, but is not limited to, an AAV having a capsid protein that does not occur in nature. Such an artificial capsid can be generated by a suitable method using a selected AAV sequence (e.g., a fragment of the vp1 capsid protein) in combination with a different selected AAV, non-contiguous portions of the same AAV, a non-AAV viral source, or a heterologous sequence that may be obtained from a non-viral source. The artificial AAV can be, but is not limited to, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid. Pseudotype vectors in which the capsid of an AAV is replaced with a heterologous capsid protein are useful in the present invention. In one embodiment, AAV2 / 5 and AAV2 / 8 are exemplary pseudotyped vectors.
[0055] In another embodiment, a self-complementary AAV is used. The term "self-complementary AAV" refers to a plasmid or vector containing an expression cassette designed such that the coding region carried by the recombinant AAV nucleic acid sequence forms an intramolecular double-stranded DNA template. Upon infection, rather than waiting for cell-mediated synthesis of a second strand, the two complementary halves of the scAAV associate to form a single double-stranded DNA (dsDNA) unit that is immediately ready for replication and transcription. See, for example, D. M. McCarty et al., "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis," Gene Therapy, (August 2001), Vol. 8, Number 16, pages 1248-1254. Self-complementary AAVs are described, for example, in U.S. Patent Nos. 6,596,535; 7,125,717, and 7,456,683, the entire contents of each of which are incorporated herein by reference.
[0056] The term "exogenous" when used to describe a nucleic acid sequence or protein means that the nucleic acid or protein does not naturally occur in the chromosome or location present in the host cell. An exogenous nucleic acid sequence also refers to a sequence that originates from and is inserted into the same host cell or subject, but exists in a non-natural state, for example, in a different copy number or under the control of different regulatory elements.
[0057] The term "heterologous" when used to describe a nucleic acid sequence or protein means that the nucleic acid or protein means that the protein is derived from a different organism or a different species of the same organism from the host cell or subject in which it is expressed. The term "heterologous," when used with reference to a protein or nucleic acid within a plasmid, expression cassette, or vector, means that the protein or nucleic acid and another sequence or subsequence are not found in the same relationship to each other in nature.
[0058] In yet another embodiment, any of the expression cassettes described herein are used to generate a recombinant AAV genome.
[0059] In certain embodiments, the expression cassettes described herein are modified into suitable genetic elements (vectors) useful for generating viral vectors and / or delivery into host cells, e.g., naked DNA, phage, transposons, cosmids, episomes, etc., to carry the LCA5 sequences carried therein. The selected vector may be delivered by any suitable method, such as transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion. Methods used to generate such constructs are known to those skilled in the art of nucleic acid manipulation and involve genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY.
[0060] For packaging of an expression cassette, rAAV genome, or production plasmid into virions, the ITRs are the only AAV components required in cis in the same construct as the expression cassette. In one embodiment, the coding sequences for replication (rep) and / or capsid (cap) are removed from the AAV genome and supplied in trans or in a packaging cell line for production of the AAV vector.
[0061] Methods for producing and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, for example, U.S. Patent No. 7,790,449; U.S. Patent No. 7,282,199; WO 2003 / 042397; WO 2005 / 033321; WO 2006 / 110689; and U.S. Patent No. 7,588,772 B2. In one system, a producer cell line is transiently transfected with a construct encoding a transgene flanked by ITRs and a construct(s) encoding rep and cap. In a second system, a packaging cell line stably supplying rep and cap is transiently transfected with a construct encoding a transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with a helper adenovirus or herpesvirus, which requires separation of the rAAV from contaminating viruses. Recently, systems have been developed that do not require helper virus infection for recovery of the AAV—the required helper functions (i.e., adenovirus E1, E2a, VA, and E4, or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase) are also supplied in trans in these systems. In these new systems, the helper functions can be supplied by transient transfection of cells with constructs encoding the required helper functions, or cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or post-transcriptional level.
[0062] The term "isolated" means that the material has been removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but is instead a naturally occurring polynucleotide or polypeptide. The same polynucleotide or polypeptide separated from some or all of the coexisting materials would be isolated even if it were subsequently returned to nature. Such a polynucleotide can be part of a vector, and / or such a polynucleotide or polypeptide can be part of a composition, but such a vector or composition would still be isolated in that it is not part of its natural environment.
[0063] In yet another system, an expression cassette flanked by the ITRs and rep / cap genes is introduced into insect cells by infection with a baculovirus-based vector. For a review of these production systems, see generally, e.g., Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the entire contents of which are incorporated herein by reference. Methods for making and using these and other AAV production systems are also described in the following U.S. patents, the entire contents of each of which are incorporated herein by reference: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065. See generally, e.g., Grieger & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications," Adv. Biochem. Engin / Biotechnol. 99:119-145; Buning et al., 2008, "Recent developments in adeno-associated virus vector technology," J. Gene Med. 10:717-733, and the following references, the entire contents of each of which are incorporated herein by reference:
[0064] The methods used to construct any embodiment of the present invention are known to those skilled in the art of nucleic acid manipulation and involve genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, See Spring Harbor, NY (2012). Similarly, methods for producing rAAV virions are well known, and the selection of an appropriate method is not a limitation of the present invention. See, e.g., K. Fisher et al. (1993) J. Virol., 70:520-532, and U.S. Patent No. 5,478,745.
[0065] "Plasmids" are generally designated herein by a lower case p preceded and / or followed by capital letters and / or numbers, in accordance with standard naming conventions well known to those of skill in the art. Numerous plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known to and readily available to those of skill in the art. Moreover, one of skill in the art can readily construct any number of other plasmids suitable for use in the present invention. The properties, construction, and use of such plasmids, as well as other vectors, in the present invention will be apparent to those of skill in the art from the present disclosure.
[0066] In one embodiment, the production plasmid is one described herein or in WO2012 / 158757, which is incorporated herein by reference. A variety of plasmids for use in producing rAAV vectors are known in the art and are useful herein. The production plasmid can be used to produce an AAV carrier. The rAAV genomes are then cultured in host cells that express the capsid and / or rep proteins, where they are rescued and packaged into capsid or envelope proteins to form infectious viral particles.
[0067] In one aspect, a production plasmid containing the expression cassette described above is provided. In one embodiment, the production plasmid is shown in SEQ ID NO:8 and Figures 1E-1F and is designated p643. This plasmid is used in the example of generating a rAAV-human codon-optimized level-stimulating vector. Such a plasmid contains a 5' AAV ITR sequence; a selected promoter; a polyA sequence; and a 3' ITR; in addition, it also contains a stuffer sequence, such as lambda. In further embodiments, the stuffer sequence maintains the rAAV vector genome at a size of about 3 kilobases (kb) to about 6 kb, about 4.7 kb to about 6 kb, about 3 kb to about 5.5 kb, or about 4.7 kb to 5.5 kb. In one embodiment, a non-coding lambda stuffer region is included in the vector backbone. An example of p643 containing a level-stimulating vector encoding sequence is set forth in SEQ ID NO:8. In another embodiment, the production plasmid is as set forth in Figures 11A-11B and SEQ ID NO:9. In another embodiment, the production plasmid is modified for optimized vector plasmid production efficiency. Such modifications include the addition of other neutral sequences or the deletion of part(s) or all of the lambda stuffer sequence to adjust the level of supercoiling of the vector plasmid. Such modifications are contemplated herein. In other embodiments, terminators and other sequences are incorporated into the plasmid.
[0068] In certain embodiments, the rAAV expression cassette, the vector (e.g., an rAAV vector), the virus (e.g., an rAAV), or the production plasmid comprises an AAV inverted terminal repeat, a codon-optimized nucleic acid sequence encoding reversilin, and expression control sequences that direct expression of the encoded protein in a host cell. In other embodiments, the rAAV expression cassette, the virus, the vector (e.g., an rAAV vector), or the production plasmid further comprises one or more of an intron, a Kozak sequence, a polyA, a post-transcriptional regulatory element, or the like. In one embodiment, the post-transcriptional regulatory element is a woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE).
[0069] The expression cassettes, vectors, and plasmids include other components that can be optimized for a particular species using methods known in the art, including, for example, codon optimization as described herein. The cassettes, vectors, plasmids, and viruses, or other components of the compositions described herein, include a promoter sequence as part of the expression control sequence. In another aspect, the promoter is cell-specific. The term "cell-specific" means that the particular promoter selected for the recombinant vector can direct expression of the cilin coding sequence at an optimized level in a particular ocular cell type. In one embodiment, the promoter is specific for expression of the transgene in photoreceptor cells. In another embodiment, the promoter is specific for expression in rods and cones. In another embodiment, the promoter is specific for expression in rods. In another embodiment, the promoter is specific for expression in cones. In one embodiment, the photoreceptor-specific promoter is the human rhodopsin kinase promoter. The rhodopsin kinase promoter has been shown to be active in both rods and cones. See, e.g., Sun et al., Gene Therapy with a Promoter Targeting Both Rods and Cones Rescues Retinal Degeneration Caused by AIPL1 Mutations, Gene Ther. 2010 January;17(1):117-131, the entire contents of which are incorporated herein by reference. In one embodiment, the promoter may further comprise one or more restriction sites. Make modifications to facilitate cloning.
[0070] In another embodiment, the promoter is a human rhodopsin promoter. In some embodiments, the promoter is modified at the ends to provide restriction for cloning purposes. See, for example, Nathans and Hogness, Isolation and nucleotide sequence of the See, "gene encoding human rhodopsin," PNAS, 81:4851-5 (August 1984). In another embodiment, the promoter is a portion or fragment of the human rhodopsin promoter. In another embodiment, the promoter is a mutant of the human rhodopsin promoter.
[0071] Another exemplary promoter is the human G-protein coupled receptor protein kinase 1 (GRK1) promoter (Genbank Accession No. AY327580). In another embodiment, the promoter is a 292 nt fragment (positions 1793-2087) of the GRK1 promoter (see Beltran et al., Gene Therapy 2010 17:1162-74, incorporated herein by reference in its entirety). In another preferred embodiment, the promoter is the human interphotoreceptor retinoid-binding protein proximal (IRBP) promoter. In one embodiment, the promoter is a 235 nt fragment of the hIRBP promoter. In one embodiment, the promoter is the RPGR proximal promoter (Shu et al., IOVS, May 2102, incorporated herein by reference in its entirety). Other promoters useful in the present invention include the rod opsin promoter, the red-green opsin promoter, the blue opsin promoter, and the cGMP-β-phosphodiesterase promoter (Qgueta et al., IOVS, Invest Ophthalmol Vis Sci. 2000 Dec;41(13):4059-63), mouse opsin promoter (Beltran et al. 2010, supra), rhodopsin promoter (Mussolino et al., Gene Ther., July 2011,18(7):637-45); alpha-subunit of cone transducin (Morrissey et al., BMC Dev. Biol., Jan 2011,11:3); beta-phosphodiesterase (PDE) promoter; retinitis pigmentosa (RP1) promoter (Nicord et al., J. Gene Med., Dec. 2007,9(12):1015-23); NXNL2 / NXNL1 promoter (Lambard et al., PLoS One., Oct. 2010,5(10):el3025); RPE65 promoter; retinal degeneration slow / peripherin 2 (Rds / perph2) promoter (Cai et al., Exp Eye Res. 2010 Aug;91(2):186-94); and VMD2 promoter (Kachi et al., Human Gene Therapy, 2009(20:31-9)). The entire contents of each of these documents are incorporated herein by reference. In another embodiment, the promoter is selected from the group consisting of human EF1α promoter, rhodopsin promoter, rhodopsin kinase, inter-photoreceptor binding protein (IRBP), cone opsin promoter (red-green, blue), cone opsin upstream sequence including the red-green cone locus control region, cone transduction, and transcription factor promoters (neural retinal leucine zipper (Nrl) and photoreceptor-specific nuclear receptor Nr2e3, bZIP).
[0072] In another embodiment, the promoter is a ubiquitous or constitutive promoter. An example of a suitable promoter is a hybrid chicken beta-actin (CBA) promoter with a cytomegalovirus (CMV) enhancer element, such as the sequence shown in Figures 1E-1F. In another embodiment, the promoter is a CB7 promoter. Other suitable promoters include the human β-actin promoter, human elongation factor-1α promoter, cytomegalovirus (CMV) promoter, simian virus 40 promoter, and herpes simplex virus thymidine kinase promoter. See, for example, Damdindorj et al. (August 2014) A Comparative Analysis of Constitutive Promoters Located in Adeno-Associated Viral Vectors. PLoS ONE 9(8):e106472. Still other suitable promoters include viral promoters, constitutive promoters, and regulatable promoters (see, for example, WO2011 / 126808 and WO2013 / 04943). Alternatively, promoters that respond to physiological cues may be utilized in the expression cassettes, rAAV genomes, vectors, plasmids, and viruses described herein. In some embodiments, due to size limitations of AAV vectors, the promoter is small, less than 1000 bp in size. In another embodiment, the promoter is less than 400 bp. Other promoters may be selected by one of skill in the art.
[0073] In further embodiments, the promoter is an SV40 promoter, a dihydrofolate reductase promoter, and a phosphoglycerol kinase (PGK) promoter, a rhodopsin kinase promoter, a rod opsin promoter, a red-green opsin promoter, a blue opsin promoter, an inter-photoreceptor binding protein (IRBP) promoter, and a cGMP-β-phosphodiesterase promoter, a phage lambda (PL) promoter, a herpes simplex virus (HSV) promoter, a tetracycline-regulated transactivator-responsive promoter (tet) system, a long terminal repeat (LTR) promoter, such as a RSV LTR, a MoMLV LTR, a BIV LTR, or an HIV The promoter sequence may be selected from the group consisting of an LTR, a Moloney murine sarcoma virus U3 region promoter, a granzyme A promoter, a metallothionein gene regulatory sequence(s), a CD34 promoter, a CD8 promoter, a thymidine kinase (TK) promoter, a B19 parvovirus promoter, a PGK promoter, a glucocorticoid promoter, a heat shock protein (HSP) promoter (e.g., HSP65 and HSP70 promoters), an immunoglobulin promoter, an MMTV promoter, a Rous sarcoma virus (RSV) promoter, a lac promoter, a CaMV 35S promoter, a nopaline synthetase promoter, an MND promoter, or an MNC promoter. These promoter sequences are known to those skilled in the art or are publicly available from the literature or databases such as GenBank and PubMed.
