Improved processes of preparing mrna-loaded lipid nanoparticles

By altering the N/P ratio during mRNA loading in preformed lipid nanoparticles, the method addresses inefficiencies in existing encapsulation methods, achieving improved delivery and expression of mRNA-encoded proteins, particularly in hepatocytes, with enhanced therapeutic index and cost-effectiveness.

JP2025134091APending Publication Date: 2025-09-16TRANSLATE BIO INC
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2025083749
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-02-25
Filing Date
2025-05-20
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

Existing methods for encapsulating mRNA in lipid nanoparticles are costly, time-consuming, and unpredictable, leading to inefficient delivery and expression of mRNA-encoded proteins.

Method used

A method involving altering the N/P ratio during the loading of preformed lipid nanoparticles with mRNA, using a controlled mixing process to achieve efficient encapsulation and uniform particle size, resulting in improved in vivo delivery and expression of mRNA-encoded proteins.

Benefits of technology

The method enhances therapeutic index by lowering costs, improving patient compliance, and ensuring efficient encapsulation and uniform particle size, with increased expression of mRNA-encoded proteins, particularly in hepatocytes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025134091000001_ABST
    Figure 2025134091000001_ABST
Patent Text Reader

Abstract

To provide improved processes for lipid nanoparticle formulation and mRNA encapsulation.SOLUTION: The present invention provides improved processes for lipid nanoparticle formulation and mRNA encapsulation. In some embodiments, the present invention provides processes of encapsulating messenger RNA (mRNA) in lipid nanoparticles, the processes comprising a step of mixing a suspension of preformed lipid nanoparticles and mRNA.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Background technology]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 981,425, filed February 25, 2020, which is hereby incorporated by reference in its entirety for all purposes.

[0002] Sequence Listing This specification references a Sequence Listing (submitted electronically on February 25, 2021 as a text (.txt) file entitled "MRT-2126WO_SL_ST25"). The text file was created on February 24, 2021, and is 18 KB in size. The entire contents of the Sequence Listing are incorporated herein by reference.

[0003] Messenger RNA therapy (MRT) has become an increasingly important approach to the treatment of various diseases. MRT involves administering messenger RNA (mRNA) to patients in need of therapy to produce the protein encoded by the mRNA in their bodies. Lipid nanoparticles are commonly used to encapsulate mRNA for efficient in vivo delivery of mRNA.

[0004] To improve lipid nanoparticle delivery, many efforts have focused on identifying novel lipids or specific lipid compositions that can affect the intracellular delivery and / or expression of mRNA in various types of mammalian tissues, organs, and / or cells (e.g., mammalian hepatocytes). However, these approaches are costly, time-consuming, and unpredictable. Summary of the Invention

[0005] The present invention provides, inter alia, an improved method for preparing mRNA-loaded lipid nanoparticles. In particular, the present invention is based on the surprising discovery that, by altering the N / P ratio during loading of preformed lipid nanoparticles with mRNA, as shown in Figure 1, formulated lipid nanoparticles can be obtained that exhibit unexpected efficiency in in vivo delivery of mRNA and surprisingly strong expression of mRNA-encoded proteins, polypeptides, and / or peptides.

[0006] Therefore, compared with conventional methods, the method of the present invention can positively shift the therapeutic index of the resulting lipid nanoparticles. Related advantages may include lower costs, better patient compliance, and more patient-friendly dosing regimens. The method of the present invention also results in efficient encapsulation and uniform particle size. Without wishing to be bound by theory, the method of the present invention is particularly useful for preparing lipid nanoparticle compositions for systemic delivery, and excellent in vivo delivery efficiency to target cells and expression of mRNA-encoded proteins have been observed. In some embodiments, systemic delivery includes delivery to the liver, particularly hepatocytes.

[0007] The methods of the present invention can be performed using a pump system and are therefore scalable, allowing for improved particle formation / formulation in quantities sufficient to conduct, for example, clinical trials and / or commercial sales.

[0008] In a first aspect, the present invention provides a method for encapsulating messenger RNA (mRNA) into preformed empty lipid nanoparticles (LNPs). wherein the lipid components of the LNPs comprise or consist of cationic lipids, non-cationic lipids, PEG-modified lipids, and optionally cholesterol, the method comprising: (a) adding a first volume of a solution containing mRNA to a suspension containing preformed empty LNPs to form a mixture containing LNPs encapsulating mRNA; and (b) adding one or more additional volumes of the solution containing mRNA to the mixture obtained in the previous step until a desired molar ratio of cationic lipid to mRNA is reached.

[0009] In some embodiments, the addition of the first volume of solution containing mRNA results in at least a 10-fold molar excess of cationic lipids relative to the mRNA. In some embodiments, the addition of the first volume of solution containing mRNA results in at least a 15-fold molar excess of cationic lipids relative to the mRNA. In some embodiments, the addition of the first volume of solution containing mRNA results in a molar ratio of about 10-20 (cationic lipid):1 (mRNA). In some embodiments, the addition of the first volume of solution containing mRNA results in a molar ratio of about 16 (cationic lipid):1 (mRNA).

[0010] In some embodiments, the first volume of solution containing the mRNA and the one or more additional volumes are equal volumes.

[0011] In some embodiments, the one or more additional volumes are four volumes or less, or eight volumes or less, hi some embodiments, the one or more additional volumes are one, two, three, four, five, six, seven, or eight additional volumes.

[0012] In some embodiments, a mixing period occurs before adding each of the one or more additional volumes of solution containing the mRNA. In some embodiments, the length of each period is equal. In some embodiments, each period does not exceed 5 minutes. In some embodiments, each period is about 3-5 minutes. In some embodiments, each period is about 4 minutes.

[0013] In some embodiments, the addition of the final one or more additional volumes is followed by an additional mixing period. In some embodiments, the additional period is equal in length to each of the preceding periods. In other embodiments, the additional period is longer than each of the preceding periods. In some embodiments, the additional period is at least 1.5 to 2 times longer than each of the preceding periods.

[0014] In some embodiments, the first volume of solution containing mRNA and one or more additional volumes are added sequentially. In some embodiments, the sequential addition of solution containing mRNA occurs over a period of no more than 20 minutes. In some embodiments, the sequential addition of solution containing mRNA occurs at a constant flow rate. In some embodiments, the sequential addition of solution containing mRNA occurs at a flow rate that increases or decreases over time. In some embodiments, the period of sequential addition of solution containing mRNA is followed by a mixing period. In some embodiments, the period of sequential addition and the period of mixing after the sequential addition do not exceed 20 minutes.

[0015] In a second aspect, the present invention provides a method for encapsulating messenger RNA (mRNA) in preformed empty lipid nanoparticles (LNPs), wherein the lipid component of the LNPs comprises or consists of cationic lipids, non-cationic lipids, PEG-modified lipids, and optionally cholesterol, the method comprising: (a) adding a first volume of a suspension containing preformed empty LNPs to a solution containing mRNA to form a mixture containing LNPs that encapsulate mRNA; and (b) adding a first volume of the preformed empty LNPs to a solution containing mRNA until a desired molar ratio of cationic lipid to mRNA is reached. adding one or more additional volumes of a suspension containing preformed empty LNPs to the mixture obtained in step 1.

[0016] In some embodiments, the addition of a first volume of a suspension containing preformed empty LNPs results in an approximately equal molar ratio of cationic lipid to mRNA. In some embodiments, the addition of one or more additional volumes of a suspension containing preformed empty LNPs results in a molar excess of cationic lipid to mRNA. In some embodiments, the addition of one or more additional volumes of a suspension containing preformed empty LNPs results in an approximately 2- to 4-fold molar excess of cationic lipid to mRNA.

[0017] In some embodiments, the first volume of suspension containing preformed empty LNPs and the one or more additional volumes are equal volumes.

[0018] In some embodiments, the one or more additional volumes are four volumes or less, or eight volumes or less, hi some embodiments, the one or more additional volumes are one, two, three, four, five, six, seven, or eight additional volumes.

[0019] In some embodiments, a mixing period occurs before adding each of the one or more additional volumes of suspension containing preformed empty LNPs. In some embodiments, the length of each period is equal. In some embodiments, the period does not exceed 5 minutes. In some embodiments, the period is about 3-5 minutes. In some embodiments, the period is about 4 minutes.

[0020] In some embodiments, the addition of the final one or more additional volumes is followed by an additional mixing period. In some embodiments, the additional mixing period is equal in length to each of the preceding periods. In other embodiments, the additional period is longer than each of the preceding periods. In some embodiments, the additional period is at least 1.5 to 2 times longer than each of the preceding periods.

[0021] In some embodiments, the first volume of the suspension containing preformed empty LNPs and one or more additional volumes are added sequentially. In some embodiments, the sequential addition of the suspension containing preformed empty LNPs occurs over a period of no more than 20 minutes. In some embodiments, the sequential addition of the suspension containing preformed empty LNPs occurs at a constant flow rate. In some embodiments, the sequential addition of the suspension containing preformed empty LNPs occurs at a flow rate that increases or decreases over time. In some embodiments, the period of sequential addition of the suspension containing preformed empty LNPs is followed by a mixing period. In some embodiments, the period of sequential addition and the period of mixing after the sequential addition do not exceed 20 minutes.

[0022] In these aspects of the invention, the suspension containing the preformed empty LNPs may be at about 60°C to about 70°C, and the solution containing the mRNA may be at ambient temperature. In some embodiments, the suspension containing the preformed empty LNPs is at about 65°C. In some embodiments, the mixing comprises heating the combined LNP and mRNA mixture to about 60°C to about 70°C. In some embodiments, the mixing comprises heating the combined LNP and mRNA mixture to about 65°C.

[0023] In these aspects of the invention, a desirable molar ratio may be about 3-5 (cationic lipid): 1 (mRNA). In some embodiments, a desirable molar ratio is about 4 (cationic lipid): 1 (mRNA).

[0024] In these aspects of the invention, empty LNPs may be formed by mixing a lipid solution with an aqueous solution, where the lipid solution comprises a cationic lipid, a non-cationic lipid, and a PEG-modified lipid in ethanol. In some embodiments, the aqueous solution comprises citrate. In some embodiments, the ethanol and / or citrate are removed by tangential flow filtration to form a solution containing empty LNPs.

[0025] In any of these embodiments of the present invention, greater than about 90% of the preformed empty LNPs have a size in the range of 75 to 150 nm. Typically, the methods described in the first and second embodiments of the present invention result in LNPs that encapsulate mRNA, and greater than about 90% of the LNPs have a size that is at least about 5% (e.g., at least about 10%) larger than the preformed empty LNPs. The mRNA encapsulation rate is typically greater than about 80%, e.g., greater than about 90%.

[0026] In any of these aspects of the invention, the preformed empty LNP and mRNA may be mixed using a pumping system, hi some embodiments, the pumping system comprises a pulseless flow pump, such as a gear pump or a centrifugal pump.

[0027] The methods described in the first and second aspects of the present invention can be used to prepare compositions of lipid nanoparticles (LNPs) that encapsulate mRNA, where the average size of the LNPs is 5% to 10% larger than LNPs prepared by mixing preformed empty LNPs with mRNA without changing the molar ratio of cationic lipid to mRNA during encapsulation. In some embodiments, the nanoparticles have a size of about 75 nm to 150 nm. In some embodiments, the nanoparticles have a PDI of less than about 0.25 to less than 0.16.

[0028] Compositions comprising LNPs encapsulating mRNA prepared by the methods of the first and second aspects of the invention find use in methods of treating a subject suffering from a deficiency of a peptide, polypeptide, or protein, the method comprising administering the composition to the subject, wherein the mRNA encodes the peptide, polypeptide, or protein. In some embodiments, the peptide, polypeptide, or protein is selected from spinal motor neuron 1 (SMN), alpha-galactosidase (GLA), argininosuccinate synthetase (ASS1), ornithine transcarbamylase (OTC), factor IX (FIX), phenylalanine hydroxylase (PAH), erythropoietin (EPO), or cystic fibrosis transmembrane conductance receptor (CFTR).

[0029] The compositions comprising LNPs encapsulating mRNA prepared by the methods of the first and second aspects of the present invention find use in methods for delivering mRNA to produce a protein in vivo, which methods include administering the composition to a subject. The mRNA typically encodes a protein of interest.

[0030] In a third aspect, the present invention provides a method for making a lipid nanoparticle (LNP) composition, the method comprising: (a) mixing a first set of preformed empty lipid nanoparticles (LNPs) containing a first cationic lipid, a first non-cationic lipid, a first PEG-modified lipid, and optionally cholesterol with mRNA under conditions that allow for encapsulation of the mRNA; and (b) combining the mRNA-encapsulated LNPs formed in step (a) with a second set of preformed empty LNPs containing a second cationic lipid, a second non-cationic lipid, a second PEG-modified lipid, and optionally cholesterol to obtain an LNP composition. Typically, the mRNA encodes a peptide, polypeptide, or protein.

[0031] In some embodiments, the first set of preformed empty LNPs and the second set of preformed empty LNPs have the same lipid composition. In some embodiments, the first set of preformed empty LNPs and the second set of preformed empty LNPs have different lipid compositions. In some embodiments, the first cationic lipid and the second cationic lipid are different. In some embodiments, the first non-cationic lipid and the second non-cationic lipid are different. In some embodiments, the first cationic lipid and the second cationic lipid are the same, and the first non-cationic lipid and the second non-cationic lipid are different. In some embodiments, the first non-cationic lipid is DOPE and the second non-cationic lipid is DEPE, or the first non-cationic lipid is DEPE and the second non-cationic lipid is DOPE.

[0032] In some embodiments, the method further comprises (i) initially mixing a first cationic lipid, a first non-cationic lipid, a first PEG-modified lipid, and optionally cholesterol to form a first set of preformed empty LNPs prior to step (a), and / or (ii) initially mixing a second cationic lipid, a second non-cationic lipid, a second PEG-modified lipid, and optionally cholesterol to form a second set of preformed empty LNPs prior to step (b).

[0033] In some embodiments, the mRNA-encapsulating LNPs and the second set of preformed empty LNPs are combined in a ratio ranging from 20:1 to 1:20, 10:1 to 1:10, 5:1 to 1:5, 3:1 to 1:3, or 2:1 to 1:2. In some embodiments, the mRNA-encapsulating LNPs and the second set of preformed empty LNPs are combined in a ratio of 20:1, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, or 1:20 or greater.

[0034] In some embodiments, the first and second sets of mRNA-encapsulating LNPs and preformed empty LNPs each have an average size ranging from about 75 to 150 nm in diameter, hi some embodiments, the first and second sets of mRNA-encapsulating LNPs and preformed empty LNPs each have an average size of less than 100 nm in diameter.

[0035] In some embodiments, the composition has a total lipid:total mRNA ratio in the range of 20:1 to 1:1, 10:1 to 1:1, 5:1 to 1:1, 5:1 to 2:1, or 4:1 to 2:1, or greater than 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 15:1, or 20:1.

[0036] In a fourth aspect, the present invention relates to a composition comprising a first set of mRNA-encapsulating lipid nanoparticles (LNPs) containing a first cationic lipid, a first non-cationic lipid, a first PEG-modified lipid, and optionally cholesterol, and a second set of empty LNPs containing a second cationic lipid, a second non-cationic lipid, a second PEG-modified lipid, and optionally cholesterol, wherein the first set of LNPs and the second set of LNPs are present in a ratio ranging from 20:1 to 1:20, 10:1 to 1:10, 5:1 to 1:5, 3:1 to 1:3, or 2:1 to 1:2. Typically, the mRNA encodes a peptide, polypeptide, or protein.

[0037] In some embodiments, the first set of LNPs and the second set of LNPs have the same lipid composition. In some embodiments, the first set of LNPs and the second set of LNPs have different lipid compositions. In some embodiments, the first cationic LNPs The lipid and the second cationic lipid are different between the first set of LNPs and the second set of LNPs. In some embodiments, the first non-cationic lipid and the second non-cationic lipid are different between the first set of LNPs and the second set of LNPs. In some embodiments, the first cationic lipid and the second cationic lipid are the same, and the first non-cationic lipid and the second non-cationic lipid are different, between the first set of LNPs and the second set of LNPs. In some embodiments, the first non-cationic lipid is DOPE and the second non-cationic lipid is DEPE, or the first non-cationic lipid is DEPE and the second non-cationic lipid is DOPE.

[0038] In some embodiments, the first set of LNPs and the second set of LNPs each have an average size ranging from about 75 to 150 nm in diameter, hi some embodiments, the first set of LNPs and the second set of LNPs each have an average size less than 100 nm in diameter.

[0039] The compositions of the third and fourth aspects of the present invention find use in methods for treating a peptide, polypeptide, or protein deficiency in a subject, the method comprising administering the composition to the subject, wherein the mRNA encodes the peptide, polypeptide, or protein that is deficient in the subject. In some embodiments, after administering the composition to the subject, the expression level of the peptide, polypeptide, or protein encoded by the mRNA is increased compared to the expression level of the peptide, polypeptide, or protein encoded by the same amount of mRNA administered containing the same mRNA-encapsulating LNP but without a second set of empty LNPs, and the expression level of the liver enzymes aspartate transaminase (AST) and / or alanine aminotransferase (ALT) is comparable. In certain embodiments, the expression level of the protein, polypeptide, or peptide is increased by at least 20%, 40%, 50%, 60%, 70%, 80%, 90%, 1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, or 5-fold.

[0040] In a fifth aspect, the present invention provides a method for encapsulating messenger RNA (mRNA) in preformed empty lipid nanoparticles (LNPs) by mixing a first liquid containing the preformed empty LNPs with a second liquid containing mRNA, wherein the lipid component of the LNPs comprises cationic lipids, the method comprising: (a) mixing the first liquid at a flow rate n1 for a first time period with a first portion of the second liquid at a flow rate n2 to produce a mixture having a first molar ratio of cationic lipid to mRNA; (b) mixing the mixture at a flow rate greater than n1 with a second portion of the second liquid at a flow rate n2 for a second time period to reduce the molar ratio of cationic lipid to mRNA in the resulting mixture by at least 20% less than the first molar ratio; and (c) repeating step (b) by increasing the flow rate of the resulting mixture, each time until a desired molar ratio of cationic lipid to mRNA is reached. In some embodiments, step (b) is repeated four or fewer times, e.g., three or two times.

[0041] In some embodiments, the desired molar ratio of cationic lipid to mRNA is 3-5 (cationic lipid): 1 (mRNA). In some embodiments, the desired molar ratio of cationic lipid to mRNA is about 4:1.

[0042] In some embodiments, the first molar ratio of cationic lipid to mRNA is 30:1 to 10:1, e.g., about 16:1. In some embodiments, the molar ratio of cationic lipid to mRNA after step (b) is performed once is 24:1 to 8:1, e.g., about 12:1. In some embodiments, the molar ratio of cationic lipid to mRNA after step (b) is repeated once is 20:1 to 6:1, e.g., about 8:1. In some embodiments, the molar ratio of cationic lipid to mRNA after step (b) is repeated a second time is 16:1 to 4:1, for example, about 4:1.

[0043] In some embodiments, the mixing in any step comprises pumping a first liquid into a mixing junction and pumping a portion of the second liquid into the mixing junction, optionally in this case the mixing junction is a T-junction. In some embodiments, the mixing in step (a) comprises mixing the first liquid and a first portion of the second liquid for a first portion of a first time period and storing the mixture in an intermediate container for a second portion of the first time period. In some embodiments, the mixing in step (b) comprises (i) mixing the mixed liquid and a second portion of the second liquid for a first portion of a second time period and (ii) storing the mixture from step (b)(i) in an intermediate container or in the intermediate container for a second portion of a second time period.

[0044] In some embodiments, the method according to the fifth aspect of the invention further comprises storing the product of step (b) or (c) in a final container. In some embodiments, the method further comprises heating the product of steps (a), (b) and / or (c) followed by storing the product in an intermediate container or in said intermediate container, or further mixing, optionally wherein the product of steps (a), (b) and / or (b) is heated to a temperature of 60°C to 70°C, such as 63°C to 67°C, for example about 65°C. In such embodiments, the method may further comprise cooling the product of step (b) or (c) followed by storing it in a final container, optionally wherein the product of step (b) or (c) is cooled to a temperature of 19°C to 23°C, for example 20°C to 22°C, for example about 21°C.

[0045] In a sixth aspect, the present invention provides a method for encapsulating messenger RNA (mRNA) in preformed empty lipid nanoparticles (LNPs) by mixing a first liquid containing the preformed empty LNPs with a second liquid containing mRNA, wherein the lipid component of the LNPs comprises cationic lipids, the method comprising: (a) mixing a first portion of the first liquid at a flow rate n1 for a first time period with a second liquid at a flow rate n2 to produce a mixture having a first molar ratio of cationic lipid to mRNA; (b) mixing a second portion of the first liquid at a flow rate greater than n1 for a second time period with a second portion of the first liquid at a flow rate n2 to increase the molar ratio of cationic lipid to mRNA in the resulting mixture by at least 20% greater than the first molar ratio; and (c) repeating step (b) by increasing the flow rate of the resulting mixture, each time until a desired molar ratio of cationic lipid to mRNA is reached. In some embodiments, step (b) is repeated four or fewer times, e.g., three or two times.

[0046] In some embodiments, the desired molar ratio of cationic lipid to mRNA is 3-5 (cationic lipid): 1 (mRNA). In some embodiments, the desired molar ratio of cationic lipid to mRNA is about 4:1.

[0047] In some embodiments, the first molar ratio of cationic lipid to mRNA is 1:10 to 1:1, e.g., about 1:1. In some embodiments, after step (b) is performed once, the molar ratio of cationic lipid to mRNA is 1:5 to 2:1, e.g., about 2:1. In some embodiments, after step (b) is repeated once, the molar ratio of cationic lipid to mRNA is 1:2 to 3:1, e.g., about 3:1. In some embodiments, after step (b) is repeated a second time, the molar ratio of cationic lipid to mRNA is 1:1 to 4:1, e.g., about 4:1.

[0048] In some embodiments, the mixing in any step comprises pumping a first liquid into a mixing junction and pumping a second liquid into a mixing junction, optionally in which case the mixing junction is a T-junction. The mixing in step (a) comprises mixing a first portion of the first liquid with a second liquid for a first portion of a first time period and storing the mixed liquid in an intermediate container for a second portion of the first time period. In some embodiments, the mixing in step (b) comprises (i) mixing the mixed liquid with a second portion of the first liquid for a first portion of a second time period and (ii) storing the mixed liquid obtained in step (b)(i) in or on an intermediate container for a second portion of a second time period.

[0049] In some embodiments, the method according to the sixth aspect of the invention further comprises storing the product of step (b) or (c) in a final container. In some embodiments, the method further comprises heating the product of steps (a), (b) and / or (c) followed by storing the product in an intermediate container or in said intermediate container, or further mixing, optionally wherein the product of steps (a), (b) and / or (b) is heated to a temperature of 60°C to 70°C, such as 63°C to 67°C, for example about 65°C. In such embodiments, the method may further comprise cooling the product of step (b) or (c) followed by storing it in a final container, optionally wherein the product of step (b) or (c) is cooled to a temperature of 19°C to 23°C, for example 20°C to 22°C, for example about 21°C.

[0050] The following embodiments may be applied to the method according to the fifth or sixth aspect of the present invention. In some embodiments, the first period of time does not exceed 5 minutes. In some embodiments, the second period of time does not exceed 5 minutes. In some embodiments, the first portion of the first period of time does not exceed 2 minutes, e.g., the first period of time is about 1 minute. In some embodiments, the first portion of the second period of time does not exceed 2 minutes, e.g., the second period of time is about 1 minute.

[0051] In some embodiments, n1 and n2 are within the range of 20 mL / min to 20 L / min. In some embodiments, the first liquid has a volume of 40 mL to 100 L. In some embodiments, the second liquid has a volume of 40 mL to 100 L. In some embodiments, the mRNA in the second liquid has a concentration of 0.01 mg / mL to 5 mg / mL.

[0052] In some embodiments, the first liquid is a suspension of preformed empty LNPs. In some embodiments, the second liquid is an mRNA solution in water for injection.

[0053] In a seventh aspect, the present invention provides an apparatus for encapsulating messenger RNA (mRNA) within preformed empty lipid nanoparticles (LNPs) by mixing a first liquid containing preformed empty LNPs with a second liquid containing mRNA, the apparatus comprising a first pump, a second pump, a mixing junction, an intermediate container, a first heat exchanger, an LNP conduit arrangement configured to direct the first liquid to the mixing junction via the first pump, an mRNA conduit arrangement configured to direct the second liquid to the mixing junction via the second pump, and a recycle loop, wherein the first liquid and the second liquid form a mixture at the mixing junction, and the recycle loop is configured to direct the mixture from the mixing junction to the first heat exchanger and from the first heat exchanger to the intermediate container, and wherein the recycle loop is configurable to direct the mixture from the intermediate container to the LNP conduit arrangement upstream of the first pump or to the mRNA conduit arrangement upstream of the second pump.

[0054] In an eighth aspect, the present invention provides an apparatus for encapsulating messenger RNA (mRNA) within preformed empty lipid nanoparticles (LNPs) by mixing a first liquid containing the preformed empty LNPs with a second liquid containing the mRNA, the apparatus comprising a first pump, a second pump, a first liquid source, a second liquid source, a mixing junction, and a first liquid from the first liquid source via the first pump to the mixing junction. an LNP conduit arrangement configured to direct a second liquid from a source of the second liquid to the mixing junction via a second pump; an mRNA conduit arrangement configured to direct a second liquid from a source of the second liquid to the mixing junction via a second pump; and a recycle loop, wherein the first liquid and the second liquid form a mixture at the mixing junction, and the recycle loop can be configured to direct the mixture to the LNP conduit arrangement upstream of the first pump or to the mRNA conduit arrangement upstream of the second pump.

