Compositions, methods and uses of messenger RNA
mRNA-based compositions with ubiquitin pathway portions and binding peptides, encapsulated in lipid nanoparticles, address the delivery limitations of small molecule- or peptide-based constructs by enabling rapid and transient protein degradation based on post-translational modification states.
Patent Information
- Application Number
- JP2025116950
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-09-28
- Filing Date
- 2025-07-11
- Publication Date
- 2025-11-13
AI Technical Summary
Existing methods for selective proteolysis in cells are limited by the difficulty in delivering small molecule- or peptide-based constructs to target proteins, restricting the size of deliverable constructs and efficacy.
mRNA-based compositions encoding ubiquitin pathway portions and binding peptides, encapsulated in lipid nanoparticles, for targeted and selective degradation of proteins, including fusion proteins with internal ribosome entry sites and various E3 ubiquitin ligases.
Achieves rapid and transient degradation of target proteins based on post-translational modification states, with ease of delivery and concentration-dependent effects.
Smart Images

Figure 2025169471000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 923,711, filed October 21, 2019, U.S. Provisional Application No. 62 / 934,842, filed November 13, 2019, and U.S. Provisional Application No. 63 / 084,422, filed September 28, 2020, each of which is incorporated by reference in its entirety. Incorporation by reference of sequence listing
[0001] This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on October 20, 2020, is named MRT-2120WO_ST25.txt and is 20 KB in size. No new matter is added hereby. [Background technology]
[0002] The degradation of cellular proteins is required for normal maintenance of cellular functions, including proliferation, differentiation, and cell death. The irreversible nature of proteolysis makes it well suited to serve as a regulatory switch that controls unidirectional processes. This principle is evident in the control of the cell cycle, where the initiation of DNA replication, chromosome segregation, and exit from mitosis are triggered by the destruction of key regulatory proteins.
[0003] One of the major pathways for post-translational protein regulation is ubiquitin-dependent protein degradation. The first step in selective degradation is the ligation of one or more ubiquitin molecules to a protein substrate. Ubiquitination occurs through the activity of ubiquitin-activating enzymes (E1), ubiquitin-conjugating enzymes (E2), and ubiquitin protein ligases (E3), which act sequentially to catalyze the attachment of ubiquitin to lysine residues on substrate proteins (see Ciechanover A., et al., BioEssays, 22:442-451 (2000)). E3 protein ligases confer specificity to the ubiquitination reaction by directly binding to the substrate. Many diseases and disorders are caused by the abnormal expression of proteins. Therefore, targeting such abnormally expressed proteins for degradation is a promising therapeutic approach for addressing a wide range of diseases or disorders. However, the utilization of cells' own systems for selective proteolysis has been limited to a limited number of target proteins for which well-known small molecules or peptides exist that bind to these proteins with high specificity to enable selective proteolysis. Typically, such proteins or peptides are linked to ligase-binding molecules (e.g., other small molecules or peptides). However, the effective delivery of such small molecule- or peptide-based constructs to target proteins within cells is difficult, significantly limiting the size of the constructs that can be delivered. Therefore, there is a need in the art for improved methods and compositions useful for selective proteolysis. [Prior art documents] [Non-patent literature]
[0004] [Non-Patent Document 1] Ciechanover A., et al., BioEssays, 22:442-451 (2000) Summary of the Invention [Means for solving the problem]
[0005] The present invention provides mRNA-based compositions and methods for selective degradation of a target protein of interest. In particular, the compositions and methods described herein provide effective in vivo delivery of mRNA encoding a ubiquitin pathway portion and a binding protein, which specifically result in degradation of the target protein. In some embodiments, the compositions and methods described herein provide effective in vivo delivery of mRNA encoding at least two binding peptides, a first binding peptide that binds to a ubiquitin pathway portion and a second binding peptide that binds to the target protein, such that binding to the target protein causes selective degradation of the target protein. The mRNA-based compositions and methods described herein have several advantages over other compositions and methods for selective targeted degradation (such as siRNA). These advantages include, for example, rapid targeting of the target protein for degradation, transient degradation effects, and ease of delivery of the compositions described herein. Additional advantages include the ability to target desired proteins for degradation based on their post-translational modification state.
[0006] In one aspect, the present invention provides, inter alia, messenger RNA (mRNA) encoding a ubiquitin pathway portion and a binding peptide that binds to a target protein, wherein the mRNA is encapsulated within a lipid nanoparticle. In some embodiments, the ubiquitin pathway portion and the binding peptide form a fusion protein. For example, in some embodiments, an mRNA encoding both the ubiquitin pathway portion and the binding peptide that binds to the target protein forms the fusion peptide. In some embodiments, the fusion protein comprises an internal ribosome entry site (IRES). In some embodiments, at least two mRNAs are provided, wherein a first mRNA encodes a ubiquitin pathway portion and a second mRNA encodes a binding peptide that binds to the target protein.
[0007] In some embodiments, the ubiquitin pathway moiety is an E3 ubiquitin ligase, an E3 ligase adaptor, or a protein or peptide capable of inducing the ubiquitin-proteasome pathway.
[0008] In some embodiments, the binding peptide specifically recognizes and binds to a target protein for degradation.
[0009] In some embodiments, the mRNA encoding the ubiquitin pathway portion and binding peptide that binds to the target protein degrades the target protein in a concentration-dependent manner.
[0010] In some embodiments, the ubiquitin pathway portion and the binding peptide are separated by a linker.
[0011] In some embodiments, the ubiquitin pathway portion is a ubiquitin pathway protein.
[0012] In some embodiments, the linker is a GS linker. For example, in some embodiments, the GS linker comprises: (GS) × , where X=1-15. In some embodiments, the GS linker comprises: (G y S) x , x=1~15, y=1~10.
[0013] In some embodiments, the ubiquitin pathway portion and the binding peptide are not separated by a linker.
[0014] In some embodiments, the ubiquitin pathway portion is an E3 adaptor protein.
[0015] In some embodiments, the E3 adaptor protein binds its substrate recognition domain The peptide is engineered to be substituted.
[0016] In some embodiments, the E3 adaptor protein is selected from SPOP, CHIP, CRBN, VHL, XIAP, MDM2, cereblon, and cIAP. Thus, in some embodiments, the E3 adaptor protein is SPOP. In some embodiments, the E3 adaptor protein is CHIP. In some embodiments, the E3 adaptor protein is VHL. In some embodiments, the E3 adaptor protein is XIAP. In some embodiments, the E3 adaptor protein is MDM2. In some embodiments, the E3 adaptor protein is cereblon. In some embodiments, the E3 adaptor protein is cIAP.
[0017] In some embodiments, the ubiquitin pathway portion is an antibody that specifically binds to an E3 adaptor protein or an E3 ligase. In some embodiments, the antibody that specifically binds to an E3 adaptor protein is SPOP, CHIP, CRBN, VHL, XIAP, MDM2, or cIAP. In some embodiments, the antibody that specifically binds to an E3 adaptor protein is SPOP. In some embodiments, the antibody that specifically binds to an E3 adaptor protein is CHIP. In some embodiments, the antibody that specifically binds to an E3 adaptor protein is CRBN. In some embodiments, the antibody that specifically binds to an E3 adaptor protein is VHL. In some embodiments, the antibody that specifically binds to an E3 adaptor protein is XIAP. In some embodiments, the antibody that specifically binds to an E3 adaptor protein is MDM2. In some embodiments, the antibody that specifically binds to an E3 adaptor protein is cIAP.
[0018] In some embodiments, the binding peptide is an antibody or antibody fragment. In some embodiments, the binding peptide is an antibody or antibody fragment that specifically binds to the target protein.
[0019] In some embodiments, the binding peptide is a protein that binds to or complexes with a target protein. In some embodiments, the protein that binds to or complexes with a target protein of interest is endogenous to the target cell. In some embodiments, the target protein is aberrantly expressed in the target cell. In some embodiments, the target protein is an intracellular protein. In some embodiments, the target protein is a nuclear protein. In some embodiments, the target protein is an enzyme. In some embodiments, the target protein is a protein involved in cell signaling. In some embodiments, the target protein is a protein involved in cell division. In some embodiments, the target protein is a protein involved in metabolism. In some embodiments, the target protein is a protein involved in the inflammatory response.
[0020] In one aspect, the present invention provides, inter alia, messenger RNA (mRNA) encoding at least two binding peptides, wherein a first binding peptide binds to a ubiquitin pathway portion and a second binding peptide binds to a target protein, wherein the mRNA is encapsulated within a lipid nanoparticle. In some embodiments, a single mRNA encodes at least two binding peptides, wherein a first binding peptide binds to a ubiquitin pathway portion and a second binding peptide binds to a target protein, wherein the mRNA is encapsulated within a lipid nanoparticle. In some embodiments, at least two mRNAs are provided, including a first mRNA encoding a first binding peptide and a second mRNA encoding a second binding peptide. In some embodiments, the first mRNA and the second mRNA are encapsulated within separate lipid nanoparticles (LNPs). In some embodiments, the first mRNA and the second mRNA are encapsulated within separate lipid nanoparticles (LNPs). The NA is encapsulated in a separate lipid nanoparticle. In some embodiments, the binding peptides encoded by the first mRNA and the second mRNA are linked to each other to generate a linked fusion-like moiety.
[0021] In some embodiments, the first binding peptide and the second binding peptide are separated by a linker.
[0022] In some embodiments, the linker is a GS linker.
[0023] In some embodiments, the first binding peptide and the second binding peptide are not separated by a linker.
[0024] In some embodiments, the ubiquitin pathway portion is a ubiquitin pathway protein.
[0025] In some embodiments, the ubiquitin pathway portion is an E3 adaptor protein.
[0026] In some embodiments, the E3 adaptor protein is selected from SPOP, CHIP, CRBN, VHL, XIAP, MDM2, and cIAP.
[0027] In some embodiments, the first binding peptide is an antibody or antibody fragment.
[0028] In some embodiments, the second binding peptide is an antibody or antibody fragment.
[0029] In some embodiments, the antibody or antibody fragment is a nanobody, Fab, Fab', Fab'2, F(ab')2, Fd, Fv, Feb, scFv, or SMIP. In some embodiments, the antibody or antibody fragment binds to an E3 ligase adaptor protein. In some embodiments, the antibody or antibody fragment binds to SPOP, CHIP, CRBN, VHL, XIAP, MDM2, cereblon, and / or cIAP. Thus, in some embodiments, the construct encodes an antibody or antibody fragment that binds to SPOP. In some embodiments, the construct encodes an antibody or antibody fragment that binds to CHIP. In some embodiments, the construct encodes an antibody or antibody fragment that binds to CRBN. In some embodiments, the construct encodes an antibody or antibody fragment that binds to VHL. In some embodiments, the construct encodes an antibody or antibody fragment that binds to XIAP. In some embodiments, the construct encodes an antibody or antibody fragment that binds to MDM2. In some embodiments, the construct encodes an antibody or antibody fragment that binds to cereblon. In some embodiments, the construct encodes an antibody or antibody fragment that binds to cIAP.
[0030] In some embodiments, the mRNA further encodes a signal peptide.
[0031] In some embodiments, the signal peptide is a nuclear localization sequence.
[0032] In some embodiments, the signal peptide is an endoplasmic reticulum (ER) signal sequence.
[0033] In some embodiments, the signal peptide is an endoplasmic reticulum (ER) retention sequence.
[0034] In some embodiments, the signal peptide is a cellular secretory sequence.
[0035] In some embodiments, the lipid nanoparticles comprise one or more cationic lipids, one or more non- It comprises a cationic lipid, one or more cholesterol-based lipids, and one or more PEG-modified lipids.
[0036] In some embodiments, the one or more cationic lipids are selected from the group consisting of cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), and combinations thereof.
[0037] In some embodiments, the one or more cationic lipids comprise cKK-E12.
[0038] In some embodiments, the target protein comprises a phosphorylated form of the target protein, a non-phosphorylated form of the target protein, a lipidated form of the target protein, a non-lipidated form of the target protein, a propeptide form of the target protein, a glycosylated form of the target protein, a non-glycosylated form of the target protein, an oxidized form of the target protein, a non-oxidized form of the target protein, a carbonylated form of the target protein, a non-carbonylated form of the target protein, a formylated form of the target protein, a non-formylated form of the target protein, an acylated form of the target protein, a non-acylated form of the target protein, an alkylated form of the target protein, a non-alkylated form of the target protein, a sulfonated form of the target protein, a non-sulfonated form of the target protein, an s-nitrated form of the target protein, a non-s-nitrated form of the target protein, a glutathionylated form of the target protein, a non-glutathionylated form of the target protein, an adenylated form of the target protein, a non-adenylated form of the target protein, or an ATP- or ADP-bound form of the protein.
[0039] In some embodiments, the target protein is bound to a receptor.