[0074] In another embodiment, the promoter is an inducible promoter. The inducible promoter may be selected from known promoters such as rapamycin / rapalog promoters, ecdysone promoters, estrogen-responsive promoters, and tetracycline-responsive promoters, or heterodimeric repressor switches. See Sochor et al., An Autogenously Regulated Expression System for Gene Therapeutic Ocular Applications. Scientific Reports. 2015 Nov 24;5:17105, and Daber R, Lewis M., A novel molecular switch. J Mol Biol. 2009 Aug 28;391(4):661-70, Epub 2009 Jun 21, both of which are incorporated herein by reference in their entirety.
[0075] In a further embodiment, the promoter is a chicken beta-actin promoter having the nucleic acid sequence from nt 546 to nt 283 of SEQ ID NO:8.
[0076] In other embodiments, the expression cassettes, vectors, plasmids, and The virus may also contain other appropriate transcription initiation, termination, and enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals, a TATA sequence, sequences that stabilize cytoplasmic mRNA, sequences that increase translation efficiency (i.e., Kozak consensus sequences), introns, sequences that increase protein stability, and, if necessary, sequences that increase secretion of the encoded product. An expression cassette or vector may contain none, one, or more of the elements described herein.
[0077] Examples of suitable poly A sequences include, for example, synthetic poly A, or bovine growth hormone (bGH), human growth hormone (hGH), SV40, rabbit β-globin (RGB), or modified RGB (mRGB). In a further embodiment, the poly A has the nucleic acid sequence from nt 3993 to nt 4200 of SEQ ID NO:8.
[0078] Examples of suitable enhancers include, for example, the CMV enhancer, RSV enhancer, alpha fetoprotein enhancer, TTR minimal promoter / enhancer, LSP (TH-binding globulin promoter / alpha 1-microglobulin / bikunin enhancer), APB enhancer, ABPS enhancer, alpha mic / bik enhancer, TTR enhancer, en34, ApoE, among others. In one embodiment, the enhancer has the nucleic acid sequence from nt 241 to nt 544 of SEQ ID NO:8.
[0079] In one embodiment, a Kozak sequence is placed upstream of the level-stimulating factor coding sequence to facilitate translation from the correct start codon. In another embodiment, a CBA exon 1 and intron are incorporated into the expression cassette. In one embodiment, the level-stimulating factor coding sequence is placed under the control of a hybrid chicken beta-actin (CBA) promoter. This promoter consists of CBA exon 1 flanked by a cytomegalovirus (CMV) immediate-early enhancer, the proximal chicken beta-actin promoter, and intron 1 sequence.
[0080] In another embodiment, the intron is selected from CBA, human beta globin, IVS2, SV40, bGH, alpha-globulin, beta-globulin, collagen, ovalbumin, p53, or a fragment thereof.
[0081] In one embodiment, the expression cassette, the vector, the plasmid, and the virus comprise a 5' ITR, a chicken beta-actin (CBA) promoter, a CMV enhancer, a CBA exon 1 and intron, a human codon-optimized leucine sequence, a bGH polyA, and a 3' ITR. In a further embodiment, the expression cassette comprises nt 1 to 4379 of SEQ ID NO:8. In yet another embodiment, the 5' ITR comprises the nucleic acid sequence from nt 1 to nt 130 of SEQ ID NO:8, and the 3' ITR comprises the nucleic acid sequence from nt 4250 to nt 4379 of SEQ ID NO:8. In a further embodiment, the CBA exon 1 and intron comprise the nucleic acid sequence from nt 824 to nt 824 of SEQ ID NO:8. In a further embodiment, the production plasmid has the sequence of SEQ ID NO: 8, also shown in Figures 1E-1F. In a further embodiment, the production plasmid has the sequence of SEQ ID NO: 9, also shown in Figures 1A-11B.
[0082] In another aspect, a method for treating Leber's congenital amaurosis caused by a defect in the reversillin gene and / or restoring visual function in a subject with LCA comprises delivering to a subject in need thereof a vector (e.g., an rAAV) encoding reversillin, as described herein. In one embodiment, a method for treating a subject with LCA with an rAAV described herein is provided.
[0083] As used in this method, "administering" refers to delivering the composition to target selected cells characterized as LCAs. In one embodiment, the method includes delivering the composition to RPE, photoreceptors, or other ocular cells via subretinal injection. In another embodiment, the subject is injected intravitreally. In another embodiment, the subject is injected subretinal. In yet another method, intravascular injection, such as injection via the palpebral vein, may be used. Still other methods of administration may be selected by one of skill in the art given this disclosure.
[0084] "Administering" or "route of administration" refers to delivery of a composition described herein to a subject, with or without a pharmaceutical carrier or excipient. Routes of administration can be combined, if desired. In some embodiments, the administration is repeated periodically. The pharmaceutical compositions described herein are designed to be delivered to a subject in need thereof by any suitable route, or a combination of different routes. In some embodiments, delivery is direct to the eye (optionally via intraocular delivery, subretinal injection, intraretinal injection, intravitreal, or topical administration), or via systemic routes, such as intravascular, intraarterial, intraocular, intravenous, intramuscular, subcutaneous, intradermal, and other parenteral routes of administration. The nucleic acid molecules, expression cassettes, and / or vectors described herein can be delivered in a single composition or in multiple compositions. Optionally, two or more different AAVs or multiple viruses can be delivered (see, e.g., WO20 2011 / 126808 and WO2013 / 049493). In another embodiment, the multiple viruses can include different replication-deficient viruses (eg, AAV and adenovirus), either alone or in combination with proteins.
[0085] Pharmaceutical compositions are also provided herein. The pharmaceutical compositions described herein are designed for delivery to a subject in need thereof by any suitable route, or a combination of different routes. These delivery means are designed to avoid direct systemic delivery of a suspension containing the AAV composition(s) described herein. Suitably, this may have the advantage of reduced dose, reduced toxicity, and / or suppression of undesired immune responses to the AAV and / or transgene product compared to systemic administration.
[0086] In yet another aspect, these nucleic acid sequences, vectors, expression cassettes, and rAAV viral vectors are useful in pharmaceutical compositions, which also include pharmaceutically acceptable carriers, excipients, buffers, diluents, surfactants, preservatives, and / or adjuvants, etc. Such pharmaceutical compositions are used to express optimized level cytosin in host cells via delivery by such recombinantly modified or engineered AAV.
[0087] To prepare these pharmaceutical compositions containing nucleic acid sequences, vectors, expression cassettes, and rAAV viral vectors, the sequences, vectors, or viral vectors are preferably evaluated for contamination by conventional methods and then formulated into pharmaceutical compositions suitable for ocular administration. Such formulations include the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier, particularly buffered saline or other buffering agents suitable for ocular administration, such as HEPES, to maintain pH at an appropriate physiological level, and optionally other medicinal agents, drugs, stabilizers, buffers, carriers, additives, diluents, surfactants, or excipients. For injection, the carrier is typically a liquid. Exemplary physiologically acceptable carriers include sterile pyrogen-free water and sterile pyrogen-free phosphate-buffered saline. A variety of such known carriers are provided in U.S. Patent Publication No. 7,629,322, incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another aspect, the carrier is a balanced salt solution. In one embodiment, the carrier comprises tween. For long-term storage of the virus, it can be frozen in the presence of glycerol or Tween 20.
[0088] In certain embodiments, for administration to a human patient, the rAAV is suitably suspended in an aqueous solution containing saline, a surfactant, and a physiologically compatible salt or mixture of such salts. Suitably, the formulation is adjusted to a physiologically acceptable pH, for example, pH 6-9, or pH 6.5-7.5, or pH 7.0-7.7, or pH 7.2-7.8. Because the pH of cerebrospinal fluid is about 7.28 to about 7.32, a pH within this range is desirable for intrathecal delivery; whereas, for intravitreal or subretinal delivery, a pH of 6.8 to about 7.2 may be desirable. However, other pH values within the broadest range, and subranges thereof, may be selected for other delivery routes.
[0089] A suitable surfactant or surfactant combination may be selected from non-toxic non-ionic surfactants. In some embodiments, a difunctional block copolymer surfactant terminated with a primary hydroxyl group, such as Pluronic® F68 [BASF], also known as Poloxamer 188, which exhibits a neutral pH and has an average molecular weight of 8400, is selected. Other surfactants and poloxamers may be selected, such as non-ionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycaprylglyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol. In some embodiments, the formulation includes a poloxamer. These copolymers are generally designated by a "P" (for poloxamer) followed by three digits; the first two digits x 100 indicate the approximate molecular weight of the polyoxypropylene core, and the last digit x 10 indicates the polyoxyethylene content. In one embodiment, Poloxamer 188 is selected. The surfactant may be present in an amount from about 0.0005% to about 0.001% of the suspension.
[0090] In one example, the formulation may comprise a buffered saline solution, including, for example, an aqueous solution containing one or more of sodium chloride, sodium bicarbonate, dextrose, magnesium sulfate (e.g., magnesium sulfate-7H2O), potassium chloride, calcium chloride (e.g., calcium chloride-2H2O), dibasic sodium phosphate, and mixtures thereof. Suitably, for intrathecal delivery, the osmolality is within a range compatible with cerebrospinal fluid (e.g., about 275 to about 290); see, e.g., emedicine.medscape.com / article / 2093316-overview. Optionally, for intrathecal delivery, commercially available diluents may be used as suspending agents, or alternative suspending agents may be used in combination with other excipients. See, e.g., Elliotts B® Solution [Lukare Medical]. In other embodiments, the formulation may include one or more permeation enhancers. Examples of suitable permeation enhancers may include, for example, mannitol, sodium glycocholate, sodium taurocholate, sodium deoxycholate, sodium salicylate, sodium caprylate, sodium caprate, sodium lauryl sulfate, polyoxyethylene-9-laurel ether, or EDTA.
[0091] In another embodiment, the composition comprises a carrier, diluent, excipient, and / or adjuvant. A suitable carrier can be readily selected by one skilled in the art, taking into account the indication caused by the transfer virus. For example, one suitable carrier is saline, which can be formulated with various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer / carrier must contain components that prevent the rAAV from clogging the injection tract while not interfering with the rAAV's binding activity in vivo.
[0092] Optionally, in addition to the rAAV and carrier(s), the compositions of the present invention may contain other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.
[0093] The compositions of the present invention may include a pharmaceutically acceptable carrier as defined above. Suitably, the compositions described herein comprise an effective amount of one or more AAVs suspended in a pharmaceutically suitable carrier and / or mixed with a suitable excipient designed for delivery to a subject via injection, osmotic pump, intrathecal catheter, or another device or route. In some examples, the compositions are formulated for intravitreal delivery. In some examples, the compositions are formulated for subretinal delivery.
[0094] In one exemplary specific embodiment, the carrier or excipient in the composition comprises 180 mM NaCl, 10 mM NaPi, pH 7.3, and 0.0001% to 0.01% Pluronic F68 (PF68). The exact composition of the saline component of the buffer ranges from 160 mM to 180 mM NaCl. Optionally, a different pH buffer (potentially HEPES, sodium bicarbonate, TRIS) is substituted for the specifically described buffer. Additionally, a buffer containing 0.9% NaCl is useful.
[0095] In the case of AAV viral vectors, quantification of genome copies ("GC"), vector genomes ("VG"), or viral particles can be used as a measure of the dose contained in a formulation or suspension. Any method known in the art can be used to determine the genome copy (GC) number of a replication-deficient viral composition of the present invention. One example of a method for titrating AAV GC number is as follows: First, a purified AAV vector sample is treated with DNase to remove non-encapsidated AAV genomic DNA or contaminating plasmid DNA from the production process. Next, the DNase-resistant particles are heat-treated to release the genome from the capsid. The released genome is then quantified by real-time PCR using a primer / probe set targeting a specific region of the viral genome (usually the polyA signal). Alternatively, the effective amount of recombinant adeno-associated virus carrying a nucleic acid sequence encoding an optimized level cytosine coding sequence is determined as described in SK McLaughlin et al., 1988 J. Virol., 62:1963, the entire contents of which are incorporated herein by reference.
[0096] As used herein, the term "dose" can refer to the total dose delivered to a subject over the course of treatment, or the amount delivered in a single unit (or multiple units, or divided doses). The pharmaceutical virus composition can be formulated in a dosage unit containing an amount of replication-deficient virus carrying a codon-optimized nucleic acid sequence encoding reversillin as described herein, which amount is about 1.0 x 10 9 GC~approx. 1.0×10 15 In one embodiment, the composition is administered in a concentration of at least 1 x 10 9 , 2 × 10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×10 9In another embodiment, the composition is formulated to contain at least 1 x 10 GC / dose, including all integers or decimals within the range. 10 , 2 × 10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×10 10 In another embodiment, the composition is formulated to contain at least 1 x 10 GC / dose, including all integers or decimals within the range. 11 , 2 × 10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 GC / dose, including all integers and decimals within the range. Then, the composition is dissolved in at least 1×10 12 , 2 × 10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 In another embodiment, the composition is formulated to contain at least 1 x 10 GC / dose, including all integers or decimals within the range. 13 , 2 × 10 13 , 3×10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 In another embodiment, the composition is formulated to contain at least 1 x 10 GC / dose, including all integers or decimals within the range. 14 , 2 × 1014 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 In another embodiment, the composition is formulated to contain at least 1 x 10 GC / dose, including all integers or decimals within the range. 15 , 2 × 10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15 GC / dose, including all integers and decimals within the range. In one embodiment, for human applications, the dose is 1 x 10 10 ~Approx. 1×10 12 GC / dose, including all integers and decimals within the range. All doses may be measured by any known method, such as oqPCR or digital droplet PCR (ddPCR), as described in, for example, M. Lock et al., Hum Gene Ther Methods 2014 Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131, which is incorporated herein by reference.
