Crispr-CAS-related methods, compositions and components for cancer immunotherapy
By modifying T cell genes using CRISPR/Cas systems, the efficacy of genetically engineered T cells is enhanced for cancer therapy, addressing limitations in T cell proliferation, survival, and function to improve anti-tumor responses.
Patent Information
- Application Number
- JP2025078666
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2015-03-25
- Filing Date
- 2025-05-09
- Publication Date
- 2025-09-02
AI Technical Summary
Existing adoptive transfer of genetically engineered T cells for cancer therapy, particularly for solid tumors, has limited efficacy due to factors such as T cell proliferation, survival, and functional inhibition by the tumor microenvironment.
Modifying T cell-expressed genes like FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC using CRISPR/Cas systems to enhance T cell proliferation, survival, and function by targeted knockout or knockdown, specifically through NHEJ-mediated modifications or using enzymatically inactive Cas9 (eiCas9) for gene expression modulation.
Enhances the anti-tumor efficacy of genetically engineered T cells by improving T cell activation, proliferation, and function, leading to increased cytotoxic responses against cancer cells.
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 61 / 981,636, filed April 18, 2014, and U.S. Provisional Patent Application No. 62 / 138,246, filed March 25, 2015, the disclosures of which are incorporated herein by reference.
[0002] Sequence Listing This specification references a Sequence Listing (submitted electronically on April 17, 2015 as a .txt file named "Sequence Listing 2011271-0005 EM034PCT.txt"). The .txt file was created on April 17, 2015 and is 11,400,000 bytes in size. The entire contents of the Sequence Listing are incorporated herein by reference.
[0003] The present invention relates to CRISPR / CAS-related methods, compositions and components for editing target nucleic acid sequences or modulating the expression of target nucleic acid sequences, and their uses in the context of cancer immunotherapy comprising the adoptive transfer of engineered T cells or T cell precursors. [Background technology]
[0004] Adoptive transfer of genetically engineered T cells has entered clinical testing as a therapeutic approach. Typically, the approach involves 1) obtaining white blood cells from a subject by apheresis; 2) selecting / enriching T cells; 3) activating T cells by cytokine treatment; 4) introducing a cloned T cell receptor (TCR) gene or a chimeric antigen receptor (CAR) gene by retroviral transduction, lentiviral transduction, or electroporation; 5) expanding T cells by cytokine treatment; 6) conditioning the subject, usually by lymphodepletion; and 7) infusing the genetically engineered T cells into the subject.
[0005] Sources of cloned TCR genes (TRAC and TRBC) include rare T cell populations isolated from individuals with specific malignancies and T cell clones isolated from T cell receptor-humanized mice immunized with specific tumor antigens or tumor cells. Following adoptive transfer, TCR-engineered T cells recognize their cognate antigenic peptides presented by major histocompatibility complex (MHC) proteins on the surface of tumor cells. Antigen binding stimulates signal transduction pathways, leading to T cell activation and proliferation. Stimulated T cells then mount a cytotoxic antitumor cell response, typically involving a secretory complex comprising granzyme B, perforin, and granulysin, to induce tumor cell apoptosis.
[0006] Chimeric antigen receptor (CAR) genes typically encode artificial T cell receptors, comprising an extracellular tumor antigen-binding domain derived from the single-chain antibody variable fragment (scFv) domain of a monoclonal antibody, fused to a cytoplasmic effector domain via a hinge and transmembrane domain. The effector domain is typically derived from the CD3-ζ chain of the T cell co-receptor complex, and may also contain domains derived from the CD28 and / or CD137 receptor proteins. The CAR extracellular domain binds to tumor antigens in an MHC-independent manner, as described for TCR-engineered T cells, resulting in the activation and proliferation of T cells, leading to cytotoxic anti-tumor effects.
[0007] To date, at least 15 different tumor antigens have been targeted in clinical trials of engineered T cells. Some trials have reported antitumor activity. The greatest success has been in hematologic malignancies. For example, adoptive transfer of CAR-T cells engineered to target the B-cell antigen CD19 has resulted in multiple partial and complete responses in subjects with lymphoma, acute lymphoblastic leukemia, acute lymphocytic leukemia, and B-cell acute lymphocytic leukemia. In contrast, trials targeting other tumor types, particularly solid tumors including renal cell carcinoma, neuroblastoma, colorectal cancer, breast cancer, ovarian cancer, melanoma, sarcoma, and prostate cancer, have been less successful. In many of these trials, very few patients experienced objective responses. Summary of the Invention [Problem to be solved by the invention]
[0008] Thus, there is a need to improve the anti-tumor efficacy of adoptively transferred genetically engineered T cells. [Means for solving the problem]
[0009] The methods and compositions discussed herein provide cancer treatment using an immunotherapy approach comprising administering genetically engineered T cells or T cell precursors to a subject. One approach to treating a subject with cancer is to isolate T cells from the subject, genetically modify them to target antigens expressed by cancer cells, and then reintroduce them into the subject, a method known as adoptive cell transfer. Methods for genetically modifying T cells include introducing T cell receptor (TCR) or chimeric antigen receptor (CAR) genes, which encode transmembrane TCR or CAR proteins, respectively, that specifically recognize specific cancer antigens. Without wishing to be bound by theory, it is believed that the binding of the TCR or CAR protein to the antigen-binding domain of a tumor-expressed antigen initiates a signaling cascade, leading to the activation and proliferation of T cells and ultimately to the destruction of cancer cells through a cytotoxic immune response (Kershaw et al., 2013 NatRevCancer 13, 525-541).
[0010] Adoptive cell transfer using genetically modified T cells has entered clinical trials for the treatment of solid and hematologic malignancies. Results to date have been mixed. In hematologic malignancies (especially lymphoma, CLL, and ALL), the majority of patients in several phase 1 and 2 trials have achieved at least partial remission, and some have achieved complete remission (Kochenderfer, J Net et al., 2012 Blood 119, 2709-2720). However, fewer responses have been observed in most tumor types (including melanoma, renal cell carcinoma, and colorectal cancer) (Johnson, LA et al., 2009 Blood 114, 535-546; Lamers, CH et al., 2013 Mol. Ther. 21, 904-912; Warren, RS et al., 1998 Cancer Gene Ther. 5, S1-S2). Therefore, there is a need to improve the efficacy of adoptive transfer of modified T cells in cancer therapy.
[0011] Factors that limit the effectiveness of genetically modified T cells as cancer therapeutics include: (1) T cell proliferation, e.g., limited proliferation of T cells following adoptive transfer; (2) T cell survival, e.g., induction of T cell apoptosis by factors in the tumor environment; and (3) T cell function, e.g., inhibition of cytotoxic T cell function by inhibitory factors secreted by host immune cells and cancer cells. The methods and compositions described herein address these limitations by modifying the expression of T cell-expressed genes that affect T cell proliferation, survival, and / or function.
[0012] In one embodiment, the methods and compositions discussed herein may be used to affect T cell proliferation (e.g., by inactivating genes that inhibit T cell proliferation). In one embodiment, the methods and compositions discussed herein may be used to affect T cell survival (e.g., by inactivating gene-mediated T cell apoptosis). In one embodiment, the methods and compositions discussed herein may be used to affect T cell function (e.g., by inactivating genes encoding immunosuppressive and inhibitory (e.g., anergy-inducing) signaling factors). It is contemplated herein that the methods and compositions described above may be used individually or in combination to affect one or more of the factors that limit the effectiveness of genetically modified cells as cancer therapeutics, such as, for example, T cell proliferation, T cell survival, T cell function, or any combination thereof.
[0013] The methods and compositions discussed herein may be used to affect T cell proliferation, survival, and / or function by modifying one or more T cell-expressed genes, such as, for example, one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, the methods and compositions described herein may be used to affect T cell proliferation by modifying one or more T cell-expressed genes, such as, for example, the CBLB and / or PTPN6 genes. In one embodiment, the methods and compositions described herein may be used to affect T cell survival by modifying one or more T cell-expressed genes, such as, for example, the FAS and / or BID genes. In one embodiment, the methods and compositions described herein may be used to affect T cell function by modifying one or more T cell-expressed genes or genes, such as, for example, the CTLA4 and / or PDCD1 and / or TRAC and / or TRBC genes.
[0014] In one approach, one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes, are independently targeted for targeted knockout or knockdown to, for example, affect T cell proliferation, survival, and / or function. In one embodiment, the approach comprises knocking out or knocking down one T cell-expressed gene (e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene). In another embodiment, the approach comprises independently knocking out or knocking down two T cell-expressed genes, such as, for example, two of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes. In another embodiment, the approach comprises independently knocking out or knocking down three genes expressed by T cells, e.g., three of the following genes: FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC. In another embodiment, the approach comprises independently knocking out or knocking down four genes expressed by T cells, e.g., four of the following genes: FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC. In another embodiment, the approach comprises independently knocking out or knocking down five genes expressed by T cells, e.g., five of the following genes: FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC. In another embodiment, the approach comprises independently knocking out or knocking down six genes expressed by T cells, e.g., six of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes. In another embodiment, the approach comprises independently knocking out or knocking down seven genes expressed by T cells, e.g., seven of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.In another embodiment, the approach comprises independently knocking out or knocking down eight T cell expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0015] In addition to the genes described above, several other T cell-expressed genes may be targeted to affect the efficacy of genetically engineered T cells. These genes include, but are not limited to, TGFBRI, TGFBRII, and TGFBRIII (Kershaw et al. 2013 NatRevCancer 13,525-541). It is contemplated herein that one or more of the TGFBRI, TGFBRII, or TGFBRIII genes may be modified individually or in combination using the methods disclosed herein. It is further contemplated herein that one or more of the TGFBRI, TGFBRII, or TGFBRIII genes may be modified individually or in combination with any one or more of the eight genes described above (i.e., FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes).
[0016] In one aspect, the methods and compositions discussed herein may be used to modify one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes to affect T cell proliferation, survival, and / or function by targeting the gene, e.g., non-coding or coding regions, such as promoter regions, or transcribed sequences, e.g., intron or exon sequences. In one embodiment, the coding sequence of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC gene, e.g., a coding region, such as an early coding region, is targeted for expression modification and knockout.
[0017] In another embodiment, the methods and compositions discussed herein may be used to modify the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC genes by targeting their coding sequences to affect T cell proliferation, survival and / or function. In one embodiment, a gene, such as the coding sequence of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC gene, is targeted to induce a modification comprising, for example, a deletion or mutation of one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC gene, thereby knocking out one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes, respectively, e.g., eliminating expression of one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes, e.g., knocking out one or two alleles of one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, the method provides a modification comprising an insertion or deletion. As described herein, the targeted knockout approach is mediated by non-homologous end joining (NHEJ) using a CRISPR / Cas system comprising enzymatically active Cas9 (eaCas9).
[0018] In one embodiment, the initial coding sequence of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC gene is targeted to knock out one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes, respectively. In one embodiment, targeting affects one or two alleles of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC gene. In one embodiment, the targeted knockout approach reduces or eliminates expression of functional FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC gene products. In one embodiment, the method provides modifications comprising insertions or deletions.
[0019] In another embodiment, the methods and compositions discussed herein may be used to modify the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC genes to affect T cell function, for example, by targeting non-coding sequences of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC genes, such as promoters, enhancers, introns, 3'UTR, and / or polyadenylation signals. In one embodiment, a gene, such as, for example, a non-coding sequence of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC gene, is targeted to induce a modification comprising, for example, a deletion or mutation of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC gene, thereby knocking out the gene, e.g., eliminating expression of the gene, e.g., knocking out one or two alleles of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC gene. In one embodiment, the method provides a modification comprising an insertion or deletion.
[0020] "T cell targeted FAS knockout locus," as used herein, refers to a position in the FAS gene that, when modified by NHEJ-mediated modification, results in a reduction or elimination of functional FAS gene product expression (e.g., knockout of functional FAS gene product expression). In one embodiment, the position is in a FAS gene coding region, e.g., an early coding region.
[0021] "T cell targeted BID knockout locus," as used herein, refers to a position in the BID gene that, when modified by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional BID gene product (e.g., knockout of expression of a functional BID gene product). In one embodiment, the position is in a BID gene coding region, such as, for example, the early coding region.
[0022] A "T cell targeted CTLA4 knockout locus," as used herein, refers to a position in the CTLA4 gene that, when modified by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional CTLA4 gene product (e.g., knockout of expression of a functional CTLA4 gene product). In one embodiment, the position is in a CTLA gene coding region, such as, for example, an early coding region.
[0023] A "T cell targeted PDCD1 knockout locus," as used herein, refers to a position in the PDCD1 gene that, when modified by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional PDCD1 gene product (e.g., knockout of expression of a functional PDCD1 gene product). In one embodiment, the position is in a PDCD1 gene coding region, e.g., an early coding region.
[0024] A "T cell targeted CBLB knockout locus," as used herein, refers to a position in the CBLB gene that, when modified by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional CBLB gene product (e.g., knockout of expression of a functional CBLB gene product). In one embodiment, the position is in a coding region of the CBLB gene, such as, for example, the early coding region.
[0025] A "T cell targeted PTPN6 knockout locus," as used herein, refers to a position in the PTPN6 gene that, when modified by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional PTPN6 gene product (e.g., knockout of expression of a functional PTPN6 gene product). In one embodiment, the position is in a coding region of the PTPN6 gene, such as, for example, the early coding region.
[0026] A "T cell targeted TRAC knockout locus," as used herein, refers to a position in the TRAC gene that, when modified by NHEJ-mediated modification, results in a reduction or elimination of expression of a functional TRAC gene product (e.g., knockout of expression of a functional TRAC gene product). In one embodiment, the position is in a coding region of the TRAC gene, such as, for example, the early coding region.
[0027] As used herein, a "T cell-targeted TRBC knockout locus" refers to a position in the TRBC gene that, when modified by NHEJ-mediated modification, results in a reduction or elimination of functional TRBC gene product expression (e.g., knockout of functional TRBC gene product expression). In one embodiment, the position is in a TRBC gene coding region, such as, for example, the early coding region.
[0028] In another aspect, the methods and compositions discussed herein may be used to modify the expression of one or more T cell expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 genes, by targeting the promoter region of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 genes to affect T cell function. In one embodiment, the promoter region of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 genes is targeted to knock down expression of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 genes. The targeted knockdown approach reduces or eliminates expression of functional FAS, BID, CTLA4, PDCD1, CBLB, and / or PTPN6 gene products. As described herein, targeted knockdown is mediated by targeting enzymatically inactive Cas9 (eiCas9) or eiCas9 fused to a transcriptional repressor domain or chromatin-modifying protein to alter transcription of the FAS, BID, CTLA4, PDCD1, CBLB, and / or PTPN6 genes, e.g., to prevent, reduce, or decrease transcription.
[0029] "T cell targeted FAS knockdown location," as used herein, refers to a location in the FAS gene that, when targeted by, for example, eiCas9 or an eiCas9 fusion protein described herein, results in reduced or eliminated expression of a functional FAS gene product. In one embodiment, transcription is reduced or eliminated. In one embodiment, the location is in the FAS promoter sequence. In one embodiment, a location in the promoter sequence of the FAS gene is targeted by enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein, as described herein.
[0030] "T cell targeted BID knockdown location," as used herein, refers to a location in the BID gene that, when targeted by, for example, eiCas9 or an eiCas9 fusion protein described herein, results in the reduction or elimination of functional BID gene product expression. In one embodiment, transcription is reduced or eliminated. In one embodiment, the location is in the BID promoter sequence. In one embodiment, a location in the promoter sequence of the BID gene is targeted by enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein, as described herein.
[0031] "T cell targeted CTLA4 knockdown location," as used herein, refers to a location in the CTLA4 gene that, when targeted by, for example, an eiCas9 or eiCas9 fusion protein described herein, results in a reduction or elimination of functional CTLA4 gene product expression. In one embodiment, transcription is reduced or eliminated. In one embodiment, the location is in the CTLA4 promoter sequence. In one embodiment, a location in the promoter sequence of the CTLA4 gene is targeted by an enzymatically inactive Cas9 (eiCas9) or eiCas9 fusion protein, as described herein.
[0032] "T cell targeted PDCD1 knockdown location," as used herein, refers to a location in the PDCD1 gene that, when targeted by, for example, eiCas9 or an eiCas9 fusion protein described herein, results in reduced or eliminated expression of a functional PDCD1 gene product. In one embodiment, transcription is reduced or eliminated. In one embodiment, the location is in the PDCD1 promoter sequence. In one embodiment, a location in the promoter sequence of the PDCD1 gene is targeted by enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein, as described herein.
[0033] "T cell targeted CBLB knockdown locus," as used herein, refers to a location in the CBLB gene that, when targeted by, for example, an eiCas9 or eiCas9 fusion protein described herein, results in reduced or eliminated expression of a functional CBLB gene product. In one embodiment, transcription is reduced or eliminated. In one embodiment, the location is in the CBLB promoter sequence. In one embodiment, the location in the promoter sequence of the CBLB gene is targeted by an enzymatically inactive Cas9 (eiCas9) or eiCas9 fusion protein, as described herein.
[0034] "T cell targeted PTPN6 knockdown location," as used herein, refers to a location in the PTPN6 gene that, when targeted by, for example, eiCas9 or an eiCas9 fusion protein described herein, results in reduced or eliminated expression of a functional PTPN6 gene product. In one embodiment, transcription is reduced or eliminated. In one embodiment, the location is in the PTPN6 promoter sequence. In one embodiment, the location in the promoter sequence of the PTPN6 gene is targeted by enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein, as described herein.
[0035] "T cell targeted FAS locus," as used herein, refers to either a T cell targeted FAS knockout locus and / or a T cell targeted FAS knockdown locus, as described herein.
[0036] "T cell targeted BID locus," as used herein, refers to either a T cell targeted BID knockout locus and / or a T cell targeted BID knockdown locus, as described herein.
[0037] "T cell targeted CTLA4 locus," as used herein, refers to either a T cell targeted CTLA4 knockout locus and / or a T cell targeted CTLA4 knockdown locus, as described herein.
[0038] "T cell targeted PDCD1 locus", as used herein, refers to either a T cell targeted PDCD1 knockout locus and / or a T cell targeted PDCD1 knockdown locus, as described herein.
[0039] "T cell targeted CBLB locus," as used herein, refers to either a T cell targeted CBLB knockout locus and / or a T cell targeted CBLB knockdown locus, as described herein.
[0040] "T cell targeted PTPN6 locus," as used herein, refers to either a T cell targeted PTPN6 knockout locus and / or a T cell targeted PTPN6 knockdown locus, as described herein.
[0041] "T cell TRAC target locus," as used herein, refers to any of the T cell targeted TRAC knockout loci, as described herein.
[0042] "T cell-targeted TRBC locus," as used herein, refers to any of the T cell-targeted TRBC knockout loci, as described herein.
[0043] "T cell targeted knockout locus," as used herein, refers to any of a T cell targeted FAS knockout locus, a T cell targeted BID knockout locus, a T cell targeted CTLA4 knockout locus, a T cell targeted PDCD1 knockout locus, a T cell targeted CBLB knockout locus, a T cell targeted PTPN6 knockout locus, a T cell targeted TRAC knockout locus, or a T cell targeted TRBC knockout locus, as described herein.
[0044] A "T cell targeted knockdown locus," as used herein, refers to any of a T cell targeted FAS knockdown locus, a T cell targeted BID knockdown locus, a T cell targeted CTLA4 knockdown locus, a T cell targeted PDCD1 knockdown locus, a T cell targeted CBLB knockdown locus, or a T cell targeted PTPN6 knockdown locus, as described herein. A "T cell targeted locus," as used herein, refers to any of a T cell targeted knockout locus or a T cell targeted knockdown locus, as described herein.
[0045] In one aspect, disclosed herein are gRNA molecules, e.g., isolated or non-naturally occurring gRNA molecules, comprising a targeting domain complementary to a targeting domain from a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene.
[0046] In one embodiment, the targeting domain of the gRNA molecule is configured to provide a cleavage event, e.g., a double-stranded or single-stranded break, sufficiently close to the T cell target location in, e.g., a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene to allow modification, e.g., NHEJ-associated modification, of the T cell target location in, e.g., a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene. In one embodiment, the targeting domain is configured such that the cleavage event, e.g., a double-stranded or single-stranded break, is located within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the T cell target location. For example, the break, such as a double-stranded or single-stranded break, can be located upstream or downstream of the T cell target locus in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene.
[0047] In one embodiment, a second gRNA molecule comprising a second targeting domain is configured to provide a cleavage event, e.g., a double-stranded or single-stranded break, sufficiently close to the T cell target location in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene to allow modification, e.g., NHEJ-associated modification, of the T cell target location in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, alone or in combination with the cleavage placed by the first gRNA molecule. In one embodiment, the first and second gRNA molecule targeting domains are configured such that a cleavage event, e.g., a double-stranded or single-stranded break, is positioned independently of each other within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target position of the gRNA molecule. In one embodiment, the cleavage, e.g., a double-stranded or single-stranded break, is positioned on either side of the nucleotide of the T cell target position of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene. In one embodiment, the break, e.g., a double-stranded or single-stranded break, is located on one side, e.g., upstream or downstream, of a nucleotide of a T cell target position in, e.g., a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene.
[0048] In one embodiment, the single-strand break is accompanied by an additional single-strand break placed by a second gRNA molecule, as discussed below. For example, the targeting domain is configured so that a cleavage event, e.g., two single-strand breaks, is located within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the T cell target location. In one embodiment, the first and second gRNA molecules are configured so that, upon induction of Cas9 nickase, the single-strand break is accompanied by an additional single-strand break placed by the second gRNA sufficiently close to each other to result in a T cell target location modification in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene. In one embodiment, the first and second gRNA molecules are configured such that the single-stranded break made by the second gRNA is within 10, 20, 30, 40, or 50 nucleotides of the break made by the first gRNA molecule, e.g., when Cas9 is a nickase. In one embodiment, the two gRNA molecules are designed to place the breaks at the same position on different strands, or within a few nucleotides of each other, e.g., essentially mimicking a double-stranded break.
[0049] In one embodiment, the double-stranded break can be accompanied by an additional double-stranded break placed by a second gRNA molecule, as discussed below. For example, the targeting domain of a first gRNA molecule is configured such that the double-stranded break is located upstream of a T cell target location in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, for example, within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target location. The targeting domain of the second gRNA molecule is configured so that a double-stranded break is located downstream of the T cell target location in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, for example, within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target location.
[0050] In one embodiment, the double-stranded break can be accompanied by two additional single-stranded breaks placed by the second and third gRNA molecules. For example, the targeting domain of the first gRNA molecule is configured such that the double-stranded break is located upstream of a T cell target position in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, for example, within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target position; and the targeting domain of the third gRNA molecule is configured so that two single-stranded breaks are located downstream of the T cell target location in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, for example, within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target location. In one embodiment, the targeting domains of the first, second, and third gRNA molecules are configured so that the cleavage events, e.g., double- or single-stranded breaks, are located independently from each gRNA molecule.
[0051] In one embodiment, the first and second single-stranded breaks can be accompanied by two additional single-stranded breaks positioned by a third gRNA molecule and a fourth gRNA molecule. For example, the targeting domains of the first and second gRNA molecules are configured such that the two single-stranded breaks are located upstream of a T cell target position in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, for example, within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target position. The targeting domains of the third and fourth gRNA molecules are configured so that two single-stranded breaks are located downstream of the T cell target location in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, for example, within 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 nucleotides of the target location.
[0052] It is contemplated herein that multiple gRNAs target the same T cell target location if they are used to generate (1) two nearby single-strand breaks, (2) e.g., two double-strand breaks flanking the location (e.g., removing one DNA, e.g., creating a deletion mutation) or two or more indels in a coding region, e.g., within the initial coding region, in a gene, (3) one double-strand break and two paired nicks flanking the location (e.g., removing one DNA, e.g., inserting a deletion), or (4) four single-strand breaks, two on each side of the location. It is further contemplated herein that multiple gRNAs may be used to target two or more locations in the same gene.
[0053] It is contemplated that when two or more gRNAs are used to place two or more cleavage events, such as double-stranded or single-stranded breaks, in a target nucleic acid, the two or more cleavage events may be generated by the same or different Cas9 proteins. For example, when two gRNAs are used to place a double-stranded break in a target nucleic acid, a single Cas9 nuclease may be used to generate both double-stranded breaks. When two or more gRNAs are used to place two or more single-stranded breaks (also referred to as nicks) in a target nucleic acid, a single Cas9 nickase may be used to generate two or more nicks. When two or more gRNAs are used to place at least one double-stranded break and at least one single-stranded break in a target nucleic acid, two Cas9 proteins, such as one Cas9 nuclease and one Cas9 nickase, may be used. When two or more Cas9 proteins are used, it is contemplated that the two or more Cas9 proteins may be delivered sequentially to control the specificity of the double-stranded break relative to the single-stranded break at the desired position in the target nucleic acid. In another embodiment, when two or more Cas9 proteins are used, the Cas9 proteins may be derived from different biological species. For example, when two or more gRNAs are used to create at least one double-stranded break and at least one single-stranded break in a target nucleic acid, the Cas9 nuclease that creates the double-stranded break may be derived from one bacterial species, and the Cas9 nickase that creates the single-stranded break may be derived from a different bacterial species.
[0054] When two or more genes are targeted for modification within a cell, the target nucleic acid may be modified, for example, by cleavage with one or more Cas9 proteins. For example, when two genes are targeted for modification, such as when two genes are targeted for knockout, each gene may be targeted using the same or different Cas9 proteins. In one embodiment, both genes (or each gene targeted within a cell) are cleaved by Cas9 nuclease to generate a double-strand break. In another embodiment, both genes (or each gene targeted within a cell) are cleaved by Cas9 nuclease to generate a double-strand break. In another embodiment, one or more genes within a cell may be modified by cleavage with Cas9 nuclease, and one or more genes within the same cell may be modified by cleavage with Cas9 nickase. When two or more Cas9 proteins are used to cleave target nucleic acids, such as different genes, within a cell, the Cas9 proteins may be derived from different bacterial species. For example, one or more genes in a cell may be modified by cleavage with a Cas9 protein from one bacterial species, and one or more genes in the same cell may be modified by cleavage with a Cas9 protein from a different bacterial species. When two or more Cas9 proteins from different species are used, it is contemplated that they may be delivered simultaneously or sequentially to control the cleavage specificity in a desired gene at a desired location in a target nucleic acid.
[0055] In some embodiments, the targeting domain of the first gRNA molecule and the targeting domain of the second gRNA molecule are complementary to opposite target strand nucleic acid molecules. In some embodiments, the gRNA molecule and the second gRNA molecule are configured with the PAM facing outward.
[0056] In one embodiment, the targeting domain of the gRNA molecule is designed to avoid unwanted target chromosomal elements, such as repetitive elements, e.g., Alu repeats, in the targeting domain. The gRNA molecule may be a first, second, third, and / or fourth gRNA molecule.
[0057] In one embodiment, the targeting domain of the gRNA molecule is designed to position the cleavage event far enough away from a preselected nucleotide, such as a nucleotide in a coding region, so that the nucleotide is not modified. In one embodiment, the targeting domain of the gRNA molecule is designed to position the intron cleavage event far enough away from an intron / exon boundary or a natural splice signal to avoid exon sequence modification or unwanted splicing events. The gRNA molecule may be the first, second, third, and / or fourth gRNA molecule as described herein.
[0058] In other embodiments, a location in the coding region, e.g., the early coding region, of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene is targeted for knockout, e.g., In one embodiment, the targeting domain comprises a sequence identical to or differing by no more than 1, 2, 3, 4, or 5 nucleotides from a targeting domain sequence from any one of Tables 1A-I, 3A-H, 5A-I, 7A-H, 9A-I, 11A-I, 13A-K, 15A-F, 17A-K, 19A-J, 21A-K, 23A-J, 25A-G, 26A-G, 27, 29, 31, or 32.
