Composition for imparting salt stress tolerance

Abstract

To provide a composition for imparting salt stress tolerance to a plant, a method for producing a salt stress-tolerant plant body, and a method for imparting salt stress tolerance to a plant body.SOLUTION: This composition for imparting salt stress tolerance to a plant contains, as an active ingredient, N-acetylglutamic acid or a salt or solvate thereof.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a technique for imparting salt stress tolerance to plants. [Background technology]

[0002] Increasingly severe climate change acts as an environmental stress on plants, inhibiting normal growth and development, resulting in reduced yields and quality deterioration. Therefore, technologies that can reduce environmental stress are essential for ensuring stable harvests of crops and other plant materials even as climate change worsens. Salt stress, a type of environmental stress, inhibits plant growth in multiple ways, including water loss in the plant body, inhibiting the absorption of inorganic ions necessary for maintaining cellular homeostasis, and reducing photosynthetic activity through inhibition of the electron transport chain in chloroplasts. Furthermore, salt stress is caused not only by natural factors such as seawater but also by human-induced factors such as salt accumulation in the soil due to drought or improper irrigation. Therefore, salt stress is recognized as a severe stress for plants, which cannot move.

[0003] In plants exposed to high salt concentrations, sodium ions flow into the body, inducing various responses to alleviate salt stress (Non-Patent Document 1). When sodium ions flow into cells, signaling pathways mediated by calcium ions and reactive oxygen species are activated, inducing an initial response in which sodium ions are transported from the cell to the extracellular space or vacuoles. When the influx of sodium ions is subsequently transmitted to the cell nucleus, changes in gene expression trigger changes in the biosynthesis and transport of plant hormones, resulting in physiological responses to alleviate salt stress. For example, in soil containing large amounts of salt, differences in osmotic pressure cause water to leak out of the plant body. However, plants activate the biosynthesis of abscisic acid, a plant hormone, to promote stomatal closure and prevent further water loss.

[0004] One method for enhancing plant salt stress tolerance is to create transgenic plants incorporating salt stress response genes. For example, Arabidopsis thaliana overexpressing the transporter SOS1, which transports sodium ions from inside to outside the cell, exhibits tolerance to salt stress (Non-Patent Document 2). Furthermore, tobacco overexpressing SnRK2, a sodium ion sensor kinase, also acquires salt stress tolerance, suggesting that enhancing salt stress tolerance through the creation of transgenic plants is an effective method for various plant species (Non-Patent Document 3). However, this method has the drawback of being unsuitable for general use, given the effort required to create genetically modified plants for each plant species and the difficulty of genetic modification in most plants.

[0005] Although 5-aminolevulinic acid and methyl farnesolate have been reported as compounds that enhance salt stress tolerance (Patent Documents 1 and 2), they are relatively expensive, and no inexpensive low-molecular-weight compounds have been found. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Patent No. 2896963 [Patent Document 2] Patent No. 6917046 [Non-patent literature]

[0007] [Non-Patent Document 1] Zelm et al, Annu Rev Plant Biol, Volume 29, Issue 71, Pages 403-433, 2010 [Non-patent document 2] Shi et al, Proc Natl Acad Sci USA, Volume 97, Issue 12, Pages 6896-901, 2000 [Non-patent document 3] Feng et al, Front Plant Sci, Volume 9, 2019 Summary of the Invention [Problem to be solved by the invention]

[0008] An object of the present invention is to provide a composition for imparting salt stress tolerance to a plant, a method for producing a plant having salt stress tolerance, and a method for imparting salt stress tolerance to a plant. [Means for solving the problem]

[0009] The present inventors have conducted extensive research into methods for imparting salt stress tolerance to plants, and as a result have found that salt stress tolerance can be imparted to plants by applying N-acetylglutamic acid, or a salt or solvate thereof, to plants, thereby completing the present invention.

[0010] That is, the present invention is as follows. [1] A composition for imparting salt stress tolerance to a plant, comprising N-acetylglutamic acid, a salt thereof, or a solvate thereof as an active ingredient. [2] The composition according to [1], wherein the salt stress tolerance is exerted under conditions of exposure to salt stress. [3] A composition for promoting the excretion of sodium ions from plants, the increase in chlorophyll content, the formation or elongation of lateral roots, or the increase in the fresh weight of above-ground parts, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient. [4] The composition of [3], which maintains or promotes sodium ion excretion, an increase in chlorophyll content, lateral root formation or elongation, or an increase in the fresh weight of aboveground parts under conditions of exposure to salt stress. [5] A composition for promoting the expression of the SOS1 gene, the SOS2 gene, or the SOS3 gene, comprising N-acetylglutamic acid, or a salt thereof, or a solvate thereof as an active ingredient. [6] The composition according to any one of [1] to [5], wherein the plant is not a genetically modified plant containing neither an N-acetylglutamic acid gene nor a gene that induces expression of said gene. [7] The composition of any one of [1] to [6], wherein the plant is a dicotyledonous plant or a monocotyledonous plant. [8] A method for producing a plant having tolerance to salt stress, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant. [9] The method of [8], wherein the salt stress tolerance is exerted under conditions of exposure to salt stress.

[10] A method for producing a plant in which sodium ion excretion, increased chlorophyll content, lateral root formation or elongation, or increased fresh weight of aboveground parts is promoted, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

[11] The method of

[10] , in which sodium ion excretion, increased chlorophyll content, lateral root formation or elongation, or promoted increase in fresh weight of aboveground parts is maintained or enhanced under conditions of exposure to salt stress.