[0097] In one embodiment, an aqueous suspension suitable for administration to a patient with LCA is provided. The suspension comprises an aqueous suspension and about 1×10 10 GC or viral particles ~ approx. 1 x 10 12 and a recombinant adeno-associated virus (rAAV) described herein useful as a therapeutic agent for LCA, which is GC or viral particles / eye.
[0098] It may also be desirable to administer the pharmaceutical composition of the present invention in multiple "booster" doses. For example, depending on the duration of the transgene in the target cells of the eye, booster doses can be delivered at 6-month intervals or annually after the initial administration. The fact that AAV neutralizing antibodies are not generated by administration of rAAV vectors allows for further booster administration.
[0099] Such booster doses, and the need for them, can be monitored by the attending physician using, for example, the retinal and visual function tests and visual behavior tests described in the Examples below. Other similar tests may be used to determine the condition of treated subjects over time. The selection of appropriate tests may be at the discretion of the attending physician. Alternatively, the methods of the present invention allow for the injection of large volumes of single or multiple infections of virus-containing solutions to achieve levels of visual function approaching those found in wild-type retina.
[0100] In another embodiment, the amount of the vectors, viruses, and replication-defective viruses described herein carrying a codon-optimized nucleic acid sequence encoding reversillin is about 1.0 x 10 7 VG / eye ~ approx. 1.0×10 15 VG / eye, including all integers and decimals within the range. In one embodiment, the amount is at least 1 x 10 7 , 2 × 10 7 , 3×10 7 , 4×10 7 , 5×10 7 , 6×10 7 , 7×10 7 , 8×10 7 , or 9×l0 7 VG / eye, including all integers and decimals therein. In one embodiment, the amount is at least 1 x 10 8 , 2 × 10 8 , 3×10 8 , 4×10 8 , 5×10 8 , 6×10 8 , 7×10 8 , 8×10 8 , or 9×l0 8VG / eye, including all integers and decimals therein. In one embodiment, the amount is at least 1 x 10 9 , 2 × 10 9 , 3×10 9 , 4×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , or 9×l0 9 VG / eye, including all integers and decimals therein. In one embodiment, the amount is at least 1 x 10 10 , 2 × 10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , or 9×l0 10 VG / eye, including all integers and decimals therein. In one embodiment, the amount is at least 1 x 10 11 , 2 × 10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×l0 11 VG / eye, including all integers and decimals therein. In one embodiment, the amount is at least 1 x 10 12 , 2 × 10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×l0 12 VG / eye, including all integers and decimals therein. In one embodiment, the amount is at least 1 x 10 13 , 2 × 10 13 , 3×10 13 , 4×10 13 , 5×1013 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×l0 13 VG / eye, including all integers and decimals therein. In one embodiment, the amount is at least 1 x 10 14 , 2 × 10 14 , 3×10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×l0 14 VG / eye, including all integers and decimals therein. In one embodiment, the amount is at least 1 x 10 15 , 2 × 10 15 , 3×10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×l0 15 GC / eye, including all integer or decimal values within that range. In one embodiment, the method 9 ~Approx. 1×10 13 In another embodiment, the method includes delivering a vector in an aqueous suspension. In another embodiment, the method includes delivering a 1 x 10 dose of the vector in a volume of about or at least 150 microliters. 9 ~1×10 13 and administering an rAAV as described herein at a dose of GC, thereby restoring visual function to the subject. All doses may be measured by any known method, such as oqPCR or digital droplet PCR (ddPCR), as described in M. Lock et al., Hum Gene Ther Methods 2014 Apr;25(2):115-25.doi:10.1089 / hgtb.2013.131, which is incorporated herein by reference.
[0101] These doses, as described above, may be administered in various volumes of carrier, excipient, or buffer formulations, ranging from about 25 to about 1000 microliters, including all values therein, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient, or buffer is at least about 25 μL. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 75 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 225 μL. In yet another embodiment, the volume is about 250 μL. In yet another embodiment, the volume is about 275 μL. In yet another embodiment, the volume is about 300 μL. In yet another embodiment, the volume is about 325 μL. In another embodiment, the volume is about 350 μL. In another embodiment, the volume is about 375 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 550 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 650 μL. In another embodiment, the volume is about 700 μL. In another embodiment, the volume is about 800 μL. In another embodiment, the volume is about 150-800 μL. In another embodiment, the volume is between about 700 and 1000 μL. In another embodiment, the volume is between about 250 and 500 μL.
[0102] In one embodiment, the viral construct is administered to a small animal subject, such as a mouse, in a volume of about 1 μL to about 3 μL, at least 1×10 9 ~ at least 1×10 11The GC dose can be delivered in a dose of 100 mg / kg / day. For large livestock subjects, whose eyes are roughly the same size as humans, the larger human doses and volumes described above are useful. See, for example, Diehl et al., J. Applied Toxicology, 21:15-23 (2001), for a discussion of best practices for administering substances to various livestock animals. This document is incorporated herein by reference.
[0103] It is desirable to utilize the lowest effective concentration of virus or other delivery vehicle to reduce the risk of undesirable effects such as toxicity, retinal dysplasia, and detachment. Further doses within these ranges may be selected by the attending physician, taking into account the physical condition of the subject, preferably a human, being treated, the subject's age, LCA, and the extent of the disorder, if progressive.
[0104] Yet another aspect described herein is a method for treating, slowing, or halting the progression of LCA in a mammalian subject. In some embodiments, a rAAV carrying a modified or codon-optimized version of Reversilin, preferably suspended in a physiologically compatible carrier, diluent, excipient, and / or adjuvant, may be administered to a desired subject, such as a human subject. The method includes administering to a subject in need thereof a nucleic acid sequence, expression cassette, rAAV genome, plasmid, vector, or rAAV vector, or a composition containing the same. In some embodiments, the composition is delivered subretinal. In other embodiments, the composition is delivered intravitreally. In yet other embodiments, the composition is delivered using a combination of administration routes suitable for treating LCA, and may include administration via the ophthalmic vein, other intravenous, or conventional administration routes.
[0105] For use in these methods, the volume and viral titer of each dose are determined individually, as further described herein, and may be the same or different from other treatments administered to the same or contralateral eye. The dosage, administration, or management can be determined by the attending physician in light of the teachings herein. In one embodiment, the affected eye is administered the composition in a single dose selected from those listed above. In another embodiment, both affected eyes are administered the composition in a single dose selected from those listed above, simultaneously or sequentially. Sequential administration can refer to a time interval between administrations from one eye to the other, such as minutes, hours, days, weeks, or months. In another embodiment, the method includes administering the composition to the eye in two or more doses (e.g., split doses). In another embodiment, multiple injections are administered to different parts of the same eye. In another embodiment, a second administration of rAAV containing a selected expression cassette (e.g., an LCA5-containing cassette) is administered at a later time point. Such time point can be weeks, months, or years after the first administration. In one embodiment, such second administration is performed using an rAAV having a different capsid than the rAAV in the first administration. In another embodiment, the rAAV in the first and second administrations have the same capsid.
[0106] In yet other embodiments, the compositions described herein may be delivered in a single composition or multiple compositions. Optionally, two or more different AAVs or multiple viruses may be delivered (see, e.g., WO2011 / 126808 and WO2013 / 049493). In another embodiment, the multiple viruses may include different replication-deficient viruses (e.g., AAV and adenovirus).
[0107] In certain embodiments of the invention, non-invasive retinal imaging and functional studies are performed to identify rod and cone photoreceptor regions to target for treatment and to test the efficacy of treatment. In these embodiments, clinical diagnostic tests are used to determine the precise location(s) for one or more subretinal injection(s). These tests may include electroretinography (ERG), perimetry, topographic mapping of retinal layers and their thickness measurements using confocal scanning laser ophthalmoscopy (cSLO) and optical coherence tomography (OCT), topographic mapping of cone density via adaptive optics (AO), functional ophthalmology, multi-electrode array (MEA), pupillary light response, etc., depending on the species, physical condition, and health of the subject being treated, as well as the dose. In terms of imaging and functional studies, some embodiments of the invention involve one or more injections in the same eye to target different regions of the affected eye. As further described herein, the volume and viral titer of each injection are determined individually and may be the same or different from other injections in the same or contralateral eye. In another embodiment, a single large volume is injected to treat the entire eye. In some embodiments, the volume and concentration of the rAAV composition is selected to affect only the region of damaged ocular cells, while in other embodiments, the volume and / or concentration of the rAAV composition is increased to reach most of the eye, including the intact photoreceptors.
[0108] In another embodiment, the method includes conducting further studies, e.g., functional and imaging studies, to determine the effectiveness of the treatment. For animal testing, such tests include assessment of retinal and visual function via electroretinogram (ERG) to look at rod and cone photoreceptor function, optokinetic nystagmus, pupillometry, water maze testing, light-dark preference, optical coherence tomography (measuring the thickness of various layers of the retina), and histology (immunofluorescence to document retinal thickness, nuclear alignment in the outer nuclear layer, transgene expression, cone photoreceptor counts, and staining of retinal sections with peanut agglutinin to identify cone photoreceptor sheaths).
[0109] In particular, for human subjects, following administration of the compositions at the dosages described herein, the subjects are examined for treatment efficacy using electroretinograms (ERGs) to test rod and cone photoreceptor function, pupillometry, contrast sensitivity color vision tests, visual field testing (Humphrey / Goldmann visual fields), visual field mobility tests (obstacle course), and reading speed tests. Other useful post-treatment efficacy tests that can be performed on subjects following treatment with the pharmaceutical compositions described herein include functional magnetic resonance imaging (fMRI), full-field light sensitivity testing, retinal structure studies including optical coherence tomography, fundus photography, fundus autofluorescence, adaptive optics laser scanning ophthalmoscopy, mobility testing, reading speed and accuracy testing, microperimetry, and / or ophthalmoscopy. These and other efficacy tests are described in U.S. Pat. No. 8,147,823; co-pending International Patent Application Publication Nos. WO 2014 / 011210 or WO 2014 / 124282, which are incorporated herein by reference.
[0110] In one embodiment of the methods described herein, a single intraocular delivery of a composition described herein, e.g., AAV delivery of an optimized LCA5 cassette, is useful for treating LCA in a subject. In another embodiment of the methods described herein, a single intraocular delivery of a composition described herein, e.g., AAV delivery of an optimized LCA5 cassette, is useful for treating LCA in an at-risk subject.
[0111] Thus, in one embodiment, the composition is administered before the onset of disease. In another embodiment, the composition is administered before the onset of visual impairment or vision loss. In another embodiment, the composition is administered after the onset of visual impairment or vision loss. In yet another embodiment, the composition is administered when less than 90% of the rods and / or cones or photoreceptors are functional or remaining compared to an unaffected eye. In one embodiment, neonatal treatment involves administering a reversilin-encoding sequence, expression cassette, or vector described herein within 8 hours, within the first 12 hours, within the first 24 hours, or within the final 12 hours of delivery. In another embodiment, particularly for primates (human or non-human), delivery to a neonate is within about 12 hours to about 1 week, 2 weeks, 3 weeks, or about 1 month, or about 24 hours to about 48 hours. In another embodiment, the composition is delivered after the onset of symptoms. In one embodiment, treatment of the patient (e.g., first injection) begins before the first year of life. In another embodiment, treatment begins after the first year, or after the first 2-3 years of age, after 5 years of age, after 11 years of age, or older. In one embodiment, treatment begins at about 4 years of age to about 12 years of age. In one embodiment, treatment begins after about 4 years of age or older. In one embodiment, treatment begins after about 5 years of age or older. In one embodiment, treatment begins after about 6 years of age or older. In one embodiment, treatment begins after about 7 years of age or older. In one embodiment, treatment begins after about 8 years of age or older. In some embodiments, treatment begins at about 9 years of age or later. In some embodiments, treatment begins at about 10 years of age or later. In some embodiments, treatment begins at about 11 years of age or later. In some embodiments, treatment begins at about 12 years of age or later. However, treatment can begin at about 15 years of age, about 20 years of age, about 25 years of age, about 30 years of age, about 35 years of age, or about 40 years of age or later. In some embodiments, in utero treatment is defined as administering a composition described herein to a fetus. See, for example, David et al., Recombinant adeno-associated virus-mediated in utero gene transfer gives therapeutic transgene expression in the sheep, Hum Gene Ther. 2011 Apr;22(4):419-26. doi: See 10.1089 / hum.2010.007. Epub 2011 Feb 2.
[0112] In another embodiment, the composition is re-administered at a later date. Optionally, multiple re-administrations are permitted. Such re-administrations may be with the same type of vector as described herein, a different viral vector, or non-viral delivery. In one embodiment, the vector is re-administered to the patient at a different location in the retina from the initial injection. In one embodiment, the vector is re-administered to the patient at the same location in the retina as the initial injection.
[0113] In yet another embodiment, any of the above methods is used in combination with another or secondary therapy. The secondary therapy may be any known or yet unknown therapy that helps prevent, block, or ameliorate these mutations or defects or any of their associated effects. The secondary therapy may be administered before, simultaneously with, or after administration of the above-described composition. In some embodiments, the secondary therapy involves a non-specific approach to maintaining retinal cell health, such as the administration of neurotrophic factors, antioxidants, or anti-apoptotic agents. The non-specific approach may be achieved by injection of proteins, recombinant DNA, recombinant viral vectors, stem cells, fetal tissue, or genetically modified cells. The latter may include encapsulated genetically modified cells.