[0059] In one embodiment, the targeting domain is selected from those in Tables 1A-I. In other embodiments, the targeting domain is as follows: [ka]
[0060] In one embodiment, the targeting domain is selected from those in Tables 3A-H. In other embodiments, the targeting domain is as follows: [ka]
[0061] In one embodiment, the targeting domain is selected from those in Tables 5A-I. In other embodiments, the targeting domain is as follows: [ka]
[0062] In one embodiment, the targeting domain is selected from those in Tables 7A-H. In other embodiments, the targeting domain is as follows: [ka]
[0063] In one embodiment, the targeting domain is selected from those in Tables 9A-I. In other embodiments, the targeting domain is as follows: [ka]
[0064] In one embodiment, the targeting domain is selected from those in Tables 11A-I. In other embodiments, the targeting domain is as follows: [ka]
[0065] In one embodiment, when the T cell target knockout location is in a FAS coding region, e.g., the early coding region, and two or more gRNAs are used to place breaks, e.g., two single-stranded breaks or two double-stranded breaks, or a combination of single-stranded and double-stranded breaks, e.g., to generate one or more indels in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 1A-F or Tables 13A-K.
[0066] In one embodiment, when the T cell target knockout location is in a BID coding region, e.g., the early coding region, and two or more gRNAs are used to place breaks, e.g., two single-stranded breaks or two double-stranded breaks, or a combination of single-stranded and double-stranded breaks, e.g., to generate one or more indels in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 3A-H or Tables 15A-K.
[0067] In one embodiment, when the T cell target knockout location is in a CTLA4 coding region, e.g., the early coding region, and two or more gRNAs are used to place breaks, e.g., two single-stranded breaks or two double-stranded breaks, or a combination of single-stranded and double-stranded breaks, e.g., to generate one or more indels in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 5A-I or Tables 17A-K.
[0068] In one embodiment, when the T cell target knockout location is in a PDCD1 coding region, e.g., the early coding region, and two or more gRNAs are used to place breaks, e.g., two single-stranded breaks or two double-stranded breaks, or a combination of single-stranded and double-stranded breaks, e.g., to generate one or more indels in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 7A-H, Tables 19A-J or Table 31 or Table 32.
[0069] In other embodiments, the targeting domain is: [ka] [ka] [ka]
[0070] Additionally, in another embodiment, the T cell target knockout location is in a PDCD1 coding region, e.g., an early coding region, and each guide RNA is independently selected from one of Tables 7A-H, 19A-J, 31, or 32 such that cleavage occurs with greater than 10% efficiency when, e.g., one or more indels occur in the target nucleic acid sequence.
[0071] In one embodiment, the targeting domain is: [ka]
[0072] In one embodiment, when the T cell target knockout location is a CBLB coding region, e.g., an early coding region, and two or more gRNAs are used to place breaks, e.g., two single-stranded breaks or two double-stranded breaks, or a combination of single-stranded and double-stranded breaks, e.g., to generate one or more indels in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 9A-I or Tables 21A-K.
[0073] In one embodiment, when the T cell target knockout location is in a PTPN6 coding region, e.g., the early coding region, and two or more gRNAs are used to place breaks, e.g., two single-stranded breaks or two double-stranded breaks, or a combination of single-stranded and double-stranded breaks, e.g., to generate one or more indels in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 11A-I or Tables 23A-J.
[0074] In one embodiment, when the T cell target knockout location is a TRAC coding region, e.g., the early coding region, and two or more gRNAs are used to place breaks, e.g., two single-stranded breaks or two double-stranded breaks, or a combination of single-stranded and double-stranded breaks, e.g., to generate one or more indels in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 25A-G or Table 29.
[0075] In other embodiments, the targeting domain is: [ka]
[0076] In another embodiment, when the T cell target knockout location is a TRAC coding region, e.g., the early coding region, and one or more gRNAs are used to place breaks, e.g., two single-stranded breaks or two double-stranded breaks, or a combination of single-stranded and double-stranded breaks, e.g., to generate one or more indels in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 25A-G or Table 29 such that the breaks are generated with greater than 10% efficiency.
[0077] In one embodiment, the targeting domain is: [ka]
[0078] In one embodiment, when the T cell target knockout location is a TRBC coding region, such as, for example, an early coding region, and two or more gRNAs are used to place breaks, such as, for example, two single-stranded breaks or two double-stranded breaks, or a combination of single-stranded and double-stranded breaks, e.g., to generate one or more indels in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 26A-G or Table 27.
[0079] In other embodiments, the targeting domain is: [ka] [ka] [ka]
[0080] In one embodiment, the T cell target knockout location is a TRBC coding region, e.g., an early coding region, and one or more gRNAs are used to place breaks, e.g., two single-stranded breaks or two double-stranded breaks, or a combination of single-stranded and double-stranded breaks, e.g., to generate one or more indels in the target nucleic acid sequence, each guide RNA being independently selected from one of Tables 26A-G or Table 27 such that the breaks are generated with greater than 10% efficiency.
[0081] In one embodiment, the targeting domain is: [ka]
[0082] In one embodiment, the targeting domain of the gRNA molecule is designed to target an enzymatically inactive Cas9 (eiCas9) or eiCas9 fusion protein (e.g., eiCas9 fused to a transcriptional repressor domain) sufficiently close to the T cell knockdown target location to decrease, reduce, or suppress expression of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene. In one embodiment, the targeting domain is designed to target the promoter region of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene to prevent transcription initiation, binding of one or more transcriptional enhancers or activators, and / or RNA polymerase. One or more gRNAs may be used to target eiCas9 to the promoter region of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
[0083] In one embodiment, when the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 promoter region is targeted, e.g., for knockdown, the targeting domain can comprise a sequence identical to or differing by no more than 1, 2, 3, 4, or 5 nucleotides from a targeting domain sequence from any one of Tables 2A-I, Tables 4A-I, Tables 6A-I, Tables 8A-H, Tables 10A-I, Tables 12A-I, Tables 14A-K, Tables 16A-K, Tables 18A-K, Tables 20A-J, Tables 22A-K, or Tables 24A-K. In one embodiment, the targeting domain is selected from those in Tables 2A-I. In other embodiments, the targeting domain is as follows: [ka] [ka]
[0084] In one embodiment, the targeting domain is selected from those in Tables 4A-I. In other embodiments, the targeting domain is as follows: [ka] [ka]
[0085] In one embodiment, the targeting domain is selected from those in Tables 6A-I. In other embodiments, the targeting domain is as follows: [ka]
[0086] In one embodiment, the targeting domain is selected from those in Tables 8A-H. In other embodiments, the targeting domain is as follows: [ka]
[0087] In one embodiment, the targeting domain is selected from those in Tables 10A-I. In other embodiments, the targeting domain is as follows: [ka]
[0088] In one embodiment, the targeting domain is selected from those in Tables 12A-I. In other embodiments, the targeting domain is as follows: [ka]
[0089] In one embodiment, when the T cell targeted knockdown site is the FAS promoter region and two or more gRNAs are used to position eiCas9 or an eiCas9 fusion protein (e.g., an eiCas9 transcriptional repressor domain fusion protein) in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 2A-I or Tables 14A-K.
[0090] In one embodiment, when the T cell targeted knockdown site is the BID promoter region and two or more gRNAs are used to position eiCas9 or an eiCas9 fusion protein (e.g., an eiCas9 transcriptional repressor domain fusion protein) in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 4A-I or Tables 16A-K.
[0091] In one embodiment, when the T cell targeted knockdown location is the CTLA4 promoter region and two or more gRNAs are used to position eiCas9 or an eiCas9 fusion protein (e.g., an eiCas9 transcriptional repressor domain fusion protein) in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 6A-I or Tables 18A-K.
[0092] In one embodiment, when the T cell targeted knockdown site is the PDCD1 promoter region and two or more gRNAs are used to position eiCas9 or an eiCas9 fusion protein (e.g., an eiCas9 transcriptional repressor domain fusion protein) in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 8A-H or Tables 20A-J.
[0093] In one embodiment, when the T cell targeted knockdown location is the CBLB promoter region and two or more gRNAs are used to position eiCas9 or an eiCas9 fusion protein (e.g., an eiCas9 transcriptional repressor domain fusion protein) in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 10A-I or Tables 22A-K.
[0094] In one embodiment, when the T cell targeted knockdown location is the PTPD6 promoter region and two or more gRNAs are used to position eiCas9 or an eiCas9 fusion protein (e.g., an eiCas9 transcriptional repressor domain fusion protein) in the target nucleic acid sequence, each guide RNA is independently selected from one of Tables 12A-I or Tables 24A-K.
[0095] In one embodiment, the gRNA is a modular gRNA, such as a gRNA comprising a targeting domain complementary to a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene. In other embodiments, the gRNA is a unimolecular or chimeric gRNA.
[0096] In one embodiment, the targeting domain complementary to a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene comprises 16 or more nucleotides in length. In one embodiment, the targeting domain complementary to a targeting domain from a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene is 16 or more nucleotides in length. In one embodiment, the targeting domain is 16 nucleotides in length. In one embodiment, the targeting domain is 17 nucleotides in length. In one embodiment, the targeting domain is 18 nucleotides in length. In one embodiment, the targeting domain is 19 nucleotides in length. In one embodiment, the targeting domain is 20 nucleotides in length. In one embodiment, the targeting domain is 21 nucleotides in length. In one embodiment, the targeting domain is 22 nucleotides in length. In one embodiment, the targeting domain is 23 nucleotides in length. In one embodiment, the targeting domain is 24 nucleotides in length. In one embodiment, the targeting domain is 25 nucleotides in length. In one embodiment, the targeting domain is 26 nucleotides in length.A gRNA as described herein may comprise, from 5' to 3', a targeting domain (comprising a "core domain" and optionally a "secondary domain"); a first complementary domain; a linking domain; a second complementary domain; a flanking domain; and a tail domain.In some embodiments, the flanking domain and the tail domain are combined into a single domain.
[0097] In one embodiment, the targeting domain comprises 16 nucleotides.
[0098] In one embodiment, the targeting domain comprises 17 nucleotides.
[0099] In one embodiment, the targeting domain comprises 18 nucleotides.
[0100] In one embodiment, the targeting domain comprises 19 nucleotides.
[0101] In one embodiment, the targeting domain comprises 20 nucleotides.
[0102] In one embodiment, the targeting domain comprises 21 nucleotides.
[0103] In one embodiment, the targeting domain comprises 22 nucleotides.
[0104] In one embodiment, the targeting domain comprises 23 nucleotides.
[0105] In one embodiment, the targeting domain comprises 24 nucleotides.
[0106] In one embodiment, the targeting domain comprises 25 nucleotides.
[0107] In one embodiment, the targeting domain comprises 26 nucleotides.
[0108] A gRNA as described herein may comprise, from 5' to 3', a targeting domain (comprising a "core domain," and optionally a "secondary domain"); a first complementary domain; a linking domain; a second complementary domain; a flanking domain; and a tail domain. In some embodiments, the flanking domain and the tail domain are combined into a single domain.
[0109] In one embodiment, the gRNA comprises a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 20 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or greater.
[0110] In another embodiment, the gRNA comprises a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 30 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or greater.
[0111] In another embodiment, the gRNA comprises a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 35 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or greater.
[0112] In another embodiment, the gRNA comprises a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 40 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or greater.
[0113] For example, a cleavage event, such as a double-stranded or single-stranded break, is generated by the Cas9 molecule. The Cas9 molecule may be, for example, an enzymatically active Cas9 (eaCas9) molecule (e.g., a nickase molecule), such as an eaCas9 molecule that forms a double-stranded break in the target nucleic acid, or an eaCas9 molecule that forms a single-stranded break in the target nucleic acid. Alternatively, in some embodiments, the Cas9 molecule may be an enzymatically inactive Cas9 (eiCas9) molecule, or a modified eiCas9 molecule, such as an eiCas9 molecule fused to a Krueppel binding box (KRAB) to generate an eiCas9-KRAB fusion protein molecule.
[0114] In one embodiment, the eaCas9 molecule catalyzes a double-stranded cleavage.
[0115] In some embodiments, the eaCas9 molecule comprises HNH-like domain cleavage activity but substantially no N-terminal RuvC-like domain cleavage activity. In this case, the eaCas9 molecule is an HNH-like domain nickase, e.g., the eaCas9 molecule comprises a mutation at D10, e.g., D10A. In other embodiments, the eaCas9 molecule comprises N-terminal RuvC-like domain cleavage activity but substantially no HNH-like domain cleavage activity. In one embodiment, the eaCas9 molecule is an N-terminal RuvC-like domain nickase, e.g., the eaCas9 molecule comprises a mutation at H840, e.g., H840A. In one embodiment, the eaCas9 molecule is an N-terminal RuvC-like domain nickase, e.g., the eaCas9 molecule comprises a mutation at N863, e.g., N863A.
[0116] In one embodiment, a single-strand break is formed in the target nucleic acid strand to which the targeting domain of the gRNA is complementary. In another embodiment, a single-strand break is formed in a target nucleic acid strand other than the strand to which the targeting domain of the gRNA is complementary.
[0117] In another aspect, disclosed herein is an isolated or non-naturally occurring nucleic acid, e.g., a DNA comprising a sequence encoding a gRNA molecule, as disclosed herein, that comprises (a) a targeting domain complementary to a targeting domain, e.g., a T cell target locus in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene.
[0118] In one embodiment, the nucleic acid encodes a gRNA molecule, e.g., a first gRNA molecule, comprising a targeting domain configured to provide a cleavage event, e.g., a double-stranded break or a single-stranded break, sufficiently close to the T cell target location in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene to allow modification, e.g., NHEJ-associated modification, of the T cell target location in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, respectively.
[0119] In one embodiment, the nucleic acid encodes a gRNA molecule, e.g., a first gRNA molecule, comprising a targeting domain designed to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., eiCas9 fused to a transcriptional repression region) sufficiently close to a T cell knockdown target location to reduce, decrease, or suppress expression of a FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
[0120] In one embodiment, the nucleic acid encodes a gRNA molecule, e.g., a first gRNA molecule comprising a targeting domain comprising a sequence identical to or differing by no more than 1, 2, 3, 4, or 5 nucleotides from a targeting domain sequence from any one of Tables 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32. In one embodiment, the nucleic acid encodes a gRNA molecule comprising a targeting domain selected from those in Table 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32.
[0121] In one embodiment, the nucleic acid encodes a modular gRNA, e.g., one or more nucleic acids encode a modular gRNA. In other embodiments, the nucleic acid encodes a chimeric gRNA. The nucleic acid may encode a gRNA, e.g., a first gRNA molecule, comprising a targeting domain comprising 16 or more nucleotides in length. The nucleic acid may encode a gRNA, e.g., a first gRNA molecule, comprising a targeting domain comprising 16 or more nucleotides in length. In one embodiment, the nucleic acid encodes a gRNA, e.g., a first gRNA molecule, comprising a targeting domain that is 17 nucleotides in length. In other embodiments, the nucleic acid encodes a gRNA, e.g., a first gRNA molecule, comprising a targeting domain that is 18 nucleotides in length. In yet other embodiments, the nucleic acid encodes a gRNA, e.g., a first gRNA molecule, comprising a targeting domain that is 19 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, e.g., a first gRNA molecule, comprising a targeting domain that is 20 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, such as, for example, a first gRNA molecule comprising a targeting domain that is 21 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, such as, for example, a first gRNA molecule comprising a targeting domain that is 22 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, such as, for example, a first gRNA molecule comprising a targeting domain that is 23 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, such as, for example, a first gRNA molecule comprising a targeting domain that is 24 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, such as, for example, a first gRNA molecule comprising a targeting domain that is 25 nucleotides in length. In still other embodiments, the nucleic acid encodes a gRNA, such as, for example, a first gRNA molecule comprising a targeting domain that is 26 nucleotides in length.
[0122] In one embodiment, the nucleic acid encodes a gRNA comprising, from 5' to 3', a targeting domain (comprising a "core domain," and optionally a "secondary domain"); a first complementary domain; a linking domain; a second complementary domain; a flanking domain; and a tail domain. In some embodiments, the flanking domain and tail domain are combined into a single domain.
[0123] In one embodiment, the nucleic acid encodes a gRNA, e.g., a first gRNA molecule comprising a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 20 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 or more nucleotides in length.
[0124] In one embodiment, the nucleic acid encodes a gRNA, e.g., a first gRNA molecule comprising a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 30 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or more.
[0125] In one embodiment, the nucleic acid encodes a gRNA, e.g., a first gRNA molecule comprising a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 35 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or more.
[0126] In one embodiment, the nucleic acid encoding a gRNA, e.g., the first gRNA molecule, comprises a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 40 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or more.
[0127] In one embodiment, the nucleic acid (a) comprises a sequence encoding a gRNA molecule, such as a first gRNA molecule, comprising a targeting domain complementary to a targeting domain in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, e.g., as disclosed herein, and (b) further comprises a sequence encoding a Cas9 molecule.
[0128] In one embodiment, the nucleic acid further comprises a sequence encoding a master gRNA molecule.
[0129] The Cas9 molecule may be, for example, an enzymatically active Cas9 (eaCas9) molecule (e.g., a nickase molecule), such as an eaCas9 molecule that forms a double-stranded break in a target nucleic acid or an eaCas9 molecule that forms a single-stranded break in a target nucleic acid. Alternatively, in some embodiments, the Cas9 molecule may be an enzymatically inactive Cas9 (eiCas9) molecule or a modified eiCas9 molecule, such as, for example, an eiCas9 molecule fused to a Krueppel binding box (KRAB) to generate an eiCas9-KRAB fusion protein molecule.
[0130] The nucleic acids disclosed herein may comprise (a) a sequence encoding a gRNA molecule comprising a targeting domain complementary to a targeting domain in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, as disclosed herein; (b) a sequence encoding a Cas9 molecule; and (c) (i) a second gRNA molecule, as described herein, having a targeting domain complementary to a second targeting domain in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene. and optionally, (ii) a sequence encoding a third gRNA molecule described herein having a targeting domain complementary to a third target domain of a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene; and optionally, (iii) a sequence encoding a fourth gRNA molecule described herein having a targeting domain complementary to a fourth target domain of a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene.
[0131] In one embodiment, the nucleic acid encoding the second gRNA molecule comprises a targeting domain configured to provide a cleavage event, e.g., a double-stranded or single-stranded break, sufficiently close to the T cell target location in, e.g., a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, to allow modification, e.g., NHEJ-associated modification, of the T cell target location in, e.g., a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, alone or in combination with the cleavage placed by the first gRNA molecule.
[0132] In one embodiment, the nucleic acid encodes a second gRNA molecule comprising a targeting domain designed to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., eiCas9 fused to a transcriptional repression region) sufficiently close to a T cell knockdown target location to reduce, decrease, or suppress expression of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
[0133] In one embodiment, the nucleic acid encoding the third gRNA molecule comprises a targeting domain configured to provide a cleavage event, e.g., a double-stranded or single-stranded break, sufficiently close to the T cell target location in, e.g., a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, to allow modification, e.g., NHEJ-associated modification, of the T cell target location in, e.g., a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, alone or in combination with the cleavage placed by the first and / or second gRNA molecule.
[0134] In one embodiment, the nucleic acid encodes a third gRNA molecule comprising a targeting domain designed to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., eiCas9 fused to a transcriptional repression region) sufficiently close to a T cell knockdown target location to reduce, decrease, or suppress expression of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
[0135] In one embodiment, the nucleic acid encoding the fourth gRNA molecule comprises a targeting domain configured to provide a cleavage event, e.g., a double-stranded or single-stranded break, sufficiently close to the T cell target location in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, to allow modification, e.g., NHEJ-associated modification, of the T cell target location in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, alone or in combination with the cleavages positioned by the first, second, and third gRNA molecules.
[0136] In one embodiment, the nucleic acid encodes a fourth gRNA molecule comprising a targeting domain designed to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., eiCas9 fused to a transcriptional repression region) sufficiently close to a T cell knockdown target location to reduce, decrease, or suppress expression of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
[0137] In one embodiment, the nucleic acid encodes a second gRNA molecule. The second gRNA is selected to target the same T cell target location as the first gRNA molecule. Optionally, the nucleic acid may encode a third gRNA, and further optionally, the nucleic acid may encode a fourth gRNA molecule. In one embodiment, the third gRNA molecule and the fourth gRNA molecule are selected to target the same T cell target location as the first and second gRNA molecules.
[0138] In one embodiment, the nucleic acid encodes a second gRNA molecule comprising a targeting domain comprising a sequence identical to or differing by no more than 1, 2, 3, 4, or 5 nucleotides from a targeting domain sequence from one of Tables 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, or Table 26A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32. In one embodiment, the nucleic acid encodes a second gRNA molecule comprising a targeting domain selected from those in Table 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, or Table 26A-G, Table 27, Table 29, Table 31, or Table 32. In one embodiment, if a third or fourth gRNA molecule is present, the third and fourth gRNA molecules are selected from the group consisting of Table 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 1 8A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32.In further embodiments, if a third or fourth gRNA molecule is present, the third and fourth gRNA molecules may comprise targeting domains independently selected from those in Table 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32.
[0139] In one embodiment, the nucleic acid encodes the second gRNA as a modular gRNA, for example, one or more nucleic acid molecules encode the modular gRNA. In other embodiments, the nucleic acid encodes the second gRNA as a chimeric gRNA. In other embodiments, when the nucleic acid encodes a third or fourth gRNA, the third and fourth gRNAs may be modular gRNAs or chimeric gRNAs. When multiple gRNAs are used, any combination of modular or chimeric gRNAs may be used.
[0140] The nucleic acid may encode a second, third, and / or fourth gRNA comprising a targeting domain comprising 16 or more nucleotides in length. In one embodiment, the nucleic acid encodes a second gRNA comprising a targeting domain 16 nucleotides in length. In one embodiment, the nucleic acid encodes a second gRNA comprising a targeting domain 17 nucleotides in length. In other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain 18 nucleotides in length. In yet other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain 19 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain 20 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain 21 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain 22 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain 23 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain 24 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain 25 nucleotides in length. In still other embodiments, the nucleic acid encodes a second gRNA comprising a targeting domain 26 nucleotides in length.
[0141] In one embodiment, the targeting domain comprises 16 nucleotides.
[0142] In one embodiment, the targeting domain comprises 17 nucleotides.
[0143] In one embodiment, the targeting domain comprises 18 nucleotides.
[0144] In one embodiment, the targeting domain comprises 19 nucleotides.
[0145] In one embodiment, the targeting domain comprises 20 nucleotides.
[0146] In one embodiment, the targeting domain comprises 21 nucleotides.
[0147] In one embodiment, the targeting domain comprises 22 nucleotides.
[0148] In one embodiment, the targeting domain comprises 23 nucleotides.
[0149] In one embodiment, the targeting domain comprises 24 nucleotides.
[0150] In one embodiment, the targeting domain comprises 25 nucleotides.
[0151] In one embodiment, the targeting domain comprises 26 nucleotides.
[0152] In one embodiment, the nucleic acid encodes a second, third, and / or fourth gRNA comprising, from 5' to 3', a targeting domain (comprising a "core domain," and optionally a "secondary domain"); a first complementary domain; a linking domain; a second complementary domain; a flanking domain; and a tail domain. In some embodiments, the flanking domain and tail domain are combined into a single domain.
[0153] In one embodiment, the nucleic acid encodes a second, third, and / or fourth gRNA comprising a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 20 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or more.
[0154] In one embodiment, the nucleic acid encodes a second, third, and / or fourth gRNA comprising a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 30 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or more.
[0155] In one embodiment, the nucleic acid encodes a second, third, and / or fourth gRNA comprising a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 35 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or more.
[0156] In one embodiment, the nucleic acid encodes a second, third, and / or fourth gRNA comprising a linking domain that is 25 nucleotides or less in length; flanking and tail domains that together are at least 40 nucleotides in length; and a targeting domain that is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length or more.
[0157] As described above, the nucleic acid may comprise (a) a sequence encoding a gRNA molecule comprising a targeting domain complementary to a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene targeting domain, and (b) a sequence encoding a Cas9 molecule. In some embodiments, (a) and (b) are present on the same nucleic acid molecule, such as the same vector, e.g., the same viral vector, e.g., the same adeno-associated virus (AAV) vector. In one embodiment, the nucleic acid molecule is an AAV vector. Representative AAV vectors that may be used in any of the compositions and methods described include an AAV1 vector, a modified AAV1 vector, an AAV2 vector, a modified AAV2 vector, an AAV3 vector, an AAV4 vector, a modified AAV4 vector, an AAV5 vector, a modified AAV5 vector, a modified AAV3 vector, an AAV6 vector, a modified AAV6 vector, an AAV7 vector, a modified AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV.rh10 vector, a modified AAV.rh10 vector, an AAV.rh32 / 33 vector, a modified AAV.rh32 / 33 vector, an AAV.rh43 vector, a modified AAV.rh43 vector, aAAV.rh64R1 vector, and a modified AAV.rh64R1 vector. In other embodiments, (a) is present on a first nucleic acid molecule, e.g., a first vector, e.g., a first viral vector, e.g., a first AAV vector; and (b) is present on a second nucleic acid molecule, e.g., a second vector, e.g., a second AAV vector. The first and second nucleic acid molecules may be AAV vectors.
[0158] In other embodiments, the nucleic acid may further comprise (c)(i) a sequence encoding a second gRNA molecule as described herein. In some embodiments, the nucleic acid comprises (a), (b), and (c)(i). Each of (a) and (c)(i) may be present on the same nucleic acid molecule, such as the same vector, e.g., the same viral vector, e.g., the same adeno-associated virus (AAV) vector. In one embodiment, the nucleic acid molecule is an AAV vector.
[0159] In other embodiments, (a) and (c)(i) are on different vectors.For example, (a) can be present on a first nucleic acid molecule, such as a first vector, for example, a first viral vector, for example, a first AAV vector; (c)(i) can be present on a second nucleic acid molecule, such as a second vector, for example, a second vector, for example, a second AAV vector.In one embodiment, the first and second nucleic acid molecules are AAV vectors.
[0160] In another embodiment, each of (a), (b), and (c)(i) is present on the same nucleic acid molecule, e.g., the same vector, e.g., the same viral vector, e.g., an AAV vector. In one embodiment, the nucleic acid molecule is an AAV vector. In an alternate embodiment, one of (a), (b), and (c)(i) is encoded on a first nucleic acid molecule, e.g., a first vector, e.g., a first viral vector, e.g., a first AAV vector; and the second and third of (a), (b), and (c)(i) are encoded on a second nucleic acid molecule, e.g., a second vector, e.g., a second AAV vector. The first and second nucleic acid molecules may be AAV vectors.
[0161] In one embodiment, (a) is present on a first nucleic acid molecule, e.g., a first vector, e.g., a first viral vector, a first AAV vector, etc.; (b) and (c)(i) are present on a second nucleic acid molecule, e.g., a second vector, e.g., a second vector, e.g., a second AAV vector. The first and second nucleic acid molecules may be AAV vectors.
[0162] In other embodiments, (b) is present on a first nucleic acid molecule, e.g., a first vector, e.g., a first viral vector, e.g., a first AAV vector; and (a) and (c)(i) are present on a second nucleic acid molecule, e.g., a second vector, e.g., a second AAV vector. The first and second nucleic acid molecules may be AAV vectors.
[0163] In other embodiments, (c)(i) is present on a first nucleic acid molecule, e.g., a first vector, e.g., a first viral vector, e.g., a first AAV vector; and (b) and (a) are present on a second nucleic acid molecule, e.g., a second vector, e.g., a second AAV vector. The first and second nucleic acid molecules may be AAV vectors.
[0164] In another embodiment, each of (a), (b), and (c)(i) is present on a different nucleic acid molecule, such as a different vector, e.g., a different viral vector, e.g., a different AAV vector. For example, (a) may be present on a first nucleic acid molecule, (b) may be present on a second nucleic acid molecule, and (c)(i) may be present on a third nucleic acid molecule. The first, second, and third nucleic acid molecules may be AAV vectors.
[0165] In another embodiment, when a third and / or fourth gRNA molecule is present, each of (a), (b), (c)(i), (c)(ii), and (c)(iii) may be present on the same nucleic acid molecule, e.g., the same vector, e.g., the same viral vector, e.g., an AAV vector. In one embodiment, the nucleic acid molecule is an AAV vector. In alternate embodiments, each of (a), (b), (c)(i), (c)(ii), and (c)(iii) may be present on different nucleic acid molecules, e.g., different vectors, e.g., different viral vectors, e.g., different AAV vectors. In further embodiments, each of (a), (b), (c)(i), (c)(ii), and (c)(iii) may be present on two or more nucleic acid molecules, e.g., AAV vectors, but fewer than five nucleic acid molecules.