[0040] In one aspect, a pharmaceutical composition is provided comprising the mRNA of any one of the embodiments described herein.
[0041] In one aspect, there is provided a method of inducing protein degradation comprising administering an mRNA described in any one of the embodiments described herein.
[0042] In some embodiments, the mRNA is administered intravenously, intradermally, subcutaneously, intrathecally, orally, or by inhalation or nebulization.
[0043] In one aspect, a cell is provided comprising the mRNA described in any one of the embodiments described herein.
[0044] In one aspect, a method of treating a subject suffering from a disease or disorder associated with aberrant protein expression, comprising administering to a subject in need thereof an mRNA as described herein, wherein administration of the mRNA results in selective degradation of the aberrantly expressed protein.
[0045] In some embodiments, the disease or disorder is a prion-based disease. In some embodiments, the disease or disorder is polycystic kidney disease. In some embodiments, the disease or disorder is Pelizaeus-Merzbacher disease. In some embodiments, the disease or disorder is an inflammatory disease. In some embodiments, the disease or disorder is cancer. [Brief explanation of the drawings]
[0046] The drawings are for purposes of illustration and not limitation.
[0047] [Figure 1A] 1A is a schematic diagram of an mRNA construct comprising sequences encoding vhhGFP4, an E3 ligase, and a FLAG tag. Optionally, the construct comprises sequences encoding an ER signal peptide, an ER retention signal, and / or a linker, shown as "^." [Figure 1B] FIG. 1B shows the subcellular localization and design of the mRNA constructs Construct A and Construct E. [Figure 2A] Figure 2A shows an image of untreated GFP-expressing HeLa cells. GFP is shown in the upper left panel, nuclear DNA staining is shown in the upper right panel, and FLAG, which indicates E3 ubiquitin ligase expression, is shown in the lower left panel. The lower right panel is a merged image. [Figure 2B] Figure 2B is a merged image of the GFP and FLAG signals. [Figure 3A]Figure 3A shows an image of GFP-expressing HeLa cells 24 hours after transfection with mRNA construct A (shown in Figure 1A and Figure 1B). GFP is shown in the upper left panel, nuclear DNA is shown in the upper right panel, and FLAG, which indicates E3 ubiquitin ligase expression, is shown in the lower left panel. A merged image is displayed in the lower right panel. [Figure 3B] Figure 3B is a magnified merged image of the GFP and FLAG signals. The arrow indicates an exemplary cell showing reduced or absent GFP signal in cells containing the vector construct (i.e., cells with SPOP E3 ubiquitin ligase). [Figure 4A] Figure 4A shows an image of GFP-expressing HeLa cells 24 hours after transfection with mRNA construct C, which contains the ER signal peptide and ER retention signal (shown in Figures 1A and 1B). GFP is shown in the upper left panel, DNA is shown in the upper right panel, and FLAG, which indicates E3 ubiquitin ligase expression, is shown in the lower left panel. A merged image is displayed in the lower right panel. [Figure 4B] Figure 4B is a magnified merged image of GFP and FLAG signals. The dashed arrow indicates an exemplary cell transfected with the vector and presenting reduced amounts of GFP (as shown by FLAG immunostaining). The solid arrow indicates an exemplary cell expressing E3 ubiquitin ligase and presenting reduced or absent GFP signals. [Figure 5A] Figure 5A shows an image of GFP-expressing HeLa cells 24 hours after transfection with mRNA construct D (shown in Figures 1A and 1B). GFP is shown in the upper left panel, nuclear DNA is shown in the upper right panel, and FLAG, which indicates E3 ubiquitin ligase expression, is shown in the lower left panel. A merged image is displayed in the lower right panel. [Figure 5B]Figure 5B is a magnified merged image of the GFP and FLAG signals. The dashed arrow indicates an exemplary cell expressing both GFP and E3 ubiquitin ligase. The solid arrow indicates an exemplary cell expressing E3 ubiquitin ligase with reduced or absent GFP signal. [Figure 6A] Figure 6A shows images of GFP-expressing HeLa cells 24 hours after transfection with mRNA construct E. GFP is shown in the upper left panel, nuclear DNA is shown in the upper right panel, and FLAG, which indicates E3 ubiquitin ligase expression, is shown in the lower right panel. A merged image is shown in the lower right panel. [Figure 6B] Figure 6B is a magnified merged image of the GFP and FLAG signals. The dashed arrow indicates an exemplary cell expressing both GFP and E3 ubiquitin ligase. The solid arrow indicates an exemplary cell expressing E3 ubiquitin ligase with reduced or absent GFP signal. [Figure 7A] Figure 7A shows an image of GFP-expressing HeLa cells 24 hours after transfection with mRNA construct F (shown in Figures 1A and 1B). GFP is shown in the upper left panel, nuclear DNA is shown in the upper right panel, and FLAG, which indicates E3 ubiquitin ligase expression, is shown in the lower left panel. [Figure 7B] Figure 7B is a magnified merged image of the GFP and FLAG signals. The dashed arrow indicates an exemplary cell expressing both GFP and E3 ubiquitin ligase. The solid arrow indicates an exemplary cell expressing E3 ubiquitin ligase with reduced or absent GFP signal. [Figure 8A]Figure 8A shows a series of images of HEK293 cells 6 hours after transfection. In the upper left panel, untreated HEK293 cells (Sample 1 listed in Table 2) show a signal for nuclear DNA only. The upper right panel (Sample 2) shows cells transfected with GFP mRNA, which show signals for nuclear DNA and GFP. The lower left panel (Sample 3) shows Construct A (shown in Figures 1A and 1B), which shows staining for nuclear DNA and FLAG, indicating localization of E3 ubiquitin ligase as nuclear speckles. The lower right panel (Sample 4) shows Construct E (shown in Figures 1A and 1B), which shows signals for nuclear DNA and FLAG, indicating localization of E3 ubiquitin ligase in the cytoplasm. [Figure 8B] Figure 8B shows a series of images of HEK293 cells 24 hours after transfection. In the upper left panel, untreated HEK293 cells (Sample 7 listed in Table 2) show only nuclear DNA signals. The upper right panel (Sample 8) shows cells transfected with GFP mRNA, which show nuclear DNA and GFP signals. The lower left panel (Sample 9) shows Construct A (shown in Figures 1A and 1B), which shows nuclear DNA and FLAG signals, indicating E3 ubiquitin ligase localization as nuclear speckles. The lower right panel (Sample 10) shows Construct E (shown in Figures 1A and 1B), which shows nuclear DNA and FLAG signals, indicating E3 ubiquitin ligase localization in the cytoplasm. [Figure 9A]Figure 9A is a series of images of HEK293 cells 6 hours after transfection with Construct A and GFP mRNA (Sample 5 shown in Table 2). GFP signals are displayed in the left panel. The right panel shows a merged image of the GFP and FLAG signals. Solid arrows indicate exemplary cells that expressed E3 ubiquitin ligase with reduced or absent GFP signals. Figure 9B is a series of images of HEK293 cells 24 hours after transfection with Construct A and GFP mRNA (Sample 11 shown in Table 2). GFP signals are displayed in the left panel. The right panel shows a merged image of the GFP and FLAG signals. Solid arrows indicate exemplary cells that expressed E3 ubiquitin ligase with reduced or absent GFP signals. [Figure 9B] Same as above. [Figure 10A] Figure 10A shows a series of images of HEK293 cells 6 hours after transfection with Construct E and GFP mRNA (Sample 6 shown in Table 2). GFP signal is displayed in the left panel. The right panel shows a merged image of GFP and FLAG signals. Solid arrows indicate exemplary cells that expressed E3 ubiquitin ligase and showed reduced or absent GFP signal. [Figure 10B] Figure 10B is a series of images of HEK293 cells 24 hours after transfection with Construct E and GFP mRNA (Sample 12 shown in Table 2). GFP signal is displayed in the left panel. The right panel shows a merged image of GFP and FLAG signals. Solid arrows indicate exemplary cells that expressed E3 ubiquitin ligase and showed reduced or absent GFP signal. [Figure 11] Figure 11 shows a series of images of H2B-tagged, GFP-expressing HeLa cells 24 hours after transfection with construct A. The DAPI signal, indicating nuclear DNA, is shown in the upper left panel, GFP is shown in the upper right panel, and FLAG, indicating E3 ubiquitin ligase expression, is shown in the lower left panel. The lower right panel shows a merged image of the GFP and FLAG signals. [Figure 12] Figure 12 shows a series of images of H2B-tagged, GFP-expressing HeLa cells 24 hours after transfection with construct E. The DAPI signal, indicating nuclear DNA, is shown in the upper left panel, GFP is shown in the upper right panel, and FLAG, indicating E3 ubiquitin ligase expression, is shown in the lower left panel. The lower right panel shows a merged image of the GFP and FLAG signals. [Figure 13A] Figures 13A-D show a series of graphs and Western blots showing the dose-response effect of Construct E. Figure 13A shows an exemplary graph showing the dose-response effect of the E3 ubiquitin ligase encoded by Construct E on the proteolysis of GFP. HeLa cells, which do not endogenously express GFP, were co-transfected with GFP mRNA and Construct E at various concentrations. ELISA was used to determine the concentration of GFP 24 hours after co-transfection. [Figure 13BC] Figure 13B shows the percent knockdown of GFP in HeLA cells after treatment with construct E and GFP mRNA by ELISA. Figure 13C shows a Western blot of FLAG. Figure 13D shows both a Western blot of GFP and a graph showing that GFP expression was reduced in a concentration-dependent manner. [Figure 13D] Same as above. [Figure 14] Figure 14 is an exemplary graph showing a time course study of GFP degradation induced by the E3 ubiquitinase encoded by construct E. HeLa cells, which do not endogenously express GFP, were co-transfected with GFP mRNA and construct E. ELISA was used to determine the concentration of GFP at various time points from 0 to 34 hours post-transfection. [Figure 15]Figure 15 is an exemplary graph showing a time course study of GFP degradation induced by the E3 ubiquitin ligase encoded by construct A. HeLa cells stably expressing HH2B-GFP in the nucleus were transfected with construct A. ELISA was used to determine the concentration of GFP at various time points from 0 to 72 hours post-transfection. [Figure 16] Figure 16 is an exemplary schematic diagram showing the study design of an in vitro cell-free translation system. Cytoplasmic extracts are prepared from HeLa cells. The cytoplasmic extracts containing a functional translation system are supplemented with mRNA encoding a target protein (e.g., GFP or A1AT) or a recombinant protein, in addition to mRNA encoding an E3 ubiquitin ligase. At various time points, samples are taken to quantify the amount of target protein by ELISA, Western blot, or qPCR. [Figure 17A] Figure 17A is an exemplary graph showing a time course study of recombinant GFP degradation induced by the E3 ubiquitin ligase encoded by Construct E in a cell-free translation system (CFTS). Cytoplasmic extracts were supplemented with GFP mRNA (5 pmol) and Construct E at various ratios of GFP mRNA:Construct E. As negative controls, a sample was supplemented with GFP mRNA only, and another sample was supplemented with no mRNA. The amount of GFP protein was quantified at various time points by ELISA. [Figure 17B] FIG. 17B is a graph showing a time course study of recombinant GFP degradation induced by the E3 ubiquitin ligase encoded by construct E in a cell-free translation system (CFTS). [Figure 17CDE] Figure 17C is a schematic diagram of construct G containing the E3 ligase cereblon. Figure 17D is a graph showing anti-GFP concentration response using construct G in a cell-free translation system (CFTS). Figure 17E is a graph showing GFP percentage at 1 hour, 2 hours, and 3 hours after contact with construct G at 2x or 6x concentration. [Figure 17F]Figure 17F is a schematic diagram showing various bioPROTAC designs containing the E3 ligase cereblon. The bioPROTAC designs include construct M, which encodes an anti-PNPLA3 scFv, and construct N, which contains the PNPLA3 protein binder ABHD5. [Figure 17G] Figure 17G is a graph depicting data obtained from an ELISA assay demonstrating a concentration-dependent decrease in PNPLA3 levels with increasing concentrations of bioPROTAC construct M. [Figure 18] Figure 18A is a schematic diagram of an mRNA construct containing sequences encoding vhhGFP4, SPOP E3 ligase, and a FLAG tag. The SPOP E3 ligase contains a nuclear localization signal (NLS). To examine the effect of linker length on GFP protein degradation, various linker lengths were introduced between vhhGFP4 and SPOP. Figure 18B is an exemplary graph showing a time course study of GFP degradation induced by the E3 ubiquitin ligase encoded by construct A with various linker lengths (constructs A1–A5, Table 4) in a cell-free translation system. Cytoplasmic extracts were supplemented with GFP mRNA and variants of construct A. As a negative control, a sample was supplemented with GFP mRNA alone. The amount of GFP protein was quantified at various time points by ELISA. [Figure 19] 19 is a schematic diagram of an mRNA construct comprising sequences encoding scFv4B12 that specifically targets A1AT, E3 ligase (hVHL or CHIP), and a FLAG tag. Optionally, the construct includes sequences encoding an ER signal peptide, an ER retention signal, and / or a linker, shown as "^." [Figure 20]Figure 20A is an exemplary graph showing the dose-response effect of the E3 ubiquitin ligase encoded by construct E on the proteolysis of A1AT. HeLa cells that do not endogenously express A1AT were co-transfected with the A1AT plasmid and the constructs shown in Figure 19 at various concentrations. The A1AT concentration was determined 24 hours after co-transfection using ELISA. Figure 20B is an exemplary graph showing the dose-response effect of the E3 ubiquitin ligase encoded by construct E on the proteolysis of A1AT in an in vitro cell-free translation system. Cytoplasmic extracts were supplemented with 4 pmol of A1AT mRNA and various ratios of the constructs shown in Figure 19. As a negative control, samples were supplemented with A1AT mRNA alone. The amount of A1AT protein was quantified at various time points by ELISA. [Figure 21A] Figures 21A and 21B show a schematic, graph, and Western blot showing the dose-response effect of Construct G. Figure 21A shows a schematic of Construct G and a graph showing the percentage of GFP knockdown in HeLA cells after treatment with Construct G bioPROTAC RNA and GFP mRNA. [Figure 21B] FIG. 21B shows a GFP Western blot from a study using construct G and its associated graphic representation. [Figure 21CD] Figure 21C shows a FACS plot of HeLA cells transfected with different ratios of construct G and GFP RNA (1:1, 4:1, and 10:1). Figure 21D is a bar graph showing GFP expression at a 1:1 ratio of construct G and GFP RNA with or without the proteasome inhibitor MG132. [Figure 22A] Figure 22A is a graph showing the results of a GFP ELISA from HeLA cells treated with Construct G bioPROTAC RNA with or without 5 uM proteome inhibitor MG-132. [Figure 22B]Figure 22B shows a GFP Western blot with and without the proteasome inhibitor MG-132 and also shows a graph corresponding to the GFP Western blot results. [Figure 23] Figure 23A is a schematic diagram showing the design of various bioPROTAC designs, including a bispecific anti-cereblon bioPROTAC. Figure 23B is a schematic diagram showing the binding of bioPROTACs to cereblon (CRBN) in an E3 ligase complex. Figure 23C is a graph showing the knockdown rate in HeLa cells co-transfected with GFP RNA and bioPROTAC RNA at various concentrations. [Figure 24] Figure 24A is a schematic diagram showing various bioPROTAC designs used to evaluate the expression duration of bioPROTACs administered in vivo, and Figure 24B is a graph showing hepatic GFP expression (μg GFP / mg protein) at 6 and 24 hours post-administration. DETAILED DESCRIPTION OF THE INVENTION
[0048] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions of these and other terms are set forth throughout the specification.