[12] A method for producing a plant in which expression of the SOS1 gene, SOS2 gene, or SOS3 gene is enhanced, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

[13] Any of the methods [8] to

[12] , wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant that induces the expression of an N-acetylglutamic acid gene or said gene.

[14] Any of the methods [8] to

[13] , wherein the plant is a dicotyledonous or monocotyledonous plant.

[15] A method for imparting salt stress tolerance to a plant, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

[16] The method of

[15] , wherein the salt stress tolerance is exerted under conditions of exposure to salt stress.

[17] A method for promoting sodium ion excretion, an increase in chlorophyll content, lateral root formation or elongation, or an increase in the fresh weight of above-ground parts, comprising applying N-acetylglutamic acid or a salt or solvate thereof to a plant.

[18] The method of

[17] , in which sodium ion excretion, increased chlorophyll content, lateral root formation or elongation, or promoted increase in fresh weight of aboveground parts is maintained or enhanced under conditions of exposure to salt stress.

[19] A method for promoting expression of the SOS1 gene, SOS2 gene, or SOS3 gene in a plant, comprising applying N-acetylglutamic acid or a salt or solvate thereof to the plant.

[20] Any of the methods

[15] to

[19] , wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant containing an N-acetylglutamic acid gene and a gene that induces expression of said gene.

[21] Any of the methods

[15] to

[20] , wherein the plant is a dicotyledonous or monocotyledonous plant. [Effects of the Invention]

[0011] Applying N-acetylglutamic acid or its salts or solvates to plants can confer salt stress tolerance to the plants. It can also promote extracellular sodium ion excretion, increased chlorophyll content, lateral root formation or elongation, and aboveground shoot growth. It can also promote the expression of SOS or its homolog genes in plants. [Brief explanation of the drawings]

[0012] [Figure 1-1] Figure 1 shows the response of NAG-treated Arabidopsis to salt stress, and is a diagram showing the appearance of Arabidopsis treated with NAG and exposed to salt stress. The growth inhibition of aboveground shoots caused by NaCl treatment was alleviated in the NAG-treated group (0.4 mM NAG) compared with the untreated group (0 mM NAG). [Figure 1-2]Figure 1 shows the response of NAG-treated Arabidopsis to salt stress. This figure shows the fresh weight of the aerial shoots of salt-stressed Arabidopsis plants. The fresh weight is relative to that of the NAG-untreated group (0 mM NAG). n = 11 (Test method: Student's t-test, **P < 0.01; error bars indicate standard error). [Figure 2] Figure 2 shows the results of an analysis of the expression levels of salt stress-responsive genes SOS1-3 in NAG-treated Arabidopsis. Figures 2A, 2B, and 2C show the expression levels of SOS1, SOS2, and SOS3, respectively. The relative expression levels were calculated compared to those in the NAG-untreated control. n = 3 (Test method: Student's t-test, **P < 0.01; error bars indicate standard error). [Figure 3-1] Figure 1 shows the effect of NAG treatment on salt stress in rice plants. This figure shows the appearance of rice plants treated with NAG and exposed to salt stress. The inhibition of shoot elongation caused by NaCl treatment was alleviated in the NAG-treated group (0.4 mM NAG) compared with the untreated group (0 mM NAG). Scale bar: 1 cm. [Figure 3-2] This figure shows the effect of NAG treatment on salt stress in rice plants. It shows the shoot length of salt-stressed rice plants. The length is shown relative to that of the NAG-untreated group (0 mM NAG). n = 8 (Test method: Student's t-test **P < 0.01, error bars indicate standard error). [Figure 4] Figure 4 shows the results of analysis of the expression levels of salt stress-responsive genes OsSOS1-3 in NAG-treated rice. Figures 4A, 4B, and 4C show the expression levels of OsSOS1, OsSOS2, and OsSOS3, respectively. Relative expression levels were calculated compared to those in the NAG-untreated control. n = 3 (Test method: Student's t-test. *P < 0.05; error bars indicate standard error). DETAILED DESCRIPTION OF THE INVENTION

[0013] The present invention will be described in detail below.

[0014] The present invention relates to a composition for imparting salt stress tolerance to plants. Salt stress in plants refers to stress caused by an environment with a high salt concentration. Salts that cause stress to plants are cations such as sodium. Imparting salt stress tolerance means imparting the ability to suppress the effects of salt stress when the stress is present or to suppress the effects of salt stress before it is present, and includes reducing or eliminating the effects of salt stress. The active ingredient in the composition of the present invention is N-acetylglutamic acid, or a salt or solvate thereof. The present invention also relates to a method for imparting salt stress tolerance to plants or a method for producing plants with salt stress tolerance by applying N-acetylglutamic acid, or a salt or solvate thereof to plants.

[0015] The composition of the present invention containing N-acetylglutamic acid can confer salt stress tolerance to plants, thereby reducing the effects of salt stress that plants normally experience and enhancing plant growth, and therefore can also be called a composition for enhancing plant growth. The salt stress that plants normally experience includes mild salt stress that does not cause leaf wilting, poor growth, withering, etc.

[0016] The effects of salt stress refer to unfavorable conditions for plants, such as leaf wilting, poor growth, and withering, which occur in plants due to salt stress.