[0055] In some embodiments, the recycle loop is configured to direct the mixed liquor to a first conduit arrangement upstream of the first pump, hi some embodiments, the recycle loop is configured to direct the mixed liquor to a second conduit arrangement upstream of the second pump.

[0056] In some embodiments, the first pump is configured to pump the first liquid at a flow rate n1 and the second pump is configured to pump the second liquid at a flow rate n2, where n1 is greater than n2. In some embodiments, the first pump is configured to pump the mixed liquid at a flow rate n3, where n3 is greater than n1. In some embodiments, the first pump is configured to increase the flow rate of the mixed liquid each time the mixed liquid passes through the recycle loop.

[0057] In some embodiments, the first pump is configured to pump the first liquid at a flow rate m1 and the second pump is configured to pump the second liquid at a flow rate m2, where m2 is greater than m1. In some embodiments, the second pump is configured to pump the mixed liquid at a flow rate m3, where m3 is greater than n2. In some embodiments, the second pump is configured to increase the flow rate of the mixed liquid each time the mixed liquid passes through the recycle loop.

[0058] The following embodiments may be applied to the method according to the seventh or eighth aspect of the invention: In some embodiments, the recycle loop is further configured to direct the mixed liquid from the mixing junction to an intermediate container or intermediate containers, and then direct the mixed liquid to the LNP conduit arrangement or the mRNA conduit arrangement.

[0059] In some embodiments, the apparatus further comprises a first heat exchanger, in which case the recycle loop is further configured to direct the mixed liquid from the mixing junction to the first heat exchanger, or to the first heat exchanger, and then to the LNP conduit arrangement or the mRNA conduit arrangement. In some embodiments, the recycle loop is further configured to direct the mixed liquid to the first heat exchanger, and then to the intermediate vessel. In some embodiments, the first heat exchanger is configured to heat the mixed liquid to a temperature of 60°C to 70°C, e.g., 63°C to 67°C, e.g., about 65°C.

[0060] In some embodiments, the device further comprises a first storage container configured to store a first liquid, the first storage container being disposed upstream of the first pump and in fluid communication with the LNP conduit arrangement, and a second storage container configured to store a second liquid, the second storage container being disposed upstream of the second pump and in fluid communication with the mRNA conduit arrangement. In some embodiments, the first storage container is configured to store the first liquid at a temperature between 60°C and 70°C, between 63°C and 67°C, e.g., about 65°C.

[0061] In some embodiments, the apparatus further comprises a conduit output arrangement configured to direct the mixed liquid from the mixing junction to a final storage container, hi some embodiments, the apparatus further comprises a second heat exchanger, wherein the conduit output arrangement further directs the mixed liquid through the second heat exchanger and thereafter directs the mixed liquid to a final storage container. In some embodiments, the second heat exchanger is configured to cool the mixture to a temperature between 19°C and 23°C, such as between 20°C and 22°C, for example, about 21°C.

[0062] In some embodiments, the first and / or second pump is a pulseless flow pump, in which case the first and / or second pump is a gear pump or a centrifugal pump.

[0063] In some embodiments, the mixed junction is a T-junction.

[0064] In a ninth aspect, the present invention provides an apparatus for encapsulating messenger RNA (mRNA) within preformed, empty lipid nanoparticles (LNPs) by mixing a first liquid containing preformed, empty LNPs with a second liquid containing mRNA, the apparatus comprising a first pump, a second pump, a mixing junction, an LNP conduit arrangement configured to direct the first liquid to the mixing junction via the first pump, an mRNA conduit arrangement configured to direct the second liquid to the mixing junction via the second pump, a recycle loop, and a processor, wherein the first liquid and the second liquid form a mixture at the mixing junction and the recycle loop directs the mixture to the first pump. The processor is configured to direct the mixture to an LNP conduit location upstream of the loop or to an mRNA conduit location upstream of the second pump, and the processor is configured to drive the first pump at a first flow rate for a first period of time and drive the second pump at a second flow rate, and, if the recycle loop is configured to direct the mixture to the LNP conduit location, to drive the first pump at n1 times the first flow rate and drive the second pump at a second flow rate for a second period of time, or, if the recycle loop is configured to direct the mixture to the LNP conduit location, to drive the first pump at the first flow rate and drive the second pump at n1 times the first flow rate for a second period of time.

[0065] In some embodiments, the method is carried out according to the fifth or sixth aspect of the invention using an apparatus according to the seventh, eighth or ninth aspect of the invention, the method further comprising passing a first stream of RNase-free water through the apparatus, passing a stream of sodium hydroxide solution through the apparatus, and passing a second stream of RNase-free water through the apparatus.

[0066] In various aspects of the invention, the cationic lipids include cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole-based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3- In some embodiments, the one or more cationic lipids may be selected from the group consisting of (4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), cDD-TE-4-E10, cDD-TE-4-E12, and combinations thereof. In some embodiments, the one or more cationic lipids comprise Target 24. In some embodiments, the one or more cationic lipids comprise ICE. In some embodiments, the one or more cationic lipids comprise cKK-E12. In some embodiments, the one or more cationic lipids comprise cDD-TE-4-E10. In some embodiments, the one or more cationic lipids comprise cDD-TE-4-E12.

[0067] In various aspects of the invention, the non-cationic lipid may be selected from the group consisting of DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DEPE (1,2-dierucoyl-sn-glycero-3-phosphoethanolamine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)). In some embodiments, the non-cationic lipid is DEPE or DOPE.

[0068] In various aspects of the invention, the PEG-modified lipid is a C6-C 20 In some embodiments, the PEG-modified lipid comprises a poly(ethylene) glycol chain up to 5 kDa in length covalently attached to a lipid having an alkyl chain of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2K).

[0069] In various aspects of the invention, the mRNA may include one or more modified nucleotides, or alternatively, the mRNA is unmodified.

[0070] In this application, the use of "or" means "and / or" unless otherwise specified. As used in this disclosure, the term "comprise," as well as variations of this term, such as "comprising" and "comprises," are not intended to exclude other additives, components, integers, or steps. As used in this application, the terms "about" and "approximately" are used synonymously. Both terms are meant to cover any normal variations understood by one of ordinary skill in the relevant art.

[0071] Other features, objects, and advantages of the present invention will become apparent in the following detailed description, drawings, and claims. It should be understood, however, that the detailed description, drawings, and claims, while referring to embodiments of the present invention, are given by way of example only, and not by way of limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art.

[0072] The drawings are for illustration purposes only and not for limitation. [Brief explanation of the drawings]

[0073] [Figure 1] Figure 1 shows a schematic diagram of the lipid nanoparticle mRNA encapsulation process, which involves mixing a suspension of preformed empty lipid nanoparticles with a solution of mRNA dissolved in an aqueous buffer (see panel A). This process is referred to herein as the conventional "remix" process or "Process B." As shown in panel B, the molar ratio of cationic lipid to mRNA (colloquially referred to as the N / P ratio) remains constant during the mixing process. As shown in panel C, the suspension containing preformed empty lipid nanoparticles is at 65°C, while the mRNA solution is at ambient temperature. The two liquids are mixed using a pumping system, and the combined mixture is heated to 65°C to eliminate the temperature difference, as shown by ΔT. [Figure 2]Figure 2 shows an improved process based on the traditional "remix" process. Panel A shows a schematic diagram of the lipid nanoparticle mRNA encapsulation process, which involves mixing a suspension of preformed empty lipid nanoparticles with batches of a solution of mRNA, which are added sequentially. In the exemplary process shown in Panel A, four batches of mRNA are added. Each addition results in an intermediate mixture. The intermediate mixture contains different molar ratios (N / P) of cationic lipid to mRNA, starting at 16 (cationic lipid):1 (mRNA) and decreasing to 4 (cationic lipid):1 (mRNA) in the final formulation. This stepwise decrease in N / P ratio is shown in Panel B. This type of process is referred to herein as a "step-down remix" process. Panel C shows the corresponding process in which a suspension of preformed empty lipid nanoparticles is added in batches to the mRNA solution, starting with an equal ratio of cationic lipid to mRNA. In the exemplary process shown in panel C, for example, four batches of preformed empty lipid nanoparticles are added until a ratio of 4 (cationic lipid):1 (mRNA) is reached. This stepwise increase in N / P ratio is shown in panel D. This type of process is referred to herein as a "step-up remix" process. [Figure 3]Figure 3 shows an exemplary step-down remix process shown in Figure 2, as well as an alternative version of the step-up remix process. For example, panels A and B show variations of these processes, in which batches of either preformed lipid nanoparticles or mRNA are added at three different times, each followed by a mixing period. The final mixing period is extended compared to the other mixing periods. Panels C and D show other variations of the step-down and step-up remix processes, in which either preformed lipid nanoparticles or mRNA are added continuously over a period of time, and the molar ratio of cationic lipid to mRNA (N / P ratio) is decreased or increased during that period until the desired N / P ratio is reached. Panels E and F show further variations that combine the step-down and step-up remix processes. These variations alternate between the addition of preformed lipid nanoparticles and the addition of mRNA, resulting in both a gradual increase and decrease in the N / P ratio before reaching the desired final N / P ratio. [Figure 4] Figure 4 shows in vivo protein expression from hOTC mRNA in the liver of wild-type CD1 mice for two lipid formulations, differing in the cationic lipid, either cDD-TE-4-E10 (Figure 4A) or cDD-TE-4-E12 (Figure 4B). Using the exemplary remix, step-down, and step-up remix processes shown in Figures 1 and 2, mRNA was formulated in lipid nanoparticles. Six- to eight-week-old male mice received a single bolus tail vein injection of the lipid nanoparticle formulation at a dose of 1.0 mg / kg hOTC mRNA. Liver homogenates were analyzed by ELISA to determine the amount of hOTC relative to total protein (in ng / mg). In each figure, the dashed line represents the approximate minimum expression level for therapeutic efficacy (approximately 450 ng of hOTC per mg of total protein). [Figure 5]Figure 5 shows that lipid nanoparticles formulated using the exemplary step-down and step-up remix processes can improve in vivo expression of hOTC mRNA compared to lipid nanoparticles formulated using a conventional remix process, even when optimal lipid nanoparticle formulations are used. Male mice aged 6 to 8 weeks were given a single bolus tail vein injection of lipid nanoparticle formulations containing hOTC mRNA at a dose of 1.0 mg / kg. Four-component liposomes based on cDD-TE-4-E12 and containing either DOPE or DEPE as the non-cationic lipid component were used as test substances. MC3-based lipid nanoparticles served as controls. Liver homogenates were analyzed by ELISA to determine the amount of hOTC relative to total protein (in ng / mg). [Figure 6-1] Figure 6 shows that in vivo expression of hOTC mRNA can be improved by adjusting the number of steps (Figure 6A) or the timing of batch addition (Figure 6B) in the exemplary step-down and step-up remix processes. Six- to eight-week-old male mice received a single bolus tail vein injection of various lipid nanoparticle formulations at a dose of 0.5 mg / kg of hOTC mRNA. Liver homogenates were analyzed by ELISA to determine the amount of hOTC relative to total protein (in ng / mg). In each figure, the dashed line represents the approximate minimum expression level for therapeutic efficacy (approximately 450 ng of hOTC per mg of total protein). [Figure 6-2] Same as above. [Figure 7-1]Figure 7 shows the dose-dependent in vivo activity of hOTC mRNA in OTCspf / ash mice 24 hours after a single bolus injection of mRNA. Panel A is a schematic diagram of the study protocol. hOTC mRNA was encapsulated in four-component lipid nanoparticles (cDD-TE-4-E12, DEPE, cholesterol, and DMG-PEG2K) using the exemplary step-down remix process shown in Figure 2A. The mRNA-loaded lipid nanoparticles were administered to OTCspf / ash mice at the indicated doses. Saline-treated wild-type and OTCspf / ash mice served as controls. 24 hours after administration, animals were challenged with NH4Cl, and plasma NH3 levels were measured 40 minutes after challenge. Liver homogenates were analyzed by ELISA to determine hOTC protein expression levels. Panel B shows that the amount of hOTC relative to total protein (expressed in ng / mg) increased in a dose-dependent manner. Panel C shows that plasma NH3 levels were reduced in a dose-dependent manner. [Figure 7-2] Same as above. [Figure 8] Figure 8 shows the persistence of in vivo activity of hOTC mRNA in OTCspf / ash mice up to 3 weeks after a single bolus injection of mRNA. Panel A is a schematic diagram of the study protocol. hOTC mRNA was encapsulated in four-component lipid nanoparticles (cDD-TE-4-E12, DEPE, cholesterol, and DMG-PEG2K) using the exemplary step-down remix process shown in Figure 2A. The mRNA-loaded lipid nanoparticles were administered to OTCspf / ash mice at a dose of 0.3 mg / kg. Saline-treated wild-type and OTCspf / ash mice served as controls. One, two, and three weeks after administration, animals were challenged with NH4Cl, and plasma NH3 levels were measured 40 minutes after challenge. Panel B shows that the amount of OTC protein administered from hOTC mRNA was adequate to reduce plasma NH3 levels to levels similar to, or indistinguishable from, those of saline-treated wild-type mice for at least 15 days after administration. [Figure 9] Figure 9 shows a variation of the "remix" process shown schematically in Figure 1A. Preformed empty lipid nanoparticles are mixed with mRNA dissolved in an aqueous buffer to encapsulate the mRNA. After encapsulation and purification, the mRNA-loaded lipid nanoparticles are mixed with the empty lipid nanoparticles to produce a mixture of mRNA-loaded and empty lipid nanoparticles (a reblended formulation). This process is referred to herein as the "reblended" process. [Figure 10] Figure 10 shows how the addition of empty lipid nanoparticles to mRNA-loaded lipid nanoparticles prepared using the "remix" process shown in Figure 1A can boost the in vivo activity of hOTC mRNA in wild-type mice. Panel A shows the amount of human erythropoietin (hEPO) protein expressed in serum 6 and 24 hours after a single bolus injection of mRNA-loaded lipid nanoparticles at a dose of 1.0 mg / kg. Mice treated with saline served as the control. hEPO expression levels in mice treated with ML2-based lipid nanoparticles (ML2 Remix) prepared using the conventional "remix" process served as the benchmark. All three "reblend" formulations tested demonstrated a boost in hEPO expression at 6 hours. Panel B shows that the tolerability of the "reblend" formulations was comparable to the "remix" benchmark formulation. Tolerability was assessed based on the expression levels of ALT and AST in the livers of the test animals. Increased ALT and AST levels are indicative of hepatotoxicity. The dashed lines indicate the mean expression levels of hEPO, ALT and AST, respectively, in mice treated with the "ML2 Remix" benchmark formulation. [Figure 11] FIG. 11 shows an apparatus for encapsulating messenger mRNA within preformed empty LNPs for use in the methods described herein by mixing a first liquid containing the preformed empty LNPs with a second liquid containing the mRNA. [Figure 12]Figure 12A shows a configuration of the device of Figure 11 in which the recycle loop is configured to direct the mixed fluid upstream of the first pump. When the device is running, the recycle loop 260 is configured to direct the mixed fluid from the mixing junction 205 to a position in the LNP conduit upstream of the first pump 203. Figure 12B shows a configuration of the device of Figure 11 in which the recycle loop is configured to direct the mixed fluid upstream of the second pump. When the device is running, the recycle loop 260 is configured to direct the mixed fluid from the mixing junction 205 to a position in the mRNA conduit upstream of the second pump 204. [Figure 13] FIG. 13 shows an apparatus including an intermediate storage container for use in the methods described herein. [Figure 14] FIG. 14 shows an apparatus including a first heat exchanger for use in the methods described herein. [Figure 15] FIG. 15 shows an apparatus including an intermediate storage vessel and a first heat exchanger for use in the methods described herein. [Figure 16] FIG. 16 shows an apparatus including a final storage container for use in the methods described herein. [Figure 17] FIG. 17 shows an apparatus including a final storage vessel and a second heat exchanger for use in the methods described herein. [Figure 18] FIG. 18 illustrates an apparatus for use in the methods described herein, including an intermediate storage vessel, a final storage vessel, a first heat exchanger, and a second heat exchanger, wherein the recycle loop can be configured to direct the mixed liquor upstream of the first or second pump. [Figure 19] FIG. 19 shows an apparatus according to claim 17 for use in the methods described herein, wherein the recycle loop is configured to direct the mixed liquor upstream of the first pump.

[0074] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions of these terms and other terms are set forth throughout the specification. Publications and other reference materials referred to herein to describe the background of the invention and to provide further details regarding its practice are incorporated herein by reference.

[0075] Amino acid: As used herein, the term "amino acid" in its broadest sense refers to any compound and / or substance that can be incorporated into a polypeptide chain. In some embodiments, an amino acid has the general structure HN-C(H)(R)-COOH. In some embodiments, an amino acid is a naturally occurring amino acid. In some embodiments, an amino acid is a synthetic amino acid, in some embodiments, an amino acid is a D-amino acid, and in some embodiments, an amino acid is an L-amino acid. A "standard amino acid" refers to any of the 20 standard L-amino acids commonly found in naturally occurring peptides. A "non-standard amino acid" refers to any amino acid other than the standard amino acids, whether it is synthetically prepared or obtained from a natural source. As used herein, a "synthetic amino acid" encompasses chemically modified amino acids, including, but not limited to, salts, amino acid derivatives (such as amides), and / or substitutions. Amino acids, including the carboxy- and / or amino-terminal amino acids in a peptide, can be modified by methylation, amidation, acetylation, protecting groups, and / or substitutions with other chemical groups that can alter the circulating half-life of the peptide without adversely affecting its activity. An amino acid can participate in a disulfide bond. An amino acid may include one or more post-translational modifications, such as association with one or more chemical entities (e.g., a methyl group, an acetate group, an acetyl group, a phosphate group, a formyl moiety, an isoprenoid group, a sulfate group, a polyethylene glycol moiety, a lipid moiety, a carbohydrate moiety, a biotin moiety, etc.). The term "amino acid" is used interchangeably with "residue" and can refer to free amino acids and / or amino acid residues of peptides. Whether the term refers to a free amino acid or a residue of a peptide will be clear from the context in which it is used.

[0076] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or parasites. In some embodiments, the animal may be a transgenic animal, a genetically engineered animal, and / or a clone.

[0077] Approximately or About: As used herein, the term "approximately" or "about" as applied to one or more values ​​of interest refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction of (greater or less than) the stated reference value, unless otherwise stated or clear from the context (except when such number exceeds 100% of possible values).

[0078] Biologically active: As used herein, the term "biologically active" refers to the characteristic of any agent that has activity in a biological system, particularly an organism. For example, an agent that, when administered to an organism, has a biological effect on that organism is considered to be biologically active.

[0079] Delivery: As used herein, the term "delivery" encompasses both local delivery and systemic delivery. For example, the delivery of mRNA encompasses the situation where mRNA is delivered to a target tissue, the encoded protein or peptide is expressed, and is retained in the target tissue (also referred to as "local distribution" or "local delivery"), and the situation where mRNA is delivered to a target tissue, the encoded protein or peptide is expressed, secreted into the patient's circulatory system (e.g., serum), distributed throughout the body, and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").

[0080] Efficacy: As used herein, the term "efficacy," or its grammatical equivalents, refers to the improvement of a biologically relevant endpoint associated with delivery of mRNA encoding a relevant protein or peptide. In some embodiments, the biological endpoint is protection against ammonium chloride challenge at a specific time point after administration.

[0081] Encapsulation: As used herein, the term "encapsulation," or its grammatical equivalents, refers to the process of enclosing nucleic acid molecules (e.g., individual mRNA molecules) within nanoparticles.

[0082] Expression: As used herein, "expression" of mRNA refers to the translation of mRNA into a peptide (e.g., an antigen), polypeptide, or protein (e.g., an enzyme), and may also include post-translational modification of the peptide, polypeptide, or fully assembled protein (e.g., an enzyme), as indicated by the context. In this application, the terms "expression" and "production," and their grammatical equivalents, are used interchangeably.

[0083] Functional: As used herein, a "functional" biomolecule is a biomolecule in a form in which it exhibits a property and / or activity by which it is characterized.

[0084] Half-life: As used herein, the term "half-life" is the time required for a quantity, such as a nucleic acid or protein concentration or activity, to fall to half of its initially measured value over a period of time.

[0085] Improve, increase, or reduce: As used herein, the terms "improve," "increase," or "reduce," or grammatical equivalents, refer to a value relative to a baseline measurement, such as a measurement in the same individual before the initiation of a treatment described herein, or a measurement in a control sample or subject (or control samples or subjects) in the absence of a treatment described herein. A "control sample" is a sample that has been subjected to the same conditions as the test sample, except for the test article. A "control subject" is a subject that suffers from the same form of disease as the subject being treated and is approximately the same age as the subject being treated.

[0086] In vitro: As used herein, the term "in vitro" refers to events that take place in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multicellular organism.

[0087] In vivo: As used herein, the term "in vivo" refers to events that occur within multicellular organisms, such as humans and non-human animals. In the context of cell-based systems, the term can be used to refer to events that occur within living cells (as opposed to, for example, in vitro systems).

[0088] Isolated: As used herein, the term "isolated" refers to substances and / or entities that are (1) separated from at least some of the components with which they were associated when originally produced (whether in nature and / or in an experimental setting) and / or (2) artificially produced, prepared, and / or manufactured. Isolated substances and / or entities can be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were originally associated. In some embodiments, the isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, calculations of percent purity of isolated substances and / or entities should not include excipients (e.g., buffers, solvents, water, etc.).

[0089] Lipid nanoparticles (LNPs): For use in the present invention, LNPs comprise three or four lipid components selected from cationic lipids, non-cationic lipids (e.g., DOPE or DEPE), cholesterol-based lipids (e.g., cholesterol), and PEG-modified lipids (e.g., DMG-PEG2K). In some embodiments, LNPs comprise three or fewer distinct lipid components. In some embodiments, one distinct lipid component is a sterol-based cationic lipid. An exemplary LNP comprises three lipid components: a sterol-based cationic lipid, a non-cationic lipid (e.g., DOPE or DEPE), and a PEG-modified lipid (e.g., DMG-PEG2K).

[0090] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one peptide, polypeptide, or protein. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. mRNA may be purified from natural sources, They may be produced using recombinant expression systems and, optionally, purified, chemically synthesized, etc. Optionally, for example, in the case of chemically synthesized molecules, mRNA may contain nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, etc. The mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, the mRNA is selected from natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, pseudouridine, and 5-methylcytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intervening bases, modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).

[0091] Multimeric encoding nucleic acid (MCNA): The mRNA as defined above may contain MCNA. For example, the MCNA compound may contain two or more encoding polynucleotides linked via their 3' ends, so that the MCNA compound contains two or more 5' ends. Various MCNA structures and methods for producing the same are described in the published U.S. patent application US2017 / 0314041, which is incorporated herein by reference in its entirety.

[0092] N / P ratio: As used herein, the term "N / P ratio" refers to the molar ratio of cationic lipids in a lipid nanoparticle to the mRNA encapsulated within the lipid nanoparticle. Thus, the N / P ratio is typically calculated as the ratio of the moles of cationic lipids in the lipid nanoparticle to the moles of mRNA encapsulated within the lipid nanoparticle. For example, a four-fold molar excess of cationic lipid per mole of mRNA results in an "N / P ratio" of 4. Various embodiments of the present invention include increasing ("gradually increasing," "stepping up") or decreasing ("gradually decreasing," "stepping down") the N / P ratio during the encapsulation process until the desired ratio is reached.

[0093] Nucleic Acid: As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, "nucleic acid" encompasses RNA as well as single- and / or double-stranded DNA and / or cDNA. Furthermore, the terms "nucleic acid," "DNA," "RNA," and / or similar terms include nucleic acid analogs, i.e., analogs having other than a phosphodiester backbone. For example, so-called "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention. The term "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and / or encode the same amino acid sequence. Nucleotide sequences encoding proteins and / or RNA may contain introns. Nucleic acids can be purified from natural sources, produced using recombinant expression systems, optionally purified, chemically synthesized, etc. Optionally, for example, in the case of chemically synthesized molecules, the nucleic acids can be chemically modified. Nucleoside analogs may be included, such as analogs with base or sugar groups, backbone modifications, etc. Nucleic acids are presented in a 5' to 3' direction unless otherwise indicated. In some embodiments, nucleic acids include natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methyl ... , C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages). In some embodiments, the present invention is specifically directed to "unmodified nucleic acids," meaning nucleic acids (e.g., polynucleotides and residues comprising nucleotides and / or nucleosides) that have not been chemically modified to facilitate or achieve delivery. In some embodiments, the nucleotides T and U are used interchangeably in sequence descriptions.

[0094] Patient: As used herein, the term "patient" or "subject" refers to any organism to which provided compositions can be administered, for example, for experimental, diagnostic, preventative, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In certain embodiments, the patient is a human. Humans include prenatal and postnatal forms.

[0095] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" refers to a material that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, inflammatory irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0096] Pharmaceutically acceptable salts: pharmaceutically acceptable salts are well known in the art.For example, S.M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19.The pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases.Examples of pharmaceutically acceptable non-toxic acid addition salts are the salts of amino groups, which are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid, or are formed by other methods used in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, and propionate. Salts derived from appropriate bases include alkali metal salts, alkaline earth metal salts, ammonium salts, and N-type salts. + (C 1-4 Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include non-toxic ammonium cations, quaternary ammonium cations, and amine cations, formed, where appropriate, using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, sulfonates, and arylsulfonates. Further pharmaceutically acceptable salts include salts formed from the quaternization of amines using suitable electrophiles, e.g., alkyl halides to form quaternized alkylated amino salts.