[0049] PROTACs (proteolysis-targeting chimeras) are heterofunctional small molecules consisting of two active domains and, optionally, a linker that can remove specific undesired proteins. Rather than acting as traditional enzyme inhibitors, PROTACs act by inducing selective intracellular protein degradation. PROTACs generally consist of two covalently linked protein-binding molecules: one capable of engaging an E3 ubiquitin ligase and the other binding to the target protein intended for degradation. Recruitment of the E3 ligase to the target protein results in ubiquitination and subsequent degradation of the target protein by the proteasome. PROTACs simply bind to the target with high selectivity, rather than inhibiting the enzymatic activity of the target protein. PROTAC technology can be applied to drug discovery using various E3 ligases, including, for example, SPOP, CHIP, pVHL, MDM2, beta-TrCP1, cereblon, and c-IAP1.
[0050] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or parasites. In some embodiments, the animal may be a transgenic animal, a genetically engineered animal, and / or a clone.
[0051] Approximately or about: As used herein, the term "approximately" or "about" as applied to one or more values of interest refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) of the stated reference value, unless otherwise specified or otherwise clear from the context (except when such number exceeds 100% of the possible values).
[0052] Delivery: As used herein, the term "delivery" encompasses both local and systemic delivery. For example, delivery of mRNA refers to a situation in which the mRNA is delivered to a target tissue, the encoded protein is expressed, and the protein is retained within the target tissue ("local distribution"). or "local delivery"), and situations in which mRNA is delivered to a target tissue, the encoded protein is expressed and secreted into the patient's circulatory system (e.g., serum), and is distributed throughout the body and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").
[0053] Encapsulation: As used herein, the term "encapsulation," or grammatical equivalents, refers to the process of confining individual mRNA molecules within nanoparticles.
[0054] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into polypeptides, the assembly of multiple polypeptides into an intact protein (e.g., an enzyme), and / or the post-translational modification of the polypeptides or fully assembled protein (e.g., an enzyme). In this application, the terms "expression" and "production" and grammatical equivalents are used interchangeably.
[0055] Half-life: As used herein, the term "half-life" is the time it takes for a quantity, such as the concentration or activity of a nucleic acid or protein, to fall to half of the value measured at the beginning of a period.
[0056] Improve, increase, or reduce: As used herein, "improve," "increase," or "reduce," or grammatical equivalents, refer to a value compared to a baseline measurement, e.g., a measurement in the same individual before initiation of a treatment described herein, or a measurement in a control subject (or control subjects) in the absence of a treatment described herein. A "control subject" is a subject suffering from the same form of disease as the subject being treated and who is approximately the same age as the subject being treated.
[0057] In vitro: As used herein, the term "in vitro" refers to events that take place in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multicellular organism.
[0058] In vivo: As used herein, the term "in vivo" refers to events that occur within a multicellular organism, such as a human or non-human animal. In the context of a cell-type system, the term can be used to refer to events that occur within a living cell (e.g., as opposed to an in vitro system).
[0059] Local distribution or local delivery: As used herein, the terms "local distribution," "local delivery," or grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or local delivery requires an mRNA-encoded protein (e.g., an enzyme) that is translated and expressed intracellularly or that is secreted only to avoid it entering the patient's circulatory system.
[0060] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA can contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems, or optionally purified, chemically synthesized, etc. Optionally, for example, in the case of chemically synthesized molecules, mRNA can contain nucleoside analogs, such as analogs with chemically modified bases or sugars, backbone modifications, etc. mRNA sequences are presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, mRNA contains natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3- methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases base); modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).
[0061] Patient: As used herein, the term "patient" or "subject" refers to any organism to which provided compositions can be administered, e.g., for experimental, diagnostic, preventative, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Humans include prenatal and postnatal forms.
[0062] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" refers to a material that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, inflammatory irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.
[0063] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., a mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Human includes prenatal and postnatal forms. In many embodiments, a subject is a human. A subject may be a patient, and refers to a person who sees a healthcare provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject may be afflicted with or susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.
[0064] Substantially: As used herein, the term "substantially" refers to the qualitative state of exhibiting the full or nearly full extent or degree of a desired characteristic or property. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, go to completion and / or reach completion, or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.
[0065] Systemic Distribution or Delivery: As used herein, the terms "systemic distribution," "systemic delivery," or grammatical equivalents refer to a delivery or distribution mechanism or approach that affects the entire body or the entire organism. Typically, systemic distribution or delivery is accomplished via the body's circulatory system, e.g., the bloodstream. Compare with the definition of "local distribution or delivery."
[0066] Target cell: As used herein, the term "target cell" refers to any cell affected by the disease being treated. In some embodiments, the target cell exhibits disease-associated pathology, symptoms, or characteristics.
[0067] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by the disease being treated. In some embodiments, the target tissue includes tissue that exhibits pathology, symptoms, or characteristics associated with the disease.
[0068] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount that, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, is sufficient to treat, diagnose, prevent symptoms of, and / or delay the onset of, the disease, disorder, and / or condition. Those skilled in the art will appreciate that a therapeutically effective amount is typically administered in a dosing regimen comprising at least one unit dose.
[0069] Treating: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment may be administered to subjects who do not exhibit signs of disease and / or who exhibit only early signs of disease, with the goal of reducing the risk of developing conditions associated with the disease.
[0070] The present invention provides mRNA-based compositions and methods for selectively degrading a target protein of interest. The mRNA compositions described herein encode ubiquitin pathway segments linked to a binding peptide of interest (directly or indirectly via a linker). Upon expression of the ubiquitin pathway segments and the binding peptide, the binding protein binds to the protein of interest, and the ubiquitin pathway segments cause the ubiquitination and selective degradation of the protein of interest. Thus, one use of the mRNAs described herein is the selective and rapid degradation of a target protein of interest.
[0071] In certain embodiments, mRNA-based PROTAC compositions are provided. Also provided are methods for treating diseases associated with abnormal expression of a target protein using mRNA encoding a ubiquitin-targeting moiety fused to a binding protein specific for the target protein. Such compositions are described herein, and in some embodiments, the mRNA is delivered to a subject in need thereof via a lipid nanoparticle delivery system.
[0072] Various aspects of the present invention are described in detail in the following sections. The use of sections is not meant to limit the present invention. Each section may be applied to any aspect of the present invention. In this application, the use of "or" means "and / or" unless otherwise stated. mRNAs encoding parts of the ubiquitin pathway and binding proteins
[0073] According to the present invention, a ubiquitin pathway moiety may be any suitable structure that recognizes and binds to a ubiquitin pathway protein. Generally, a ubiquitin pathway protein may be any entity or complex that can catalyze or cause catalysis of the transfer of ubiquitin or a ubiquitin-like modified polypeptide, e.g., a target protein of Nedd8, APG12, or ISG15 / UCRP, to another protein. In one embodiment, the ubiquitin pathway protein is a ubiquitin protein ligase or an E3 adaptor protein or an E3 ubiquitin ligase. There are at least 600 E3 ligases encoded by the human genome (Lim et al., bioRxiv See preprint, "bioPROTACs as amuseious monators of intracellular therapeutics: Application to proliferate cell nuclear antigen (PCNA)," dx.doi.org / 10.1101 / 728071, the contents of which are incorporated herein by reference in their entirety. Any available E3 ligase or adaptor protein can be used in the invention described herein. Of these E3 ligases, the most commonly used are, for example, CRB In some embodiments, the mRNA of the present invention encodes an E3 ligase selected from SPOP, CHIP, CRBN, VHL, MDM2, and cIAP.
[0074] In some embodiments, an mRNA encoding at least two binding peptides is provided, a first binding peptide that binds to a ubiquitin pathway portion and a second binding peptide that binds to a target protein, and the mRNA is encapsulated within a lipid nanoparticle.
[0075] In another embodiment, the ubiquitin pathway portion may be a protein involved in a ubiquitin-like pathway or a component of the ubiquitin-like pathway, transporting ubiquitin-like modified polypeptides, such as SUMO, Nedd8, APG12, or ISG15 / UCRP.The component of the ubiquitin-like pathway is usually a homolog of the ubiquitin pathway.For example, the ubiquitin-like pathway for SUMO may include a homolog of ubiquitin protein-activating enzyme or E1 protein, a homolog of ubiquitin protein-conjugating enzyme or E2 protein, and a homolog of ubiquitin ligase or E3 protein.
[0076] Ubiquitin pathway proteins can be expressed in a tissue-specific or regulated manner. For example, VACM-1 receptor (also known as CUL-5) and F-box protein NFB42 are expressed in a tissue-specific manner. In one embodiment, ubiquitin pathway proteins can be RING system or HECT system ubiquitin ligases.
[0077] According to one embodiment of the invention, a ubiquitin pathway moiety of the invention can be any suitable ligand for a ubiquitin pathway protein, such as a ubiquitin protein ligase or an E3 adaptor protein or a homolog thereof. In another embodiment, a ubiquitin pathway moiety of the invention can be any ubiquitin pathway protein-binding peptide, domain, or region of a ligand for a ubiquitin pathway protein. In yet another embodiment, a ubiquitin pathway protein binding moiety of the invention can recognize and bind to a ubiquitin pathway protein in a controlled manner.
[0078] In some embodiments, the E3 adaptor protein can be used in its native form. In some embodiments, the E3 adaptor protein can be engineered to replace its substrate recognition domain with a binding peptide. In some embodiments, the E3 adaptor protein can be selected from SPOP, CHIP, CRBN, VHL, XIAP, MDM2, and cIAP. In one embodiment, the E3 adaptor protein is SPOP. In another example, the E3 adaptor protein is VHL.