[0166] The nucleic acid described herein may comprise a promoter operably linked to the sequence encoding the gRNA molecule (a), such as a promoter described herein. The nucleic acid may further comprise a second promoter operably linked to the sequence encoding the second, third, and / or fourth gRNA molecule (c), such as a promoter described herein. The promoter and the second promoter are different from each other. In some embodiments, the promoter and the second promoter are the same.
[0167] The nucleic acids described herein may further comprise a promoter operably linked to the sequence encoding the Cas9 molecule of (b), e.g., a promoter described herein.
[0168] In another aspect, disclosed herein is a composition comprising (a) a gRNA molecule comprising a targeting domain complementary to a targeting domain in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, as described herein. The composition (a) may further comprise (b) a Cas9 molecule, e.g., a Cas9 molecule as described herein. The composition (a) and (b) may further comprise (c) a second, third, and / or fourth gRNA molecule, e.g., a second, third, and / or fourth gRNA molecule described herein. In one embodiment, the composition may comprise at least two gRNA molecules targeting two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes. In one embodiment, the composition further comprises a master gRNA molecule or a nucleic acid encoding a master gRNA molecule.
[0169] In another aspect, disclosed herein is a method of modifying a cell, e.g., modifying the structure, e.g., sequence, of a cellular target nucleic acid, comprising contacting the cell with (a) a gRNA targeting a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, e.g., a gRNA as described herein; (b) a Cas9 molecule, e.g., a Cas9 molecule as described herein; and, optionally, (c) a second, third, and / or fourth gRNA targeting a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, e.g., a gRNA as described herein. In one embodiment, the method further comprises introducing into the cell a governing gRNA molecule, or a nucleic acid encoding the governing gRNA molecule.
[0170] In some embodiments, the method comprises contacting a cell with (a) and (b).
[0171] In some embodiments, the method comprises contacting a cell with (a), (b), and (c).
[0172] The gRNAs in (a) and optionally (c) may be independently selected from any of Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I, Tables 10A-I, Tables 11A-I, Tables 12A-I, Tables 13A-K, Tables 14A-K, Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32, or may be independently selected from any of Tables 1A-I, Tables 2A-I , Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32, and may be independently selected from gRNAs that differ by no more than 1, 2, 3, 4, or 5 nucleotides from a targeting domain sequence independently selected from any of Tables 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32.
[0173] In one embodiment, a method for modifying a cell, e.g., modifying a target nucleic acid structure, e.g., modifying a sequence, comprises modifying two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes. When two or more genes are modified in a cell, the cell is contacted with (a) a gRNA targeting two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes, e.g., two or more of the gRNAs described herein; (b) a Cas9 molecule, e.g., a Cas9 molecule, e.g., a Cas9 molecule described herein; and optionally, (c) a second, third, and / or fourth gRNA, each targeting two or more genes selected in (a), e.g., a gRNA, ...
[0174] In one embodiment, the method of modifying a cell comprises modifying two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
[0175] In one embodiment, the method of modifying a cell comprises modifying three or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
[0176] In one embodiment, the method of modifying a cell comprises modifying four or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
[0177] In one embodiment, the method of modifying a cell comprises modifying five or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0178] In one embodiment, the method of modifying a cell comprises modifying six or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0179] In one embodiment, the method of modifying a cell comprises modifying seven or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0180] In one embodiment, the method of modifying a cell comprises modifying each of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
[0181] In some embodiments, the method comprises contacting a cell derived from a subject suffering from cancer. The cell may be derived from a subject who would benefit from having a mutation at a T cell target locus.
[0182] In some embodiments, the cells contacted in the disclosed methods are T cells. The contacting step may be performed ex vivo, and the contacted cells may be returned to the subject's body after the contacting step. The T cells may be genetically engineered T cells, such as genetically engineered CAR (chimeric antigen receptor) T cells or genetically engineered TCR (T cell receptor) T cells. The T cells may be genetically engineered to express a TCR or CAR before, after, or simultaneously with the introduction of T cell target site mutations in one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0183] In some embodiments, the method of modifying a cell as described herein comprises, prior to the contacting step, obtaining knowledge of the sequence of a T cell target location within the cell. The step of obtaining knowledge of the sequence of a T cell target location within the cell may be by sequencing of a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, or a portion of a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene.
[0184] In some embodiments, the contacting step of the method comprises contacting the cell with a nucleic acid that expresses at least one of (a), (b), and (c), e.g., a vector described herein, e.g., an AAV vector, e.g., an AAV vector. In some embodiments, the contacting step of the method comprises contacting the cell with a nucleic acid that expresses each of (a), (b), and (c), e.g., a vector, e.g., an AAV vector. In another embodiment, the contacting step of the method comprises delivering to the cell a Cas9 molecule of (b), a nucleic acid encoding the gRNA of (a), and optionally a second gRNA of (c)(i), and (further optionally a third gRNA (c)(iv) and / or a fourth gRNA (c)(iii).
[0185] In some embodiments, the contacting step of the method comprises contacting the cell with a nucleic acid, e.g., a vector, e.g., an AAV vector, that expresses at least one of (a), (b), and (c). In some embodiments, the contacting step of the method comprises contacting the cell with a nucleic acid, e.g., a vector, e.g., an AAV vector, that expresses each of (a), (b), and (c). In one embodiment, the contacting step comprises contacting the cell with a nucleic acid such as, for example, a vector, e.g., an AAV vector, an AAV1 vector, a modified AAV1 vector, an AAV2 vector, a modified AAV2 vector, an AAV3 vector, a modified AAV3 vector, an AAV4 vector, a modified AAV4 vector, an AAV5 vector, a modified AAV5 vector, an AV6 vector, a modified AAV6 vector, an AAV7 vector, a modified AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV.rh10 vector, a modified AAV.rh10 vector, an AAV.rh32 / 33 vector, a modified AAV.rh32 / 33 vector, an AAV.rh43 vector, a modified AAV.rh43 vector, an AAV.rh64R1 vector, and a modified AAV.rh64R1 vector.
[0186] In one embodiment, the contacting step comprises delivering to the cell the Cas9 molecule of (b) as a protein or mRNA and a nucleic acid encoding (a) and optionally (c).
[0187] In one embodiment, the contacting step comprises delivering to the cell the Cas9 molecule of (b) as a protein or mRNA, the gRNA of (a) as RNA, and optionally a second gRNA of (c) as RNA.
[0188] In one embodiment, the contacting step comprises delivering to the cell the gRNA of (a) as RNA, optionally a second gRNA (c) as RNA, and a nucleic acid encoding the Cas9 molecule of (b).
[0189] In another aspect, disclosed herein is a method for treating a subject (or cells derived from a subject) with a steroid hormone. (a) a gRNA targeting a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, such as, for example, a gRNA disclosed herein; (b) a Cas9 molecule, such as, for example, a Cas9 molecule disclosed herein; Optionally, (c)(i) a second gRNA targeting a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, e.g., a second gRNA disclosed herein, and further optionally, (c)(ii) a third gRNA, and even more optionally, (c)(iii) a fourth gRNA targeting a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene, e.g., a third and fourth gRNA disclosed herein. In one embodiment, the method further comprises introducing a command gRNA molecule or a nucleic acid encoding the command gRNA molecule into the subject or into a cell of the subject.
[0190] In some embodiments, the contacting step comprises contacting (a) and (b).
[0191] In some embodiments, the contacting step comprises contacting (a), (b), and (c)(i).
[0192] In some embodiments, the contacting step comprises contacting (a), (b), (c)(i), and (c)(ii).
[0193] In some embodiments, the contacting step comprises contacting (a), (b), (c)(i), (c)(ii), and (c)(iii).
[0194] The gRNAs of (a) or (c) (e.g., (c)(i), (c)(ii), or (c)(iii)) may be independently selected from any of Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I, Tables 10A-I, Tables 11A-I, Tables 12A-I, Tables 13A-K, Tables 14A-K, Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32; and may be independently selected from gRNAs that differ by no more than 1, 2, 3, 4, or 5 nucleotides from a targeting domain sequence independently selected from any of Tables 1A-I, Tables 2A-I, Tables 3A-H, Tables 4A-I, Tables 5A-I, Tables 6A-I, Tables 7A-H, Tables 8A-H, Tables 9A-I, Tables 10A-I, Tables 11A-I, Tables 12A-I, Tables 13A-K, Tables 14A-K, Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32.
[0195] In one embodiment, a method of treating a subject suffering from cancer comprises modifying two or more target nucleic acids (e.g., two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes) in a subject, e.g., by modifying the structure, e.g., sequence, of two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes. When two or more genes are modified in a subject (or a cell derived from a subject), the subject (or a cell derived from a subject) is contacted with (a) a gRNA targeting two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes, e.g., two or more gRNAs as described herein; (b) a Cas9 molecule, e.g., a Cas9 molecule as described herein; and optionally, (c) a second, third, and / or fourth gRNA, each targeting two or more genes selected in (a), e.g., a gRNA as described herein. In one embodiment, the method further comprises the step of introducing the master gRNA molecule or a nucleic acid encoding the master gRNA molecule into the subject or into a cell of the subject.
[0196] In one embodiment, a method of treating a subject suffering from cancer comprises modifying two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0197] In one embodiment, a method of treating a subject suffering from cancer comprises modifying three or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0198] In one embodiment, a method of treating a subject suffering from cancer comprises modifying four or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0199] In one embodiment, a method of treating a subject suffering from cancer comprises modifying five or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0200] In one embodiment, a method of treating a subject suffering from cancer comprises modifying six or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0201] In one embodiment, a method of treating a subject suffering from cancer comprises modifying seven or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0202] In one embodiment, a method of treating a subject suffering from cancer comprises modifying each of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
[0203] In one embodiment, the method comprises obtaining knowledge of the sequence of a T cell target location in a subject.
[0204] In one embodiment, the method comprises obtaining knowledge of the sequence of a T cell target locus in a subject by sequencing one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes, or portions of one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
[0205] In one embodiment, the method comprises introducing a mutation into a T cell target locus in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene.
[0206] In one embodiment, the method comprises introducing a mutation into one or more T cell target loci in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0207] In one embodiment, the method comprises introducing a mutation into a T cell target locus in two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0208] In one embodiment, the method comprises introducing mutations into T cell target loci in three or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0209] In one embodiment, the method comprises introducing mutations into four or more T cell target loci in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0210] In one embodiment, the method comprises introducing mutations into five or more T cell target loci in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0211] In one embodiment, the method comprises introducing mutations into six or more T cell target loci in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0212] In one embodiment, the method comprises introducing mutations into seven or more T cell target loci in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0213] In one embodiment, the method comprises introducing a mutation into each of the T cell target loci of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0214] In one embodiment, the method comprises introducing mutations into one or more T cell target loci in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene by NHEJ.
[0215] In one embodiment, the subject's cells are contacted with (a), (b), and optionally (c) ex vivo. In one embodiment, the cells are returned to the subject's body. In one embodiment, the subject's cells are contacted with T cells ex vivo. The T cells may be engineered T cells, such as, for example, engineered CAR (chimeric antigen receptor) T cells or engineered TCR (T cell receptor) T cells. The T cells may be engineered to express a TCR or CAR before, after, or simultaneously with the introduction of T cell target site mutations in one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
[0216] If the method comprises (1) inducing a mutation at a T cell target locus by NHEJ, or (2) knocking down expression of a FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene, e.g., by targeting a promoter region, the contacting step includes (b) Cas9 and at least one guide RNA, e.g., the guide RNA of (a).
[0217] In another aspect, disclosed herein is a reaction mixture comprising a gRNA, a nucleic acid, or a composition described herein and a cell, e.g., a cell derived from a subject with cancer or a subject that would benefit from a mutation in a T cell target locus.
[0218] In another aspect, disclosed herein is a method for treating a pulmonary arthritis, comprising: (a) a gRNA molecule described herein, or a nucleic acid encoding a gRNA, and one or more of the following: (b) a Cas9 molecule, e.g., a Cas9 molecule described herein, or a nucleic acid or mRNA encoding Cas9; (c)(i) a second gRNA molecule, e.g., a second gRNA molecule described herein, or a nucleic acid encoding (c)(i); (c)(ii) a third gRNA molecule, e.g., a second gRNA molecule described herein, or a nucleic acid encoding (c)(ii); (c)(iii) a fourth gRNA molecule, e.g., a second gRNA molecule described herein, or a nucleic acid encoding (c)(iii) A kit comprising:
[0219] In one embodiment, the kit comprises a nucleic acid, such as an AAV vector, e.g., an AAV vector described herein, encoding one or more of (a), (b), (c)(i), (c)(ii), and (c)(iii). In one embodiment, the kit further comprises a governing gRNA molecule or a nucleic acid encoding a governing gRNA molecule.
[0220] In one aspect, the present disclosure features a gRNA molecule, referred to herein as a master gRNA molecule, comprising a targeting domain complementary to a targeting domain on a nucleic acid encoding a component of a CRISPR / Cas system introduced into a cell or subject. In one embodiment, the master gRNA molecule targets a nucleic acid encoding a Cas9 molecule or a nucleic acid encoding a target gene gRNA molecule. In one embodiment, the master gRNA comprises a targeting domain complementary to a targeting domain in a sequence encoding a Cas9 component, e.g., a Cas9 molecule, or a target gene gRNA molecule. In one embodiment, the targeting domain is designed with or has minimal homology to other nucleic acid sequences in the cell, e.g., to minimize off-target cleavage. For example, the targeting domain on the master gRNA can be selected to reduce or minimize off-target effects. In one embodiment, the targeting domain of the master gRNA can be located within the regulatory or coding region of the Cas9 molecule, or between the regulatory and transcribed regions. In one embodiment, the targeting domain of the master gRNA can be located within the regulatory or coding region of the target gene gRNA molecule, or between the regulatory and transcribed regions of the target gene gRNA. Without wishing to be bound by theory, in one embodiment, it is believed that modifying, e.g., inactivating, the nucleic acid encoding the Cas9 molecule or the nucleic acid encoding the target gene gRNA molecule can be effected by cleavage of the target nucleic acid sequence or by binding of the Cas9 molecule / master gRNA molecule complex to the target nucleic acid sequence.
[0221] As disclosed herein, the compositions, reaction mixtures, and kits can also include a control gRNA molecule, such as, for example, a control gRNA molecule disclosed herein.
[0222] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs.Methods and materials similar to or equivalent to those described herein can be used in the present invention or in the testing of the present invention, and suitable methods and materials are listed below.All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety.In addition, materials, methods and examples are intended to be illustrative only and are not intended to be limiting.
[0223] Headings, including numerical and alphabetical headings and subheadings, are for organizational and presentation purposes only and are not intended to be limiting.
[0224] Other features and advantages of the invention will become apparent from the detailed description, the drawings, and the claims.
[0225] First, the drawings will be briefly described. [Brief explanation of the drawings]
[0226] [Figure 1A] A representation of one representative gRNA, a modular gRNA molecule partially derived from (or partially modeled on) the sequence of Streptococcus pyogenes (S. pyogenes), depicted as a double-stranded structure (SEQ ID NOS: 42 and 43, respectively, in order of appearance); [Figure 1B] 1 is a depiction of one representative gRNA. A unimolecular (or chimeric) gRNA molecule derived in part from S. pyogenes is depicted as a duplex structure (SEQ ID NO: 44); [Figure 1C] 1 is a depiction of one representative gRNA. A unimolecular gRNA molecule derived in part from S. pyogenes is depicted as a duplex structure (SEQ ID NO: 45); [Figure 1D]1 is a depiction of one representative gRNA. A unimolecular gRNA molecule derived in part from S. pyogenes is depicted as a duplex structure (SEQ ID NO: 46); [Figure 1E] 1 is a depiction of one representative gRNA. A unimolecular gRNA molecule derived in part from S. pyogenes is depicted as a duplex structure (SEQ ID NO: 47); [Figure 1F] A representation of one representative gRNA, a modular gRNA molecule derived in part from Streptococcus thermophilus (S. thermophilus), depicted as a duplex structure (SEQ ID NOS: 48 and 49, respectively, in order of appearance); [Figure 1G] 1 depicts a representation of one representative gRNA. 2 depicts the alignment of modular gRNA molecules for S. pyogenes and S. thermophilus (SEQ ID NOS: 50-53, respectively, in order of appearance). [Figure 2A-G] Figure 1 depicts an alignment of Cas9 sequences from Chylinski et al. (RNA BIOL. 2013;10(5):726-737). The N-terminal RuvC-like domain is indicated by a boxed "y." The other two RuvC-like domains are indicated by a boxed "b." The HNH-like domain is indicated by a boxed "g." Sm: S. mutans (SEQ ID NO: 1); Sp: S. pyogenes (SEQ ID NO: 2); St: S. thermophilus (SEQ ID NO: 3); Li: L. innocua (SEQ ID NO: 4). Motif: This is a motif based on the four sequences: residues conserved in all four sequences are indicated by single-letter amino acid abbreviations; "*" indicates any amino acid found at the corresponding position in any of the four sequences; "-" indicates any amino acid, e.g., any of the 20 naturally occurring amino acids. [Figure 3A-B]An alignment of the N-terminal RuvC-like domains from the Cas9 molecules disclosed in Chylinski et al. is shown (SEQ ID NOS: 54-103, respectively, in order of appearance). The last row of Figure 3B identifies four highly conserved residues. [Figure 4A-B] Figure 4B shows an alignment of the N-terminal RuvC-like domains from the Cas9 molecules disclosed in Chylinski et al. (SEQ ID NOS: 104-177, respectively, in order of appearance), excluding sequence outliers. The last row of Figure 4B identifies three highly conserved residues. [Figure 5A-C] An alignment of the HNH-like domains from the Cas9 molecules disclosed in Chylinski et al. (SEQ ID NOS: 178-252, respectively, in order of appearance) is shown. The last line of Figure 5C identifies conserved residues. [Figure 6A-B] Figure 6B shows an alignment of the HNH-like domains from the Cas9 molecules disclosed in Chylinski et al. (SEQ ID NOS: 253-302, respectively, in order of appearance), excluding sequence outliers. The last row of Figure 6B identifies three highly conserved residues. [Figure 7A-B] Depicting an alignment of Cas9 sequences from S. pyogenes and Neisseria meningitidis. The N-terminal RuvC-like domain is indicated by a boxed "Y." The other two RuvC-like domains are indicated by a boxed "B." The HNH-like domain is indicated by a boxed "G." Sp: S. pyogenes; Nm: N. meningitidis. Motif: This is a motif based on two sequences: residues conserved in both sequences are indicated by a single amino acid name; "*" indicates any amino acid found at the corresponding position in either of the two sequences; "-" indicates any amino acid, e.g., any of the 20 naturally occurring amino acids; "-" indicates any amino acid, e.g., any of the 20 naturally occurring amino acids, or absence. [Figure 8]
[0023] Figure 3 shows the nucleic acid sequence encoding N. meningitidis Cas9 (SEQ ID NO:303). The sequence designated by "R" is the SV40 NLS; the sequence designated as "G" is the HA tag; and the sequence designated by "O" is a synthetic NLS sequence. The remaining (unmarked) sequence is the open reading frame (ORF). [Figure 9A] 1 shows a schematic depicting the domain organization of S. pyogenes Cas9 with respect to the two lobes of Cas9 (the recognition (REC) and nuclease (NUC) lobes) and the organization of the Cas9 domains, including amino acid positions. [Figure 9B] 8A-8C show a schematic depicting the S. pyogenes Cas9 domain organization, along with the percent homology of each domain across 83 Cas9 orthologs. [Figure 10A] A representative structure of a unimolecular gRNA molecule derived in part from S. pyogenes as a double-stranded structure is shown (SEQ ID NO: 40). [Figure 10B] A representative structure of a unimolecular gRNA molecule derived in part from S. aureus as a double-stranded structure is shown (SEQ ID NO: 41). [Figure 11] Results are shown from an experiment evaluating the activity of gRNAs generated against the TRBC2 gene in 293 cells using S. aureus Cas9. 293s were transfected with two plasmids, one encoding S. aureus Cas9 and the other encoding the indicated gRNA. The graph summarizes the average %NHEJ observed at the TRBC2 locus for each gRNA, calculated from T7E1 assays performed on genomic DNA isolated from replicate samples. [Figure 12]Results are shown from an experiment evaluating the activity of gRNAs aligned against the TRBC1 gene in 293 cells using S. pyogenes Cas9. 293 cells were transfected with two plasmids, one encoding S. pyogenes Cas9 and the other encoding the indicated gRNA. The graph shows the average %NHEJ observed at both the TRBC1 and TRBC2 loci for each gRNA, calculated from T7E1 assays performed on genomic DNA isolated from duplicate samples. [Figure 13] Results are shown from an experiment evaluating the activity of gRNAs generated against the TRAC gene in 293 cells using S. aureus Cas9. 293 cells were transfected with two plasmids, one encoding S. aureus Cas9 and the other encoding the indicated gRNA. The graph shows the average %NHEJ observed at the TRAC locus for each gRNA, calculated from T7E1 assays performed on genomic DNA isolated from replicate samples. [Figure 14] Results are shown from an experiment evaluating the activity of gRNAs generated against the TRAC gene in 293 cells using S. pyogenes Cas9. 293 cells were transfected with two plasmids, one encoding S. pyogenes Cas9 and the other encoding the indicated gRNA. The graph shows the average %NHEJ observed at the TRAC locus for each gRNA, calculated from T7E1 assays performed on genomic DNA isolated from replicate samples. [Figure 15]Results are shown from an experiment evaluating the activity of gRNAs generated against the PDCD1 gene in 293 cells using S. aureus Cas9. 293 cells were transfected with two plasmids, one encoding S. aureus Cas9 and the other encoding the indicated gRNA. The graph shows the average %NHEJ observed at the PDCD1 locus for each gRNA, calculated from T7E1 assays performed on genomic DNA isolated from replicate samples. [Figure 16] Results are shown from an experiment evaluating the activity of gRNAs generated against the PDCD1 gene in 293 cells using S. pyogenes Cas9. 293 cells were transfected with two plasmids, one encoding S. pyogenes Cas9 and the other encoding the indicated gRNA. The graph shows the average %NHEJ observed at the PDCD1 locus for each gRNA, calculated from T7E1 assays performed on genomic DNA isolated from replicate samples. [Figures 17A-C] Figure 17 depicts results showing loss of CD3 expression in CD4+ T cells due to delivery of S. pyogenes Cas9 mRNA and TRBC2 and TRAC gene-specific gRNAs. [Figure 17A] CD4+ T cells electroporated with S. pyogenes Cas9 mRNA and the indicated gRNA (TRBC-210 (GCGCUGACGAUCUGGGUGAC) (SEQ ID NO: 413), TRAC-4 (GCUGGUACACGGCAGGGUCA) (SEQ ID NO: 453), or AAVS1 (GUCCCCUCCACCCCACAGUG) (SEQ ID NO: 51201)), stained with APC-CD3 antibody, and analyzed by FACS. Cells were analyzed 2 and 3 days after electroporation. [Figure 17B] Quantification of the CD3-negative population from the plot in (A) is shown. [Figure 17C] %NHEJ obtained from a T7E1 assay performed at the TRBC2 and TRAC loci. [Figures 18A-C]Figure 18A depicts results showing loss of CD3 expression in Jurkat T cells due to delivery of S. aureus Cas9 / gRNA RNP targeting the TRAC gene. [Figure 18A] Jurkat T cells electroporated with S. aureus Cas9 / gRNATRAC-233 (GUGAAUAGGCAGACAGACUUGUCA) (SEQ ID NO: 474) RNP targeting the TRAC gene, stained with APC-CD3 antibody, and analyzed by FACS. Cells were analyzed 1, 2, and 3 days after electroporation. [Figure 18B] Quantification of the CD3-negative population from the plot in (A) is shown. [Figure 18C] % NHEJ obtained from a T7E1 assay performed at the TRAC locus is shown. [Figure 19] The structure of the 5' ARCA cap is shown. [Figure 20] 1 depicts the results from quantification of viable Jurkat T cells after electroporation with Cas9 mRNA and AAVS1 gRNA. Jurkat T cells were electroporated with S. pyogenes Cas9 mRNA and the respective modified gRNA. 24 hours after electroporation, 1 x 10 cells were stained with a FITC-conjugated annexin V-specific antibody for 15 minutes at room temperature, followed by staining with propidium iodide immediately prior to analysis by flow cytometry. The percentage of cells that did not stain with either annexin V or PI is reported in the bar graph. [Figure 21A-C]Figure 21A depicts the loss of CD3 expression in naive CD3+ T cells due to delivery of S. aureus Cas9 / gRNA RNP targeting TRAC. [Figure 21A] Depicts naive CD3+ T cells electroporated with S. aureus Cas9 / gRNA (with targeting domain GUGAUAGGCAGACAGACUUGUCA (SEQ ID NO: 474)) RNP targeting TRAC stained with APC-CD3 antibody and analyzed by FACS. Cells were analyzed 4 days after electroporation. The negative control is cells with gRNA with targeting domain GUGAUAGGCAGACAGACUUGUCA (SEQ ID NO: 474) but without functional Cas9. [Figure 21B] Depicts quantification of the CD3-negative population from the plot in Figure 21A. [Figure 21C] Depicts NHEJ obtained from % T7E1 assay performed at the TRAC locus. [Figure 22]
[0023] Figure 1 depicts genome editing at the PDCD1 locus in Jurkat T cells following delivery of S. pyogenes Cas9 mRNA and PDCD1 gRNA (with the targeting domain GUCUGGGCGGUGCUACAACU (SEQ ID NO: 508)), or S. pyogenes Cas9 / gRNA RNP (with the targeting domain GUCUGGGCGGUGCUACAACU (SEQ ID NO: 508)) targeting PDCD1. Quantification of %NHEJ from T7E1 assays performed at the PDCD1 locus at 24, 48, and 72 hours. Higher levels of %NHEJ were detected with RNP compared to mRNA delivery.
[0227] definition "Domain" is used herein to describe a protein or nucleic acid portion. Unless otherwise specified, a domain need not have any particular functional property.
[0228] Calculation of homology or sequence identity (the terms are used interchangeably herein) between two sequences is performed as follows: The sequences are aligned for optimal comparison purposes (e.g., for optimal alignment, gaps can be inserted into one or both of the first and second amino acid or nucleic acid sequences, and non-homologous sequences can be ignored for comparison purposes). Optimal alignment is evaluated as the highest score using the GAP program in the GCG software package, with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5, using a Blosum62 weight matrix. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide sequence sites are then compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percentage identity between two sequences is a function of the number of identical positions shared by the sequences.
[0229] As used herein, a "controlling gRNA molecule" refers to a gRNA molecule comprising a targeting domain complementary to a targeting domain on a nucleic acid comprising a sequence encoding a component of a CRISPR / Cas system introduced into a cell or subject. The controlling gRNA does not target an endogenous cellular or subject sequence. In one embodiment, the controlling gRNA molecule comprises a targeting domain complementary to a target sequence on (a) a nucleic acid encoding a Cas9 molecule; (b) a nucleic acid encoding a gRNA comprising a targeting domain targeting a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene (targeting gene gRNA); or on two or more nucleic acids encoding CRISPR / Cas components, e.g., both (a) and (b). In one embodiment, a nucleic acid molecule encoding a CRISPR / Cas component, e.g., encoding a Cas9 molecule or a targeting gene gRNA, comprises two or more targeting domains complementary to the control gRNA targeting domain. Without wishing to be bound by theory, it is believed that the master gRNA molecule forms a complex with the Cas9 molecule, resulting in Cas9-mediated inactivation of the target nucleic acid, e.g., by cleavage or nucleic acid binding, resulting in the disruption or reduction of production of CRISPR / Cas system components. In one embodiment, the Cas9 molecule forms two complexes: a complex comprising a Cas9 molecule with a target gene gRNA that modifies a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene; and a complex comprising a Cas9 molecule with a master gRNA that functions to prevent further production of a CRISPR / Cas system component, e.g., a Cas9 molecule or a target gene gRNA molecule. In one embodiment, the master gRNA molecule / Cas9 molecule complex binds to or promotes cleavage of a regulatory region sequence, such as a promoter, operably linked to the sequence encoding the Cas9 molecule, e.g., a sequence encoding a transcribed region, exon, or intron of the Cas9 molecule. In one embodiment, the governing gRNA molecule / Cas9 molecule complex binds to or promotes cleavage of, for example, a regulatory region sequence of a promoter operably linked to the gRNA molecule or a sequence encoding the gRNA molecule.In one embodiment, a controlling gRNA, e.g., a Cas9-targeting controlling gRNA molecule or a target gene gRNA-targeting controlling gRNA molecule, limits the effectiveness of gene targeting mediated by the Cas9 molecule / target gene gRNA molecule complex. In one embodiment, the controlling gRNA imposes temporal, expression level, or other constraints on the activity of the Cas9 molecule / target gene gRNA molecule complex. In one embodiment, the controlling gRNA reduces off-target or other undesired activity. In one embodiment, the controlling gRNA molecule inhibits, e.g., totally or substantially totally, the production of a component of the Cas9 system, thereby limiting or affecting its activity.