[0097] Efficacy: As used herein, the term "efficacy" or grammatical equivalents refers to the expression of a protein or peptide encoded by an mRNA and / or the resulting biological effect.

[0098] Processor: As used herein, the term "processor" includes microprocessors, microelectronic, virtual processors, and / or integrated circuits configured to process data and / or control components of the devices described herein.

[0099] Protein: As used herein, the term "protein" includes peptides (e.g., dipeptides), proteins, polypeptides, and / or collections of peptides, polypeptides, or proteins. In some embodiments, the term "protein" may exclude peptides. Proteins relevant to the present invention may be proteins of biological and / or therapeutic relevance.

[0100] Systemic distribution or delivery: As used herein, the terms "systemic distribution," "systemic delivery," or grammatical equivalents refer to a delivery or distribution mechanism or approach that affects the entire body or the entire organism. Typically, systemic distribution or delivery is achieved via the body's circulatory system, e.g., the bloodstream. Compare with the definition of "local distribution or delivery."

[0101] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., a mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, a subject is a human. A subject may be a patient, and refers to a person who sees a healthcare provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may be afflicted with or susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0102] Substantially: As used herein, the term "substantially" refers to the qualitative state of exhibiting the full or nearly full extent or degree of a desired characteristic or property. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, go to completion and / or reach completion, or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0103] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by the disease being treated. In some embodiments, the target tissue includes tissue that exhibits pathology, symptoms, or characteristics associated with the disease.

[0104] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount that, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, is sufficient to treat, diagnose, prevent symptoms of, and / or delay the onset of, the disease, disorder, and / or condition. Those skilled in the art will appreciate that a therapeutically effective amount is typically administered in a dosing regimen comprising at least one unit dose.

[0105] Treating: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment may be administered to subjects who do not exhibit signs of the disease and / or who exhibit only early signs of the disease, for the purpose of reducing the risk of developing conditions associated with the disease.

[0106] Yield: As used herein, the term "yield" refers to the percentage of mRNA recovered after encapsulation compared to the total mRNA as starting material. In some embodiments, the term "recovery" is used interchangeably with the term "yield." DETAILED DESCRIPTION OF THE INVENTION

[0107] The present invention provides improved methods for lipid nanoparticle (LNP) formulations and mRNA encapsulation. In some embodiments, the present invention provides methods for encapsulating messenger RNA (mRNA) in lipid nanoparticles, comprising forming lipids into preformed lipid nanoparticles (i.e., formed without mRNA) and then combining the preformed lipid nanoparticles with the mRNA. In some embodiments, the novel formulation methods result in mRNA formulations that are potentially better tolerated due to higher potency (peptide, polypeptide, or protein expression) and improved efficacy (improved biologically relevant endpoints) both in vitro and in vivo compared to formulations of the same mRNA prepared without preforming lipid nanoparticles (e.g., by directly combining lipids with mRNA). The higher potency and / or efficacy of such formulations may allow for lower dosages and / or less frequent administration of pharmaceuticals. In some embodiments, the present invention features improved lipid formulations comprising a cationic lipid, a helper lipid, and PEG or PEG-modified lipids.

[0108] In some embodiments, the lipid nanoparticle formulation and manufacturing method of the present invention have an encapsulation efficiency of at least 80%, for example at least 90%.For nucleic acid delivery, encapsulation is often considered important to protect pharmaceutical ingredients in vivo and reduce activity loss.Usually, the higher the encapsulation efficiency, the greater the amount of encapsulated nucleic acid (for example, mRNA) that is delivered to target cells.

[0109] Various aspects of the invention are described in detail in the following sections. The use of a section is not meant to limit the invention. Each section may be applicable to any aspect of the invention.

[0110] messenger RNA (mRNA) The present invention can be used to encapsulate any mRNA. mRNA is typically thought of as a type of RNA that carries information from DNA to the ribosome. Typically, in eukaryotes, mRNA processing involves adding a "cap" on the 5' end and a "tail" on the 3' end. A typical cap is a 7-methylguanosine cap. The cap is a guanosine linked via a 5'-5'-triphosphate bond to the first transcribed nucleotide. The presence of the cap is important for providing resistance to nucleases found in most eukaryotic cells. The addition of the tail is typically a polyadenylation event, whereby a polyadenylyl moiety is added to the 3' end of the mRNA molecule. The presence of this "tail" serves to protect the mRNA from exonuclease degradation. Messenger RNA is translated by ribosomes into a series of amino acids that make up proteins.

[0111] mRNA synthesis and performance mRNA can be synthesized by any of a variety of known methods. Various methods are described in published U.S. Patent Application No. 2018 / 0258423 and can be used in practicing the present invention, all of which are incorporated herein by reference. For example, for use in the present invention, mRNA can be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or an RNAse inhibitor. The exact conditions will vary depending on the specific application. In some embodiments, mRNA may be further purified for use in the present invention. In some embodiments, in vitro synthesized mRNA can be purified prior to formulation and encapsulation to remove undesired impurities, including various enzymes and other reagents used during mRNA synthesis.

[0112] Various methods may be used to purify mRNA for use in the present invention. For example, purification of mRNA can be carried out using centrifugation, filtration, and / or chromatography. In some embodiments, the synthesized mRNA is purified by ethanol precipitation or filtration or chromatography, or gel purification or any other suitable means. In some embodiments, the mRNA is purified by HPLC. In some embodiments, the mRNA is extracted with a standard phenol:chloroform:isoamyl alcohol solution well known to those of skill in the art.

[0113] In certain embodiments, mRNA is purified by tangential flow filtration (TFF).Suitable purification methods include those described in published US patent application No. 2016 / 0040154, published US patent application No. 2015 / 0376220, published US patent application No. 2018 / 0251755, published US patent application No. 2018 / 0251754, US provisional patent application No. 62 / 757,612 filed on November 8, 2018, and US provisional patent application No. 62 / 891,781 filed on August 26, 2019, all of which are incorporated herein by reference and can be used to implement the present invention.

[0114] In some embodiments, the mRNA is purified before capping and tailing. In some embodiments, the mRNA is purified after capping and tailing. In some embodiments, the mRNA is purified before and after capping and tailing. In some embodiments, the mRNA is purified by centrifugation either before or after, or both before and after capping and tailing. In some embodiments, the mRNA is purified by filtration either before or after, or both before and after capping and tailing. In some embodiments, the mRNA is purified by TFF either before or after, or both before and after capping and tailing. In some embodiments, the mRNA is purified by chromatography either before or after, or both before and after capping and tailing.

[0115] The present invention can be used to formulate and encapsulate mRNA of various lengths.In some embodiments, the present invention can be used to formulate and encapsulate in vitro synthesized mRNA of about 0.5kb, 1kb, 1.5kb, 2kb, 2.5kb, 3kb, 3.5kb, 4kb, 4.5kb, 5kb, 6kb, 7kb, 8kb, 9kb, 10kb, 11kb, 12kb, 13kb, 14kb, 15kb, 20kb, 30kb, 40kb or 50kb or more in length. In some embodiments, the present invention may be used to formulate and encapsulate in vitro synthesized mRNA ranging in length from about 1 to 20 kb, about 1 to 15 kb, about 1 to 10 kb, about 5 to 20 kb, about 5 to 15 kb, about 5 to 12 kb, about 5 to 10 kb, about 8 to 20 kb, about 8 to 15 kb, or about 8 to 50 kb.

[0116] mRNA modification The present invention can be used to formulate and encapsulate unmodified mRNA or mRNA that contains one or more modifications that typically enhance stability, in some embodiments, the modifications are selected from modified nucleotides, modified sugar-phosphate backbones, and 5' and / or 3' untranslated regions.

[0117] In some embodiments, the mRNA comprises naturally occurring nucleosides (or unmodified nucleosides, i.e., adenosine, guanosine, cytidine, and uridine) or consists of naturally occurring nucleosides. In some embodiments, modifications of the mRNA may include modifications of the nucleotides of the RNA (e.g., adenosine analogs, guanosine analogs, cytidine analogs, uridine analogs). In some embodiments, the mRNA comprises both unmodified and modified nucleosides. Modified mRNAs according to the present invention may include, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, one or more modified nucleosides are nucleoside analogs. In some embodiments, one or more modified nucleosides comprise at least one modification selected from a modified sugar and a modified nucleobase. In some embodiments, the mRNA comprises one or more modified nucleotides. In some embodiments, one or more modified nucleosides comprise a modified nucleobase, e.g., a chemically modified base, a biologically modified base (e.g., a methylated base), or an intermediate base.

[0118] In some embodiments, mRNA may be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides), including, but not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), such as 1-methyladenine, 2-methyladenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyladenine, N6-methylthio-N-6-isopentenyl- ... N6-isopentenyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethyluracil aminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy -uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queuosine, beta-D-mannosyl-queuosine, wybutoxosine, as well as phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, pseudouridine (e.g., N-1-methyl-pseudouridine They may be synthesized from natural nucleotides and / or nucleotide analogs (modified nucleotides), including 2-thiouridine, 2-thiocytidine, 5-methylcytidine, inosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, diaminopurine, and 2-chloro-6-aminopurine cytosine. The preparation of such analogs is known to those skilled in the art from, for example, U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642, the disclosures of which are incorporated herein by reference in their entirety.

[0119] In some embodiments, the mRNA can be RNA, in which 25% of the U residues are 2-thiouridine and 25% of the C residues are 5-methylcytidine. Teachings regarding the use of such modified RNA are disclosed in U.S. Patent Application Publication No. 2012 / 0195936 and International Publication No. 2011 / 012316, both of which are incorporated herein by reference in their entirety. In some embodiments, the presence of one or more nucleoside analogs can make the mRNA more stable and / or less immunogenic than a control mRNA having the same sequence but containing only naturally occurring nucleosides. For example, see U.S. Patent No. 8,278,036 or WO2011 / 012316 for a discussion of 5-methylcytidine, pseudouridine, and 2-thiouridine and their incorporation into mRNA.

[0120] In some embodiments, the mRNA contains one or more modified nucleotides. For example, one or more of the modified nucleotides used to produce the mRNA of the present invention may contain a modified phosphate group. Thus, in the mRNA, one or more phosphodiester bonds are replaced with another anionic, cationic, or neutral group. For example, in some embodiments, the one or more modified nucleotides contain a modified phosphate group selected from methyl phosphonate, methyl phosphoramidate, phosphoramidate, phosphorothioate (e.g., cytidine 5'-O-(1-thiophosphate)), boranophosphate, and a positively charged guanidinium group. In some embodiments, the one or more modified internucleoside linkages are phosphorothioate linkages. In some embodiments, the one or more modified internucleoside linkages are 5'-N-phosphoramidite linkages.

[0121] In some embodiments, one or more modified nucleosides comprise a modified sugar. In some embodiments, one or more modified nucleosides comprise a modification to the furanose ring. In some embodiments, one or more modified nucleosides are 2'-deoxy-2'-fluoro-oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotides (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyl oligoribonucleotides, The modified sugar is selected from 2'-deoxy-2'-C-alkyl oligoribonucleotides (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-C-alkyl oligoribonucleotides, and their isomers (2'-aracytidine 5'-triphosphate, 2'-arauidine 5'-triphosphate), or azidotriphosphates (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate). In some embodiments, one or more modified nucleosides contain a modified sugar selected from a 2'-O-alkyl modification or a locked nucleic acid (LNA). In some embodiments, the sugar modification is a 2'-O-alkyl modification, such modifications include a 2'-deoxy-2'-fluoro modification, a 2'-O-methyl ... In some embodiments, the one or more modified nucleosides comprise a modified sugar selected from 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose.

[0122] In some embodiments, any of these modifications may be present individually or in combination in 0-100% of the nucleotides, e.g., 0%, 1%, 10%, 25%, 50%, 75%, 85%, 90%, 95%, or greater than 100% of the constituent nucleotides.

[0123] In some embodiments, the RNA may be complexed or hybridized with additional polynucleotides and / or peptide polynucleotides (PNAs).

[0124] Typically, mRNA synthesis involves adding a "cap" onto the 5' end and a "tail" onto the 3' end. The presence of a cap is important for providing resistance to nucleases found in most eukaryotic cells. The presence of a "tail" serves to protect the mRNA from exonuclease degradation. As described herein, adding a 5' cap and / or a 3' tail facilitates the detection of abortive transcripts generated during in vitro synthesis, because, without capping and / or tailing, prematurely terminated mRNA transcripts are too small to be detected. Thus, in some embodiments, a 5' cap and / or a 3' tail are added to a synthetic mRNA before the mRNA is tested for purity (e.g., the level of abortive transcripts present in the mRNA). In some embodiments, a 5' cap and / or a 3' tail are added to a synthetic mRNA before the mRNA is purified as described herein. In some embodiments, a 5' cap and / or a 3' tail are added to a synthetic mRNA after the mRNA is purified as described herein.

[0125] Thus, in some embodiments, the mRNA contains a 5' cap structure. The 5' cap is typically added as follows: First, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates. Then, guanosine triphosphate (GTP) is added to the terminal phosphate via a guanylyltransferase, resulting in a 5'5'5 triphosphate linkage. The 7-nitrogen of guanine is then methylated by a methyltransferase. 2'-O-methylation can also occur at the first and / or second base after the 7-methylguanosine triphosphate residue. Examples of cap structures include, but are not limited to, mGpppNp-RNA, mGpppNmp-RNA, mGpppNmpNmp-RNA (where m represents a 2'-O methyl residue), mG(5')ppp(5')(A), G(5')ppp(5')A, and G(5')ppp(5')G. Additional cap structures are described in published U.S. patent application US2016 / 0032356 and published U.S. patent application US2018 / 0125989.

[0126] In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, such as an iron-responsive element. In some embodiments, the 5' untranslated region can be about 50-500 nucleotides in length.

[0127] In some embodiments, the 3' untranslated region includes one or more of a polyadenylation signal, a binding site for a protein that affects the positional stability of the mRNA in the cell, or one or more binding sites for miRNA. In some embodiments, the 3' untranslated region can be 50 to 500 nucleotides or more in length. The tail structure typically includes a poly(A) tail and / or a poly(C) tail. A poly(A) tail or poly(C) tail on the 3' end of the mRNA. The tail typically has at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 550 adenosine or cytosine nucleotides. at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb of adenosine or cytosine nucleotides, respectively.In some embodiments, the poly-A tail or poly-C tail each comprises between about 10 and 800 adenosine or cytosine nucleotides (e.g., between about 10 and 200 adenosine or cytosine nucleotides, between about 10 and 300 adenosine or cytosine nucleotides, between about 10 and 400 adenosine or cytosine nucleotides, between about 10 and 500 adenosine or cytosine nucleotides, between about 10 and 550 adenosine or cytosine nucleotides, between about 10 and 600 adenosine or cytosine nucleotides, between about 50 and 600 adenosine or cytosine nucleotides, between about 100 and 600 adenosine or cytosine nucleotides, between about 150 and 600 adenosine or cytosine nucleotides, between about 200 and 300 adenosine or cytosine nucleotides, between about 200 and 300 adenosine or cytosine nucleotides, between about 300 and 400 adenosine or cytosine nucleotides, between about 10 and 500 adenosine or cytosine nucleotides, between about 10 and 550 adenosine or cytosine nucleotides, between about 10 and 600 adenosine or cytosine nucleotides, between about 50 and 600 adenosine or cytosine nucleotides, between about 100 and 600 adenosine or cytosine nucleotides, between about 150 and 600 adenosine or cytosine nucleotides, between about 200 and 300 adenosine or cytosine nucleotides, between about The tail structure may be about 600 adenosine or cytosine nucleotides, about 250-600 adenosine or cytosine nucleotides, about 300-600 adenosine or cytosine nucleotides, about 350-600 adenosine or cytosine nucleotides, about 400-600 adenosine or cytosine nucleotides, about 450-600 adenosine or cytosine nucleotides, about 500-600 adenosine or cytosine nucleotides, about 10-150 adenosine or cytosine nucleotides, about 10-100 adenosine or cytosine nucleotides, about 20-70 adenosine or cytosine nucleotides, or about 20-60 adenosine or cytosine nucleotides. In some embodiments, the tail structure includes or is a combination of poly(A) tails and poly(C) tails of various lengths as described herein. In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides.In some embodiments, the tail structure comprises at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.

[0128] While mRNA resulting from an in vitro transcription reaction may be desirable in some embodiments, other sources of mRNA, including mRNA produced from bacteria, fungi, plants, and / or animals, are contemplated within the scope of the present invention.

[0129] mRNA-encoded proteins In some embodiments, a suitable mRNA sequence is an mRNA sequence encoding a peptide, polypeptide, or protein. In some embodiments, a suitable mRNA sequence is codon optimized for efficient expression in human cells. Codon optimization typically involves modifying a native or wild-type nucleic acid sequence encoding a peptide, polypeptide, or protein to achieve the highest possible G / C content, adjusting codon usage to avoid rare or rate-limiting codons, removing destabilizing nucleic acid sequences or motifs, and / or removing pause sites or terminator sequences without changing the amino acid sequence of the mRNA-encoded peptide, polypeptide, or protein. In some embodiments, a suitable mRNA sequence is a native or wild-type sequence. In some embodiments, a suitable mRNA sequence encodes a protein, polypeptide, or peptide containing one or more mutations in the amino acid sequence.

[0130] The present invention can be used to formulate and encapsulate mRNA encoding various proteins.Non-limiting examples of mRNA suitable for the present invention include mRNA encoding spinal motor neuron 1 (SMN), alpha-galactosidase (GLA), argininosuccinate synthetase (ASS1), ornithine transcarbamylase (OTC), factor IX (FIX), phenylalanine hydroxylase (PAH), erythropoietin (EPO), and cystic fibrosis transmembrane conductance receptor (CFTR).Exemplary mRNA sequences disclosed herein are listed below:

[0131] Codon-optimized human OTC coding sequence

[0132] Codon-optimized human ASS1 coding sequence

[0133] Codon-optimized human CFTR coding sequence AUGCAACGCUCUCCUCUUGAAAAGGCCUCGGUGGUGUCCAAGCUCUUCUUCUCGUGGACUAGACCCAUCCUGAGAAAGGGGUACAGACAGCGCUUGGAGCUGUCCGAUAUCUAUCAAAUCCCUUCCGUGGACUCCGCGGACAACCUGUCCGAGAAGCUCGAGAGAGAAUGGGACAGAGAACUCGCCUCAAAGAAGAACCCGAAGCUGAUUAAUGCGCUUAGGCGGUGCUUUUUCUGGCGGUUCAUGUUCUACGGCAUCUUCCUCUACCUGGGAGAGGUCACCAAGGCCGUGCAGCCCCUGUUGCUGGGACGGAUUAUUGCCUCCUACGACCCCGACAACAAGGAAGAAAGAAGCAUCGCUAUCUACUUGGGCAUCGGUCUGUGCCUGCUUUUCAUCGUCCGGACCCUCUUGUUGCAUCCUGCUAUUUUCGGCCUGCAUCACAUUGGCAUGCAGAUGAGAAUUGCCAUGUUUUCCCUGAUCUACAAGAAAACUCUGAAGCUCUCGAGCCGCGUGCUUGACAAGAUUUCCAUCGGCCAGCUCGUGUCCCUGCUCUCCAACAAUCUGAACAAGUUCGACGAGGGCCUCGCCCUGGCCCACUUC

[0134] Comparative codon-optimized human CFTR mRNA coding sequence AUGCAGCGGUCCCCGCUCGAAAAGGCCAGUGUCGUGUCCA GCAUGGGCACAAGCAGCUCAUGUGCCUGGCGCGAUCCGUCCUCUAAAGCGAAAAUUCUUCUCUUGGAUGAACCUUCGGCCCAUCUGGACCCGGUAACGUAUCAGAUCAUCAGAAGGACACUUAAGCAGGCGUUUGCCGACUGCACGGUGAUUCUCUGUGCAUCGUAUCGAGGCCAUGCUCGAAUGCCAGCAAUUUCUUGUC AUCGAAGAGAAUAAGGUCCGCCAGUACGACUCCAUCCAGAAGCUGCUUAAUGAGAGAUCAUUGUUCCGGCAGGCGAUUUCACCAUCCGAUAGGGUGAAACUUUUUCCACACAGAAAUUCGUCGAAGUGCAAGUCCAAACCGCAGAUCGCGGCCUUGAAAGAAGAGACUGAAGAAGAAGUUCAAGACACGCGUCUUUAA (SEQ ID NO: 4)

[0135] Codon-optimized human PAH coding sequence

[0136] In some embodiments, mRNA suitable for the present invention may be SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: In some embodiments, an mRNA suitable for the present invention comprises a nucleotide sequence identical to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5.

[0137] mRNA solution Properties of the mRNA solution The mRNA may be provided as a solution and mixed with a suspension of preformed empty LNPs so that the mRNA can be encapsulated in the LNPs. A suitable mRNA solution may be any aqueous solution containing the mRNA to be encapsulated at various concentrations. For example, a suitable mRNA solution may contain mRNA at a concentration of about 0.01 mg / ml, 0.05 mg / ml, 0.06 mg / ml, 0.07 mg / ml, 0.08 mg / ml, 0.09 mg / ml, 0.1 mg / ml, 0.15 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, or greater than 1.0 mg / ml. In some embodiments, a suitable mRNA solution is about 0.01-1.0 mg / ml, 0.01-0.9 mg / ml, 0.01-0.8 mg / ml, 0.01-0.7 mg / ml, 0.01-0.6 mg / ml, 0.01-0.5 mg / ml, 0.01-0.4 mg / ml, 0.01-0.3 mg / ml, 0.01-0.2 mg / ml, 0.01-0.1 mg / ml, 0.05-1.0 mg / ml, 0.05-0.9 mg / ml, 0.0 The mRNA may be contained at a concentration in the range of 5 to 0.8 mg / ml, 0.05 to 0.7 mg / ml, 0.05 to 0.6 mg / ml, 0.05 to 0.5 mg / ml, 0.05 to 0.4 mg / ml, 0.05 to 0.3 mg / ml, 0.05 to 0.2 mg / ml, 0.05 to 0.1 mg / ml, 0.1 to 1.0 mg / ml, 0.2 to 0.9 mg / ml, 0.3 to 0.8 mg / ml, 0.4 to 0.7 mg / ml, or 0.5 to 0.6 mg / ml. In some embodiments, a suitable mRNA solution may contain mRNA at a concentration of up to about 5.0 mg / ml, 4.0 mg / ml, 3.0 mg / ml, 2.0 mg / ml, 1.0 mg / ml, 0.09 mg / ml, 0.08 mg / ml, 0.07 mg / ml, 0.06 mg / ml, or 0.05 mg / ml.

[0138] A suitable mRNA solution may be free of buffers and / or salts, for example, in certain embodiments, the mRNA may be in RNase-free water, such as water for injection.

[0139] In some embodiments, a suitable mRNA solution may include a buffer and / or salt. Common buffers include HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, and sodium phosphate. In some embodiments, a suitable concentration of the buffer may be in the range of about 0.1 mM to 100 mM, 0.5 mM to 90 mM, 1.0 mM to 80 mM, 2 mM to 70 mM, 3 mM to 60 mM, 4 mM to 50 mM, 5 mM to 40 mM, 6 mM to 30 mM, 7 mM to 20 mM, 8 mM to 15 mM, or 9 mM to 12 mM. In some embodiments, a suitable concentration of buffering agent is about 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM or more.

[0140] Exemplary salts may include sodium chloride, magnesium chloride, and potassium chloride. In some embodiments, a suitable concentration of salt in the mRNA solution is about 1 mM to 500 mM, 5 mM to 400 mM, 10 mM to 350 mM, 15 mM to 300 mM, 20 mM to 250 mM, 30 mM to 200 mM, 40 mM to 190 mM, 50 mM to 180 mM, 50 mM to 170 mM, 50 mM to 160 mM, 50 mM to 150 mM, or 50 mM to 100 mM. Suitable salt concentrations in the mRNA solution are greater than or equal to about 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM.

[0141] In some embodiments, a suitable mRNA solution may have a pH in the range of about 3.5 to 6.5, 3.5 to 6.0, 3.5 to 5.5, 3.5 to 5.0, 3.5 to 4.5, 4.0 to 5.5, 4.0 to 5.0, 4.0 to 4.9, 4.0 to 4.8, 4.0 to 4.7, 4.0 to 4.6, or 4.0 to 4.5. In some embodiments, a suitable mRNA solution may have a pH of about 3.5, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.3, and 6.5 or less.

[0142] Preparation of mRNA solution Various methods may be used to prepare an mRNA solution suitable for the present invention. In some embodiments, mRNA may be directly dissolved in the buffer solution described herein. In some embodiments, the mRNA solution may be prepared by mixing an mRNA stock solution with a buffer solution before being mixed with a suspension of preformed empty LNPs and encapsulated. In some embodiments, the mRNA solution may be prepared by mixing an mRNA stock solution with a buffer solution immediately before being mixed with a suspension of preformed empty LNPs and encapsulated. In some embodiments, a suitable mRNA stock solution may contain mRNA in water at a concentration of about 0.2 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.8 mg / mL, 1.0 mg / mL, 1.2 mg / mL, 1.4 mg / mL, 1.5 mg / mL, or 1.6 mg / mL, 2.0 mg / mL, 2.5 mg / mL, 3.0 mg / mL, 3.5 mg / mL, 4.0 mg / mL, 4.5 mg / mL, or 5.0 mg / mL or greater.