[0114] In one embodiment, a method for producing a recombinant rAAV comprises obtaining a plasmid containing an AAV expression cassette as described above and culturing packaging cells harboring the plasmid in the presence of sufficient viral sequences to allow packaging of the AAV viral genome into an infectious AAV envelope or capsid. Specific methods for rAAV vector production are described above and can be used to generate rAAV vectors capable of delivering the codon-optimized LCA5 in the expression cassette and genome described above and in the Examples below.
[0115] In certain embodiments of the present invention, the subject has Leber's congenital amaurosis (LCA), for which the components, compositions, and methods of the present invention are designed to treat. As used herein, the term "subject" includes humans, domestic or farm animals, domestic or pet animals. "Subject" refers to a mammal, including animals commonly used in clinical research, including mice, rats, dogs, cats, pigs, cows, sheep, and non-human primates. As used herein, the term "subject" is used interchangeably with "patient." In certain embodiments, the subject of these methods and compositions is a human. Still other suitable subjects include, but are not limited to, mice, rats, dogs, cats, pigs, cows, sheep, and non-human primates.
[0116] As used herein, the terms "treatment" or "treating" are defined to include administering one or more compounds or compositions described herein to a subject for the purpose of ameliorating one or more symptoms of LCA. Accordingly, "treatment" can include one or more of the following: reducing the onset or progression of LCA in a given subject; preventing the disease; reducing the severity of disease symptoms or slowing their progression, including the progression of blindness; eliminating disease symptoms; delaying the onset of the disease; or monitoring disease progression or the effectiveness of treatment.
[0117] It should be noted that the terms "a" or "an" refer to one or more. As such, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.
[0118] The terms "comprise," "comprises," and "comprising" are to be interpreted inclusively and not exclusively. The terms "consist," "consisting," and variations thereof are to be interpreted exclusively and not inclusively. Although various embodiments herein are presented using the language of "comprising," it is intended that, under other circumstances, the relevant embodiment also be construed and described using the language of "consisting of" or "consisting essentially of."
[0119] As used herein, the terms "disease," "disorder," and "condition" are used interchangeably to refer to an abnormal state in a subject.
[0120] As used herein, the term "about" or "to" refers to a 10% variation from the given reference unless otherwise specified.
[0121] As used herein, the term "modulate" or variations thereof refers to the ability of a composition to inhibit one or more components of a biological pathway.
[0122] Unless otherwise defined herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art and by reference to the published documents, which provide those skilled in the art with general guidance for many of the terms used herein. [Example]
[0123] The following examples are illustrative only and are not intended to limit the invention.
[0124] Example 1: Recombinant rAAV and in vitro expression studies Retinal gene transfer using AAV2, the most studied recombinant AAV serotype, has been performed in humans and in over 310 eyes in 29 different clinical trials (clinicaltrials.gov). These trials target a variety of diseases, including autosomal abnormalities (RPE65 deficiency, MERTK-mutated retinitis pigmentosa, choroideremia, and color blindness), mitochondrial diseases (Leber's hereditary optic neuropathy), complications of age-related macular degeneration (choroidal neovascularization), and end-stage retinal degeneration (using optogenetic therapy). The majority (18 / 29, or 18 of 22 studies using AAV and subretinal injection) aimed to efficiently target RPE cells. The end result is a large amount of safety data for intraocular delivery of AAV. Subretinal injection is the same surgical technique required to target photoreceptors in LCA5 patients.
[0125] Based on this information, considerable effort has been devoted to developing protocols for treating LCA5 and other diseases involving primary photoreceptor defects. Unfortunately, AAV2 vectors do not efficiently target photoreceptors, and as previously mentioned, photoreceptors comprise the primary cell type in LCA5 and most other inherited retinal degenerations. For this reason, we selected AAV7m8, a vector generated by evolutionary design. This vector has been shown to efficiently target photoreceptors in multiple species (mice and nonhuman primates (NHPs)) and using different administration routes.
[0126] The efficacy reported here includes improved ability of treated animals to navigate using visual stimuli, restoration of the visual pathway to the brain as seen by pupillometry, reduced photoreceptor apoptosis, and preservation of functional photoreceptors with morphology and markers characteristic of this cell type, such as the presence of rhodopsin in the outer retina. Treated Lca5gt / gt photoreceptors exhibit a thick outer nuclear layer with preserved outer segments containing stacked outer segment discs. This contrasts sharply with untreated Lca5gt / gt retinas, which were reduced to a single row of noncontiguous photoreceptor nuclei by 19 years and 3 months of age. The improvements were not permanent; however, they persisted for at least 3 months, at which point untreated Lca5gt / gt mice had no remaining photoreceptors. Electroretinogram and MEA results indicate that, upon successful photoreceptor transduction, LCA5 gene therapy can at least partially restore responses mediated by both rod and cone photoreceptors. The cellular responses included responses reflecting the activity of various ganglion cell types as well as a reversal of the dominant melanopsin response observed in untreated Lca5gt / gt retinas, with near-normal kinetics. These results complement the pupillometry and visual behavioral findings and provide a framework for future studies (including studies of visual behavior in low-light conditions) aimed at further characterizing and optimizing treatment efficacy. These data suggest that a gene augmentation approach in humans similar to that used in Lca5gt / gt mice holds promise for improving vision. Further optimization of the therapeutic intervention may enable more durable rescue. Varying the components of the transgene cassette (e.g., promoter) and the region of the retina treated may lead to further benefits. Dosing studies will identify the optimal dose for therapeutic efficacy. The fact that patients without LCA5 can retain photoreceptors throughout adulthood (mice lose photoreceptors early in their lives) suggests that LCA5 humans may offer a better window of opportunity compared to Lca5- / - mice. Photoreceptors without LCA5 in the outer foveal nuclear layer have been reported in humans for up to 30 years, which is important because successful gene therapy requires the presence of affected cells.We were able to demonstrate that retained photoreceptors in adults with LCA5 mutations exhibited a temporal pattern of light response (albeit with reduced amplitude) similar to that of photoreceptors derived from individuals with normal vision. These results indicate that the remaining photoreceptors in LCA5 patients are functional, despite structural and physiological defects. The primary cilia in iPSC-RPE derived from LCA5 mutant patients were significantly fewer than those derived from control cells. The fact that the photoreceptor ciliary defects in Lca5gt / gt mice can be corrected with gene augmentation therapy, and the number of cilia can be increased to normal levels, suggests that the ciliary defects observed in humans with this condition may be ameliorated.
[0127] A. Recombinant AAV Recombinant AAV was developed using the AAV7m8 capsid, which is known to infect photoreceptors more efficiently than AAV2, at the Center for Advanced Reproduction. produced at Tinal and Ocular Therapeutics (CAROT) (Dalkara D, Byrne LC, Klimczak RR, Visel M, Yin L, Merigan WH, et al. In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal Gene delivery from the vitreous. Sci Transl Med (2013) 5(189): 189ra76. doi:10.1126 / scitranslmed.3005708.) An optimized cDNA (hopt.LCA5) encoding human (h) wild-type level activator was individually designed for optimal codon usage and synthesized using DNA2.0 (Menlo Park, CA). The LCA5 cDNA was placed under the control of exon 1 of a hybrid chicken β-actin (CBA) gene flanked by intron 1 sequences and the cytomegalovirus (CMV) immediate-early enhancer (IME) (Figure 1A and IE). A bovine growth hormone poly(A) sequence followed this cDNA. A long stuffer sequence was included to prevent reverse packaging of the AAV2 inverted terminal repeat-derived vector (i.e., containing a non-transgene). These vectors were generated by triple transfection and formulated in a vehicle containing phosphate-buffered saline (PBS) and 0.001% Pluronic F68 (PF68). See, for example, Mizukami, Hiroaki, et al. A Protocol for AAV vector production and purification. Diss. Division of Genetic Therapeutics, Center for Molecular Medicine, 1998. The control vector contained an enhanced green fluorescent protein (eGFP) cDNA instead of the LCA5 cDNA.
[0128] These rAAVs were tested for expression of the appropriate size transgenic protein by Western blot. 8431 cells were cultured at 2 × 10 6 Two days after seeding, the cells were transfected with 1 × 10 AAV7m8.hopt.LCA5 (or AAV7m8.CBA.EGFP as a control) at 1 × 10 5 or 5×10 5Cells were transduced with 1000 mg of IgG1 / 2000 ng / ml ...
[0129] The AAV7m8.CBA.hopt.LCA5 virus can drive efficient expression of the LCA5 transgene in 8431 cells. Following infection with AAV7m8.CBA.hopt.LCA5, the expected approximately 81 kDa level of cillin protein was produced, demonstrating a dose-dependent response.
[0130] Example 2: LCA Mouse Model Study of Lca5- / - Mice Developing proof-of-concept gene augmentation therapy in the Lca5gt / gt mouse model poses several challenges: 1) retinal degenerative changes begin very early and progress rapidly, necessitating therapeutic intervention in neonatal mice; 2) because this is a photoreceptor-specific disease, recombinant AAV vectors that efficiently target photoreceptors must be used. AAV2 vectors, widely used in animal and human studies targeting RPE cells, do not target photoreceptors as efficiently as other AAV serotypes, as demonstrated by transduction comparisons of different serotypes after infection at comparable doses. Ideally, therapies must be developed that can ultimately be translated into human clinical trials; and 3) because retinal and visual function are very low at baseline and difficult to score, outcome assessments must be developed to accurately identify and quantify these improvements. Herein, we present a methodology designed for directed evolution. We used a recombinant AAV vector (AAV7m8) to deliver a cDNA encoding codon-optimized human resilin. By using AAV7m8 to deliver LCA5 to diseased photoreceptors early in life, we demonstrate that gene augmentation therapy results in both structural improvement of the retina and functional improvement of vision in Lca5gt / gt mice.
[0131] Reversillin is localized to the connecting cilium of photoreceptor cells (22). This connecting cilium is a transition zone between the photoreceptor inner segment and the antenna-like outer segment, supporting the selective transport of proteins and membrane vesicles. Therefore, the connecting cilium is a conduit supporting bidirectional protein transport along the ciliary microtubule track, or intraflagellar transport (IFT). Using both quantitative affinity proteomics (affinity purification, mass spectrometry, and bioinformatics analysis) and transgenic mouse models, Boldt et al. demonstrated that LCA5 mutations interfere with IFT (22), leading to premature defects in photoreceptor outer segment development and the inability to properly transport two distinct proteins specifically expressed in photoreceptors, arrestin and opsin. Knockout of the Lca5 gene in mice resulted in a retinal degenerative phenotype. The Lca5 − / − mice develop hypopigmented retinal patches, never develop outer segments, and lack cone and rod ERG responses to light. They have early and rapidly progressive retinal degeneration, and by 2 months of age, only a single (pathological) row of nuclei is present in the ONL. (22) Therefore, the Lca5 − / − mice were used as an animal model of LCA.
[0132] Adult Lca5 gt / gt (Lca5- / -) mice were purchased from Jackson Labs (Bar Harbor, ME) and sibling-bred to generate the strain. All animals used in this study were genotype-verified (see Supplementary Methods). Mice were subjected to a 12-hour light / 12-hour dark cycle and provided with food and water ad libitum. This study was conducted in accordance with federal and state regulations.
[0133] For cohorts of pups, subretinal injections were performed unilaterally in neonatal mice as previously described (28). Mice were anesthetized by hypothermia on postnatal day 5 (PN5). On postnatal day 15 (PN15), animals were anesthetized with ketamine / xylazine. Table 1 shows the number of animals used per cohort.
[0134] We also performed intravitreal injections of AAV7m8, as this vector has previously been reported to penetrate the mouse retina from the vitreous side toward target photoreceptors. (25) AAV7m8.CBA.hopt.LCA5 was administered to cohort 1 in 1 μl for a total of 9.20 × 10 9 vg (Table 1). The injection solution contained 5% v / v AAV7m8.CBA.EGFP, allowing reliable identification of the injection area at later time points by the presence of enhanced green fluorescent protein (EGFP). Additional animals were sham-injected (Cohort 2), injected with AAV7m8.CBA.EGFP alone (Cohort 3), or maintained uninjected as controls (Cohort 4). After injection, pups were returned to their mothers until weaning. [Table 1]
[0135] Approximately one month after injection, ophthalmoscopy was performed to confirm that the tunica media was clear, the retina was not detached, and therefore there were no surgical complications. Animals with corneal or vitreous opacities were excluded from further study.
[0136] Cohorts of mice were housed and studied and injected at early postnatal (PN5) and juvenile stages (PN15) (Table 1). Few complications were observed due to the injections. After injection at PN5, the majority of animals did not develop corneal or vitreous opacities that would preclude further testing. Some animals with opacities were excluded from further analysis.
[0137] This AAV7m8.CβA.hopt-LCA5 virus was able to promote efficient expression of the human LCA5 transgene in the mouse retina after both intravitreal (IVT) and subretinal (SR) administration (Figures 1C and 1D, respectively). Western blot analysis demonstrated the production of the expected approximately 81-kDa LCA5 protein after intraocular delivery of AAV7m8.CβA.hopt-LCA5 in Lca5gt / gt and wild-type mice at PN20 (Figure 1B). Immunofluorescence analysis demonstrated the presence of leveling cilin protein in the ONL, inner segment (IS), and connecting cilium (CC) of wild-type adult retinas (Figure 1E). In Lca5gt / gt retinas, leveling cilin was observed after intravitreal or subretinal injection of AAV7m8.CβA.hopt-LCA5. Lucilin was found in the CC as well as the IS and ONL (Figures 1G and 1H). In contrast, lucilin was not found in sham-injected Lca5gt / gt retinas (Figure 1F). In addition, after IVT injection, a significant number of Müller cells produced lucilin (Figure 1G).
[0138] Example 3: Testing of retinal / visual function Tests of visual and retinal function included light-cued water maze (2-3 months post-injection), pupillometry (2.5 months post-injection), multi-electrode array (3 months post-injection), and electroretinography using mice as shown or described in Example 2. Retinas were then evaluated for histopathology and immunofluorescence as described in Example 4. Extensive histological analysis was also performed.