[0079] According to the present invention, a targeting moiety or binding peptide is any structure that recognizes and binds to a target protein. For example, the binding peptide may be an endogenous protein that binds to or forms a complex with the target protein. Alternatively, the binding peptide may be an antibody or antibody fragment that specifically binds to the target protein. The target protein may be any protein whose level or activity one desires to modulate, for example, via ubiquitin-dependent proteolysis or via the attachment of ubiquitin or ubiquitin-like modified polypeptides to lysine residues critical to the protein's activity or structure. Typically, the target protein is aberrantly expressed in the target cell. For example, the target protein may be a protein involved in cell cycle (e.g., cyclin-dependent kinases), signal transduction (e.g., receptor tyrosine kinases or GTPases, or similar), cell differentiation, cell dedifferentiation, cell growth, production of cytokines or other biological regulators, production of regulatory or functional proteins (e.g., transcription factors), pro-inflammatory signaling, or glucose regulatory pathways. In one embodiment, the target protein is not known to be ubiquitinated or is a substrate of any ubiquitin pathway protein. It may be a protein that is not known to exist.
[0080] In another embodiment, the target protein is a disease-related protein, for example, a protein whose function or activity changes to cause disease, or whose function is considered to be important for the development of a disease state. The target protein can be either stable or unstable, for example, androgen receptor, estrogen receptor, myc, cyclin B, Ras, or cyclin E.
[0081] In some embodiments, the target protein is A1AT. In some embodiments, the target protein is PNPLA3. In some embodiments, the target protein is an aggregate-forming protein. In some embodiments, the target protein is tau. In some embodiments, the target protein is β-amyloid. In some embodiments, the target protein is α-synuclein. In some embodiments, the target protein is a prion. In some embodiments, the target protein is TDP-43 fused to sarcoma protein, cysteine C, Notch3, GFAP, PLP, seipin, transthyretin, serpin, amyloid A protein, IAPP, apolipoprotein, gelsolin, lysozyme, fibrinogen, insulin, or hemoglobin. Selective degradation of target proteins
[0082] The compositions and methods described herein are useful for selectively targeting proteins of interest (hereinafter "target proteins") for degradation. Selective targeting of target proteins includes selective targeting of proteins with particular types of post-translational modifications.
[0083] For example, in some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in a phosphorylated form. In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in a non-phosphorylated form. In some embodiments, the target protein is in a lipidated form.
[0084] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in a non-lipidated form of the target protein.
[0085] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in its propeptide form.
[0086] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is a glycosylated form of the target protein.
[0087] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is an unglycosylated form of the target protein.
[0088] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in an oxidized form of the target protein.
[0089] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in its non-oxidized form.
[0090] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in its carbonylated form.
[0091] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in its non-carbonylated form.
[0092] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is a formylated form of the target protein.
[0093] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in its non-formylated form.
[0094] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is an acylated form of the target protein.
[0095] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in its unacylated form.
[0096] In some embodiments, the compositions and methods described herein are used to target proteins for degradation where the target protein is an alkylated form of the target protein.
[0097] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in its non-alkylated form.
[0098] In some embodiments, the compositions and methods described herein are used to target proteins for degradation where the target protein is a sulfonated form of the target protein.
[0099] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in its non-sulfonated form.
[0100] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is an s-nitrated form of the target protein.
[0101] In some embodiments, the compositions and methods described herein target proteins for degradation when the target protein is a non-s-nitrated form of the target protein. Used to:
[0102] In some embodiments, the compositions and methods described herein are used to target proteins for degradation where the target protein is a glutathionylated form of the target protein.
[0103] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in a non-glutathionylated form of the target protein.
[0104] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in an adenylated form of the target protein.
[0105] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein is in a non-adenylated form of the target protein.
[0106] In some embodiments, the compositions and methods described herein are used to target proteins for degradation where the target protein is an ATP- or ADP-bound form of the protein.
[0107] In some embodiments, the compositions and methods described herein are used to target proteins for degradation when the target protein has one or more post-translational modifications. For example, the target protein can have one or more of the following post-translational modifications: acetylation, amidation, deamidation, prenylation (such as farnesylation or geranylation), formylation, glycosylation, hydroxylation, methylation, myristoylation, phosphorylation, sialylation, polysialylation, sumoylation, neddylation, ribosylation, sulfation, or any combination thereof.
[0108] In some embodiments, the compositions and methods described herein are used to selectively degrade target proteins that are bound to another protein. For example, the compositions and methods described herein can be used to selectively degrade target proteins that are bound to a receptor. In some embodiments, the compositions and methods described herein can be used to selectively degrade target proteins that are not bound to a receptor.
[0109] In some embodiments, the compositions and methods described herein are used to selectively degrade target proteins with long half-lives. Many such proteins with long half-lives are known in the art and include, for example, cellular structural proteins. Binding peptides
[0110] According to the present invention, a binding peptide or targeting moiety is any structure that recognizes and binds to a target protein or protein of interest (POI), e.g., a protein aberrantly expressed in a target cell of a subject (e.g., an intracellular protein). It can be, for example, a ligand, an antibody, or an antibody fragment. According to the present invention, a ubiquitin pathway protein moiety is, for example, covalently attached to the targeting moiety or binding peptide of interest by any suitable means. In some embodiments, a composition of the present invention comprises mRNA encoding a chimeric fusion protein comprising a ubiquitin pathway moiety (e.g., an E3 adaptor protein or E3 ligase) fused to a binding protein that targets a protein of interest (e.g., an antibody). In another embodiment, a composition of the present invention comprises a binding protein that targets a protein of interest (e.g., an antibody). The method includes mRNA encoding a chimeric fusion protein that includes a ubiquitin pathway moiety (e.g., an E3 adaptor protein or an antibody that specifically binds to an E3 ligase) fused to a ligation protein. Upon expression of the chimeric fusion protein, the ligation protein binds to a protein of interest, and the ubiquitin pathway moiety causes ubiquitination and selective degradation of the protein of interest.
[0111] In some embodiments, the binding peptide may be a member of a molecular library, which may be any collection of molecules, including but not limited to combinatorial libraries, small molecule libraries, receptor libraries, and ligand libraries.
[0112] The binding peptide may be a peptide, antibody, or antibody mimic that allows binding to a wide variety of target proteins, such as proteins (e.g., intracellular proteins) that are aberrantly expressed in the target cells of interest. In some embodiments, the binding protein is an antibody, antibody fragment, or antibody domain.
[0113] In certain embodiments, the binding peptide may be an endogenous protein or a fragment thereof that specifically binds to a target protein of interest. For example, the endogenous protein or a fragment thereof may form a complex with the target protein of interest. Thus, the compositions of the present invention include mRNAs encoding chimeric fusion proteins that include a ubiquitin pathway portion (e.g., an E3 adaptor protein or an E3 ligase, such as an endogenous E3 adaptor protein or an E3 ligase) fused with an endogenous protein that specifically binds to or forms a complex with the target protein of interest. In certain embodiments, the mRNA encodes a chimeric fusion protein that includes an endogenous ubiquitin pathway portion engineered to replace its substrate recognition domain with an endogenous protein that binds to or forms a complex with the target protein of interest. Fusion proteins that include or consist of components that are endogenously expressed in the human body (i.e., peptides or proteins that are normally expressed in the human body) can be particularly advantageous because they are less likely to elicit an immune response that may be encountered if the fusion protein encodes a peptide or protein that is exogenous to the human body (i.e., a peptide or protein that is not normally expressed in the human body and therefore may elicit an immune response when expressed in target cells of interest).
[0114] In other embodiments, the binding protein may be an antibody that specifically binds to a target protein of interest, e.g., a protein (e.g., an intracellular protein) that is abnormally expressed in a target cell of interest. The versatility of antibodies in specifically binding to proteins of interest and the diversity of antibody formats make their use in the fusion proteins of the invention particularly attractive. Furthermore, a wide range of specific antibodies are known against target proteins implicated in disease mechanisms, making it relatively simple and inexpensive to create fusion proteins with specific specificity for a target protein of interest. Thus, in some embodiments, the compositions of the invention comprise mRNA encoding a chimeric fusion protein comprising a ubiquitin pathway portion (e.g., an E3 adaptor protein or E3 ligase) fused to an antibody that specifically binds to a target protein of interest.
[0115] In some embodiments, the antibody is a single domain antibody (sdAb), e.g., a nanobody, Fab, Fab', Fab'2, F(ab')2, Fd, Fv, Feb, scFv, or SMIP. Thus, in some embodiments, the antibody is a single domain antibody (sdAb), e.g., a nanobody. In some embodiments, the antibody is a Fab. In some embodiments, the antibody is a Fab'. In some embodiments, the antibody is a Fab'2. In some embodiments, the antibody is a Fab'2 In some embodiments, the antibody is an Fd. In some embodiments, the antibody is an Fv. In some embodiments, the antibody is an Feb. In some embodiments, the antibody is an scFv. In some embodiments, the antibody is a SMIP.
[0116] As recognized in the art, a nanobody is a single-domain antibody (sdAb) possessing a single monomeric variable antibody domain. In some embodiments, a nanobody may be a VHH fragment or a VNAR fragment. A nanobody may be the anti-GFP nanobody vhhGFP4. sdAbs that specifically bind to a target protein of interest are particularly suitable for use in the compositions of the invention due to their relatively small size and ability to diffuse more easily to intracellular locations. Thus, in some embodiments, a composition of the invention comprises an mRNA encoding a chimeric fusion protein comprising a ubiquitin pathway portion (e.g., an E3 adaptor protein or an E3 ligase) fused to an sdAb that specifically binds to a target protein of interest. In another embodiment, a composition of the invention comprises an mRNA encoding a chimeric fusion protein comprising an sdAb that specifically binds to an E3 adaptor protein or an E3 ligase fused to an sdAb that specifically binds to a target protein of interest.
[0117] A target protein can be any protein whose level or activity one desires to modulate, for example, through ubiquitin-dependent proteolysis or through the attachment of ubiquitin or ubiquitin-like modified polypeptides to lysine residues critical to the protein's activity or structure. For example, a target protein can be a protein involved in cell cycle, signal transduction, cell differentiation, cell dedifferentiation, cell growth, production of cytokines or other biological regulators, production of regulatory or functional proteins, pro-inflammatory signal transduction, or glucose regulatory pathways. In one embodiment, a target protein can be a protein not known to be ubiquitinated or to be a substrate of any ubiquitin pathway protein.
[0118] In another embodiment, the target protein may be a disease-associated protein, for example, a protein whose alteration in function or activity causes disease, or whose function is considered to be important for the development of a disease state. In some embodiments, the target protein may be either stable or unstable, for example, a G protein-coupled receptor (GPCR), such as the androgen receptor, estrogen receptor, myc, cyclin B, Ras, or cyclin E.
[0119] In some embodiments, target proteins may include cyclin A / CDK2, pRB, maltose binding protein (MBP), β-galactosidase, and GFP-tagged proteins. Coupling of ubiquitin pathway segments and binding peptides
[0120] In some embodiments of the present invention, the mRNA encodes a ubiquitin pathway portion directly fused to a binding protein. The ubiquitin pathway portion may be an endogenous protein that forms part of a ubiquitin ligase complex, such as an E3 adaptor protein or an E3 ligase. Thus, in some embodiments, the mRNA encodes an E3 adaptor or E3 ligase fused to a protein of interest to be bound. In a typical embodiment, the mRNA encodes an E3 ligase from which the endogenous substrate recognition domain has been removed and fused to a binding protein (e.g., an antibody that specifically binds to the target protein of interest). Suitable E3 ligases include, but are not limited to, SPOP, CHIP, CRBN, VHL, XIAP, MDM2, and cIAP. Using an endogenous protein that forms part of a ubiquitin ligase complex as the ubiquitin pathway portion can recruit other components of the ubiquitin ligase complex to the target protein of interest to achieve selective degradation. Furthermore, the use of endogenous proteins has the added advantage of potentially avoiding the elicitation of unwanted immune responses.
[0121] Alternatively, the ubiquitin pathway portion may be an exogenous protein that binds to an endogenous protein that forms part of a ubiquitin ligase complex. For example, the ubiquitin pathway portion may be an antibody that specifically binds to an E3 adaptor protein or E3 ligase. In certain embodiments, the antibody specifically binds to an E3 ligase, e.g., an E3 ligase selected from the group consisting of SPOP, CHIP, CRBN, VHL, XIAP, MDM2, and cIAP. Thus, in some embodiments, the mRNA encodes an antibody directed to an E3 adaptor or E3 ligase fused to a protein of interest to be bound (e.g., an antibody that specifically binds to a target protein of interest). In certain embodiments, the mRNA encodes an antibody directed to an E3 ligase fused to a protein of interest to be bound (e.g., an antibody that specifically binds to a target protein of interest). Using an antibody that specifically binds to an E3 adaptor protein or E3 ligase may be advantageous due to the diversity of ubiquitin ligases and adaptor proteins expressed in the human body. Existing constructs may be modified to target different ligase complexes by simply substituting the antibody sequence encoded by the mRNA, e.g., to achieve selective degradation of a target protein of interest only in specific cells that express the ubiquitin ligase targeted by the antibody.