[0143] lipid nanoparticles For use in the methods disclosed herein, various processes can be used to prepare preformed empty lipid nanoparticle suspensions or mRNA-encapsulated lipid nanoparticle suspensions.Typically, the first step in preparing such suspensions is to provide a lipid solution.As used herein, a lipid solution contains a mixture of lipids suitable for forming lipid nanoparticles for encapsulating mRNA. lipid solution

[0144] In some embodiments, the suitable lipid solution is ethanol-based. For example, the suitable lipid solution may contain a mixture of desired lipids dissolved in pure ethanol (i.e., 100% ethanol). In another embodiment, the suitable lipid solution is isopropyl alcohol-based. In another embodiment, the suitable lipid solution is dimethyl sulfoxide-based. In another embodiment, the suitable lipid solution is a mixture of suitable solvents, including but not limited to ethanol, isopropyl alcohol, and dimethyl sulfoxide.

[0145] Suitable lipid solutions may contain a mixture of desired lipids at various concentrations, for example, a total concentration of about 0.1 mg / ml, 0.5 mg / ml, 1.0 mg / ml, 2.0 mg / ml, 3.0 mg / ml, 4.0 mg / ml, 5.0 mg / ml, 6.0 mg / ml, 7.0 mg / ml, 8.0 mg / ml, 9.0 mg / ml, 10 mg / ml, 15 mg / ml, 20 mg / ml, 30 mg / ml, 40 mg / ml, 50 mg / ml, or 100 mg / ml or more. In some embodiments, a suitable lipid solution may comprise a lipid concentration of about 0.1-100 mg / mL, 0.5-90 mg / mL, 1.0-80 mg / mL, 1.0-70 mg / mL, 1.0-60 mg / mL, 1.0-50 mg / mL, 1.0-40 mg / mL, 1.0-30 mg / mL, 1.0-20 mg / mL The lipid solution may contain a total concentration of desired lipids ranging from 1.0-15 mg / mL, 1.0-10 mg / mL, 1.0-9.0 mg / mL, 1.0-8.0 mg / mL, 1.0-7.0 mg / mL, 1.0-6.0 mg / mL, or 1.0-5.0 mg / mL. In some embodiments, a suitable lipid solution may contain a mixture of desired lipids at a total concentration of up to about 100 mg / mL, 90 mg / mL, 80 mg / mL, 70 mg / mL, 60 mg / mL, 50 mg / mL, 40 mg / mL, 30 mg / mL, 20 mg / mL, or 10 mg / mL.

[0146] Any desired lipids can be mixed in any ratio suitable for encapsulating mRNA. In some embodiments, a suitable lipid solution contains a mixture of desired lipids, including cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol lipids) and / or PEG-modified lipids. In some embodiments, a suitable lipid solution contains a mixture of desired lipids, including cationic lipids, one or more helper lipids (e.g., non-cationic lipids, and optionally cholesterol-based lipids) and PEG-modified lipids.

[0147] cationic lipids As used herein, the phrase "cationic lipid" refers to any of a number of lipid species that have a net negative charge at a selected pH, such as physiological pH, or under selected conditions, such as the conditions under which the composition is formulated and / or administered. Several cationic lipids have been described in the literature, and many of them are commercially available. Cationic lipids that are particularly suitable for use in the compositions and methods of the present invention include those described in International Patent Publication Nos. WO 2010 / 053572 (particularly the cationic lipids described as amino alcohol lipidoids, particularly C12-200, described in paragraph

[0225] ) and WO 2012 / 170930, both of which are incorporated herein by reference. In certain embodiments, cationic lipids suitable for the compositions and methods of the present invention include, for example, (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine (HGT 5001), and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002), as described in U.S. Provisional Patent Application No. 61 / 617,468, filed March 29, 2012 (corresponding to International Patent Application Publication No. WO2013 / 149140, both of which are incorporated herein by reference).

[0148] In some embodiments, cationic lipids suitable for the compositions and methods of the present invention include cationic lipids such as 3,6-bis(4-(bis((9Z,12Z)-2-hydroxyoctadeca-9,12-dien-1-yl)amino)butyl)piperazine-2,5-dione (OF-02).

[0149] Suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication No. 2010 / 144740, which is incorporated herein by reference.In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure: (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate: [ka] and pharmaceutically acceptable salts thereof.

[0150] Other suitable cationic lipids for use in the compositions and methods of the present invention include the ionizable cationic lipids described in International Patent Publication No. 2013 / 149140, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of one of the following formulas: [ka] or a pharmaceutically acceptable salt thereof, wherein R and R are each independently hydrogen, an optionally substituted variably saturated or unsaturated C-C 20 Alkyl, and optionally substituted variably saturated or unsaturated C-C 20 acyl; L and L are each independently selected from the group consisting of hydrogen, optionally substituted C-C 30 Alkyl, optionally substituted variably unsaturated C-C 30 Alkenyl, and optionally substituted C-C 30alkynyl, m and o are each independently selected from the group consisting of zero and any positive integer (e.g., m is 3), and n is zero or any positive integer (e.g., n is 1). In certain embodiments, the compositions and methods of the present invention provide a cationic lipid (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine ("HGT5000"), having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine ("HGT5001") having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and The method comprises combining a cationic lipid and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (“HGT5002”) having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0151] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described as amino alcohol lipidoids in International Patent Publication No. 2010 / 053572, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0152] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2016 / 118725, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0153] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2016 / 118724, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0154] Other suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids having the formula 14,25-ditridecyl 15,18,21,24-tetraaza-octatriacontane, and pharmaceutically acceptable salts thereof.

[0155] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publications 2013 / 063468 and 2016 / 205691, each of which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein R L each instance of is independently an optionally substituted C6-C 40 In certain embodiments, the compositions and methods of the present invention provide cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and The method includes providing a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0156] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2015 / 184256, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein each X is independently O or S, each Y is independently O or S, each m is independently 0 to 20, each n is independently 1 to 6, and R Aare each independently hydrogen, optionally substituted C alkyl, optionally substituted C alkenyl, optionally substituted C alkynyl, optionally substituted C carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C aryl, optionally substituted 5-14 membered heteroaryl or halogen; R B are each independently hydrogen, optionally substituted C alkyl In certain embodiments, the compositions and methods of the present invention provide a cationic lipid, "Target 23," having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0157] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof.

[0158] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in U.S. Provisional Patent Application No. 62 / 758,179, filed November 9, 2018, and U.S. Provisional Patent Application No. 62 / 871,510, filed July 8, 2019, which are incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein R 1 and R 2 are each independently H or a C1-C6 aliphatic group, each m is independently an integer having a value of 1 to 4, each A is independently a covalent bond or arylene, and L 1 are each independently an ester, thioester, disulfide, or anhydride group; L 2 are each independently, C2-C 10 It is aliphatic and X 1 are each independently H or OH, and R 3 are each independently, C6-C 20 In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] and pharmaceutically acceptable salts thereof.

[0159] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in J. McClellan, MCKing, Cell, 1999, 14, 149-152, which are incorporated herein by reference. 2010, 141, 210-217 and Whitehead et al., Nature Communications (2014) 5:4277. In certain embodiments, the cationic lipid of the compositions and methods of the present invention is a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0160] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2015 / 199952, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0161] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2017 / 004143, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and The method includes providing a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0162] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2017 / 075531, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein L 1 or L 2 One of the groups is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a -, or -NR a C(=O)O-, and L 1 or L 2 The other is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a - or -NR a C(=O)O- or a direct bond, and G 1 and G 2 are each independently unsubstituted C-C 12 Alkylene or C1-C 12 alkenylene, G 3 But C1-C 24 Alkylene, C1-C 24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene, and R a But H or C1-C 12 alkyl, and R 1 and R 2 are each independently, C6-C24 Alkyl or C6-C 24 alkenyl, and R 3 But, H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 , or -NR 5 C(=O)R 4 and R 4 But C1-C 12 alkyl, and R 5 is H or C1-C6 alkyl and x is 0, 1, or 2.

[0163] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2017 / 117528, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0164] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2017 / 049245, which is incorporated herein by reference. In some embodiments, the cationic lipid of the compositions and methods of the invention is a compound of one of the following formulas: [ka] and pharmaceutically acceptable salts thereof. In any one of these four formulas, R4 is independently -(CH2) n Q and -(CH2) n CHQR, where Q is -OR, -OH, -O(CH2) n In certain embodiments, the cationic lipid is selected from the group consisting of N(R), -OC(O)R, -CX, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)R, -N(H)S(O)R, -N(R)C(O)N(R), -N(H)C(O)N(R), -N(H)C(O)N(H)(R), -N(R)C(S)N(R), -N(H)C(S)N(R), -N(H)C(S)N(H)(R), and heterocycle, wherein n is 1, 2, or 3. In certain embodiments, the compositions and methods of the present invention provide cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0165] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publications 2017 / 173054 and 2015 / 095340, each of which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0166] Other suitable cationic lipids for use in the pharmaceutical compositions and methods of the invention include those described in U.S. Provisional Patent Application No. 62 / 865,555, filed June 24, 2019, which is incorporated herein by reference. In some embodiments, the pharmaceutical compositions and methods of the invention comprise a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0167] Other suitable cationic lipids for use in the pharmaceutical compositions and methods of the invention include those described in U.S. Provisional Patent Application No. 62 / 864,818, filed June 21, 2019, which is incorporated herein by reference. In some embodiments, the pharmaceutical compositions and methods of the invention comprise cationic lipids having a compound structure according to the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein R 2 , R 3 and R 4 Each of the C6-C 30 Alkyl, C6-C 30 Alkenyl, or C6-C 30 alkynyl, and L 1 is C1-C 30 Alkylene, C2-C 30 Alkenylene, or C2-C 30 alkynylene, and B 1 is an ionizable nitrogen-containing group. In some embodiments, L 1 is C1-C 10 In some embodiments, L 1 is unsubstituted C1-C 10 In some embodiments, L 1 is (CH2)2, (CH2)3, (CH2)4, or (CH2)5. In some embodiments, L 1 is (CH2), (CH2)6, (CH2)7, (CH2)8, (CH2)9, or (CH2) 10 In some embodiments, B 1 is independently NH, guanidine, amidine, mono- or dialkylamine, 5- to 6-membered nitrogen-containing heterocycloalkyl, or 5- to 6-membered nitrogen-containing heteroaryl. 1 teeth, [ka] In some embodiments, B 1 teeth, [ka] In some embodiments, B 1 teeth, [ka] In some embodiments, R 2 , R 3 , and R 4 are each independently an unsubstituted linear C6-C 22 Alkyl, unsubstituted linear C6-C 22 alkenyl, unsubstituted linear C6-C 22 Alkynyl, unsubstituted branched C6-C 22 Alkyl, unsubstituted branched C6-C 22 Alkenyl or unsubstituted branched C6-C 22 In some embodiments, R is alkynyl. 2 , R 3 , and R 4 are unsubstituted C6-C 22 In some embodiments, R 2 , R 3 , and R 4 is -CH 13 , -CH 15 , -CH 17 , -CH 19 , -C 10 H 21 , -C 11 H 23 , -C 12 H 25 , -C 13 H 27 , -C 14 H 29 , -C 15 H 31 , -C 16 H 33 , -C 17 H 35 , -C 18 H 37 , -C 19 H 39 , -C 20 H 41 , -C 21 H 43 , -C 22 H45 , -C 23 H 47 , -C 24 H 49 , or -C 25 H 51 In some embodiments, R 2 , R 3 , and R 4 are each independently -O(CO)R 5 or -C(O)OR 5 C6-C substituted by 12 alkyl, where R 5 is unsubstituted C6-C 14 In some embodiments, R 2 , R 3 , and R 4 are unsubstituted C6-C 22 In some embodiments, R is alkenyl. 2 , R 3 , and R 4 are respectively -(CH2)4CH=CH2, -(CH2)5CH=CH2, -(CH2)6CH=CH2, -(CH2)7CH=CH2, -(CH2)8CH=CH2, -(CH2)9CH=CH2, -(CH2) 10 CH=CH2, -(CH2) 11 CH=CH2, -(CH2) 12 CH=CH2, -(CH2) 13 CH=CH2, -(CH2) 14 CH=CH2, -(CH2) 15 CH=CH2, -(CH2) 16 CH=CH2, -(CH2) 17 CH=CH2, -(CH2) 18 CH=CH2, -(CH2)7CH=CH(CH2)3CH3, -(CH2)7CH=CH(CH2)5CH3, -(CH2)4CH=CH(CH2)8CH3, -(CH2)7CH=CH(CH2)7CH3, -(CH2)6CH=CHCH2CH=CH(CH 2)4CH3, -(CH2)7CH=CHCH2CH=CH(CH2)4CH3, -(CH2)7CH=CHCH2CH=CHCH2CH=CHCH2CH3, -(CH2)3CH=CHCH2CH=CHCH2CH=CHCH2CH=CH(CH2)4CH3, -(CH2)3CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH3, -(CH2) 11 CH=CH(CH2)7CH3, or -(CH2)2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH3. In some embodiments, the C6-C 22 The alkenyl is monoalkenyl, dienyl, or trienyl. In embodiments, R 2 , R 3 , and R 4 are respectively as follows: [ka] In some embodiments, the pharmaceutical compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the pharmaceutical compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the pharmaceutical compositions of the present invention and the method comprises a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the pharmaceutical compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0168] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cleavable cationic lipids described in International Patent Publication No. 2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] and pharmaceutically acceptable salts thereof, wherein R1 is selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; and R2 is selected from the group consisting of one of the following two formulas: [ka] and pharmaceutically acceptable salts thereof, wherein R and R are each independently an optionally substituted variable saturated or unsaturated C-C 20 Alkyl and optionally substituted variably saturated or unsaturated C6-C 20 acyl, and n is 0 or any In certain embodiments, the compositions and methods of the present invention provide a cationic lipid "HGT4001" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4002" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4003" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4004" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4005" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0169] Other suitable cationic lipids for use in the compositions and methods of the invention include the cleavable cationic lipids described in International Patent Application Publication No. WO 2019 / 222424, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the invention comprise a cationic lipid having any of the general formulas or structures (1a)-(21a) and (1b)-(21b) and (22)-(237) described in International Patent Application Publication No. WO 2019 / 222424. In certain embodiments, the compositions and methods of the invention comprise a cationic lipid having a structure according to formula (I'): [ka] and pharmaceutically acceptable salts thereof, wherein: R X are independent, -H, -L 1 -R 1 , or -L 5A -L 5B -B', L 1 , L 2 , and L 3 each independently represents a covalent bond, —C(O)—, —C(O)O—, —C(O)S—, or —C(O)NR L - and L4A and L 5A are each independently —C(O)—, —C(O)O—, or —C(O)NR L - and L 4B and L 5B are each independently, C1-C 20 Alkylene, C2-C 20 Alkenylene, or C2-C 20 is alkynylene, B and B' are each NR 4 R 5 or a 5- to 10-membered nitrogen-containing heteroaryl; R 1 , R 2 , and R 3 are each independently, C6-C 30 Alkyl, C6-C 30 Alkenyl, or C6-C 30 is alkynyl, R 4 and R 5 are each independently hydrogen, C1-C 10 Alkyl, C2-C 10 Alkenyl, or C2-C 10 is alkynyl, R L are each independently hydrogen, C1-C 20 Alkyl, C2-C 20 Alkenyl, or C2-C 20 Includes cationic lipids that are alkynyl. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid, which is compound (139) of patent application WO2019 / 222424, having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0170] In some embodiments, the pharmaceutical compositions and methods of the present invention comprise a cationic lipid that is TBL-0070 (RL3-DMA-07D), having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.

[0171] In some embodiments, cationic lipids suitable for the compositions and methods of the present invention include those described in WO 2015 / 184256 A2 entitled "Biodegradable lipids for delivery of nucleic acids," which is incorporated herein by reference, such as 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24).

[0172] In some embodiments, cationic lipids suitable for the compositions and methods of the present invention include those described in WO 2013 / 063468 and U.S. Provisional Application No. WO 2015 / 061467 entitled "Lipid Formulations for Delivery of Messenger RNA," which are incorporated herein by reference. In some embodiments, the cationic lipid is a compound of formula I-c1-a: [ka] or a pharmaceutically acceptable salt thereof, wherein: Each R 2 are independently hydrogen or C 1-3 is alkyl, each q is independently 2 to 6; Each R' is independently hydrogen or C 1-3 is alkyl, Each R L independently, C 8-12 It is alkyl.

[0173] In some embodiments, each R 2 is independently hydrogen, methyl, or ethyl. In some embodiments, each R 2 is independently hydrogen or methyl. In some embodiments, each R 2 is hydrogen.

[0174] In some embodiments, each q is independently 3 to 6. In some embodiments, each q is independently 3 to 5. In some embodiments, each q is 4.

[0175] In some embodiments, each R' is independently hydrogen, methyl, or ethyl. In some embodiments, each R' is independently hydrogen or methyl. In some embodiments, each R' is independently hydrogen.

[0176] In some embodiments, each R L independently, C 8-12 In some embodiments, each R L are independently 8-12 In some embodiments, each R L independently, C 9-11 In some embodiments, each R L are independently 9-11 In some embodiments, each R L independently, C 10 In some embodiments, each R L are independently 10 It is alkyl.

[0177] In some embodiments, each R 2 is independently hydrogen or methyl, each q is independently 3 to 5, each R' is independently hydrogen or methyl, and each R L is independently C 8-12 It is alkyl.

[0178] In some embodiments, each R 2 is hydrogen, each q is independently 3 to 5, each R' is hydrogen, and each R L is independently C 8-12 It is alkyl.

[0179] In some embodiments, each R 2 is hydrogen, each q is 4, each R' is hydrogen, and each R L is independently C 8-12 It is alkyl.

[0180] In some embodiments, the cationic lipid is a compound of formula Ig: [ka] or a pharmaceutically acceptable salt thereof, wherein each R L is independently C 8-12 In some embodiments, each R L are independently 8-12 In some embodiments, each R L independently, C 9-11 In some embodiments, each R L are independently 9-11 In some embodiments, each R L independently, C 10 In some embodiments, each R L is nC 10 It is alkyl.

[0181] In certain embodiments, a suitable cationic lipid is cKK-E12 or (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione), and pharmaceutically acceptable salts thereof. The structure of cKK-E12 is shown below. [ka]

[0182] Further exemplary cationic lipids are cationic lipids of Formula I: [ka] (See, for example, Fenton, Owen S., et al. “Bioinspired Alkenyl Amino Alcohol Ionizable Lipid Materials for Highly Potent In Vivo mRNA Delivery.” Advanced materials (2016)).

[0183] In some embodiments, one or more cationic lipids suitable for the present invention may be N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride, or "DOTMA" (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355, which are incorporated herein by reference). Other suitable cationic lipids include, for example, 5-carboxyspermylglycinedioctadecylamide, or "DOGS," 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium, or "DOSPA" (Behr et al. Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355, which are incorporated herein by reference). Acad. Sci. 86, 6982 (1989), U.S. Pat. No. 5,171,678, U.S. Pat. No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane or "DODAP", and 1,2-dioleoyl-3-trimethylammonium-propane or "DOTAP".

[0184] Additional exemplary cationic lipids include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA," 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA," 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA," 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane or "DLenDMA," N-dioleyl-N,N-dimethylammonium chloride, and 1,2-dioleyloxy-N,N-dimethylammonium chloride. Lid or "DODAC", N,N-distearyl-N,N-dimethylammonium bromide or "DDAB", N-(l,2-dimyrityloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide or "DMRIE", 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutan-4-oxy)-l-(cis,cis-9,12-octadecadienooxy)propane or "CLinDMA", 2-[5'-(cholest-5- N,N-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl ll-(cis,cis-9',l-2'-octadecadienooxy)propane or "CpLinDMA", N,N-dimethyl-3,4-dioleyloxybenzylamine or "DMOBA", 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane or "DOcarbDAP", 2,3-dilinoleoyloxy-N,N-dimethylpropylamine or "DLinDAP", l,2-N,N' -Dilinoleylcarbamyl-3-dimethylaminopropane or "DLincarbDAP", l,2-Dilinoleylcarbamyl-3-dimethylaminopropane or "DLinCDAP", 2,2-Dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane or ("DLin-K-DMA"), 2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]octyl)oxy] ... 2-((8-[(3beta)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA"), (2R)-2-((8-[(3beta)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA(2R)"), (2S)-2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N, fsl-dimethyl-3-[(9Z,12Z)-octadeca Also included are deca-9,12-dien-1-yloxy]propan-1-amine (“Octyl-CLinDMA(2S)”), 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or “DLin-K-XTC2-DMA,” and 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine (“DLin-KC2-DMA”) (see International Publication No. WO 2010 / 042877, Semple et al., Nature Biotech. 28:172-176 (2010)), which are incorporated herein by reference), or mixtures thereof.(Heyes, J., et al., J Controlled Release 107:276-287(2005); Morrissey, DV., et al. al., Nat. Biotechnol. 23(8):1003-1007 (2005); International Patent Application Publication No. WO 2005 / 121348). In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole moiety, a dialkylamino moiety, or a guanidinium moiety.

[0185] In some embodiments, the one or more cationic lipids are selected from the group consisting of XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadecyl) ... (N-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine), NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammonium propane), HGT4003 (WO2012 / 170889, the teachings of which are incorporated herein by reference in their entirety), ICE (WO2011 / 068810, the teachings of which are incorporated herein by reference in their entirety), HGT5000 (U.S. Provisional Patent Application No. 61 / 617,468 and International Patent Application Publication No. WO2013 / 149140, the teachings of which are incorporated herein by reference in their entirety), or HGT5001 (cis or trans) (Provisional Patent Application No. 61 and WO 2013 / 149140, amino alcohol lipidoids such as those disclosed in WO 2010 / 053572, DOTAP (1,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; Mac Lachlan, I. “Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids” J. Contr. Rel. 2005, 107, 276-287), DLin-KC2-DMA (Semple, SC et al. “Rational Design of Cationic Lipids for siRNA Delivery” Nature Biotech. 2010, 28, 172-176), C12-200 (Love, KT et al. “Lipid-like materials for low-dose in vivo gene silencing” PNAS 2010, 107, 1864-1869), N1GL, N2GL, V1GL, and combinations thereof.

[0186] In some embodiments, one or more cationic lipids are amino lipids. Amino lipids suitable for use in the present invention include those described in WO2017180917, which is incorporated herein by reference. Exemplary amino lipids in WO2017180917 include those described in paragraph

[0744] , such as DLin-MC3-DMA (MC3), (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine (L608), and compound 18. Other amino lipids include compound 2, compound 23, compound 27, compound 10, and compound 20. Additional amino lipids suitable for use in the present invention include those described in WO2017112865, which is incorporated herein by reference. Exemplary amino lipids in WO2017112865 include compounds according to one of formulas (I), (Ial)-(Ia6), (1b), (II), (Ila), (III), (Ilia), (IV), (17-1), (19-1), (19-11), and (20-1), and the compounds in paragraphs

[0185] ,

[0201] , and

[0276] . In some embodiments, cationic lipids suitable for use in the present invention include those described in WO2016118725, which is incorporated herein by reference. Exemplary cationic lipids in WO2016118725 include those such as KL22 and KL25. In some embodiments, cationic lipids suitable for use in the present invention include those described in WO2016118724, which is incorporated herein by reference. Exemplary cationic lipids in WO2016118725 include those such as KL10, 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), and KL25.

[0187] In some embodiments, the cationic lipids comprise at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipids in a suitable lipid solution by weight or molar. In some embodiments, the cationic lipids comprise about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid mixture by weight or molar.

[0188] Non-cationic lipids / helper lipids As used herein, the phrase "non-cationic lipid" refers to any lipid that is neutral, zwitterionic, or anionic at a selected pH, e.g., physiological pH, or under selected conditions, e.g., the conditions under which a composition is formulated and / or administered. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that carry a net negative charge at a selected pH, e.g., physiological pH. Non-cationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylcholine (PPC ... Examples of suitable lipid solutions include phosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 1,2-dierucoyl-sn-glycero-3-phosphoethanolamine (DEPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl phosphatidiethanolamine (SOPE), or mixtures thereof. In some embodiments, suitable lipid solutions include DOPE as a non-cationic lipid component. In other embodiments, suitable lipid solutions include DEPE as a non-cationic lipid component. In some embodiments, the non-cationic lipids may comprise at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% by weight or molar of the total lipids in a suitable lipid solution. In some embodiments, the total non-cationic lipids comprise about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipids in a suitable lipid solution.

[0189] Cholesterol-based lipids Suitable lipid solution typically comprises at least one cholesterol-based lipid.For example, suitable cholesterol-based cationic lipid comprises DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao et al. Biochem.Biophys.Res.Comm.179,280(1991); Wolf et al. BioTechniques 23,139(1997); U.S. Patent No. 5,744,335), or the imidazole cholesterol ester (ICE) disclosed in International Patent Application Publication WO2011 / 068810, having the following structure: [ka]

[0190] In some embodiments, the cholesterol-based lipid is cholesterol. In other embodiments, the cholesterol-based lipid is ICE. In certain embodiments, ICE is both the cholesterol-based lipid component and the cationic lipid component of the lipid nanoparticles disclosed herein. In some embodiments, the cholesterol-based lipids comprise at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% by weight or molar of the total lipids in a suitable lipid solution, hi some embodiments, the cholesterol-based lipids comprise about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) by weight or molar of the total lipids in a suitable lipid solution.

[0191] PEG modified lipid The presence of PEG-modified lipids in lipid nanoparticles can prevent aggregation of the complex and can increase circulation lifetime, providing a means for increasing delivery of lipid-nucleic acid compositions to target tissues (Klibanov et al. (1990) FEBS Letters, 268(1):235-237). Alternatively, these components can be selected to rapidly exchange out of the formulation in vivo (see U.S. Pat. No. 5,885,613).