[0230] "Modulator," as used herein, refers to an entity, such as, for example, an agent, that can alter the activity (e.g., enzymatic activity, transcriptional activity, or translational activity), amount, distribution, or structure of a molecule or gene sequence of interest. In one embodiment, modulation comprises cleavage, e.g., breaking a covalent or non-covalent bond, or formation of a covalent or non-covalent bond, e.g., attaching a moiety to the molecule of interest. In one embodiment, a modulator alters the three-dimensional, secondary, tertiary, or quaternary structure of the molecule of interest. A modulator may increase, decrease, initiate, or eliminate an activity of interest.
[0231] "Large molecule," as used herein, refers to a molecule having a molecular weight of at least 2, 3, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 kD. Large molecules include proteins, polypeptides, nucleic acids, biologics, and carbohydrates.
[0232] A "polypeptide," as used herein, refers to a polymer of amino acids having fewer than 100 amino acid residues. In one embodiment, it has fewer than 50, 20, or 10 amino acid residues.
[0233] "Non-homologous end joining" or "NHEJ," as used herein, refers to ligation-mediated and / or non-template-mediated repair, including, for example, forward NHEJ (cNHEJ), alternative NHEJ (altNHEJ), microhomology-mediated end joining (MMEJ), single-strand annealing (SSA), and synthesis-dependent microhomology-mediated end joining (SD-MMEJ).
[0234] As used herein, a "reference molecule," e.g., a reference Cas9 molecule or a reference gRNA, refers to a molecule to which a molecule of interest, e.g., a subject Cas9 molecule or a subject gRNA molecule, e.g., a modified or candidate Cas9 molecule, is compared. For example, a Cas9 molecule may be characterized as having 10% or less of the nuclease activity of the reference Cas9 molecule. Examples of reference Cas9 molecules include naturally occurring, unmodified Cas9 molecules, e.g., naturally occurring Cas9 molecules, e.g., S. pyogenes, S. aureus, or S. thermophilus Cas9 molecules. In one embodiment, a reference Cas9 molecule is a naturally occurring Cas9 molecule that has the closest sequence identity or homology to the Cas9 molecule to which it is being compared. In one embodiment, a reference Cas9 molecule is a sequence, e.g., a naturally occurring or known sequence, e.g., a parental form to which changes, e.g., mutations, have been made.
[0235] "Substituted" or "replaced," as used herein in reference to molecular modification, does not necessarily imply a limitation on the process, but merely that a replacement entity is present.
[0236] "Small molecule," as used herein, refers to a compound having a molecular weight of less than about 2 kD, for example, less than about 2 kD, less than about 1.5 kD, less than about 1 kD, or less than about 0.75 kD.
[0237] "Subject," as used herein, can mean either a human or a non-human animal. The term includes, but is not limited to, mammals (e.g., humans, other primates, pigs, rodents (e.g., mice and rats or hamsters), rabbits, guinea pigs, cows, horses, cats, dogs, sheep, and goats). In one embodiment, the subject is a human. In another embodiment, the subject is poultry.
[0238] "Treat," "treating," and "treatment," as used herein, refer to the treatment of a disease in a mammal, e.g., a human, including, for example, (a) inhibiting the disease, i.e., arresting or preventing its progression; (b) palliating the disease, i.e., causing regression of the disease state; and (c) curing the disease.
[0239] "X," as used herein in the context of an amino acid sequence, refers to any amino acid (eg, any of the 20 naturally occurring amino acids) unless otherwise specified. DETAILED DESCRIPTION OF THE INVENTION
[0240] Improving cancer immunotherapy In one embodiment, the compositions and methods described herein can be used to affect the proliferation of engineered T cells by modifying one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. For engineered T cells to mount an effective anti-tumor response, they must 1) adequately proliferate following transfer into a subject to provide sufficient numbers of specific tumor-targeting T cells; 2) survive long enough to maintain the necessary anti-tumor activity in the subject; and 3) avoid the influence of suppressive factors produced by immune cells, tumor cells, and other cells in the tumor environment so that the engineered T cells maintain a functional anti-tumor phenotype. Poor proliferation and / or survival, as well as sensitivity to inhibitory factors, can contribute to the lack of efficacy of engineered T cells in subjects with cancer. The methods and compositions disclosed herein address these issues to improve the efficacy of engineered T cells as cancer therapy.
[0241] In one embodiment, the compositions and methods described herein can be used to modify the CBLB gene to affect the proliferation of engineered T cells. Without wishing to be bound by theory, reduced or absent expression of the Casitas B-lineage lymphoma b protein (encoded by CBLB) is believed to reduce the need for exogenous interleukin signaling to promote the proliferation of engineered T cells following transfer into a subject (Stromnes, I M et al., 2010 J. Clin. Invest. 120, 3722-3734).
[0242] In one embodiment, the compositions and methods described herein can be used to modify the PTPN6 gene to affect the proliferation of genetically engineered T cells. Without wishing to be bound by theory, it is believed that reduced or absent expression of the Src homology region 2 domain-containing phosphatase-1 protein (encoded by PTPN6) leads to increased short-term accumulation of transferred T cells, which subsequently improves anti-tumor activity (Stromnes, I M et al., 2012 J. Immunol. 189, 1812-1825).
[0243] In one embodiment, the compositions and methods described herein can be used to modify the FAS gene, which can affect the proliferation of genetically engineered T cells. Without wishing to be bound by theory, it is believed that reduced or absent Fas protein expression inhibits the induction of T cell apoptosis by Fas ligand, a factor expressed by many cancer types (Dotti, G. et al., 2005 Blood 105, 4677-4684).
[0244] In one embodiment, the compositions and methods described herein can be used to modify the BID gene to affect the proliferation of genetically engineered T cells. Without wishing to be bound by theory, it is believed that reduced or absent Bid protein expression prevents the induction of T cell apoptosis following Fas pathway activation (Lei, XY et al., 2009 Immunol. Lett. 122, 30-36).
[0245] In one embodiment, the compositions and methods described herein may be used to modify the CTLA4 gene, thereby reducing the effect of immunosuppressive factors on genetically engineered T cells. Without wishing to be bound by theory, it is believed that reduced or absent expression of cytotoxic T-lymphocyte-associated antigen 4 (encoded by CTLA4) prevents the induction of an unresponsive state ("anergy") following engagement of CD80 or CD86 expressed by antigen-presenting cells in the tumor environment (Shrikant, P. et al., 1999 Immunity 11, 483-493).
[0246] In one embodiment, the compositions and methods described herein may be used to modify the PDCD1 gene, thereby reducing the effect of immunosuppressive factors on genetically engineered T cells. Without wishing to be bound by theory, it is believed that reduced or absent expression of programmed cell death protein 1 (encoded by PDCD1) prevents the induction of T cell apoptosis by binding of PD1 ligands expressed by tumor cells or cells within the tumor environment (Topalian, SLet et al., 2012 N. Engl. J. Med. 366, 2443-2454).
[0247] In one embodiment, the compositions and methods described herein can be used to modify the TRAC and / or TRBC genes to improve T cell specificity and safety. Without wishing to be bound by theory, it is believed that reduced or absent T cell receptor (encoded by TRAC and TRBC) expression prevents graft-versus-host disease by eliminating T cell receptor recognition and host tissue responses. Therefore, this approach can be used to generate "universal" T cells (Torikai et al., 2012 Blood 119, 5697-5705). Also, without wishing to be bound by theory, it is believed that reduced or absent TRAC and / or TRBC gene expression reduces or eliminates mispairing of endogenous T cell receptors with exogenously transgenetically engineered T cell receptors, thereby improving therapeutic efficacy (Provasi et al., 2012 Nature Medicine 18, 807-815).
[0248] In one embodiment, the compositions and methods described herein may be used to improve cancer immunotherapy treatment by using genetically engineered T cells to reduce one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0249] Disclosed herein is an approach to treating cancer via immunotherapy using the compositions and methods described herein.
[0250] In one approach, one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes are targeted for targeted knockout or knockdown, e.g., to affect T cell proliferation, survival, and / or function. In one embodiment, the approach comprises knocking out or knocking down one T cell-expressed gene (e.g., the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene). In another embodiment, the approach comprises knocking out or knocking down two T cell-expressed genes, e.g., two of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes, respectively. In another embodiment, the approach comprises knocking out or knocking down three T cell-expressed genes, e.g., three of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes, respectively. In another embodiment, the approach comprises knocking out or knocking down four genes expressed by T cells, e.g., four of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes, respectively. In another embodiment, the approach comprises knocking out or knocking down five genes expressed by T cells, e.g., five of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes, respectively. In another embodiment, the approach comprises knocking out or knocking down six genes expressed by T cells, e.g., six of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes, respectively. In another embodiment, the approach comprises knocking out or knocking down seven genes expressed by T cells, e.g., seven of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes, respectively.In another embodiment, the approach comprises knocking out or knocking down each of eight genes expressed by T cells, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
[0251] In one embodiment, the method comprises initiating treatment of the subject after disease onset, hi one embodiment, the method comprises initiating treatment of the subject sufficiently after disease onset, such as, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 24, or 36 months after onset of cancer.
[0252] In one embodiment, the method comprises initiating treatment of a subject at an advanced stage of the disease.
[0253] Overall, initiating treatment of subjects at all stages of the disease is expected to benefit the subject.
[0254] Cancers that may be treated using the compositions and methods disclosed herein include blood cancers and solid tumors.For example, cancers that may be treated using the compositions and methods disclosed herein include, but are not limited to, lymphoma, chronic lymphocytic leukemia (CLL), B-cell acute lymphocytic leukemia (B-ALL), acute lymphoblastic leukemia, acute myeloid leukemia, non-Hodgkin's lymphoma (NHL), diffuse large cell lymphoma (DELL), multiple myeloma, renal cell carcinoma (RCC), neuroblastoma, colorectal cancer, breast cancer, ovarian cancer, melanoma, sarcoma, prostate cancer, lung cancer, esophageal cancer, hepatocellular carcinoma, pancreatic cancer, astrocytoma, mesothelioma, head and neck cancer, and medulloblastoma.
[0255] Methods for modifying one or more T cell expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC genes. As disclosed herein, one or more T cell expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC genes, can be targeted (e.g., modified) by gene editing, e.g., using CRISPR-Cas9 mediated methods as described herein.
[0256] The methods and compositions discussed herein provide for targeting (e.g., modifying) T cell target loci in one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. T cell target loci can be targeted (e.g., modified) by gene editing, such as, for example, using CRISPR-Cas9-mediated methods to target (e.g., modify) one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes.
[0257] Disclosed herein are methods for targeting (e.g., modifying) T cell target loci in one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes.
[0258] Targeting (e.g., modifying) T cell target loci can be achieved, for example, by: (1) knocking out one or more T cell expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC genes: (a) an insertion or deletion (e.g., an NHEJ-mediated insertion or deletion) of one or more nucleotides near or within the coding region of one or more T cell-expressed genes, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes; or (b) deletion of genomic sequences (e.g., NHEJ-mediated deletion), including at least a portion of one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes; or (2) knockdown of one or more T cell-expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, and / or PTPN6 genes, mediated by enzymatically inactive Cas9 (eiCas9) molecules or eiCas9 fusion proteins, for example, by targeting non-coding regions, such as the promoter regions of the genes; This is achieved by:
[0259] All approaches result in the targeting (e.g., modification) of one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC genes.
[0260] In one embodiment, the methods described herein introduce one or more truncations near the coding region of at least one allele of one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In another embodiment, the methods described herein introduce two or more truncations flanking at least a portion of one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. The two or more truncations remove (e.g., delete) genomic sequence comprising at least a portion of one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In another embodiment, the methods described herein comprise knocking down one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, and / or PTPN6 genes, mediated by an enzymatically inactive Cas9 (eiCas9) molecule or an eiCas9 fusion protein by targeting the promoter region of the T cell-targeted knockdown location. All of the methods described herein result in the targeting (e.g., modification) of one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes.
[0261] Targeting (e.g., modification) of one or more T cell-expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes, can be mediated by any mechanism. Exemplary mechanisms that may be involved in the modification of one or more T cell-expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes, include, but are not limited to, non-homologous end joining (e.g., classical or alternative), microhomology-mediated end joining (MMEJ), homology-directed repair (e.g., endogenous donor template-mediated), SDSA (synthesis-dependent strand annealing), single-strand annealing, or single-strand invasion.
[0262] Knockout of one or more T cell expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC genes, by introduction of an indel or deletion in one or more T cell expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC genes. In one embodiment, the method comprises introducing an insertion or deletion of another nucleotide near a T cell targeted knockout location (e.g., in an early coding region) of one or more T cell expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. As described herein, in one embodiment, the method comprises introducing one or more breaks (e.g., single-strand or double-strand breaks) into a T cell targeted knockout location, such as, for example, in the coding region (e.g., in an early coding region, such as within 500 bp from the start codon, or in the remaining coding sequence, such as, for example, the first 500 bp downstream from the start codon) of one or more T cell expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. Without wishing to be bound by theory, it is believed that NHEJ-mediated repair of the breaks allows for NHEJ-mediated introduction of an indel near the T cell targeted knockout location.
[0263] In one embodiment, a single-stranded break (e.g., positioned by one gRNA molecule) is introduced at or near the T cell target knockout location in one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, a single gRNA molecule (e.g., with a Cas9 nickase) is used to create a single-stranded break at or near the T cell target knockout location, such as, for example, a coding region (e.g., an early coding region, such as within 500 bp from the start codon, or the remaining coding sequence, such as, for example, the first 500 bp downstream from the start codon). In one embodiment, the break is positioned to avoid unwanted target chromosomal elements, such as, for example, repetitive elements such as Alu repeats.
[0264] In one embodiment, a double-stranded break (e.g., positioned by a single gRNA molecule) is introduced at or near a T cell target knockout location in one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, a single gRNA molecule (e.g., with a Cas9 nuclease other than a Cas9 nickase) is used to create a double-stranded break at or near a T cell target knockout location, such as, for example, a coding region (e.g., an early coding region, such as within 500 bp from the start codon, or the remaining coding sequence, such as, for example, the first 500 bp downstream from the start codon). In one embodiment, the break is positioned to avoid unwanted target chromosomal elements, such as, for example, repetitive elements such as Alu repeats.
[0265] In one embodiment, two single-stranded breaks (e.g., positioned by two gRNA molecules) are introduced at or near a T cell target knockout location in one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, two gRNA molecules (e.g., with one or two Cas9 nickcases) are used to create two single-stranded breaks at or near a T cell target knockout location, such as, for example, a coding region (e.g., an early coding region, e.g., within 500 bp from the start codon, or the remaining coding sequence, e.g., the first 500 bp downstream from the start codon). In one embodiment, the gRNA molecules are configured such that both single-stranded breaks are located upstream or downstream of the T cell target knockout location. In another embodiment, two gRNA molecules (e.g., with two Cas9 nickcases) are used to generate two single-stranded breaks at or near the T cell target knockout location, e.g., the gRNA molecules are configured such that one single-stranded break is located upstream and the second single-stranded break is located downstream of the T cell target knockout location. In one embodiment, the breaks are positioned to avoid unwanted target chromosomal elements, e.g., repetitive elements such as Alu repeats.
[0266] In one embodiment, two sets of cuts (e.g., two double-stranded breaks) are introduced (e.g., positioned by two gRNA molecules) at or near a T cell target knockout location in one or more T cell-expressed genes, e.g., in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, two gRNA molecules (e.g., with one or two Cas9 nucleases that are not Cas9 nickases) are used to create two double-stranded breaks flanking the T cell target knockout location, e.g., in the coding region (e.g., the early coding region, e.g., within 500 bp from the start codon, or the remaining coding sequence, e.g., the first 500 bp downstream from the start codon). In one embodiment, the gRNA molecules are configured such that both sets of cuts are located upstream or downstream of the T cell target knockout location. In one embodiment, the gRNA molecules are configured such that one cut set is located upstream and the second cut set is located downstream of the T cell target knockout location. In one embodiment, the cut is positioned to avoid unwanted target chromosomal elements, for example repetitive elements such as Alu repeats.
[0267] In one embodiment, two sets of cuts (e.g., one double-stranded break and one pair of single-stranded breaks) are introduced (e.g., positioned by three gRNA molecules) at or near a T cell target knockout location of one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, three gRNA molecules (e.g., with a Cas9 nuclease and one or two Cas9 nickases) are used to create two sets of cuts flanking the T cell target knockout location, e.g., the coding region (e.g., the early coding region, e.g., within 500 bp from the start codon, or the remaining coding sequence, e.g., the first 500 bp downstream from the start codon). In one embodiment, the gRNA molecules are configured such that both sets of cuts are located upstream or downstream of the T cell target knockout location. In one embodiment, the gRNA molecules are configured such that one set of cuts is located upstream and the second set of cuts is located downstream of the T cell target knockout location. In one embodiment, the cut is positioned to avoid unwanted target chromosomal elements, for example repetitive elements such as Alu repeats.
[0268] In one embodiment, two sets of cuts (e.g., two pairs of single-strand cuts) are introduced (e.g., positioned by four gRNA molecules) at or near the T cell target knockout location in one or more T cell-expressed genes, e.g., in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, four gRNA molecules (e.g., with one or more Cas9 nickases) are used to generate two sets of cuts flanking the T cell target knockout location, e.g., the coding region (e.g., the early coding region, e.g., within 500 bp from the start codon, or the remaining coding sequence, e.g., the first 500 bp downstream from the start codon). In one embodiment, the gRNA molecules are configured such that both sets of cuts are located upstream or downstream of the T cell target knockout location. In one embodiment, the gRNA molecules are configured such that one set of cuts is located upstream and the second set of cuts is located downstream of the T cell target knockout location. In one embodiment, the cut is positioned to avoid unwanted target chromosomal elements, for example repetitive elements such as Alu repeats.
[0269] In one embodiment, two or more (e.g., three or four) gRNA molecules are used with one Cas9 molecule. In another embodiment, when two or more (e.g., three or four) gRNAs are used with two or more Cas9 molecules, at least one Cas9 molecule is derived from a different biological species from the other Cas9 molecules. For example, when two gRNA molecules are used with two Cas9 molecules, one Cas9 molecule can be derived from one biological species and the other Cas9 molecule can be derived from a different biological species. Both Cas9 species are used to generate single- or double-strand breaks as desired.
[0270] When two or more genes are targeted for modification within a cell, the target nucleic acid may be modified, for example, by cleavage with one or more Cas9 proteins. For example, when two genes are targeted for modification, such as when two genes are targeted for knockout, each gene may be targeted using the same or different Cas9 proteins. In one embodiment, both genes (or each gene targeted within a cell) are cleaved by Cas9 nuclease to generate a double-strand break. In another embodiment, both genes (or each gene targeted within a cell) are cleaved by Cas9 nuclease to generate a double-strand break. In another embodiment, one or more genes within a cell may be modified by cleavage with Cas9 nuclease, and one or more genes within the same cell may be modified by cleavage with Cas9 nickase. When two or more Cas9 proteins are used to cleave target nucleic acids, such as different genes, within a cell, the Cas9 proteins may be derived from different bacterial species. For example, one or more genes in a cell may be modified by cleavage with a Cas9 protein from one bacterial species, and one or more genes in the same cell may be modified by cleavage with a Cas9 protein from a different bacterial species. When two or more Cas9 proteins from different species are used, it is contemplated that they may be delivered simultaneously or sequentially to control the cleavage specificity in a desired gene at a desired location in a target nucleic acid.
[0271] In some embodiments, the targeting domain of the first gRNA molecule and the targeting domain of the second gRNA molecule are complementary to opposite target strand nucleic acid molecules. In some embodiments, the gRNA molecule and the second gRNA molecule are configured with the PAM facing outward.
[0272] For example, by deleting genomic sequences including at least a portion of one or more T cell expressed genes, such as FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes (e.g., NHEJ-mediated deletion), knocking out one or more T cell expressed genes, such as FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, a method comprises introducing a deletion of a genomic sequence comprising at least a portion of one or more T cell-expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. As described herein, in one embodiment, a method comprises introducing two double-stranded breaks, one 5' and one 3' (i.e., flanking) the T cell target knockout location. In one embodiment, two gRNAs, e.g., unimolecular (or chimeric) or modular gRNA molecules, are designed such that two sets of breaks (e.g., two double-stranded breaks, one double-stranded break and a pair of single-stranded breaks, or two pairs of single-stranded breaks) are located on opposite sides of the T cell target knockout location in one or more T cell-expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes.
[0273] In one embodiment, the method comprises removing (e.g., NHEJ-mediated deletion) genomic sequences comprising at least a portion of one or more T cell expressible genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC gene genes. As described herein, in one embodiment, a method comprises introducing two sets of breaks (e.g., a pair of double-stranded breaks, one double-stranded break or a pair of single-stranded breaks, or two pairs of single-stranded breaks) flanking a region in one or more T cell expressible genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC gene genes (e.g., a coding region, e.g., an early coding region, or a non-coding region, e.g., a promoter, enhancer, intron, 3'UTR, and / or a non-coding sequence, e.g., a polyadenylation signal, of one or more T cell expressible genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC gene genes). Without wishing to be bound by theory, it is believed that NHEJ-mediated repair of the break allows for modification of one or more T cell expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC gene genes as described herein, to reduce or eliminate expression of the gene, e.g., to knock out one or both alleles of one or more T cell expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and / or TRBC gene genes.
[0274] In one embodiment, two sets of cuts (e.g., two double-stranded breaks) are introduced (e.g., positioned by two gRNA molecules) at or near a T cell target knockout locus in one or more T cell-expressed genes, e.g., in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, two gRNA molecules (e.g., with one or two Cas9 nucleases that are not Cas9 nickases) are used to generate two sets of cuts flanking the T cell target knockout locus, e.g., the gRNA molecules are configured such that one set of cuts is located upstream and the second set of cuts is located downstream of the T cell target knockout locus. In one embodiment, the cuts are positioned to avoid unwanted target chromosomal elements, e.g., repetitive elements such as Alu repeats.
[0275] In one embodiment, two sets of cuts (e.g., one double-stranded break and one pair of single-stranded breaks) are introduced (e.g., positioned by three gRNA molecules) at or near a T cell target knockout locus of one or more T cell-expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, three gRNA molecules (e.g., with a Cas9 nuclease and one or two Cas9 nickases) are used to generate two sets of cuts flanking the T cell target knockout locus, e.g., the gRNA molecules are configured such that one set of cuts is located upstream and the second set of cuts is located downstream of the T cell target knockout locus. In one embodiment, the cuts are positioned to avoid unwanted target chromosomal elements, e.g., repetitive elements such as Alu repeats.
[0276] In one embodiment, two sets of cuts (e.g., two pairs of single-stranded cuts) are introduced (e.g., positioned by four gRNA molecules) at or near the T cell target knockout locus in one or more T cell-expressed genes, e.g., in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and / or TRBC genes. In one embodiment, four gRNA molecules (e.g., with a Cas9 nuclease and one or two Cas9 nickases) are used to generate two sets of cuts flanking the T cell target knockout locus, e.g., the gRNA molecules are configured such that one set of cuts is located upstream and the second set of cuts is located downstream of the T cell target knockout locus. In one embodiment, the cuts are positioned to avoid unwanted target chromosomal elements, e.g., repetitive elements such as Alu repeats.
[0277] In one embodiment, two or more (e.g., three or four) gRNA molecules are used with one Cas9 molecule. In another embodiment, when two or more (e.g., three or four) gRNAs are used with two or more Cas9 molecules, at least one Cas9 molecule is derived from a different biological species from the other Cas9 molecules. For example, when two gRNA molecules are used with two Cas9 molecules, one Cas9 molecule can be derived from one biological species and the other Cas9 molecule can be derived from a different biological species. Both Cas9 species are used to generate single- or double-strand breaks as desired.
[0278] When two or more genes are targeted for modification within a cell, the target nucleic acid may be modified, for example, by cleavage with one or more Cas9 proteins. For example, when two genes are targeted for modification, such as when two genes are targeted for knockout, each gene may be targeted using the same or different Cas9 proteins. In one embodiment, both genes (or each gene targeted within a cell) are cleaved by Cas9 nuclease to generate a double-strand break. In another embodiment, both genes (or each gene targeted within a cell) are cleaved by Cas9 nuclease to generate a double-strand break. In another embodiment, one or more genes within a cell may be modified by cleavage with Cas9 nuclease, and one or more genes within the same cell may be modified by cleavage with Cas9 nickase. When two or more Cas9 proteins are used to cleave target nucleic acids, such as different genes, within a cell, the Cas9 proteins may be derived from different bacterial species. For example, one or more genes in a cell may be modified by cleavage with a Cas9 protein from one bacterial species, and one or more genes in the same cell may be modified by cleavage with a Cas9 protein from a different bacterial species. When two or more Cas9 proteins from different species are used, it is contemplated that they may be delivered simultaneously or sequentially to control the cleavage specificity in a desired gene at a desired location in a target nucleic acid.
[0279] In some embodiments, the targeting domain of the first gRNA molecule and the targeting domain of the second gRNA molecule are complementary to opposite target strand nucleic acid molecules. In some embodiments, the gRNA molecule and the second gRNA molecule are configured with the PAM facing outward.
[0280] Knockdown of one or more T cell expressed genes, such as, for example, FAS, BID, CTLA4, PDCD1, CBLB, and / or PTPN6 genes, mediated by an enzymatically inactive Cas9 (eiCas9) molecule. The targeted knockdown approach reduces or eliminates expression of functional FAS, BID, CTLA4, PDCD1, CBLB, and / or PTPN6 gene products. As described herein, in one embodiment, the targeted knockdown is mediated by targeting an enzymatically inactive Cas9 (eiCas9) molecule or eiCas9 fused to a transcriptional repressor domain or chromatin-modifying protein to alter transcription, e.g., prevent, reduce, or decrease transcription of one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, P, and / or PTPN6 genes.
[0281] The methods and compositions discussed herein may be used to modify the expression of one or more T cell expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, and / or PTPN6 genes, to treat or prevent HIV infection or AIDS, for example, by targeting the promoter region of one or more T cell expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, and / or PTPN6 genes. In one embodiment, the promoter region targets knockdown of expression of one or more T cell expressed genes, such as, for example, the FAS, BID, CTLA4, PDCD1, CBLB, and / or PTPN6 genes. The targeted knockdown approach reduces or eliminates expression of functional FAS, BID, CTLA4, PDCD1, CBLB, and / or PTPN6 gene products. As described herein, in one embodiment, targeted knockdown is mediated by targeting enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein (e.g., eiCas9 fused to a transcriptional repressor domain or a chromatin-modifying protein) to alter transcription, e.g., prevent, decrease, or reduce transcription of one or more T cell-expressed genes, e.g., FAS, BID, CTLA4, PDCD1, CBLB, P, and / or PTPN6 genes.
[0282] In one embodiment, one or more eiCas9s can be used to disrupt the binding of one or more endogenous transcription factors. In another embodiment, eiCas9s can be fused to chromatin-modifying proteins. Modifying chromatin state can result in reduced expression of target genes. One or more eiCas9s fused to one or more chromatin-modifying proteins can be used to modify chromatin state.