[0122] In some embodiments, the mRNA encodes a ubiquitin pathway portion that is fused to a binding protein in the absence of a linker.
[0123] In some embodiments, the mRNA encodes a ubiquitin pathway portion that is covalently attached to the binding peptide by any suitable means, for example. For example, a ubiquitin pathway portion, e.g., an E3 ligase such as SPOP E3 ligase, or an antibody directed against an E3 ligase, is attached to the binding peptide of interest. In some embodiments, the composition of the invention may be a chimeric fusion protein encoded by an mRNA expression system. In another embodiment, the ubiquitin pathway portion is covalently attached to the binding peptide via a linker, e.g., a linker having a binding domain of the ubiquitin pathway portion and the binding peptide. Any suitable linker known in the art can be used. (See, e.g., Chen et al., Adv Drug Deliv Rev. 2013 October 15; 65(10): 1357-1369, the contents of which are incorporated herein by reference).
[0124] In some embodiments, the linker is a flexible linker. In some embodiments, the linker is a rigid linker. In some embodiments, the linker is a helical linker. In some embodiments, a suitable rigid linker is proline-rich. In some embodiments, a suitable rigid linker comprises PAPAP. In some embodiments, the rigid linker is PAPAP. In some embodiments, a suitable helical linker is a rigid helical linker.
[0125] In some embodiments, the linker is a GS linker. A variety of GS linkers are known. For example, in some embodiments, the linker contains (GGS)n, where n is 1-10, 1-5, etc. (e.g., 1-3), such as GGS(GGS)n, where n is 0-10. In some embodiments, the linker contains the sequence (GGGGS)n, where n is 1-10 or n is 1-5 (e.g., 1-3). In further embodiments, the linker contains (GGGGGS)n, where n is 1-4 (e.g., 1-3). The linker may contain any combination of the above, such as 2, 3, 4, or 5 repeats of GS, GGS, GGGGS, and / or GGGGGS linkers. In some embodiments, the linker is 2 to 30 amino acids in length. In some embodiments, the linker is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids in length.
[0126] Linkers may be naturally occurring, synthetic, or a combination of both. Particularly suitable linker polypeptides primarily comprise amino acid residues selected from glycine (Gly), serine (Ser), alanine (Ala), and threonine (Thr). For example, a linker may contain at least 75% (calculated based on the total number of residues present in the peptide linker), such as at least 80%, at least 85%, or at least 90%, of amino acid residues selected from Gly, Ser, Ala, and Thr. A linker may also consist exclusively of Gly, Ser, Ala, and / or Thr residues. In some embodiments, a linker contains 1-25 glycine residues, 5-20 glycine residues, 5-15 glycine residues, or 8-12 glycine residues. In some aspects, suitable peptide linkers typically contain at least 50% glycine residues, such as at least 75% glycine residues. In some embodiments, a peptide linker contains only glycine residues. In some embodiments, the peptide linker comprises only glycine and serine residues.
[0127] In yet another embodiment, the ubiquitin pathway portion can be non-covalently attached to the binding peptide in response to the presence of a signaling factor, e.g., the presence or level of an intracellular metabolite, a regulatory protein, etc. For example, the ubiquitin pathway portion and the binding peptide can be attached when they simultaneously chelate an intracellular metabolite.
[0128] In yet another embodiment, the ubiquitin pathway portion may include a first coupling moiety and the binding peptide may include a second coupling moiety, such that the first and second coupling moieties couple or bind to each other in vitro or in vivo in the presence of a signaling factor or enzymatic activity (e.g., phosphorylation of the first coupling moiety by a kinase produced by a cancer cell allows the first coupling moiety to bind to the second coupling moiety).
[0129] Alternatively, in some embodiments, the ubiquitin pathway moiety and the binding peptide are not separated by a linker, but instead can be part of a single moiety.
[0130] Combinations of different ubiquitin pathway parts and binding peptides can be used to perform targeted ubiquitination. Such targeted ubiquitination is useful for controlling protein levels or activity, and therefore provides therapeutic treatment for disease states. This creates an alternative method for selective degradation of target proteins.
[0131] One or more mRNAs of the present invention can be administered to ubiquitinate a target protein either in vitro or in vivo. Ubiquitination by the mRNA-encoded protein results in the selective degradation of the protein of interest.
[0132] In one embodiment, two or more mRNAs of the invention encode the same binding peptide but are linked to two or more different ubiquitin pathway portions that are administered to a cell to ubiquitinate a target protein (e.g., to ubiquitinate a target protein at a desired rate or extent). For example, in some embodiments, a composition comprises two mRNAs that target the same protein of interest but each encode a binding peptide that binds to a different ubiquitin pathway portion (e.g., one mRNA encodes a CHIP E3 ligase and another mRNA encodes an SPOP E3 ligase).
[0133] In another embodiment, two or more mRNAs of the present invention encode the same ubiquitin pathway moiety but encode different binding peptides that bind to different target proteins.In yet another embodiment, the mRNAs encoding the ubiquitin targeting moiety and binding protein are engineered for expression at specific locations inside or outside the cell.This can be achieved, for example, by engineering the mRNA to encode a signal peptide, such as a nuclear localization signal, an endoplasmic reticulum signal (ER signal), an endoplasmic reticulum retention signal (ER retention signal), or a cell secretion signal.In this way, the target protein can be targeted for degradation in various compartments of the cell, as well as at extracellular locations. cell delivery part
[0134] In some embodiments, the mRNA of the present invention can optionally encode a cellular delivery moiety. A cellular delivery moiety is any structure that facilitates the delivery of the composition or promotes the transduction of the composition into cells. In some embodiments, for example, as described in more detail below, the mRNA of the present invention is encapsulated in a lipid nanoparticle. In one embodiment, the cellular delivery moiety is derived from a viral protein or peptide, such as a tat peptide. In another embodiment, the cellular delivery moiety is a hydrophobic compound that can penetrate cell membranes. Alternatively, a ubiquitin pathway protein binding moiety that is more sensitive to cell membrane penetration can be used to enhance the transduction of the composition through the cell membrane. signal peptide
[0135] In some embodiments, the mRNA of the present invention may optionally encode a signal peptide, which can enable the binding peptide to target a protein of interest present at different locations inside or outside the cell. In some embodiments, the signal peptide may be one or more of a nuclear localization sequence, an endoplasmic reticulum (ER) signal sequence, an endoplasmic reticulum (ER) retention sequence, or a cellular secretion sequence. In some embodiments, the E3 ligase protein naturally contains an NLS sequence. In some embodiments, the NLS is fused to the E3 ligase protein at the N-terminus. In some embodiments, the NLS is fused to the E3 ligase protein at the C-terminus.
[0136] A nuclear localization signal or sequence (NLS) is an amino acid sequence that tags a protein for import into the cell nucleus via nuclear transport. Typically, this signal typically contains one or more short sequences of positively charged lysines or arginines exposed on the protein surface. For example, in some embodiments, the mRNA encoding the protein construct described herein contains an NLS that can promote nuclear protein ubiquitination, thereby targeting the protein in the cell nucleus for degradation. The nuclear localization signal used in the present invention is not particularly limited, as long as the signal sequence has the ability to translocate the substance attached to it into the nucleus. Various types of NLSs known in the art are suitable for use in the present invention. In some embodiments, the nuclear localization signal may be a sequence containing SV40 VP1, SV40 large T antigen, or hepatitis D virus δ antigen, or "PKKKRKV," the smallest unit with nuclear translocation activity within the nuclear localization signal of SV40 large T antigen.
[0137] In some embodiments, the signal peptide may be an ER signal sequence. The ER signal sequence may be an amino acid sequence that directs a protein to the ER membrane of a cell. An mRNA construct containing an ER signal sequence promotes ubiquitination of a protein within the endoplasmic reticulum, thereby targeting the protein to the ER or associated with the ER.
[0138] In some embodiments, the signal peptide may be an endoplasmic reticulum (ER) retention sequence. An ER retention sequence is an amino acid sequence that tags a protein for retention in the endoplasmic reticulum. An mRNA construct containing an ER retention signal sequence promotes protein ubiquitination within the endoplasmic reticulum, thereby facilitating the continued regulation of target protein levels within the ER.
[0139] A monomeric ER signal sequence is a polypeptide in which at least a portion of the polypeptide can function as an endoplasmic reticulum (ER) routing signal and / or an ER retention signal. An ER routing signal functions to direct a polypeptide to the ER, while a retention signal functions to retain a polypeptide in the ER or prevent secretion of an ER-localized polypeptide.
[0140] A variety of epitopes for use as ER signal or ER retention sequences are known in the art and include, for example, hemagglutinin (HA), FLAG, and Myc.
[0141] In some embodiments, the signal peptide may be a cellular secretory sequence. An mRNA construct with a cellular secretory sequence promotes ubiquitination of proteins located outside of a cell.
[0142] Examples of secreted proteins are discussed below and include proteins that play important roles in intercellular signaling. Such proteins include transmembrane receptors and cell surface markers, extracellular matrix molecules, cytokines, hormones, growth and differentiation factors, neuropeptides, vascular mediators, ion channels, transporters / pumps, and proteases. (Reviewed in Alberts, B. et al. (1994) Molecular Biology of The Cell, Garland Publishing, New York, NY, pp. 557-560, 582-592.)
[0143] An exemplary mRNA may encode a chimeric fusion protein that includes, starting from the N-terminus, an ER signal sequence, a binding protein that targets a protein of interest (e.g., an antibody), a ubiquitin pathway portion (e.g., an E3 adaptor protein, an E3 ligase, or an antibody that specifically binds to an E3 adaptor protein or an E3 ligase), and an ER retention sequence. In another embodiment, an exemplary mRNA encodes a chimeric fusion protein that includes, starting from the N-terminus, a binding protein that targets a protein of interest (e.g., an antibody), a ubiquitin pathway portion (e.g., an E3 adaptor protein, an E3 ligase, or an antibody that specifically binds to an E3 adaptor protein or an E3 ligase), and an NLS. Administration of mRNA Compositions
[0144] In some embodiments, the mRNA compositions described herein are used in the treatment of diseases. Any type of disease characterized by the aberrant expression, e.g., overexpression, of a protein or peptide can be treated with the mRNA compositions described herein. Diseases (including symptoms thereof) associated with or caused by the aberrant expression or overexpression of proteins or peptides are known in the art and include, for example, prion-related diseases, polycystic kidney disease, Pelizaeus-Merzbacher disease, inflammatory diseases, and cancer. In some embodiments, the disease may be associated with one or more mutations in a protein, or protein misfolding / aggregation. For example, the mRNA compositions described herein can be used in methods for treating diseases or disorders associated with or caused by the aberrant expression of a target protein. The target protein can be an enzyme, a protein involved in cell signaling, cell division, or metabolism, or a protein involved in the inflammatory response. Thus, in some embodiments, the mRNA compositions described herein can be used in methods for treating cancer, metabolic diseases, or inflammatory diseases. In certain embodiments, the present invention provides: The present invention relates to the use of the mRNA compositions described herein in the manufacture of a medicament for treating a disease or disorder associated with or caused by the abnormal expression of a target protein. The compositions and methods according to the present invention may be useful in combination with other therapies to degrade target proteins.
[0145] The mRNA compositions described herein can result in rapid targeting and degradation of target proteins of interest. In some embodiments, the mRNA compositions described herein result in targeted degradation of target proteins of interest within about 48 hours, 40 hours, 36 hours, 32 hours, 28 hours, 24 hours, 20 hours, 19 hours, 18 hours, 17 hours, 16 hours, 15 hours, 14 hours, 13 hours, 12 hours, 11 hours, 10 hours, 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, or less than 4 hours after administration to a subject. Thus, in some embodiments, the mRNA compositions result in targeted degradation of target proteins of interest within about 24 hours after administration to a subject in need thereof. In some embodiments, the mRNA compositions result in targeted degradation of target proteins of interest within about 20 hours after administration to a subject in need thereof. The mRNA compositions result in targeted degradation of target proteins of interest within about 19 hours after administration to a subject in need thereof. The mRNA composition results in targeted degradation of a protein of interest within about 18 hours of administration to a subject in need thereof. The mRNA composition results in targeted degradation of a protein of interest within about 17 hours of administration to a subject in need thereof. The mRNA composition results in targeted degradation of a protein of interest within about 16 hours of administration to a subject in need thereof. The mRNA composition results in targeted degradation of a protein of interest within about 16 hours of administration to a subject in need thereof. The mRNA composition results in targeted degradation of a protein of interest within about 15 hours of administration to a subject in need thereof. The mRNA composition results in targeted degradation of a protein of interest within about 14 hours of administration to a subject in need thereof. The mRNA composition results in targeted degradation of a protein of interest within about 13 hours of administration to a subject in need thereof. The mRNA composition results in targeted degradation of a protein of interest within about 12 hours of administration to a subject in need thereof. The mRNA composition results in targeted degradation of a protein of interest within about 11 hours of administration to a subject in need thereof. The mRNA composition results in targeted degradation of a protein of interest within about 10 hours of administration to a subject in need thereof.The mRNA composition results in targeted degradation of the protein of interest within about 9 hours after administration to a subject in need thereof. The mRNA composition results in targeted degradation of the protein of interest within about 8 hours after administration to a subject in need thereof. The mRNA composition results in targeted degradation of the protein of interest within about 7 hours after administration to a subject in need thereof. The mRNA composition results in targeted degradation of the protein of interest within about 6 hours after administration to a subject in need thereof. The mRNA composition results in targeted degradation of the protein of interest within about 5 hours after administration to a subject in need thereof. The mRNA composition results in targeted degradation of the protein of interest within about 4 hours after administration to a subject in need thereof. The mRNA composition results in targeted degradation of the protein of interest within about 3 hours after administration to a subject in need thereof.