[0192] For example, the use of polyethylene glycol (PEG)-modified phospholipids and derivatized lipids such as derivatized ceramides (PEG-CER) including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide) are also contemplated by the present invention. Contemplated PEG-modified lipids include C6-C 20 Examples of exchangeable lipids include, but are not limited to, polyethylene glycol chains of up to 2 kDa, up to 3 kDa, up to 4 kDa, or up to 5 kDa in chain length covalently attached to lipids having alkyl chains of up to 2 kDa, up to 3 kDa, up to 4 kDa, or up to 5 kDa in chain length. In some embodiments, the PEG-modified or PEG-modified lipid is PEG-modified cholesterol or PEG-2K. In some embodiments, particularly useful exchangeable lipids have shorter acyl chains (e.g., C 14 or C 18 ) is a PEG-ceramide.

[0193] PEG-modified phospholipids and derivatized lipids may constitute at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% by weight or molar of the total lipids in a suitable lipid solution. In some embodiments, the PEG-modified lipids constitute about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipids in a suitable lipid solution by weight or molar.

[0194] Lipid solutions suitable for use in the present invention typically contain a PEG-modified lipid, such as, for example, 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2K).

[0195] Exemplary Lipid Formulations Various combinations of lipids, i.e., cationic lipids, non-cationic lipids, PEG-modified lipids, and optionally cholesterol, that can be used to prepare preformed lipid nanoparticles are described in the literature and herein. A preferred lipid solution comprises cDD-TE-4-E12, DOPE, and DMG-PEG2K. Another preferred lipid solution comprises cDD-TE-4-E12, DOPE, cholesterol, and DMG-PEG2K. Another preferred lipid solution comprises cDD-TE-4-E12, DEPE, and DMG-PEG2K. Another preferred lipid solution comprises cDD-TE-4-E12, DEPE, cholesterol, and DMG-PEG2K. Another preferred lipid solution comprises cDD-TE-4-E10, DOPE, and DMG-PEG2K. Another preferred lipid solution comprises cDD-TE-4-E10, DOPE, and DMG-PEG2K. Another preferred lipid solution comprises cDD-TE-4-E10, DEPE, and DMG-PEG2K.Another preferred lipid solution comprises cDD-TE-4-E10, DEPE, cholesterol, and DMG-PEG2K.

[0196] However, other lipid formulations are contemplated, for example, suitable lipid solutions include cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT5000, DOPE, cholesterol, and DMG-PEG2K; HGT5001, DOPE, cholesterol, and DMG-PEG2K; cKK-E12, DPPC, cholesterol, and DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000, DPPC, cholesterol, and DMG-PEG2K; HGT5001, DPPC, cholesterol and DMG-PEG2K; or ICE, DOPE, and DMG-PEG2K. Additional lipid combinations are described in the art, for example, in U.S. Patent Application No. 62 / 420,421 (filed November 10, 2016, corresponding international publication number WO2018 / 089790), U.S. Patent Application No. 62 / 421,021 (filed November 11, 2016, corresponding international publication number WO2018 / 089790), U.S. Patent Application No. 62 / 464,327 (filed February 27, 2017, corresponding international publication number WO2018 / 089790), and the PCT application entitled "Novel ICE-based Lipid Nanoparticle Formulation for Delivery of mRNA" filed November 10, 2017, the disclosures of which are incorporated herein by reference in their entirety.

[0197] The selection of cationic lipid, non-cationic lipid and PEG-modified lipid comprising lipid mixture, and the relative molar ratio of these lipids to each other are based on the characteristics of selected lipid and the nature and characteristics of the mRNA to be encapsulated.Additional considerations include, for example, the saturation degree of the alkyl chain of selected lipid, as well as size, charge, pH, pKa, fusogenicity and toxicity.Therefore, molar ratio can be adjusted accordingly.

[0198] mRNA encapsulation As used herein, "Process A" refers to the conventional method of encapsulating mRNA by mixing an mRNA solution with a lipid solution, in which the mRNA solution and / or the lipid solution are heated to a temperature above ambient temperature before mixing, without first preforming the lipids into lipid nanoparticles (described in U.S. Patent Application No. 14 / 790,562, filed July 2, 2015, entitled "Encapsulation of messenger RNA," and its U.S. Provisional Patent Application No. 62 / 020,163, filed July 2, 2014, and International Patent Applications WO2016 / 004318 and US 2016 / 0038432).

[0199] As used herein, the "remix process" (or "process B") refers to another conventional method of encapsulating mRNA by mixing a suspension of preformed lipid nanoparticles with an mRNA solution, as described in US 2018 / 0153822.

[0200] The present invention relates to a novel method for formulating mRNA-containing lipid nanoparticles. In the "remix process," the process involves combining preformed empty lipid nanoparticles with mRNA. The inventors surprisingly found that by changing the N / P ratio during the combination of preformed empty lipid nanoparticles with mRNA, the potency and efficacy of the resulting mRNA-encapsulated lipid nanoparticles can be improved.

[0201] Empty lipid nanoparticles are formed by mixing a lipid solution containing dissolved lipids with an aqueous solution or buffer solution.Then, the resulting suspension of pre-formed empty lipid nanoparticles is added to an mRNA solution to encapsulate mRNA.In some embodiments, empty lipid nanoparticles are formed by mixing a lipid solution containing dissolved lipids in a solvent with an aqueous solution.In some embodiments, the solvent can be ethanol.In some embodiments, the aqueous solution can be citrate buffer solution.

[0202] In some embodiments, ethanol, citrate buffer, and other destabilizing agents are not present during the addition of mRNA, so the formulation does not require any further downstream processing. In certain embodiments, after the formation of the preformed empty lipid nanoparticles, the buffer is exchanged with a suitable storage buffer. In some embodiments, the storage buffer comprises or consists of an aqueous solution containing about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% disaccharide (w / v). Suitable disaccharides include: , sucrose, and trehalose. In some embodiments, adding mRNA to empty lipid nanoparticles in a storage buffer results in a final formulation that does not require downstream purification or processing and can be stably stored in frozen form. In a typical embodiment, the storage buffer comprises or consists of an aqueous solution containing about 10% trehalose.

[0203] Heating during sealing As used herein, the term "ambient temperature" means room temperature or the temperature surrounding the object of interest (e.g., a preformed empty lipid nanoparticle suspension, an mRNA solution, or an mRNA-containing lipid nanoparticle suspension) without heating or cooling.

[0204] In some embodiments, the solution containing mRNA is at ambient temperature prior to any mixing step. In some embodiments, the ambient temperature is about 35°C, 30°C, 25°C, 20°C, or 16°C, or lower. In some embodiments, the ambient temperature is in the range of about 15-35°C, about 15-30°C, about 15-25°C, about 15-20°C, about 20-35°C, about 25-35°C, about 30-35°C, about 20-30°C, about 25-30°C, or about 20-25°C. In some embodiments, the ambient temperature is 20-25°C. In some embodiments, the ambient temperature is in the range of about 19°C to 23°C, e.g., 20°C to 22°C, e.g., about 21°C.

[0205] In certain embodiments, the suspension containing empty LNPs is at a temperature higher than ambient temperature before being combined with the mRNA solution. In some embodiments, the mixture of the mRNA solution and the suspension containing empty LNPs is heated to a temperature higher than ambient temperature. The temperature higher than ambient temperature is typically greater than about 25°C. In some embodiments, the temperature higher than ambient temperature is greater than about 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C. In some embodiments, the temperature higher than ambient temperature is in the range of about 25-70°C, about 30-70°C, about 35-70°C, about 40-70°C, about 45-70°C, about 50-70°C, or about 60-70°C. In certain embodiments, the temperature higher than ambient temperature is about 60-70°C. In certain embodiments, the temperature higher than ambient temperature is about 65°C.

[0206] In typical embodiments, the total heating time is limited to 20 minutes or less (e.g., 16 minutes, 15 minutes, 14 minutes or less), and in some embodiments, the total heating time is between 10 and 20 minutes, e.g., about 15 minutes.

[0207] In some embodiments, heating of one or more of the suspension containing preformed lipid nanoparticles, the solution containing mRNA, and the combination of the suspension and solution does not occur before or after the formulation process.

[0208] Adding and Mixing Volumes In one aspect, the present invention relates to a method for encapsulating mRNA in preformed empty lipid nanoparticles (LNPs). The method includes combining a solution containing mRNA with a suspension containing preformed empty LNPs to form a mixture (also referred to herein as a "mixture") containing LNPs encapsulating mRNA. In a subsequent step, one or more additional volumes of the solution containing mRNA or the preformed empty LNPs are added to the mixture obtained in the previous step until a desired molar ratio of cationic lipid to mRNA is reached. In some embodiments, the subsequent step of adding one or more additional volumes of the solution containing mRNA or the preformed empty LNPs includes or consists of a mixing period. The one or more additional volumes may be added continuously or in stages. In some embodiments, the number of additional volumes is 3, 4, or 5. In certain embodiments, the number of additional volumes is 3.

[0209] A mixing period may be performed after adding any one of the one or more additional volumes or after adding each of the one or more additional volumes. The first volume and the one or more additional volumes may be the same as, greater than, or less than each preceding volume. Typically, the first volume and the one or more additional volumes are the same. The duration of each mixing period may be the same as, greater than, or shorter than each preceding period. Typically, each mixing time is the same.

[0210] The mixing period need not exceed 5 minutes. For example, a period of 1 to 5 minutes may be sufficient to achieve high encapsulation efficiency. In some embodiments, the mixing period (e.g., 1 minute) is followed by an incubation period (e.g., 4 minutes). During the incubation period, the mixture is stored, for example, at an intermediate storage level. If the preformed LNP suspension, the mixture, or both, are heated during the encapsulation process, minimizing the mixing period and / or the subsequent incubation period also minimizes heat exposure of the encapsulated mRNA, which may be beneficial in avoiding or reducing degradation of mRNA (e.g., large mRNAs, such as mRNAs of 4 kb or more, e.g., mRNAs of 5 kb or more).

[0211] In some embodiments, encapsulation of mRNA into preformed empty LNPs may be performed by pumping a first liquid containing mRNA and a second liquid containing preformed empty LNPs into a mixing junction where the first and second liquids are mixed. Typically, the mRNA is encapsulated into the LNPs when mixed at the mixing junction. Encapsulation efficiency may be increased by incubating the mixture for a period of time after mixing. This can be done in an intermediate storage container, as described in detail below.

[0212] In some embodiments, the mRNA solution and the preformed empty LNP suspension may be mixed using one or more pumps. Because the encapsulation procedure can occur over a wide range of scales, different types of pumps may be used to accommodate the desired scale. Typically, a pulseless flow pump is desirable. As used herein, a pulseless flow pump refers to any pump that can establish a continuous flow with a stable flow rate. Suitable pump types include, but are not limited to, gear pumps, positive displacement pumps, and centrifugal pumps. Exemplary gear pumps include, but are not limited to, Cole-Parmer or Diener gear pumps. Exemplary centrifugal pumps include, but are not limited to, those manufactured by Grainger or Cole-Parmer.

[0213] Table 1 (below) illustrates a method for encapsulating mRNA into preformed empty LNPs according to an embodiment of the present invention. The flow rate, X, may be measured (or expressed) in mL / min. In a first step, a first liquid containing preformed empty LNPs may be pumped into the mixing junction at a flow rate of 4X, and a portion of a second liquid containing mRNA may be pumped into the mixing junction at a flow rate of X. In a second step, the mixture produced in step 1 may be pumped into the mixing junction at a flow rate of 5X, and an additional portion of the second liquid containing mRNA may be pumped into the mixing junction at a flow rate of X. In a third step, the mixture produced in step 2 may be pumped into the mixing junction at a flow rate of 6X, and an additional portion of the second liquid containing mRNA may be pumped into the mixing junction at a flow rate of X. In a fourth step, the mixture produced in step 3 may be pumped into the mixing junction at a flow rate of 7X, and an additional portion of the second liquid containing mRNA may be pumped into the mixing junction at a flow rate of X. In some embodiments, each portion of the second liquid is approximately the same volume.

[0214] After each step, the N / P ratio, or the ratio of cationic fragments in the LNP to the mRNA encapsulated in the LNP, was measured. The molar ratio of cationic lipids is shown in the right-most column of Table 1. In some embodiments, Y may be a molar ratio of about 4 (cationic lipid):1 (mRNA). As can be seen in Table 1, the N / P ratio of the resulting liquid decreases after each step. Hence, the method is referred to herein as the "step-down process" or "step-down remix" process. [Table 1]

[0215] Table 2 (below) illustrates a method for encapsulating mRNA into preformed empty LNPs according to an embodiment of the present invention. X may be measured (or expressed) in mL / min. In a first step, a portion of a first liquid containing preformed empty LNPs may be pumped into the mixing junction at a flow rate of X, and a second liquid containing mRNA may be pumped into the mixing junction at a flow rate of 4X. In a second step, the mixture produced in step 1 may be pumped into the mixing junction at a flow rate of 5X, and an additional portion of the first liquid containing preformed empty LNPs may be pumped into the mixing junction at a flow rate of X. In a third step, the mixture produced in step 2 may be pumped into the mixing junction at a flow rate of 6X, and an additional portion of the first liquid containing preformed empty LNPs may be pumped into the mixing junction at a flow rate of X. In a fourth step, the mixture produced in step 3 may be pumped into the mixing junction at a flow rate of 7X, and an additional portion of the first liquid containing preformed empty LNPs may be pumped into the mixing junction at a flow rate of X. In some embodiments, each portion of the first liquid is approximately the same volume.

[0216] The N / P ratio, or the molar ratio of cationic lipid in the LNP to mRNA encapsulated within the LNP, after each step is shown in the right-most column of Table 2. In some embodiments, Y may be a molar ratio of about 4 (cationic lipid):1 (mRNA). As seen in Table 2, the N / P ratio of the resulting liquid increases after each step. Hence, the method is referred to herein as the "step-up process" or "step-up remix" process. [Table 2]

[0217] The mRNA solution may be pumped at a flow rate of 20 mL / min to 20 L / min. The preformed empty LNP suspension may be pumped at a flow rate of 20 mL / min to 20 L / min. In commercial-scale embodiments of the invention, the mRNA solution and preformed empty LNP suspension may be pumped at a flow rate of 1 L / min to 20 L / min, e.g., 5 L / min to 15 L / min, e.g., 10 L / min. In laboratory-scale embodiments of the invention, the mRNA solution and preformed empty LNP suspension may be pumped at a flow rate of 20 mL / min to 1 L / min, e.g., 50 mL / min to 500 mL / min, e.g., 250 mL / min.

[0218] In some embodiments, the mixing period may last from 1 minute to 5 minutes. In some embodiments, there are 2 to 4 mixing periods. Thus, the total time for pumping the mRNA solution and / or the preformed empty LNP suspension may be from 2 to 20 minutes. Thus, in some embodiments, the initial total volume of the mRNA solution may be from 40 mL to 100 L, and the initial total volume of the preformed empty LNP suspension may be from 40 mL to 100 L. The total volume of the mixed solution may be from 80 mL to 200 L.

[0219] In commercial-scale embodiments of the invention, the initial total volume of the mRNA solution may be 5 L to 100 L, the initial total volume of the suspension of preformed empty LNPs may be 5 L to 100 L, and the total volume of the mixture may be 10 L to 200 L. In laboratory-scale embodiments of the invention, the initial total volume of the mRNA solution may be 100 mL to 5 L, the initial total volume of the suspension of preformed empty LNPs may be 100 mL to 5 L, and the total volume of the mixture may be 200 mL to 10 L.

[0220] Equipment used for encapsulation Described below are devices configured to perform the methods described herein. In some embodiments, the device can be configured to perform either a step-down remix method or a step-up remix method, and the components of the device may be configured to perform the step-up remix method but not the step-down remix method at some times, and to perform the step-down remix method but not the step-up remix method at other times. In some embodiments, the device is configured to selectively perform either the step-up remix method or the step-down remix method. In some embodiments, the device is configured to perform either the step-up remix method or the step-down remix method.

[0221] The devices described herein are exemplary and therefore should not be construed as limiting the scope of the claims. It will be apparent to those skilled in the art that certain modifications, substitutions, and additions can be made to the devices described herein without departing from the scope and spirit of the invention.

[0222] 11 shows an apparatus configured for use in the mRNA encapsulation process described herein. A first liquid containing mRNA may be stored in a first storage container 101, and a second liquid containing preformed empty LNPs may be stored in a second storage container 102. The first liquid may be pumped into a mixing junction 105 by a first pump 103, and the second liquid may be pumped into the mixing junction 105 by a second pump 104. The conduit through which the first liquid is transported from the first storage container 101 to the mixing junction 105 may be referred to as the LNP conduit arrangement. The conduit through which the second liquid is transported from the second storage container 102 to the mixing junction 105 may be referred to as the mRNA conduit arrangement. During operation of the apparatus, the mixing junction 105 may produce a mixed liquid when the first and second liquids are simultaneously pumped into the mixing junction. The recycle loop 120 can be configured to direct the mixed liquid to a position in the LNP conduit arrangement upstream of the first pump 103 when the device is operating, or can be configured to direct the mixed liquid to a position in the mRNA conduit arrangement upstream of the second pump.

[0223] 12A shows an apparatus configured for use in the mRNA encapsulation process described herein. The apparatus may operate in substantially the same manner as the apparatus shown in FIG. 11. When the apparatus is running, recycle loop 260 is configured to direct the mixed solution from mixing junction 205 to a position in the LNP conduit upstream of first pump 203. When recycle loop 260 is configured to direct the mixed solution from mixing junction 205 to a position in the LNP conduit upstream of first pump 203, the apparatus may be said to operate in a step-down remix mode of operation. When the apparatus is configured to operate in the step-down remix mode of operation, the molar ratio of cationic lipid to mRNA in the mixed solution decreases each time the mixed solution passes through mixing junction 205.

[0224] 12B shows an apparatus configured for use in the mRNA encapsulation process described herein. The apparatus may operate in substantially the same manner as the apparatus shown in FIG. 11. When the apparatus is running, the recycle loop 260 is configured to direct the mixed solution from the mixing junction 205 to a position in the mRNA conduit upstream of the second pump 204. When the recycle loop 260 is configured to direct the mixed solution from the mixing junction 205 to a position in the LNP conduit upstream of the second pump 204, the apparatus may be said to operate in a step-up remix mode of operation. When the apparatus is configured to operate in the step-up remix mode of operation, the molar ratio of cationic lipid to mRNA in the mixed solution increases each time the mixed solution passes through the mixing junction 205.

[0225] Figure 13 shows an apparatus configured for use in the mRNA encapsulation process described herein. The apparatus may operate in substantially the same manner as the apparatus shown in Figure 11, but may incorporate an intermediate storage container 308. When the apparatus is in operation, the mixed liquid may be directed from mixing junction 305 to intermediate storage container 308, where the mixed liquid is stored, and then directed to recycle loop 320. The mixed liquid stored in intermediate storage container 308 may be pumped into the recycle loop by a pump (not shown), or by a first or second pump when recycle loop 320 is configured in a step-down remix or step-up remix mode of operation, respectively.

[0226] Figure 14 shows an apparatus configured for use in the mRNA encapsulation process described herein. The apparatus may operate in substantially the same manner as the apparatus shown in Figure 11, but may incorporate a first heat exchanger 409. When the apparatus is in operation, the mixed liquid is passed through mixing junction 408. The mixed liquor may be directed from the mixed liquor feed stream 405 to a first heat exchanger 409 where it is heated before being directed to the recycle loop 420. The heat exchanger may be configured to heat the mixed liquor to a desired temperature before being directed to the recycle loop 420.

[0227] Figure 15 shows an apparatus configured for use in the mRNA encapsulation process described herein. The apparatus may operate in substantially the same manner as the apparatus shown in Figure 14, but may incorporate an intermediate storage vessel 508. When the apparatus is in operation, the mixed liquid may be directed from the mixing junction 505 to a first heat exchanger 509, and from the first heat exchanger 509 to the intermediate storage vessel 508. The intermediate storage vessel 508 may operate in substantially the same manner as the intermediate storage vessel described in connection with Figure 13. Optionally, the mixed liquid may be directed from the mixing junction 505 to the intermediate storage vessel 508, and then directed to the first heat exchanger 509.

[0228] Figure 16 illustrates an apparatus configured for use in the mRNA encapsulation process described herein. The apparatus may operate in substantially the same manner as the apparatus shown in Figure 11, but may incorporate a final storage container 610. When the apparatus is in operation, the mixed liquid may be directed from a mixing junction 605 to the final storage container 610. The apparatus may be configured such that the mixed liquid passes through a recycle loop 620 a desired number of times before the mixed liquid is directed from the mixing junction 605 to the final storage container 610. In certain embodiments, the mixed liquid is directed through the recycle loop 620 a total of three times before the mixed liquid is directed to the final storage container 610.

[0229] Figure 17 shows an apparatus configured for use in the mRNA encapsulation process described herein. The apparatus may operate in substantially the same manner as the apparatus shown in Figure 16, but may incorporate a second heat exchanger 711. When the apparatus is in operation, the mixed liquid may be directed from the mixing junction 705 to the second heat exchanger 711 and from the second heat exchanger 711 to the final storage vessel 710. The apparatus may be configured such that the mixed liquid is directed from the mixing junction 705 to the second heat exchanger 711 after the mixed liquid has passed through the recycle loop 720 a desired number of times. In certain embodiments, the mixed liquid is directed to the second heat exchanger 711 after having been directed through the recycle loop 720 a total of three times.

[0230] Figure 18 shows an apparatus configured for use in the mRNA encapsulation process described herein. The apparatus may operate in substantially the same manner as the apparatus shown in Figure 17, but may incorporate a first heat exchanger 809 and an intermediate storage vessel 808. When the apparatus is in operation, the mixed liquid may be directed from the mixing junction 805 to the first heat exchanger 809 and from the first heat exchanger 809 to the intermediate storage vessel 808. If the apparatus is configured to recycle the mixed liquid, the mixed liquid may be directed from the intermediate storage vessel 808 to a recycle loop 820. If the apparatus is configured to output the mixed liquid, the mixed liquid may be directed from the intermediate storage vessel 808 to a second heat exchanger 811 and from the second heat exchanger 811 to a final storage vessel 810. In certain embodiments, after the mixed liquid has been directed through the recycle loop 820 a total of three times, the mixed liquid is directed to the second heat exchanger 811.

[0231] Figure 19 shows an apparatus configured for use in the mRNA encapsulation process described herein. The apparatus may operate in substantially the same manner as the apparatus shown in Figure 18, except that the recycle loop 906 is configured to direct the mixed liquid from an intermediate storage vessel 908 to a location in the LNP conduit arrangement upstream of the first pump 903.

[0232] During cycles of operational execution or different production runs (e.g., encapsulating mRNAs encoding different proteins for different therapeutic applications), the devices described herein For example, the RNase-free water may be purified by (i) passing a first flow of RNase-free water through the device, (ii) passing a flow of sodium hydroxide solution through the device, and (iii) passing a second flow of RNase-free water through the device. The RNase-free water may be water for injection.

[0233] In any one of the devices described herein, optionally, the first heat exchanger may be incorporated into the intermediate storage vessel. Optionally, the second heat exchanger may be incorporated into the final storage vessel.

[0234] In any one of the devices described herein, optionally, a first pump may be incorporated into the LNP conduit arrangement and / or into the first storage container, and optionally, a second pump may be incorporated into the mRNA conduit arrangement and / or into the second storage container.

[0235] In any one of the devices described herein, optionally the conduit arrangement may be one conduit configured to conduct fluid between and through component parts of the device. Optionally, the conduit arrangement may include multiple conduits operatively and / or fluidly connected to conduct fluid between and through component parts of the device.

[0236] purification In some embodiments, the preformed empty lipid nanoparticles or mRNA-containing lipid nanoparticles are purified and / or concentrated. A variety of purification methods may be used.

[0237] In some embodiments, lipid nanoparticles are purified using tangential flow filtration (TFF, also called cross-flow filtration).TFF is a type of filtration, and the material to be filtered passes tangentially along the filter, not through the filter.In TFF, undesired permeate passes through the filter, while desired retentate passes along the filter and is collected downstream.In TFF, desired material is typically contained in retentate.It is important to note that this is the opposite of what is usually encountered in traditional "dead-end" filtration.

[0238] Depending on the material to be filtered, TFF is typically used for either microfiltration or ultrafiltration. Microfiltration is typically defined as when the filter has a pore size of 0.05 μm to 1.0 μm inclusive, while ultrafiltration typically involves filters with pore sizes less than 0.05 μm. The pore size also determines the nominal molecular weight cutoff (NMWL), also known as the molecular weight cutoff (MWCO), for a particular filter; microfiltration membranes typically have an NMWL greater than 1,000 kilodaltons (kDa), while ultrafiltration filters have an NMWL of 1 kDa to 1,000 kDa.

[0239] A major advantage of tangential flow filtration is that non-permeable particles (sometimes called "filter cake") that would otherwise agglomerate and plug the filter during conventional "dead-end" filtration are instead carried along the surface of the filter. This advantage allows tangential flow filtration to be widely used in industrial processes requiring continuous operation, as downtime is significantly reduced since the filter generally does not need to be removed and cleaned.

[0240] Tangential flow filtration can be used for several purposes, including, among others, concentration and diafiltration. Concentration is a process in which solvent is removed from a solution while solute molecules are retained. To effectively concentrate a sample, the molecular weight of the solute molecules must be substantially smaller than that of the solute molecules to be retained. A membrane with a WL or MWCO is used. Generally, one skilled in the art can select a filter with a NMWL or MWCO that is 3 to 6 times smaller than the molecular weight of the target molecule.