[0139] A. Electroretinography ERGs were recorded from eight Lca5gt / gt mice, five wild-type animals, and 16 Lca5gt / gt mice that received intravitreal injections of vehicle in the left eye and AAV7m8.CβA.hopt-LCA5 in the right eye at PN5. Control eyes not injected with Lca5gt / gt or vehicle-injected Lca5gt / gt eyes (32 eyes in total) did not produce detectable ERG responses. Of the 16 AAV7m8.CβA.hopt-LCA5-injected eyes, four showed ERG responses to dim light flashes in the dark-adapted state, consistent with rod mediation of the signal, as well as mixed rod-cone responses to brighter light flashes that resembled the small-scale wild-type (WT) mixed rod-cone ERG waveform (fig. S2). Light-adapted ERGs were also detectable in these eyes, suggesting cone mediation of the photopic response. The amplitude of detectable ERGs after treatment ranged from 20–25% of WT amplitude (Figure S2). This result suggests recovery of both rod and cone photoreceptor function after gene therapy in some animals. The discrepancy in ERG findings across all fields may reflect incomplete retinal coverage and / or tissue damage (e.g., cataract, unresolved detachment) that persists after these technically challenging subretinal injections performed early in postnatal life. However, these results, although variable in magnitude and frequency, were dramatically different from the undetectable ERGs observed in untreated Lca5gt / gt eyes. B. Water Maze Guidance Studies
[0140] A water maze test was performed to assess each animal's ability to identify the chamber containing a submerged platform within a five-chamber water maze (Figure 11). The apparatus was placed in a room without external light, and a light source was placed directly above the platform prior to testing. Dark-adapted mice were released in the center of the maze and given 60 seconds, without interruption, to find the illuminated platform and land with all four paws.
[0141] Mice were dark-adapted and trained under room light (approximately 200 lux) before testing under dim light. During training, if the mouse failed to find the platform at the end of 60 seconds, the experimenter guided the mouse to the platform. For each trial, the light and platform were placed in different chambers using random selection.
[0142] Training pass criterion was defined as the ability of the mouse to independently enter the appropriate chamber without veering into a different chamber and climb the platform within 60 seconds on more than five out of nine consecutive trials. All mice were trained over five days, regardless of the day on which the training pass criterion was met. Testing was performed over four days using the same procedure as used in training, but with a series of filters to further dim the light source. The use of filters reduced the luminance to 1.06 x 10 5 , 8.69 x 10 3 , 5.87×10 2 scot cd m 2 Or, the brightness when the light is off is 0 scot cd m 2 It was.
[0143] Animals were trained and tested in the light-cued water maze at 2-2.5 months of age. Results of the light-cued water maze test showed that the AAV7m8.CBA.hopt.LCA5 subretinal or intravitreal injection groups performed significantly better than the control group (Table 2B, see bolded values; Figure 3). Table 2A shows the raw data for the number of animals analyzed in each cohort and tested to a specified light level using the water maze. Table 2B shows the results of statistical analysis using one-way analysis of variance (ANOVA). Treated animals had a 8.69 x 10 3 scot cd m 2 passed the test in the control cohort of animals injected with the vehicle, but not in the control cohort of animals (p<0.01). [Table 2-1] [Table 2-2]
[0144] C. Pupillary light reflex The amplitude of pupil constriction was measured with 10 consecutive flashes per eye. The flash intensity was 1,000 scot lux. PLR was defined as a pupil constriction response with a maximum amplitude within a 0.6-1.2 s interval following a flash that exceeded three standard deviations of the pre-stimulus diameter. A scientist blinded to the treatment paradigm evaluated each animal's data prior to analysis to ensure that each pupil was accurately tracked. If this was not the case, that particular animal was excluded from further analysis.
[0145] For statistical analysis, treated (right) and contralateral sham-injected control (left) Lca5- / - eyes were compared at each light intensity. The normalized amplitude of the contraction in the treated eye was divided by that in the untreated eye to obtain the maximum differential amplitude of response (MDAR) percentage. A higher MDAR percentage indicates a stronger response to the therapeutic intervention. Additional untreated Lca5- / - and wild-type (C57B1 / 6) mice of the same age were used as positive and negative controls, respectively. The MDAR of untreated Lca5- / - and C57B1 / 6 mice was set to approximately 0 due to minimal difference between the two eyes.
[0146] Further analysis assessed the magnitude of pupil constriction amplitude in the right eye of different cohorts of mice, so that constriction amplitude could be compared between treated and untreated Lca5- / - mice and untreated C57B1 / 6 mice.
[0147] Analysis of the amplitude of the pupillary light reflex evoked by stimulation in treated and control eyes revealed a significant (p<0.05) improvement in pupillary reflex amplitude in Lca5- / - mice treated with AAV7m8.hopt-LCA5 either subretinally or intravitreally compared with untreated control Lca5- / - animals (Fig. 2). Animals injected with either delivery route at PN5 (Fig. 2A, 2B, 2H, and 2I) and with subretinal delivery at PN15 showed a significant improvement in pupillary light reflex (PLR), with a trend toward improvement with intravitreal delivery (Fig. 2H and 2I).
[0148] D. Multielectrode array AAV7m8.CMV / CBA.hopt.LCA5 (approximately 9.87 × 10) cells were mixed with 5% (v / v) AAV7m8.CBA.GFP. 10 Multielectrode array (MEA) testing was performed in five animals 2.5–3.5 months after intravitreal injection of 100 mg / vg (vg / eye) into one eye. The other eye was sham-injected and used as a negative control. Five untreated, age-matched wild-type (WT) C57B1 / 6 mice served as positive controls. The retinas of light-adapted mice were dissected under red light, and ganglion cells were placed in a perforated MEA chamber. The explants were placed facing downward. The presence of GFP in the explants confirmed exposure of photoreceptors to AAV. Calibrated full-field flashes of 455 nm light of different intensities (pigment excitation efficiency approximately 40% for rhodopsin and M-opsin; approximately 0.2% for S-opsin) were used for photostimulation (2-second flashes at 0.1 Hz or 50-ms flashes at 4 Hz). Data were analyzed using custom code in Matlab (MatLab, Natick, MA); spike sorting was performed with Plexon Offline Sorter (Plexon, Dallas, TX). AAV7m8.CβA.hopt-LCA5 at PN5 was probed using multielectrode array (MEA) analysis. The reason for using an MEA is that it measures retinal output signals sent to the brain, providing information about the retinal neural network in addition to examining photoreceptor function. Of the five retinas / animals tested with the MEA, two had clearly detectable rod and cone ERGs (see representative recordings in Figure S2), one had a residually faint, approximately 10 V ERG, and two had no detectable ERGs. Three of the five retinas injected with AAV7m8.CBA.hopt.LCA5 showed strong light responses, one showed a median response, and one showed a minimal response in the MEA test (Figure 5A-D). Responses became detectable at scotopic intensities (42–112 photons*s). -1* μm -2 , or, on average, 8.28el hv / μm 2 ;455nm), and 2.00e9 photons*s -1* μm -2 A strong response was observed at the brightest photopic intensity of 1 μm , where the collection areas of the rods and cones for end-on illumination are approximately 1 μm at the wavelength of peak sensitivity. 2Assuming that 455 nm light stimulates rhodopsin and that the efficiency of M- and S-cone opsins is approximately 60%, 50%, and 0.3%, respectively,23,24 (note that in both ERG and our MEA experiments, light enters the retina from the ganglion cell side),25-27 the dim light that produces clearly detectable responses in our experiments should result in fewer than 70 photoisomerizations / sec / cell for rods, fewer than 60 for M-cones, and approximately 0.3 for S-cones. Data from suction pipette recordings show that dye excitation at this rate can produce detectable light responses (response amplitudes greater than 20% of maximum) in rods, whereas cone responses would be at least 20-fold smaller under the most favorable conditions (dark-adapted rod-transducin knockout retinas containing M cones) and would be undetectable in rod-dominated mouse retinas. 25,26,28 (The collection area of side-on illumination in suction pipette recordings is approximately 0.5 μm for cones and 0.2 μm for cones.) Thus, in our experiments, the observation of light responses across the dimmer intensity range demonstrates the restoration of rod function in treated Lca5gt / gt retinas. Responses at the brightest intensity edge should be cone-driven (the brightest intensity produces approximately 1.00e9 and 6.00e6 photoisomerizations / sec / cell for M- and S-cones, respectively, and must be capable of driving at least both M- and S-cones). As expected for rod / cone-driven responses, after the first intensity series (light-sensitive retinas were subjected to at least two intensity series, increasing approximately 0.5 logs from scotopic to brightest photopic intensity), scotopic responses disappeared, whereas photopic responses were not significantly affected (Fig. 5C and D). WT and treated Lca5gt / gt retinas also responded to 4 Hz flicker stimuli at intensities expected to drive cone responses (data not shown). The retina of the sham-injected contralateral eye showed minimal to absent response, with high autoluminescence and a prominent melanopsin response.
[0149] A slower melanopsin-driven response was also detected in both AAV7m8.CβA.hopt-LCA5-treated and Lca5gt / gt retinas, and the melanopsin response of wild-type mice (which appears to have a slower recovery after the first flash in a series, resulting in an increased emission rate at the onset of the second flash) appears to be absent in treated retinas compared to untreated retinas. [Table 3]
[0150] The two treated Lca5- / - retinas showed signs of injury after injection and, despite being highly autoluminescent, showed no light response.
[0151] The responses of AAV7m8.CBA.hopt.LCA5-treated retinas were similar to those of untreated wild-type retinas. One treated retina, examined at the shortest time post-injection, showed reduced light sensitivity and a lack of OFF- and sustained ON-responses (red downward-pointing triangles in Figure 5D). The development of OFF-responses required a longer time post-injection compared with ON-responses, consistent with the increased variability in OFF-response amplitude observed in the 10 treated retinas. Under full-field stimulation, the functions of all ganglion cell types identifiable in WT retinas were detected in Lca5gt / gt AAV-treated retinas after spike sorting (Figure S10). Under scotopic and photopic stimulation, even at the brightest intensity (approximately 100 mW / cm), the functions of all ganglion cell types identifiable in WT retinas were detected in Lca5gt / gt AAV-treated retinas after spike sorting (Figure S10). 2 ) was observed. As expected for a rod / cone-driven response, after exposure to the brightest light, the scotopic response was abolished, whereas the photopic response was not significantly affected (data not shown).
[0152] The response of the AAV7m8.hopt.LCA5-treated retina became detectable at scotopic intensities (42-112 photons). * s-1 * μm-2, or on average, 8.28 el hv / μm2; 455 nm) and 2.00e9 photons * s-1 *A strong response was observed at the brightest photopic intensity of 1.5 μm-2. Retinas from sham-injected contralateral eyes showed minimal to absent responses (data not shown, control Lca5- / -). Responses in retinas treated with AAV7m8.hopt.LCA5 were similar to those in wild-type mice. After exposure to the brightest light (2E9 hv / cm2), flicker responses indicated that the photopic response was not significantly affected (data not shown, Lca5- / - treated). Flicker response intensity series (3.53E2-1.52E6 hv / cm2) showed a significant difference in the response intensity. (Starting with a representative AAV7m8.CBAhopt.LCA5-treated retina at cm2) shows that the amplitude of the response increases with increasing light intensity. Examination of rod and cone durability responses after the brightest light flashes showed a persistence of cone responses similar to that observed in wild-type retinas. Flicker response studies show similar responses in treated Lca5- / - retinas compared to wild-type mouse retinas. The emission rates of rods and cones in treated Lca5- / - retinas as a function of light intensity approximate those of wild-type retinas (as opposed to control, untreated Lca5- / - retinas).
[0153] The response kinetics was similar to that of the WT retina (data not shown). * s -1* μm -2 The light sensitivity of treated Lca5- / - retinas was slightly lower than that of the most sensitive WT retinas, where the first response was detected at 1000 kJ / s (data not shown). All ganglion cell types (ON, OFF, and ON / OFF types) discernible in WT retinas under full-field stimulation were detected in Lca5- / - treated retinas after spike sorting. WT and treated Lca5- / - retinas exhibited a photon response of 3.53e2-2.00e9 photons. * s -1* μm -2 In contrast, the untreated Lca5- / - retinas responded to 4 Hz flicker stimuli at 100 Hz (data not shown). All untreated Lca5- / - retinas exhibited a bright, intense, and slow melanopsin-driven response that was absent in the light-sensitive treated Lca5- / - retinas. A summary of the findings is shown in Table 3.
[0154] Although results from electroretinogram and MEA experiments demonstrated recovery of rod and cone function in at least some animals, these methods produced useful ERG signals in only one-quarter of treated mice, making them inadequate for assessing the efficacy of therapeutic intervention in the majority of animals. Therefore, we evaluated the efficacy of therapeutic intervention based on two additional methods: pupillary light reflex (PLR) and visual behavior analysis. First, we demonstrated greater sensitivity than electroretinograms and, second, demonstrated that treatment of Lca5gt / gt retinas with AAV7m8.CβA.hopt-LCA5 resulted in a light-induced signal that was relayed beyond the retina via the visual pathway to the brain.
[0155] The pupillary light reflex (PLR) relies on signal relay from photoreceptors to retinal ganglion cells, then to the Edinger-Westphal nucleus in the brain, and finally back to the pupillary sphincter via the ciliary ganglion, which controls iris diameter. Compared to sham-injected controls, the amplitude of the PLR in eyes of Lca5gt / gt mice treated with AAV7m8.CβA.hopt-LCA5 was significantly (p<0.05) increased in post-stimulation PLR analysis of treated and control eyes (Figure 2C). Significant improvements in the PLR were detected in animals injected intravitreally or subretinally at PN5 (Figures 2A-2B and 2E-2F), with near-wild-type responses observed (Figure 2D). A statistically significant improvement in PLR amplitude was also demonstrated through comparison of the maximum difference amplitude of the response (MDAR; Figures 2G-2I; Figure S1). Animals receiving IVT or SR delivery of AAV7m8.CβA.hopt-LCA5 also showed a significant improvement in PLR as quantified by MDAR (Figures 2H and 2I).