[0146] The mRNA compositions of the present invention useful for therapeutic treatment can be administered alone, in a composition with a suitable pharmaceutical carrier, or in combination with other therapeutic agents. The effective amount of the composition to be administered can be determined on a case-by-case basis.
[0147] The compositions of the present invention may be administered in any medically acceptable manner, which may depend on the disease state or injury to be treated. Possible routes of administration include injection by intravascular, intravenous, intrathecal or other parenteral routes, or oral, nasal, ophthalmic, rectal, topical, or pulmonary, e.g., by inhalation or spray.
[0148] In some embodiments, administration of the composition results in a reduction in the level of the aberrantly expressed protein compared to a control over the treatment period. In some embodiments, administration of the composition results in a reduction in the level of the aberrantly expressed protein compared to a control for 7 days. In some embodiments, administration of the composition results in a reduction in the level of the aberrantly expressed protein compared to a control for 10 days. In some embodiments, administration of the composition results in a reduction in the level of the aberrantly expressed protein compared to a control for 15 days. In some embodiments, administration of the composition results in a reduction in the level of the aberrantly expressed protein compared to a control for 20 days. In some embodiments, administration of the composition results in a reduction in the level of the aberrantly expressed protein compared to a control for 25 days. In some embodiments, administration of the composition results in a reduction in the level of the aberrantly expressed protein compared to a control for 30 days. In some embodiments, administration of the composition results in a reduction in the level of the aberrantly expressed protein compared to a control for 35 days. In some embodiments, administration of the composition results in a reduction in the level of the aberrantly expressed protein compared to a control for 40 days. In some embodiments, administration of the composition results in a reduction in the level of the aberrantly expressed protein compared to a control for 45 days. Dosage and interval
[0149] As used herein, the term "therapeutically effective amount" is primarily based on the total amount of mRNA contained in the composition of the present invention. Generally, a therapeutically effective amount is sufficient to achieve a meaningful benefit to the subject. For example, a therapeutically effective amount may be an amount sufficient to achieve a desired therapeutic and / or prophylactic effect. Generally, the amount of a therapeutic agent (e.g., mRNA encoding a therapeutic protein or peptide) administered to a subject in need of treatment will vary depending on the characteristics of the subject. Such characteristics include the subject's condition, disease severity, general health, age, sex, and weight. Those skilled in the art will be able to easily determine the appropriate dosage depending on these and other relevant factors. Furthermore, both objective and subjective assays can be used to identify optimal dosage ranges.
[0150] The delivery vehicle containing the mRNA can be administered and dosed according to current medical practice, taking into account the subject's clinical condition, the site and method of administration (e.g., local and systemic, including intratumoral, intravenous, and injection), the administration schedule, the subject's age, sex, and weight, and other factors relevant to a clinician in the art. For purposes herein, an "effective amount" can be determined by experimental clinical studies, pharmacological, clinical, and medical techniques, and other relevant considerations known to those skilled in the art.
[0151] In some embodiments, the method comprises injecting a single dose. In some embodiments, the method comprises injecting multiple doses periodically.
[0152] The provided methods of the present invention contemplate single administration as well as multiple administrations of a therapeutically effective amount of the therapeutic agents described herein. The compositions may be administered at regular intervals depending on the nature, severity, and extent of the subject's condition. In some embodiments, a therapeutically effective amount of a composition of the present invention may be administered periodically at regular intervals (e.g., daily, twice a week, once every four days, once a week, once every 10 days, every other week, monthly, bimonthly, twice a month, once every 30 days, once every 28 days, or continuously).
[0153] In some embodiments, the provided liposomes and / or compositions are formulated to be suitable for sustained release of the mRNA contained therein. Such sustained release compositions can be administered to a subject at extended dosing intervals as needed. For example, in some embodiments, the compositions of the present invention are administered to a subject twice daily. In some embodiments, the compositions are administered to a subject twice daily. In some embodiments, the compositions are administered to a subject every day. In some embodiments, the compositions are administered to a subject every other day. In some embodiments, the compositions are administered to a subject twice weekly. In some embodiments, the compositions are administered to a subject once weekly. In some embodiments, the composition is administered to the subject once every 7 days. In some embodiments, the composition is administered to the subject once every 10 days. In some embodiments, the composition is administered to the subject once every 14 days. In some embodiments, the composition is administered to the subject once every 28 days. In some embodiments, the composition is administered to the subject once every 30 days. In some embodiments, the composition is administered to the subject once every 2 weeks. In some embodiments, the composition is administered to the subject once every 3 weeks. In some embodiments, the composition is administered to the subject once every 4 weeks. In some embodiments, the composition is administered to the subject once monthly. In some embodiments, the composition is administered to the subject twice monthly. In some embodiments, the composition is administered to the subject once every 6 weeks. In some embodiments, the composition is administered to the subject once every 8 weeks. In some embodiments, the composition is administered to the subject once every other month. In some embodiments, the composition is administered to the subject once every 3 months. In some embodiments, the composition is administered to the subject once every 4 months. In some embodiments, the composition is administered to the subject once every 6 months. In some embodiments, the composition is administered to the subject once every eight months. In some embodiments, the composition is administered to the subject once every nine months. In some embodiments, the composition is administered to the subject annually. Also contemplated are compositions and liposomes formulated for depot administration (e.g., intramuscular, subcutaneous, intravitreal) to deliver or release mRNA over a long period of time. Preferably, the sustained release method employed is combined with modifications made to mRNA to enhance stability.
[0154] Therapeutically effective amount is generally administered in a dosage regimen that can comprise multiple unit doses.For any specific vaccine, the therapeutically effective amount and administration interval (and / or the appropriate unit dose in the effective dosage regimen) can vary depending on, for example, administration route, and combination with other pharmaceuticals.In addition, the therapeutically effective amount (and / or unit dose) specific to any specific patient can depend on various factors, including the disorder being treated and the severity of the disorder; the activity of the specific composition being used; the specific composition being used; the patient's age, weight, general health, sex and diet; administration time, administration route, and / or the excretion or metabolic rate of the specific protein being used; treatment duration; and similar factors well known in the medical field.
[0155] In some embodiments, the first dose and subsequent doses are the same amount. In some embodiments, the first dose and subsequent doses are different amounts. In some embodiments, the first dose is larger than the subsequent doses. In some embodiments, the first dose is smaller than the subsequent doses. In some embodiments, each of the multiple doses comprises the same dosage of mRNA. In some embodiments, each of the multiple doses comprises a different dosage of mRNA. Composition of the Invention
[0156] In one aspect, the present invention relates to a method for selective degradation of aberrantly expressed or overexpressed proteins via administration of a composition comprising one or more mRNAs encoding the protein or peptide encapsulated within a lipid nanoparticle. In one aspect, the present invention provides a pharmaceutical composition comprising one or more mRNAs each encoding a ubiquitin pathway portion, a binding peptide, and optionally a signal peptide, wherein the one or more mRNAs are encapsulated within a lipid nanoparticle. mRNA synthesis
[0157] In some embodiments, the one or more mRNAs encode a ubiquitin pathway portion, a connecting peptide, and optionally a signal peptide.
[0158] In some embodiments, one or more mRNAs are codon-optimized. In some embodiments, the protein or peptide encoded by the mRNA is wild-type. In some embodiments, the protein or peptide encoded by the mRNA is codon-optimized. The gene contains a mutation or modification.
[0159] The mRNA of the present invention can be synthesized according to any of various known methods.For example, the mRNA of the present invention can be synthesized through in vitro transcription (IVT).Briefly, IVT is often carried out using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and a suitable RNA polymerase (for example, T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitor.The exact conditions will vary depending on the specific application.
[0160] [Table 1-1] [Table 1-2] [Table 1-3]
[0161] [Table 2-1] [Table 2-2]
[0162] The mRNA of the present invention can be synthesized according to any of various known methods.For example, the mRNA of the present invention can be synthesized through in vitro transcription (IVT).Briefly, IVT is often carried out using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and a suitable RNA polymerase (for example, T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitor.The exact conditions will vary depending on the specific application. Exemplary mRNA Construct Design Construct Design: X-mRNA coding region-Y 5' and 3' UTR sequences: X(5'UTR sequence) = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG (SEQ ID NO: 11) Y(3'UTR sequence)= CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU (SEQ ID NO: 12) or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU (SEQ ID NO: 13)
[0163] The present invention can be used to deliver mRNAs of various lengths. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs of lengths of about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or more. In some embodiments, the present invention can be used to deliver in vitro synthesized mRNAs of lengths ranging from about 1 to 20 kb, about 1 to 15 kb, about 1 to 10 kb, about 5 to 20 kb, about 5 to 15 kb, about 5 to 12 kb, about 5 to 10 kb, about 8 to 20 kb, or about 8 to 15 kb.
[0164] In some embodiments, a DNA template is transcribed in vitro to prepare mRNA according to the present invention. A suitable DNA template typically has a promoter for in vitro transcription, such as a T3, T7, or SP6 promoter, followed by the desired nucleotide sequence of the desired mRNA and a termination signal. Synthesis of mRNA using SP6 RNA polymerase
[0165] In some embodiments, mRNA is produced using SP6 RNA polymerase, which has high sequence specificity for the SP6 promoter sequence. SP6 polymerase is a DNA-dependent RNA polymerase with a 5' to 3' in vitro synthesis of RNA from either single-stranded or double-stranded DNA downstream of its promoter, incorporating natural and / or modified ribonucleotides and / or labeled ribonucleotides into the polymerized transcript. Examples of such labeled ribonucleotides include biotin, fluorescein, digoxigenin, aminoallyl, and isotope-labeled nucleotides.
[0166] The sequence of bacteriophage SP6 RNA polymerase was originally described as having the following amino acid sequence (GenBank: Y00105.1): (SEQ ID NO: 14).
[0167] The SP6 RNA polymerase suitable for the present invention may be any enzyme having substantially the same polymerase activity as bacteriophage SP6 RNA polymerase. Thus, in some embodiments, the SP6 RNA polymerase suitable for the present invention may be modified with SEQ ID NO: 14. For example, a suitable SP6 RNA polymerase may contain one or more amino acid substitutions, deletions, or additions. In some embodiments, a suitable SP6 The RNA polymerase has an amino acid sequence that is about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 75%, 70%, 65%, or 60% identical or homologous to SEQ ID NO: 14. In some embodiments, a suitable SP6 RNA polymerase may be a truncated protein (N-terminal, C-terminal, or internal) that retains polymerase activity. In some embodiments, a suitable SP6 RNA polymerase is a fusion protein.
[0168] SP6 RNA polymerase suitable for the present invention may be a commercially available product, for example, from Aldevron, Ambion, New England Biolabs (NEB), Promega, and Roche. SP6 may be ordered and / or custom-designed from a commercial or non-commercial source according to the amino acid sequence of SEQ ID NO: 14 or a variant of SEQ ID NO: 14 described herein. SP6 has a standard fidelity The polymerase may be a high-fidelity / high-efficiency / high-capacity polymerase, or may be modified to enhance RNA polymerase activity (e.g., by mutation of the SP6 RNA polymerase gene or by post-translational modification of the SP6 RNA polymerase itself). Examples of such modified SP6s include Ambion's SP6 RNA Polymerase-Plus™, NEB's HiScribe SP6, and Promega's RiboMAX™ and Riboprobe® systems.