[0017] In the present invention, salt stress tolerance is imparted to plants by applying N-acetylglutamic acid or a salt or solvate thereof, and therefore genetic modification such as knocking in or knocking out a specific gene involved in plant salt stress tolerance is not required. Genes involved in plant salt stress tolerance are not limited, but examples include N-acetylglutamic acid synthesis genes, genes that induce the expression of these genes, and SOS genes, and particularly N-acetylglutamic acid synthesis genes and genes that induce the expression of these genes.

[0018] 1. N-acetylglutamic acid N-Acetylglutamic acid has the structural formula shown in Formula I and the chemical formula is CH 11 It is expressed as NO5 and abbreviated as NAG. Its appearance is white to almost white crystals to crystalline powder.

[0019] [ka]

[0020] Both L-(N-acetyl-L-glutamic acid) and D-(N-acetyl-D-glutamic acid) forms can be used, but L-(N-acetyl-L-glutamic acid), which is synthesized in vivo, is preferred. In prokaryotes and simple eukaryotes, N-acetylglutamic acid is produced by, for example, N-acetylglutamic acid synthase or ornithine acetyltransferase. Therefore, secretions, isolates, extracts, or purified products of N-acetylglutamic acid-producing organisms can be used, or the organisms themselves can be used. Enzymatic production without the involvement of a living organism or fermentation using microorganisms with or without mutagenesis can also be used. N-acetylglutamic acid can also be chemically synthesized. Commercially available N-acetylglutamic acid can be used. Examples of commercially available N-acetylglutamic acid include those manufactured by Fujifilm Wako Pure Chemical Industries, Ltd., Sigma-Aldrich Corporation, and Tokyo Chemical Industry Co., Ltd.

[0021] Salts constituting N-acetylglutamic acid include both hydrated and anhydrous salts, and include salts with inorganic bases such as sodium, potassium, magnesium, calcium, and aluminum; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine and ornithine; and ammonium salts. The salt may be an acid addition salt, specifically including salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, methanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. Hereinafter, the term "N-acetylglutamic acid" includes its salts and solvates.

[0022] N-acetylglutamic acid is quantified using high-performance liquid chromatography and mass spectrometry (MS). Specifically, a sample containing N-acetylglutamic acid is separated into components by high-performance liquid chromatography, and the separated components are then subjected to mass spectrometry analysis (single MS or tandem MS) to measure the amount of N-acetylglutamic acid contained in the sample.

[0023] 2. Salt stress According to the Agricultural Technology Encyclopedia by the National Agriculture and Food Research Organization (http: / / lib.ruralnet.or.jp / nrpd / ), salt stress tolerance is the ability to withstand salt damage, which occurs due to water shortage caused by osmotic stress, and the inactivation of enzymes and inhibition of protein synthesis caused by the movement of ions. When plants face water shortage, they adjust osmotic pressure by accumulating compatible solutes in the cytoplasm, just as they do when drought occurs. In order to express tolerance to ion toxicity, Na + -H + This role is played by the SOS1 gene product, which functions as an antiporter.

[0024] Therefore, salt stress refers to exposure of a plant to higher salt concentrations than those normally required for growth for any period of time and any number of times. Plants exposed to salt stress experience physiological disorders, including poor growth and withering. Plants' tolerance to salt stress allows them to cope with salt stress and suppress declines in survival rate, growth, and yield, even under salt stress. Here, the most common salt found in saline soils is sodium chloride. Generally, when exposed to salt, most crops experience changes in cellular water potential and inorganic ion homeostasis due to the salt taken up by the body, resulting in salt stress disorder, growth inhibition, and eventual death (Chemistry and Biology, Vol. 42, No. 5, pp. 309-312, 2004). Based on this finding, salt stress in this invention can be primarily defined as stress caused by exposure to sodium concentrations higher than those required for plant growth. Furthermore, if alkalinity progresses in the growing environment, such as the soil in which plants grow, elements in the soil precipitate, inhibiting the absorption of essential elements by plants and impeding plant growth.

[0025] N-acetylglutamic acid confers the above-mentioned salt stress tolerance to plants, and as a result, plants can acquire tolerance to salt stress.

[0026] 3. Enhancement of salt stress-responsive gene expression N-acetylglutamic acid enhances the expression of salt-stress-responsive genes involved in salt stress tolerance in plants, thereby conferring salt stress tolerance to plants.

[0027] In Arabidopsis, the salt stress-responsive genes include SOS1, SOS2, and SOS3. Enhanced expression of any of these genes results in a response to salt stress.

[0028] In other plant species, the expression of homologs of the Arabidopsis SOS1, SOS2, and SOS3 genes is enhanced. For example, when obtaining the nucleotide sequence of a homolog in each plant species, a TBLASTN search can be performed using the amino acid sequences of the proteins encoded by the above Arabidopsis genes as a query, and the gene with the highest score can be selected as the homolog from among the genes listed as homolog candidates.

[0029] For example, in rice, the expression of OsSOS1, OsSOS2, and OsSOS3 genes, which are homologs of the Arabidopsis SOS1, SOS2, and SOS3 genes, is enhanced. The proteins encoded by the homologs of the Arabidopsis SOS1, SOS2, and SOS3 genes in various plant species are collectively referred to as SOS1, SOS2, and SOS3, respectively.

[0030] In plants to which N-acetylglutamic acid has been applied, the expression of these salt stress-responsive genes is increased by 1.05-fold or more, 1.1-fold or more, preferably 1.2-fold or more, more preferably 1.5-fold or more, even more preferably 1.7-fold or more, even more preferably 1.8-fold or more, even more preferably 1.9-fold or more, even more preferably 2.0-fold or more, even more preferably 2.1-fold or more, even more preferably 2.3-fold or more, even more preferably 2.5-fold or more, even more preferably 3.0-fold or more, even more preferably 4.0-fold or more, and even more preferably 5.0-fold or more, compared to plants to which N-acetylglutamic acid has not been applied. For example, in Arabidopsis thaliana, the expression of the SOS2 gene and the SOS3 gene is increased by about 1.1-fold and 1.4-fold, respectively.

