Compositions and methods for treating cancer with atypical BRAF mutations
ERK inhibitors, combined with other agents, provide a targeted treatment for cancers with non-V600E/K BRAF mutations, effectively addressing the inadequacies of current therapies by targeting and ameliorating the effects of these mutations in various cancer types.
Patent Information
- Application Number
- JP2025100020
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2017-05-16
- Filing Date
- 2025-06-16
- Publication Date
- 2025-08-22
AI Technical Summary
Existing treatments for cancers with BRAF mutations other than the V600E mutation are inadequate, as the clinical significance of these mutations is largely unknown, and current therapies targeting the MAPK pathway are not effective for non-V600E/K BRAF mutations.
Administering ERK inhibitors, such as BVD-523, SCH-722984, SCH-772984, SCH-900353, LY3214996, AEZS-140, AEZS-131, AEZS-136, LTT-462, RG-7842, and CC-90003, to subjects with non-V600E/K BRAF mutations, optionally combined with MEK inhibitors, RAF inhibitors, HDAC inhibitors, antibodies, cytotoxic agents, or other therapeutic agents, to target and treat these cancers.
The ERK inhibitors effectively target and ameliorate the effects of non-V600E/K BRAF mutations in various cancers, including glioblastoma, melanoma, cholangiocarcinoma, and other solid tumor and hematological cancers, providing a therapeutic option for previously untreated mutation types.
Smart Images

Figure 2025123379000025 
Figure 2025123379000026 
Figure 2025123379000027
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62 / 506,995, filed May 16, 2017, the entire contents of which are incorporated herein by reference.
[0002] The present disclosure relates to methods, kits, and pharmaceutical compositions for treating or ameliorating the effects of cancers harboring atypical genetic mutations using one or more anti-cancer agents.
[0003] Incorporation by Reference of Sequence Listing This application contains references to amino acid and / or nucleic acid sequences filed in the enclosed Sequence Listing text file "2391211.txt," file size 246 KB, created May 15, 2018. The foregoing Sequence Listing is incorporated herein by reference in its entirety pursuant to 37 CFR § 1.52(e)(5). [Background technology]
[0004] Mitogen-activated protein kinase (MAPK) or RAS / RAF / MEK / ERK signaling is responsible for several cell signaling pathways involved in the control of proliferation, differentiation, and apoptosis. Disruption of the MAPK cell signaling pathway has been observed in human cancers, often due to activating mutations in the KRAS, NRAS, or BRAF genes. Selective BRAF inhibitors, such as vemurafenib and dabrafenib, have been developed to target BRAF-mutant tumors. For example, vemurafenib has been approved for unresectable or metastatic melanoma harboring the BRAF V600E mutation, and detection of the BRAF V600E mutation has just become the standard of care for predicting response to vemurafenib, dabrafenib, and trametinib treatment.
[0005] While the V600E mutation is the most common BRAF mutation observed in many tumor types, the Catalog of Somatic Mutations in Cancer (COSMIC) database reports over 100 other mutations within exons 11 and 15 of the BRAF gene. The clinical significance of BRAF mutations other than the V600 codon is largely unknown.
[0006] In view of the foregoing, there is a need for novel therapeutic agents that target the MAPK pathway in cell types harboring BRAF mutations other than V600E. The present application aims to meet these and other needs. Summary of the Invention [Means for solving the problem]
[0007] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject harboring a non-V600E / K BRAF mutation, the method comprising administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.
[0008] According to some embodiments, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.
[0009] According to some embodiments, the ERK inhibitor is BVD-523.
[0010] According to some embodiments, the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-impaired mutation, or a kinase-unknown mutation, and combinations thereof.
[0011] According to some embodiments, the kinase-activating mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.
[0012] According to some embodiments, the kinase-deficient mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.
[0013] According to some embodiments, the kinase unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.
[0014] According to some embodiments, the non-V600E / K BRAF mutation is selected from the group consisting of D594, G469, K601E, L597, T599 duplication, L485W, F247L, G466V, BRAF fusion, BRAF-AGAP3 rearrangement, BRAF exon 15 splice variant, and combinations thereof.
[0015] According to some embodiments, the subject is a mammal.
[0016] According to some embodiments, the mammal is selected from the group consisting of humans, primates, livestock, and domestic animals.
[0017] According to some embodiments, the mammal is a human.
[0018] According to some embodiments, the cancer is a solid tumor cancer or a hematological cancer.
[0019] According to some embodiments, the cancer is selected from the group consisting of glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.
[0020] According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma.
[0021] According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.
[0022] According to some embodiments, the MEK inhibitor is selected from the group consisting of anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas Pharma Inc.), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), and the like. Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD098059 (2-(2'-amino-3'-methoxyphenyl(methoxphenyl))-oxanaphthalen-4-one) (Pfizer), PD184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co., Ltd.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-LaRoche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda Pharmaceutical Company Limited), trametinib (Japan Tobacco Inc.), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
[0023] According to some embodiments, the RAF inhibitor is AAL881 (Novartis), AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN2480) (Sunesis & Takeda), b-raf inhibitors (Sareum), BRAF kinase inhibitors (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK632 (Takeda Pharmaceutical Company Limited), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo Co., Ltd.), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
[0024] According to some embodiments, the HDAC inhibitor is selected from the group consisting of abexinostat (PCI-24781), gibinostat, entinostat, vorinostat, CI-994, CUDC-101, entinostat, BML-210, M344, NVP-LAQ824, panobinostat, pracinostat (SB939), mocetinostat, resminostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
[0025] According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from the group consisting of an antibody, an antibody fragment, an antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoreactive therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof.
[0026] According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab Selected from the group consisting of atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, prosalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.
[0027] According to some embodiments, the cytotoxic agent is cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, Selected from the group consisting of dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0028] According to some embodiments, the toxin is diphtheria toxin or a portion thereof.
[0029] According to some embodiments, the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.
[0030] According to some embodiments, the immunomodulatory agent is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune checkpoint inhibitors, and combinations thereof.
[0031] According to some embodiments, the radiosensitizer is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof.
[0032] According to some embodiments, the hormone is selected from the group consisting of prostaglandins, leukotrienes, prostacyclins, thromboxanes, amylin, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedins, leptin, liptropin, The inhibitor is selected from the group consisting of luteinizing hormone, melanocyte-stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof.
[0033] According to some embodiments, the antiangiogenic agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0034] According to some embodiments, the additional therapeutic agent is a PI3K / Akt pathway inhibitor.
[0035] According to some embodiments, the PI3K / Akt pathway inhibitor is selected from the group consisting of A-674563 (CAS No. 552325-73-2), AGL2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxilin-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), benzimidazoles, Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS No. 32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No. 612847-09-3, CAS No. 681281-88-9, CAS No. 75747-14-7, CAS No. 925681-41-0, CAS No. 98510-80-6, CCT128930 (CAS No. 885499-61-6), CH5132799 (CAS No. 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA124 (CAS number 902779-59-3), GS-1101 (CAL-101) (Gilead GSK690693 (CAS number 937174-76-0), H-89 (CAS number 127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT5720 (CAS no. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS no. 1032350-13-2), ML-9 (CAS no. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS no. 1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS no. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
[0036] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject, the method comprising: (a) identifying a subject having a cancer that harbors a non-V600E / K BRAF mutation; and (b) administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.
[0037] According to some embodiments, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.
[0038] According to some embodiments, the ERK inhibitor is BVD-523.
[0039] According to some embodiments, the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-deficient mutation, or a kinase-unknown mutation, and combinations thereof.
[0040] According to some embodiments, the kinase-activating mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.
[0041] According to some embodiments, the kinase-deficient mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.
[0042] According to some embodiments, the kinase unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.
[0043] According to some embodiments, the subject is a mammal.
[0044] According to some embodiments, the mammal is selected from the group consisting of humans, primates, livestock, and domestic animals.
[0045] According to some embodiments, the mammal is a human.
[0046] According to some embodiments, the cancer is a solid tumor cancer or a hematological cancer.
[0047] According to some embodiments, the cancer is selected from the group consisting of glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.
[0048] According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma.
[0049] According to some embodiments, the method further includes (i) obtaining a biological sample from the subject; and (ii) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation.
[0050] According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.
[0051] According to some embodiments, the MEK inhibitor is selected from the group consisting of anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas Pharma Inc.), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), and the like. Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co., Ltd.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-LaRoche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda Pharmaceutical Company Limited), trametinib (Japan Tobacco Inc.), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
[0052] According to some embodiments, the RAF inhibitor is selected from the group consisting of AAL881 (Novartis), AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN2480) (Sunesis & Takeda), b-raf inhibitors (Sareum), BRAF kinase inhibitors (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK632 (Takeda Pharmaceutical Company Limited), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo Co., Ltd.), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
[0053] According to some embodiments, the HDAC inhibitor is selected from the group consisting of abexinostat (PCI-24781), gibinostat, entinostat, vorinostat, CI-994, CUDC-101, entinostat, BML-210, M344, NVP-LAQ824, panobinostat, pracinostat (SB939), mocetinostat, resminostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
[0054] According to some embodiments, the method further comprises administering at least one additional therapeutic agent selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoreactive therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof.
[0055] According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab Selected from the group consisting of atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, prosalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.
[0056] According to some embodiments, the cytotoxic agent is cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine ... Selected from the group consisting of carbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0057] According to some embodiments, the toxin is diphtheria toxin or a portion thereof.
[0058] According to some embodiments, the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.
[0059] According to some embodiments, the immunomodulatory agent is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune checkpoint inhibitors, and combinations thereof.
[0060] According to some embodiments, the radiosensitizer is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof.
[0061] According to some embodiments, the hormone is a prostaglandin, leukotriene, prostacyclin, thromboxane, amylin, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone, The active ingredient in the steroid hormone is selected from the group consisting of steroid hormone, steroid hormone, steroid hormone-releasing ...
[0062] According to some embodiments, the antiangiogenic agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0063] According to some embodiments, the additional therapeutic agent is a PI3K / Akt pathway inhibitor.
[0064] According to some embodiments, the PI3K / Akt pathway inhibitor is selected from the group consisting of A-674563 (CAS No. 552325-73-2), AGL2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), benzimidazoles, Genentech (Roche Holdings Inc., South San Francisco, CA), Francisco, CA), BML-257 (CAS No. 32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No. 612847-09-3, CAS No. 681281-88-9, CAS No. 75747-14-7, CAS No. 925681-41-0, CAS No. 98510-80-6, CCT128930 (CAS No. 885499-61-6), CH5132799 (CAS No. 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA124 (CAS number 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK690693 (CAS number 937174-76-0), H-89 (CAS number 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT5720 (CAS No. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS No. 1032350-13-2), ML-9 (CAS No. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS No. 1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS no. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, CA) Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
[0065] According to one aspect, the present disclosure provides a method for identifying a subject having cancer who is expected to benefit from treatment with an ERK inhibitor, or a pharmaceutically acceptable salt thereof, comprising: (a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation, wherein the presence of a non-V600E / K BRAF mutation is confirmation that the subject is expected to benefit from treatment with an ERK inhibitor, or a pharmaceutically acceptable salt thereof.
[0066] According to some embodiments, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.
[0067] According to some embodiments, the ERK inhibitor is BVD-523.
[0068] According to some embodiments, the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-deficient mutation, or a kinase-unknown mutation, and combinations thereof.
[0069] According to some embodiments, the kinase-activating mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.
[0070] According to some embodiments, the kinase-deficient mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.
[0071] According to some embodiments, the kinase unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.
[0072] According to some embodiments, the subject is a mammal.
[0073] According to some embodiments, the mammal is selected from the group consisting of humans, primates, livestock, and domestic animals.
[0074] According to some embodiments, the mammal is a human.
[0075] According to some embodiments, the cancer is a solid tumor cancer or a hematological cancer.
[0076] According to some embodiments, the cancer is selected from the group consisting of glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.
[0077] According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma.
[0078] According to some embodiments, the method further comprises administering an ERK inhibitor or a pharmaceutically acceptable salt thereof to the subject having a non-V600E / K BRAF mutation.
[0079] According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.