[0283] When two or more genes are targeted for modification within a cell, the target nucleic acid may be modified, for example, by one or more eiCas9 proteins or eiCas9 fusion proteins. When two or more eiCas9 proteins or eiCas9 fusion proteins are used, the eiCas9 proteins or eiCas9 fusion proteins may be derived from different bacterial species. For example, one or more genes within a cell may be modified by an eiCas9 protein or eiCas9 fusion protein derived from one bacterial species, and one or more genes within the same cell may be modified by an eiCas9 protein or eiCas9 fusion protein derived from a different bacterial species. When two or more eiCas9 proteins or eiCas9 fusion proteins derived from different biological species are used, they may be delivered simultaneously or sequentially to control the cleavage specificity within a desired gene at a desired location in the target nucleic acid.
[0284] Without wishing to be bound by theory, it is believed that adoptive transfer of genetically engineered T cells may provide a possible treatment for cancer. A gene encoding a cell surface receptor is inserted into the T cells. The genetically engineered T cells can detect tumor-associated antigens that can be used to distinguish tumor cells from most normal tissues.
[0285] Knockout or knockdown of one or two alleles of a target gene (e.g., a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene) may be performed after disease onset, but is preferably performed early in the disease course.
[0286] I.gRNA molecule As used herein, gRNA molecule refers to a nucleic acid that facilitates specific targeting or auto-guiding of a gRNA molecule / Cas9 molecule complex to a target nucleic acid. A gRNA molecule can be unimolecular (having a single RNA molecule), sometimes referred to herein as a "chimeric" gRNA, or modular (comprising two or more, typically two separate RNA molecules). A gRNA molecule comprises several domains. The gRNA molecule domains are described in detail below.
[0287] Some representative gRNA structures with domains depicted thereon are provided in Figure 1. Without wishing to be bound by theory, regions of high complementarity are sometimes shown as double-stranded in Figure 1, and other depictions are provided herein, with respect to the three-dimensional shape of the active form of the gRNA, or intra- or inter-strand interactions.
[0288] In one embodiment, the unimolecular gRNA or chimeric gRNA preferably has the following in the 5' to 3' direction: a targeting domain (e.g., complementary to a target nucleic acid in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, such as a targeting domain from any of Tables 1A-I, 2A-I, 3A-H, 4A-I, 5A-I, 6A-I, 7A-H, 8A-H, 9A-I, 10A-I, 11A-I, 12A-I, 13A-K, 14A-K, 15A-F, 16A-K, 17A-K, 18A-K, 19A-J, 20A-J, 21A-K, 22A-K, 23A-J, 24A-K, 25A-G, 26A-G, 27, 29, 31, or 32); first complementary domain; Concatenated domains; a second complementarity domain (complementary to the first complementarity domain); adjacent domains; and Optionally, a tail domain The compound comprises:
[0289] In one embodiment, the modular gRNA comprises: Preferably, in the 5' to 3' direction, a targeting domain (e.g., complementary to a target nucleic acid in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene, such as a targeting domain from Table 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32); and a first strand comprising a first complementary domain, and Preferably in the 5' to 3' direction, optionally a 5' extension domain; a second complementary domain; adjacent domains; and Optionally, a second strand comprising a tail domain The compound comprises:
[0290] Domains are briefly discussed below. Targeted Domains FIG. 1 provides an example of the placement of a targeting domain.
[0291] The targeting domain comprises a complementary nucleotide sequence, e.g., at least 80, 85, 90, 95, 98, or 99% complementary, e.g., fully complementary, to the target sequence of the target nucleic acid. The targeting domain is a portion of an RNA molecule and therefore comprises the base uracil (U), while any DNA encoding the gRNA molecule comprises the base thymine (T). Without wishing to be bound by theory, in one embodiment, the complementarity between the target sequence and the targeting domain is believed to contribute to the specificity of the interaction between the target nucleic acid and the gRNA molecule / Cas9 molecule complex. In targeting domain and target sequence pairing, it is understood that the uracil base in the targeting domain pairs with the adenine base in the target sequence. In one embodiment, the targeting domain itself comprises, from 5' to 3', an optional secondary domain and a core domain. In one embodiment, the core domain is fully complementary to the target sequence. In one embodiment, the targeting domain is 5 to 50 nucleotides in length. The strand of a target nucleic acid to which a targeting domain is complementary is referred to herein as the complementary strand. Some or all of the nucleotides of the domain may have modifications, such as, for example, those found in Section VIII of the present specification.
[0292] In one embodiment, the targeting domain is 16 nucleotides in length.
[0293] In one embodiment, the targeting domain is 17 nucleotides in length.
[0294] In one embodiment, the targeting domain is 18 nucleotides in length.
[0295] In one embodiment, the targeting domain is 19 nucleotides in length.
[0296] In one embodiment, the targeting domain is 20 nucleotides in length.
[0297] In one embodiment, the targeting domain is 21 nucleotides in length.
[0298] In one embodiment, the targeting domain is 22 nucleotides in length.
[0299] In one embodiment, the targeting domain is 23 nucleotides in length.
[0300] In one embodiment, the targeting domain is 24 nucleotides in length.
[0301] In one embodiment, the targeting domain is 25 nucleotides in length.
[0302] In one embodiment, the targeting domain is 26 nucleotides in length.
[0303] In one embodiment, the targeting domain comprises 16 nucleotides.
[0304] In one embodiment, the targeting domain comprises 17 nucleotides.
[0305] In one embodiment, the targeting domain comprises 18 nucleotides.
[0306] In one embodiment, the targeting domain comprises 19 nucleotides.
[0307] In one embodiment, the targeting domain comprises 20 nucleotides.
[0308] In one embodiment, the targeting domain comprises 21 nucleotides.
[0309] In one embodiment, the targeting domain comprises 22 nucleotides.
[0310] In one embodiment, the targeting domain comprises 23 nucleotides.
[0311] In one embodiment, the targeting domain comprises 24 nucleotides.
[0312] In one embodiment, the targeting domain comprises 25 nucleotides.
[0313] In one embodiment, the targeting domain comprises 26 nucleotides.
[0314] Targeting domains are discussed in more detail below.
[0315] First complementary domain 1A-1G provide examples of first complementary domains.
[0316] The first complementary domain is complementary to the second complementary domain and, in one embodiment, has sufficient complementarity with the second complementary domain to form a duplex region under at least some physiological conditions. In one embodiment, the first complementary domain is 5 to 30 nucleotides in length. In one embodiment, the first complementary domain is 5 to 25 nucleotides in length. In one embodiment, the first complementary domain is 7 to 25 nucleotides in length. In one embodiment, the first complementary domain is 7 to 22 nucleotides in length. In one embodiment, the first complementary domain is 7 to 18 nucleotides in length. In one embodiment, the first complementary domain is 7 to 15 nucleotides in length. In one embodiment, the first complementary domain is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length.
[0317] In one embodiment, the first complementary domain comprises three subdomains, from 5' to 3': a 5' subdomain, a central subdomain, and a 3' subdomain. In one embodiment, the 5' subdomain is 4 to 9 nucleotides in length, e.g., 4, 5, 6, 7, 8, or 9. In one embodiment, the central subdomain is 1, 2, or 3 nucleotides in length, e.g., 1. In one embodiment, the 3' subdomain is 3 to 25 nucleotides in length, e.g., 4 to 22, 4 to 18, or 4 to 10, or 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.
[0318] The first complementary domain can share homology with or be derived from a naturally occurring first complementary domain, hi one embodiment, it has at least 50% homology with a first complementary domain disclosed herein, such as a first complementary domain of S. pyogenes, S. aureus, N. meningitidis, or S. thermophilus.
[0319] Some or all of the nucleotides of the first complementary domain may have modifications such as, for example, those found in Section VIII herein.
[0320] The first complementary domain is discussed in more detail below.
[0321] Linked Domains 1A-1G provide examples of linking domains.
[0322] The linking domain serves to link the first and second complementary domains of the unimolecular gRNA. The linking domain may link the first and second complementary domains covalently or non-covalently. In one embodiment, the linking domain is a covalent bond. In one embodiment, the linking domain covalently links the first and second complementary domains, see, e.g., Figures 1B-1E. In one embodiment, the linking domain is or comprises a covalent bond inserted between the first and second complementary domains. Typically, the linking domain comprises one or more nucleotides, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10.
[0323] In modular gRNA molecules, the two molecules are joined by hybridization of complementary domains, see, e.g., Figure 1A.
[0324] A wide variety of linking domains are suitable for use in a single-molecule gRNA molecule. Linking domains can consist of a covalent bond or can be as short as one or a few nucleotides, e.g., 1, 2, 3, 4, or 5 nucleotides in length. In one embodiment, the linking domain is 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 nucleotides in length or more. In one embodiment, the linking domain is 2-50, 2-40, 2-30, 2-20, 2-10, or 2-5 nucleotides in length. In one embodiment, the linking domain shares homology with or is derived from a naturally occurring sequence, such as, for example, the sequence of a tracrRNA that is 5' to the second complementary domain. In one embodiment, the linking domain has at least 50% homology to a linking domain disclosed herein.
[0325] Some or all of the nucleotides of the linking domain may have modifications, such as, for example, those found in Section VIII herein.
[0326] Linking domains are discussed in more detail below.
[0327] 5' extension domain In one embodiment, the modular gRNA may comprise additional sequence 5' to the second complementary domain, referred to herein as the 5' extension domain; see, e.g., Figure 1A. In one embodiment, the 5' extension domain is 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, or 2-4 nucleotides in length. In one embodiment, the 5' extension domain is 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides in length.
[0328] Second complementary domain 1A-1G provide examples of second complementary domains.
[0329] The second complementary domain is complementary to the first complementary domain and, in one embodiment, has sufficient complementarity with the second complementary domain to form a duplex region under at least some physiological conditions. For example, as shown in Figures 1A-1B, in one embodiment, the second complementary domain can include a sequence that lacks complementarity with the first complementary domain, such as a sequence that loops out from the duplex region. In one embodiment, the second complementary domain is 5-27 nucleotides in length. In one embodiment, it is longer than the first complementary region.
[0330] In one embodiment, the second complementary domain is 7 to 27 nucleotides in length. In one embodiment, the second complementary domain is 7 to 25 nucleotides in length. In one embodiment, the second complementary domain is 7 to 20 nucleotides in length. In one embodiment, the second complementary domain is 7 to 17 nucleotides in length. In one embodiment, the complementary domain is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.
[0331] In one embodiment, the second complementary domain comprises three subdomains, from 5' to 3': a 5' subdomain, a central subdomain, and a 3' subdomain. In one embodiment, the 5' subdomain is 3 to 25 nucleotides in length, e.g., 4 to 22, 4 to 18, or 4 to 10, or 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In one embodiment, the central subdomain is 1, 2, 3, 4, or 5 nucleotides in length, e.g., 3. In one embodiment, the 3' subdomain is 4 to 9 nucleotides in length, e.g., 4, 5, 6, 7, 8, or 9.
[0332] In one embodiment, the 5' and 3' subdomains of the first complementary domain are complementary, eg, perfectly complementary, to the 3' and 5' subdomains of the second complementary domain, respectively.
[0333] The second complementary domain can share homology with or be derived from a naturally occurring second complementary domain, hi one embodiment, it has at least 50% homology with a second complementary domain disclosed herein, such as a first complementary domain of S. pyogenes, S. aureus, N. meningitidis, or S. thermophilus.
[0334] Some or all of the nucleotides of the second complementary domain may have modifications such as, for example, those found in Section VIII herein.
[0335] Adjacent domains 1A-1G provide examples of flanking domains.
[0336] In one embodiment, the flanking domain is 5-20 nucleotides in length. In one embodiment, the flanking domain shares homology with or can be derived from a naturally occurring flanking domain. In one embodiment, it has at least 50% homology to a flanking domain disclosed herein, such as, for example, an S. pyogenes, S. aureus, N. meningitidis, or S. thermophilus flanking domain.
[0337] Some or all of the nucleotides of the flanking domains may have modifications such as, for example, those found in Section VIII herein.
[0338] 7) Tail domain 1A-1G provide examples of tail domains.
[0339] As can be seen by inspection of the tail domains in Figure 1A and Figures 1B-1F, a wide range of tail domains are suitable for use in gRNA molecules. In one embodiment, the tail domain is 0 (absent), 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In one embodiment, the tail domain nucleotides are derived from or share homology with a sequence from the 5' end of a naturally occurring tail domain; see, e.g., Figure 1D or Figure 1E. In one embodiment, the tail domain comprises sequences that are complementary to each other and form a duplex region under at least some physiological conditions.
[0340] In one embodiment, the tail domain is absent or is 1-50 nucleotides in length. In one embodiment, the tail domain shares homology with or can be derived from a naturally occurring adjacent tail domain. In one embodiment, it has at least 50% homology to a tail domain disclosed herein, such as, for example, an S. pyogenes, S. aureus, N. meningitidis, or S. thermophilus tail domain.
[0341] In one embodiment, the tail domain comprises 3'-terminal nucleotides relevant to in vitro or in vivo transcription methods. When a T7 promoter is used for in vitro transcription of gRNA, these nucleotides may be any nucleotides present before the 3'-end of the DNA template. When a U6 promoter is used for in vivo transcription, these nucleotides may be the UUUUUU sequence. When an alternate Pol-III promoter is utilized, these nucleotides may be of varying numbers or uracil bases, or may include alternate bases.
[0342] The domains of the gRNA molecule are detailed below.
[0343] Targeted Domains The "targeting domain" of the gRNA is complementary to the "targeting domain" on the target nucleic acid. The target nucleic acid strand comprising the core domain target is referred to herein as the "complementary strand" of the target nucleic acid. Guidance for selecting the targeting domain can be found, for example, in Fu Y et al., Nat Biotechnol 2014 (doi:10.1038 / nbt.2808) and Sternberg SH et al., Nature 2014 (doi:10.1038 / nature13011).
[0344] In one embodiment, the targeting domain is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.
[0345] In one embodiment, the targeting domain is 16 nucleotides in length.
[0346] In one embodiment, the targeting domain is 17 nucleotides in length.
[0347] In one embodiment, the targeting domain is 18 nucleotides in length.
[0348] In one embodiment, the targeting domain is 19 nucleotides in length.
[0349] In one embodiment, the targeting domain is 20 nucleotides in length.
[0350] In one embodiment, the targeting domain is 21 nucleotides in length.
[0351] In one embodiment, the targeting domain is 22 nucleotides in length.
[0352] In one embodiment, the targeting domain is 23 nucleotides in length.
[0353] In one embodiment, the targeting domain is 24 nucleotides in length.
[0354] In one embodiment, the targeting domain is 25 nucleotides in length.
[0355] In one embodiment, the targeting domain is 26 nucleotides in length.
[0356] In one embodiment, the targeting domain comprises 16 nucleotides.
[0357] In one embodiment, the targeting domain comprises 17 nucleotides.
[0358] In one embodiment, the targeting domain comprises 18 nucleotides.
[0359] In one embodiment, the targeting domain comprises 19 nucleotides.
[0360] In one embodiment, the targeting domain comprises 20 nucleotides.
[0361] In one embodiment, the targeting domain comprises 21 nucleotides.
[0362] In one embodiment, the targeting domain comprises 22 nucleotides.
[0363] In one embodiment, the targeting domain comprises 23 nucleotides.
[0364] In one embodiment, the targeting domain comprises 24 nucleotides.
[0365] In one embodiment, the targeting domain comprises 25 nucleotides.
[0366] In one embodiment, the targeting domain comprises 26 nucleotides. In one embodiment, the targeting domain is 10+ / -5, 20+ / -5, 30+ / -5, 40+ / -5, 50+ / -5, 60+ / -5, 70+ / -5, 80+ / -5, 90+ / -5, or 100+ / -5 nucleotides in length.
[0367] In one embodiment, the targeting domain is 20+ / -5 nucleotides in length.
[0368] In one embodiment, the targeting domain is 20+ / -10, 30+ / -10, 40+ / -10, 50+ / -10, 60+ / -10, 70+ / -10, 80+ / -10, 90+ / -10, or 100+ / -10 nucleotides in length.
[0369] In one embodiment, the targeting domain is 30+ / -10 nucleotides in length.
[0370] In one embodiment, the targeting domain is 10 to 100, 10 to 90, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, 10 to 20 or 10 to 15 nucleotides in length.
[0371] In other embodiments, the targeting domain is between 20 and 100, 20 and 90, 20 and 80, 20 and 70, 20 and 60, 20 and 50, 20 and 40, 20 and 30, or 20 and 25 nucleotides in length.
[0372] Typically, a targeting domain has perfect complementarity to the target sequence. In some embodiments, a targeting domain has or includes 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides that are not complementary to the corresponding nucleotides of the targeting domain.
[0373] In one embodiment, the targeting domain comprises 1, 2, 3, 4, or 5 nucleotides that are complementary to corresponding nucleotides in the targeting domain within 5 nucleotides of its 5' end. In one embodiment, the targeting domain comprises 1, 2, 3, 4, or 5 nucleotides that are complementary to corresponding nucleotides in the targeting domain within 5 nucleotides of its 3' end.
[0374] In one embodiment, the targeting domain comprises 1, 2, 3, or 4 nucleotides within 5 nucleotides of its 5' end that are not complementary to the corresponding nucleotides in the targeting domain. In one embodiment, the targeting domain comprises 1, 2, 3, or 4 nucleotides within 5 nucleotides of its 3' end that are not complementary to the corresponding nucleotides in the targeting domain.
[0375] In one embodiment, the degree of complementarity, in combination with other properties of the gRNA, is sufficient to allow targeting of the Cas9 molecule to the target nucleic acid.
[0376] In some embodiments, the targeting domain comprises two consecutive nucleotides that are not complementary to the targeting domain ("non-complementary nucleotides"), e.g., two consecutive non-complementary nucleotides that are within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or more than 5 nucleotides away from one or both ends of the targeting domain.
[0377] In one embodiment, no two consecutive nucleotides that are within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or within a region more than 5 nucleotides from either or both ends of the targeting domain are complementary to the targeting domain.
[0378] In one embodiment, there are no non-complementary nucleotides within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or within a region more than 5 nucleotides from either or both ends of the targeting domain.
[0379] In one embodiment, the targeting domain nucleotides do not contain modifications, such as, for example, modifications of the type provided in Section VIII. However, in one embodiment, the targeting domain comprises one or more modifications, such as, for example, a modification that makes it less susceptible to degradation or more biocompatible, such as, for example, less immunogenic. As an example, the backbone of the targeting domain may be modified with phosphorothioate or other modifications from Section VIII. In one embodiment, the targeting domain nucleotides may comprise a 2' modification, such as, for example, 2-acetylation, 2' methylation, or other modifications from Section VIII.
[0380] In some embodiments, the targeting domain comprises one, two, three, four, five, six, seven, eight, or more modifications. In one embodiment, the targeting domain comprises one, two, three, or four modifications within five nucleotides of its 5' end. In one embodiment, the targeting domain comprises one, two, three, or as many as four modifications within five nucleotides of its 3' end.
[0381] In some embodiments, the targeting domain comprises a modification of two consecutive nucleotides, e.g., two consecutive nucleotides that are within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or more than 5 nucleotides away from one or both ends of the targeting domain.
[0382] In one embodiment, any two consecutive nucleotides within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or within a region more than 5 nucleotides from either or both ends of the targeting domain are unmodified. In one embodiment, any nucleotides within 5 nucleotides of the 5' end of the targeting domain, within 5 nucleotides of the 3' end of the targeting domain, or within a region more than 5 nucleotides from either or both ends of the targeting domain are unmodified.
[0383] Modifications in the targeting domain can be selected so as not to interfere with targeting efficiency, which can be assessed by testing candidate modifications in the system described in Section IV. gRNAs having candidate targeting domains of selected lengths, sequences, degrees of complementarity, or degrees of modification can be assessed in the system of Section IV. Candidate targeting domains can be placed alone or together with one or more other candidate changes in a gRNA molecule / Cas9 molecule system known to be functional for the selected target and evaluated.
[0384] In some embodiments, all modified nucleotides are complementary to and capable of hybridizing with corresponding nucleotides present in the target domain, while in other embodiments, 1, 2, 3, 4, 5, 6, 7, or 8 or more modified nucleotides are not complementary to or capable of hybridizing with corresponding nucleotides present in the target domain.
[0385] In one embodiment, the targeting domain preferably comprises, in 5' to 3' direction, a secondary domain and a core domain, which are discussed in more detail below.
[0386] Core and Secondary Domains of the Targeting Domain The "core domain" of the targeting domain is complementary to the "core domain target" on the target nucleic acid. In one embodiment, the core domain comprises about 8 to about 13 nucleotides from the 3' end of the targeting domain (e.g., the 3'-most 8 to 13 nucleotides of the targeting domain).
[0387] In one embodiment, the secondary domain is absent or optional.
[0388] In one embodiment, the core domain and the targeting domain are independently 6+ / -2, 7+ / -2, 8+ / -2, 9+ / -2, 10+ / -2, 11+ / -2, 12+ / -2, 13+ / -2, 14+ / -2, 15+ / -2, or 16+-2 nucleotides in length.
[0389] In one embodiment, the core domain and the targeting domain are independently 10+ / -2 nucleotides in length.
[0390] In one embodiment, the core domain and the targeting domain are independently 10+ / -4 nucleotides in length.
[0391] In one embodiment, the core domain and the targeting domain are independently 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides in length.
[0392] In one embodiment, the core and targeting domains are independently 3 to 20, 4 to 20, 5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20, or 15 to 20 nucleotides in length.
[0393] In one embodiment, the core and targeting domains are independently 3-15 nucleotides in length, e.g., 6-15, 7-14, 7-13, 6-12, 7-12, 7-11, 7-10, 8-14, 8-13, 8-12, 8-11, 8-10, or 8-9.
[0394] The core domain is complementary to the core domain target. Typically, the core domain has exact complementarity with the core domain target. In some embodiments, the core domain can have 1, 2, 3, 4 or 5 nucleotides that are not complementary to the corresponding nucleotides of the core domain. In one embodiment, the degree of complementarity is sufficient to allow the Cas9 molecule to target nucleic acid, in combination with other properties of gRNA.
[0395] The "secondary domain" of the targeting domain of the gRNA is complementary to the "secondary domain target" of the target nucleic acid.
[0396] In one embodiment, the secondary domain is positioned 5' to the core domain.
[0397] In one embodiment, the secondary domain is absent or optional.
[0398] In one embodiment, if the targeting domain is 26 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 12-17 nucleotides in length.
[0399] In one embodiment, if the targeting domain is 25 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 12-17 nucleotides in length.
[0400] In one embodiment, if the targeting domain is 24 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 11-16 nucleotides in length.
[0401] In one embodiment, if the targeting domain is 23 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 10-15 nucleotides in length.
[0402] In one embodiment, if the targeting domain is 22 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 9-14 nucleotides in length.
[0403] In one embodiment, if the targeting domain is 21 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 8-13 nucleotides in length.
[0404] In one embodiment, if the targeting domain is 20 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 7-12 nucleotides in length.
[0405] In one embodiment, if the targeting domain is 19 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 6-11 nucleotides in length.
[0406] In one embodiment, if the targeting domain is 18 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 5-10 nucleotides in length.
[0407] In one embodiment, if the targeting domain is 17 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 4-9 nucleotides in length.
[0408] In one embodiment, if the targeting domain is 16 nucleotides in length and the core domain (counted from the 3' end of the targeting domain) is 8-13 nucleotides in length, the secondary domain is 3-8 nucleotides in length.
[0409] In one embodiment, the secondary domain is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotides in length.
[0410] The secondary domain is complementary to the secondary domain target.Typically, the secondary domain has exact complementarity with the secondary domain target.In some embodiments, the secondary domain can have 1, 2, 3, 4 or 5 nucleotides that are not complementary to the corresponding nucleotides of the secondary domain.In one embodiment, the degree of complementarity is sufficient to allow the Cas9 molecule to target nucleic acid, in combination with other properties of gRNA.
[0411] In one embodiment, the core domain nucleotides do not contain modifications, such as, for example, modifications of the type provided in Section VIII. However, in one embodiment, the core domain comprises one or more modifications, such as, for example, modifications that make it less susceptible to degradation or more biocompatible, such as, for example, less immunogenic. By way of example, the backbone of the core domain may be modified with phosphorothioate or other modifications from Section VIII. In one embodiment, the nucleotides of the core domain may comprise a 2' modification (e.g., a modification at the 2' position on the ribose), such as, for example, a 2-acetylation, a 2' methylation, or other modification from Section VIII. Typically, the core domain contains no more than one, two, or three modifications.
[0412] Modifications in the core domain can be selected so as not to interfere with targeting efficiency, which can be assessed by testing the candidate modifications in the system described in Section IV. gRNAs having candidate core domains of selected lengths, sequences, degrees of complementarity, or degrees of modification can be assessed in the system described in Section IV. Candidate core domains can be placed alone or together with one or more other candidate changes in a gRNA molecule / Cas9 molecule system known to be functional for the selected target and evaluated.
[0413] In one embodiment, the secondary domain nucleotides do not contain modifications, such as, for example, modifications of the type provided in Section VIII. However, in one embodiment, the secondary domain comprises one or more modifications, such as, for example, a modification that makes it less susceptible to degradation or more biocompatible, such as, for example, less immunogenic. By way of example, the backbone of the secondary domain may be modified with phosphorothioate or other modifications from Section VIII. In one embodiment, the nucleotides of the secondary domain may comprise a 2' modification, such as, for example, a 2-acetylation, a 2' methylation, or other modification from Section VIII. Typically, the secondary domain contains no more than one, two, or three modifications.
[0414] Modifications in the secondary domain can be selected so as not to interfere with targeting efficiency, which can be assessed by testing the candidate modifications in the system described in Section IV. gRNAs having candidate secondary domains of selected lengths, sequences, degrees of complementarity, or degrees of modification can be assessed in the system described in Section IV. Candidate secondary domains can be placed alone or together with one or more other candidate changes in a gRNA molecule / Cas9 molecule system known to be functional for the selected target and assessed.
[0415] In one embodiment, (1) the degree of complementarity between the core domain and its target and (2) the degree of complementarity between the secondary domain and its target may be different. In one embodiment, (1) may be greater than (2). In one embodiment, (1) may be less than (2). In one embodiment, (1) and (2) may be identical, e.g., each may be perfectly complementary to its target.
[0416] In one embodiment, (1) the number of modifications in the nucleotides of the core domain (e.g., modifications from Section VIII) and (2) the number of modifications in the nucleotides of the secondary domain (e.g., modifications from Section VIII) can be different. In one embodiment, (1) can be less than (2). In one embodiment, (1) can be greater than (2). In one embodiment, (1) and (2) can be the same, e.g., each can contain no modifications.
[0417] First and second complementary domains The first complementary domain is complementary to the second complementary domain.
[0418] Typically, the first complementary domain does not have exact complementarity with the second complementary domain target.In some embodiments, the first complementary domain can have 1, 2, 3, 4 or 5 nucleotides that are not complementary to the corresponding nucleotides of the second complementary domain.In one embodiment, 1, 2, 3, 4, 5 or 6 nucleotides, such as 3 nucleotides, are not paired in the double strand, forming, for example, a non-duplex region or a loop-out region.In one embodiment, an unpaired or loop-out region, such as a 3-nucleotide loop-out, exists on the second complementary domain.In one embodiment, the unpaired region starts at the 1st, 2nd, 3rd, 4th, 5th or 6th nucleotide, such as the 4th nucleotide, from the 5' end of the second complementary domain.
[0419] In one embodiment, the degree of complementarity, in combination with other properties of the gRNA, is sufficient to allow targeting of the Cas9 molecule to the target nucleic acid.
[0420] In one embodiment, the first and second complementary domains are independently, 6+ / -2, 7+ / -2, 8+ / -2, 9+ / -2, 10+ / -2, 11+ / -2, 12+ / -2, 13+ / -2, 14+ / -2, 15+ / -2, 16+ / -2, 17+ / -2, 18+ / -2, 19+ / -2, or 20+ / -2, 21+ / -2, 22+ / -2, 23+ / -2, or 24+ / -2 nucleotides in length; independently, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length; or Independently, 5–24, 5–23, 5–22, 5–21, 5–20, 7–18, 9–16, or 10–14 nucleotides in length is.