[0031] Whether or not gene expression is enhanced in plants by N-acetylglutamic acid can be measured by extracting RNA from the plant body, synthesizing cDNA using reverse transcriptase, and analyzing the expression level by real-time PCR.

[0032] The present invention encompasses compositions for enhancing expression of salt stress-responsive genes, or compositions for enhancing expression, that contain N-acetylglutamic acid. Specifically, the present invention encompasses compositions for enhancing expression of the SOS1 gene, SOS2 gene, and SOS3 gene, each containing N-acetylglutamic acid. The compositions have the same composition as those for imparting salt stress tolerance to plants.

[0033] Treatment of plants with N-acetylglutamic acid can enhance the expression of SOS1, SOS2, and SOS3 genes, thereby conferring tolerance to salt stress.

[0034] Specifically, treatment of plants with N-acetylglutamic acid can confer salt stress tolerance through enhanced expression of the above genes. Furthermore, by enhancing the expression of these genes, N-acetylglutamic acid treatment can also promote sodium ion excretion, increase chlorophyll content, promote root and lateral root formation and elongation, and increase shoot fresh weight under salt stress conditions. Overexpression of the SOS1 transporter, which is responsible for the excretion of sodium ions from inside to outside the cells under salt stress conditions, in Arabidopsis promotes shoot growth under salt stress conditions, indicating that enhanced expression of this gene promotes shoot growth in response to salt stress (Shi et al., Proc Natl Acad Sci USA, Volume 97, Issue 12, Pages 6896-901, 2000). Furthermore, in Arabidopsis plants overexpressing SOS3, which receives and transmits sodium ions into cells, the amount of sodium ions in the plant body decreases under salt stress conditions, the amount of chlorophyll increases, and the formation of lateral roots is promoted. This indicates that enhancing the expression of this gene promotes the excretion of sodium ions from cells, increases the amount of chlorophyll, and leads to the formation and elongation of lateral roots in response to salt stress (Yang et al., Mol Plant, Volume 1, Pages 22-31, 2009). Note that lateral roots are roots that grow out to the side of the main root.

[0035] 4.Target plants In the present invention, target plants include both angiosperms and gymnosperms, but are preferably angiosperms. Furthermore, angiosperms include both dicotyledonous and monocotyledonous plants. Monocotyledonous plants include grasses such as rice, corn, barley, wheat, and sorghum; Araceae plants such as taro and konjac; Amaryllidaceae plants such as onion and leek; and Asparagaceae plants such as asparagus. Among these, grasses are preferred. Examples of dicotyledonous plants include Cannabaceae plants such as hemp, hops, Zelkova, and Enoki mushroom; Brassicaceae plants such as cabbage, Chinese cabbage, broccoli, radish, arugula, komatsuna, mizuna, mustard, and Arabidopsis; Solanaceae plants such as potato, tobacco, Nicotiana benthamiana, and tomato; Asteraceae plants such as lettuce and artichoke; Legumes such as alfalfa and soybean; Amaranthaceae plants such as spinach and sugar beet; Lamiaceae plants such as perilla and basil; Umbelliferae plants such as carrot and mitsuba; Cucurbitaceae plants such as melon, watermelon, cucumber, and pumpkin; and Malvaceae plants such as cotton. Among these, Cannabaceae and Cruciferae plants are preferred.

[0036] 5. Method and dosage of N-acetylglutamic acid To confer salt stress tolerance to plants using N-acetylglutamic acid, N-acetylglutamic acid can be applied to plants.

[0037] Here, application of N-acetylglutamic acid refers to bringing N-acetylglutamic acid into contact with a plant or allowing it to be taken up by the plant, for example, treating a plant with N-acetylglutamic acid, or administering or adding N-acetylglutamic acid to a plant.

[0038] N-acetylglutamic acid may be applied as is in powder or crystalline form, dissolved in an appropriate solvent such as water or a buffer solution, coexisting with an excipient, or incorporated into fertilizers, culture media, potting soil, pesticides, etc. N-acetylglutamic acid can be applied to plants, for example, in culture, hydroponics, soil, or potted plants. Specifically, N-acetylglutamic acid may be administered to culture media or soil, or directly to the plant, or may be sprayed or applied to either or both of the culture media / soil and the plant. Administration to plants may be by, for example, spraying, spraying, applying, irrigating, or drenching plant seeds, seedlings, leaves, stems, etc., preferably by root absorption. In the present invention, N-acetylglutamic acid dissolved in a solvent, incorporated into fertilizers, culture media, potting soil, pesticides, etc., or coexisting with an excipient or spreader, etc., is referred to as a composition containing N-acetylglutamic acid. The composition can be applied in the form of an emulsifiable concentrate, liquid, water-soluble concentrate, powder, dust, paste, granules, wettable powder, etc. When spraying or spraying on plants, a sprayer or applicator can be used, and when spraying on a large scale over a large farm, aerial spraying can be performed using a helicopter or drone.