[0169] In some embodiments, a suitable SP6 RNA polymerase is a fusion protein. For example, the SP6 RNA polymerase may contain one or more tags to facilitate isolation, purification, or solubility of the enzyme. Suitable tags may be located at the N-terminus, C-terminus, and / or internally. Non-limiting examples of suitable tags include calmodulin-binding protein (CBP), Fasciola hepatica 8-kDa antigen (Fh8), FLAG tag peptide, glutathione-S-transferase (GST), histidine tag (e.g., hexahistidine tag (His6)), maltose-binding protein (MBP), N-utilization substance (NusA), small ubiquitin-like modifier (SUMO) fusion tag, streptavidin-binding peptide (STREP), tandem affinity purification (TAP), and thioredoxin (TrxA). Other tags may be used in the present invention. These and other fusion tags are described, for example, in Costa et al. Frontiers in Microbiology 5(2014):63 and PCT / US16 / 57044, the contents of which are incorporated herein by reference in their entireties. In certain embodiments, the His tag is located at the N-terminus of SP6. SP6 promoter
[0170] Any promoter that can be recognized by SP6 RNA polymerase can be used in the present invention. Typically, the SP6 promoter contains 5'ATTTAGGTGACACTATAG-3' (SEQ ID NO: 15). Variants of the SP6 promoter have been discovered and / or created to optimize the recognition and / or binding of SP6 to the promoter. Non-limiting variants include, but are not limited to: 5'-ATTTAGGGGACACTATAGAAGAG-3', 5'-ATTTAGGGGACACTATAGAAGG-3', 5'-ATTTAGGGGACACTATAGAAGGG-3', 5'-ATTTAGGTGACACTATAGAA-3', 5'-ATTTAGGTGACACTATAGAAGA-3', 5'-ATTTAGGTGACACTATAGAAGAG-3', 5'-ATTTAGGTGACACTATAGAAGG-3', 5'-ATTTAGGTGACACTATAGAAGAG-3', 5'-ATTTAGGTGACACTATAGAAGGG-3', 5'-ATTTAGGTGACACTATAGAAGNG-3', and 5'-CATACGATTTAGGTGACACTATAG-3' (SEQ ID NO: 16 to SEQ ID NO: 25).
[0171] Additionally, an SP6 promoter suitable for the present invention may be about 95%, 90%, 85%, 80%, 75%, or 70% identical or homologous to any one of SEQ ID NOs: 15 through 25. Additionally, an SP6 promoter useful for the present invention may include one or more additional nucleotides 5' and / or 3' to any of the promoter sequences described herein. DNA template
[0172] Typically, the DNA template is either fully double-stranded or mostly single-stranded with the double-stranded SP6 promoter sequence.
[0173] Linearized plasmid DNA (linearized via one or more restriction enzymes), linearized genomic DNA fragments (via restriction enzymes and / or physical means), PCR products, and / or synthetic DNA oligonucleotides are inserted upstream (and in the correct orientation) of the DNA sequence to be transcribed. Provided that it contains a double-stranded SP6 promoter, it can be used as a template for in vitro transcription using SP6.
[0174] In some embodiments, the linearized DNA template has blunt ends.
[0175] In some embodiments, the DNA sequence to be transcribed may be optimized to promote more efficient transcription and / or translation. For example, DNA sequences can be optimized for cis-regulatory elements (e.g., TATA boxes, termination signals, and protein binding sites), artificial recombination sites, Chi sites, CpG dinucleotide content, negative CpG islands, GC content, polymerase slippage sites, and / or other elements related to transcription; DNA sequences can be optimized for cryptic splice sites, mRNA secondary structure, mRNA stability free energy, repetitive sequences, RNA instability motifs, and / or other elements related to mRNA processing and stability; DNA sequences can be optimized for codon usage bias, codon adaptability, internal Chi sites, ribosome binding sites (e.g., IRES), premature poly(A) sites, Shine-Dalgarno (SD) sequences, and / or other elements related to translation; and / or DNA sequences can be optimized for codon context, codon-anticodon interactions, translational pause sites, and / or other elements related to protein folding. Optimization methods known in the art may be used in the present invention, such as GeneOptimizer and OptimumGene™ by ThermoFisher, and are described in US2011 / 0081708, the contents of which are incorporated herein by reference in their entirety.
[0176] In some embodiments, the DNA template comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, such as an iron-responsive element. In some embodiments, the 5' untranslated region can be approximately 50-500 nucleotides in length.
[0177] In some embodiments, the 3' untranslated region includes one or more of a polyadenylation signal, a binding site for a protein that affects the positional stability of the mRNA in the cell, or one or more binding sites for an miRNA. In some embodiments, the 3' untranslated region can be 50 to 500 nucleotides in length or longer.
[0178] Exemplary 3' and / or 5' UTR sequences can be derived from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzymes) to increase the stability of the sense mRNA molecule. For example, the 5' UTR sequence can include a subsequence of the CMV immediate early 1 (IE1) gene or a fragment thereof to improve nuclease resistance and / or improve the half-life of the polynucleotide. Inclusion of a sequence encoding human growth hormone (hGH) or a fragment thereof in the 3' end or untranslated region of a polynucleotide (e.g., mRNA) is also contemplated to further stabilize the polynucleotide. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to their unmodified counterparts, for example, to improve the resistance of such polynucleotides to in vivo nuclease digestion. Large-scale mRNA synthesis
[0179] The present invention relates to large-scale production of wild-type or codon-optimized mRNA. In some embodiments, the method according to the present invention allows for the production of at least 100 mg, 150 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 80 mg, 900 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, 150 mg, 1600 mg, 1700 mg, 1800 mg, 2000 mg, 2500 mg, 3000 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 1000 mg, 1500 mg, 1600 mg, 1700 mg, 1800 mg, 2000 mg, The term "batch" as used herein refers to the quantity or amount of mRNA synthesized at one time, e.g., produced according to a single manufacturing setup. A batch may refer to the amount of mRNA synthesized in a single reaction, generated through a single aliquot of enzyme and / or a single aliquot of DNA template for continuous synthesis under one set of conditions. mRNA synthesized in a single batch does not include mRNA synthesized at different times that are combined to achieve the desired amount. Generally, the reaction mixture includes SP6 RNA polymerase, a linear DNA template, and an RNA polymerase reaction buffer (which may contain or require the addition of ribonucleotides).
[0180] According to the present invention, typically, 1-100 mg of SP6 polymerase is used per gram (g) of mRNA produced. In some embodiments, approximately 1-90 mg, 1-80 mg, 1-60 mg, 1-50 mg, 1-40 mg, 10-100 mg, 10-80 mg, 10-60 mg, or 10-50 mg of SP6 polymerase is used per gram of mRNA produced. In some embodiments, approximately 5-20 mg of SP6 polymerase is used to produce approximately 1 gram of mRNA. In some embodiments, approximately 0.5-2 grams of SP6 polymerase is used to produce approximately 100 grams of mRNA. In some embodiments, approximately 5-20 grams of SP6 polymerase is used for approximately 1 kilogram of mRNA. In some embodiments, at least 5 mg of SP6 polymerase is used to produce at least 1 gram of mRNA. In some embodiments, at least 500 mg of SP6 polymerase is used to produce at least 100 grams of mRNA. In some embodiments, at least 5 grams of SP6 polymerase is used to produce at least 1 kilogram of mRNA. In some embodiments, about 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of plasmid DNA is used per gram of mRNA produced. In some embodiments, about 10-30 mg of plasmid DNA is used to produce about 1 gram of mRNA. In some embodiments, about 1-3 grams of plasmid DNA is used to produce about 100 grams of mRNA. In some embodiments, about 10-30 grams of plasmid DNA is used for about 1 kilogram of mRNA. In some embodiments, at least 10 mg of plasmid DNA is used to produce at least 1 gram of mRNA. In some embodiments, at least 1 gram of plasmid DNA is used to produce at least 100 grams of mRNA. In some embodiments, at least 10 grams of plasmid DNA is used to produce at least 1 kilogram of mRNA.
[0181] In some embodiments, the concentration of SP6 RNA polymerase in the reaction mixture can be about 1-100 nM, 1-90 nM, 1-80 nM, 1-70 nM, 1-60 nM, 1-50 nM, 1-40 nM, 1-30 nM, 1-20 nM, or about 1-10 nM. In certain embodiments, the concentration of SP6 RNA polymerase is about 10-50 nM, 20-50 nM, or 30-50 nM. A concentration of SP6 RNA polymerase of 100 to 10,000 units / ml can be used, and examples of concentrations that can be used include 100 to 9,000 units / ml, 100 to 8,000 units / ml, 100 to 7,000 units / ml, 100 to 6,000 units / ml, 100 to 5,000 units / ml, 100 to 1,000 units / ml, 200 to 2,000 units / ml, 500 to 1,000 units / ml, 500 to 2,000 units / ml, 500 to 3,000 units / ml, 500 to 4,000 units / ml, 500 to 5,000 units / ml, 500 to 6,000 units / ml, 1,000 to 7,500 units / ml, and 2,500 to 5,000 units / ml. This can be done.
[0182] The concentration of each ribonucleotide (e.g., ATP, UTP, GTP, and CTP) in the reaction mixture is about 0.1 mM to about 10 mM, for example, about 1 mM to about 10 mM, about 2 mM to about 10 mM, about 3 mM to about 10 mM, about 1 mM to about 8 mM, about 1 mM to about 6 mM, about 3 mM to about 10 mM, about 3 mM to about 8 mM, about 3 mM to about 6 mM, or about 4 mM to about 5 mM. In some embodiments, each ribonucleotide is about 5 mM in the reaction mixture. In some embodiments, the total concentration of rNTPs (e.g., a combination of ATP, GTP, CTP, and UTP) used in the reaction ranges from 1 mM to 40 mM. In some embodiments, the total concentration of rNTPs (e.g., a combination of ATP, GTP, CTP, and UTP) used in the reaction ranges from 1 mM to 30 mM, or 1 mM to 28 mM, or 1 mM to 25 mM, or 1 mM to 20 mM. In some embodiments, the total rNTPs concentration is less than 30 mM. In some embodiments, the total rNTPs concentration is less than 25 mM. In some embodiments, the total rNTPs concentration is less than 20 mM. In some embodiments, the total rNTPs concentration is less than 15 mM. In some embodiments, the total rNTPs concentration is less than 10 mM.
[0183] RNA polymerase reaction buffers typically contain salts / buffers such as Tris, HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium phosphate, sodium chloride, and magnesium chloride.
[0184] The pH of the reaction mixture may be between about 6 and 8.5, 6.5 and 8.0, 7.0 and 7.5, and in some embodiments, the pH is 7.5.
[0185] Combine linear or linearized DNA template (e.g., as described above, and in a sufficient amount / concentration to provide the desired amount of RNA), RNA polymerase reaction buffer, and SP6 RNA polymerase to form a reaction mixture. Incubate the reaction mixture at about 37°C to about 42°C for 30 minutes to 6 hours, e.g., about 60 to about 90 minutes.
[0186] In some embodiments, about 5 mM NTPs, about 0.05 mg / mL SP6 polymerase, and about 0.1 mg / mL DNA template in a suitable RNA polymerase reaction buffer (final reaction mixture pH of about 7.5) are incubated at about 37°C to about 42°C for 60 to 90 minutes.
[0187] In some embodiments, the reaction mixture contains the linearized double-stranded DNA template along with an SP6 polymerase-specific promoter, SP6 RNA polymerase, RNase inhibitor, pyrophosphatase, 29 mM NTPs, 10 mM DTT, and reaction buffer (for 10x: 800 mM HEPES, 20 mM spermidine, 250 mM MgCl, pH 7.7), and sufficient RNase-free water to bring the reaction volume to the desired volume (QS). The reaction mixture is then incubated at 37°C for 60 minutes. The polymerase reaction is then quenched by adding DNase I and DNase I buffer (for 10x: 100 mM Tris-HCl, 5 mM MgCl, and 25 mM CaCl, pH 7.6) to facilitate digestion of the double-stranded DNA template in preparation for purification. This embodiment has been shown to be sufficient to produce 100 grams of mRNA.
[0188] In some embodiments, the reaction mixture comprises NTPs at a concentration ranging from 1 to 10 mM, DNA template at a concentration ranging from 0.01 to 0.5 mg / ml, and SP6 RNA polymerase at a concentration ranging from 0.01 to 0.1 mg / ml, for example, the reaction mixture comprises NTPs at a concentration of 5 mM, DNA template at a concentration of 0.1 mg / ml, and SP6 RNA polymerase at a concentration of 0.05 mg / ml. Contains P6 RNA polymerase. nucleotide
[0189] A variety of naturally occurring or modified nucleosides may be used to produce mRNA according to the present invention. In some embodiments, mRNA is prepared using natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine), nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-ur ... The amino acid sequence may be or contain: C5-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, pseudouridine (e.g., N-1-methyl-pseudouridine), 2-thiouridine, and 2-thiocytidine), chemically modified bases, biologically modified bases (e.g., methylated bases), intercalated bases, modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or modified phosphate groups (e.g., phosphorothioate and 5'-N-phosphoramidite linkages).