[0080] According to some embodiments, the MEK inhibitor is selected from the group consisting of anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas Pharma Inc.), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), and the like. Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co., Ltd.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-LaRoche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda Pharmaceutical Company Limited), trametinib (Japan Tobacco Inc.), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
[0081] According to some embodiments, the RAF inhibitor is selected from the group consisting of AAL881 (Novartis), AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN2480) (Sunesis & Takeda), b-raf inhibitors (Sareum), BRAF kinase inhibitors (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK632 (Takeda Pharmaceutical Company Limited), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo Co., Ltd.), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
[0082] According to some embodiments, the HDAC inhibitor is selected from the group consisting of abexinostat (PCI-24781), gibinostat, entinostat, vorinostat, CI-994, CUDC-101, entinostat, BML-210, M344, NVP-LAQ824, panobinostat, pracinostat (SB939), mocetinostat, resminostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
[0083] According to some embodiments, the method further comprises administering to the subject with a non-V600E / K BRAF mutation at least one additional therapeutic agent selected from the group consisting of an antibody, an antibody fragment, an antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoreactive therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof.
[0084] According to some embodiments, the antibody or fragment thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab Selected from the group consisting of atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, prosalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.
[0085] According to some embodiments, the cytotoxic agent is cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, Selected from the group consisting of dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0086] According to some embodiments, the toxin is diphtheria toxin or a portion thereof.
[0087] According to some embodiments, the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.
[0088] According to some embodiments, the immunomodulatory agent is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune checkpoint inhibitors, and combinations thereof.
[0089] According to some embodiments, the radiosensitizer is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof.
[0090] According to some embodiments, the hormone is a prostaglandin, leukotriene, prostacyclin, thromboxane, amylin, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone, The active ingredient in the steroid hormone is selected from the group consisting of steroid hormone, steroid hormone, steroid hormone-releasing ...
[0091] According to some embodiments, the antiangiogenic agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0092] According to some embodiments, the additional therapeutic agent is a PI3K / Akt pathway inhibitor.
[0093] According to some embodiments, the PI3K / Akt pathway inhibitor is selected from the group consisting of A-674563 (CAS No. 552325-73-2), AGL2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), benzimidazoles, Genentech (Roche Holdings Inc., South San Francisco, CA), Francisco, CA), BML-257 (CAS No. 32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No. 612847-09-3, CAS No. 681281-88-9, CAS No. 75747-14-7, CAS No. 925681-41-0, CAS No. 98510-80-6, CCT128930 (CAS No. 885499-61-6), CH5132799 (CAS No. 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA124 (CAS number 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK690693 (CAS number 937174-76-0), H-89 (CAS number 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT5720 (CAS No. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS No. 1032350-13-2), ML-9 (CAS No. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS No. 1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS no. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, CA) Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
[0094] According to one aspect, the present disclosure provides a pharmaceutical composition for treating or ameliorating the effects of cancer in a subject harboring a non-V600E / K BRAF mutation, the composition comprising a pharmaceutically acceptable carrier or diluent and an effective amount of an ERK inhibitor, or a pharmaceutically acceptable salt thereof.
[0095] According to some embodiments, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.
[0096] According to some embodiments, the ERK inhibitor is BVD-523.
[0097] According to some embodiments, the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-deficient mutation, or a kinase-unknown mutation, and combinations thereof.
[0098] According to some embodiments, the kinase-activating mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.
[0099] According to some embodiments, the kinase-deficient mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.
[0100] According to some embodiments, the kinase unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.
[0101] According to some embodiments, the subject is a mammal.
[0102] According to some embodiments, the mammal is selected from the group consisting of humans, primates, livestock, and domestic animals.
[0103] According to some embodiments, the mammal is a human.
[0104] According to some embodiments, the cancer is a solid tumor cancer or a hematological cancer.
[0105] According to some embodiments, the cancer is selected from the group consisting of glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.
[0106] According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma.
[0107] According to some embodiments, the composition is administered to the subject orally or by injection.
[0108] According to some embodiments, the composition is administered to the subject as a tablet.
[0109] According to some embodiments, the pharmaceutical composition comprises at least one additional therapeutic agent selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.
[0110] According to some embodiments, the MEK inhibitor is selected from the group consisting of anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas Pharma Inc.), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), and the like. Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co., Ltd.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-LaRoche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda Pharmaceutical Company Limited), trametinib (Japan Tobacco Inc.), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
[0111] According to some embodiments, the RAF inhibitor is selected from the group consisting of AAL881 (Novartis), AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN2480) (Sunesis & Takeda), b-raf inhibitors (Sareum), BRAF kinase inhibitors (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK632 (Takeda Pharmaceutical Company Limited), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo Co., Ltd.), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
[0112] According to some embodiments, the HDAC inhibitor is selected from the group consisting of abexinostat (PCI-24781), gibinostat, entinostat, vorinostat, CI-994, CUDC-101, entinostat, BML-210, M344, NVP-LAQ824, panobinostat, pracinostat (SB939), mocetinostat, resminostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
[0113] According to some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoreactive therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof.
[0114] According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab Selected from the group consisting of atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, prosalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.
[0115] According to some embodiments, the cytotoxic agent is cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, Selected from the group consisting of dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0116] According to some embodiments, the toxin is diphtheria toxin or a portion thereof.
[0117] According to some embodiments, the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.
[0118] According to some embodiments, the immunomodulatory agent is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune checkpoint inhibitors, and combinations thereof.
[0119] According to some embodiments, the radiosensitizer is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof.
[0120] According to some embodiments, the hormone is a prostaglandin, leukotriene, prostacyclin, thromboxane, amylin, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone, The active ingredient in the steroid hormone is selected from the group consisting of steroid hormone, steroid hormone, steroid hormone-releasing ...
[0121] According to some embodiments, the antiangiogenic agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0122] According to some embodiments, the additional therapeutic agent is a PI3K / Akt pathway inhibitor.
[0123] According to some embodiments, the PI3K / Akt pathway inhibitor is selected from the group consisting of A-674563 (CAS No. 552325-73-2), AGL2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), benzimidazoles, Genentech (Roche Holdings Inc., South San Francisco, CA), Francisco, CA), BML-257 (CAS No. 32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No. 612847-09-3, CAS No. 681281-88-9, CAS No. 75747-14-7, CAS No. 925681-41-0, CAS No. 98510-80-6, CCT128930 (CAS No. 885499-61-6), CH5132799 (CAS No. 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA124 (CAS number 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK690693 (CAS number 937174-76-0), H-89 (CAS number 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT5720 (CAS No. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS No. 1032350-13-2), ML-9 (CAS No. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS No. 1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS no. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, CA) Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
[0124] According to some embodiments, the pharmaceutical composition is in a unit dosage form comprising both the ERK inhibitor and the additional therapeutic agent.
[0125] According to some embodiments, the pharmaceutical composition, the ERK inhibitor, is in a first unit dosage form and the additional therapeutic agent is in a second unit dosage form separate from the first unit dosage form.
[0126] According to some embodiments, the ERK inhibitor and the additional therapeutic agent are administered simultaneously to the subject.
[0127] According to some embodiments, the ERK inhibitor and the additional therapeutic agent are administered sequentially to the subject.
[0128] According to some embodiments, the ERK inhibitor is administered to the subject before or after administration of the additional therapeutic agent.
[0129] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, comprising administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
[0130] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject, the method comprising: (a) identifying a subject having a cancer that harbors a non-V600E / K BRAF mutation; and (b) administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
[0131] According to one aspect, the present disclosure provides a method for identifying a subject having cancer who is expected to benefit from treatment with BVD-523 or a pharmaceutically acceptable salt thereof, the method comprising: (a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation, wherein the presence of a non-V600E / K BRAF mutation confirms that the subject is expected to benefit from treatment with BVD-523 or a pharmaceutically acceptable salt thereof.
[0132] According to one aspect, the present disclosure provides a pharmaceutical composition for treating or ameliorating the effects of cancer in a subject harboring a non-V600E / K BRAF mutation, the composition comprising a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.
[0133] According to one aspect, the present disclosure provides a kit for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, the kit comprising the pharmaceutical composition of any one of claims 88, 103 and 107 packaged together with instructions for use thereof.
[0134] According to some embodiments, the RAF inhibitor is selected from the group consisting of erlotinib (Tarceva), gefitinib (Iressa), imatinib mesylate (Gleevec), lapatinib (Tyverb), sunitinib malate (Sutent), pharmaceutically acceptable salts thereof, and combinations thereof.
[0135] According to some embodiments, the RAF inhibitor is selected from the group consisting of LXH254 (Novartis), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), REDX0535 (RedX Pharma Plc), pharmaceutically acceptable salts thereof, and combinations thereof.
[0136] According to some embodiments, the HDAC inhibitor is selected from the group consisting of vorinostat, panobinostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
[0137] According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab atezolizumab (Tecentriq), durvalumab (Imfinzi), ofatumumab, obinutuzumab (Gazyva), panitumumab, and combinations thereof.
[0138] According to some embodiments, the PI3K / Akt pathway inhibitor is BVD-723. In certain embodiments, for example, the following items are provided: (Item 1) 1. A method for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, comprising administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof. (Item 2) The ERK inhibitor may be BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna 2. The method of claim 1, wherein the medicament is selected from the group consisting of: AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof. (Item 3) 2. The method of item 1, wherein the ERK inhibitor is BVD-523. (Item 4) 2. The method of claim 1, wherein the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-deficient mutation, or a kinase-unknown mutation, and combinations thereof. (Item 5) 5. The method of item 4, wherein the kinase-activating mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof. (Item 6) 5. The method of item 4, wherein the kinase-deficient mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof. (Item 7) 5. The method of item 4, wherein the kinase unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof. (Item 8) 2. The method of claim 1, wherein the non-V600E / K BRAF mutation is selected from the group consisting of D594, G469, K601E, L597, T599 duplication, L485W, F247L, G466V, BRAF fusion, BRAF-AGAP3 rearrangement, BRAF exon 15 splice variant, and combinations thereof. (Item 9) Item 10. The method of item 1, wherein the subject is a mammal. (Item 10) 10. The method of claim 9, wherein the mammal is selected from the group consisting of humans, primates, livestock, and domestic animals. (Item 11) 10. The method of claim 9, wherein the mammal is a human. (Item 12) Item 10. The method of item 1, wherein the cancer is a solid tumor cancer or a blood cancer. (Item 13) 2. The method of item 1, wherein the cancer is selected from the group consisting of glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer. (Item 14) Item 14. The method of item 13, wherein the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma. (Item 15) 2. The method of claim 1, further comprising administering to the subject at least one additional therapeutic agent selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof. (Item 16) The MEK inhibitor may be anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas Pharma Inc.), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), or a combination thereof. Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co., Ltd.