[0039] The timing of application of N-acetylglutamic acid is not limited, and it may be before exposure to salt stress, simultaneously with exposure to salt stress, or after exposure to salt stress. Preferably, it is applied before exposure to salt stress or simultaneously with exposure to salt stress in order to previously impart salt stress tolerance to the plant. It is particularly preferred to apply it before exposure to salt stress.

[0040] For example, if weather forecasts or storm surge forecasts predict that plants will be exposed to salt stress, N-acetylglutamic acid can be applied to the plants in advance. Furthermore, if a sudden change in weather or other factors causes plants to be exposed to salt stress, N-acetylglutamic acid can be applied to the plants promptly. Of course, timely application of N-acetylglutamic acid can make plant cultivation possible even in areas where salt stress is predicted to make plant cultivation difficult.

[0041] In either case, N-acetylglutamic acid may be applied continuously or intermittently. Continuous application here refers to, for example, mixing N-acetylglutamic acid into a medium and cultivating or hydroponically cultivating for a certain period of time, or cultivating in soil using a tool that allows for a continuous supply of N-acetylglutamic acid. Intermittent application refers to, for example, application in culture or hydroponics in accordance with the expected timing and level of salt stress, while in soil cultivation, application can be timed to the soil moisture status and the expected timing and level of stress. When applied continuously, the application period is not limited, and application can be continued, for example, until the cause of salt stress disappears. When applied intermittently, the number and amount of application are not limited, and application can be repeated, for example, until the cause of salt stress disappears, including continuous application followed by reapplication.

[0042] The concentration of N-acetylglutamic acid in the composition containing N-acetylglutamic acid is not limited, and the composition can be applied so that the required amount of N-acetylglutamic acid described below can be applied to plants.

[0043] The amount of N-acetylglutamic acid to be applied can be adjusted appropriately depending on the type of plant, its growth stage, and the degree of salt stress.

[0044] Examples of application amounts are as follows: The compound can be applied at a concentration of, for example, 0.0001 to 100,000,000 μM per volume of medium or per volume of soil, preferably 0.001 to 10,000,000 μM, 0.01 to 1,000,000 μM, 0.1 to 1,000,000 μM, or 0.1 to 500,000 μM.

[0045] 6. How to confirm salt stress tolerance Whether or not salt stress tolerance has been conferred to a plant to which N-acetylglutamic acid has been applied can be confirmed by exposing the plant to which N-acetylglutamic acid has been applied to salt stress and then visually checking the degree of leaf wilting or by measuring the fresh weight of the above-ground parts of the plant excluding seeds and roots.

[0046] Application of N-acetylglutamic acid to plants confers salt stress tolerance under conditions of exposure to salt stress. In other words, the adverse effects of salt stress (withering, leaf wilting, and loss of fresh weight) are hardly observed under conditions of salt stress, and the plants do not wither even under salt stress. As a result, the effects of salt stress can be prevented while imparting salt stress tolerance by application of N-acetylglutamic acid. Normally, when plants are exposed to salt stress, many individuals wither and die, while only a few survive, and some of these individuals may grow thereafter. However, in the present invention, application of N-acetylglutamic acid results in fewer plants withering compared to when not treated with N-acetylglutamic acid, and preferably, the plants do not wither and continue to grow even under conditions of exposure to salt stress.

[0047] For example, a plant to which N-acetylglutamic acid has been applied can be placed under high-salt conditions, and the degree of leaf wilting can be confirmed visually or by measuring the fresh weight of the above-ground parts of the plant excluding the seeds and roots. Since plants can be placed under high-salt conditions by increasing the salt concentration in the supply water, if the degree of leaf wilting or the decrease in fresh weight of a plant treated with high salt and applied with N-acetylglutamic acid is less than that of an untreated plant or a plant not treated with N-acetylglutamic acid, it can be determined that salt stress tolerance has been conferred.

[0048] 7. Sodium ions are excreted from the cell, chlorophyll content increases, and lateral roots are formed and elongated. Plants to which N-acetylglutamic acid has been applied show increased excretion of sodium ions outside the cells, increased chlorophyll content, and promoted lateral root formation and elongation compared to plants to which N-acetylglutamic acid has not been applied. Whether or not these effects have been achieved can be confirmed, compared, and evaluated for plants to which N-acetylglutamic acid has been applied and plants to which it has not been applied using the following methods. Excretion of sodium ions outside the cell: The plant body is heat-treated in a muffle furnace, and the sample dissolved in hydrogen chloride solution is subjected to atomic absorption spectrometry to quantify the sodium ions in the plant body (quantification can be performed with reference to the description in Yang et al., Mol Plant, Volume 1, Pages 22-31). Increased chlorophyll content: The plant body is immersed in dimethylformamide and incubated overnight, and the amount of chlorophyll in the plant body is quantified by measuring the absorbance of the extract (see Yamaguchi et al., Nature Commun, Volume 12, Article number 3480, 2021 for reference). Lateral root formation and elongation: The roots of plants grown on solid medium are observed visually or under a stereomicroscope, and the number of lateral roots per root is counted. The length of the lateral roots is measured in the same manner.

[0049] 8. Plant growth enhancement Plants to which N-acetylglutamic acid has been applied show enhanced growth even under high-salinity conditions such as high tides. Whether or not the growth-enhancing effect has been imparted to plants to which N-acetylglutamic acid has been applied can be confirmed by measuring the fresh weight of the above-ground parts of the plants, excluding the seeds and roots, after application of N-acetylglutamic acid. It can also be confirmed by measuring the number of leaves, plant height, leaf color, etc. [Example]

[0050] The present invention will be specifically explained by the following examples, but the present invention is not limited to these examples.