[0156] Because the PLR demonstrates retinal signaling and function but does not provide information about formed vision, we used a light-cued water maze test to measure functional vision, as previously described. While the majority of untreated wild-type (normally sighted) mice successfully navigated the water maze at all light levels, untreated Lca5gt / gt mice were severely impaired (Table 2, Figure 3A). Water maze results showed that Lca5gt / gt animals injected both intravenously and subretinally with AAV7m8.CβA.hopt-LCA5 performed statistically significantly better than uninjected controls under at least one light condition (Table 2; Figure 3). Animals receiving subretinal treatment on PN5 demonstrated significantly improved success rates (p<0.01) over the control vehicle-injected cohort across all lighting test conditions (1.06E+05, 8.69E+03, and 5.87E+02 scod cd m-2). Improvement was minimal when animals were injected on PN15 (IVT or SR). To confirm that the mice were using only the designated light cues, we performed the test in the dark (0.00 scot cd m²). More than 90% of the mice failed the test (including mice with normal vision, Figure 3B).
[0157] Example 4: Ocular histology, histopathology, immunofluorescence, and TUNEL assay Histological rescue of Lca5gt / gt photoreceptors at PN5 after treatment with AAV7m8.CβA.hopt-LCA5 was assessed through both molecular assessment and structural measurements related to the proper function of the phototransduction cascade. Animals described in Examples 2 and 3 were euthanized at 3 months of age. Eyes were enucleated, and retinal sections were evaluated using a modified method described by Boldt et al. (22). Tissues were fixed in 4% paraformaldehyde in PBS and cryoprotected in 30% sucrose / PBS before freezing and cryosectioning. Histopathology was analyzed by examination of 4',6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Philadelphia, PA)-stained sections and / or staining with hematoxylin and eosin. For immunofluorescence studies, sections were incubated with anti-reversilin (1:300, (12, 22)) in the presence of blocking solution, washed, and then treated with Cy3-conjugated secondary antibodies. Additional antibodies used were anti-rhodopsin (1:500, Leico Technologies), anti-red / green cone opsin (1:250, Chemicon), and anti-acetylated tubulin (1:1,000, Sigma-Aldrich). Stained sections were coverslipped with Citifluor mounting medium containing DAPI (Electron Microscopy Services, Hatsfield, PA). TUNEL staining was performed using a terminal deoxynucleotidyl transferase (TdT) dUTP nick-end labeling (TUNEL) assay kit according to the manufacturer's recommendations (Vector Laboratories, Burlingame, CA). Sections were evaluated using a Zeiss Axio Imager M2 microscope equipped with epifluorescence and Axio-Vision 4.6 software, and a confocal laser scanning microscope (Olympus Fluoview 1000, Center Valley, PA, USA). Transmission electron microscopy (TEM) was performed on designated tissue samples using an FEI-Tecnai T12 S / TEM.
[0158] Immunofluorescence analysis of eyes injected with AAV7m8-hopt-LCA5 at PN5 and analyzed at PN15 showed reversillin colocalizing with the base of tubulin-positive outer segments. After intravitreal injection, reversillin was distributed throughout the retina and was nearly absent from photoreceptors at PN95. In contrast, reversillin was absent in untreated PN15 and PN95 Lca5- / - retinas.
[0159] Hematoxylin and eosin stained treated and control retinal sections were compared with sham injections after intravitreal (IVT) or subretinal (SR) injection of AAV7m8.hopt-LCA5 (5% v / v AAV7m8.eGFP) at PN40 versus PN99. Hematoxylin and eosin stained (H&E) photomicrographs of retinas showed that the inner / outer segment (IS / OS) and ONL were preserved at 3 months (PN99) after either IVT or SR injection of AAV7m8.hopt-LCA5 (data not shown). In contrast, no such layers were observed in sham-injected control retinas at PN99 (data not shown). Furthermore, reversilin was detected in treated retinas but not in sham-treated control retinas (data not shown). Persistent expression of rhodopsin in the ONL was also confirmed by immunofluorescence analysis (data not shown), but was only observed in treated eyes.
[0160] At PN5, the thickness of the photoreceptor layer in retinas treated with AAV7m8.CβA.hopt-LCA5 by IVT or SR injection was significantly greater than that in control retinas ( Fig. 4 ). There was also a pronounced demarcation in thickness between the AAV-exposed and unexposed retinal regions in the subretinal-treated retinas (data not shown). Preservation of the photoreceptor layer persisted up to the latest time point (PN99). The increased thickness was due to an increased number of columns in the outer nuclear layer and the presence of inner and outer segments (Figure 4). Consistent with this, the proportion of dying photoreceptors was significantly higher in control compared with AAV.LCA5-treated retinas, as judged by TUNEL labeling, particularly within the first month of treatment (data not shown).
[0161] Evaluation of Lca5- / - mouse retinas injected with AAV7m8.hLCA5 at PN5 between 1 and 3 months after injection revealed increased outer nuclear layer thickness (Figures 5A and 9). Immunofluorescence analysis revealed that reversilin colocalized with the base of tubulin-positive outer segments in Lca5- / - retinas treated with AAV7m8.hOP.LCA5 (Figure 1M). Untreated Lca5- / - retinas contained numerous TUNEL-positive cells at 1 month of age, whereas retinas treated with AAV7m8.hOPT.LCA5 contained significantly fewer TUNEL-positive cells (Figures 6B and 6C). The number of TUNEL-positive cells decreased by the time these animals reached 3 months of age (Figures 6D and 6E). The majority of cells that degenerated over time in untreated Lca5- / - retinas compared with control (untreated) retinas were photoreceptors, as indicated by the fact that rhodopsin-positive cells were only found in AAV-treated retinas (Fig. 6B). Immunofluorescence analysis confirmed this result (see blue DAPI-stained ONL) and showed a sustained increase in rhodopsin (red staining) at 3 months (Fig. 6D). After injection of AAV7m8.hopt.LCA5, we observed evidence of light-mediated changes in the location of phototransduction-specific molecules (Fig. 10).
[0162] Transmission electron microscopy (TEM) of AAV7m8.hopt.LCA5-treated retinas revealed detailed outer segments with stacked outer segment discs, 9+0 microtubule arrays typical of primary villi (Figure 7B), and connecting cilia (Figure 7C). In contrast, untreated Lca5- / - retinas lacked both connecting cilia and outer segments. Untreated retinas lacked outer segments and showed extensive degeneration of photoreceptors with only pyknotic nuclei and remnants of photoreceptor organelles. Control untreated or sham-injected retinas contained only disorganized degenerating photoreceptor cell bodies.
[0163] Light stimulation of dark-adapted adult Lca5gt / gt retinas treated with AAV7m8.hopt-LCA5 on PN5 induced a normal translocation pattern of phototransduction proteins to the outer segments. Arrestin translocates appropriately after light exposure in AAV7m8.hopt-LCA5-treated retinas. This behavior cannot be assessed in control retinas due to IS / OS degeneration. This data reflects the restoration of intraflagellar transport defects in mouse retinas after delivery of wild-type (WT) hLCA5 cDNA.
[0164] Developing proof-of-concept gene augmentation therapy in the Lca5- / - mouse model poses several challenges: 1) retinal degenerative changes begin early in life and progress rapidly, necessitating therapeutic intervention in neonatal mice; 2) because this is a photoreceptor-specific disease, recombinant AAV vectors must be used that efficiently target photoreceptors. The AAV2 vector, widely used in animal and human studies targeting RPE cells, does not target photoreceptors as efficiently as other AAVs (23, 24). Ideally, reagents that can ultimately be used in human clinical trials must be used; and 3) because retinal and visual function are difficult to measure at baseline, outcome measures that reflect these improvements must be developed. Herein, we tested the efficacy of a recombinant AAV, AAV7m8 (25), designed using directed evolution, following delivery of a cDNA encoding native human leucine. Others have reported that this vector efficiently targets photoreceptors following intravitreal delivery (25-27). AAV7m8 was used to deliver the hLCA5 cDNA. By delivering A to diseased photoreceptors early in life, gene augmentation therapy resulted in both structural improvement of the retina and functional improvement of vision in Lca5- / - mice.
[0165] In Examples 3 and 4, we demonstrated that AAV7m8-mediated gene augmentation therapy in Lca5- / - mice rescued retinal and visual function, as well as retinal structure.
[0166] The efficacy reported in this example included the model's improved ability to navigate using visual cues, restoration of rod and cone photoreceptor responses as demonstrated by multielectrode array (MEA), reduced apoptotic cell death (i.e., photoreceptor preservation), and the presence of cellular biological and physical features characteristic of normally functioning photoreceptors, such as the presence of rhodopsin in the outer retina and normal-appearing outer segment development with stacked outer segment discs. MEA results demonstrated that, with successful injection and sufficient time post-injection to express the transgenic protein and restore rod / cone outer segment function, gene therapy restored degenerated retinal cells to a state nearly indistinguishable from the WT state. Furthermore, delivery of wild-type LCA5 protected photoreceptors from degeneration. While untreated Lca5- / - retinas were reduced to a single row of pathological photoreceptors by 3 months of age, the AAV-treated areas later had a thickened outer nucleus with inner and outer segments. These benefits persisted for at least 3 months—a significant finding, especially considering that by this age, there are no remaining photoreceptors in the retina of untreated Lca5- / - mice. These data suggest that a genetic augmentation approach similar to that used in Lca5- / - mice can improve vision in humans.
[0167] Example 5: Human studies: Pupillary light reflex test The study was conducted after obtaining written informed consent under an IRB-approved protocol (#815348). Pupillary responses were recorded simultaneously in both eyes using a Procyon P3000 pupillometer and PupilFit6 software (Monmouthshire, UK). Pupillary responses to light were recorded after a dark interval following a 0.2-second application of a 10-lux green light stimulus to the right eye. An infrared-sensitive camera capturing video images at 25 frames per second allowed for measurements of pupil diameter in both eyes every 40 milliseconds.
[0168] A pupillary light reflex test was performed to determine whether there was evidence of function in the remaining photoreceptors present in adults with homozygous LCA5 mutations. As shown in Figure 8, the pupillary light reflex was present in this individual and followed the same temporal sequence as in individuals with normal vision. However, the amplitude of the response was significantly reduced compared to individuals with normal vision.
[0169] Example 6: Induced pluripotent stem cell (iPSC) model of LCA5 To support the translation of mouse rescue studies to humans, we studied human induced pluripotent stem cell (iPSC) lines derived for research purposes from individuals with normal vision and individuals affected by LCA due to LCA5 mutations. Recently, it has been reported that iPSC-derived retinal pigment epithelium (RPE) recapitulates the functional phenotype of polarized epithelium, with secretory, gene expression, and maturation characteristics comparable to fetal and adult RPE. 29 These cells hold great promise for understanding disease mechanisms associated with defects in ciliary biology. 30, 31 Herein, we differentiated iPSCs into RPE cells (Figure 12A), a process that allowed for the evaluation of ciliated cells more quickly and efficiently than that used to generate neurons / photoreceptors (fig. S12). We evaluated LCA5 gene expression and found that LCA5 mRNA was expressed in unaffected iPSC-derived RPE, and that LCA5 expression levels in RPE from LCA patients were significantly reduced compared to controls (Figure 12B). When we measured the distribution of cilia, we found that iPSC-RPE derived from LCA5 patients had significantly fewer cilia than RPE derived from individuals with normal vision (Figure 12D-E). This resulted in the production of reversilin protein (Fig. 12C) and a comparable number of cilia in RPE cells from individuals treated with AAV7m8.LCA5 and individuals with normal vision (Fig. 12D-F).
[0170] Peripheral blood mononuclear cells (PBMCs) were collected from two different probands with LCA5 mutations after obtaining signed informed consent (IRB-approved protocol #808828). One proband, JB605, was a compound heterozygote for LCA5 Gln279Stop CAG>TAG het and Lys172del4ctcAAAG het; the other, JB590, was homozygote for LCA5 c.835C>Tp.Q279X. Wild-type cells were derived from individual PBWT4.6. Induced pluripotent stem cell lines were generated from each of the three individuals. These PBMCs were cultured in growth medium consisting of QBSF-60 (Invitrogen, Carlsbad, CA) medium supplemented with cytokines and hormones. The medium was replenished every 2–3 days for 7–9 days until the cells entered the exponential growth phase.
[0171] For reprogramming, expanded PBMCs were transduced with rTTA lentivirus and a doxycycline-inducible "stem cell cassette" containing lentiviral vectors delivering OCT4, KLF4, SOX2, and cMyc cDNAs, as well as the microRNA 302 / 367 cluster driven by the TetO / CMV promoter. Cells were grown in growth medium supplemented with polybrene (5 μg / ml; Sigma-Aldrich, St. Louis, MO). These cells were incubated at 37°C for 20–24 hours. Infected cells were then washed and placed in growth medium supplemented with 1 μg / ml doxycycline (DOX). After 48 hours, the cells were resuspended in Iscove's modified Dulbecco's medium (IMDM) containing 10% fetal bovine serum (FBS), penicillin / streptomycin, L-glutamine, beta-mercaptoethanol, non-essential amino acids, 4 ng / ml basic fibroblast growth factor (bFGF), and 1 μg / ml DOX (Sigma-Aldrich, St. Louis, MO) and then transferred to Matrigel-coated (BD Biosciences, San Jose, CA) mouse embryonic fibroblast (MEF) plates. Cells remained in this medium for 10 days before being transferred to human embryonic stem cell (hESC) medium (DMEM / F12, 20% knockout serum replacement, non-essential amino acids, 4 ng / ml bFGF, 0.001% beta-mercaptoethanol, penicillin / streptomycin, L-glutamine, and 1 μg / ml DOX (Invitrogen, Carlsbad, CA). After 4 weeks, iPSC-like colonies were manually picked and expanded on Matrigel-coated MEF plates for 6 passages, then transferred to 0.1% gelatin-coated MEF plates for at least 15 passages. iPSCs were characterized using SSEA3+, SSEA4+, TRA-1-60, and TRA-1-81 (Biolegend, San Diego, CA). Surface antigen expression was measured by flow cytometry using antibodies against pluripotency markers: DMNT3B, ABCG2, REX1, OCT4, SOX2, NANOG, cMYC, and KLF4.Karyotyping of iPSCs was performed by G-banding to generate a visible karyotype, and the ability of these cells to differentiate into multiple different lineages was assessed using a PCR germ layer assay (Qiagen, Germantown, MD, USA).