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda Pharmaceutical Co., Ltd.), trametinib (Japan Tobacco Inc.), U0126 (1,Item 16. The method according to item 15, wherein the compound is selected from the group consisting of 4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 17) The RAF inhibitor is AAL881 (Novartis), AB-024 (Ambito) Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.Item 16. The method of item 15, wherein the medicament is selected from the group consisting of medicament for treating rheumatoid arthritis, rheumatoid arthritis, rheumatoid arthritis (rheumatoid arthritis), ... (Item 18) 16. The method of item 15, wherein the HDAC inhibitor is selected from the group consisting of abexinostat (PCI-24781), gibinostat, entinostat, vorinostat, CI-994, CUDC-101, entinostat, BML-210, M344, NVP-LAQ824, panobinostat, pracinostat (SB939), mocetinostat, resminostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof. (Item 19) 10. The method of claim 1, further comprising administering to the subject at least one additional therapeutic agent selected from the group consisting of an antibody, an antibody fragment, an antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoreactive therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof. (Item 20) The antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab 20. The method of item 19, wherein the therapeutic agent is selected from the group consisting of atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, prosalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof. (Item 21) The cytotoxic agent is cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludara 20. The method of item 19, wherein the anti-inflammatory agent is selected from the group consisting of vinca alkaloids, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof. (Item 22) 20. The method of claim 19, wherein the toxin is diphtheria toxin or a portion thereof. (Item 23) 20. The method of claim 19, wherein the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof. (Item 24) 20. The method of claim 19, wherein the immunomodulatory agent is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune checkpoint inhibitors, and combinations thereof. (Item 25) 20. The method of claim 19, wherein the radiosensitizer is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof. (Item 26) The hormones include prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, anti-Mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone, melanocytes, and the like. 20. The method of item 19, wherein the steroid hormone is selected from the group consisting of steroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof. (Item 27) 20. The method of item 19, wherein the antiangiogenic agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof. (Item 28) 20. The method of item 19, wherein the additional therapeutic agent is a PI3K / Akt pathway inhibitor. (Item 29) The PI3K / Akt pathway inhibitors include A-674563 (CAS No. 552325-73-2), AGL2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), benzimidazoles, Genentech (Roche Holdings Inc., South San Francisco, CA), Francisco, CA), BML-257 (CAS number 32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No. 612847-09-3, CAS No. 681281-88-9, CAS No. 75747-14-7, CAS No. 925681-41-0, CAS No. 98510-80-6, CCT128930 (CAS No. 885499-61-6), CH5132799 (CAS No. 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA124 (CAS No. 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK690693 (CAS no. 937174-76-0), H-89 (CAS no. 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT5720 (CAS No. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS No. 1032350-13-2), ML-9 (CAS No. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS No. 1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS no. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA). 29. The method of claim 28, wherein the medicament is selected from the group consisting of triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 30) 1. A method for treating or ameliorating the effects of cancer in a subject, comprising: (a) identifying a subject having a cancer harboring a non-V600E / K BRAF mutation; (b) administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof; A method comprising: (Item 31) The ERK inhibitor may be BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna 31. The method of item 30, wherein the anti-cancer agent is selected from the group consisting of: AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof. (Item 32) 31. The method of item 30, wherein the ERK inhibitor is BVD-523. (Item 33) 31. The method of claim 30, wherein the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-deficient mutation, or a kinase-unknown mutation, and combinations thereof. (Item 34) 34. The method of item 33, wherein the kinase-activating mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof. (Item 35) 34. The method of item 33, wherein the kinase-deficient mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof. (Item 36) 34. The method of item 33, wherein the kinase unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof. (Item 37) 31. The method of claim 30, wherein the subject is a mammal. (Item 38) 38. The method of claim 37, wherein the mammal is selected from the group consisting of humans, primates, livestock, and domestic animals. (Item 39) 38. The method of claim 37, wherein the mammal is a human. (Item 40) 31. The method of item 30, wherein the cancer is a solid tumor cancer or a blood cancer. (Item 41) 31. The method of claim 30, wherein the cancer is selected from the group consisting of glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer. (Item 42) Item 42. The method of item 41, wherein the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma. (Item 43) Step (a) (i) obtaining a biological sample from said subject; (ii) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation; Item 31. The method according to Item 30, comprising: (Item 44) 31. The method of item 30, further comprising administering to the subject at least one additional therapeutic agent selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof. (Item 45) The MEK inhibitor may be anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas Pharma Inc.), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), or a combination thereof. Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co., Ltd.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda Pharmaceutical Co., Ltd.), trametinib (Japan Tobacco Inc.), U0126 (1,45. The method according to item 44, wherein the compound is selected from the group consisting of 4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 46) The RAF inhibitor is AAL881 (Novartis), AB-024 (Ambito) B-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen) Therapeutics), BRAFsiRNA313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK632 (Takeda Pharmaceutical Company Limited), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo Co., Ltd.), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 47) 45. The method of item 44, wherein the HDAC inhibitor is selected from the group consisting of abexinostat (PCI-24781), gibinostat, entinostat, vorinostat, CI-994, CUDC-101, entinostat, BML-210, M344, NVP-LAQ824, panobinostat, pracinostat (SB939), mocetinostat, resminostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof. (Item 48) 31. The method of item 30, further comprising administering at least one additional therapeutic agent selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoreactive therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof. (Item 49) The antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab 49. The method of item 48, wherein the therapeutic agent is selected from the group consisting of atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, prosalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof. (Item 50) The cytotoxic agent is cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludara 49. The method of item 48, wherein the anti-inflammatory agent is selected from the group consisting of vinca alkaloids, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof. (Item 51) 49. The method of claim 48, wherein the toxin is diphtheria toxin or a portion thereof. (Item 52) 49. The method of claim 48, wherein the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof. (Item 53) 49. The method of claim 48, wherein the immunomodulatory agent is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune checkpoint inhibitors, and combinations thereof. (Item 54) 49. The method of claim 48, wherein the radiosensitizer is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof. (Item 55) The hormones include prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, anti-Mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone, melanocytes, and the like. 49. The method of item 48, wherein the steroid hormone is selected from the group consisting of steroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof. (Item 56) 49. The method of item 48, wherein the antiangiogenic agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. (Item 57) 49. The method of claim 48, wherein the additional therapeutic agent is a PI3K / Akt pathway inhibitor. (Item 58) The PI3K / Akt pathway inhibitor is selected from the group consisting of A-674563 (CAS No. 552325-73-2), AGL2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), benzimidazoles, Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS No. 32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No. 612847-09-3, CAS No. 681281-88-9, CAS No. 75747-14-7, CAS No. 925681-41-0, CAS No. 98510-80-6, CCT128930 (CAS No. 885499-61-6), CH5132799 (CAS No. 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA124 (CAS no. 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK690693 (CAS no. 937174-76-0), H-89 (CAS no. 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT5720 (CAS no. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS no. 1032350-13-2), ML-9 (CAS no. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS no. 1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS No. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof (Item 59). 1. A method for identifying a subject having cancer who is expected to benefit from treatment with an ERK inhibitor or a pharmaceutically acceptable salt thereof, comprising: (a) obtaining a biological sample from said subject; (b) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation; Including, The presence of the non-V600E / K BRAF mutation is confirmation that the subject is expected to benefit from treatment with an ERK inhibitor or a pharmaceutically acceptable salt thereof. The ERK inhibitor may be BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna 59. The method of claim 58, wherein the anti-cancer agent is selected from the group consisting of: AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof. (Item 61) 60. The method of item 59, wherein the ERK inhibitor is BVD-523. (Item 62) 60. The method of claim 59, wherein the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-deficient mutation, or a kinase-unknown mutation, and combinations thereof. (Item 63) 63. The method of item 62, wherein the kinase-activating mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof. (Item 64) 63. The method of item 62, wherein the kinase-deficient mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof. (Item 65) 63. The method of item 62, wherein the kinase unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof. (Item 66) 60. The method of claim 59, wherein the subject is a mammal. (Item 67) Item 67. The method of item 66, wherein the mammal is selected from the group consisting of humans, primates, livestock, and domestic animals. (Item 68) Item 67. The method of item 66, wherein the mammal is a human. (Item 69) 60. The method of claim 59, wherein the cancer is a solid tumor cancer or a blood cancer. (Item 70) 60. The method of claim 59, wherein the cancer is selected from the group consisting of glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer. (Item 71) 71. The method of claim 70, wherein the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma. (Item 72) 60. The method of item 59, further comprising administering an ERK inhibitor or a pharmaceutically acceptable salt thereof to the subject having a non-V600E / K BRAF mutation. (Item 73) 73. The method of item 72, further comprising administering to the subject at least one additional therapeutic agent selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof. (Item 74) The MEK inhibitor may be anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas Pharma Inc.), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), or a combination thereof. Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co., Ltd.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda Pharmaceutical Co., Ltd.), trametinib (Japan Tobacco Inc.), U0126 (1,Item 73. The method according to item 73, wherein the compound is selected from the group consisting of 4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 75) The RAF inhibitor is AAL881 (Novartis), AB-024 (Ambito) B-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen) Therapeutics), BRAFsiRNA313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK632 (Takeda Pharmaceutical Company Limited), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo Co., Ltd.), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 76) 74. The method of item 73, wherein the HDAC inhibitor is selected from the group consisting of abexinostat (PCI-24781), gibinostat, entinostat, vorinostat, CI-994, CUDC-101, entinostat, BML-210, M344, NVP-LAQ824, panobinostat, pracinostat (SB939), mocetinostat, resminostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof. (Item 77) 73. The method of claim 72, further comprising administering to the subject having a non-V600E / K BRAF mutation at least one additional therapeutic agent selected from the group consisting of an antibody, an antibody fragment, an antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoreactive therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof. (Item 78) The antibody or fragment thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab 78. The method of item 77, wherein the therapeutic agent is selected from the group consisting of atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, prosalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof. (Item 79) The cytotoxic agent is cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludara 78. The method of item 77, wherein the antiviral agent is selected from the group consisting of vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof. (Item 80) 78. The method of claim 77, wherein the toxin is diphtheria toxin or a portion thereof. (Item 81) 78. The method of claim 77, wherein the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof. (Item 82) 78. The method of claim 77, wherein the immunomodulatory agent is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune checkpoint inhibitors, and combinations thereof. (Item 83) 78. The method of claim 77, wherein the radiosensitizer is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof. (Item 84) The hormones include prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, anti-Mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone, melanocytes, and the like. 78. The method of item 77, wherein the steroid hormone is selected from the group consisting of steroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof. (Item 85) 78. The method of item 77, wherein the antiangiogenic agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. (Item 86) 78. The method of item 77, wherein the additional therapeutic agent is a PI3K / Akt pathway inhibitor. (Item 87) The PI3K / Akt pathway inhibitor is selected from the group consisting of A-674563 (CAS No. 552325-73-2), AGL2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), benzimidazoles, Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS No. 32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No. 612847-09-3, CAS No. 681281-88-9, CAS No. 75747-14-7, CAS No. 925681-41-0, CAS No. 98510-80-6, CCT128930 (CAS No. 885499-61-6), CH5132799 (CAS No. 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA124 (CAS no. 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK690693 (CAS no. 937174-76-0), H-89 (CAS no. 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT5720 (CAS no. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS no. 1032350-13-2), ML-9 (CAS no. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS no. 1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS No. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 88) A pharmaceutical composition for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, comprising a pharmaceutically acceptable carrier or diluent and an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof. (Item 89) 89. The pharmaceutical composition of item 88, wherein the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof. (Item 90) 89. The pharmaceutical composition of item 88, wherein the ERK inhibitor is BVD-523. (Item 91) 89. The pharmaceutical composition of item 88, wherein the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-deficient mutation, or a kinase-unknown mutation, and combinations thereof. (Item 92) 92. The pharmaceutical composition of item 91, wherein the kinase-activating mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof. (Item 93) 92. The pharmaceutical composition of item 91, wherein the kinase-deficient mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof. (Item 94) 92. The pharmaceutical composition of item 91, wherein the kinase unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof. (Item 95) 89. The pharmaceutical composition of item 88, wherein the subject is a mammal. (Item 96) 96. The pharmaceutical composition of item 95, wherein the mammal is selected from the group consisting of humans, primates, livestock, and domestic animals. (Item 97) 96. The pharmaceutical composition of item 95, wherein the mammal is a human. (Item 98) 89. The pharmaceutical composition of item 88, wherein the cancer is a solid tumor cancer or a blood cancer. (Item 99) Item 89. The pharmaceutical composition of item 88, wherein the cancer is selected from the group consisting of glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer. (Item 100) Item 99. The pharmaceutical composition of item 99, wherein the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma. (Item 101) 89. The pharmaceutical composition of item 88, which is administered to the subject orally or by injection. (Item 102) 89. The pharmaceutical composition of item 88, which is administered to the subject as a tablet. (Item 103) 89. The pharmaceutical composition of item 88, further comprising at least one additional therapeutic agent selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof. (Item 104) The MEK inhibitor may be anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas Pharma Inc.), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), or a combination thereof. Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co., Ltd.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda Pharmaceutical Co., Ltd.), trametinib (Japan Tobacco Inc.), U0126 (1,Item 103, the pharmaceutical composition of item 103, wherein the compound is selected from the group consisting of 4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 105) The RAF inhibitor is AAL881 (Novartis), AB-024 (Ambito) B-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen) Therapeutics), BRAFsiRNA313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK632 (Takeda Pharmaceutical Company Limited), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo Co., Ltd.), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 106) 104. The pharmaceutical composition of item 103, wherein the HDAC inhibitor is selected from the group consisting of abexinostat (PCI-24781), gibinostat, entinostat, vorinostat, CI-994, CUDC-101, entinostat, BML-210, M344, NVP-LAQ824, panobinostat, pracinostat (SB939), mocetinostat, resminostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof. (Item 107) 89. The pharmaceutical composition of item 88, further comprising at least one additional therapeutic agent selected from the group consisting of an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoreactive therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof. (Item 108) The antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab 108. The pharmaceutical composition of item 107, wherein the compound is selected from the group consisting of atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, prosalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof. (Item 109) The cytotoxic agent is selected from the group consisting of cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, and fludarabine. , 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof. (Item 110) Item 111. The pharmaceutical composition according to Item 107, wherein the toxin is diphtheria toxin or a portion thereof. 108. The pharmaceutical composition of item 107, wherein the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof. (Item 112) 108. The pharmaceutical composition of item 107, wherein the immunomodulatory agent is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune checkpoint inhibitors, and combinations thereof. (Item 113) 108. The pharmaceutical composition of claim 107, wherein the radiosensitizer is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof. (Item 114) The hormone may be a prostaglandin, a leukotriene, a prostacyclin, a thromboxane, an amylin, an anti-Mullerian hormone, an adiponectin, an adrenocorticotropic hormone, angiotensinogen, angiotensin, a vasopressin, an atriopeptin, a brain natriuretic peptide, a calcitonin, a cholecystokinin, a corticotropin-releasing hormone, an enkephalin, an endothelin, an erythropoietin, a follicle-stimulating hormone, a galanin, a gastrin, a ghrelin, a glucagon, a gonadotropin-releasing hormone, a growth hormone-releasing hormone, a human chorionic gonadotropin, a human placental lactogen, a growth hormone, an inhibin, an insulin, a somatomedin, a leptin, a lipotropin, a luteinizing hormone, a melanocyte-stimulating hormone, a steroid ... 108. The pharmaceutical composition of item 107, wherein the steroid hormone is selected from the group consisting of hormones, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof. (Item 115) 108. The pharmaceutical composition of item 107, wherein the antiangiogenic agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. (Item 116) 108. The pharmaceutical composition of item 107, wherein the additional therapeutic agent is a PI3K / Akt pathway inhibitor. (Item 117) The PI3K / Akt pathway inhibitor is selected from the group consisting of A-674563 (CAS No. 552325-73-2), AGL2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), benzimidazoles, Genentech (Roche Holdings Inc., South San Francisco, CA), BML-257 (CAS No. 32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No. 612847-09-3, CAS No. 681281-88-9, CAS No. 75747-14-7, CAS No. 925681-41-0, CAS No. 98510-80-6, CCT128930 (CAS No. 885499-61-6), CH5132799 (CAS No. 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA124 (CAS no. 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK690693 (CAS no. 937174-76-0), H-89 (CAS no. 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT5720 (CAS no. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS no. 1032350-13-2), ML-9 (CAS no. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS no. 1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-delta inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-delta inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS No. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 118) 108. The pharmaceutical composition of item 103 or 107, in unit dosage form, comprising both the ERK inhibitor and the additional therapeutic agent. (Item 119) 108. The pharmaceutical composition of claim 103 or 107, wherein the ERK inhibitor is in a first unit dosage form and the additional therapeutic agent is in a second unit dosage form separate from the first unit dosage form. (Item 120) 108. The pharmaceutical composition of claim 103 or 107, wherein the ERK inhibitor and the additional therapeutic agent are administered simultaneously to the subject. (Item 121) 108. The pharmaceutical composition of claim 103 or 107, wherein the ERK inhibitor and the additional therapeutic agent are administered sequentially to the subject. (Item 122) 122. The pharmaceutical composition of claim 121, wherein the ERK inhibitor is administered to the subject before or after administration of the additional therapeutic agent. (Item 123) A method for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, comprising administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof. (Item 124) 1. A method for treating or ameliorating the effects of cancer in a subject, comprising: (a) identifying a subject having a cancer harboring a non-V600E / K BRAF mutation; (b) administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof; A method comprising: (Item 125) 1. A method for identifying a subject having cancer who is expected to benefit from treatment with BVD-523 or a pharmaceutically acceptable salt thereof, comprising: (a) obtaining a biological sample from said subject; (b) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation; Including, The presence of said non-V600E / K BRAF mutation is confirmation that said subject is expected to benefit from treatment with BVD-523 or a pharmaceutically acceptable salt thereof. (Item 126) A pharmaceutical composition for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, comprising a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof. (Item 127) 108. A kit for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, the kit comprising the pharmaceutical composition of any one of items 88, 103 and 107 packaged together with instructions for its use. (Item 128) 104. The method of item 15, 44, 73, or 103, wherein the RAF inhibitor is selected from the group consisting of erlotinib (Tarceva), gefitinib (Iressa), imatinib mesylate (Gleevec), lapatinib (Tyverb), sunitinib malate (Sutent), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 129) 104. The method of item 15, 44, 73, or 103, wherein the RAF inhibitor is selected from the group consisting of LXH254 (Novartis), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), REDX0535 (RedX Pharma Plc), pharmaceutically acceptable salts thereof, and combinations thereof. (Item 130) 104. The method of item 15, 44, 73, or 103, wherein the HDAC inhibitor is selected from the group consisting of vorinostat, panobinostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof. (Item 131) 108. The method of item 19, 48, or 107, wherein the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab atezolizumab (Tecentriq), durvalumab (Imfinzi), ofatumumab, obinutuzumab (Gazyva), panitumumab, and combinations thereof. (Item 132) 117. The method of items 28, 57, 87, or 116, wherein the PI3K / Akt pathway inhibitor is BVD-723. [Brief explanation of the drawings]
[0139] [Figure 1] FIG. 1 is a schematic diagram of the mitogen-activated protein kinase (MAPK) pathway.
[0140] [Figure 2] Figure 2 shows responses in patients treated with BVD-523. All patients with disease as measured by RECIST v1.1 are included. Patients received one or more doses of study treatment and underwent one or more on-treatment tumor assessments. Response was measured as the change from baseline in the sum of the longest diameters of each target lesion. The solid line indicates the threshold for partial response by RECIST v1.1. Abbreviations: GBM, glioblastoma; NSCLC, non-small cell lung cancer; CRC, colorectal cancer. The atypical BRAF mutation associated with each patient's cancer is indicated.
[0141] [Figure 3]Figure 3 shows treatment duration in a swimmer plot categorized by group. Group 1 members are any patients with any BRAF mutation in any tumor type other than colorectal cancer (CRC) and non-small cell lung cancer (NSCLC) who have not previously been treated with a MAPK pathway inhibitor. Group 2 members are patients with any BRAF mutation in CRC who have not previously been treated with a MAPK pathway inhibitor. Group 3 members are patients with tumors refractory to MAPK inhibitors who have a BRAF V600E / K mutation. Group 6 members are patients with any BRAF mutation present in NSCLC. As shown in Figure 3, all 28 patients are included, represented by one horizontal bar per subject. The treatment duration for each subject in each group is indicated from the top (longest treatment duration) to the bottom (shortest treatment duration) of the group. The horizontal axis represents the study duration in days for the patient. Figure 3 also shows the type of response achieved per patient according to RECIST v1.1 (diamond = partial response; circle = stable disease; vertical bar = progressive disease; triangle = not assessed).
[0142] [Figure 4] Figure 4 shows treatment duration in swimmer plots categorized by BRAF mutation, including all 28 patients measured for RECIST v1.1 response criteria, plus additional patients not assessed by RECIST v1.1 (diamonds = partial response; circles = stable disease; vertical bars = progressive disease; triangles = not assessed). DETAILED DESCRIPTION OF THE INVENTION
[0143] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject harboring a non-V600E / K BRAF mutation, the method comprising administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.
[0144] As used herein, the term "V600E / K BRAF mutation" and its grammatical variants are associated with cancer in a subject, and refer to cancer cells that contain a non-synonymous substitution mutation in the gene encoding human BRAF (SEQ ID NO: 2), resulting in the substitution of the amino acid valine (V) with glutamic acid (E) or lysine (K) at amino acid position 600 of BRAF.As used herein, the term "carrying a non-V600E / K BRAF mutation" and its grammatical variants are associated with cancer in a subject, and refer to cancer cells that contain a somatic mutation that is not a V600E / K BRAF mutation.As used herein, all BRAF mutations are based on the human wild-type sequence (SEQ ID NO: 2).These orthologs from other species are also considered herein.
[0145] As used herein, the terms "treat," "treating," "treatment," and their grammatical variations refer to subjecting an individual subject to a protocol, regimen, method, or therapy, and it is desirable to obtain a physiological response or outcome in the subject, e.g., patient. In particular, the methods and compositions of the present invention may be used to delay the onset of disease symptoms, delay the onset of a disease or condition, or halt the progression of disease development. However, treatment does not require that the desired physiological response or outcome be achieved in all subjects or subject populations, e.g., patient populations, respectively, because not all treated subjects may respond to a particular treatment protocol, regimen, method, or therapy. Thus, a given subject or subject population, e.g., patient population, may not respond or may not respond adequately to treatment.
[0146] As used herein, the terms "ameliorate," "ameliorating," and grammatical variations thereof, refer to a decrease in the severity of symptoms of a disease in a subject.
[0147] As used herein, a "subject" is a mammal, preferably a human. In addition to humans, classes of mammals within the scope of the present invention include, for example, livestock, domestic animals, and laboratory animals. Some examples of livestock include cows, pigs, horses, and goats. Some examples of domestic animals include dogs and cats. Some examples of laboratory animals include primates, rats, mice, rabbits, and guinea pigs.
[0148] As used herein, the term "effective amount" or "therapeutically effective amount" of a compound or composition disclosed herein refers to an amount of the compound or composition sufficient to produce a beneficial or desired result as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts may be determined empirically, and making such determinations is within the skill of the art. It is understood by those skilled in the art that dosage amounts are expected to vary with factors such as the route of administration, excretion rate, duration of treatment, the identity of any other drugs administered, the age, size, and species of the mammal, e.g., human patient, as well as factors well known in the medical and veterinary arts. Generally, a suitable dose of a compound or composition according to the present invention is expected to be the amount of the composition at the lowest dose effective to produce the desired effect. An effective dose of a compound or composition of the present invention may be administered as two, three, four, five, six, or more divided doses, administered separately at appropriate intervals throughout the day.
[0149] In some embodiments, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof. In some embodiments, the ERK inhibitor is BVD-523.
[0150] In the present invention, BVD-523 is a compound according to formula (I): [ka]
[0151] and pharmaceutically acceptable salts thereof. BVD-523 is a highly potent, selective, reversible, ATP-competitive ERK1 / 2 inhibitor. BVD-523 may be synthesized, for example, according to the method disclosed in U.S. Pat. No. 7,354,939, which is incorporated by reference. Enantiomers of BVD-523 and racemic mixtures of both enantiomers are also contemplated within the scope of the present invention. BVD-523 is an ERK1 / 2 inhibitor with a mechanism of action that is unique and believed to be different from certain other ERK1 / 2 inhibitors, such as SCH772984. While other ERK1 / 2 inhibitors, such as SCH772984, inhibit the autophosphorylation of ERK (Morris et al., 2013), BVD-523 autophosphorylates ERK while still inhibiting ERK.
[0152] According to some embodiments, the cancer of the subject has somatic mutation in BRAF gene.As used herein, " somatic mutation " refers to the change that occurs in any cell that is not destined to become germ cell.Mutation can be, for example, substitution, deletion, insertion or fusion.The following table 1 shows the distribution summary of BRAF mutation as shown in Sanger database. [Table 1]
[0153] BRAF mutations are found in approximately 66% of melanomas (Davies et al., 2002; Brose et al., 2002; Hocket et al., 2007), with relatively lower percentages in other cancers, such as 36% of thyroid tumors and 10% of colon cancers (Xu et al., 2003; Fransen et al., 2004). The most common BRAF mutation occurs at amino acid 600 of the human wild-type protein kinase (SEQ ID NO: 2) by substitution of valine with glutamic acid, resulting in the mutant B-RafV600E, which accounts for approximately 80% of BRAF mutations (Davies et al., 2002; Hocker et al., 2007). The B-RafV600E kinase domain has 500-fold increased kinase activity compared to the basal activity of wild-type B-Raf (Wan et al., 2004). Among other BRAF mutations identified in melanoma, V600K and V600D / R are also common, accounting for 16% and 3% of all BRAF mutations, respectively (Long et al., 2011). In addition to melanoma, BRAF mutations are also common in many other cancers, including papillary thyroid carcinoma, ovarian cancer, and colorectal cancer (Wellbrock et al., 2004). In one study, BRAF splice variants (in which exons 14 and 15 are spliced) were found in 5 / 24 (21%) colorectal cancer cell lines (Seth et al., 2009).