[0051] Example 1: Enhancement of salt stress tolerance in Arabidopsis thaliana by N-acetylglutamic acid treatment 1. Purpose We will examine whether N-acetylglutamic acid (NAG), a non-protein amino acid, confers salt stress tolerance to plants. We will use Arabidopsis thaliana, a dicotyledonous plant model that is easy to analyze not only phenotypes but also gene expression.

[0052] 2. Experimental Method (1) Experimental materials Arabidopsis thaliana (accession: Col-0) seeds were purchased from Inplanta Innovations, Inc. (https: / / www.inplanta.jp / ).

[0053] (2) Growth method and salt stress treatment The growth medium used was a solid medium containing 1 / 2 (w / v) Murashige-Skoog medium salt mixture (Nacalai), 1% (w / v) sucrose (FUJIFILM Wako), and 1% (w / v) gellan gum (FUJIFILM Wako). Arabidopsis seeds were sterilized by immersing them in a 2:1 dilution of Haiter (registered trademark, Kao) with purified water and incubating for 3 minutes. After washing three times with sterile water, the seeds were sown onto the medium using a pipette. The plates were then incubated overnight at 4°C in the dark to ensure uniform germination. The plates were then transferred to a plant culture incubator (TOMY) and incubated for 7 days at 22°C under a 16-hour light / 8-hour dark photoperiod.

[0054] After 7 days, N-acetylglutamic acid (NAG, Tokyo Chemical Industry Co., Ltd.) stock solution (NAG stock solution) was added to prepare solid medium containing NAG at final concentrations of 0 and 0.4 mM. Plants were transplanted into the medium using tweezers and incubated for 24 hours. For the NAG-untreated group (0 mM NAG), medium containing the same amount of sterilized water as the added NAG stock solution was used.

[0055] After 24 hours, the plants were transplanted onto solid medium containing sodium chloride (NaCl, FUJIFILM Wako) at final concentrations of 0, 75, or 100 mM and incubated for 6 days, after which the above-ground parts were excised from the plants and their fresh weights were measured.

[0056] 3. Results In Arabidopsis plants treated with NAG, inhibition of shoot growth when treated with 75 mM NaCl was alleviated compared to samples in the NAG-untreated group (Figure 1-1). Quantitative analysis of shoot fresh weight revealed a significant increase in fresh weight in the NAG-treated group compared to the untreated group (Figure 1-2).

[0057] 4. Conclusion In Arabidopsis, NAG suppressed the loss of shoot fresh weight due to salt stress, suggesting that NAG may confer salt stress tolerance to dicotyledonous plants.

[0058] Example 2: Enhancement of salt stress response genes by N-acetylglutamate in Arabidopsis thaliana 1. Purpose The initial step in the plant salt stress response is the extracellular excretion of sodium ions, primarily through the SOS gene family. Sodium ions entering the cell are received by a signaling pathway consisting of SOS2, SOS3, and calcium ions. Activated SOS2 then activates the transporter SOS1. This promotes the excretion of sodium ions, thereby mitigating damage caused by salt stress in the plant. Plants overexpressing SOS family genes exhibit tolerance to high salt treatment, indicating that the intake and excretion of sodium ions by the SOS family during the initial salt stress response is important for alleviating salt stress (Shi et al., Proc Natl Acad Sci USA, Volume 97, Issue 12, Pages 6896-901, 2000). To examine whether NAG enhances salt stress tolerance through the regulation of SOS family gene expression, we examined the expression levels of SOS family genes in NAG-treated Arabidopsis plants.

[0059] 2. Experimental Method (1) Experimental materials This is the same as in the first embodiment.

[0060] (2) Growth method The growth medium used was a liquid medium containing 1 / 2 Murashige-Skoog medium mixed salts (Nacalai) and 1% sucrose (FUJIFILM Wako). Arabidopsis seeds were sterilized for 3 minutes with Kitchen Haiter solution (registered trademark, Kao) diluted to half strength with distilled water, washed three times with sterile distilled water, and then incubated overnight at 4°C. 1 mL of the growth medium was dispensed into a 24-well microplate (IWAKI), and three seeds were seeded per well. The plate was then transferred to an incubator (TOMY) to initiate growth. The incubator conditions were the same as in Example 1.

[0061] (3) N-acetylglutamic acid treatment and RNA extraction Seven days after sowing, Arabidopsis thaliana plants were cultured with NAG at a final concentration of 0.4 mM and incubated for 2 hours. The samples were then frozen in liquid nitrogen and RNA was extracted using the RNeasy Plant Mini Kit (Thermo Fischer Scientific).