[0172] iPSCs characterized by activation of the Wnt signaling pathway, inhibition of the fibroblast growth factor signaling pathway, and inhibition of the Rho-associated coiled-coil-containing protein kinase signaling pathway were differentiated into RPE. Proliferated, pigmented cells were purified by plate adhesion on 8-chamber slides mounted on Geltrex matrix. Enriched cells were cultured until they developed a cuboidal, cobblestone appearance. iPS-RPE characteristics were confirmed by gene expression, immunocytochemistry, and microscopy. Cilia length was measured using ARL 1. After fixation and staining for 3B and pericentrin, cilium length was measured in three dimensions using custom-designed software from the Wistar Imaging Facility (Wistar Institute, Philadelphia, PA).
[0173] Cilia density and length were assessed in control and LCA5 iPSC-RPE cell lines. RPE cells derived from two LCA5 patients had significantly fewer cilia than wild-type cell lines. In addition, cilia in the LCA5-derived lines were significantly shorter than those in wild-type cells.
[0174] It has previously been shown that LCA5 patients can retain photoreceptors, including those in the outer foveal nuclear layer, for up to 30 years (21, 29). Because the presence of these cells is essential for successful gene therapy (even in diseased individuals), LCA5 photoreceptors may be suitable for therapy. The fact that this study demonstrated that retained photoreceptors in adults with LCA5 exhibited a temporal pattern of photoresponsiveness similar to that of photoreceptors in individuals with normal vision (albeit with reduced amplitude) is encouraging. These results further support the fact that the residual photoreceptors in these abnormal retinas are viable despite their structural and functional defects. Furthermore, the cilia of iPSC-RPE cells derived from LCA patients were significantly shorter than those in wild-type control cells. The fact that the ciliary defects in photoreceptors in Lca5- / - mice could be corrected by gene augmentation therapy suggests that the ciliary defects present in humans with this condition may be ameliorated. Studies are currently underway aimed at correcting the ciliary defects in iPSC-derived RPE cells in vitro.
[0175] LCA5 gene augmentation therapy in humans is being studied to test its safety and efficacy. In addition to the need to develop appropriate outcome measures for this severe blinding condition, this application provides solutions to several challenges in planning human clinical trials, including expanding the limitations on achieving rescue. Rescue was demonstrated in Lca5- / - mice in both newborn (PN5) and juvenile (PN15) mice. Because of the early loss of photoreceptors in this mouse model, therapeutic intervention was not observed at later stages of the disease. Developmental abnormalities in the mouse model (consistent with photoreceptor degeneration) suggested a developmental component to the disease. Similarly, there may be a developmental component to the human pathology. As noted above, there is evidence of persistence of some macular photoreceptors in humans with LCA5, even in adulthood. (21) Research is underway to determine ways to improve the function of these photoreceptors, as well as to determine whether visual pathways can be resuscitated in humans with LCA5, even after decades of suffering from vision loss, based on the successful resuscitation of cortical vision in humans enrolled in clinical trials of RPE65 gene therapy. (4, 30, 31)
[0176] Example 7: Genotyping of Lca5− / − mice Genomic DNA was PCR amplified using the following oligos: LCA-13F6 (common F) GCCTGTTCCTGCTTGCTTAC (included as SEQ ID NO: 13); LCA-13R2 (WT reverse) TGCTTTCCAAAGTAAGCACAAA (included as SEQ ID NO: 14).
[0177] en2.8r (mutant reverse) CCTGGCCTCCAGACAAGTAG (included as SEQ ID NO: 15). PCR was performed for 35 cycles with an annealing temperature of 50°C and an extension step of 72°C. The expected products were 353 bp (wild type) and 439 bp (Lca5- / -).
[0178] Example 8: Intravitreal injection of AAV7m8.hLCA5 inhibits photoreception in Lca5- / - mice Restores bodily functions to approximately WT levels Early-onset vision loss is caused by mutations in LCA5, a gene that encodes reversilin, a protein critical for photoreceptor health and function. Because there is relative preservation of photoreceptors, LCA5 disease may be amenable to gene augmentation therapy. The potential for gene augmentation therapy using intravitreal delivery of AAV7m8.CMV / CBA.hLCA5 was tested in an Lca5- / - mouse model using multielectrode arrays (MEAs) to restore photoreceptor and retinal function.
[0179] On postnatal day 5, Lca5 mice were inoculated with AAV7m8.CMV / CBA.hLCA5 (approximately 9.87 × 10) mixed with 5% (v / v) AAV7m8.CBA.GFP. 10 AAV (vg / eye) was intravitreally injected into the Lca5- / - retinas. The contralateral eye was uninjected and served as a negative control. Three months after the intervention, Lca5- / - retinas were dissected under red light under light-adapted conditions and placed ganglion cell-side down in perforated MEA chambers. As a positive control, age-matched untreated wild-type mice (C57Bl / 6) underwent the same dissection and preparation procedures. The presence of GFP confirmed photoreceptor exposure to AAV. Calibrated full-field flashes of 455 nm light in the scotopic and photopic intensity ranges (10 2-second flashes at 0.1 Hz or 400 50-ms flashes at 4 Hz) were used for light stimulation (blue light was used to target both M- and S-cones to maximize the chance of response detection; M- and S-cone excitation efficiencies are approximately 40% and 0.2%, respectively). Data were analyzed using custom Matlab code and spike sorting was performed using Pllexon Offline Sorting.
[0180] After 3 months, of the eyes with intact retinas, 3 of 5 demonstrated strong light responses, 1 showed a median response, and 1 showed a minimal response when tested using MEA recordings. The 3 retinas showing strong responses were within the scotopic range (42–112 photons × s). -1 ×μm -2) at which the photoresponse becomes detectable, and 2.00 × 10 9 photon×s -1 ×μm -2 Strong responses were observed up to the brightest photopic intensities of 8–21 photons × s−1. In contrast, responses in the uninjected contralateral eye retina were minimal or absent. As expected for rod / cone-driven responses, scotopic responses disappeared after exposure to the brightest stimulus series, whereas responses in the photopic range were not significantly affected. Response kinetics and sensitivity were very similar to those observed in five WT retinas tested with the same protocol (the sensitivity of the treated retinas was slightly lower compared to the most sensitive WT retina, with the dimmest flashes generating a rod-driven response ranging from 8 to 21 photons × s−1). -1 ×μm -2 One of the treated retinas examined 2 months after injection showed a lower light sensitivity (1.52 × 10 4 photon×s -1 ×μm -2 The Lca5- / - treated retinas showed a response that began at a photopic intensity of 1000 s (with most responses disappearing after the brightest exposure), suggesting that sufficient expression of the target protein and generation of functional rod / cone outer segments may require 3 months. All ganglion cell types (ON, OFF, and ON / OFF types) identifiable in WT retinas under full-field stimulation were detected in Lca5- / - treated retinas after spike sorting. Similar to WT retinas, treated Lca5- / - retinas showed a 3.53 × 10 2 ~2.00×10 9 photon×s -1 ×μm -2 The Lca5- / - retinas responded to 4 Hz flicker stimuli at a range of intensities. Only one of seven control, untreated Lca5- / - retinas demonstrated very weak light responses to bright photopic stimuli, which may indicate residual cone function. All untreated Lca5- / - retinas demonstrated slow melanopsin-driven responses at bright intensities that were absent in the light-sensitive, treated Lca5- / - retinas.
[0181] Two of the treated Lca5- / - retinas showed signs of injury after injection and showed no light response despite being highly autoluminescent. One treated retina showed no obvious signs of injury after injection, but was sensitive to light at the bright end of the stimulus intensity (8.07 × 10 8 photon×s -1 ×μm -2 (above) showed only a very weak light response, which could be indicative of low expression of the target protein and / or residual weak cone function.
[0182] If the injection is successful and sufficient time is allowed post-injection to express the target protein and restore rod / cone outer segment function, gene therapy restores degenerated retinal cells to a state nearly indistinguishable from the WT state.
[0183] LCA itself is one of the most severe retinal degenerative diseases, and LCA5 is one of the most severe subtypes in this category. In most cases, LCA5 patients only experience light perception early in life, and nystagmus makes it difficult to perform structural studies or specialized tests of visual function in these extremely low-vision subjects. Therefore, this disease is considered difficult to approach. However, the phenotype of Lca5- / - mice mirrors many of the clinical findings in humans with LCA5 mutations. Rescue data in Lca5- / - mice offer hope that similar genetic augmentation approaches as in humans may improve vision. In parallel with preclinical studies leading to human clinical trials, it is important to develop methodologies to accurately measure the structure and function of LCA5 retina so that the effects of gene therapy can be reliably and accurately captured in clinical trials. Such studies and gene therapy clinical trials will not only lead to treatment of this devastating condition, but also provide a framework for measuring the effectiveness of therapeutic interventions in other severe, early-onset blindness conditions.
[0184] Example 9: Preliminary analysis of LCA5 disease in humans To determine whether there was evidence of function in the remaining photoreceptors present in human adults with homozygous LCA5 mutations, we performed PLR studies. As shown in Figure S11, PLR was present in these individuals at the same time sequence as in individuals with normal vision. However, the amplitude of the response was significantly reduced compared to individuals with normal vision.
[0185] Example 10: Loss of Reversilin leads to dysregulation of RPE maturation and ciliary function in cell and animal models We investigated Leber congenital amaurosis 5 (LCA5), a pathological change occurring in the visual system due to loss of expression of the LCA5 gene, which encodes reversillin. Previous studies have elucidated the detrimental effects of reversillin deficiency on the neural retina, particularly photoreceptors. This study aimed to further elucidate the pathogenic mechanisms leading to LCA5 by focusing on the contribution of normal LCA5 expression to retinal pigment epithelium (RPE) development and function.
[0186] Two independent experimental paradigms were performed: one generated RPE cells derived from induced pluripotent stem cells (iPSCs) from both individuals with normal vision and individuals with LCA5. RPE cell morphology, pigmentation, cell-specific markers, and primary trophoblast characteristics were measured. The second method evaluated the retinas of wild-type mice compared with those of a mouse model of LCA5 deficiency (Lca5gt / gt mice). Spatiotemporal differentiation patterns were characterized to delineate the changes between degeneration and development that occur in the visual system due to the absence of the LCA5 protein.
[0187] These results demonstrate that LCA5 deficiency in both human RPE cell models and live mouse RPE cells leads to profound alterations in the development of these cells. Through gene expression analysis, we identified dysregulation of key proteins involved in ciliogenesis and intraflagellar transport, pigmentation, and the WNT signaling pathway during development. Immunostaining also identified differences in the epithelial barrier consistent with altered maturation resulting from loss of LCA5 protein function.
[0188] , This study potentially demonstrates that the cytotoxicity of these cells may be due to the inhibition of intracellular transport or indirectly. We reveal the detrimental effects of LCA5 inhibition in the RPE through alterations in processes such as pigmentation by slowing maturation progression. In this study, we highlight a potential key role for RPE cells in retinal pathologies traditionally attributed to photoreceptor dysfunction.
[0189] All patents, patent publications, and other publications cited herein, as well as priority applications U.S. Provisional Patent Application Nos. 62 / 465,649, filed March 1, 2017, and 62 / 469,642, filed March 10, 2017, are hereby incorporated by reference. Similarly, the sequence numbers referenced herein and found in the attached sequence listing are hereby incorporated by reference. While the invention has been described with reference to specific embodiments, it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.