[0421] In one embodiment, the second complementary domain is, for example, 2, 3, 4, 5, or 6 nucleotides longer, such as, for example, 6 nucleotides longer than the first complementary domain.
[0422] In one embodiment, the first and second complementary domains independently do not comprise modifications, such as, for example, modifications of the type provided in Section VIII.
[0423] In one embodiment, the first and second complementary domains independently comprise one or more modifications, such as, for example, a modification that renders the domain less susceptible to degradation or more biocompatible, such as, for example, less immunogenic. As an example, the backbone of the domain may be modified with phosphorothioate or other modifications from Section VIII. In one embodiment, the nucleotides of the domain may comprise a 2' modification, such as, for example, a 2-acetylation, e.g., a 2' methylation, or other modification from Section VIII.
[0424] In one embodiment, the first and second complementary domains independently comprise one, two, three, four, five, six, seven, or eight or more modifications. In one embodiment, the first and second complementary domains independently comprise one, two, three, or four modifications within five nucleotides of their 5' ends. In one embodiment, the first and second complementary domains independently comprise one, two, three, or four modifications within two nucleotides of their 3' ends.
[0425] In one embodiment, the first and second complementary domains independently comprise modifications at two consecutive nucleotides, e.g., within 5 nucleotides of the 5' end of the domain, within 5 nucleotides of the 3' end of the domain, or two consecutive nucleotides more than 5 nucleotides away from either or both ends of the domain. In one embodiment, the first and second complementary domains independently do not comprise modified nucleotides within 5 nucleotides of the 5' end of the domain, within 5 nucleotides of the 3' end of the domain, or within a region more than 5 nucleotides away from either or both ends of the domain. In one embodiment, the first and second complementary domains independently do not comprise modified nucleotides within 5 nucleotides of the 5' end of the domain, within 5 nucleotides of the 3' end of the domain, or within a region more than 5 nucleotides away from either or both ends of the domain.
[0426] Modifications in the complementary domain can be selected so as not to interfere with targeting efficiency, which can be assessed by testing the candidate modifications in the system described in Section IV. gRNAs having candidate complementary domains of selected lengths, sequences, degrees of complementarity, or degrees of modification can be assessed in the system described in Section IV. Candidate complementary domains can be placed alone or together with one or more other candidate changes in a gRNA molecule / Cas9 molecule system known to be functional for the selected target and assessed.
[0427] In one embodiment, the first complementary domain has at least 60, 70, 80, 85%, 90% or 95% homology to, or differs by no more than 1, 2, 3, 4, 5 or 6 nucleotides from, a reference first complementary domain, such as, for example, a first complementary domain of natural origin, such as, for example, S. pyogenes, S. aureus, N. meningitidis, or S. thermophilus, or a first complementary domain described herein, for example, in Figures 1A-1G.
[0428] In one embodiment, the second complementary domain has at least 60, 70, 80, 85%, 90%, or 95% homology to, or differs by no more than 1, 2, 3, 4, 5, or 6 nucleotides from, a reference second complementary domain, such as, for example, a second complementary domain of natural origin, such as, for example, S. pyogenes, S. aureus, N. meningitidis, or S. thermophilus, or a second complementary domain described herein, for example, in Figures 1A-1G.
[0429] The duplex region formed by the first and second complementary domains is typically 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 base pairs in length (excluding any loop-out or unpaired nucleotides).
[0430] In some embodiments, the first and second complementary domains, when duplexed, comprise, for example, 11 paired nucleotides in the gRNA sequence (one paired strand underlined, one bold). [ka]
[0431] In some embodiments, the first and second complementary domains, when duplexed, comprise, for example, 15 paired nucleotides of the gRNA sequence (one paired strand underlined, one bold). [ka]
[0432] In some embodiments, the first and second complementary domains, when duplexed, comprise, for example, 16 paired nucleotides in the gRNA sequence (one paired strand underlined, one bold). [ka]
[0433] In some embodiments, the first and second complementary domains, when duplexed, comprise, for example, 21 paired nucleotides in the gRNA sequence (one paired strand underlined, one bold). [ka]
[0434] In some embodiments, nucleotides are exchanged, for example to remove a poly-U sequence in the gRNA sequence (exchanged nucleotides are underlined). [ka]
[0435] 5' extension domain In one embodiment, the modular gRNA may comprise additional sequence 5' to the second complementary domain. In one embodiment, the 5' extension domain is 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, or 2-4 nucleotides in length. In one embodiment, the 5' extension domain is 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides in length.
[0436] In one embodiment, the 5' extension domain nucleotides do not contain modifications, such as, for example, modifications of the type provided in Section VIII. However, in one embodiment, the 5' extension domain comprises one or more modifications, such as, for example, a modification that makes it less susceptible to degradation or more biocompatible, such as, for example, less immunogenic. By way of example, the backbone of the 5' extension domain may be modified with phosphorothioate or other modifications from Section VIII. In one embodiment, the 5' extension domain nucleotides may comprise a 2' modification, such as, for example, a 2-acetylation, e.g., a 2' methylation, or other modifications from Section VIII.
[0437] In some embodiments, the 5' extension domain may comprise as many as 1, 2, 3, 4, 5, 6, 7, or 8 modifications. In one embodiment, the 5' extension domain comprises as many as 1, 2, 3, or 4 modifications within 5 nucleotides of its 5' end, e.g., in a modular gRNA molecule. In one embodiment, the 5' extension domain comprises as many as 1, 2, 3, or 4 modifications within 5 nucleotides of its 3' end, e.g., in a modular gRNA molecule.
[0438] In some embodiments, the 5'-extension domain comprises modifications at two consecutive nucleotides, e.g., two consecutive nucleotides that are within 5 nucleotides of the 5'-end of the 5'-extension domain, within 5 nucleotides of the 3'-end of the 5'-extension domain, or more than 5 nucleotides away from one or both ends of the 5'-extension domain. In one embodiment, two consecutive nucleotides that are within 5 nucleotides of the 5'-end of the 5'-extension domain, within 5 nucleotides of the 3'-end of the 5'-extension domain, or more than 5 nucleotides away from one or both ends of the 5'-extension domain are unmodified. In one embodiment, nucleotides that are within 5 nucleotides of the 5'-end of the 5'-extension domain, within 5 nucleotides of the 3'-end of the 5'-extension domain, or more than 5 nucleotides away from one or both ends of the 5'-extension domain are unmodified.
[0439] Modifications in the 5' extension domain can be selected so as not to interfere with gRNA molecule efficiency, which is assessed by testing the candidate modifications in the system described in Section IV. gRNAs having candidate 5' extension domains of a selected length, sequence, degree of complementarity, or degree of modification can be evaluated in the system described in Section IV. Candidate 5' extension domains can be placed alone or together with one or more other candidate changes in a gRNA molecule / Cas9 molecule system known to be functional for a selected target and evaluated.
[0440] In one embodiment, the 5' extension domain has at least 60, 70, 80, 85, 90, 95, 98 or 99% homology to, or differs by no more than 1, 2, 3, 4, 5 or 6 nucleotides from, a reference 5' extension domain, such as a 5' extension domain of a naturally occurring origin, e.g., S. pyogenes, S. aureus, N. meningitidis, or S. thermophilus, e.g., a 5' extension domain described herein in Figures 1A and 1G.
[0441] Linked Domains In a unimolecular gRNA molecule, the linking domain is located between the first and second complementary domains. In a modular gRNA molecule, the two molecules are bound to each other by their complementary domains.
[0442] In one embodiment, the linking domain is 10+ / -5, 20+ / -5, 30+ / -5, 40+ / -5, 50+ / -5, 60+ / -5, 70+ / -5, 80+ / -5, 90+ / -5, or 100+ / -5 nucleotides in length.
[0443] In one embodiment, the linking domain is 20+ / -10, 30+ / -10, 40+ / -10, 50+ / -10, 60+ / -10, 70+ / -10, 80+ / -10, 90+ / -10, or 100+ / -10 nucleotides in length.
[0444] In one embodiment, the linking domain is 10 to 100, 10 to 90, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, 10 to 20, or 10 to 15 nucleotides in length, while in other embodiments, the linking domain is 20 to 100, 20 to 90, 20 to 80, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, or 20 to 25 nucleotides in length.
[0445] In one embodiment, the linking domain is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.
[0446] In one embodiment, the linking domain is a covalent bond.
[0447] In one embodiment, the linking domain typically comprises a duplex region adjacent to or within 1, 2, or 3 nucleotides of the 3' end of the first complementary domain and / or the 5' end of the second complementary domain. In one embodiment, the duplex region may be 20 + / - 10 base pairs in length. In one embodiment, the duplex region may be 10 + / - 5, 15 + / - 5, 20 + / - 5, or 30 + / - 5 base pairs in length. In one embodiment, the duplex region may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 base pairs in length.
[0448] Typically, the sequences forming the duplex region have exact complementarity to one another, although in some embodiments as many as 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides are not complementary to corresponding nucleotides.
[0449] In one embodiment, the linking domain nucleotides do not contain modifications, such as, for example, modifications of the type provided in Section VIII. However, in one embodiment, the linking domain comprises one or more modifications, such as, for example, modifications that make it less susceptible to degradation or more biocompatible, such as, for example, less immunogenic. By way of example, the backbone of the linking domain may be modified with phosphorothioate or other modifications from Section VIII. In one embodiment, the linking domain nucleotides may comprise a 2' modification, such as, for example, a 2-acetylation, a 2' methylation, or other modification from Section VIII. In some embodiments, the linking domain may comprise as many as 1, 2, 3, 4, 5, 6, 7, or 8 modifications.
[0450] Modifications in the linking domain can be selected so as not to interfere with targeting efficiency, which can be assessed by testing candidate modifications in the system described in Section IV. gRNAs with candidate linking domains of selected lengths, sequences, degrees of complementarity, or degrees of modification can be evaluated in the system described in Section IV. Candidate linking domains can be placed alone or together with one or more other candidate changes in a gRNA molecule / Cas9 molecule system known to be functional for a selected target and evaluated.
[0451] In one embodiment, the linking domain has at least 60, 70, 80, 85, 90, 95, 98, or 99% homology to, and differs by no more than 1, 2, 3, 4, 5, or 6 nucleotides from, a reference linking domain, such as, for example, a linking domain described herein in Figures 1A-1G.
[0452] Adjacent domains In one embodiment, the flanking domains are 6+ / -2, 7+ / -2, 8+ / -2, 9+ / -2, 10+ / -2, 11+ / -2, 12+ / -2, 13+ / -2, 14+ / -2, 14+ / -2, 16+ / -2, 17+ / -2, 18+ / -2 nucleotides in length.
[0453] In one embodiment, the flanking domain is 6, 7, 8, 9, 10, 11, 12, 13, 14, 14, 16, 17, 18, 19, or 20 nucleotides in length.
[0454] In one embodiment, the flanking domain is 5 to 20, 7 to 18, 9 to 16, or 10 to 14 nucleotides in length.
[0455] In one embodiment, the flanking domain nucleotides do not contain modifications, such as, for example, modifications of the type provided in Section VIII. However, in one embodiment, the flanking domain comprises one or more modifications, such as, for example, a modification that makes it less susceptible to degradation or more biocompatible, such as, for example, less immunogenic. As an example, the backbone of the flanking domain may be modified with phosphorothioate or other modifications from Section VIII. In one embodiment, the nucleotides of the flanking domain may comprise a 2' modification, such as, for example, a 2-acetylation, e.g., a 2' methylation, or other modifications from Section VIII.
[0456] In some embodiments, the flanking domain may comprise as many as 1, 2, 3, 4, 5, 6, 7, or 8 modifications. In one embodiment, the flanking domain comprises as many as 1, 2, 3, or 4 modifications within 5 nucleotides of its 5' end, e.g., in a modular gRNA molecule. In one embodiment, the targeting domain comprises as many as 1, 2, 3, or 4 modifications within 5 nucleotides of its 3' end, e.g., in a modular gRNA molecule.
[0457] In some embodiments, the adjacent domain comprises a modification of two consecutive nucleotides, e.g., two consecutive nucleotides that are within 5 nucleotides of the 5' end of the adjacent domain, within 5 nucleotides of the 3' end of the adjacent domain, or more than 5 nucleotides away from one or both ends of the adjacent domain. In one embodiment, two consecutive nucleotides that are within 5 nucleotides of the 5' end of the adjacent domain, within 5 nucleotides of the 3' end of the adjacent domain, or more than 5 nucleotides away from one or both ends of the adjacent domain are unmodified. In one embodiment, the nucleotides that are within 5 nucleotides of the 5' end of the adjacent domain, within 5 nucleotides of the 3' end of the adjacent domain, or more than 5 nucleotides away from one or both ends of the adjacent domain are unmodified.
[0458] Modifications in the flanking domains can be selected so as not to interfere with gRNA molecule efficiency, which is assessed by testing the candidate modifications in the system described in Section IV. gRNAs with candidate flanking domains of a selected length, sequence, degree of complementarity, or degree of modification can be evaluated in the system described in Section IV. Candidate flanking domains can be placed alone or together with one or more other candidate changes in a gRNA molecule / Cas9 molecule system known to be functional for a selected target and evaluated.
[0459] In one embodiment, the flanking domain has at least 60, 70, 80, 85, 90, 95, 98, or 99% homology to, or differs by no more than 1, 2, 3, 4, 5, or 6 nucleotides from, a naturally occurring flanking domain, e.g., from S. pyogenes, S. aureus, N. meningitidis, or S. thermophilus, or to a reference flanking domain, e.g., a flanking domain described herein in Figures 1A-1G.
[0460] Tail domain In one embodiment, the tail domain is 10+ / -5, 20+ / -5, 30+ / -5, 40+ / -5, 50+ / -5, 60+ / -5, 70+ / -5, 80+ / -5, 90+ / -5, or 100+ / -5 nucleotides in length.
[0461] In one embodiment, the tail domain is 20+ / -5 nucleotides in length.
[0462] In one embodiment, the tail domain is 20+ / -10, 30+ / -10, 40+ / -10, 50+ / -10, 60+ / -10, 70+ / -10, 80+ / -10, 90+ / -10, or 100+ / -10 nucleotides in length.
[0463] In one embodiment, the tail domain is 25+ / -10 nucleotides in length.
[0464] In one embodiment, the tail domain is 10 to 100, 10 to 90, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, 10 to 20 or 10 to 15 nucleotides in length.
[0465] In other embodiments, the tail domain is between 20 and 100, 20 and 90, 20 and 80, 20 and 70, 20 and 60, 20 and 50, 20 and 40, 20 and 30, or 20 and 25 nucleotides in length.
[0466] In one embodiment, the tail domain is 1 to 20, 1 to 1, 1 to 10, or 1 to 5 nucleotides in length.
[0467] In one embodiment, the tail domain nucleotides do not contain modifications, such as, for example, modifications of the type provided in Section VIII. However, in one embodiment, the tail domain comprises one or more modifications, such as, for example, a modification that makes it less susceptible to degradation or more biocompatible, such as, for example, less immunogenic. By way of example, the backbone of the tail domain may be modified with phosphorothioate or other modifications from Section VIII. In one embodiment, the nucleotides of the tail domain may comprise a 2' modification, such as, for example, a 2-acetylation, e.g., a 2' methylation, or other modifications from Section VIII.
[0468] In some embodiments, the tail domain can have as many as 1, 2, 3, 4, 5, 6, 7, or 8 modifications. In one embodiment, the targeting domain comprises as many as 1, 2, 3, or 4 modifications within 5 nucleotides of its 5' end. In one embodiment, the targeting domain comprises as many as 1, 2, 3, or 4 modifications within 5 nucleotides of its 3' end.
[0469] In one embodiment, the tail domain comprises a tail double-stranded domain capable of forming a tail double-stranded region. In one embodiment, the tail double-stranded region can be 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 base pairs in length. In one embodiment, there is an additional single-stranded domain 3' to the tail double-stranded domain. In one embodiment, this domain is 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In one embodiment, it is 4 to 6 nucleotides in length.
[0470] In one embodiment, the tail domain has at least 60, 70, 80, 90, 95, 98, or 99% homology to, or differs by no more than 1, 2, 3, 4, 5, or 6 nucleotides from, a reference tail domain, such as, for example, a naturally occurring tail domain of S. pyogenes, S. aureus, N. meningitidis, or S. thermophilus, or a tail domain described herein in Figures 1A-1G.
[0471] In one embodiment, the flanking and tail domains together comprise the following sequence: [ka]
[0472] In one embodiment, the tail domain comprises the 3' sequence UUUUUU, such as, for example, when a U6 promoter is used for transcription.
[0473] In one embodiment, the tail domain comprises the 3' sequence UUUU, such as, for example, when the H1 promoter is used for transcription.
[0474] In one embodiment, the tail domain comprises a varying number of 3'Us, depending, for example, on the termination signal of the pol-III promoter used.
[0475] In one embodiment, the tail domain comprises a variable 3' sequence derived from the DNA template when a T7 promoter is used.
[0476] In one embodiment, the tail domain comprises a variable 3' sequence derived from a DNA template, such as when in vitro transcription is used to generate an RNA molecule.
[0477] In one embodiment, the tail domain comprises a variable 3' sequence derived from the DNA template, such as when a pol-II promoter is used to drive transcription.
[0478] Modifications in the tail domain can be selected so as not to interfere with targeting efficiency, which can be assessed by testing the candidate modifications in the system described in Section IV. gRNAs with candidate tail domains of selected lengths, sequences, degrees of complementarity, or degrees of modification can be assessed in the system described in Section IV. Candidate tail domains can be placed alone or together with one or more other candidate changes in a gRNA molecule / Cas9 molecule system known to be functional for the selected target and evaluated.
[0479] In some embodiments, the tail domain comprises a modification of two consecutive nucleotides, e.g., two consecutive nucleotides that are within 5 nucleotides of the 5' end of the tail domain, within 5 nucleotides of the 3' end of the tail domain, or more than 5 nucleotides away from one or both ends of the tail domain. In one embodiment, two consecutive nucleotides that are within 5 nucleotides of the 5' end of the tail domain, within 5 nucleotides of the 3' end of the tail domain, or more than 5 nucleotides away from one or both ends of the tail domain are unmodified. In one embodiment, nucleotides that are within 5 nucleotides of the 5' end of the tail domain, within 5 nucleotides of the 3' end of the tail domain, or more than 5 nucleotides away from one or both ends of the tail domain are unmodified.
[0480] In one embodiment, the gRNA comprises: 5' [targeting domain]-[first complementary domain]-[linking domain]-[second complementary domain]-[adjacent domain]-[tail domain]-3'; During the ceremony, the targeting domain comprises a core domain and optionally a secondary domain, and is 10 to 50 nucleotides in length; The first complementary domain is 5-25 nucleotides in length and, in one embodiment, has at least 50, 60, 70, 80, 85, 90, 95, 98 or 99% homology to a reference first complementary domain disclosed herein; The linking domain is 1 to 5 nucleotides in length; The flanking domain is 5-20 nucleotides in length and, in one embodiment, has at least 50, 60, 70, 80, 85, 90, 95, 98, or 99% homology to a reference flanking complementary domain disclosed herein; and The tail domain is absent or the nucleotide sequence is 1-50 nucleotides in length and in one embodiment has at least 50, 60, 70, 80, 85, 90, 95, 98 or 99% homology to a reference tail domain disclosed herein.
[0481] Representative chimeric gRNAs In one embodiment, the unimolecular gRNA or chimeric gRNA preferably has the following in the 5' to 3' direction: For example, a targeting domain comprising 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides (complementary to the target nucleic acid); first complementary domain; Concatenated domains; a second complementary domain (complementary to the first complementary domain); adjacent domains; and Tail domain comprising During the ceremony, (a) the flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides; (b) at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain; or (c) there are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0482] In one embodiment, the sequence from (a), (b), or (c) has at least 60, 75, 80, 85, 90, 95, or 99% homology to the corresponding sequence of a naturally occurring gRNA or to a gRNA described herein.
[0483] In one embodiment, the flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0484] In one embodiment, there are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0485] In one embodiment, there are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0486] In one embodiment, the targeting domain comprises, has, or consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.
[0487] In one embodiment, the targeting domain comprises, has, or consists of 16 nucleotides (e.g., 16 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 16 nucleotides in length.
[0488] In one embodiment, the targeting domain comprises, has, or consists of 17 nucleotides (e.g., 17 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 17 nucleotides in length.
[0489] In one embodiment, the targeting domain comprises, has, or consists of 18 nucleotides (e.g., 18 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 18 nucleotides in length.
[0490] In one embodiment, the targeting domain comprises, has, or consists of 19 nucleotides (e.g., 19 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 19 nucleotides in length.
[0491] In one embodiment, the targeting domain comprises, has, or consists of 20 nucleotides (e.g., 20 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 20 nucleotides in length.
[0492] In one embodiment, the targeting domain comprises, has, or consists of 21 nucleotides (e.g., 21 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 21 nucleotides in length.
[0493] In one embodiment, the targeting domain comprises, has, or consists of 22 nucleotides (e.g., 22 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 22 nucleotides in length.
[0494] In one embodiment, the targeting domain comprises, has, or consists of 23 nucleotides (e.g., 23 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 23 nucleotides in length.
[0495] In one embodiment, the targeting domain comprises, has, or consists of 24 nucleotides (e.g., 24 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 24 nucleotides in length.
[0496] In one embodiment, the targeting domain comprises, has, or consists of 25 nucleotides (e.g., 25 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 25 nucleotides in length.
[0497] In one embodiment, the targeting domain comprises, has, or consists of 26 nucleotides (e.g., 26 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 26 nucleotides in length.
[0498] In one embodiment, the targeting domain comprises, has, or consists of 16 nucleotides (e.g., 16 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 16 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0499] In one embodiment, the targeting domain comprises, has, or consists of 16 nucleotides (e.g., 16 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 16 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0500] In one embodiment, the targeting domain comprises, has, or consists of 16 nucleotides (e.g., 16 consecutive nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 16 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0501] In one embodiment, the targeting domain comprises, has, or consists of 17 nucleotides (e.g., 17 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 17 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0502] In one embodiment, the targeting domain comprises, has, or consists of 17 nucleotides (e.g., 17 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 17 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0503] In one embodiment, the targeting domain comprises, has, or consists of 17 nucleotides (e.g., 17 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 17 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0504] In one embodiment, the targeting domain comprises, has, or consists of 18 nucleotides (e.g., 18 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 18 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0505] In one embodiment, the targeting domain comprises, has, or consists of 18 nucleotides (e.g., 18 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 18 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0506] In one embodiment, the targeting domain comprises, has, or consists of 18 nucleotides (e.g., 18 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 18 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0507] In one embodiment, the targeting domain comprises, has, or consists of 19 nucleotides (e.g., 19 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 19 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0508] In one embodiment, the targeting domain comprises, has, or consists of 19 nucleotides (e.g., 19 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 19 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0509] In one embodiment, the targeting domain comprises, has, or consists of 19 nucleotides (e.g., 19 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 19 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0510] In one embodiment, the targeting domain comprises, has, or consists of 20 nucleotides (e.g., 20 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 20 nucleotides in length; and the flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0511] In one embodiment, the targeting domain comprises, has, or consists of 20 nucleotides (e.g., 20 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 20 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0512] In one embodiment, the targeting domain comprises, has, or consists of 20 nucleotides (e.g., 20 consecutive nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 20 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0513] In one embodiment, the targeting domain comprises, has, or consists of 21 nucleotides (e.g., 21 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 21 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0514] In one embodiment, the targeting domain comprises, has, or consists of 21 nucleotides (e.g., 21 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 21 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0515] In one embodiment, the targeting domain comprises, has, or consists of 21 nucleotides (e.g., 21 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 21 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0516] In one embodiment, the targeting domain comprises, has, or consists of 22 nucleotides (e.g., 22 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 22 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0517] In one embodiment, the targeting domain comprises, has, or consists of 22 nucleotides (e.g., 22 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 22 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0518] In one embodiment, the targeting domain comprises, has, or consists of 22 nucleotides (e.g., 22 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 22 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0519] In one embodiment, the targeting domain comprises, has, or consists of 23 nucleotides (e.g., 23 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 23 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0520] In one embodiment, the targeting domain comprises, has, or consists of 23 nucleotides (e.g., 23 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 23 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0521] In one embodiment, the targeting domain comprises, has, or consists of 23 nucleotides (e.g., 23 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 23 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0522] In one embodiment, the targeting domain comprises, has, or consists of 24 nucleotides (e.g., 24 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 24 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0523] In one embodiment, the targeting domain comprises, has, or consists of 24 nucleotides (e.g., 24 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 24 nucleotides in length, and there are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0524] In one embodiment, the targeting domain comprises, has, or consists of 24 nucleotides (e.g., 24 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 24 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0525] In one embodiment, the targeting domain comprises, has, or consists of 25 nucleotides (e.g., 25 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 25 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0526] In one embodiment, the targeting domain comprises, has, or consists of 25 nucleotides (e.g., 25 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 25 nucleotides in length, and there are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0527] In one embodiment, the targeting domain comprises, has, or consists of 25 nucleotides (e.g., 25 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 25 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0528] In one embodiment, the targeting domain comprises, has, or consists of 26 nucleotides (e.g., 26 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 26 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0529] In one embodiment, the targeting domain comprises, has, or consists of 26 nucleotides (e.g., 26 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 26 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0530] In one embodiment, the targeting domain comprises, has, or consists of 26 nucleotides (e.g., 26 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 26 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0531] In one embodiment, a unimolecular or chimeric gRNA molecule (comprising a targeting domain, a first complementary domain, a linking domain, a second complementary domain, a flanking domain, and optionally, a tail domain) comprises the following sequence, in which the targeting domain is depicted as 20 Ns, but it can be of any sequence and range from 16 to 26 nucleotides in length, in which the gRNA sequence is followed by 6 Us, which serve as a termination signal for the U6 promoter, but which can be either absent or fewer: [ka] In one embodiment, the monomolecular or chimeric gRNA molecule is a S. pyogenes gRNA molecule.
[0532] In some embodiments, a unimolecular or chimeric gRNA molecule (comprising a targeting domain, a first complementary domain, a linking domain, a second complementary domain, a flanking domain, and optionally, a tail domain) comprises the following sequence, in which the targeting domain is depicted as 20 Ns, but it can be of any sequence and range from 16 to 26 nucleotides in length, in which the gRNA sequence is followed by 6 Us, which serve as a termination signal for the U6 promoter, but which can be either absent or fewer: [ka] In one embodiment, the monomolecular or chimeric gRNA molecule is a S. aureus gRNA molecule.
[0533] The sequences and structures of representative chimeric gRNAs are also shown in Figures 10A-10B.
[0534] Representative modular gRNAs In one embodiment, the modular gRNA comprises: Preferably, in the 5' to 3' direction: For example, a targeting domain comprising 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides; First complementary domain and a first strand comprising: Preferably, in the 5' to 3' direction: optionally, a 5' extension domain; a second complementary domain, Adjacent domains, and Tail domain and a second strand comprising comprising During the ceremony, (a) the flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides; (b) at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain; or (c) there are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0535] In one embodiment, the sequence from (a), (b), or (c) has at least 60, 75, 80, 85, 90, 95, or 99% homology to the corresponding sequence of a naturally occurring gRNA or to a gRNA described herein.
[0536] In one embodiment, the flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0537] In one embodiment, there are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0538] In one embodiment, there are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0539] In one embodiment, the targeting domain has or consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length.
[0540] In one embodiment, the targeting domain comprises, has, or consists of 16 nucleotides (e.g., 16 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 16 nucleotides in length.
[0541] In one embodiment, the targeting domain comprises, has, or consists of 17 nucleotides (e.g., 17 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 17 nucleotides in length.
[0542] In one embodiment, the targeting domain comprises, has, or consists of 18 nucleotides (e.g., 18 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 18 nucleotides in length.
[0543] In one embodiment, the targeting domain comprises, has, or consists of 19 nucleotides (e.g., 19 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 19 nucleotides in length.
[0544] In one embodiment, the targeting domain comprises, has, or consists of 20 nucleotides (e.g., 20 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 20 nucleotides in length.
[0545] In one embodiment, the targeting domain comprises, has, or consists of 21 nucleotides (e.g., 21 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 21 nucleotides in length.