[0241] Diafiltration is a fractionation process whereby small, undesired particles pass through the filter while larger, desired nanoparticles are retained in the retentate without changing their concentration in the solution. Diafiltration is often used to remove salts or reaction buffers from a solution. Diafiltration can be either continuous or discontinuous. In continuous diafiltration, the diafiltrate solution is added to the sample feed at the same rate as the filtrate is produced. In discontinuous diafiltration, the solution is first diluted and then concentrated to a starting concentration. Discontinuous diafiltration may be repeated until the desired nanoparticle concentration is reached.

[0242] The purified and / or concentrated lipid nanoparticles can be formulated in a desired buffer, such as, for example, PBS.

[0243] Lipid nanoparticles encapsulating mRNA The process according to the present invention results in higher potency and efficacy, and a positive shift in the therapeutic index at lower doses. In some embodiments, the method according to the present invention results in uniform and small particle size (e.g., less than 150 nm), and significantly improved encapsulation efficiency and / or mRNA recovery rate compared to conventional methods.

[0244] Various methods are known in the art for sizing lipid nanoparticle populations. One such sizing method is described in U.S. Pat. No. 4,737,323, which is incorporated herein by reference. Sonication of liposome suspensions, either by bath or probe sonication, results in a gradual reduction in size to small ULVs with diameters of less than about 0.05 micrometers. Homogenization is another method that utilizes shear energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, MLVs are recirculated using a standard emulsion homogenizer until a selected liposome size, typically about 0.1 to 0.5 micrometers, is observed. Liposome size can be calculated by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-450 (1981), incorporated herein by reference. The average liposome diameter can be reduced by sonicating the formed liposomes. Intermittent sonication cycles can be alternated with QELS assessment to guide efficient liposome synthesis.

[0245] In some embodiments, the majority of the purified nanoparticles in the composition, i.e., about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles, have a size of about 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). In some embodiments, substantially all of the purified nanoparticles have a size of about 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). In some embodiments, the lipid nanoparticles have an average size of less than 120 nm. In some embodiments, the lipid nanoparticles have an average size of less than 100 nm. In some embodiments, the lipid nanoparticles have an average size of less than 90 nm. In some embodiments, the lipid nanoparticles have an average size of less than 80 nm. In some embodiments, the lipid nanoparticles have an average size of less than 70 nm. In some embodiments, the lipid nanoparticles have an average size of less than 60 nm. In some embodiments, the lipid nanoparticles have an average size of less than 120 nm. The lipid nanoparticles have an average size of less than 50 nm. In some embodiments, the lipid nanoparticles have an average size of less than 30 nm. In some embodiments, the lipid nanoparticles have an average size of less than 20 nm.

[0246] Furthermore, more uniform nanoparticles with a narrow particle size range are achieved by the methods of the present invention, for example, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles in the compositions provided by the present invention have a size in the range of about 75-150 nm (e.g., about 75-145 nm, about 75-140 nm, about 75-135 nm, about 75-130 nm, about 75-125 nm, about 75-120 nm, about 75-115 nm, about 75-110 nm, about 75-105 nm, about 75-100 nm, about 75-95 nm, about 75-90 nm, or 75-85 nm). In some embodiments, substantially all of the purified nanoparticles have a size in the range of about 75 to 150 nm (e.g., about 75 to 145 nm, about 75 to 140 nm, about 75 to 135 nm, about 75 to 130 nm, about 75 to 125 nm, about 75 to 120 nm, about 75 to 115 nm, about 75 to 110 nm, about 75 to 105 nm, about 75 to 100 nm, about 75 to 95 nm, about 75 to 90 nm, or 75 to 85 nm).

[0247] In some embodiments, the molecular size dispersion or heterogeneity (PDI) of the nanoparticles encapsulating mRNA provided by the present invention is less than about 0.5. In some embodiments, the lipid nanoparticles have a PDI of less than about 0.4. In some embodiments, the lipid nanoparticles have a PDI of less than about 0.3. In some embodiments, the lipid nanoparticles have a PDI of less than about 0.28. In some embodiments, the lipid nanoparticles have a PDI of less than about 0.25. In some embodiments, the lipid nanoparticles have a PDI of less than about 0.23 (e.g., less than about 0.23, 0.22, 0.21, 0.20, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.10, 0.09, or 0.08). In certain embodiments, the PDI is less than about 0.16.

[0248] In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles in the compositions provided herein encapsulate mRNA within each individual particle. In some embodiments, substantially all of the purified lipid nanoparticles in the compositions encapsulate mRNA within each individual particle. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of 50% to 99%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 60%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 65%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 70%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 75%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 80%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 85%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 90%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 92%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 95%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 98%. In some embodiments, the lipid nanoparticles have an encapsulation efficiency of greater than about 99%. Typically, lipid nanoparticles intended for use in the present invention have an encapsulation efficiency of at least 90%-95%.

[0249] In some embodiments, the composition of the present invention is formulated to be administered to a subject at a dose.In some embodiments, the composition of mRNA lipid nanoparticles described herein is formulated at a dose concentration of less than 1.0mg / kg mRNA lipid nanoparticles (for example, 0.6mg / kg, 0.5mg / kg, 0.3mg / kg, 0.016mg / kg, 0.05mg / kg and 0.016mg / kg).In some embodiments, the dose is reduced due to the unexpected finding that lower doses produce higher efficacy and effectiveness. In some embodiments, the dose is reduced by about 70%, 65%, 60%, 55%, 50%, 45%, or 40%.

[0250] In some embodiments, the potency of mRNA-encapsulated lipid nanoparticles produced by the step-up remix process and / or the step-down remix process is greater than 100% (i.e., greater than 200%, greater than 300%, greater than 400%, greater than 500%, greater than 600%, greater than 700%, greater than 800%, or greater than 900%) to greater than 1000% when prepared by the step-up remix process and / or the step-down remix process compared to Process B.

[0251] Therapeutic Uses of the Composition The invention also provides for the delivery of compositions of the invention for use in treating a subject, e.g., a human subject, or cells in a human subject, or cells that are treated and delivered to a human subject.

[0252] Techniques for formulation and administration of the compositions of the present invention may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa. (latest edition).

[0253] The provided mRNA-loaded nanoparticles and compositions containing them can be administered and dosed in accordance with current medical practice, taking into account the subject's clinical condition, the site and method of administration, the administration schedule, the subject's age, sex, and weight, and other factors relevant to a clinician in the art. For purposes herein, an "effective amount" can be determined by experimental clinical studies, pharmacological, clinical, and medical considerations known to those skilled in the art. In some embodiments, the amount administered is effective to at least partially stabilize, ameliorate, or eliminate symptoms or other indicators selected by those skilled in the art as appropriate measures of disease progression, regression, or improvement. For example, a suitable amount and dosing regimen is one that results in at least transient production of a protein (e.g., an enzyme).

[0254] Delivery method The present invention provides a method for delivering mRNA to produce a protein in vivo, the method comprising administering mRNA to a subject in need thereof. In some embodiments, the mRNA is administered via a delivery route selected from the group consisting of intravenous delivery, subcutaneous delivery, oral delivery, subdermal delivery, ocular delivery, intratracheal injection pulmonary delivery (e.g., nebulization), intramuscular delivery, intrathecal delivery, or intraarticular delivery.

[0255] Suitable routes of administration include, for example, oral administration, rectal administration, vaginal administration, transmucosal administration, pulmonary administration including intratracheal or inhalation administration, or intestinal administration, parenteral delivery including intradermal injection, transdermal (topical) injection, intramuscular injection, subcutaneous injection, intramedullary injection, as well as intrathecal, direct intracerebroventricular, intravenous, intraperitoneal, or intranasal administration. In some embodiments, intramuscular administration is into a muscle selected from the group consisting of skeletal muscle, smooth muscle, and cardiac muscle. In some embodiments, administration results in delivery of mRNA to muscle cells. In some embodiments, administration results in delivery of mRNA to hepatocytes (i.e., liver cells). In certain embodiments, intramuscular administration results in delivery of mRNA to muscle cells.

[0256] The choice of administration route depends on the target cell or tissue. Systemic delivery of mRNA-encoded proteins or peptides may be achieved, for example, via intravenous, intramuscular, or pulmonary administration of mRNA, typically encapsulated in lipid nanoparticles (e.g., liposomes). Intravenous delivery can be used to efficiently target hepatocytes. Intramuscular administration Pulmonary delivery is typically the method of choice for delivering mRNA encoding immunogenic proteins or peptides (e.g., intended for use as vaccines). Pulmonary delivery is commonly used to target the lung epithelium.

[0257] In some embodiments, the mRNA-loaded lipid nanoparticles are administered by pulmonary delivery via nebulization, typically involving a suitable nebulization device (e.g., a mesh nebulizer). Additional teachings on pulmonary delivery and nebulization are found in published U.S. patent application Ser. No. 2018 / 0125989 and published U.S. patent application Ser. No. 2018 / 0333457, each of which is incorporated by reference in its entirety.

[0258] Alternatively or additionally, the mRNA-carrying nanoparticles and compositions of the present invention can be administered locally rather than systemically, for example, by directly injecting the pharmaceutical composition into the target tissue, preferably in a sustained-release formulation. Local delivery can be achieved in various ways depending on the tissue to be targeted. For example, an aerosol containing the composition of the present invention can be inhaled (in the case of nasal, tracheal, or bronchial delivery), the composition of the present invention can be injected, for example, at the site of injury, disease symptoms, or pain, the composition can be provided in a lozenge for oral, tracheal, or esophageal use, in liquid, tablet, or capsule form for gastric or intestinal administration, in suppository form for rectal or vaginal use, or can be delivered to the eye using a cream, droplet, or even injection. Formulations containing the provided composition complexed with a therapeutic molecule or ligand can also be administered surgically, for example, in combination with a polymer or other structure or substance that allows the composition to diffuse from the implantation site to surrounding cells. Alternatively, they can be applied surgically without the use of a polymer or support.

[0259] Medication regimen The provided method of the present invention contemplates single administration and multiple administration of a therapeutically effective amount of the therapeutic agent (e.g., mRNA) described herein. The therapeutic agent can be administered at regular intervals depending on the nature, severity, and extent of the subject's condition. In some embodiments, the therapeutically effective amount of the therapeutic agent (e.g., mRNA) of the present invention can be intrathecally administered periodically at regular intervals (e.g., once a year, once every 6 months, once every 5 months, once every 3 months, every other month (once every 2 months), every month (once every month), every other week (once every 2 weeks), twice a month, once every 30 days, once every 28 days, once every 14 days, once every 10 days, once every 7 days, weekly, twice a week, daily, or continuously).

[0260] As used herein, the term "therapeutically effective amount" is determined primarily based on the total amount of the therapeutic agent contained in the pharmaceutical composition of the present invention. Generally, a therapeutically effective amount is an amount sufficient to provide a meaningful benefit to the subject (e.g., treat, regulate, cure, prevent, and / or alleviate a disease or disorder). For example, a therapeutically effective amount may be an amount sufficient to achieve a desired therapeutic and / or preventive effect. Typically, the amount of a therapeutic agent (e.g., mRNA) administered to a subject in need thereof will depend on the subject's characteristics. Such characteristics include the subject's condition, disease severity, general health, age, sex, and weight. Those skilled in the art will be able to easily determine the appropriate dosage depending on these and other relevant factors. Furthermore, both objective and subjective assays can be used to identify optimal dosage ranges.

[0261] In some embodiments, the therapeutically effective dose is from about 0.005 mg / kg body weight to 500 mg / kg body weight, e.g., from about 0.005 mg / kg body weight to 400 mg / kg body weight, from about 0.005 mg / kg body weight to 300 mg / kg body weight, from about 0.005 mg / kg body weight to 200 mg / kg body weight, from about 0.005 mg / kg body weight to 100 mg / kg body weight, from about 0.005 mg / kg body weight to 90 mg / kg body weight, or from about The ranges are 0.005 mg / kg (body weight) to 80 mg / kg (body weight), approximately 0.005 mg / kg (body weight) to 70 mg / kg (body weight), approximately 0.005 mg / kg (body weight) to 60 mg / kg (body weight), approximately 0.005 mg / kg (body weight) to 50 mg / kg (body weight), approximately 0.005 mg / kg (body weight) to 40 mg / kg (body weight), approximately 0.005 mg / kg (body weight) to 30 mg / kg (body weight), approximately 0.005 mg / kg (body weight) to 25 mg / kg (body weight), approximately 0.005 mg / kg (body weight) to 20 mg / kg (body weight), approximately 0.005 mg / kg (body weight) to 15 mg / kg (body weight), and approximately 0.005 mg / kg (body weight) to 10 mg / kg (body weight).

[0262] In some embodiments, a therapeutically effective dose is greater than about 0.1 mg / kg body weight, greater than about 0.5 mg / kg body weight, greater than about 1.0 mg / kg body weight, greater than about 3.0 mg / kg body weight, greater than about 5.0 mg / kg body weight, greater than about 10 mg / kg body weight, greater than about 15 mg / kg body weight, greater than about 20 mg / kg body weight, greater than about 30 mg / kg body weight, greater than about 40 mg / kg body weight, greater than about 50 mg / kg body weight, greater than about 6 ... g (body weight), greater than about 70 mg / kg (body weight), greater than about 80 mg / kg (body weight), greater than about 90 mg / kg (body weight), greater than about 100 mg / kg (body weight), greater than about 150 mg / kg (body weight), greater than about 200 mg / kg (body weight), greater than about 250 mg / kg (body weight), greater than about 300 mg / kg (body weight), greater than about 350 mg / kg (body weight), greater than about 400 mg / kg (body weight), greater than about 450 mg / kg (body weight), or greater than about 500 mg / kg (body weight). In certain embodiments, the therapeutically effective dose is 1.0 mg / kg. In some embodiments, the therapeutically effective dose of 1.0 mg / kg is administered intramuscularly or intravenously.

[0263] According to various embodiments, the timing of expression of the delivered mRNA can be tailored to suit specific medical needs. In some embodiments, expression of the protein encoded by the delivered mRNA is detectable 1 hour, 2 hours, 3 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, and / or 96 hours after administration of provided liposomes and / or compositions. In some embodiments, expression of the protein encoded by the delivered mRNA is detectable 1 week, 2 weeks, and / or 1 month after administration.

[0264] Relative Potency and Efficacy of the Compositions of the Invention In some embodiments, administration of a provided composition results in an increase in mRNA expression levels in a biological sample from a subject, compared to an equivalent composition formulated using the "step-up remix" and / or "step-down remix" processes described herein. Biological samples include, for example, whole blood, serum, plasma, urine, and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administration of a provided composition results in an increase in mRNA expression levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to an equivalent composition formulated using the "step-up remix" and / or "step-down remix" processes described herein.

[0265] Specific Peptides, Polypeptides and Proteins Intended for Use in the Invention In certain embodiments, the present invention provides methods for making therapeutic compositions comprising mRNA molecules encoding peptides or polypeptides for delivery to or use in treating the lungs or lung cells of a subject. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding the cystic fibrosis transmembrane conductance regulator (CFTR) protein. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding the ATP-binding cassette subfamily A member 3 protein. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding the dynein axoneme intermediate chain 1 protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding dynein axoneme heavy chain 5 (DNAH5) protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding alpha-1-antitrypsin protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding forkhead box P3 (FOXP3) protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding one or more surfactant proteins, e.g., one or more of surfactant A protein, surfactant B protein, surfactant C protein, and surfactant D protein.

[0266] In certain embodiments, the present invention provides a method for producing a therapeutic composition having mRNA molecules encoding peptides or polypeptides for delivery to or use in treating the liver or liver cells of a subject. Such peptides and polypeptides may include those associated with urea cycle disorders, lysosomal storage disorders, glycogen storage disorders, amino acid metabolism disorders, lipid metabolism or fibrotic disorders, methylmalonic acidemia, or any other metabolic disorder for which delivery of enriched mRNA molecules to or treatment with the liver or liver cells provides a therapeutic benefit.

[0267] In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding proteins associated with urea cycle disorders. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding ornithine transcarbamylase (OTC) proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding argininosuccinate synthetase 1 proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding carbamoyl phosphate synthetase I proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding argininosuccinate lyase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding arginase proteins.

[0268] In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding proteins associated with lysosomal storage disorders. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding alpha-galactosidase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding glucocerebrosidase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding iduronate-2-sulfatase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding iduronidase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding N-acetyl-alpha-D-glucosaminidase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding heparan N-sulfatase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding galactosamine-6 ​​sulfatase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding beta-galactosidase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding lysosomal lipase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding arylsulfatase B (N-acetylglucosidase). In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding transcription factor EB (TFEB) proteins.

[0269] In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding proteins associated with glycogen storage disorders. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding acid alpha-glucosidase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding glucose-6-phosphatase (G6PC) proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding liver glycogen phosphorylase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding muscle phosphoglycerate mutase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding glycogen debranching enzymes.

[0270] In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding proteins involved in amino acid metabolism. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding phenylalanine hydroxylase enzymes. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding glutaryl-CoA dehydrogenase enzymes. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding propionyl-CoA carboxylase enzymes. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding oxalase alanine-glyoxylaminotransferase enzymes.

[0271] In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding proteins related to lipid metabolism or fibrotic disorders. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding mTOR inhibitors. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding ATPase phospholipid transport 8B1 (ATP8B1) protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding one or more NF-kappa B inhibitors, such as one or more of I-kappa B alpha, interferon-related developmental regulator 1 (IFRD1), and sirtuin 1 (SIRT1). In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding PPAR-gamma protein or an active variant thereof.

[0272] In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding proteins associated with methylmalonic acidemia. For example, in certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding methylmalonyl-CoA mutase proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions comprising mRNA molecules encoding methylmalonyl-CoA epimerase proteins.

[0273] In certain embodiments, the present invention provides a method for producing a therapeutic composition having a full-length mRNA, the delivery of which to the liver or treatment of which can provide therapeutic benefits. In certain embodiments, the present invention provides a method for producing a therapeutic composition having an mRNA molecule encoding ATP7B protein, also known as Wilson disease protein. In certain embodiments, the present invention provides a method for producing a therapeutic composition having an mRNA molecule encoding ATP7B protein, also known as Wilson disease protein. In embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding porphobilinogen deaminase enzymes. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding one or more coagulation enzymes, such as Factor VIII, Factor IX, Factor VII, and Factor X. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding human hemochromatosis (HFE) proteins.

[0274] In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding peptides or polypeptides for delivery to or use in treating cardiovascular structures or cells of a subject. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding vascular endothelial growth factor A proteins. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding relaxin proteins. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding bone morphogenetic protein-9 proteins. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding bone morphogenetic protein-2 receptor proteins.

[0275] In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding peptides or polypeptides for delivery to or use in treating muscle or muscle cells in a subject. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding dystrophin proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding frataxin proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding peptides or polypeptides for delivery to or use in treating cardiac muscle or cardiac cells in a subject. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding proteins that regulate potassium channels and / or sodium channels in muscle tissue or muscle cells. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding proteins that regulate Kv7.1 channels in muscle tissue or muscle cells. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding proteins that regulate Nav1.5 channels in muscle tissue or muscle cells.

[0276] In certain embodiments, the present invention provides methods for producing therapeutic compositions having RNA molecules encoding peptides or polypeptides for delivery to or use in treating the nervous system or nervous system cells of a subject. For example, in certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding survival motor neuron 1 protein. For example, in certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding survival motor neuron 2 protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding frataxin protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding ATP-binding cassette subfamily D member 1 (ABCD1) protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding CLN3 protein.

[0277] In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding peptides or polypeptides for delivery to or use in treating the blood or bone marrow or blood or bone marrow cells of a subject. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding beta-globin proteins. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding Bruton's tyrosine kinase kinase (BKK) proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding one or more coagulation enzymes, e.g., Factor VIII, Factor IX, Factor VII, and Factor X.

[0278] In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding peptides or polypeptides for delivery to or use in treating a subject's kidney or kidney cells. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding type IV collagen alpha 5 chain (COL4A5) protein.

[0279] In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding peptides or polypeptides for delivery to or use in treating a subject's eye or ocular cells. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding ATP-binding cassette subfamily A member 4 (ABCA4) protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding retinoschisin protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding retinal pigment epithelium-specific 65 kDa (RPE65) protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding 290 kDa centrosomal protein (CEP290).

[0280] In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding peptides or polypeptides for use in delivering or treating vaccines to a subject or cells of a subject. For example, in certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from infectious pathogens, such as viruses. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from influenza viruses. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from respiratory syncytial viruses. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from rabies viruses. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from cytomegaloviruses. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from rotaviruses. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from hepatitis viruses, such as hepatitis A, hepatitis B, or hepatitis C. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from human papillomavirus. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from herpes simplex viruses, such as herpes simplex virus type 1 or herpes simplex virus type 2. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from human immunodeficiency viruses, such as human immunodeficiency virus type 1 or human immunodeficiency virus type 2. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from human metapneumovirus.In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding antigens from human parainfluenza viruses, such as human parainfluenza virus type 1, human parainfluenza virus type 2, or human parainfluenza virus type 3. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding antigens from malaria viruses. In certain embodiments, the present invention provides methods for making therapeutic compositions having mRNA molecules encoding antigens from Zika viruses. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens derived from Chikungunya virus.

[0281] In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens associated with a subject's cancer or antigens identified from the subject's cancer cells. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens determined from the subject's own cancer cells. That is, methods for providing personalized cancer vaccines are provided. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding antigens expressed from a mutant KRAS gene.

[0282] In certain embodiments, the present invention provides methods for producing a therapeutic composition having an mRNA molecule encoding an antibody. In certain embodiments, the antibody may be a bispecific antibody. In certain embodiments, the antibody may be part of a fusion protein. In certain embodiments, the present invention provides methods for producing a therapeutic composition having an mRNA molecule encoding an antibody against OX40. In certain embodiments, the present invention provides methods for producing a therapeutic composition having an mRNA molecule encoding an antibody against VEGF. In certain embodiments, the present invention provides methods for producing a therapeutic composition having an mRNA molecule encoding an antibody against tissue necrosis factor alpha. In certain embodiments, the present invention provides methods for producing a therapeutic composition having an mRNA molecule encoding an antibody against CD3. In certain embodiments, the present invention provides methods for producing a therapeutic composition having an mRNA molecule encoding an antibody against CD19.

[0283] In certain embodiments, the present invention provides methods for making a therapeutic composition comprising an mRNA molecule encoding an immunomodulator. In certain embodiments, the present invention provides methods for making a therapeutic composition comprising an mRNA molecule encoding interleukin-12. In certain embodiments, the present invention provides methods for making a therapeutic composition comprising an mRNA molecule encoding interleukin-23. In certain embodiments, the present invention provides methods for making a therapeutic composition comprising an mRNA molecule encoding interleukin-36 gamma. In certain embodiments, the present invention provides methods for making a therapeutic composition comprising an mRNA molecule encoding one or more constitutively active variants of the stimulator of interferon genes (STING) protein.

[0284] In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding Cas endonucleases. The present invention provides methods for producing therapeutic compositions having mRNA molecules encoding RNA-guided DNA endonuclease proteins, such as the 9 protein. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding meganuclease proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding transcription activator-like effector nuclease proteins. In certain embodiments, the present invention provides methods for producing therapeutic compositions having mRNA molecules encoding zinc finger nuclease proteins.

[0285] In some embodiments, compositions and methods of the invention are provided for delivering mRNA encoding a therapeutic peptide, polypeptide, or protein to a subject, wherein the subject is suffering from a disease or disorder caused by a deficiency in the peptide, polypeptide, or protein encoded by the mRNA in the subject. The deficiency can be caused by a lack of expression of the peptide, polypeptide, or protein, expression of a non-functional peptide, polypeptide, or protein, or a dysfunctional peptide, polypeptide, or protein. The cause may be a peptide, polypeptide, or protein, or a peptide, polypeptide, or protein with reduced function, or other functional disorder of the peptide, polypeptide, or protein. Diseases or disorders of this nature are generally referred to as "protein deficiency diseases." Typically, these diseases or disorders are caused by one or more mutations in the gene encoding the peptide, polypeptide, or protein in a subject. The replacement peptide, polypeptide, or protein encoded by the mRNA does not contain the one or more mutations that are the underlying cause of the protein deficiency. Diseases or disorders caused by protein deficiency include cystic fibrosis, lysosomal storage diseases, metabolic disorders (e.g., urea cycle disorders), etc.

[0286] In other embodiments, compositions and methods of the invention are provided for the delivery of mRNA encoding therapeutic peptides, polypeptides, or proteins, including antibodies, immunogens, cytokines, allergens, and the like.

[0287] In some embodiments, the compositions and methods of the present invention provide for the delivery of mRNA encoding a therapeutic protein (eg, cytoplasmic, transmembrane, or secreted).

[0288] In some embodiments, the present invention is used to prevent, treat, and / or cure a subject suffering from a disease or disorder listed above, or a disease or disorder associated with a protein listed therein. In some embodiments, the mRNA encodes one or more of cystic fibrosis transmembrane conductance regulator (CFTR), argininosuccinate synthetase (ASS1), factor IX, survival motor neuron 1 (SMN1), or phenylalanine hydroxylase (PAH). In some embodiments, the present invention is used to prevent, treat, and / or ameliorate a subject suffering from any one of cystic fibrosis, citrullinemia, hemophilia B, spinal muscular atrophy, and phenylketonuria. [Example]

[0289] While certain compounds, compositions, and methods of the present invention have been specifically described in accordance with certain embodiments, the following examples serve merely to illustrate the invention and are not intended to be limiting thereof.