[0154] Table 2 below, taken from the Sanger database, shows the distribution and frequency of BRAF mutations in human tumors. [Table 2-1] [Table 2-2]
[0155] Table 3 below shows selected BRAF nucleic acid and amino acid sequences, which may be used in methods (such as those described below) for identifying subjects with a mutant BRAF genotype. [Table 3-1] [Table 3-2]
[0156] The method for identifying mutations in nucleic acid such as the above-identified BRAF gene is known in the art.Nucleic acid can be obtained from biological sample.In the present invention, biological sample includes but is not limited to blood, plasma, urine, skin, saliva and biopsy material.Biological sample can be obtained from subject by conventional procedure and known method in the art.
[0157] Non-limiting examples of methods for identifying mutations include PCR, sequencing, hybrid capture, in-solution capture, molecular inversion probes, fluorescent in situ hybridization (FISH) assays, and combinations thereof.
[0158] A variety of sequencing methods are known in the art.These include but are not limited to Sanger sequencing (also known as dideoxy sequencing), and various sequencing-by-synthesis (SBS) methods, such as those disclosed in Metzker (2005), hybridization sequencing, ligation sequencing (for example, International Publication No. 2005021786), degradation sequencing (for example, US Patent No. 5,622,824 and US Patent No. 6,140,053), and nanopore sequencing (which is commercially available from Oxford Nanopore Technologies, UK).In deep sequencing technology, a given nucleotide in sequence is read more than once during sequencing process. Deep sequencing techniques are disclosed, for example, in U.S. Patent Application Publication No. 20120264632 and WO 2012125848.
[0159] PCR-based methods for detecting mutations are known in the art and use PCR amplification. Here, each target sequence in a sample has a corresponding pair of unique sequence-specific primers. For example, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method allows mutations to be rapidly detected after genomic sequences are amplified by PCR. Mutations are discriminated by digesting with specific restriction endonucleases and identified by electrophoresis. See, for example, Ota et al., 2007. Mutations can also be detected using real-time PCR. See, for example, International Application Publication No. 2012046981.
[0160] Hybrid capture methods are known in the art and are disclosed, for example, in US Patent Application Publication No. 20130203632 and US Patent Nos. 8,389,219 and 8,288,520. These methods are based on the selective hybridization of target genomic regions to user-designed oligonucleotides. Hybridization can be performed on oligonucleotides immobilized on high-density or low-density microarrays (on-array capture), or solution-phase hybridization can be performed on oligonucleotides modified with ligands (e.g., biotin), which can then be immobilized on solid surfaces such as beads (solution capture).
[0161] The molecular inversion probe (MIP) method is known in the art and has been disclosed, for example, in Absalan et al., 2008. This method uses MIP molecules, which are special "padlock" probes for genotyping (Nilsson et al., 1994). MIP molecules are linear oligonucleotides containing a specific region, a universal sequence, a restriction site, and a tag (index) sequence (16-22 bp). In such methods, MIPs hybridize directly near the genetic marker / SNP of interest. The MIP method may also use multiple "padlock" probe sets that hybridize in parallel to genomic DNA (Hardenbol et al., 2003). If there is a perfect match, the genomic homologous regions are ligated by inversion in configuration (as the name of the technique suggests), creating a circular molecule. After the first restriction, all molecules are amplified using universal primers. The amplicon is restricted again, leaving short fragments for hybridization on a microarray. The resulting short fragments are labeled and hybridized to cTag (complementary strand for indexing) on the array via the Tag sequence. After the Tag-cTag duplex is formed, the signal is detected.
[0162] According to some embodiments, the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-defective mutation, a kinase-defective mutation, or a combination thereof. As used herein, the term "kinase-activating mutation" and grammatical variations thereof means that the mutation confers increased kinase activity on the mutated kinase compared to the wild-type kinase. As used herein, the term "kinase-defective mutation" and grammatical variations thereof means that the mutation confers decreased kinase activity on the mutated kinase compared to the wild-type kinase. As used herein, the term "kinase-defective mutation" and grammatical variations thereof means that the activity of the mutant kinase is unknown or that the activity of the mutated kinase is approximately the same as the kinase activity of the wild-type kinase (Zheng, G. et al., Clinical detection and categorization of uncommon and See concomitant mutations involving BRAF, BMC Cancer, (2015) 15:779, the entire contents of which are incorporated herein by reference.
[0163] According to some embodiments, the BRAF kinase-activating mutation is selected from the group consisting of R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof. According to some embodiments, the BRAF kinase-deficient mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof. According to some embodiments, BRAF kinase unknown mutation is selected from the group consisting of T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.As used herein, all BRAF mutations are based on human wild-type sequence (SEQ ID NO: 2).These orthologs from other species are also considered herein.
[0164] In the present invention, the methods and compositions for treating non-V600E / K BRAF mutations are effective against disease states harboring single mutations and one or more mutations. Indeed, any single mutation or any combination of mutations disclosed herein (or identified below) (e.g., any combination of non-V600E / K mutations or any combination of non-V600E / K and V600E / K mutations) may be treated using the compositions or according to the methods of the present invention.
[0165] According to some embodiments, the non-V600E / K BRAF mutation is selected from the group consisting of D594, G469, K601E, L597, T599 duplication, L485W, F247L, G466V, BRAF fusion, BRAF-AGAP3 rearrangement, BRAF exon 15 splice variant, and combinations thereof.
[0166] As used herein, the notation for an amino acid substitution mutation includes the closed format of wild-type amino acid; position; substituted amino acid (e.g., K601E). As used herein, the notation for an amino acid substitution also includes the open-ended format of wild-type amino acid; position (e.g., G469). As used herein, the open-ended notation includes the substitution of any amino acid. For example, a G469 mutation discloses the substitution of glycine at position 469 with any of the amino acids A, R, N, D, C, Q, E, H, I, L, K, M, F, P, S, T, W, Y, and V. Also, as used herein, the closed notation includes the substitution of any amino acid, preferably the substituted amino acid described. For example, a K601E mutation discloses the substitution of lysine at position 601 with any of the amino acids A, R, N, D, C, Q, E, G, H, I, L, M, F, P, S, T, W, Y, and V, more preferably with amino acid E. As used herein, the use of the closed notation should not be understood to limit the disclosure to the specifically stated amino acid substitutions.
[0167] In some embodiments, the subject with a cancer harboring a non-V600E / K BRAF mutation is a mammal. In some embodiments, the mammal is selected from the group consisting of humans, primates, livestock, and domestic animals. In some embodiments, the mammal is a human.
[0168] According to some embodiments, the present disclosure provides treatments for both solid cancers and hematological cancers. Non-limiting examples of solid cancers include adrenocortical carcinoma, anal cancer, bladder cancer, bone cancer (such as osteosarcoma), brain cancer, breast cancer, carcinoid cancer, carcinoma, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, extrahepatic bile duct cancer, Ewing's family of cancers, extracranial germ cell cancer, eye cancer, gallbladder cancer, gastric cancer, germ cell tumors, gestational trophoblastic neoplasia, head and neck cancer, hypopharyngeal cancer, islet cell carcinoma, kidney cancer, colorectal cancer, laryngeal cancer, leukemia, lip and oral cavity cancer, liver tumor / cancer, lung tumor / cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndrome, myeloproliferative disorders, nasopharyngeal cancer, neuroblastoma, oral cavity cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell cancer, pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid carcinoma, penile cancer, pituitary cancer, plasma cell neoplasms, prostate cancer, rhabdomyosarcoma, rectal cancer, renal cell carcinoma, transitional cell carcinoma of the renal pelvis and ureter, salivary gland cancer, Sézary syndrome, skin cancer (including cutaneous T-cell lymphoma, Kaposi's sarcoma, mast cell tumor, and melanoma), small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, thymoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.
[0169] Examples of hematological cancers include, but are not limited to, leukemias such as adult / childhood acute lymphoblastic leukemia, adult / childhood acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, and hairy cell leukemia, lymphomas such as AIDS-related lymphoma, cutaneous T-cell lymphoma, adult / childhood Hodgkin's lymphoma, mycosis fungoides, adult / childhood non-Hodgkin's lymphoma, primary central nervous system lymphoma, Sezary syndrome, cutaneous T-cell lymphoma, and Waldenstrom's macroglobulinemia, and other proliferative disorders such as chronic myeloproliferative disorders, Langerhans cell histiocytosis, multiple myeloma / plasma cell neoplasm, myelodysplastic syndrome, and myelodysplastic / myeloproliferative neoplasm.
[0170] According to some embodiments, the subject's cancer is selected from the group consisting of glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer. Preferably, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma.
[0171] According to some aspects, the present disclosure provides administering to the subject at least one additional mitogen-activated protein kinase (MAPK) pathway inhibitor. According to some embodiments, the at least one additional therapeutic agent is selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, an ERK inhibitor, and combinations thereof.
[0172] As used herein, a "mitogen-activated protein kinase (MAPK) pathway inhibitor" is any substance that modulates, e.g., decreases, the activity, expression, or phosphorylation of proteins in the MAPK pathway, resulting in decreased cell growth or increased cell death.
[0173] An overview of the mammalian MAPK cascade is shown in Figure 1. Details of the MAPK pathway are outlined, for example, in Akinleye et al., 2013. Briefly, with regard to the ERK1 / 2 module (light purple box) in Figure 1, the MAPK1 / 2 signaling cascade is activated by ligand binding to receptor tyrosine kinases (RTKs). The activated receptor recruits and phosphorylates the adaptor proteins Grb2 and SOS, which then interact with and activate the membrane-bound GTPase Ras. In its activated GTP-bound form, Ras recruits and activates Raf kinases (A-Raf, B-Raf, and C-Raf / RaF-1). Activated Raf kinases activate MAPK1 / 2 (MKK1 / 2), which then catalyze the phosphorylation of threonine and tyrosine residues at the activation sequence Thr-Glu-Tyr of ERK1 / 2. For the JNK / p38 module (shown in yellow in Figure 1), upstream kinases, such as MAP3Ks (MEKK1 / 4, ASK1 / 2, and MLK1 / 2 / 3), activate MAP2K3 / 6 (MKK3 / 6), MAP2K4 (MKK4), and MAP2K7 (MKK7). These MAP2Ks then activate JNK protein kinases, including JNK1, JNK2, and JNK3, as well as p38α / β / γ / Δ. To carry out these functions, JNKs activate several transcription factors, including c-Jun, ATF-2, NF-ATc1, HSF-1, and STAT3. For the ERK5 module (shown in blue in Figure 1), the upstream kinases of MAP2K5 (MKK5) are MEKK2 and MEKK3. The best-characterized downstream target of MEK5 is ERK5, also known as big MAP kinase 1 (BMK1) because it is twice the size of other MAPKs.
[0174] Non-limiting examples of MAPK pathway inhibitors include RAS inhibitors, RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, pharmaceutically acceptable salts thereof, and combinations thereof.
[0175] As used herein, "RAS inhibitor" refers to a substance that (i) directly interacts with RAS, for example, by binding to RAS, and (ii) reduces the expression or activity of RAS. Non-limiting exemplary RAS inhibitors include, but are not limited to, farnesyl transferase inhibitors (such as tipifarnib and lonafarnib), farnesyl group-containing small molecules (such as salirasib and TLN-4601), DCAI as disclosed by Maurer (Maurer et al., 2012), Kobe0065 and Kobe2602 as disclosed by Shima (Shima et al., 2013), HBS3 (Patgiri et al., 2011), and AIK-4 (Allinky).
[0176] As used herein, "RAF inhibitor" refers to a substance that (i) directly interacts with RAF, e.g., by binding to RAF, and (ii) reduces the expression or activity of RAF, e.g., A-RAF, B-RAF, and C-RAF (Raf-1). Non-limiting exemplary RAF inhibitors include: [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] There is.
[0177] AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY43-9006 Sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK632 (Takeda Pharmaceutical Company Limited), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo Co., Ltd.), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.
[0178] According to some embodiments, RAF inhibitors include pan-inhibitors; non-limiting examples of which include erlotinib (Tarceva), gefitinib (Iressa), imatinib mesylate (Gleevec), lapatinib (Tyverb), sunitinib malate (Sutent), pharmaceutically acceptable salts thereof, and combinations thereof.
[0179] As used herein, "MEK inhibitor" refers to a substance that (i) directly interacts with MEK, for example, by binding to MEK, and (ii) reduces the expression or activity of MEK. Thus, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEF inhibitors according to the present invention.Non-limiting examples of MEK inhibitors include anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas Pharma Inc.), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), the lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co., Ltd.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche) Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda Pharmaceutical Company Limited), trametinib (Japan Tobacco Inc.), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.