[0546] In one embodiment, the targeting domain comprises, has, or consists of 22 nucleotides (e.g., 22 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 22 nucleotides in length.
[0547] In one embodiment, the targeting domain comprises, has, or consists of 23 nucleotides (e.g., 23 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 23 nucleotides in length.
[0548] In one embodiment, the targeting domain comprises, has, or consists of 24 nucleotides (e.g., 24 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 24 nucleotides in length.
[0549] In one embodiment, the targeting domain comprises, has, or consists of 25 nucleotides (e.g., 25 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 25 nucleotides in length.
[0550] In one embodiment, the targeting domain comprises, has, or consists of 26 nucleotides (e.g., 26 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 26 nucleotides in length.
[0551] In one embodiment, the targeting domain comprises, has, or consists of 16 nucleotides (e.g., 16 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 16 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0552] In one embodiment, the targeting domain comprises, has, or consists of 16 nucleotides (e.g., 16 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 16 nucleotides in length, and there are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0553] In one embodiment, the targeting domain comprises, has, or consists of 16 nucleotides (e.g., 16 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 16 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0554] In one embodiment, the targeting domain comprises, has, or consists of 17 nucleotides (e.g., 17 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 17 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0555] In one embodiment, the targeting domain comprises, has, or consists of 17 nucleotides (e.g., 17 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 17 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0556] In one embodiment, the targeting domain comprises, has, or consists of 17 nucleotides (e.g., 17 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 17 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0557] In one embodiment, the targeting domain comprises, has, or consists of 18 nucleotides (e.g., 18 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 18 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0558] In one embodiment, the targeting domain comprises, has, or consists of 18 nucleotides (e.g., 18 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 18 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0559] In one embodiment, the targeting domain comprises, has, or consists of 18 nucleotides (e.g., 18 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 18 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0560] In one embodiment, the targeting domain comprises, has, or consists of 19 nucleotides (e.g., 19 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 19 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0561] In one embodiment, the targeting domain comprises, has, or consists of 19 nucleotides (e.g., 19 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 19 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0562] In one embodiment, the targeting domain comprises, has, or consists of 19 nucleotides (e.g., 19 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 19 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0563] In one embodiment, the targeting domain comprises, has, or consists of 20 nucleotides (e.g., 20 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 20 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0564] In one embodiment, the targeting domain comprises, has, or consists of 20 nucleotides (e.g., 20 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 20 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0565] In one embodiment, the targeting domain comprises, has, or consists of 20 nucleotides (e.g., 20 consecutive nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 20 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0566] In one embodiment, the targeting domain comprises, has, or consists of 21 nucleotides (e.g., 21 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 21 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0567] In one embodiment, the targeting domain comprises, has, or consists of 21 nucleotides (e.g., 21 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 21 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0568] In one embodiment, the targeting domain comprises, has, or consists of 21 nucleotides (e.g., 21 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 21 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0569] In one embodiment, the targeting domain comprises, has, or consists of 22 nucleotides (e.g., 22 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 22 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0570] In one embodiment, the targeting domain comprises, has, or consists of 22 nucleotides (e.g., 22 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 22 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0571] In one embodiment, the targeting domain comprises, has, or consists of 22 nucleotides (e.g., 22 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 22 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0572] In one embodiment, the targeting domain comprises, has, or consists of 23 nucleotides (e.g., 23 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 23 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0573] In one embodiment, the targeting domain comprises, has, or consists of 23 nucleotides (e.g., 23 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 23 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0574] In one embodiment, the targeting domain comprises, has, or consists of 23 nucleotides (e.g., 23 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 23 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0575] In one embodiment, the targeting domain comprises, has, or consists of 24 nucleotides (e.g., 24 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 24 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0576] In one embodiment, the targeting domain comprises, has, or consists of 24 nucleotides (e.g., 24 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 24 nucleotides in length, and there are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0577] In one embodiment, the targeting domain comprises, has, or consists of 24 nucleotides (e.g., 24 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 24 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0578] In one embodiment, the targeting domain comprises, has, or consists of 25 nucleotides (e.g., 25 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 25 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0579] In one embodiment, the targeting domain comprises, has, or consists of 25 nucleotides (e.g., 25 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 25 nucleotides in length, and there are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0580] In one embodiment, the targeting domain comprises, has, or consists of 25 nucleotides (e.g., 25 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 25 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0581] In one embodiment, the targeting domain comprises, has, or consists of 26 nucleotides (e.g., 26 contiguous nucleotides) that have complementarity with the targeting domain, e.g., the targeting domain is 26 nucleotides in length. The flanking and tail domains together comprise at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides.
[0582] In one embodiment, the targeting domain comprises, has, or consists of 26 nucleotides (e.g., 26 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 26 nucleotides in length. There are at least 15, 18, 20, 25, 30, 31, 35, 40, 45, 49, 50, or 53 nucleotides 3' to the last nucleotide of the second complementary domain.
[0583] In one embodiment, the targeting domain comprises, has, or consists of 26 nucleotides (e.g., 26 contiguous nucleotides) that have complementarity with the target domain, e.g., the targeting domain is 26 nucleotides in length. There are at least 16, 19, 21, 26, 31, 32, 36, 41, 46, 50, 51, or 54 nucleotides 3' to the last nucleotide of the second complementary domain that is complementary to the corresponding nucleotide of the first complementary domain.
[0584] II. How to design gRNA The method of designing gRNA is described herein, including the method of selecting, designing and verifying target domain.Representative target domain is also provided herein.The target domain discussed herein can be incorporated into the gRNA described herein.
[0585] Methods for target sequence selection and validation, as well as off-target analysis, are described, for example, in Mali et al., 2013 SCIENCE 339(6121):823-826; Hsu et al., NAT BIOTECHNOL, 31(9):827-32; Fu et al., 2014 NAT BIOTECHNOL, doi:10.1038 / nbt.2808. PubMed PMID:24463574; Heigwer et al., 2014 NAT METHODS 11(2):122-3. doi:10.1038 / nmeth.2812. PubMed PMID:24481216; Bae et al., 2014 BIOINFORMATICS PubMed PMID:24463181; Xiao A et al., 2014 BIOINFORMATICS Described in PubMed PMID:24389662.
[0586] In some embodiments, software tools can be utilized to optimize the selection of gRNAs in a user's target sequence, for example, by minimizing total off-target activity across the genome. Off-target activity can be other than cleavage. For example, for each possible gRNA option using S. pyogenes Cas9, the software tool can identify all possible off-target sequences (preceding either a NAG or NGG PAM) across the genome that contain a specific number of mismatched base pairs (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10). The cleavage efficiency at each off-target sequence can be predicted, for example, using an experimentally derived weighting scheme. Each possible gRNA can then be ranked according to its total predicted off-target cleavage; the highest-ranked gRNAs represent those likely to have the greatest on-target and least off-target cleavage. Other functions, such as automated reagent design for gRNA vector construction, primer design for on-target surveyor assays, and primer design for high-throughput detection and quantification of off-target cleavage via next-generation sequencing, may also be included in the tool. Candidate gRNA molecules may be evaluated by methods well known in the art or as described in Section IV of this specification.
[0587] In some embodiments, gRNAs for use with S. pyogenes, S. aureus, and N. meningitidis Cas9 are identified using a DNA sequence search algorithm, such as using application-specific gRNA design software based on the public tool cas-offinder (Bae et al. Bioinformatics. 2014;30(10):1473-1475). The application-specific gRNA design software scores guides after calculating their genome-wide off-target propensity. Typically, matches ranging from perfect matches to seven mismatches are considered for guides ranging in length from 17 to 24. Once off-target sites have been computationally determined, an aggregate score is calculated for each guide and summarized in a tabular output using a web interface. In addition to identifying potential gRNA sites adjacent to the PAM sequence, the software also identifies all PAM-flanking sequences that differ from the selected gRNA site by one, two, three, or more nucleotides. The genomic DNA sequence of each gene is obtained from the UCSC Genome Browser, and the sequence is screened for repetitive elements using the publicly available RepeatMasker program. RepeatMasker searches the test DNA sequence for repetitive elements and low-complexity regions. The result is a detailed annotation of the repeats present in a given query sequence.
[0588] Following identification, gRNAs were ranked into a hierarchy based on one or more of their distance to the target site, their orthogonality, and the presence of a 5'G (e.g., based on identifying close matches in the human genome containing relevant PAMs such as NGG PAM for S. pyogenes, NNGRR (e.g., NNGRRT or NNGRRV) PAM for S. aureus, and NNNNGATT or NNNNGCTTPAM for N. meningitidis). Orthogonality refers to the number of sequences in the human genome that contain a minimal number of mismatches to the target sequence. "High level of orthogonality" or "good orthogonality" may refer, for example, to a 20-mer targeting domain that has no identical sequences other than the intended target in the human genome or any sequences containing one or two mismatches in the target sequence. Targeting domains with good orthogonality are selected to minimize off-target DNA cleavage. This is a non-limiting example, and it is understood that a variety of strategies can be utilized to identify gRNAs for use with S. pyogenes, S. aureus, and N. meningitidis or other Cas9 enzymes.
[0589] Two design and layering strategies are utilized to identify representative gRNAs for use with S. pyogenes, S. aureus, and N. meningitidis Cas9 enzymes.
[0590] First strategy to design and layer gRNAs In the first strategy, the publicly available web-based ZiFiT server was used to identify S. pyogenes Cas9 for use with gRNAs (Fu et al., Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat Biotechnol. 2014 Jan 26. doi:10.1038 / nbt.2808. PubMed PMID:24463574; for original references, see Sander et al., 2007, NAR 35:W599-605; Sander et al., 2010, NAR 38:W462-8). In addition to identifying potential gRNA sites adjacent to the PAM sequence, the software also identifies all PAM-flanking sequences that differ from the selected gRNA site by one, two, three, or more nucleotides. The genomic DNA sequence of each gene was obtained from the UCSC Genome Browser, and the sequences were screened for repetitive elements using the publicly available Repeat-Masker program. RepeatMasker searches a test DNA sequence for repetitive elements and low-complexity regions. The result is a detailed annotation of the repeats present in a given query sequence. Following identification, gRNAs used with S. pyogenes Cas9 were ranked into five tiers.
[0591] The targeting domains of the first-tier gRNA molecules were selected based on their distance to the target site, their orthogonality, and the presence of a 5'G (based on ZiFiT identification of close matches in the human genome containing an NGG PAM). Orthogonality refers to the number of sequences in the human genome that contain a minimum number of mismatches to the target sequence. "High level of orthogonality" or "good orthogonality" may refer, for example, to 20-mer gRNAs that do not have identical sequences in the human genome or any sequences that contain one or two mismatches in the target sequence. Targeting domains with good orthogonality were selected to minimize off-target DNA cleavage. For all targets, both 17-mer and 20-mer gRNAs were designed. gRNAs were also selected for both single-gRNA nuclease cleavage and dual-gRNA nickase strategies. The criteria for selecting gRNAs and determining which gRNAs can be used for which strategies are based on several considerations:
[0592] Both the single gRNA nuclease cleavage and the double gRNA pairing "nickase" strategies identified gRNAs. The criteria for selecting gRNAs and the determination of which gRNAs can be used for the double gRNA pairing "nickase" strategy are based on two considerations: 1. The gRNA pair should be oriented on the DNA with the PAM facing outward, such that cleavage by the D10A Cas9 nickase results in a 5' overhang. 2. The hypothesis is that cleavage by a double nickase pair results in the deletion of the entire intervening sequence with reasonable frequency. However, cleavage by a double nickase pair can often also result in indel mutations at only one site of the gRNA. Candidate pair members can be tested for how efficiently they remove the entire sequence compared to simply causing indel mutations at one gRNA site.
[0593] Targeting domains for first-tier gRNA molecules were selected based on (1) reasonable distance from the target location, e.g., within the first 500 bp of coding sequence downstream of the start codon, (2) a high level of orthogonality, and (3) the presence of a 5' G. For second-tier gRNA selection, the requirement for a 5' G was eliminated, but distance restrictions were required and a high level of orthogonality was required. Third-tier selection used the same distance restrictions and the requirement for a 5' G, but eliminated the requirements for good orthogonality. Fourth-tier selection used the same distance restrictions, but eliminated the requirements for good orthogonality and starting with a 5' G. Fifth-tier selection eliminated the requirements for good orthogonality and a 5' G, and scanned longer sequences (e.g., the remaining portion of the coding sequence, e.g., 500 bp upstream or downstream of additional transcriptional target sites). Note that the tiers are non-inclusive (each gRNA is listed only once). In some cases, gRNAs were not identified based on specific tier criteria.
[0594] As discussed above, gRNAs were identified for single gRNA nuclease cleavage as well as for the double gRNA pairing "nickase" strategy, as shown.
[0595] gRNAs used with N. meningitidis and S. aureus Cas9 were manually identified by scanning genomic DNA sequences for the presence of PAM sequences. These gRNAs were differentiated into two tiers. For first-tier gRNAs, targeting domains were selected in the first 500 bp of coding sequence downstream of the start codon. For second-tier gRNAs, targeting domains were selected in the remaining coding sequence (downstream of the first 500 bp). Note that the tiers are non-inclusive (each gRNA is listed only once for a strategy). In some cases, gRNAs were not identified based on specific tier criteria.
[0596] Representative targeting domains (first strategy) Below is a table providing representative targeting domains according to the first design and layering strategy. As an example, for S. pyogenes, S. aureus, and N. meningitidis targets, 17-mer or 20-mer targeting domains were designed.
[0597] Table 1A provides targeting domains for FAS gene knockout using S. pyogenes Cas9 selected according to the first tier parameters. The targeting domain binds within the first 500 bp of coding sequence downstream of the start codon and begins with a G, with good orthogonality. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, where a S. pyogenes Cas9 nickase is used with two targeting domains complementary to opposing DNA strands to generate two nicks on opposing DNA strands; for example, a gRNA comprising any minus-strand targeting domain can be paired with any gRNA comprising a plus-strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp. In one embodiment, two gRNAs are used to target two Cas9 nucleases or two Cas9 nickases; for example, a gRNA with a targeting domain from Group A shown in Table 1 can be paired with a gRNA with any targeting domain from Group B.
[0598] [Table 1]
[0599] [Table 2]
[0600] Table 1B provides targeting domains for FAS gene knockout using S. pyogenes Cas9 selected according to the second tier parameters. The targeting domains bind within the first 500 bp of coding sequence downstream of the start codon, have good orthogonality, and do not start with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0601] [Table 3]
[0602] Table 1C provides targeting domains for FAS gene knockout using S. pyogenes Cas9 selected according to the third tier parameters. The targeting domain binds within the first 500 bp of coding sequence downstream of the start codon and begins with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0603] [Table 4]
[0604] Table ID provides targeting domains for FAS gene knockout using S. pyogenes Cas9 selected according to the fourth tier of parameters. The targeting domain binds within the first 500 bp of coding sequence downstream of the start codon and does not begin with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0605] [Table 5]
[0606] Table 1E provides targeting domains for FAS gene knockout using S. pyogenes Cas9 selected according to the fifth tier parameter. The targeting domain binds within the remaining coding sequence (downstream of the first 500 bp). It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0607] [Table 6]
[0608] Table 1F provides targeting domains for FAS gene knockout using S. aureus Cas9 selected according to the first tier parameters. The targeting domain binds within the first 500 bp of the coding sequence downstream of the start codon. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. aureus Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0609] [Table 7]
[0610] Table 1G provides targeting domains for FAS gene knockout using S. aureus Cas9 selected according to the second tier parameters. The targeting domain binds within the remaining coding sequence (downstream of the first 500 bp). It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. aureus Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0611] [Table 8]
[0612] Table 1H provides targeting domains for FAS gene knockout using N. meningitidis Cas9 selected according to the first tier parameters. The targeting domain binds within the first 500 bp of the coding sequence downstream of the start codon. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with N. meningitidis Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, whereby N. meningitidis Cas9 nickase is used to generate two nicks on opposing DNA strands, with two targeting domains complementary to opposing DNA strands; for example, any gRNA comprising a minus-strand targeting domain may be paired with any gRNA comprising a plus-strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0613] [Table 9]
[0614] Table 1I provides targeting domains for FAS gene knockout using N. meningitidis Cas9 selected according to the second tier parameters. The targeting domain binds within the remaining coding sequence (downstream of the first 500 bp). It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with N. meningitidis Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, whereby N. meningitidis Cas9 nickase is used to generate two nicks on opposing DNA strands, with two targeting domains complementary to opposing DNA strands; for example, any gRNA comprising a minus-strand targeting domain may be paired with any gRNA comprising a plus-strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0615] [Table 10]
[0616] Table 2A provides targeting domains for FAS gene knockdown using S. pyogenes Cas9 selected according to the first tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site, have good orthogonality, and begin with a G. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0617] [Table 11]
[0618] Table 2B provides targeting domains for FAS gene knockdown using S. pyogenes Cas9 selected according to the second tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site, have good orthogonality, and do not start with a G. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0619] [Table 12]
[0620] Table 2C provides targeting domains for FAS gene knockdown using S. pyogenes Cas9 selected according to the third tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site and begin with a G. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0621] [Table 13]
[0622] Table 2D provides targeting domains for FAS gene knockdown using S. pyogenes Cas9 selected according to the fourth tier of parameters. The targeting domain binds within 500 bp upstream and downstream of the transcription start site and does not start with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0623] [Table 14]
[0624] Table 2E provides targeting domains for FAS gene knockdown using S. pyogenes Cas9 selected according to the fifth tier parameter. The targeting domains bind within an additional 500 bp upstream and downstream of the transcription start site (spanning 1 kb upstream and downstream of the transcription start site). It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0625] [Table 15]
[0626] Table 2F provides targeting domains for FAS gene knockdown using S. aureus Cas9 selected according to the first tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0627] [Table 16]
[0628] Table 2G provides targeting domains for FAS gene knockdown using S. aureus Cas9 selected according to the second tier parameters. The targeting domains bind within an additional 500 bp upstream and downstream of the transcription start site (spanning 1 kb upstream and downstream of the transcription start site). It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus eiCas9 molecules, such as the eiCas9 fusion proteins described herein.
[0629] [Table 17]
[0630] Table 2H provides targeting domains for FAS gene knockdown using N. meningitidis Cas9 selected according to the first tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with N. meningitidis eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0631] [Table 18]
[0632] Table 2I provides targeting domains for FAS gene knockdown using N. meningitidis Cas9 selected according to the second tier parameters. The targeting domains bind within an additional 500 bp upstream and downstream of the transcription start site (spanning 1 kb upstream and downstream of the transcription start site). It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with N. meningitidis eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0633] [Table 19]
[0634] Table 3A provides targeting domains for BID gene knockout using S. pyogenes Cas9 selected according to the first tier parameters. The targeting domains bind within the first 500 bp of coding sequence downstream of the start codon, have good orthogonality, and begin with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, where a S. pyogenes Cas9 nickase is used with two targeting domains complementary to opposing DNA strands to generate two nicks on opposing DNA strands; for example, a gRNA comprising any minus-strand targeting domain can be paired with any gRNA comprising a plus-strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp. In one embodiment, two gRNAs are used to target two Cas9 nucleases or two Cas9 nickases; for example, a gRNA with a targeting domain from Group A shown in Table 3 can be paired with a gRNA with any targeting domain from Group B, or a gRNA with a targeting domain from Group C shown in Table 3 can be paired with a gRNA with any targeting domain from Group D.
[0635] [Table 20]
[0636] [Table 21]
[0637] Table 3B provides targeting domains for BID gene knockout using S. pyogenes Cas9 selected according to the second tier parameters. The targeting domains bind within the first 500 bp of coding sequence downstream of the start codon, have good orthogonality, and do not start with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0638] [Table 22]
[0639] Table 3C provides targeting domains for BID gene knockout using S. pyogenes Cas9 selected according to the third tier parameters. The targeting domain binds within the first 500 bp of coding sequence downstream of the start codon and begins with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0640] [Table 23]
[0641] Table 3D provides targeting domains for BID gene knockout using S. pyogenes Cas9 selected according to the fourth tier of parameters. The targeting domain binds within the first 500 bp of coding sequence downstream of the start codon and does not begin with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0642] [Table 24]
[0643] Table 3E provides targeting domains for BID gene knockout using S. pyogenes Cas9 selected according to the fifth tier parameter. The targeting domain binds within the remaining coding sequence (downstream of the first 500 bp). It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0644] [Table 25]
[0645] Table 3F provides targeting domains for BID gene knockout using S. aureus Cas9 selected according to the first tier parameters. The targeting domain binds within the first 500 bp of the coding sequence downstream of the start codon. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. aureus Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0646] [Table 26]
[0647] Table 3G provides targeting domains for BID gene knockout using S. aureus Cas9 selected according to the second tier parameters. The targeting domain binds within the remaining coding sequence (downstream of the first 500 bp). It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. aureus Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0648] [Table 27]
[0649] Table 3H provides targeting domains for BID gene knockout using N. meningitidis Cas9 selected according to the first tier parameters. The targeting domain binds within the first 500 bp of the coding sequence downstream of the start codon. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with N. meningitidis Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, whereby N. meningitidis Cas9 nickase is used to generate two nicks on opposing DNA strands, with two targeting domains complementary to opposing DNA strands; for example, any gRNA comprising a minus-strand targeting domain may be paired with any gRNA comprising a plus-strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0650] [Table 28]
[0651] Table 4A provides targeting domains for BID gene knockdown using S. pyogenes Cas9 selected according to the first tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site, have good orthogonality, and begin with a G. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0652] [Table 29]
[0653] Table 4B provides targeting domains for BID gene knockdown using S. pyogenes Cas9 selected according to the second tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site, have good orthogonality, and do not start with a G. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0654] [Table 30]
[0655] Table 4C provides targeting domains for BID gene knockdown using S. pyogenes Cas9 selected according to the third tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site and begin with a G. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0656] [Table 31]
[0657] Table 4D provides targeting domains for BID gene knockdown using S. pyogenes Cas9 selected according to the fourth tier parameters. The targeting domain binds within 500 bp upstream and downstream of the transcription start site and does not start with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0658] [Table 32]
[0659] Table 4E provides targeting domains for BID gene knockdown using S. pyogenes Cas9 selected according to the fifth tier parameter. The targeting domains bind within an additional 500 bp upstream and downstream of the transcription start site (spanning 1 kb upstream and downstream of the transcription start site). It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0660] [Table 33]
[0661] Table 4F provides targeting domains for BID gene knockdown using S. aureus Cas9 selected according to the first tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0662] [Table 34]
[0663] Table 4G provides targeting domains for BID gene knockdown using S. aureus Cas9 selected according to the second tier parameters. The targeting domains bind within an additional 500 bp upstream and downstream of the transcription start site (spanning 1 kb upstream and downstream of the transcription start site). It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus eiCas9 molecules, such as the eiCas9 fusion proteins described herein.
[0664] [Table 35]
[0665] Table 4H provides targeting domains for BID gene knockdown using N. meningitidis Cas9 selected according to the first tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with N. meningitidis eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0666] [Table 36]
[0667] Table 4I provides targeting domains for BID gene knockdown using N. meningitidis Cas9 selected according to the second tier parameters. The targeting domains bind within an additional 500 bp upstream and downstream of the transcription start site (spanning 1 kb upstream and downstream of the transcription start site). It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with N. meningitidis eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0668] [Table 37]
[0669] Table 5A provides targeting domains for CTLA4 gene knockout using S. pyogenes Cas9 selected according to the first tier parameters. The targeting domains bind within the first 500 bp of coding sequence downstream of the start codon, have good orthogonality, and begin with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, where a S. pyogenes Cas9 nickase is used with two targeting domains complementary to opposing DNA strands to generate two nicks on opposing DNA strands; for example, a gRNA comprising any minus-strand targeting domain can be paired with any gRNA comprising a plus-strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp. In one embodiment, two gRNAs are used to target two Cas9 nucleases or two Cas9 nickases; for example, a gRNA with a targeting domain from Group A shown in Table 5 can be paired with a gRNA with any targeting domain from Group B, or a gRNA with a targeting domain from Group C shown in Table 5 can be paired with a gRNA with any targeting domain from Group D.
[0670] [Table 38]
[0671] [Table 39]
[0672] Table 5B provides targeting domains for CTLA4 gene knockout using S. pyogenes Cas9 selected according to the second tier parameters. The targeting domains bind within the first 500 bp of coding sequence downstream of the start codon, have good orthogonality, and do not start with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0673] [Table 40]
[0674] Table 5C provides targeting domains for CTLA4 gene knockout using S. pyogenes Cas9 selected according to the third tier parameters. The targeting domain binds within the first 500 bp of coding sequence downstream of the start codon and begins with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0675] [Table 41]
[0676] Table 5D provides targeting domains for CTLA4 gene knockout using S. pyogenes Cas9 selected according to the fourth tier of parameters. The targeting domain binds within the first 500 bp of coding sequence downstream of the start codon and does not begin with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0677] [Table 42]
[0678] Table 5E provides targeting domains for CTLA4 gene knockout using S. pyogenes Cas9 selected according to the fifth tier parameters. The targeting domain binds within the remaining coding sequence (downstream of the first 500 bp). It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. pyogenes Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA with the PAMs facing outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0679] [Table 43]
[0680] Table 5F provides targeting domains for CTLA4 gene knockout using S. aureus Cas9 selected according to the first tier parameters. The targeting domain binds within the first 500 bp of the coding sequence downstream of the start codon. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. aureus Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0681] [Table 44]
[0682] Table 5G provides targeting domains for CTLA4 gene knockout using S. aureus Cas9 selected according to the second tier parameters. The targeting domain binds within the remaining coding sequence (downstream of the first 500 bp). It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, with two targeting domains complementary to opposite DNA strands, using S. aureus Cas9 nickase to generate two nicks on opposite DNA strands; for example, any gRNA comprising a minus strand targeting domain may be paired with any gRNA comprising a plus strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0683] [Table 45]
[0684] Table 5H provides targeting domains for CTLA4 gene knockout using N. meningitidis Cas9 selected according to the first tier parameters. The targeting domain binds within the first 500 bp of the coding sequence downstream of the start codon. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with N. meningitidis Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, whereby N. meningitidis Cas9 nickase is used to generate two nicks on opposing DNA strands, with two targeting domains complementary to opposing DNA strands; for example, any gRNA comprising a minus-strand targeting domain may be paired with any gRNA comprising a plus-strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0685] [Table 46]
[0686] Table 5I provides targeting domains for CTLA4 gene knockout using N. meningitidis Cas9 selected according to the second tier parameters. The targeting domain binds within the remaining coding sequence (downstream of the first 500 bp). It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with N. meningitidis Cas9 molecules to generate double-stranded breaks (Cas9 nuclease) or single-stranded breaks (Cas9 nickase). In one embodiment, dual targeting is used, whereby N. meningitidis Cas9 nickase is used to generate two nicks on opposing DNA strands, with two targeting domains complementary to opposing DNA strands; for example, any gRNA comprising a minus-strand targeting domain may be paired with any gRNA comprising a plus-strand targeting domain, provided that the two gRNAs are oriented on the DNA such that the PAMs face outward and the distance between the 5' ends of the gRNAs is 0-50 bp.
[0687] [Table 47]
[0688] Table 6A provides targeting domains for CTLA4 gene knockdown using S. pyogenes Cas9 selected according to the first tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site, have good orthogonality, and begin with a G. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0689] [Table 48]
[0690] Table 6B provides targeting domains for CTLA4 gene knockdown using S. pyogenes Cas9 selected according to the second tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site, have good orthogonality, and do not start with a G. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0691] [Table 49]
[0692] Table 6C provides targeting domains for CTLA4 gene knockdown using S. pyogenes Cas9 selected according to the third tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site and begin with a G. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0693] [Table 50]
[0694] Table 6D provides targeting domains for CTLA4 gene knockdown using S. pyogenes Cas9 selected according to the fourth tier parameters. The targeting domain binds within 500 bp upstream and downstream of the transcription start site and does not start with a G. It is contemplated herein that the targeting domain hybridizes to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0695] [Table 51]
[0696] Table 6E provides targeting domains for CTLA4 gene knockdown using S. pyogenes Cas9 selected according to the fifth tier parameter. The targeting domains bind within an additional 500 bp upstream and downstream of the transcription start site (spanning 1 kb upstream and downstream of the transcription start site). It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. pyogenes eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0697] [Table 52]
[0698] Table 6F provides targeting domains for CTLA4 gene knockdown using S. aureus Cas9 selected according to the first tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0699] [Table 53]
[0700] Table 6G provides targeting domains for CTLA4 gene knockdown using S. aureus Cas9 selected according to the second tier parameters. The targeting domains bind within an additional 500 bp upstream and downstream of the transcription start site (spanning 1 kb upstream and downstream of the transcription start site). It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with S. aureus eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0701] [Table 54]
[0702] Table 6H provides targeting domains for CTLA4 gene knockdown using N. meningitidis Cas9 selected according to the first tier parameters. The targeting domains bind within 500 bp upstream and downstream of the transcription start site. It is contemplated herein that the targeting domains hybridize to the target domain through complementary base pairing. Any of the targeting domains in the table can be used with N. meningitidis eiCas9 molecules, such as, for example, the eiCas9 fusion proteins described herein.