[0062] (4) Analysis of salt stress response gene expression levels by real-time PCR The resulting RNA was used to synthesize cDNA, which served as a template for real-time PCR. cDNA was synthesized using 1,000 ng of total RNA from each sample using PrimeScript™ RT Master Mix (Perfect Real Time) (TaKaRa). The synthesized cDNA was diluted 5-fold with sterile distilled water and subjected to real-time PCR. The target genes for real-time PCR were SOS1 (AGI code: AT2G01980), SOS2 (AGI code: AT5G35410), and SOS3 (AGI code: AT5G24270), and the reference gene was PP2AA3 (AGI code: AT1G13320). PCR reaction mixture was prepared using TB Green Ex Taq II (TaKaRa). PCR reactions were performed using a Thermal Cycler Dice™ Real Time System IV (TaKaRa), with 50 amplification cycles. The primers used were as follows: SOS1 Fw: GCAGGAAAGTGCATTGGTTC (SEQ ID NO: 1) Rv: CAAGGGCTCGTAATTCTTGC (SEQ ID NO: 2) / SOS2 Fw: TGCTTTGGCCATTGGTTTGG (SEQ ID NO: 3) Rv: ACATGTCTTCGCAGGACAAG (SEQ ID NO: 4) / SOS3 Fw: CGCTTCTTCACGAATCCGAAC (SEQ ID NO: 5) Rv: TGCACGAAAGCCTTATCCAC (SEQ ID NO: 6) / PP2AA3 Fw: GACCAAGTGAACCAGGTTATTGG (SEQ ID NO: 7) Rv: TACTCTCCAGTGCCTGTCTTCA (SEQ ID NO: 8). The relative expression levels of the target genes upon NAG treatment were then calculated by the ΔΔCt method using the Ct values ​​obtained from real-time PCR.

[0063] 3. Results Figure 2 shows the results of an analysis of the expression levels of salt stress-responsive genes in NAG-treated Arabidopsis plants. Figures 2A, 2B, and 2C show the expression levels of SOS1, SOS2, and SOS3, respectively. Compared to the untreated control, the expression levels of SOS2 and SOS3 in the NAG-treated control were increased by approximately 1.1-fold and 1.4-fold, respectively.

[0064] 4. Conclusion In plant salt stress responses, overexpression of SOS1, SOS2, or SOS3 has been shown to suppress the loss of shoot fresh weight due to high salt concentrations, demonstrating tolerance to salt stress (Zhu et al., Front Plant Sci, Volume 12, 2021 / Yang et al., Mol Plant, Volume 1, Pages 22-31, 2009). Furthermore, it has been reported that Arabidopsis plants overexpressing SOS3 exhibit reduced chlorophyll content, inhibited lateral root formation, and reduced sodium ion accumulation in the plant body due to salt stress compared to wild-type plants, and these alleviating effects do not require overexpression of SOS1 or SOS2 (Yang et al., Mol Plant, Volume 1, Pages 22-31, 2009). These results suggest that NAG enhances salt stress tolerance in Arabidopsis through increased expression of SOS3.

[0065] Example 3: Enhancement of salt stress tolerance in rice by N-acetylglutamic acid treatment 1. Purpose We investigated whether the salt stress tolerance-enhancing effect of NAG in Arabidopsis, a dicotyledonous plant, could also be confirmed in monocotyledonous plants, using rice as a model.

[0066] 2. Experimental Method (1) Experimental materials Rice (variety: Nipponbare) was used as the experimental material. Seeds were purchased from Nouken Co., Ltd. (https: / / www.k-nouken.com / ).

[0067] (2) Growth method and salt stress treatment The growth medium used was a solid medium containing 1 / 2 (w / v) Murashige-Skoog medium salt mixture (Nacalai), 1% (w / v) sucrose (FUJIFILM Wako), and 0.8% (w / v) agar (Ina Food Industry). The rice seeds were husked using a thresher, soaked in Kitchen Haiter solution (registered trademark, Kao Corporation) for 30 minutes, and then washed five times with sterile water. The tubes were placed horizontally, and sterile distilled water was poured over the washed seeds to cover them. The seeds were then cultured in an incubator for three days for germination. The incubator was set at 30°C with a 16-hour light / 8-hour dark photoperiod. After three days, the germinated seeds were sown on solid medium containing 0.5 mM NAG and incubated for 24 hours in the incubator. The plants were then transferred to solid medium containing 200 mM NaCl and incubated for six days. The aboveground length was then measured.

[0068] 3. Results Compared to the untreated area, the inhibition of above-ground shoot elongation caused by salt stress was alleviated in the NAG-treated area (Figure 3-1). Measurement of above-ground shoot length revealed that the NAG-treated area had a significantly increased above-ground shoot length compared to the untreated area (Figure 3-2).

[0069] 4. Conclusion In rice, NAG alleviated the inhibition of shoot elongation caused by salt stress, suggesting that NAG may confer salt stress tolerance to monocotyledonous plants.

[0070] Example 4: Enhancement of salt stress responsive genes by N-acetylglutamic acid in rice 1. Purpose We investigated whether the effect of NAG on enhancing the expression of the salt stress-responsive gene SOS family, as seen in Arabidopsis, could be confirmed in rice.

[0071] 2. Experimental Method (1) Search for homologs of Arabidopsis salt stress response genes in rice To design primers for target genes required for gene expression analysis by real-time PCR, we searched for rice homologs of Arabidopsis salt stress-responsive genes. The amino acid sequences of Arabidopsis SOS1 (AGI code: AT2G01980), SOS2 (AGI code: AT5G35410), and SOS3 (AGI code: AT5G24270) were obtained from TAIR (https: / / www.arabidopsis.org / ), and the nucleotide sequences of the homologs were obtained using RAP-DB (https: / / rapdb.dna.affrc.go.jp / ). The nucleotide sequence of the Arabidopsis ACT2 (AGI code: AT3G18780) homolog was also obtained as a reference gene. The rice homologs were named OsSOS1, OsSOS2, OsSOS3, and OsACT1.

[0072] (2) Experimental materials This is the same as in Example 3.

[0073] (3) Growth method The growth medium used was a liquid medium consisting of 1 / 2 (w / v) Murashige-Skoog medium salt mixture. Rice seeds were sterilized by immersing them in a 50 mL Falcon tube in a solution of bleach diluted to half its original concentration with distilled water for 30 minutes, then washed five times with sterile distilled water. The tube was placed horizontally, and sterile distilled water was poured over the washed seeds to cover them. The seeds were then cultured in an incubator for three days for germination. The incubator conditions were the same as in Example 3.