[0180] As used herein, "ERK1 / 2 inhibitor" refers to a substance that (i) directly interacts with ERK1 and / or ERK2, for example, by binding to ERK1 / 2, and (ii) reduces the expression or activity of ERK1 and / or ERK2 protein kinases. Consequently, inhibitors that act upstream of ERK1 / 2, such as MEK inhibitors and RAF inhibitors, are not ERK1 / 2 inhibitors according to the present invention. Non-limiting examples of ERK1 / 2 inhibitors include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), pharmaceutically acceptable salts thereof, and combinations thereof.
[0181] As used herein, "HDAC inhibitor" refers to a substance that (i) directly interacts with histone deacetylase (HDAC), for example, by binding to HDAC, and (ii) reduces the expression or activity of HDAC. Non-limiting examples of HDAC inhibitors include abexinostat (PCI-24781), gibinostat, entinostat, vorinostat, CI-994, CUDC-101 entinostat, BML-210, M344, NVP-LAQ824, panobinostat, pracinostat (SB939), mocetinostat, resminostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
[0182] According to some embodiments, the HDAC inhibitor is selected from the group consisting of vorinostat, panobinostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.
[0183] In another embodiment, the method further comprises administering to the subject at least one additional therapeutic agent effective to treat or ameliorate the effects of cancer. The additional therapeutic agent may be selected from the group consisting of an antibody, an antibody fragment, an antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a photoreactive therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof.
[0184] As used herein, "antibody" encompasses naturally occurring immunoglobulins as well as non-naturally occurring immunoglobulins, including, for example, single-chain antibodies, chimeric antibodies (e.g., humanized murine antibodies), and heteroconjugate antibodies (e.g., bispecific antibodies). Antibody fragments include antigen-binding fragments (e.g., Fab', F(ab')2, Fab, Fv, and rIgG). See, e.g., Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, Ill.); Kuby, J., Immunology, 3rd ed., W.H. Freeman & Co., New York (1998). The term antibody also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. The term "antibody" further includes both polyclonal and monoclonal antibodies.
[0185] Examples of therapeutic antibodies that may be used in the present invention include rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab These include atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, prosalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.
[0186] According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab atezolizumab (Tecentriq), durvalumab (Imfinzi), ofatumumab, obinutuzumab (Gazyva), panitumumab, and combinations thereof.
[0187] Cytotoxic agents useful in the present invention include DNA damaging agents, antimetabolites, microtubule inhibitors, and antibiotics. DNA damaging agents include alkylating agents, platinum-based agents, intercalating agents, and DNA replication inhibitors. Non-limiting examples of DNA alkylating agents include cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, pharmaceutically acceptable salts, prodrugs, and combinations thereof. Non-limiting examples of platinum-based agents include cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, pharmaceutically acceptable salts, prodrugs, and combinations thereof. Non-limiting examples of intercalating agents include doxorubicin, daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of DNA replication inhibitors include irinotecan, topotecan, amsacrine, etoposide, etoposide phosphate, teniposide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Antimetabolites include folate antagonists such as methotrexate and pemetrexed, purine antagonists such as 6-mercaptopurine, dacarbazine, and fludarabine, and pyrimidine antagonists such as 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Antimicrobial agents include, but are not limited to, vinca alkaloids, paclitaxel (Taxol®), docetaxel (Taxotere®), and ixabepilone (Ixempra®). Antibiotics include, but are not limited to, actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts, prodrugs, and combinations thereof.
[0188] According to some embodiments, the cytotoxic agent is cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, Selected from the group consisting of dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof.
[0189] Cytotoxic agents according to the present invention also include PI3K / Akt pathway inhibitors. Non-limiting examples of PI3K / Akt pathway inhibitors include A-674563 (CAS No. 552325-73-2), AGL2263, AMG-319 (Amgen, Thousand Oaks, Calif.), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), benzimidazoles, Genentech (Roche Holdings Inc., South San Francisco, CA). Francisco, Calif.), BML-257 (CAS No. 32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, Calif.), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS No. 612847-09-3, CAS No. 681281-88-9, CAS No. 75747-14-7, CAS No. 925681-41-0, CAS No. 98510-80-6, CCT128930 (CAS No. 885499-61-6), CH5132799 (CAS No. 1007207-67-1), CHR-4432 (Chroma Therapeutics, Ltd., Abingdon, UK), FPA124 (CAS number 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK690693 (CAS number 937174-76-0), H-89 (CAS number 127243-85-0), honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT5720 (CAS No. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS No. 1032350-13-2), ML-9 (CAS No. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, Mass.), perifosine, PHT-427 (CAS No. 1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor-2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-alpha / delta inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, Calif.), PI3-delta inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-delta inhibitor, Intellikine (Intellikine Inc., La Jolla, Calif.), PI3-delta inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-delta inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Cellzome (Cellzome AG), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Intellikine (Intellikine Inc.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-delta / gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-gamma inhibitor Evotec (Evotec), PI3-gamma inhibitor, Cellzome (Cellzome AG), PI3-gamma inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), PI3K delta / gamma inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS No. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, Ind.), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, Calif.), triciribine, X-339 (Xcovery, West Palm Beach, Fla.), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.
[0190] In the present invention, BVD-723 is a compound according to formula (II) [ka]
[0191] and pharmaceutically acceptable salts thereof. BVD-723 is a selective inhibitor of PI3Kγ. BVD-723 may be synthesized, for example, according to the method disclosed in U.S. Patent Application Publication No. 2016 / 0214980, the entire contents of which are incorporated herein by reference. Enantiomers of BVD-723 and racemic mixtures of both enantiomers are also contemplated within the scope of the present invention.
[0192] In the present invention, the term "toxin" means an antigenic poison or venom of plant or animal origin. An example is diphtheria toxin or a part thereof.
[0193] As used herein, the term "radionuclide" refers to a radioactive substance that is administered to a patient, for example, intravenously or orally, and then penetrates through the patient's normal metabolism to a target organ or tissue, where it delivers radiation locally over a short period of time. Examples of radionuclides include, but are not limited to, I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, and Y-90.
[0194] As used herein, the term "immunomodulator" refers to a substance that alters the immune response by enhancing or diminishing the immune system's ability to recognize and react with the antigen that initiated its production, thereby producing antibodies or sensitized cells. Immunomodulators may be recombinant, synthetic, or natural preparations, including cytokines, corticosteroids, cytotoxic agents, thymosins, and immunoglobulins. Some immunomodulators occur naturally in the body, and some are available as pharmacological preparations. Examples of immunomodulators include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod, bacterial membrane fractions, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune checkpoint inhibitors, and combinations thereof.
[0195] As used herein, the term "photoreactive therapeutic agent" refers to compounds and compositions that become active when exposed to light. Specific examples of photoreactive therapeutic agents are disclosed, for example, in U.S. Patent Application Publication No. 2011 / 0152230A1, entitled "Photoactive Metal Nitrosyls For Blood Pressure Regulation And Cancer Therapy."
[0196] As used herein, the term "radiosensitizer" refers to a compound that makes tumor cells more sensitive to radiation therapy. Examples of radiosensitizers include misonidazole, metronidazole, tirapazamine, and trans-sodium crocetinate, and combinations thereof.
[0197] As used herein, the term "hormone" refers to a substance released by cells in one part of the body that affects cells in another part of the body. Examples of hormones include, but are not limited to, prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, anti-Mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endrin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, and human placenta. Lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone, melanocyte-stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcidiol.
[0198] Some compounds interfere with the activity of certain hormones or stop the production of certain hormones. These hormone-interfering compounds include, but are not limited to, tamoxifen (Nolvadex®), anastrozole (Arimidex®), letrozole (Femara®), and fulvestrant (Faslodex®). Such compounds are also within the meaning of hormone in this invention.
[0199] As used herein, " antiangiogenic " agent refers to the substance that reduces or inhibits the growth of new blood vessels, such as vascular endothelial growth factor (VEGF) inhibitor and endothelial cell migration inhibitor.Antiangiogenic agent includes but is not limited to 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-α, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, ziv-aflibercept, their pharmaceutically acceptable salts, prodrugs, and their combinations.
[0200] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject, the method comprising: (a) identifying a subject having a cancer that harbors a non-V600E / K BRAF mutation; and (b) administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.
[0201] According to one embodiment, the ERK inhibitor is selected from the group consisting of BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof. According to one embodiment, the ERK inhibitor is BVD-523. In one aspect of this embodiment, BVD-523 or a pharmaceutically acceptable salt thereof is administered in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier or diluent.
[0202] According to one aspect, the present disclosure provides for identifying a subject having cancer harboring a non-V600E / K BRAF mutation, comprising: (i) obtaining a biological sample from the subject; and (ii) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation.
[0203] Suitable preferred subjects are as disclosed herein.In this embodiment, the method can be used to treat the cancers disclosed above, including the cancers with the mutation backgrounds identified above.The method for identifying such mutations is also as described above.
[0204] In the present invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva and biopsy material.Biological samples are obtained from subjects by conventional procedures and methods known in the art.Non-limiting examples of methods for identifying mutations include PCR, sequencing, hybrid capture, in-solution capture, molecular inversion probe, fluorescence in situ hybridization (FISH) assay and combinations thereof.
[0205] According to one embodiment, the method further comprises administering to the subject at least one additional therapeutic agent selected from the group consisting of MEK inhibitor, RAF inhibitor, HDAC inhibitor, and combinations thereof.Suitable preferred subjects are as disclosed herein.In this embodiment, the method can be used to treat the cancers disclosed above, including the cancers with the mutation backgrounds identified above, by using one or more of the additional therapeutic agents disclosed above.The method of identifying such mutations is also shown above.
[0206] According to one aspect, the present disclosure provides a method for identifying a subject having cancer who is expected to benefit from treatment with an ERK inhibitor or a pharmaceutically acceptable salt thereof, the method comprising: (a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation, wherein the presence of the non-V600E / K BRAF mutation confirms that the subject is expected to benefit from treatment with an ERK inhibitor or a pharmaceutically acceptable salt thereof. According to some embodiments, the method further comprises administering an ERK inhibitor or a pharmaceutically acceptable salt thereof to the subject. According to some embodiments, the method further comprises administering at least one additional therapeutic agent to the subject. In this embodiment, the method may be used to identify the above-identified mutational background in the above-mentioned cancer. Methods for identifying such mutations are also set forth above. In this embodiment, the ERK inhibitor from which the identified patient is expected to benefit is as described above. The additional therapeutic agent is as described above. Suitable preferred subjects are as described above.
[0207] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject, the method comprising: (a) identifying a subject with cancer harboring a non-V600E / K BRAF mutation; and (b) administering an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof to the subject. According to one aspect, the present disclosure provides a method for identifying a subject with cancer who is expected to benefit from treatment with BVD-523 or a pharmaceutically acceptable salt thereof, the method comprising: (a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation, wherein the presence of a non-V600E / K BRAF mutation confirms that the subject is expected to benefit from treatment with BVD-523 or a pharmaceutically acceptable salt thereof. In these embodiments, the method may be used to identify the above-identified mutational background in the aforementioned cancers. Methods for identifying such mutations are also provided above. Suitable preferred subjects are as disclosed above.
[0208] A further aspect of the present disclosure provides a kit for treating or ameliorating the effects of cancer in a subject harboring a non-V600E / K BRAF mutation. According to some embodiments, the kit comprises an effective amount of an ERK inhibitor, as described above, and optionally an additional therapeutic agent, as described above.
[0209] The kit may also include storage containers, such as ampoules, vials, tubes, etc., suitable for each anticancer agent of the present invention (which may be in the form of, for example, a pharmaceutical composition) and other reagents, such as buffers, balanced salt solutions, etc., for use in administering the anticancer agent to a subject. The anticancer agent of the present invention and other reagents may be present in the kit in any convenient form, such as, for example, in solution or powder form. The kit may further include a packaging container, optionally having one or more partitions for containing the pharmaceutical composition and other reagents as needed.
[0210] In the present invention, an "effective amount" or "therapeutically effective amount" of an anticancer agent, including a pharmaceutical composition disclosed herein containing the anticancer agent of the present invention, is an amount of the agent or composition sufficient to produce a beneficial or desired result as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosage amounts may be determined empirically, and making such determinations is within the skill of the art. It will be understood by those skilled in the art that dosage amounts are expected to vary with factors such as the route of administration, excretion rate, duration of treatment, the identity of any other drugs administered, the age, size, and species of the mammal, e.g., human patient, as well as factors well known in the medical and veterinary arts. Generally, a suitable dose of an agent or composition according to the present invention is expected to be the amount of the agent or composition that is the lowest dose effective to produce the desired effect. An effective dose of an agent or composition of the present invention may be administered as two, three, four, five, six, or more divided doses, administered separately at appropriate intervals throughout the day.