[0290] Example 1. Lipid nanoparticle formulation process using preformed lipid nanoparticles Cationic lipids, non-cationic lipids (DOPE), cholesterol, and PEG-modified lipids (DMG-PEG2K) were dissolved in ethanol and mixed with citrate buffer using a pump system. By immediately mixing the two streams, empty four-component lipid nanoparticles were formed via a self-assembly process. The formulation then underwent a TFF purification process to remove the citrate buffer and alcohol and replace them with a storage buffer (10% trehalose). The resulting suspension of preformed empty lipid nanoparticles was mixed with mRNA according to one of three processes described below.

[0291] In the first experiment, a suspension of preformed empty lipid nanoparticles was heated to 65°C and mixed with a room-temperature solution of mRNA encoding the protein ornithine transcarbamylase (OTC). A four-fold molar excess of cationic lipid per mole of mRNA was previously observed to be beneficial, as it resulted in a high percentage of encapsulated mRNA. This ratio has been found to be appropriate regardless of the actual number of positively charged nitrogens (N) to negatively charged phosphates (P) in the mRNA molecule to be encapsulated, but is still colloquially referred to as an "N / P ratio" of 4. This "remix" process resulted in a suspension of lipid nanoparticles encapsulating OTC mRNA, as shown schematically in Figure 1A. The N / P ratio compared to the formulation process time is shown in Figure 1B. The N / P ratios for heated lipid nanoparticles and room-temperature mRNA were compared. The solution was mixed using the pump system shown in Figure 1C.

[0292] Instead of mixing all of the preformed empty lipid nanoparticles and all of the mRNA in one step to achieve the desired N / P ratio, the mRNA or preformed empty lipid nanoparticles can be mixed by increasing (stepping up) or decreasing (stepping down) the N / P ratio in a stepwise manner until the desired ratio is achieved. Thus, in a second experiment, a first volume of mRNA was added to the preformed empty lipid nanoparticles (used in the remix experiment above) to obtain an intermediate suspension with an N / P ratio of 16 (i.e., an excess of preformed empty lipid nanoparticles). An additional volume was then added to obtain a new intermediate suspension with an N / P ratio of 12. These steps were repeated two more times until a final N / P ratio of 4 was achieved. This "step-down remix" process resulted in a suspension of lipid nanoparticles encapsulating mRNA. The process is shown schematically in Figure 2A. The N / P ratio compared to the formulation process time for this process is shown in Figure 2B.

[0293] In a third experiment, a first volume of preformed empty lipid nanoparticles (used in the remix and step-down experiments above) was added to a solution of mRNA to obtain an intermediate suspension with an N / P ratio of 1. An additional volume of preformed empty lipid nanoparticles was then added to the solution of mRNA to obtain an intermediate suspension with an N / P ratio of 2. These steps were repeated two more times until a final N / P ratio of 4 was achieved. This "step-up remix" process resulted in a suspension of lipid nanoparticles encapsulating mRNA. The process is shown schematically in Figure 2C. The N / P ratio compared to the formulation process time for this process is shown in Figure 2D.

[0294] In the traditional "remix" process, it has been found beneficial to heat preformed empty lipid nanoparticles to 65°C before mixing and combining with a room temperature solution of mRNA. During mixing, the combined suspension is heated to 65°C. Typically, mixing is carried out for at least 15 minutes to ensure that the maximum amount of mRNA is encapsulated in the lipid nanoparticles. Heating during mixing has been shown to dramatically increase encapsulation efficiency.

[0295] Therefore, for both the "step-down remix" and "step-up remix" processes, a suspension containing preformed empty lipid nanoparticles was heated to 65°C before mixing. After each batch of mRNA (step-down remix) or empty lipid nanoparticles (step-up remix) was added, the combined suspension was heated to 65°C during mixing. Minimizing heat exposure to the mRNA solution is desirable to ensure mRNA integrity. It was found that 4 minutes of mixing and heating after each batch was sufficient to obtain mRNA-loaded lipid nanoparticle formulations with improved properties compared to formulations prepared by the traditional "remix" process. Particularly with the "step-down remix" process, it is believed to be beneficial that only one-quarter of the mRNA is exposed to heat for approximately the same length of time as the traditional "remix" process, thereby minimizing degradation as a result of heat exposure. This advantage is realized either by adding the mRNA to the lipid nanoparticles in several separate volumes and then mixing for a period of time (thus adjusting the N / P ratio stepwise as shown in Figure 3A), or by adding the mRNA to the lipid nanoparticles continuously while mixing for a period of time until the desired N / P ratio is achieved (as illustrated in Figure 3C).

[0296] Example 2. In vivo protein expression from hOTC mRNA in wild-type CD1 mice This example demonstrates how stepwise changes in the N / P ratio during mixing of preformed lipid nanoparticles with mRNA can result in lipid nanoparticles that are more potent in inducing protein expression from encapsulated mRNA.

[0297] Two exemplary four-component lipid nanoparticles were administered intravenously (IV). Both nanoparticles contained a non-cationic lipid (DOPE), cholesterol, a PEG-modified lipid (DMG-PEG2K), and hOTC mRNA. The first formulation contained the cationic lipid cDD-TE-4-E12, while the second formulation contained the cationic lipid cDD-TE-4-E10. Experiments were conducted using both formulations to test mRNA delivery and the resulting hOTC protein expression. Male CD1 mice aged 6-8 weeks were injected via the tail vein with a single bolus of one of six formulations: either cDD-TE-4-E10 or cDD-TE-4-E12 nanoparticles. Each formulation was formed using either the remix, step-down, or step-up process (i.e., six formulations in total). These were prepared as described in Example 1 at a dose of 1.0 mg / kg of hOTC mRNA. Mice were euthanized and perfused with saline for 24 hours after administration. Liver tissue was harvested and hOTC protein expression levels were measured in liver homogenates by ELISA.

[0298] As shown in Figure 4, all three lipid nanoparticle formulations tested for cDD-TE-4-E10 (Figure 4A) and cDD-TE-4-E12 (Figure 4B) were effective in delivering mRNA to the liver in vivo and expressing the OTC protein encoded by the delivered mRNA. Surprisingly, however, the "step-up remix" and "step-down remix" processes resulted in formulations that were approximately six-fold more potent in protein expression than formulations prepared by the "remix" process. In each figure, the dashed line represents the approximate minimum expression level for therapeutic efficacy (approximately 450 ng of hOTC per mg of total protein).

[0299] While both formulations exhibited improved expression when formulated by step-up or step-down remix, cDD-TE-4-E12 (a cationic lipid with a 12-carbon alkyl chain) showed improved expression compared to cDD-TE-4-E10 (a cationic lipid with a 10-carbon alkyl chain). Without wishing to be bound by any particular theory, the inventors believe that the step-up and step-down remix processes more efficiently increase the potency of encapsulated mRNA (as assessed by in vivo protein expression) when lipid formulations are prepared using cationic lipids with longer alkyl chains.

[0300] Example 3. Improved in vivo expression of hOTC mRNA after intravenous delivery using optimized lipid nanoparticle formulations This example demonstrates that stepwise changes in the N / P ratio during mRNA loading into preformed lipid nanoparticles can further enhance the efficacy of lipid nanoparticle formulations, even if the lipid composition has already been optimized to maximize protein expression.

[0301] The cationic lipid plays a crucial role in determining the in vivo efficacy of four-component lipid nanoparticle formulations. Therefore, optimizing this lipid component can dramatically increase the efficacy of the resulting lipid nanoparticles. Furthermore, it has been demonstrated that the efficacy of four-component lipid nanoparticles can be further enhanced by replacing the non-cationic lipid component DOPE with DEPE (see U.S. Provisional Patent Application No. 62 / 871,513, filed July 8, 2019, which is incorporated herein by reference in its entirety).

[0302] The first four-component lipid nanoparticles were prepared using the optimized cationic lipids cDD-TE-4-E12, DOPE, cholesterol, and DMG-PEG2K. The second four-component lipid nanoparticles were prepared using ccDD-TE-4-E12, DEPE, cholesterol, and DMG-PEG2K (i.e., DOPE was replaced with DEPE as the non-cationic lipid component). The formulation was prepared in the same manner as the second formulation except that the 2-hydroxybenzoate was replaced with 2-hydroxybenzoate.

[0303] First and second lipid nanoparticles were prepared using either the "remix" process, the "step-down remix" process, or the "step-up remix" process, as described in Example 1, resulting in six lipid nanoparticle formulations. These lipid nanoparticle formulations were administered to male CD-1 mice as described in Example 2, as summarized in the table below. [Table 3]

[0304] As shown in Figure 5, all six lipid nanoparticle formulations tested were effective in delivering mRNA to the liver in vivo, resulting in expression of the OTC protein encoded by the delivered mRNA. As observed in Example 2, the formulations obtained by step-up and step-down remixing were many times more potent than those prepared by "remixing." Surprisingly, increased potency was still observed even with highly optimized lipid nanoparticle formulations containing the cationic lipid cDD-TE-4-E12 and the non-cationic lipid DEPE instead of DOPE. Although the increase in potency was less pronounced with these highly optimized formulations, OTC expression still nearly doubled when the "step-down remixing" or "step-up remixing" process was used instead of the "remixing" process. Although no statistically significant difference was obtained, the "step-down remixing" formulation tended to be superior to the "step-up remixing" formulation, likely due to increased mRNA integrity resulting from reduced heat exposure to the mRNA. Therefore, the "step-down remixing" process was selected for subsequent experiments.

[0305] Example 4. Improved in vivo expression of hOTC mRNA after intravenous delivery using lipid nanoparticle formulations prepared using different numbers of steps This example demonstrates that adjusting the N / P ratio gradually in smaller stepwise changes during encapsulation of mRNA within preformed lipid nanoparticles results in lipid nanoparticles that are more potent at inducing protein expression from encapsulated mRNA than lipid nanoparticle formulations prepared by processes involving larger stepwise changes in the N / P ratio.

[0306] Four-component lipid nanoparticles containing the cationic lipid cKK-E12 (also known as TBL-0346 or ML-(DOPE)), cholesterol, and PEG-modified lipid (DMG-PEG2K), and hOTC mRNA were prepared as summarized in Table 4. Apart from the difference in the number of steps, the preparation method was similar to the "step-up lipid nanoparticle preparation" described in Example 1. The process was the same as the "step-down remix" process. The total process time was 16 minutes to minimize the period during which the mRNA was exposed to high temperatures. Male CD1 mice aged 6 to 8 weeks were injected with a single bolus of the four formulations via the tail vein at a dose of 0.5 mg / kg hOTC mRNA. Mice were euthanized and perfused with saline for 24 hours after administration. Liver tissue was harvested, and hOTC protein expression levels were measured in liver homogenates by ELISA. [Table 4]

[0307] As shown in Figure 6A, all four lipid nanoparticle formulations tested were effective in delivering mRNA to the liver in vivo, resulting in expression of the OTC protein encoded by the delivered mRNA. Increasing the number of steps from four to eight improved OTC expression in both the step-up and step-down remix formulations.

[0308] This example showed that increasing the number of steps taken to achieve a predetermined N / P ratio further improved the efficacy of the resulting lipid nanoparticles, indicating that it may be beneficial to gradually adjust the N / P ratio in smaller stepwise changes during encapsulation of mRNA within preformed lipid nanoparticles.

[0309] Example 5. Improved in vivo expression of hOTC mRNA after intravenous delivery using lipid nanoparticle formulations prepared using different timings of addition This example demonstrates that by continuously varying the N / P ratio over a period of time during encapsulation of mRNA into preformed lipid nanoparticles, mRNA-encapsulated lipid nanoparticles can be obtained that are highly effective in inducing protein expression from the encapsulated mRNA.

[0310] Four-component lipid nanoparticles containing the cationic lipid cKK-E12 (also known as TBL-0346 or ML-2), a PEG-modified lipid (DMG-PEG2K), and hOTC mRNA were prepared as summarized in Table 5. The timing of stepwise addition was Otherwise, the preparation methods were the same as the "step-up remix" and "step-down remix" processes described in Example 1. The total process time was 16 minutes to minimize the period during which the mRNA was exposed to high temperatures. Male CD1 mice aged 6 to 8 weeks were injected with a single bolus tail vein injection of the four formulations at a dose of 0.5 mg / kg hOTC mRNA. The mice were euthanized and perfused with saline for 24 hours after administration. Liver tissue was harvested, and hOTC protein expression levels were measured in liver homogenates by ELISA. [Table 5]

[0311] As shown in Figure 6B, all four lipid nanoparticle formulations tested were effective in delivering mRNA to the liver in vivo, resulting in expression of the OTC protein encoded by the delivered mRNA. Omission of post-addition mixing and heating improved OTC expression in both the step-up and step-down remix formulations. This beneficial effect on formulation potency was independent of the encapsulation efficiency for each formulation.

[0312] This example demonstrates that by continuously and stepwise changing the N / P ratio during the encapsulation of mRNA into preformed lipid nanoparticles, an intervening period of mixing and heating is not required to obtain mRNA-encapsulated lipid nanoparticles that are highly effective in inducing protein expression from the encapsulated mRNA. Rather, highly potent mRNA-encapsulated lipid nanoparticles can be prepared by continuously adding mRNA to preformed lipid nanoparticles. These results suggest that although mRNA encapsulation occurs rapidly, the efficacy of the final mRNA-encapsulated lipid nanoparticles can be dramatically improved by gradually changing the N / P ratio during the encapsulation process.

[0313] Example 6. OTC after 24 hours spf / ash In vivo activity of hOTC mRNA in mice This example demonstrates that by optimizing the formulation process, even low dose levels of mRNA can be used to provide missing proteins via delivery of protein-encoding mRNA. It is shown that highly effective and potent lipid nanoparticle formulations can be obtained.

[0314] In this example, hOTC mRNA encapsulated in lipid nanoparticles prepared by the "step-down remix" process, as described in Example 1, was used to treat five OTC mice. spf / ashMice were administered a single dose of the 4-component lipid nanoparticles (cDD-TE-4-E12, DEPE, cholesterol, and DMG-PEG2K) whose lipid composition was identical to that of the second 4-component lipid nanoparticle tested in Example 3. Wild-type mice treated with saline and OTC spf / ash Mice were used as controls. 24 hours after administration, animals were challenged with NH4Cl, and plasma NH3 levels were measured 40 minutes after challenge, as shown in Figure 7A. At the end of the experiment, mice were sacrificed, and their liver tissues were isolated and analyzed for OTC protein production using ELISA.

[0315] Figure 7B shows that hOTC mRNA administered to animals increased the OTC activity in a dose-dependent manner. spf / ash The results show that the amount of detectable OTC protein increased in the livers of mice. The results, shown in Figure 7C, confirm that the expressed OTC protein is active in the liver and effective in reducing plasma NH3 levels in a dose-dependent manner. Starting at a dose of 0.4 mg / kg, plasma NH3 levels in treated mice were indistinguishable from those observed in saline-treated wild-type mice.

[0316] Example 7. OTC several weeks after administration spf / ash In vivo activity of hOTC mRNA in mice This example demonstrates that mRNA encapsulated in lipid nanoparticles by either the "step-up remix" or "step-down remix" process maintained in vivo activity for at least 15 days after administration.

[0317] In this example, a single dose of 0.3 mg / kg of hOTC mRNA encapsulated in lipid nanoparticles prepared as described in Example 3 was administered to eight OTC mice. spf / ash Mice were administered OTC. spf / ashMice served as controls. Animals were challenged with NH4Cl 1, 2, 3, and 4 weeks after administration, and plasma NH3 levels were measured 40 minutes after challenge, as shown in Figure 8A.

[0318] As shown in Figure 8B, even at a low dose of 0.3 mg / kg, the lipid nanoparticle formulation was effective in delivering sufficient hOTC mRNA to the liver of mice to produce sufficient OTC protein to reduce plasma NH3 levels for at least 15 days after administration, levels that were similar to or indistinguishable from those of saline-treated wild-type mice. These results are comparable to previous studies, as similar results were obtained with a three-fold higher dose (1.0 mg / kg) of hOTC mRNA encapsulated and delivered in lipid nanoparticles prepared by a conventional "remix" process (see Example 15 of International Patent Application Publication WO 2018 / 089801).

[0319] Example 8. Addition of empty lipid nanoparticles boosts the in vivo activity of hOTC mRNA in wild-type mice This example demonstrates that the addition of empty lipid nanoparticles to mRNA-encapsulated lipid nanoparticles prepared by a conventional "remix" process can also boost the efficacy of the resulting formulation.

[0320] Without wishing to be bound by any particular theory, the inventors believe that the N / P ratio is adjusted stepwise when the mRNA is mixed with pre-formed empty lipid nanoparticles to achieve the desired N / P ratio. We believe that a step-up or step-down in the amount of cationic lipid associated with each mRNA molecule results in less cationic lipid being associated with each mRNA molecule, thus leaving more unbound cationic lipid available for fusion with the endosomal membrane after cellular uptake, resulting in more efficient release of the mRNA payload into the cytoplasm.

[0321] Thus, the mere presence of "free" cationic lipids within an endosomal compartment can increase the likelihood of endosomal escape, regardless of whether the "free" cationic lipids are associated with the same lipid nanoparticles containing the cationic lipids associated with the mRNA, or whether the "free" cationic lipids are provided by "empty" lipid nanoparticles that enter the endosomal compartment along with the mRNA-carrying lipid nanoparticles.

[0322] To investigate whether the simple addition of (additional) empty lipid nanoparticles could also result in more efficient mRNA delivery, mRNA encoding human erythropoietin (hEPO) was encapsulated into ML2-based four-component lipid nanoparticles using the conventional "remix" process described in Example 1. After encapsulation, the loaded lipid nanoparticles were purified and buffer-exchanged using tangential flow filtration. The purified, buffered lipid nanoparticle formulation was mixed with empty lipid nanoparticles in a 1:1 ratio ("reblend" in ML2), as shown schematically in Figure 9. Lipid nanoparticles prepared by the conventional "remix" process without the addition of empty lipid nanoparticles served as a control (ML2 remix).

[0323] Male CD1 mice, 6-8 weeks old, received a single bolus tail vein injection of hEPO mRNA lipid nanoparticles at a dose of 1.0 mg / kg or saline. Saline-treated animals served as untreated controls. hEPO expression was assessed in the serum of the animals 6 and 24 hours after administration using ELISA. ALT and AST levels (biomarkers for liver toxicity) were also determined to assess any differences in tolerability between the two lipid nanoparticle formulations.

[0324] As can be seen in Figure 10A, the control lipid nanoparticle formulation (ML2 Remix) prepared using the conventional "remix" process yielded serum hEPO protein levels of approximately 20 μg / mL at both 6 and 24 hours after administration. When the same lipid nanoparticle formulation was mixed with "empty" lipid nanoparticles ("reblended with ML2"), the detectable hEPO protein levels in serum at 6 hours were more than two-fold higher. A smaller increase was observed at 24 hours. The mean EPO protein expression at 6 and 24 hours relative to the ML2 Remix control formulation is shown by the dashed line. Tolerability was assessed based on the expression levels of ALT and AST in the livers of the test animals. Increased ALT and AST expression levels are indicative of hepatotoxicity. As can be seen in Figure 10B, mice treated with the "reblended" formulation exhibited ALT / AST expression levels comparable to the "ML2 Remix" benchmark. The mean ALT and AST expression levels for the "ML2 Remix" control formulation are shown by the dashed line.

[0325] When used in vivo lipid nanoparticle delivery, it has been observed that the stronger the cationic lipid (or the larger the amount of cationic lipid), the lower the tolerability.Therefore, attempts to improve protein expression by using stronger cationic lipids or administering larger amounts of lipid nanoparticle formulations are typically negatively correlated with tolerability.Therefore, it is surprising that adding empty lipid nanoparticles to the formulation composition of mRNA-encapsulated lipid nanoparticles can increase protein expression from mRNA without changing tolerability.

[0326] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above description, but rather is as set forth in the following claims.

Claims

1. 1. A method for encapsulating messenger RNA (mRNA) into preformed empty lipid nanoparticles (LNPs), wherein the lipid components of the LNPs comprise or consist of cationic lipids, non-cationic lipids, PEG-modified lipids, and optionally cholesterol, said method comprising: (a) adding a first volume of a solution containing the mRNA to a suspension containing the preformed empty LNPs to form a mixture containing LNPs encapsulating the mRNA; (b) adding one or more additional volumes of the solution containing the mRNA to the mixture obtained in the previous step until a desired molar ratio of cationic lipid to mRNA is reached.

2. 10. The method of claim 1, wherein adding the first volume of solution containing the mRNA results in at least a 10-fold molar excess of cationic lipid relative to mRNA.

3. 3. The method of claim 2, wherein adding the first volume of solution containing the mRNA results in at least a 15-fold molar excess of cationic lipid relative to mRNA.

4. 3. The method of claim 2, wherein adding the first volume of solution containing the mRNA results in a molar ratio of about 10-20 (cationic lipid):1 (mRNA).

5. 5. The method of claim 4, wherein adding the first volume of solution containing the mRNA results in a molar ratio of about 16 (cationic lipid):1 (mRNA).

6. 6. The method of claim 1, wherein the first volume of solution containing the mRNA and the one or more additional volumes are equal volumes.

7. The method of claim 6 , wherein the one or more additional volumes is four volumes or less, or eight volumes or less.

8. 8. The method of claim 7, wherein the one or more additional volumes are one, two, three, four, five, six, seven, or eight additional volumes.

9. 9. The method of any one of claims 1 to 8, wherein a mixing period occurs before adding each of the one or more additional volumes of solution containing the mRNA.

10. The method of claim 9 , wherein each period is equal in length.

11. 11. The method of claim 9 or 10, wherein each period does not exceed 5 minutes.

12. 12. The method of claim 11, wherein each period is about 3 to 5 minutes.

13. 13. The method of claim 12, wherein each period is about 4 minutes.

14. 14. The method of any one of claims 9 to 13, wherein the addition of the last of the one or more additional volumes is followed by a further mixing period.

15. 15. The method of claim 14, wherein the additional period of time is equal in length to each of the preceding periods of time or the additional period of time exceeds the length of each of the preceding periods of time.

16. 16. The method of claim 15, wherein the further period of time is at least 1.5 to 2 times longer than each of the preceding periods of time.

17. 9. The method of claim 1, wherein the first volume and the one or more additional volumes of solution containing the mRNA are added sequentially.

18. 18. The method of claim 17, wherein the continuous addition of the solution containing the mRNA is performed for a period not exceeding 20 minutes.

19. 19. The method of claim 17 or 18, wherein the continuous addition of the solution containing the mRNA occurs at a constant flow rate.

20. 19. The method of claim 17 or 18, wherein the continuous addition of the solution containing the mRNA occurs at a flow rate that increases or decreases over time.

21. 21. The method of any one of claims 18 to 20, wherein the period of successive addition of solutions comprising the mRNA is followed by a mixing period.

22. 22. The method of claim 21, wherein the duration of the successive additions and the mixing period after the successive additions does not exceed 20 minutes.

23. 1. A method for encapsulating messenger RNA (mRNA) into preformed empty lipid nanoparticles (LNPs), wherein the lipid components of the LNPs comprise or consist of cationic lipids, non-cationic lipids, PEG-modified lipids, and optionally cholesterol, said method comprising: (a) adding a first volume of a suspension containing the preformed empty LNPs to a solution containing the mRNA to form a mixture containing LNPs encapsulating the mRNA; (b) adding one or more additional volumes of the suspension containing the pre-formed empty LNPs to the mixture obtained in the previous step until a desired molar ratio of cationic lipid to mRNA is reached.

24. 24. The method of claim 23, wherein adding the first volume of a suspension containing the preformed empty LNPs results in an approximately equal molar ratio of cationic lipids to mRNA.

25. 24. The method of claim 23, wherein the addition of the one or more additional volumes of a suspension containing the preformed empty LNPs results in a molar excess of cationic lipid relative to mRNA.

26. 26. The method of claim 25, wherein the addition of the one or more additional volumes of suspension containing the preformed empty LNPs results in approximately a 2-4 fold molar excess of cationic lipid to mRNA.

27. 27. The method of any one of claims 23 to 26, wherein the first volume of suspension containing the preformed empty LNPs and the one or more additional volumes are equal volumes.

28. 28. The method of claim 27, wherein the one or more additional volumes is four volumes or less, or eight volumes or less.

29. 29. The method of claim 28, wherein the one or more additional volumes are one, two, three, four, five, six, seven, or eight additional volumes.

30. 30. The method of any one of claims 23-29, wherein a mixing period occurs before adding each of the one or more additional volumes of the preformed, empty LNP-containing suspension.

31. 31. The method of claim 30, wherein each period is equal in length.

32. 32. The method of claim 30 or 31, wherein the period of time does not exceed 5 minutes.

33. 33. The method of claim 32, wherein the period of time is about 3 to 5 minutes.

34. 34. The method of claim 33, wherein the period is about 4 minutes.

35. 35. The method of any one of claims 30 to 34, wherein the addition of the last of the one or more additional volumes is followed by a further mixing period.

36. 36. The method of claim 35, wherein the additional mixing period is equal in length to each of the preceding periods or the additional period exceeds the length of each of the preceding periods.

37. 37. The method of claim 36, wherein the further period of time is at least 1.5 to 2 times longer than each of the preceding periods of time.

38. 30. The method of any one of claims 23 to 29, wherein the first volume and the one or more additional volumes of suspension containing the preformed empty LNPs are added sequentially.

39. 39. The method of claim 38, wherein the continuous addition of the suspension containing the preformed empty LNPs is performed for a period of not more than 20 minutes.

40. 40. The method of claim 38 or 39, wherein the continuous addition of the suspension containing the preformed empty LNPs occurs at a constant flow rate.

41. 40. The method of claim 38 or 39, wherein the continuous addition of the suspension containing the preformed empty LNPs occurs at a flow rate that increases or decreases over time.