[0190] (Sequence listing free text) The following information is a numeric identifier <223> The sequence listing contains free text below. [Table 4]
[0191] source 1. Redmond TM, Yu S, Lee E, Bok D, Hamasaki D, Chen N, et al. Rpe65 is necessary for production of 11-cis-vitamin A in the retinal visual cycle. Nat Genet (1998) 20(4):344-51. PubMed PMID: 9843205. 2. Redmond T, Hamel C. Genetic analysis of RPE65: from human disease to mouse model. Methods in Enzymol (2000) 317:705-24. 3. Maguire AM, High KA, Auricchio A, Wright JF, Pierce EA, Testa F, et al. Age- dependent effects of RPE65 gene therapy for Leber’s congenital amaurosis: a phase 1 dose- escalation trial. Lancet (2009) 374(9701): 1597-605. PubMed PMID: 1985 4499. 4. Bennett J, Wellman J, Marshall KA, McCague S, Ashtari M, DiStefano-Pappas J, et al. Safety and durability of effect of contralateral-eye administration of AAV2 gene therapy in patients with childhood-onset blindness caused by RPE65 mutations: a follow-on phase 1 trial Lancet (2016) 388(10045):661-72. doi: 10.1016 / S0140-6736(16)30371-3. PubMed PMID: 27375040. 5. Jacobson SG, Cideciyan AV, Ratnakaram R, Heon E, Schwartz SB, Roman AJ, et al. Gene Therapy for Leber Congenital Amaurosis Caused by RPE65 Mutations: Safety and Efficacy in 15 Children and Adults Followed Up to 3 Years. Arch Ophthalmol (2012) 130(1):9-24. Epub 2011 / 09 / 14. doi: archophthalmol.2011.298 [pii] 10.1001 / archophthalmol.2011.298. PubMed PMID: 21911650. 6. Cideciyan AV, Jacobson SG, Beltran WA, Sumaroka A, Swider M, Iwabe S, et al. Human retinal gene therapy for Leber congenital amaurosis shows advancing retinal degeneration despite enduring visual improvement. Proc Natl Acad Sci U S A (2013). Epub 2013 / 01 / 24. doi: 1218933110 [pii] 10.1073 / pnas. 1218933110. PubMed PMID: 23341635. 7. Bainbridge JW, Smith AJ, Barker SS, Robbie S, Henderson R, Balaggan K, et al. Effect of gene therapy on visual function in Leber’s congenital amaurosis. N Engl J Med (2008) 358(21):2231-9. PubMed PMID: 18441371. 8. Weleber RG, Pennesi ME, Wilson DJ, Kaushal S, Erker LR, Jensen L, et al. Results at 2 Years after Gene Therapy for RPE65-Deficient Leber Congenital Amaurosis and Severe Early - Childhood-Onset Retinal Dystrophy. Ophthalmology (2016) 123(7): 1606-20. doi: 10.1016 / j.ophtha.2016.03.003. PubMed PMID: 27102010. 9. Banin E, Bandah-Rozenfeld D, Obolensky A, Cideciyan AV, Aleman TS, Marks-Ohana D, et al. Molecular anthropology meets genetic medicine to treat blindness in the north african jewish population: human gene therapy initiated in Israel. Hum Gene Ther (2010) 21(12): 1749- 57. Epub 2010 / 07 / 08. doi: 10.1089 / hum.2010.047. PubMed PMID: 20604683. 10. Maguire A, Russell S, Bennett J, Chung D, Wellman J, High K, editors. Phase 3 trial of AAV2-hRPE65v2 (SPK-RPE65) to treat RPE65 mutation-associated inherited retinal dystrophies. American Academy of Ophthalmology Retina Subspecialty Day;2015;, Los Vegas, NV. 11. Russell S, Bennett J, High K, Chung D, Wellman J, Maguire A. Phase 3 trial of AAV2- hRPE65v2 (SPK-RPE65) to treat RPE65 mutation-associated inherited retinal dystrophies. Saudi Ophthalmologic Society (2016). 12. den Hollander AI, Koenekoop RK, Mohamed MD, Arts HH, Boldt K, Towns KV, et al. Mutations in LCA5, encoding the ciliary protein lebercilin, cause Leber congenital amaurosis. Nat Genet (2007) 39(7):889-95. Epub 2007 / 06 / 05. doi: ng2066 [pii] 10.1038 / ng2066. PubMed PMID: 17546029. 13. Gerber S, Hanein S, Perrault I, Delphin N, Aboussair N, Leowski C, et al. Mutations in LCA5 are an uncommon cause of Leber congenital amaurosis (LCA) type II. Hum Mutat (2007) 28(12): 1245. doi: 10.1002 / humu.9513. PubMed PMID: 18000884.14. Chen X, Sheng X, Sun X, Zhang Y, Jiang C, Li H, et al. Next-generation Sequencing Extends the Phenotypic Spectrum for LCA5 Mutations: Novel LCA5 Mutations in Cone Dystrophy. Sci Rep (2016) 6:24357. doi: 10.1038 / srep24357. PubMed PMID: 27067258; PubMed Central PMCID: PMCPMC4828721. 15. Corton M, Avila-Fernandez A, Vallespin E, Lopez-Molina MI, Almoguera B, Martin-Garrido E, et al. Involvement of LCA5 in Leber congenital amaurosis and retinitis pigmentosa in the Spanish population. Ophthalmology (2014) 121(l):399-407. doi: 10.1016 / j.ophtha.2013.08.028. PubMed PMID: 24144451. 16. Mackay DS, Borman AD, Sui R, van den Born LI, Berson EL, Ocaka LA, et al. Screening of a large cohort of leber congenital amaurosis and retinitis pigmentosa patients identifies novel LCA5 mutations and new genotype-phenotype correlations. Hum Mutat (2013) 34(11): 1537-46. doi: 10.1002 / humu.22398. PubMed PMID: 23946133;PubMed Central PMCID: PMCPMC4337959. 17. Vallespin E, Avila-Fernandez A, Almoguera B, Velez-Monsalve C, Cantalapiedra D, Garcia-Hoyos M, et al. Novel human pathological mutations. Gene symbol: LCA5. Disease: Leber congenital amaurosis. Hum Genet (2010) 127(4):487. PubMed PMID: 21488265. 18. Vallespin E, Avila-Fernandez A, Almoguera B, Cantalapiedra D, Garcia-Hoyos M, Riveiro-Alvarez R, et al. Novel human pathological mutations. Gene symbol: LCA5. Disease: Leber Congenital Amaurosis (LCA). Hum Genet (2010) 127(1): 118. PubMed PMID: 20108395. 19. Ahmad A, Daud S, Kakar N, Nurnberg G, Nurnberg P, Babar ME, et al. Identification of a novel LCA5 mutation in a Pakistani family with Leber congenital amaurosis and cataracts. Mol Vis (2011) 17:1940-5. PubMed PMID: 21850168;PubMed Central PMCID: PMCPMC3154126. 20. Seong MW, Kim SY, Yu YS, Hwang JM, Kim JY, Park SS. LCA5, a rare genetic cause of leber congenital amaurosis in Koreans. Ophthalmic Genet (2009) 30(l):54-5. doi: 10.1080 / 13816810802592567. PubMed PMID: 19172513. 21. Jacobson SG, Aleman TS, Cideciyan AV, Sumaroka A, Schwartz SB, Windsor EA, et al. Leber congenital amaurosis caused by Lebercilin (LCA5) mutation: retained photoreceptors adjacent to retinal disorganization. Mol Vis (2009) 15:1098-106. Epub 2009 / 06 / 09. doi: 116 [pii], PubMed PMID: 19503738;PubMed Central PMCID: PMC2690955. 22. Boldt K, Mans DA, Won J, van Reeuwijk J, Vogt A, Kinkl N, et al. Disruption of intraflagellar protein transport in photoreceptor cilia causes Leber congenital amaurosis in humans and mice. J Clin Invest (2011) 121(6):2169-80. Epub 2011 / 05 / 25. doi: 45627 [pii] 10.1172 / JCI45627. PubMed PMID: 21606596;PubMed Central PMCID: PMC3104757. 23. Vandenberghe L, Bell P, Maguire A, Cearley C, Xiao R, Calcedo R, et al. Dosage Thresholds for AAV2 and AAV8 Photoreceptor Gene Therapy in Monkey. Sci Transl Med (2011) 3(88):88ra54. Epub 22 June 2011. 24. Ramachandran PS, Lee V, Wei Z, Song JY, Casal G, Cronin T, et al. Evaluation of Dose and Safety of AAV7m8 and AAV8BP2 in the Non-Human Primate Retina. Hum Gene Ther (2016). doi: 10.1089 / hum.2016.111. PubMed PMID: 27750461. 25. Dalkara D, Byrne LC, Klimczak RR, Visel M, Yin L, Merigan WH, et al. In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery from the vitreous. Sci Transl Med (2013) 5(189): 189ra76. doi: 10.1126 / scitranslmed.3005708. PubMed PMID: 23761039. 26. Dalkara D, Kolstad KD, Caporale N, Visel M, Klimczak RR, Schaffer DV, et al. Inner limiting membrane barriers to AAV-mediated retinal transduction from the vitreous. Mol Ther (2009) 17(12):2096-102. doi: 10.1038 / mt.2009.181. PubMed PMID: 19672248;PubMed Central PMCID: PMCPMC2814392. 27. Mace E, Caplette R, Marre O, Sengupta A, Chaffiol A, Barbe P, et al. Targeting channelrhodopsin-2 to ON-bipolar cells with vitreally administered AAV Restores ON and OFF visual responses in blind mice. Mol Ther (2015) 23(1):7-16. doi: 10.1038 / mt.2014.154. PubMed PMID: 25095892;PubMed Central PMCID: PMCPMC4270733. 28. Liang FQ, Anand V, Maguire AM, Bennett J. Intraocular delivery of recombinant virus. Methods Mol Med (2001) 47:125-39. doi: 10.1385 / 1-59259-085-3:125. PubMed PMID:21394582. 29. Mohamed M, Topping N, Jafri H, Raashed Y, McKibbin M, Inglehearn C. Progression of phenotype in Leber’s congenital amaurosis with a mutation at the LCA5 loc us. Br J Ophthalmol (2003) 87(4):473-5. 30. Ashtari M, Cyckowski LL, Monroe JF, Marshall KA, Chung DC, Auricchio A, et al. The human visual cortex responds to gene therapy-mediated recovery of retinal function. J Clin Invest 121(6):2160-8. Epub 2011 / 05 / 25. doi: 57377 [pii] 10.1172 / JCI57377. PubMed PMID: 21606598;PubMed Central PMCID: PMC3104779. 31. Bennett J, Ashtari M, Wellman J, Marshall KA, Cyckowski LL, Chung DC, et al. AAV2 gene therapy readministration in three adults with congenital blindness. Sci Transl Med 4(120): 120ra15. Epub 2012 / 02 / 11. doi: 4 / 120 / 120ral5 [pii] 10.1126 / scitranslmed.3002865. PubMed PMID: 22323828.
Claims
1. A codon-optimized, modified nucleic acid sequence of SEQ ID NO: 3 encoding human reversillin.
2. An expression cassette comprising the codon-optimized nucleic acid sequence of SEQ ID NO: 3 encoding human reversillin.
3. A recombinant adeno-associated virus (rAAV), the rAAV comprising an AAV capsid and a vector genome packaged therein, the vector genome comprising: (a) AAV 5′ inverted terminal repeat (ITR) sequence; (b) a promoter; (c) a coding sequence encoding human reversillin; (d) AAV3'ITR, The rAAV comprising:
4. The rAAV of claim 3, wherein the coding sequence of (c) is a codon-optimized human LCA5 that is at least 70% identical to the native human leucine coding sequence of SEQ ID NO:
2.
5. The rAAV of claim 3 or 4, wherein the coding sequence of (c) is SEQ ID NO:
3.
6. The rAAV according to any one of claims 3 to 5, wherein the rAAV capsid is AAV7m8 or a mutant thereof, an AAV8 capsid, an AAV6 capsid or a mutant thereof, an AAV9 capsid or a mutant thereof, an AAV7 capsid or a mutant thereof, an AAV5 capsid or a mutant thereof, an AAV2 capsid or a mutant thereof, an AAV1 capsid or a mutant thereof, an AAV3 capsid or a mutant thereof, or an AAV4 capsid or a mutant thereof.
7. The rAAV according to any one of claims 3 to 6, wherein the promoter is a cytomegalovirus (CMV) promoter or a hybrid promoter comprising a CMV promoter sequence and a chicken beta actin (CBA) promoter sequence.
8. The rAAV according to any one of claims 3 to 7, wherein the AAV 5' ITR and / or the AAV 3' ITR is derived from AAV2.
9. The rAAV according to any one of claims 3 to 8, wherein the vector genome further comprises polyA.
10. The rAAV of any one of claims 3 to 9, further comprising an intron.
11. The rAAV of any one of claims 3 to 10, further comprising an enhancer.
12. A composition comprising the rAAV of any one of claims 3 to 11 and a pharmaceutically acceptable carrier or excipient suitable for delivery to the eye.
13. 1. An aqueous suspension suitable for administration to a patient with LCA, said suspension comprising an aqueous suspension and about 1×10 10 Virus particles ~ approximately 1 x 10 12 The present invention also provides a recombinant adeno-associated virus (rAAV) useful as a therapeutic agent for treating LCA, which is GC or viral particle / eye, wherein the rAAV has an AAV capsid, and (a) AAV 5′ inverted terminal repeat (ITR) sequence; (b) a promoter; (c) a coding sequence encoding human reversillin; (d) an AAV 3′ ITR; The aqueous suspension having a vector genome packaged therein.
14. 14. The suspension of claim 13, wherein the suspension is suitable for subretinal or intravitreal injection.
15. 15. The suspension of claim 13 or 14, wherein the promoter is SEQ ID NO: 10 and the coding sequence is SEQ ID NO:
3.
16. The suspension of any one of claims 13 to 15, wherein the rAAV capsid is an AAV7m8 capsid.
17. The suspension of any one of claims 13 to 16, further comprising CBA exon 1 and intron from nt 824 to nt 1795 of SEQ ID NO:
8.
18. Use of an rAAV according to any one of claims 3 to 11, a composition according to claim 12, or a suspension according to any one of claims 13 to 18 for the treatment of a subject with LCA.
19. The rAAV was added to an aqueous suspension at a concentration of about 1×10 9 ~Approx. 1×10 13 The use according to claim 18, wherein the vector genome / eye (vg / eye) is delivered.
20. 20. The use of claim 18 or 19, wherein the rAAV is administered subretinally or intravitreally.
21. The rAAV is added to a volume containing about or at least 150 microliters at a concentration of 1 x 10 9 ~1 x 10 13 The use of any of claims 18 to 20, wherein a dose of rAAV is administered to restore visual function in said subject.
22. A method of treating a subject with LCA with an rAAV according to any one of claims 3 to 11, a composition according to claim 12, or a suspension according to any one of claims 13 to 18.
23. The rAAV was added to an aqueous suspension at a concentration of about 1×10 9 ~Approx. 1×10 13 The method of claim 22, wherein the vector genome / eye (vg / eye) is delivered.
24. 24. The method of claim 22 or 23, wherein the rAAV is administered subretinally or intravitreally.
25. The rAAV is added to a volume containing about or at least 150 microliters at a concentration of 1 x 10 9 ~1 x 10 13 25. The method of any of claims 22-24, wherein a dose of rAAV is administered to the subject, thereby restoring visual function in the subject.