[0211] Suitable, non-limiting examples of dosages of BVD-523, a RAF inhibitor, an ERK inhibitor, or another anti-cancer agent disclosed herein are from about 1 mg / kg to about 2400 mg / kg per day, e.g., from about 1 mg / kg to about 1200 mg / kg per day, from 75 mg / kg per day to about 300 mg / kg per day, including from about 1 mg / kg to about 100 mg / kg per day. Other representative dosages of such agents are about 1 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, 200 mg / kg, 250 mg / kg, 300 mg / kg, 400 mg / kg, 450 mg / kg, 500 mg / kg, 600 mg / kg, 700 mg / kg, 750 mg / kg, 800 mg / kg, 900 mg / kg, 1000 mg / kg, 1250 mg / kg, 150 mg / kg, 175 mg / kg, 200 mg / kg, 250 mg / kg, 300 mg / kg, 400 mg / kg, 450 mg / kg, 500 mg / kg, 500 mg / kg, 600 mg / kg, 700 mg / kg, 750 mg / kg, 800 mg / kg, 900 mg / kg, 1000 mg / kg, 1250 mg / kg, 150 mg / kg, 175 mg / kg, 200 mg / kg, 250 mg / kg, 300 mg / kg, 450 mg / kg, 50 ...
[0023] Effective doses of BVD-523, RAF inhibitors, ERK inhibitors, or other anti-cancer agents disclosed herein may be administered as two, three, four, five, six, or more divided doses, administered individually at appropriate intervals throughout the day.
[0212] BVD-523, RAF inhibitors, ERK inhibitors, or other therapeutic agents, or pharmaceutical compositions containing the same of the present invention, may be administered in any desired and effective manner for oral ingestion, as ointments or drops for local administration to the eye, or by any suitable manner for parenteral or other administration, such as intraperitoneal, intratumoral, subcutaneous, topical, intradermal, inhalation, intrapulmonary, rectal, vaginal, sublingual, intramuscular, intravenous, intraarterial, intrathecal, or intralymphatic. Furthermore, BVD-523, RAF inhibitors, or other therapeutic agents, or pharmaceutical compositions containing the same of the present invention, may be administered in combination with other treatments. BVD-523, RAF inhibitors, or other therapeutic agents, or pharmaceutical compositions containing the same, may be encapsulated or otherwise protected against gastric or other secretions, if desired.
[0213] Pharmaceutical compositions of the present invention comprise one or more active ingredients, e.g., therapeutic agents, mixed with one or more pharmaceutically acceptable diluents or carriers, and optionally one or more other compounds, drugs, ingredients and / or materials. Regardless of the route of administration selected, the agents / compounds of the present invention are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. See, for example, Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott, (Williams and Wilkins, Philadelphia, Pa.).
[0214] Pharmaceutically acceptable diluents or carriers are well known in the art (see, e.g., Remington, The Science and Practice of Pharmacy (21st ed., Lippincott Williams and Wilkins, Philadelphia, Pa.) and The National Formulary (American Pharmaceutical Association, Washington, DC)) and include, but are not limited to, sugars (e.g., lactose, sucrose, mannitol, and sorbitol), starch, cellulose preparations, calcium phosphates (e.g., dicalcium phosphate, tricalcium phosphate, and calcium hydrogen phosphate), sodium citrate, water, aqueous solutions (e.g., saline, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection), alcohols (e.g., ethyl alcohol, propanediol, sorbitol ... Examples of suitable pharmaceutically acceptable carriers include hydroxypropyl alcohol, and benzyl alcohol), polyols (e.g., glycerol, propylene glycol, and polyethylene glycol), organic esters (e.g., ethyl oleate and triglycerides), biodegradable polymers (e.g., polylactide-polyglycolide, poly(orthoesters), and poly(anhydrides)), elastomeric matrices, liposomes, microspheres, oils (e.g., corn, germ, olive, castor, sesame, cottonseed, and peanut), cocoa butter, waxes (e.g., suppository wax), paraffin, silicones, talc, salicylates, and the like. Each pharmaceutically acceptable diluent or carrier used in the pharmaceutical compositions of the present invention should be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the subject. Diluents or carriers suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable diluents or carriers for a selected dosage form and method of administration can be determined using common techniques in the art.
[0215] The pharmaceutical composition of the present invention may optionally contain additional components and / or materials that are commonly used in pharmaceutical compositions.These components and materials are well known in the art, and include: (1) fillers or extenders, such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders, such as carboxymethylcellulose, alginate, gelatin, polyvinylpyrrolidone, hydroxypropylmethylcellulose, sucrose, and acacia; (3) humectants, such as glycerol; (4) disintegrants, such as agar, calcium carbonate, potato or Tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethylcellulose, and sodium carbonate; (5) solution retarders, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as cetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol. , and sodium lauryl sulfate; (10) suspending agents, such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, and tragacanth; (11) buffering agents; (12) excipients, such as lactose, milk sugar, polyethylene glycol, animal and vegetable fats, oils, waxes, paraffin, cocoa butter, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonite, nite, silicic acid, talc, salicylate, zinc oxide, aluminum hydroxide, calcium silicate, and polyamide powder; (13) inert diluents, such as water or other solvents; (14) preservatives; (15) surfactants; (16) dispersing agents; (17) controlled-release or absorption retarding agents, such as hydroxypropyl methylcellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin, and waxes; (18) opacifying agents; (19) adjuvants; (20) wetting agents;(21) emulsifying and suspending agents; (22) solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofuryl alcohol, polyethylene glycol, and fatty acid esters of sorbitan; (23) propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane; (24) antioxidants; (25) agents that render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickening agents; (27) coating materials, such as lecithin; and (28) sweeteners, flavorings, colorings, fragrances, and preservatives. Each such ingredient or material should be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the subject. Ingredients and materials suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable ingredients and materials for a selected dosage form and method of administration may be determined using common techniques in the art.
[0216] Pharmaceutical compositions of the present invention suitable for oral administration may be in the form of a capsule, cachet, pill, tablet, powder, granule, solution or suspension in an aqueous liquid or non-aqueous liquid, oil-in-water or water-in-oil liquid emulsion, elixir or syrup, troche, bolus, electuary, or paste. These formulations may be prepared by methods known in the art, for example, using conventional pan-coating, mixing, granulating, or lyophilizing processes.
[0217] Solid dosage forms for oral administration (such as capsules, tablets, pills, dragees, powders, granules, etc.) may be prepared, for example, by mixing the active ingredient with one or more pharmaceutically acceptable diluents or carriers, and, optionally, one or more fillers, extenders, binders, humectants, disintegrants, solution retarders, absorption accelerators, wetting agents, absorbents, lubricants, and / or coloring agents. Solid compositions of a similar type may also be used as fillers in soft and hard-filled gelatin capsules, using suitable excipients. Tablets may also be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using suitable binders, lubricants, inert diluents, preservatives, disintegrants, surfactants, or dispersing agents. Molded tablets may also be made by molding in a suitable machine. Tablets and other solid dosage forms, such as dragees, capsules, pills, and granules, can be optionally scored or prepared with coatings and shells, such as enteric coatings, and other coatings well known in the art of pharmaceutical formulation. They can also be formulated to provide delayed or controlled release of the active ingredient herein. They can be sterilized, for example, by filtration through a bacteria-retaining filter. These compositions can also optionally contain opacifying agents, and the compositions can be designed to release the active ingredient only or preferentially in a certain part of the gastrointestinal tract, optionally in a delayed manner. The active ingredient can also be in microencapsulated form.
[0218] The liquid dosage form for oral administration includes pharmaceutically acceptable emulsion, microemulsion, solution, suspension, syrup and elixir.Liquid dosage form can contain suitable inert diluent that is commonly used in the art.In addition to inert diluent, oral composition can also contain adjuvants such as wetting agent, emulsifying and suspending agent, sweetener, flavoring agent, coloring agent, fragrance and preservative.Suspension can also contain suspending agent.
[0219] The pharmaceutical composition of the present invention for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more active ingredients with one or more suitable non-irritating diluents or carriers that are solid at room temperature but liquid at body temperature, and are therefore expected to melt in the rectum or vaginal cavity and release the active compound.The pharmaceutical composition of the present invention suitable for vaginal administration also includes pessaries, tampons, creams, gels, pastes, foams, or spray formulations containing pharmaceutically acceptable diluents or carriers known in the art to be suitable.
[0220] Dosage forms for topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, liquids, patches, drops, and inhalants.The active agent / compound may be mixed with a suitable pharmaceutically acceptable diluent or carrier under sterile conditions.Ointments, pastes, creams, and gels may contain excipients.Powder and sprays may contain excipients and propellants.
[0221] Pharmaceutical compositions of the present invention suitable for parenteral administration may contain one or more drugs / compounds in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, or sterile injectable solutions or dispersions that can be reconstituted immediately before use, and may contain suitable antioxidants, buffers, solutes that render the formulation isotonic with the blood of the intended recipient, or sterile powders that may contain suspending or thickening agents. Proper fluidity can be maintained, for example, by the use of coating materials, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. These pharmaceutical compositions may also contain suitable adjuvants such as wetting agents, emulsifying agents, and dispersing agents. It may also be desirable to include an isotonic agent. In addition, prolonged absorption of injectable pharmaceutical forms may be achieved by including an agent that delays absorption.
[0222] In some cases, in order to prolong the effect of a drug (e.g., a pharmaceutical formulation), it is desirable to slow its absorption from subcutaneous or intramuscular injection. This can be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility.
[0223] Therefore, the rate of absorption of an active agent / drug depends on its dissolution rate, which in turn may depend on crystal size and crystalline form. Alternatively, delayed absorption of parenterally administered agents / drugs can be achieved by dissolving or suspending the active agent / drug in an oil vehicle. Injectable depot forms can also be made by forming microencapsule matrices of the active ingredient in biodegradable polymers. The release rate of the active ingredient can be controlled depending on the ratio of the active ingredient to the polymer and the characteristics of the specific polymer used. Injectable depot formulations can also be prepared by encapsulating the drug in liposomes or microemulsions that are compatible with body tissues. The injectable material can be sterilized, for example, by filtration through a bacteria-retaining filter.
[0224] The formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried condition requiring only the addition of a sterile liquid diluent or carrier, for example, water for injection, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets of the type described above.
[0225] The following examples are provided to further illustrate the methods of the present invention. These examples are illustrative only and are not intended to limit the scope of the invention in any way. [Example]
[0226] Example 1 The following example shows the results of a solid tumor Phase 1b clinical trial of BVD-523. The waterfall plot illustrated in Figure 2 illustrates human clinical trial patient information showing each individual patient's response to treatment with BVD-523, as measured by % change in tumor burden. Patients were generally given 600 mg twice daily (BID), with some patients receiving tapered doses of 300 mg to 400 mg BID if side effects could not be managed with other symptomatic medications.
[0227] As shown in Figure 2, tumor response to BVD-523 was evaluated according to the Response Evaluation Criteria in Solid Tumors (RESE). Radiologic assessment was performed in 28 evaluable patients using RECIST v1.1 (Reporting Incident to Solid Tumors). One patient was unable to obtain both scans of the target lesion and was therefore not evaluated. The horizontal axis across the plots serves as the baseline measurement for each patient. The vertical axis is the maximum percentage change from baseline in radiologic measurements by RECIST v1.1, i.e., the magnitude of the percentage growth or decrease in tumor burden. Radiologic measurements included computed tomography (CT) scans and, in rare cases, magnetic resonance imaging (MRI).