[0703] [Table 55]
[0704] ...
Claims
1. A gRNA molecule comprising a targeting domain complementary to a targeting domain derived from a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene.
2. 2. The gRNA molecule of Claim 1, wherein the targeting domain is configured to provide a cleavage event selected from a double-stranded break and a single-stranded break within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of a T cell targeted knockout position.
3. 2. The gRNA molecule of Claim 1, wherein the targeting domain is designed to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein sufficiently close to a T cell targeted knockdown location to reduce, decrease or suppress expression of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
4. 4. The gRNA molecule of Claim 3, wherein the targeting domain is designed to target the promoter region of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
5. 2. The gRNA molecule of Claim 1, wherein the targeting domain comprises a sequence identical to or differing by no more than 3 nucleotides from a targeting domain sequence from any of Tables 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32.
6. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 1A-F or 13A-K.
7. 2. The gRNA molecule of claim 1, wherein the targeting domain is selected from those in Tables 2A-I or 14A-K.
8. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 3A-H or 15A-F.
9. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 4A-I or 16A-K.
10. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 5A-I or 17A-K.
11. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 6A-I or 18A-K.
12. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 7A-H, 19A-J, 31, or 32.
13. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 8A-H or 20A-J.
14. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 9A-I or 21A-K.
15. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 10A-I or 22A-K.
16. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 11A-I or 23A-J.
17. 2. The gRNA molecule of claim 1, wherein the targeting domain is selected from those in Tables 12A-I or 24A-K.
18. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Tables 25A-G or 29.
19. 2. The gRNA molecule of Claim 1, wherein the targeting domain is selected from those in Table 26A-G or Table 27.
20. The gRNA molecule of any one of claims 1 to 19, wherein the gRNA is a modular gRNA molecule.
21. The gRNA molecule of any one of claims 1 to 19, wherein the gRNA is a chimeric gRNA molecule.
22. 20. The gRNA molecule of any one of claims 1 to 19, wherein the targeting domain is 16 or 17 nucleotides or more in length.
23. 20. The gRNA molecule of any one of claims 1 to 19, wherein the targeting domain is 16 or 17 nucleotides in length.
24. 20. The gRNA molecule of any one of claims 1 to 19, wherein the targeting domain is 18 nucleotides in length.
25. 20. The gRNA molecule of any one of claims 1 to 19, wherein the targeting domain is 19 nucleotides in length.
26. 20. The gRNA molecule of any one of claims 1 to 19, wherein the targeting domain is 20 nucleotides in length.
27. 20. The gRNA molecule of any one of claims 1 to 19, wherein the targeting domain is 21 nucleotides in length.
28. 20. The gRNA molecule of any one of claims 1 to 19, wherein the targeting domain is 22 nucleotides in length.
29. 20. The gRNA molecule of any one of claims 1 to 19, wherein the targeting domain is 23 nucleotides in length.
30. 20. The gRNA molecule of any one of claims 1 to 19, wherein the targeting domain is 24, 25, or 26 nucleotides in length.
31. In the 5' to 3' direction, targeting domain; a first complementary domain; Linking domain; a second complementary domain; adjacent domains; and Tail domain The gRNA molecule of any one of claims 1 to 30, comprising:
32. a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 20 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The gRNA molecule of any one of claims 1 to 30, comprising:
33. a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 30 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The gRNA molecule of any one of claims 1 to 30, comprising:
34. a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 35 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The gRNA molecule of any one of claims 1 to 30, comprising:
35. a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 40 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The gRNA molecule of any one of claims 1 to 30, comprising:
36. (a) a nucleic acid comprising a sequence encoding a gRNA molecule, wherein the gRNA molecule comprises a targeting domain complementary to a T cell targeting domain in a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene.
37. 37. The nucleic acid of claim 36, wherein the gRNA molecule is a gRNA molecule of any one of claims 1 to 35.
38. 37. The nucleic acid of Claim 36, wherein the targeting domain is configured to provide a cleavage event selected from a double-stranded break and a single-stranded break within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of a T cell targeting knockout position.
39. 37. The nucleic acid of claim 36, wherein the targeting domain is designed to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein sufficiently close to a T cell targeted knockdown location to reduce, decrease or suppress expression of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
40. 37. The nucleic acid of claim 36, wherein the targeting domain is designed to target the promoter region of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
41. 37. The nucleic acid of claim 36, wherein the targeting domain comprises a sequence that is identical or differs by no more than 3 nucleotides from a targeting domain sequence from any of Table 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32.
42. The targeting domain is Table 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A- 37. The nucleic acid of claim 36, wherein the nucleic acid is selected from those of Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32.
43. 43. The nucleic acid of any one of claims 36 to 42, wherein the gRNA is a modular gRNA molecule.
44. The nucleic acid of any one of claims 36 to 42, wherein the gRNA is a chimeric gRNA molecule.
45. 43. The nucleic acid of any one of claims 36 to 42, wherein the targeting domain is 16 or 17 nucleotides or more in length.
46. 43. The nucleic acid of any one of claims 36 to 42, wherein the targeting domain is 16 or 17 nucleotides in length.
47. 43. The nucleic acid of any one of claims 36 to 42, wherein the targeting domain is 18 nucleotides in length.
48. 43. The nucleic acid of any one of claims 36 to 42, wherein the targeting domain is 19 nucleotides in length.
49. 43. The nucleic acid of any one of claims 36 to 42, wherein the targeting domain is 20 nucleotides in length.
50. 43. The nucleic acid of any one of claims 36 to 42, wherein the targeting domain is 21 nucleotides in length.
51. 43. The nucleic acid of any one of claims 36 to 42, wherein the targeting domain is 22 nucleotides in length.
52. 43. The nucleic acid of any one of claims 36 to 42, wherein the targeting domain is 23 nucleotides in length.
53. 43. The nucleic acid of any one of claims 36 to 42, wherein the targeting domain is 24, 25, or 26 nucleotides in length.
54. In the 5' to 3' direction targeting domain; a first complementary domain; Linking domain; a second complementary domain; adjacent domains; and Tail domain The nucleic acid according to any one of claims 36 to 54, comprising:
55. a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 20 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The nucleic acid according to any one of claims 36 to 54, comprising:
56. a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 30 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The nucleic acid according to any one of claims 36 to 54, comprising:
57. a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 35 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The nucleic acid according to any one of claims 36 to 54, comprising:
58. a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 40 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The nucleic acid according to any one of claims 36 to 54, comprising:
59. (b) the nucleic acid of any one of claims 36 to 58, further comprising a sequence encoding a Cas9 molecule.
60. 60. The nucleic acid of Claim 59, wherein the Cas9 molecule is an eaCas9 molecule.
61. 61. The nucleic acid of Claim 60, wherein the eaCas9 molecule comprises a nickase molecule.
62. 61. The nucleic acid of Claim 60, wherein the eaCas9 molecule forms a double-stranded break in the target nucleic acid.
63. 61. The nucleic acid of Claim 60, wherein the eaCas9 molecule forms a single-stranded break in the target nucleic acid.
64. 64. The nucleic acid of Claim 63, wherein the single-stranded break is formed in the target nucleic acid strand to which the targeting domain of a gRNA molecule is complementary.
65. 64. The nucleic acid of Claim 63, wherein the single-stranded break is formed in a strand of the target nucleic acid other than the strand to which the targeting domain of a gRNA is complementary.
66. 61. The nucleic acid of Claim 60, wherein the eaCas9 molecule comprises HNH-like domain cleavage activity but no or insignificant N-terminal RuvC-like domain cleavage activity.
67. 61. The nucleic acid of Claim 60, wherein the eaCas9 molecule is an HNH-like domain nickase.
68. 61. The nucleic acid of Claim 60, wherein the eaCas9 molecule comprises a mutation at D10.
69. 61. The nucleic acid of Claim 60, wherein the eaCas9 molecule comprises N-terminal RuvC-like domain cleavage activity but no or insignificant HNH-like domain cleavage activity.
70. 61. The nucleic acid of Claim 60, wherein the eaCas9 molecule is an N-terminal RuvC-like domain nickase.
71. 61. The nucleic acid of Claim 60, wherein the eaCas9 molecule comprises a mutation at H840.
72. 60. The nucleic acid of Claim 59, wherein the Cas9 molecule is an eiCas9 molecule.
73. 73. The nucleic acid of Claim 72, wherein the Cas9 molecule is an eiCas9 fusion protein molecule (e.g., an eiCas9 transcriptional repressor domain fusion, such as an eiCas9-KRAB domain fusion).
74. (c) the nucleic acid of any one of claims 36 to 73, further comprising a sequence encoding a second gRNA molecule described herein, having a targeting domain complementary to a second target domain of a FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC gene.
75. 75. The nucleic acid of claim 74, wherein the second gRNA molecule is a gRNA molecule of any one of claims 1 to 35.
76. 75. The nucleic acid of Claim 74, wherein the targeting domain of the second gRNA is configured to provide a cleavage event selected from a double-stranded break and a single-stranded break within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of a T cell targeted knockout position.
77. 75. The nucleic acid of Claim 74, wherein the targeting domain of the second gRNA is designed to target an enzymatically inactive Cas9 (eiCas9) or an eiCas9 fusion protein sufficiently close to a T cell targeted knockdown location to reduce, decrease or suppress expression of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
78. 75. The nucleic acid of Claim 74, wherein the targeting domain of the second gRNA is designed to target the promoter region of the FAS, BID, CTLA4, PDCD1, CBLB, or PTPN6 gene.
79. 75. The nucleic acid of Claim 74, wherein the targeting domain of the second gRNA comprises a sequence identical to or differing by no more than 3 nucleotides from a targeting domain sequence from any of Tables 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32.
80. 75. The nucleic acid of Claim 74, wherein the targeting domain of the second gRNA is selected from those in Table 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K, Table 15A-F, Table 16A-K, Table 17A-K, Table 18A-K, Table 19A-J, Table 20A-J, Table 21A-K, Table 22A-K, Table 23A-J, Table 24A-K, Table 25A-G, Table 26A-G, Table 27, Table 29, Table 31, or Table 32.
81. 81. The nucleic acid of any one of claims 74 to 80, wherein the second gRNA molecule is a modular gRNA molecule.
82. 81. The nucleic acid of any one of claims 74 to 80, wherein the second gRNA molecule is a chimeric gRNA molecule.
83. 81. The nucleic acid of any one of claims 74 to 80, wherein the targeting domain is 16 or 17 nucleotides or more in length.
84. 81. The nucleic acid of any one of claims 74 to 80, wherein the targeting domain is 16 or 17 nucleotides in length.
85. 81. The nucleic acid of any one of claims 74 to 80, wherein the targeting domain is 18 nucleotides in length.
86. 81. The nucleic acid of any one of claims 74 to 80, wherein the targeting domain is 19 nucleotides in length.
87. 81. The nucleic acid of any one of claims 74 to 80, wherein the targeting domain is 20 nucleotides in length.
88. 81. The nucleic acid of any one of claims 74 to 80, wherein the targeting domain is 21 nucleotides in length.
89. 81. The nucleic acid of any one of claims 74 to 80, wherein the targeting domain is 22 nucleotides in length.
90. 81. The nucleic acid of any one of claims 74 to 80, wherein the targeting domain is 23 nucleotides in length.
91. 81. The nucleic acid of any one of claims 74 to 80, wherein the targeting domain is 24, 25, or 26 nucleotides in length.
92. the second gRNA molecule is arranged in a 5' to 3' direction as follows: targeting domain; a first complementary domain; Linking domain; a second complementary domain; adjacent domains; and Tail domain The nucleic acid according to any one of claims 74 to 91, comprising:
93. the second gRNA molecule a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 20 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The nucleic acid according to any one of claims 74 to 92, comprising:
94. The second molecule gRNA comprises: a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 30 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The nucleic acid according to any one of claims 74 to 92, comprising:
95. the second gRNA molecule a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 35 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The nucleic acid according to any one of claims 74 to 92, comprising:
96. the second gRNA molecule a linking domain of 25 nucleotides or less in length; flanking and tail domains that together are at least 40 nucleotides in length; and a targeting domain of 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length The nucleic acid according to any one of claims 74 to 92, comprising:
97. 97. The nucleic acid of any one of claims 74 to 96, further comprising a third gRNA molecule.
98. 98. The nucleic acid of Claim 97, further comprising a fourth gRNA molecule.
99. (b) the nucleic acid of claim 36, further comprising a sequence encoding a Cas9 molecule of any one of claims 59 to 73.
100. 100. The nucleic acid of Claim 99, wherein the nucleic acid does not comprise (c) a sequence encoding a second gRNA molecule.
101. 101. The nucleic acid of claim 100, wherein each of (a) and (b) is present on the same nucleic acid molecule.
102. 101. The nucleic acid of claim 100, wherein the nucleic acid molecule is an AAV vector.
103. 102. The nucleic acid of claim 101, wherein (a) is present on a first nucleic acid molecule; and (b) is present on a second nucleic acid molecule.
104. 104. The nucleic acid of claim 103, wherein the first and second nucleic acid molecules are AAV vectors.
105. (b) a sequence encoding a Cas9 molecule according to any one of claims 59 to 73; and (c) A sequence encoding a second gRNA molecule according to claims 74 to 96.
37. The nucleic acid of claim 36, further comprising:
106. 106. The nucleic acid of claim 105, wherein each of (a), (b), and (c) is present on the same nucleic acid molecule.
107. The nucleic acid of claim 106, wherein the nucleic acid molecule is an AAV vector.
108. one of (a), (b), and (c) is encoded on a first nucleic acid molecule; 106. The nucleic acid of claim 105, wherein the second and third of (a), (b), and (c) are encoded on a second nucleic acid molecule.
109. 109. The nucleic acid of claim 108, wherein the first and second nucleic acid molecules are AAV vectors.
110. 109. The nucleic acid of claim 108, wherein (a) is present on a first nucleic acid molecule; and (b) and (c) are present on a second nucleic acid molecule.
111. 111. The nucleic acid of claim 110, wherein the first and second nucleic acid molecules are AAV vectors.
112. 109. The nucleic acid of claim 108, wherein (b) is present on a first nucleic acid molecule; and (a) and (c) are present on a second nucleic acid molecule.
113. 113. The nucleic acid of claim 112, wherein the first and second nucleic acid molecules are AAV vectors.
114. 109. The nucleic acid of claim 108, wherein (c) is present on a first nucleic acid molecule; and (b) and (a) are present on a second nucleic acid molecule.
115. 115. The nucleic acid of claim 114, wherein the first and second nucleic acid molecules are AAV vectors.
116. 115. The nucleic acid of any one of claims 103, 108, 110, 112, or 114, wherein the first nucleic acid molecule is other than an AAV vector and the second nucleic acid molecule is an AAV vector.
117. 59. The nucleic acid of any one of claims 36 to 58, wherein the nucleic acid comprises a promoter operably linked to a sequence encoding the gRNA molecule of (a).
118. 97. The nucleic acid of any one of claims 74 to 96, wherein the nucleic acid comprises a second promoter operably linked to a sequence encoding the second gRNA molecule of (c).
119. 119. The nucleic acid of any one of claims 117 or 118, wherein the promoter and the second promoter are different from each other.
120. 119. The nucleic acid of any one of claims 117 or 118, wherein the promoter and the second promoter are the same.
121. 74. The nucleic acid of any one of claims 59 to 73, wherein the nucleic acid comprises a promoter operably linked to a sequence encoding the Cas9 molecule of (b).
122. 97. The nucleic acid of any one of claims 36 to 96, further comprising a gRNA molecule targeting a second gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
123. 97. The nucleic acid of any one of claims 36 to 96, further comprising a gRNA molecule targeting at least one additional gene selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
124. A composition comprising a gRNA molecule (a) according to any one of claims 1 to 35.
125. The composition of claim 124, further comprising a (b) Cas9 molecule of any one of claims 59 to 73.
126. The composition of any one of claims 124 or 125, further comprising (c) a second gRNA molecule of any one of claims 74 to 96.
127. 127. The composition of claim 126, further comprising a third gRNA molecule.
128. 128. The composition of claim 127, further comprising a fourth gRNA molecule.
129. A composition comprising at least two gRNA molecules targeting two or more of the following genes: FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC.
130. At least two gRNA molecules directed against two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes are listed in Table 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A-I, Table 13A-K, Table 14A-K 130. The composition of claim 129, comprising a sequence identical to or differing by no more than 3 nucleotides from a targeting domain sequence from any of Tables 15A-F, Tables 16A-K, Tables 17A-K, Tables 18A-K, Tables 19A-J, Tables 20A-J, Tables 21A-K, Tables 22A-K, Tables 23A-J, Tables 24A-K, Tables 25A-G, Tables 26A-G, Table 27, Table 29, Table 31, or Table 32.
131. At least two gRNA molecules directed against two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes are listed in Table 1A-I, Table 2A-I, Table 3A-H, Table 4A-I, Table 5A-I, Table 6A-I, Table 7A-H, Table 8A-H, Table 9A-I, Table 10A-I, Table 11A-I, Table 12A 130. The composition of claim 129, wherein the composition is selected from those in Tables 13A-K, 14A-K, 15A-F, 16A-K, 17A-K, 18A-K, 19A-J, 20A-J, 21A-K, 22A-K, 23A-J, 24A-K, 25A-G, 26A-G, 27, 29, 31, or 32.
132. (b) the composition of any one of claims 59 to 73, further comprising a Cas9 molecule.
133. 133. The composition of any one of claims 129-132, further comprising (c) a second gRNA molecule of any one of claims 74-96 that targets two or more of the following genes: FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC.
134. 134. The composition of claim 133, further comprising a third gRNA molecule.
135. 135. The composition of claim 134, further comprising a fourth gRNA molecule.
136. Cells (a) a gRNA according to any one of claims 1 to 35; (b) a Cas9 molecule according to any one of claims 59 to 73; and Optionally, (c) a second gRNA molecule according to any one of claims 74 to 96. A method of modifying a cell, comprising contacting the cell with
137. 137. The method of Claim 136, further comprising a third gRNA molecule.
138. 138. The method of Claim 137, further comprising a fourth gRNA molecule.
139. 139. The method of any one of claims 136-138, comprising contacting said cell with (a), (b), and optionally (c).
140. 140. The method of any one of claims 136 to 139, wherein the gRNA molecule is selected from any one of claims 1 to 35.
141. 141. The method of any one of claims 136 to 140, wherein the cells are derived from a subject suffering from cancer.
142. 142. The method of any one of claims 136 to 141, wherein said cells are derived from a subject with cancer or who would otherwise benefit from a mutation in a T cell target locus of said FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene.
143. 143. The method of any one of claims 136 to 142, wherein the cell is a T cell.
144. 144. The method of claim 143, wherein the T cells are genetically engineered T cells.
145. 145. The method of claim 144, wherein the engineered T cells are engineered chimeric antigen receptor (CAR) T cells.
146. 145. The method of claim 144, wherein the engineered T cells are engineered TCR (T cell receptor) T cells.
147. 144. The method of claim 143, wherein said T cells are genetically engineered to express a TCR or CAR prior to introducing the T cell targeted position mutation(s) of one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
148. 144. The method of claim 143, wherein said T cells are engineered to express a TCR or CAR after introduction of one or more T cell targeted position mutations of said FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
149. 144. The method of claim 143, wherein said T cells are genetically engineered to express a TCR or CAR concomitantly with the introduction of one or more T cell targeted position mutations of said FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
150. 150. The method of claims 136-149, wherein the contacting step is carried out in vitro.
151. The method of claims 136-150, wherein the contacted cells are returned to the subject's body.
152. 152. The method of any one of claims 136 to 151, wherein the cells are derived from a subject with cancer.
153. 153. A method according to any one of claims 136 to 152, comprising obtaining knowledge of the sequence of a T cell target location within said cell.
154. 154. The method of claim 153, comprising sequencing a portion of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene to obtain knowledge of the T cell target location sequence within the cell.
155. 155. The method of any one of claims 136 to 154, comprising inducing targeted positional mutations in T cells.
156. 156. The method of any one of claims 136-155, wherein the contacting step comprises contacting the cell with a nucleic acid encoding at least one of (a), (b), and (c).
157. 157. The method of any one of claims 136 to 156, wherein the contacting step comprises contacting said cell with a nucleic acid of any one of claims 36 to 123.
158. 158. The method of any one of Claims 136-157, wherein the contacting comprises delivering to said cell a nucleic acid encoding the Cas9 molecule of (b), (a), and optionally (c).
159. 159. The method of any one of Claims 136-158, wherein the contacting comprises delivering to the cell a Cas9 molecule of (b), a gRNA molecule of (a), and optionally a second gRNA molecule of (c).
160. 160. The method of any one of Claims 136-159, wherein the contacting comprises delivering to said cell a nucleic acid encoding a gRNA molecule of (a), optionally a second gRNA molecule of (c), and a Cas9 molecule of (b).
161. A subject (or cells derived from said subject) (a) a gRNA according to any one of claims 1 to 35; (b) a Cas9 molecule according to any one of claims 59 to 73; and Optionally, (c) a second gRNA according to any one of claims 74 to 96. A method of treating a subject comprising contacting a
162. 162. The method of Claim 161, further comprising a third gRNA molecule.
163. 163. The method of Claim 162, further comprising a fourth gRNA molecule.
164. 164. The method of any one of claims 161 to 163, further comprising the step of contacting the subject with (a), (b), and optionally (c).
165. The method of any one of claims 161 to 164, wherein the subject is suffering from cancer.
166. 166. The method of claim 165, wherein the cancer is selected from the group consisting of lymphoma, chronic lymphocytic leukemia (CLL), B-cell acute lymphocytic leukemia (B-ALL), acute lymphoblastic leukemia, acute myeloid leukemia, non-Hodgkin's lymphoma (NHL), diffuse large cell lymphoma (DLCL), multiple myeloma, renal cell carcinoma (RCC), neuroblastoma, colorectal cancer, breast cancer, ovarian cancer, melanoma, sarcoma, prostate cancer, lung cancer, esophageal cancer, hepatocellular carcinoma, pancreatic cancer, astrocytoma, mesothelioma, head and neck cancer, and medulloblastoma.
167. 167. The method of any one of claims 161 to 166, wherein said subject will benefit from a mutation in a T-cell target locus of said FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene.
168. 168. The method of any one of claims 161 to 167, wherein the subject will benefit from a mutation in one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
169. 168. The method of any one of claims 161 to 167, wherein the subject will benefit from mutations in two or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
170. 168. The method of any one of claims 161 to 167, wherein the subject will benefit from mutations in three or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
171. 168. The method of any one of claims 161 to 167, wherein the subject will benefit from mutations in four or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
172. 168. The method of any one of claims 161 to 167, wherein the subject will benefit from mutations in five or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
173. 168. The method of any one of claims 161 to 167, wherein the subject will benefit from six or more mutations in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
174. 168. The method of any one of claims 161 to 167, wherein the subject will benefit from seven or more mutations in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC and TRBC genes.
175. 168. The method of any one of claims 161 to 167, wherein the subject will benefit from a mutation in each of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, and TRBC genes.
176. 176. The method of any one of claims 161 to 175, comprising obtaining knowledge of the sequence of a T cell target location in said subject.
177. 177. The method of claim 176, comprising sequencing one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes or portions thereof to obtain knowledge of the sequence of T cell target locations in the subject.
178. 178. The method of any one of claims 161 to 177, comprising inducing T cell targeted positional mutations in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC gene.
179. 179. The method of any one of claims 161-178, wherein cells of the subject are contacted with (a), (b), and optionally (c) ex vivo.
180. 180. The method of claim 179, wherein the subject's cells are T cells.
181. 181. The method of claim 180, wherein the T cells are genetically engineered to express a TCR or a CAR.
182. 181. The method of claim 180, wherein said T cells are genetically engineered to express a TCR or CAR prior to inducing the T cell targeted positional mutation(s) of one or more of the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
183. 181. The method of claim 180, wherein said T cells are engineered to express a TCR or CAR after induction of T cell targeted positional mutations in one or more of said FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
184. 181. The method of claim 180, wherein said T cells are genetically engineered to express a TCR or CAR concomitantly with inducing T cell targeted positional mutations in one or more of said FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC or TRBC genes.
185. 185. The method of any one of claims 179 to 184, wherein the cells are returned to the subject's body.
186. 186. The method of any one of claims 179-185, wherein said treating comprises introducing cells into the body of said subject, said cell subject being contacted with (a), (b), and optionally (c) ex vivo.
187. 187. The method of any one of claims 161-186, wherein the contacting step comprises contacting the subject with a nucleic acid encoding at least one of (a), (b), and (c).
188. 188. The method of any one of claims 161 to 187, wherein the contacting step comprises contacting the subject with a nucleic acid of any of claims 36 to 123.
189. 189. The method of any one of Claims 161-188, wherein the contacting comprises delivering to the subject a Cas9 molecule of (b) and a nucleic acid encoding (a) and optionally (c).
190. 189. The method of any one of Claims 161-188, wherein the contacting step comprises delivering to the subject a Cas9 molecule of (b), a gRNA of (a), and optionally a second gRNA of (c).
191. 189. The method of any one of Claims 161-188, wherein the contacting comprises delivering to the subject a gRNA molecule of (a), optionally a second gRNA of (c), and a nucleic acid encoding Cas9 of (b).
192. A reaction mixture comprising a gRNA, nucleic acid, or composition described herein and cells derived from a subject with cancer or who would benefit from a mutation in one or more T-cell target loci in the FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, TRAC, or TRBC genes.
193. (a) a gRNA molecule according to any one of claims 1 to 35, or a nucleic acid encoding the gRNA, and one or more of the following: (b) a Cas9 molecule according to any one of claims 59 to 73; (c) a second gRNA molecule according to any one of claims 74 to 96; and (d) a nucleic acid encoding one or more of (b) and (c). A kit comprising:
194. 194. The kit of claim 193, comprising nucleic acid encoding one or more of (a), (b), and (c).
195. 195. The kit of Claim 194, further comprising a third gRNA molecule that targets a T cell target locus.
196. 196. The kit of claim 195, further comprising a fourth gRNA molecule that targets a T cell target locus.
197. 36. The gRNA of any one of claims 1 to 35, wherein the gRNA comprises a modification at or near its 5' end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 5' end).
198. 36. The gRNA of any one of claims 1 to 35, wherein the gRNA comprises a modification at or near its 3' end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 3' end).
199. 36. The gRNA of any one of claims 1 to 35, wherein the gRNA comprises a modification at or near its 5' end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 5' end) and / or a modification at or near its 3' end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 3' end).
200. 200. The gRNA of any one of Claims 197-199, wherein the modification causes the gRNA to exhibit increased stability against nucleases when introduced into a T cell.
201. 200. The gRNA of any one of Claims 197-199, wherein the modification causes the gRNA to exhibit a reduced innate immune response when introduced into a T cell.
202. 202. The gRNA of claim 201, wherein the innate immune response is accompanied by induction of cytokine expression.
Citation Information
Patent Citations
Method for human PD1 gene specific knockout through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat) and sgRNA(single guide RNA)for specially targeting PD1 gene
CN103820454A
RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX
WO2013142578A1
Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
WO2013176772A1
T cell modifying compounds and uses thereof
WO2014059173A2
Methods for engineering t cells for immunotherapy by using RNA-guided CAS nuclease system
WO2014191128A1