[0074] (4) N-acetylglutamic acid treatment and RNA extraction Rice samples germinated for 3 days were placed in a liquid medium consisting of a 1 / 2 Murashige-Skoog salt mixture. Specifically, 3 mL of the liquid medium was dispensed into a 12-well microplate (IWAKI), and three samples were transferred at a time. NAG was added to each well to a final concentration of 0.5 mM. After incubation for 2 hours, RNA was extracted from the aerial shoots using the RNeasy Plant Mini Kit.

[0075] (5) Analysis of salt stress response gene expression levels by real-time PCR The resulting RNA was used to synthesize cDNA, which served as a template for real-time PCR. cDNA was synthesized using 1,000 ng of total RNA from each sample using PrimeScript™ RT Master Mix (Perfect Real Time). The synthesized cDNA was diluted 5-fold with sterile distilled water and subjected to real-time PCR. The target genes for real-time PCR were OsSOS1, OsSOS2, and OsSOS3, and the reference gene was OsACT1. The PCR reaction mixture was prepared using TB Green Ex Taq II. The Thermal Cycler Dice™ Real Time System IV was used for PCR, with 50 amplification cycles. The primers used were as follows: OsSOS1 Fw: TAGCAGCAACAAAGCTTCGC (SEQ ID NO: 9) Rv: TCACCAAAAGCCTCCAATGC (SEQ ID NO: 10) / OsSOS2 Fw: AATGAGCCCGTTTGCTGTTG (SEQ ID NO: 11) Rv: TCACCAGCAACCTTTCGAAC (SEQ ID NO: 12) / OsSOS3 Fw: TCAGAGAAGACTGCGTTTGC (SEQ ID NO: 13) / Rv: ACAGCGCATTCGGAAAGATG (SEQ ID NO: 14) / OsACT1 Fw: AGCACATTCCAGCAGATGTG (SEQ ID NO: 15) Rv: TTCCTGTGCACAATGGATGG (SEQ ID NO: 16). The relative expression levels of the target genes upon NAG treatment were then calculated using the ΔΔCt method.

[0076] 3. Results Figure 4 shows the results of an analysis of the expression levels of salt stress-responsive genes in NAG-treated rice. Figures 4A, 4B, and 4C show the expression levels of OsSOS1, OsSOS2, and OsSOS3, respectively. Compared to the untreated control, the expression levels of OsSOS1, OsSOS2, and OsSOS3 in the NAG-treated control were increased by approximately 1.3-, 1.4-, and 1.1-fold, respectively.

[0077] 4. Conclusion In rice, NAG was suggested to enhance salt stress tolerance through upregulation of salt stress-responsive genes OsSOS1-3. [Industrial Applicability]

[0078] By applying N-acetylglutamic acid or a salt or solvate thereof to a plant, salt stress tolerance can be imparted to the plant, and as a result, the yield of the plant can be increased even in a harsh environment where salt stress occurs.

[0079] SEQ ID NOs: 1 to 16 Primers

Claims

1. A composition for imparting salt stress tolerance to a plant, comprising N-acetylglutamic acid, a salt thereof, or a solvate thereof as an active ingredient.

2. The composition according to claim 1 , wherein the salt stress tolerance is exerted under conditions of exposure to salt stress.

3. A composition for promoting sodium ion excretion, an increase in chlorophyll content, or the formation or elongation of lateral roots, or an increase in the fresh weight of above-ground parts of a plant, comprising N-acetylglutamic acid or a salt or solvate thereof as an active ingredient.

4. The composition according to claim 3, wherein sodium ion excretion, increased chlorophyll content, or lateral root formation or elongation, or increased fresh weight of the aboveground part is maintained or promoted under conditions of exposure to salt stress.

5. A composition for promoting the expression of the SOS1 gene, the SOS2 gene, or the SOS3 gene, comprising N-acetylglutamic acid, or a salt thereof, or a solvate thereof as an active ingredient.

6. The composition according to any one of claims 1 to 5, wherein the plant is not a genetically modified plant containing neither an N-acetylglutamic acid gene nor a gene that induces the expression of said gene.

7. The composition according to any one of claims 1 to 5, wherein the plant is a dicotyledonous plant or a monocotyledonous plant.

8. A method for producing a plant that has tolerance to salt stress, comprising applying N-acetylglutamic acid, or a salt or solvate thereof, to the plant.

9. The method according to claim 8, wherein the salt stress tolerance is exerted under conditions of exposure to salt stress.

10. The method according to claim 8 or 9, wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant that induces an N-acetylglutamic acid gene and expression of said gene.

11. 10. The method of claim 8 or 9, wherein the plant is a dicotyledonous or monocotyledonous plant.

12. A method for imparting salt stress tolerance to a plant, comprising applying N-acetylglutamic acid, or a salt or solvate thereof, to the plant.

13. The method according to claim 12, wherein the salt stress tolerance is exerted under conditions of exposure to salt stress.

14. The method according to claim 12 or 13, wherein the plant to which N-acetylglutamic acid or a salt or solvate thereof is applied is not a genetically modified plant containing an N-acetylglutamic acid gene and a gene that induces expression of said gene.

15. 14. The method of claim 12 or 13, wherein the plant is a dicotyledonous or monocotyledonous plant.

Images