[0228] The tumor burden data represented by Figure 2 are ordered from worst value (i.e., greatest progression of tumor burden) on the left side of the plot to best value (i.e., greatest decrease in tumor burden) on the right side of the plot. RECIST v1.1 response criteria for measured target lesions have been previously described (Eisenhauer, EA et al., New response evaluation criteria in solid tumors:Revised RECIST guideline (version 1.1), European J. of Cancer 45, 228-247 (2009), the entire contents of which are incorporated herein by reference. Response criteria are as follows:
[0229] Complete response (CR) - disappearance of all target lesions;
[0230] Partial response (PR) - at least a 30% reduction in the sum of the diameters of the target lesions, taking the sum of the baseline diameters as the criterion; as shown in Figure 2, the 30% reduction threshold for partial response is indicated by a horizontal line;
[0231] Progressive disease (PD) - an increase of at least 20% in the sum of the diameters of the target lesions, taking as the criterion the smallest sum during the study (including the baseline sum if it is the smallest during the study). In addition to a relative increase of 20%, an absolute increase in the sum of at least 5 mm must also be demonstrated (note: the appearance of one or more new lesions is also considered progression);
[0232] Stable Disease (SD) - Taking the sum of the smallest diameters under study as the criterion, there is neither a sufficient reduction to qualify for PR nor a sufficient increase to qualify for PD.
[0233] Figure 2 also shows the type of cancer or organ where the tumor burden was measured for each patient to identify the type of atypical BRAF mutation in that patient's tumor sample. Of the 28 patients shown, 13 tumors contained BRAF D594 mutations (7 D594G and 6 D594N); 1 patient tumor contained a BRAF F247L mutation; 1 patient tumor contained a BRAF gene fused with the nuclear factor IC (NFIC) gene (i.e., a BRAF-NFIC fusion mutation); 1 patient tumor contained a BRAF G466V mutation; 5 patient tumors contained BRAF G469 mutations (1 G469V and 4 G469A); 3 patient tumors contained a BRAF K601E mutation; 1 patient tumor contained a BRAF L485W mutation; 3 patient tumors contained a BRAF L597 mutation (1 undefined and 2 L597Q), and 2 patient tumors contained a T599 duplication. BRAF mutation types are color-coded by cancer type for each patient (see Figure 2).
[0234] Five patients achieved a reduction in the sum of target lesions between 35% and 100% from baseline. These patients had gallbladder tumors containing the L485W mutation; head / neck squamous cell tumors containing the G469A mutation; non-small cell lung cancers containing the BRAF L597Q mutation or the BRAF T599 duplication; and small intestinal tumors containing the BRAF G469A mutation. Stable disease was demonstrated in 19 patients. Three patients showed progressive disease at first evaluation (see Figure 2). Thus, treatment with BVD-523 surprisingly resulted in partial responses or stable disease in 24 of 28 patients with atypical (i.e., non-V600E / K) BRAF mutations.
[0235] Figure 3 shows treatment duration in a swimmer plot categorized by group. Group 1 members are any patient with any BRAF mutation in any tumor type other than colorectal cancer (CRC) and non-small cell lung cancer (NSCLC) who has not previously been treated with a MAPK pathway inhibitor. Group 2 members are patients with any BRAF mutation in CRC who has not previously been treated with a MAPK pathway inhibitor. Group 3 members are patients with tumors harboring a BRAF V600E / K mutation that are refractory to MAPK inhibitor treatment. Group 6 members are patients with any BRAF mutation present in NSCLC. As shown in Figure 3, all 28 patients are included, represented by one horizontal bar per subject. The treatment duration for each subject in each group is indicated from the top (longest treatment duration) to the bottom (shortest treatment duration) of the group. The horizontal axis represents the study duration in days for the patient. Figure 3 also shows the type of response achieved per patient according to RECIST v1.1 (diamond = partial response; circle = stable disease; vertical bar = progressive disease; triangle = not assessed).
[0236] Figure 4 shows treatment duration in a waterfall plot categorized by BRAF mutation. All 28 patients measured for RECIST v1.1 response criteria are included, as well as additional patients not evaluated by RECIST v1.1 (diamonds = partial response; circles = stable disease; vertical bars = progressive disease; triangles = not evaluated). For tumors harboring the same BRAF mutation, the mean duration of BVD-523 treatment before discontinuation was: D594, 73.6 days; G469, 208.14 days; K601E, 50.25 days; L597, 73.3 days; and T599Dup, 63.5 days. For one patient representative of a specific BRAF mutation, treatment duration was: L485W, 304 days; F247L, 84 days; G466V, 77 days; BRAF fusion, 65 days; BRAF-AGAP3 rearrangement, 43 days; BRAF exon 15 splice variant, 15 days. Genomic screening of cancer patients for BRAF mutations and thorough in vitro characterization of these mutations (as driving mutations) after treating patients demonstrates that BVD-523 is useful for identifying and identifying effective treatment options for patients carrying BRAF mutations. Patient clinical populations and efficacy are primarily defined not by tumor type, but rather by the mutation status of enzymes such as BRAF upstream of ERK1 / 2 kinase activation.
[0237] In summary, the examples provided show data from a solid tumor Phase 1b trial of BVD-523, a novel ERK inhibitor, as a treatment for patients with cancers harboring atypical BRAF mutations. Continuous twice-daily treatment with BVD-523 produced antitumor effects in several patients, and was not limited to any one particular cancer type or atypical BRAF mutation. literature [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] All documents cited in this application are hereby incorporated by reference as if set forth in their entirety herein. While illustrative embodiments of the present invention have been described herein, it should be understood that the invention is not limited to what has been described and that various other changes or modifications may be made by those skilled in the art without departing from the scope or spirit of the invention.
Claims
1. A drug comprising BVD-523 or a pharmaceutically acceptable salt thereof for use in delaying cancer progression in a subject harboring a non-V600E / K BRAF mutation, wherein the non-V600E / K BRAF mutation is selected from the group consisting of F247L, G466V, D594G, D594N, K601E, G469A, G469V, L597Q, L485W, T599 duplication, and combinations thereof.
2. A pharmaceutical composition for use in delaying cancer progression in a subject harboring a non-V600E / K BRAF mutation, said composition comprising a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof, wherein said non-V600E / K BRAF mutation is selected from the group consisting of F247L, G466V, D594G, D594N, K601E, G469A, G469V, L597Q, L485W, T599 duplication, and combinations thereof.
3. A drug for use as described in claim 1, or a pharmaceutical composition for use as described in claim 2, wherein the subject is a mammal selected from the group consisting of humans, primates, livestock, and domestic animals, preferably a human.
4. A drug for use as defined in any one of claims 1 and 3, or a pharmaceutical composition for use as defined in any one of claims 2 and 3, wherein the cancer is a solid tumor cancer selected from the group consisting of melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer, preferably the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma.
5. At least one additional therapeutic agent is administered to the subject, or the pharmaceutical composition further comprises at least one additional therapeutic agent; (i) the therapeutic agent is selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof; The MEK inhibitor is selected from the group consisting of anthrax toxin, antroquinonol (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas Pharma Inc.), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai Co., Ltd.), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), the lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD098059 (2-(2'-amino-3'-methoxyphenyl)-oxanaphthalen-4-one) (Pfizer), PD184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co., Ltd.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda Pharmaceutical Co., Ltd.), trametinib (Japan Tobacco Inc.), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene (Sigma), WX-554 (Wilex), YopJ polypeptide, pharmaceutically acceptable salts thereof, and combinations thereof; The RAF inhibitor is AAL881 (Novartis), AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006, Sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN2480) (Sunesis & Takeda), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) ( Liu et al., 2007 ), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma-Aldrich), and ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals,Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda Pharmaceutical Company Limited), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo Co., Ltd.), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof, preferably the RAF inhibitor is selected from the group consisting of LXH254 (Novartis), PLX3603 (Daiichi Sankyo Co., Ltd.), PLX8394 (Daiichi Sankyo Co., Ltd.), REDX0535 (RedX Pharma Co., Ltd.), PLC), pharmaceutically acceptable salts thereof, and combinations thereof, or the RAF inhibitor is selected from the group consisting of erlotinib (Tarceva), gefitinib (Iressa), imatinib mesylate (Gleevec), lapatinib (Tyverb), sunitinib malate (Sutent), pharmaceutically acceptable salts thereof, and combinations thereof, the HDAC inhibitor is selected from the group consisting of abexinostat (PCI-24781), gibinostat, entinostat, vorinostat, CI-994, CUDC-101, entinostat, BML-210, M344, NVP-LAQ824, panobinostat, pracinostat (SB939), mocetinostat, resminostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof, preferably the HDAC inhibitor is selected from the group consisting of vorinostat, panobinostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof; or (ii) the therapeutic agent is selected from the group consisting of an antibody, an antibody fragment, an antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulator, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof; The antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab, atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, prozac, mab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof, preferably wherein said antibody, fragment thereof, or conjugate thereof is selected from the group consisting of rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyl), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab, atezolizumab (Tecentriq), durvalumab (Imfinzi), ofatumumab, obinutuzumab (Gazyva), panitumumab, and combinations thereof; The cytotoxic agent may be cyclophosphamide, mechlorethamine, uramustine, melphalan, chlorambucil, ifosfamide, carmustine, lomustine, streptozocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, triplatin tetranitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine ... selected from the group consisting of carbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valrubicin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, and combinations thereof; the toxin is diphtheria toxin or a portion thereof, the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof; the immunomodulator is selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate-guanosine (CpG), immune checkpoint inhibitors, and combinations thereof; the radiosensitizer is selected from the group consisting of misonidazole, metronidazole, tirapazamine, trans sodium crocetinate, and combinations thereof; The hormones include prostaglandins, leukotrienes, prostacyclin, thromboxane, amylin, anti-Mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, ghrelin, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone, selected from the group consisting of melanocyte-stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcidiol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof; the anti-angiogenic agent is selected from the group consisting of 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-alpha, IL-12, itraconazole, linomide, platelet factor-4, prolactin, SU5416, suramin, tasquinimod, tecogalan, tetrathiomolybdate, thalidomide, thrombospondin, TNP-470, ziv-aflibercept, pharmaceutically acceptable salts thereof, and combinations thereof; or (iii) The therapeutic agent is A-674563 (CAS No. 552325-73-2), AGL 2263, AMG-319 (Amgen, Thousands Oaks, CA), AS-041164 (5-benzo[1,3]dioxol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS No. 857531-00-1), BML-257 (CAS No. 32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), compound with CAS number 612847-09-3, compound with CAS number 681281-88-9, compound with CAS number 75747-14-7, compound with CAS number 925681-41-0, compound with CAS number 98510-80-6, CCT128930 (CAS number 885499-61-6), CH5132799 (CAS number 1007207-67-1), CHR-4432 (Chroma Therapeutics,Ltd. , Abingdon, UK), FPA 124 (CAS number 902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS number 937174-76-0), H-89 (CAS number 127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.), KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS No. 108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS No. 1032350-13-2), ML-9 (CAS No. 105637-50-1), naltrindole hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS No. 1191951-57-1), PI3-delta / gamma inhibitor, pictilisib (Roche Holdings Inc.), PIK-90 (CAS No. 677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore a PI3K / Akt pathway inhibitor selected from the group consisting of: tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof, and preferably, the PI3K / Akt pathway inhibitor is BVD-723; A medicament for use according to any one of claims 3 and 4, or a pharmaceutical composition for use according to any one of claims 2 to 4.
6. A pharmaceutical composition for use according to any one of claims 2 to 5, wherein the composition is administered to the subject orally or by injection, or the composition is administered to the subject as a tablet. (i) the pharmaceutical composition is in a unit dosage form containing both BVD-523 or a pharmaceutically acceptable salt thereof and the additional therapeutic agent; or (ii) BVD-523 or a pharmaceutically acceptable salt thereof is in a first unit dosage form, and the additional therapeutic agent is in a second unit dosage form separate from the first unit dosage form; A pharmaceutical composition for use according to claim 5 or 6. (i) BVD-523 or a pharmaceutically acceptable salt thereof and the additional therapeutic agent are administered simultaneously to the subject; or (ii) BVD-523 or a pharmaceutically acceptable salt thereof and the additional therapeutic agent are administered sequentially to the subject; or (iii) BVD-523 or a pharmaceutically acceptable salt thereof is administered to the subject before or after administration of the additional therapeutic agent; A pharmaceutical composition for use according to any one of claims 5 to 7.
9. A kit for use in delaying cancer progression in a subject carrying a non-V600E / K BRAF mutation, the kit comprising a pharmaceutical composition according to any one of claims 2 to 8 packaged together with instructions for use thereof.
Citation Information
Patent Citations
c.novyi for the treatment of solid tumors in humans
JP2016515586A
Cancer treatment with a combination of type 2 mek inhibitors and erk inhibitors
JP2017500320A
Cancer treatment using a combination of erk and raf inhibitors
JP2017502017A
Compositions and methods for treating cancers with atypical BRAF mutations
JP7405408B2