42. 42. The method of any one of claims 38-41, wherein the period of continuous addition of the preformed empty LNP-containing suspension is followed by a mixing period.

43. 43. The method of claim 42, wherein the period of time for the successive additions and the period of mixing after the successive additions does not exceed 20 minutes.

44. 44. The method of any one of claims 1 to 43, wherein the suspension containing the preformed empty LNPs is at about 60°C to about 70°C and the solution containing the mRNA is at ambient temperature.

45. 45. The method of claim 44, wherein the suspension containing the preformed empty LNPs is at about 65°C.

46. The method of claim 44 or 45, wherein the mixing comprises heating the mixture of the combined LNP and mRNA to about 60°C to about 70°C.

47. 47. The method of claim 46, wherein the mixing comprises heating the combined LNP and mRNA mixture to about 65°C.

48. 48. The method of any one of claims 1 to 47, wherein the desired molar ratio is about 3-5 (cationic lipid): 1 (mRNA).

49. 49. The method of claim 48, wherein the desired molar ratio is about 4 (cationic lipid): 1 (mRNA).

50. 50. The method of any one of claims 1 to 49, wherein the empty LNPs are formed by mixing a lipid solution with an aqueous solution, the lipid solution comprising a cationic lipid, a non-cationic lipid, and a PEG-modified lipid in ethanol.

51. 51. The method of claim 50, wherein the aqueous solution comprises a citrate salt.

52. 52. The method of claim 50 or 51, wherein the ethanol and / or citrate is removed by tangential flow filtration to form a suspension containing the empty LNPs.

53. The cationic lipids include cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinC2DMA, ICE (imidazole-based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA, and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxy 53. The method of any one of claims 1 to 52, wherein the hydroxybenzoate is selected from the group consisting of 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), cDD-TE-4-E10, cDD-TE-4-E12, and combinations thereof.

54. 54. The method of claim 53, wherein the one or more cationic lipids comprise a target 24.

55. 54. The method of claim 53, wherein the one or more cationic lipids comprise ICE.

56. 54. The method of claim 53, wherein the one or more cationic lipids comprise cKK-E12.

57. 57. The method of any one of claims 1 to 56, wherein the non-cationic lipid is selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DEPE (1,2-dierucoyl-sn-glycero-3-phosphoethanolamine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), and DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).

58. 58. The method of claim 57, wherein the cationic lipid is DEPE or DOPE.

59. 59. The method of claim 1, wherein the PEG-modified lipid comprises a poly(ethylene)glycol chain of up to 5 kDa in length covalently attached to a lipid having an alkyl chain of C6-C20 in length. The method according to any one of claims 1 to 5.

60. 60. The method of claim 59, wherein the PEG-modified lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2K).

61. 61. The method of any one of claims 1 to 60, wherein greater than about 90% of the preformed empty LNPs have a size in the range of 75 to 150 nm.

62. 62. The method of claim 61, wherein greater than about 90% of the LNPs encapsulating the mRNA have a size that is at least about 5% (e.g., at least about 10%) larger than the size of the preformed empty LNPs.

63. 63. The method of any one of claims 1 to 62, wherein the mRNA encapsulation rate is greater than about 80%, such as greater than about 90%.

64. 64. The method of any one of claims 1 to 63, wherein the preformed empty LNPs and mRNA are mixed using a pump system.

65. 65. The method of claim 64, wherein the pump system comprises a pulseless flow pump, such as a gear pump or a centrifugal pump.

66. 66. The method of any one of claims 1 to 65, wherein the mRNA comprises one or more modified nucleotides.

67. 66. The method of any one of claims 1 to 65, wherein the mRNA is unmodified.

68. 68. A composition of lipid nanoparticles (LNPs) encapsulating mRNA, produced by the method of any one of claims 1 to 67, wherein the average size of the LNPs is 5% to 10% larger than LNPs prepared by mixing preformed empty LNPs with mRNA without changing the molar ratio of cationic lipid to mRNA during encapsulation.

69. 69. The composition of claim 68, wherein the nanoparticles have a size of about 75 nm to 150 nm.

70. 70. The composition of claim 68 or 69, wherein the nanoparticles comprise a PDI of less than about 0.25 to less than 0.

16.

71. 1. A method of treating a subject suffering from a peptide, polypeptide, or protein deficiency, comprising: administering to the subject a composition comprising lipid nanoparticles (LNPs) encapsulating mRNA encoding the peptide, polypeptide, or protein; 68. A method, wherein the composition comprising LNPs encapsulating the mRNA is produced by the method of any one of claims 1 to 67.

72. 72. The method of claim 71, wherein the peptide, polypeptide, or protein is selected from spinal motor neuron 1 (SMN), alpha-galactosidase (GLA), argininosuccinate synthetase (ASS1), ornithine transcarbamylase (OTC), factor IX (FIX), phenylalanine hydroxylase (PAH), erythropoietin (EPO), and cystic fibrosis transmembrane conductance receptor (CFTR).

73. 68. A method for delivering mRNA for in vivo protein production, comprising administering to a subject a lipid nanoparticle composition encapsulating mRNA produced by the method of any one of claims 1 to 67, wherein the mRNA encodes a protein of interest.

74. 71. A method of delivering mRNA for in vivo protein production, comprising administering to a subject a composition according to any one of claims 68 to 70.

75. 1. A method of making a lipid nanoparticle (LNP) composition, comprising: (a) mixing mRNA with a first set of pre-formed empty lipid nanoparticles (LNPs) comprising a first cationic lipid, a first non-cationic lipid, a first PEG-modified lipid, and optionally cholesterol under conditions that allow for encapsulation of the mRNA; (b) combining the mRNA-encapsulated LNPs formed in step (a) with a second set of pre-formed empty LNPs comprising a second cationic lipid, a second non-cationic lipid, a second PEG-modified lipid, and optionally cholesterol to obtain the LNP composition.

76. 76. The method of claim 75, wherein the first set of preformed empty LNPs and the second set of preformed empty LNPs have the same lipid composition.

77. 76. The method of claim 75, wherein the first set of preformed empty LNPs and the second set of preformed empty LNPs have different lipid compositions.

78. 78. The method of claim 77, wherein the first cationic lipid and the second cationic lipid are different.

79. 79. The method of claim 77 or 78, wherein the first non-cationic lipid and the second non-cationic lipid are different.

80. 79. The method of claim 77 or 78, wherein the first cationic lipid and the second cationic lipid are the same, and the first non-cationic lipid and the second non-cationic lipid are different.

81. 81. The method of claim 80, wherein the first non-cationic lipid is DOPE and the second non-cationic lipid is DEPE, or the first non-cationic lipid is DEPE and the second non-cationic lipid is DOPE.

82. 82. The method of any one of claims 75-81, wherein the method further comprises: (i) initially mixing the first cationic lipid, the first non-cationic lipid, the first PEG-modified lipid, and optionally cholesterol to form the first set of preformed empty LNPs prior to step (a); and / or (ii) initially mixing the second cationic lipid, the second non-cationic lipid, the second PEG-modified lipid, and optionally cholesterol to form the second set of preformed empty LNPs prior to step (b).

83. 83. The method of any one of claims 75-82, wherein the mRNA-encapsulating LNPs and the second set of preformed empty LNPs are combined in a ratio ranging from 20:1 to 1:20, 10:1 to 1:10, 5:1 to 1:5, 3:1 to 1:3, or 2:1 to 1:

2.

84. 84. The method of any one of claims 75-83, wherein the mRNA-encapsulating LNPs and the second set of preformed empty LNPs are combined in a ratio of 20:1, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, or 1:20 or greater.

85. 85. The method of any one of claims 75 to 84, wherein the first and second sets of mRNA-encapsulating LNPs and the preformed empty LNPs each have an average size in the range of about 75 to 150 nm in diameter.

86. 86. The method of any one of claims 75 to 85, wherein the first and second sets of mRNA-encapsulating LNPs and the preformed empty LNPs each have an average size of less than 100 nm in diameter.

87. 87. The method of any one of claims 75-86, wherein the composition has a ratio of total lipids to total mRNA in the range of 20:1 to 1:1, 10:1 to 1:1, 5:1 to 1:1, 5:1 to 2:1, or 4:1 to 2:1, or greater than 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 15:1, or 20:

1.

88. 88. The method of any one of claims 75 to 87, wherein the mRNA encodes a peptide, polypeptide, or protein.

89. A composition comprising a first set of mRNA-encapsulating lipid nanoparticles (LNPs) comprising a first cationic lipid, a first non-cationic lipid, a first PEG-modified lipid, and optionally cholesterol, and a second set of empty LNPs comprising a second cationic lipid, a second non-cationic lipid, a second PEG-modified lipid, and optionally cholesterol, wherein the first set of LNPs and the second set of LNPs are present in a ratio ranging from 20:1 to 1:20, 10:1 to 1:10, 5:1 to 1:5, 3:1 to 1:3, or 2:1 to 1:

2.

90. 90. The composition of claim 89, wherein the first set of LNPs and the second set of LNPs have the same lipid composition.

91. 90. The composition of claim 89, wherein the first set of LNPs and the second set of LNPs have different lipid compositions.

92. 92. The composition of claim 91, wherein the first cationic lipid and the second cationic lipid are different.

93. 93. The composition of claim 91 or 92, wherein the first non-cationic lipid and the second non-cationic lipid are different.

94. 93. The composition of claim 91 or 92, wherein the first cationic lipid and the second cationic lipid are the same, and the first non-cationic lipid and the second non-cationic lipid are different.

95. The first non-cationic lipid is DOPE and the second non-cationic lipid is DEPE, or the first non-cationic lipid is DEPE and the second non-cationic lipid is DOPE.

95. The composition of claim 94, wherein the carboxylic lipid is DOPE.

96. 96. The composition of any one of claims 89 to 95, wherein the first set of LNPs and the second set of LNPs each have an average size in the range of about 75 to 150 nm in diameter.

97. 97. The composition of any one of claims 89 to 96, wherein the first set of LNPs and the second set of LNPs each have an average size of less than about 100 nm in diameter.

98. 98. The composition of any one of claims 89 to 97, wherein the mRNA encodes a peptide, polypeptide, or protein.

99. 99. A method of delivering mRNA for protein expression in vivo, comprising administering to a subject a composition according to any one of claims 89 to 98.

100. 100. A method of treating a peptide, polypeptide or protein deficiency in a subject, comprising administering to the subject a composition of any one of claims 89 to 98, wherein the mRNA encodes the peptide, polypeptide or protein that is deficient in the subject.

101. The method of claim 99 or 100, wherein after administering the composition to the subject, the expression level of the peptide, polypeptide or protein encoded by the mRNA is increased compared to the expression level of the peptide, polypeptide or protein encoded by the same amount of mRNA administered containing the same mRNA-encapsulated LNP but without the second set of empty LNPs, and the expression levels of the liver enzymes aspartate transaminase (AST) and / or alanine aminotransferase (ALT) are equivalent.

102. 102. The method of claim 99, 100, or 101, wherein the expression level of the protein, polypeptide, or peptide is increased by at least 20%, 40%, 50%, 60%, 70%, 80%, 90%, 1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, or 5-fold.

103. 1. A method of encapsulating messenger RNA (mRNA) within preformed empty lipid nanoparticles (LNPs) by mixing a first liquid containing the preformed empty LNPs with a second liquid containing the mRNA, wherein the lipid component of the LNPs comprises a cationic lipid, the method comprising: (a) a first period, flow rate n 1 the first liquid at a flow rate n 2 and a first portion of the second liquid to produce a mixture having a first molar ratio of cationic lipids and mRNA; (b) a second period, n 1 The mixture at a larger flow rate and a flow rate n 2 and a second portion of said second liquid, so that the molar ratio of cationic lipid to mRNA in the resulting mixture is at least 20% less than said first molar ratio; and (c) repeating step (b) by increasing the flow rate of the resulting mixture, with each repetition until a desired cationic lipid to mRNA molar ratio is reached.

104. 104. The method of claim 103, wherein the desired molar ratio of cationic lipid to mRNA is 3-5 (cationic lipid): 1 (mRNA).

105. 105. The method of claim 104, wherein the desired molar ratio of cationic lipid to mRNA is about 4:

1. The method described.

106. 106. The method of any one of claims 103 to 105, wherein step (b) is repeated no more than four times, such as three or two times.

107. 107. The method of any one of claims 103 to 106, wherein the first molar ratio of cationic lipid to mRNA is between 30:1 and 10:1, for example about 16:

1.

108. 108. The method of any one of claims 103 to 107, wherein the molar ratio of cationic lipid to mRNA once step (b) has been carried out is between 24:1 and 8:1, for example about 12:

1.

109. 109. The method of any one of claims 103 to 108, wherein the molar ratio of cationic lipid to mRNA after step (b) has been repeated once is between 20:1 and 6:1, for example about 8:

1.

110. 110. The method of any one of claims 103 to 109, wherein the molar ratio of cationic lipid to mRNA after step (b) has been repeated twice is between 16:1 and 4:1, for example about 4:

1.

111. The mixing in any step pumping the first liquid into a mixing junction; and 111. The method of any one of claims 103 to 110, comprising pumping a portion of the second liquid into the mixing junction, optionally wherein the mixing junction is a T-junction.

112. The mixing in step (a) mixing the first liquid and a first portion of the second liquid during a first portion of the first time period; and 112. A method according to any one of claims 103 to 111, comprising storing the mixture in an intermediate container for a second portion of the first period.

113. The mixing in step (b) (i) mixing the mixed liquid with a second portion of the second liquid during a first portion of the second time period; and (ii) storing the mixture resulting from step (b)(i) in or in an intermediate container for a second portion of the second period of time.

114. The method further comprises:

114. The method of any one of claims 103 to 113, comprising storing the product of step (b) or (c) in a final container.

115. moreover, 115. A method according to any one of claims 103 to 114, comprising heating the product of steps (a), (b) and / or (c), after which the product is stored in or in an intermediate container or further mixed, optionally wherein the product of steps (a), (b) and / or (c) is heated to a temperature of from 60°C to 70°C, such as from 63°C to 67°C, for example about 65°C.

116. moreover, 116. A method according to claim 114 or 115, comprising cooling the product of step (b) or (c) and thereafter storing it in said final container, optionally wherein the product of step (b) or (c) is cooled to a temperature of from 19°C to 23°C, such as from 20°C to 22°C, for example about 21°C.

117. 1. A method of encapsulating messenger RNA (mRNA) within preformed empty lipid nanoparticles (LNPs) by mixing a first liquid containing the preformed empty LNPs with a second liquid containing the mRNA, wherein the lipid component of the LNPs comprises a cationic lipid, the method comprising: (a) a first period, flow rate n 1 a first portion of the first liquid at a flow rate n 2 and the second liquid to prepare a mixture having a first molar ratio of cationic lipids and mRNA; (b) a second period, n 1 The mixture at a larger flow rate and a flow rate n 2 and a second portion of said first liquid, wherein the molar ratio of cationic lipid to mRNA in the resulting mixture is at least 20% greater than said first molar ratio; and (c) repeating step (b) by increasing the flow rate of the resulting mixture, with each repetition until a desired cationic lipid to mRNA molar ratio is reached.

118. 118. The method of claim 117, wherein the desired molar ratio of cationic lipid to mRNA is 3-5 (cationic lipid): 1 (mRNA).

119. 119. The method of claim 118, wherein the desired molar ratio of cationic lipid to mRNA is about 4:

1.

120. 118. The method of claim 117, wherein step (b) is repeated no more than four times, for example three or two times.

121. 121. The method of any one of claims 117 to 120, wherein the first molar ratio of cationic lipid to mRNA is between 1:10 and 1:1, for example about 1:

1.

122. 122. The method of any one of claims 117 to 121, wherein the molar ratio of cationic lipid to mRNA once step (b) has been performed is between 1:5 and 2:1, for example about 2:

1.

123. 123. The method of any one of claims 117 to 122, wherein the molar ratio of cationic lipid to mRNA after step (b) has been repeated once is between 1:2 and 3:1, for example about 3:

1.

124. 124. The method of any one of claims 117 to 123, wherein the molar ratio of cationic lipid to mRNA after step (b) has been repeated twice is between 1:1 and 4:1, for example about 4:

1.

125. The mixing in any step pumping a portion of the first liquid into a mixing junction; and 125. The method of any one of claims 117 to 124, comprising pumping the second liquid into the mixing junction, optionally wherein the mixing junction is a T-junction.

126. The mixing in step (a) mixing a first portion of the first liquid with the second liquid during a first portion of the first time period; and 126. The method of any one of claims 117 to 125, comprising storing the mixture in an intermediate container for a second portion of the first period of time.

127. The mixing in step (b) (i) mixing the mixed liquid with a second portion of the first liquid during a first portion of the second time period; and (ii) storing the mixture resulting from step (b)(i) in or in an intermediate container for a second portion of the second period of time.

128. The method further comprises:

128. The method of any one of claims 117 to 127, comprising storing the product of step (b) or (c) in a final container.

129. moreover, 129. A method according to any one of claims 117 to 128, comprising heating the product of steps (a), (b) and / or (c), after which the product is stored in or in an intermediate container or further mixed, optionally wherein the product of steps (a), (b) and / or (c) is heated to a temperature of from 60°C to 70°C, such as from 63°C to 67°C, for example about 65°C.

130. moreover, 130. A method according to claim 128 or 129, comprising cooling the product of step (b) or (c) and thereafter storing it in said final container, optionally wherein the product of step (b) or (c) is cooled to a temperature of from 19°C to 23°C, for example from 20°C to 22°C, for example about 21°C.

131. 131. The method of any one of claims 103 to 130, wherein the first period of time does not exceed 5 minutes.

132. 132. The method of any one of claims 103 to 131, wherein the second period of time does not exceed 5 minutes.

133. 133. The method of any one of claims 112 to 116 or claims 126 to 132, wherein the first portion of the first period of time does not exceed 2 minutes, for example the first period of time is about 1 minute.

134. 134. A method according to any one of claims 113 to 116 or claims 127 to 133, wherein the first portion of the second period of time does not exceed 2 minutes, for example the second period of time is about 1 minute.

135. n 1 and n 2 The method of any one of claims 103 to 134, wherein the flow rate is in the range of 20 mL / min to 20 L / min.

136. 136. The method of any one of claims 103 to 135, wherein the first liquid has a volume of between 40 mL and 100 L.

137. 137. The method of any one of claims 103 to 136, wherein the second liquid has a volume of 40 mL and 100 L.

138. 138. The method of any one of claims 103 to 137, wherein the mRNA in the second liquid has a concentration of 0.01 mg / mL to 5 mg / mL.

139. 139. The method of any one of claims 103 to 138, wherein the first liquid is a preformed suspension of empty LNPs.

140. 140. The method of any one of claims 103 to 139, wherein the second liquid is a solution of mRNA in water for injection.

141. 1. An apparatus for encapsulating messenger RNA (mRNA) in preformed empty lipid nanoparticles (LNPs) by mixing a first liquid containing the preformed empty LNPs with a second liquid containing the mRNA, comprising: First pump, Second pump, mixed joint, Intermediate container, a first heat exchanger; an LNP conduit arrangement configured to direct the first liquid to the mixing junction via the first pump; an arrangement of an mRNA conduit configured to direct the second liquid to the mixing junction via the second pump, wherein the first and second liquids form a mixture at the mixing junction; A recycling loop, a recycle loop configured to direct the mixed liquor from the mixing junction to the first heat exchanger and from the first heat exchanger to the intermediate vessel, the recycle loop directing the mixed liquor from the intermediate vessel through: to direct placement of the LNP conduit upstream of the first pump; or a recycling loop configurable to direct placement of the mRNA conduit upstream of the second pump.

142. 1. An apparatus for encapsulating messenger RNA (mRNA) in preformed empty lipid nanoparticles (LNPs) by mixing a first liquid containing the preformed empty LNPs with a second liquid containing the mRNA, comprising: First pump, Second pump, a source of said first liquid; a source of said second liquid; mixed joint, an LNP conduit arrangement configured to direct the first liquid from a source of the first liquid to the mixing junction via the first pump; an mRNA conduit arrangement configured to direct the second liquid from a source of the second liquid to the mixing junction via the second pump, wherein the first and second liquids form a mixture at the mixing junction; a recycle loop, the mixed liquid being to direct placement of the LNP conduit upstream of the first pump; or a recycling loop configurable to direct placement of the mRNA conduit upstream of the second pump.

143. 143. The apparatus of claim 141 or 142, wherein the recycle loop is configured to direct the mixed liquor to a first conduit arrangement upstream of the first pump.

144. 143. The apparatus of claim 141 or 142, wherein the recycle loop is configured to direct the mixed liquor to a second conduit arrangement upstream of the second pump.

145. The first pump pumps the first liquid at a flow rate n 1 the second pump is configured to pump the second liquid at a flow rate n 2 configured to pump in the n 1 is n 2 144. An apparatus according to any one of claims 141 to 143, wherein the

146. The first pump pumps the mixed liquid at a flow rate n 3 configured to pump with 3 is n 1 The device of claim 145, wherein the

147. 147. The apparatus of claim 146, wherein the first pump is configured to increase the flow rate of the mixed liquid each time the mixed liquid passes through the recycle loop.

148. The first pump pumps the first liquid at a flow rate m 1 the second pump is configured to pump the second liquid at a flow rate m 2 configured to pump in the m 2 is m 1 145. The device of claim 141, 142, or 144, wherein the

149. The second pump pumps the mixed liquid at a flow rate m 3 configured to pump in at m 3 is m 2 The device of claim 148, wherein the

150. 150. The apparatus of claim 149, wherein the second pump is configured to increase the flow rate of the mixed liquid each time the mixed liquid passes through the recycle loop.

151. the recycle loop further comprising: The device of any one of claims 141 to 150, configured to direct the mixed liquid from the mixing junction to an intermediate container or the intermediate container, and then direct the mixed liquid to the LNP conduit arrangement or the mRNA conduit arrangement.

152. moreover, The device of any one of claims 141 to 151, comprising a first heat exchanger or the first heat exchanger, and the recycle loop is further configured to direct the mixed liquid from the mixing junction to the first heat exchanger and then to direct the mixed liquid to the LNP conduit arrangement or the mRNA conduit arrangement.

153. the recycle loop further comprising:

153. The apparatus of claim 151 or 152, configured to direct the mixed liquid to the first heat exchanger, and then direct the mixed liquid to the intermediate vessel.

154. 154. Apparatus according to any one of claims 141 to 153, wherein the first heat exchanger is configured to heat the mixed liquid to a temperature of from 60°C to 70°C, such as from 63°C to 67°C, for example about 65°C.

155. moreover, a first storage container configured to store the first liquid, disposed upstream of the first pump and in fluid communication with the LNP conduit arrangement; and 155. The apparatus of any one of claims 141 to 154, comprising a second storage container configured to store the second liquid, positioned upstream of the second pump, and in fluid communication with the mRNA conduit arrangement.

156. 156. Apparatus according to claim 155, wherein the first storage container is configured to store the first liquid at a temperature of between 60°C and 70°C, such as between 63°C and 67°C, for example around 65°C.

157. moreover, 157. Apparatus according to any one of claims 141 to 156, comprising a conduit output arrangement configured to direct the mixed liquid from the mixing junction to a final storage vessel.

158. moreover, 158. The apparatus of claim 157, further comprising a second heat exchanger, and wherein the conduit output arrangement is further configured to direct the mixed liquid through the second heat exchanger and thereafter direct the mixed liquid to the final storage container.

159. 159. Apparatus according to claim 158, wherein the second heat exchanger is configured to cool the mixture to a temperature of between 19°C and 23°C, for example between 20°C and 22°C, for example about 21°C.

160. 160. An apparatus according to any one of claims 141 to 159, wherein the first and / or second pump is a pulseless flow pump, for example the first and / or second pump is a gear pump or a centrifugal pump.

161. 161. Apparatus according to any one of claims 141 to 160, wherein the mixed joint is a T-joint.

162. 1. An apparatus for encapsulating messenger RNA (mRNA) in preformed empty lipid nanoparticles (LNPs) by mixing a first liquid containing the preformed empty LNPs with a second liquid containing the mRNA, comprising: First pump, Second pump, mixed joint, an LNP conduit arrangement configured to direct the first liquid to the mixing junction via the first pump; an arrangement of an mRNA conduit configured to direct the second liquid to the mixing junction via the second pump, wherein the first and second liquids form a mixture at the mixing junction; a recycle loop, the mixed liquid being to direct placement of the LNP conduit upstream of the first pump; or a recycling loop configured to direct placement of the mRNA conduit upstream of the second pump; and A processor, configured to operate the first pump at a first flow rate and the second pump at a second flow rate for a first period of time; and When the recycle loop is configured to direct the mixed liquid to the LNP conduit arrangement, n of the first flow rate is 1 configured to drive the first pump at the second flow rate and the second pump at the second flow rate; or When the recycle loop is configured to direct the mixed liquor to the LNP conduit arrangement, driving the first pump at the first flow rate for a second period of time, and 1 a processor configured to drive the second pump in a double

163. The method is carried out using an apparatus according to any one of claims 141 to 162, the method further comprising: passing a first stream of RNase-free water through said device; passing a flow of sodium hydroxide solution through said device; and 141. The method of any one of claims 103 to 140, comprising passing a second stream of RNase-free water through the device.

Citation Information

Patent Citations

  • n-terminal functionalized amino acid derivatives capable of forming drug-encapsulating microspheres

    JP2014534220A

  • Hybridosomes, compositions containing same, methods of their preparation and uses thereof

    JP2017502997A

  • Lipids for the delivery of active agents

    WO2013086373A1

  • Liposome compositions comprising weak acid drugs and uses thereof

    WO2019023092A1