[0190] In some embodiments, the mRNA comprises one or more non-standard nucleotide residues. Non-standard nucleotide residues can include, for example, 5-methyl-cytidine ("5mC"), pseudouridine ("U"), and / or 2-thio-uridine ("2sU"). For a discussion of such residues and their incorporation into mRNA, see, for example, U.S. Pat. No. 8,278,036 or WO2011 / 012316. The mRNA can also be RNA, defined as RNA in which 25% of U residues are 2-thio-uridine and 25% of C residues are 5-methylcytidine. Teachings regarding the use of RNA are disclosed in U.S. Patent Application Publication No. 2012 / 0195936 and WO2011 / 012316, both of which are incorporated herein by reference in their entireties. The presence of non-standard nucleotide residues can render the mRNA more stable and / or less immunogenic than a control mRNA having the same sequence but containing only standard residues. In further embodiments, the mRNA may contain one or more non-standard nucleotide residues selected from isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine cytosine, as well as combinations of these and other nucleobase modifications. Some embodiments may further include additional modifications to the furanose ring or nucleobase. Additional modifications may include, for example, sugar modifications or substitutions (e.g., one or more of 2'-O-alkyl modifications, locked nucleic acids (LNAs)). In some embodiments, the RNA may be complexed or hybridized with additional polynucleotides and / or peptide polynucleotides (PNAs). In some embodiments in which the sugar modification is a 2'-O-alkyl modification, such modifications may include, but are not limited to, 2'-deoxy-2'-fluoro modifications, 2'-O-methyl modifications, 2'-O-methoxyethyl modifications, and 2'-deoxy modifications.In some embodiments, any of these modifications may be present individually or in combination in 0-100% of the nucleotides, e.g., 0%, 1%, 10%, 25%, 50%, 75%, 85%, 90%, 95%, or greater than 100% of the constituent nucleotides. Post-synthesis processing
[0191] Typically, a 5' cap and / or a 3' tail may be added post-synthesis. The presence of a cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of a "tail" serves to protect the mRNA from exonuclease degradation. Add.
[0192] A 5' cap is typically added as follows: First, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates. Guanosine triphosphate (GTP) is then added to the terminal phosphate via a guanylyltransferase, resulting in a 5'5'5 triphosphate linkage. The 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5')ppp (5'(A,G(5')ppp(5')A and G(5')ppp(5')G). Additional cap structures are described in published U.S. patent application Ser. No. 2016 / 0032356 and U.S. provisional patent application Ser. No. 62 / 464,327, filed Feb. 27, 2017, and are incorporated herein by reference.
[0193] The tail structure typically comprises a poly(A) tail and / or a poly(C) tail. The poly(A) or poly(C) tail on the 3' end of an mRNA typically comprises at least 50 adenosine or cytosine nucleotides, at least 150 adenosine or cytosine nucleotides, at least 200 adenosine or cytosine nucleotides, at least 250 adenosine or cytosine nucleotides, at least 300 adenosine or cytosine nucleotides, at least 350 adenosine or cytosine nucleotides, at least 400 adenosine or cytosine nucleotides, at least 450 adenosine or cytosine nucleotides, at least 500 adenosine or cytosine nucleotides, at least 5 At least 50 adenosine or cytosine nucleotides, at least 600 adenosine or cytosine nucleotides, at least 650 adenosine or cytosine nucleotides, at least 700 adenosine or cytosine nucleotides, at least 750 adenosine or cytosine nucleotides, at least 800 adenosine or cytosine nucleotides, at least 850 adenosine or cytosine nucleotides, at least 900 adenosine or cytosine nucleotides, at least 950 adenosine or cytosine nucleotides, or at least 1 kb of adenosine or cytosine nucleotides, respectively.In some embodiments, the poly-A tail or poly-C tail each has between about 10 and 800 adenosine or cytosine nucleotides (e.g., between about 10 and 200 adenosine or cytosine nucleotides, between about 10 and 300 adenosine or cytosine nucleotides, between about 10 and 400 adenosine or cytosine nucleotides, between about 10 and 500 adenosine or cytosine nucleotides, between about 10 and 550 adenosine or cytosine nucleotides, between about 10 and 600 adenosine or cytosine nucleotides, between about 50 and 600 adenosine or cytosine nucleotides, between about 100 and 600 adenosine or cytosine nucleotides, between about 15 ... 00 adenosine or cytosine nucleotides, about 200 to 600 adenosine or cytosine nucleotides, about 250 to 600 adenosine or cytosine nucleotides, about 300 to 600 adenosine or cytosine nucleotides, about 350 to 600 adenosine or cytosine nucleotides, about 400 to 600 adenosine or cytosine nucleotides, about 450 to 600 adenosine or cytosine nucleotides, about 500 to 600 adenosine or cytosine nucleotides, about 10 to 150 adenosine or cytosine nucleotides, about 10 to 100 adenosine or cytosine nucleotides, about 20 to 7 The tail structure may be a poly(A) tail with at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% adenosine nucleotides. In some embodiments, the tail structure may be at least 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, or 99% cytosine nucleotides.
[0194] As described herein, the addition of a 5' cap and / or 3' tail facilitates the detection of abortive transcripts generated during in vitro synthesis because, without capping and / or tailing, the size of these prematurely aborted mRNA transcripts may be too small to be detected. Thus, in some embodiments, a 5' cap and / or 3' tail is added to a synthetic mRNA before the mRNA is tested for purity (e.g., the level of abortive transcripts present in the mRNA). In some embodiments, a 5' cap and / or 3' tail is added to a synthetic mRNA before the mRNA is purified as described herein. In some embodiments, a 5' cap and / or 3' tail is added to a synthetic mRNA after the mRNA is purified as described herein.
[0195] The mRNA synthesized according to the present invention can be used without further purification. In particular, the mRNA synthesized according to the present invention can be used without a step to remove shortmers. In some embodiments, the mRNA synthesized according to the present invention may be further purified. Various methods can be used to purify the mRNA synthesized according to the present invention. For example, purification of the mRNA can be carried out using centrifugation, filtration, and / or chromatography. In some embodiments, the synthesized mRNA is purified by ethanol precipitation, filtration, chromatography, gel purification, or any other suitable means. In some embodiments, the mRNA is purified by HPLC. In some embodiments, the mRNA is extracted with a standard phenol:chloroform:isoamyl alcohol solution well known to those of skill in the art. In some embodiments, the mRNA is purified using tangential flow filtration. Suitable purification methods include those described in US2016 / 0040154, US2015 / 0376220, and "METHODS FOR PURIFICATION OF TERMINAL SYNTHESIS" filed February 27, 2018. No. PCT application PCT / US18 / 19954, entitled "Methods for Purifying Messenger RNA," filed February 27, 2018, and PCT application PCT / US18 / 19978, entitled "Methods for Purifying Messenger RNA," filed February 27, 2018, all of which are incorporated by reference herein and may be used to practice the present invention.
[0196] In some embodiments, the mRNA is purified before capping and tailing. In some embodiments, the mRNA is purified after capping and tailing. In some embodiments, the mRNA is purified before and after capping and tailing.
[0197] In some embodiments, the mRNA is purified by centrifugation either before or after capping and tailing, or both before and after capping and tailing.
[0198] In some embodiments, the mRNA is purified by filtration prior to capping and tailing. The purified fragment may be purified either before or after capping and tailing, or both before and after capping and tailing.
[0199] In some embodiments, mRNA is purified by tangential flow filtration (TFF) either before or after capping and tailing, or both before and after capping and tailing.
[0200] In some embodiments, the mRNA is purified by chromatography either before or after capping and tailing, or both before and after capping and tailing. mRNA characterization
[0201] Full-length or abortive mRNA transcripts may be detected and quantified using any method available in the art. In some embodiments, synthesized mRNA molecules are detected using blotting, capillary electrophoresis, chromatography, fluorescence, gel electrophoresis, HPLC, silver staining, spectroscopy, ultraviolet (UV), or UPLC, or a combination thereof. The present invention includes other detection methods known in the art. In some embodiments, synthesized mRNA molecules are detected using UV absorption spectroscopy with separation by capillary electrophoresis. In some embodiments, mRNA is first denatured with glyoxal dye before gel electrophoresis ("glyoxal gel electrophoresis"). In some embodiments, synthesized mRNA is characterized before capping or tailing. In some embodiments, synthesized mRNA is characterized after capping and tailing.
[0202] In some embodiments, mRNA produced by the methods disclosed herein contains less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.1% of impurities other than full-length mRNA, including IVT contaminants such as proteins, enzymes, free nucleotides, and / or shortmers.
[0203] In some embodiments, the mRNA produced according to the present invention is substantially free of shortmers or abortive transcripts. In particular, the mRNA produced according to the present invention contains undetectable levels of shortmers or abortive transcripts by capillary electrophoresis or glyoxal gel electrophoresis. As used herein, the term "shortmer" or "abortive transcript" refers to any transcript that is less than full-length. In some embodiments, a "shortmer" or "abortive transcript" is less than 100 nucleotides in length, less than 90 nucleotides in length, less than 80 nucleotides in length, less than 70 nucleotides in length, less than 60 nucleotides in length, less than 50 nucleotides in length, less than 40 nucleotides in length, less than 30 nucleotides in length, less than 20 nucleotides in length, or less than 10 nucleotides in length. In some embodiments, shortmers are detected or quantified after adding a 5'-cap and / or a 3'-polyA tail. Delivery Vehicle
[0204] According to the present invention, mRNA encoding a protein or peptide described herein (e.g., full-length, fragment, or portion of a protein or peptide) may be delivered as naked RNA (unpackaged) or via a delivery vehicle. As used herein, the terms "delivery vehicle," "transfer vehicle," "nanoparticle," or grammatical equivalents are used interchangeably.
[0205] The delivery vehicle may comprise one or more additional nucleic acids, carriers, targeting ligands, or stabilizing reagents. They may be combined or formulated into pharmaceutical compositions mixed with suitable excipients. Techniques for drug formulation and administration can be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition. A particular delivery vehicle is selected based on its ability to facilitate transfection of nucleic acids into target cells.
[0206] In some embodiments, a delivery vehicle containing one or more mRNAs is administered intravenously, intratumorally, intradermally, subcutaneously, intramuscularly, intraperitoneally, epidurally, intrathecally, or by pulmonary delivery, including, for example, nebulization. In some embodiments, the mRNA is expressed in the tissue to which the delivery vehicle is administered. Additional teachings regarding pulmonary delivery and nebulization are described in related International Application PCT / US17 / 61100, filed November 10, 2017, entitled "NOVEL ICE-BASED LIPID NANOPARTICLE FORMULATION FOR DELIVERY OF MRNA," and U.S. Provisional Patent Application No. 62 / 507,061, each of which is incorporated by reference in its entirety.
[0207] In some embodiments, mRNA encoding protein or peptide can be delivered via a single delivery vehicle.In some embodiments, mRNA encoding protein or peptide can be delivered via one or more delivery vehicles, each with different composition.In some embodiments, one or more mRNAs are encapsulated in the same lipid nanoparticle.In some embodiments, one or more mRNAs are encapsulated in separate lipid nanoparticles.
[0208] According to various embodiments, suitable delivery vehicles include, but are not limited to, polymeric carriers such as polyethyleneimine (PEI), lipid nanoparticles, and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, exosomes of both natural and synthetic origin, natural, synthetic, and semi-synthetic lamellar bodies, nanoparticles, calcium phosphosilicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline microparticles, semiconductor nanoparticles, poly(D-arginine), sol-gels, nanodendrimers, starch-based delivery systems, micelles, emulsions, niosomes, multidomain block polymers (vinyl polymers, polypropylacrylic acid polymers, dynamic polyconjugates), dry powder formulations, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, and other vector tags. Bio-nanocapsules and other viral capsid protein assemblies are also contemplated as suitable transport vehicles. (See Hum. Gene Ther. 2008 September;19(9):887-95) Liposomal Delivery Vehicles
[0209] In some embodiments, a suitable delivery vehicle is a liposomal delivery vehicle, e.g., a lipid nanoparticle. As used herein, a liposomal delivery vehicle, e.g., a lipid nanoparticle, is generally characterized as a microscopic vesicle having an internal aqueous space separated from the external medium by one or more bilayer membranes. The bilayer membrane of a liposome is typically formed by amphiphilic molecules, such as lipids of synthetic or natural origin, containing spatially separated hydrophilic and hydrophobic domains (Lasic, Trends Biotechnol., 16:307-321, 1998). The bilayer membrane of a liposome may also be formed by amphiphilic polymers and surfactants (e.g., polymerosomes, niosomes, etc.). In the context of the present invention, a liposomal delivery vehicle typically serves to transport a desired mRNA to a target cell or tissue. In some embodiments, the nanoparticle delivery vehicle is a liposome. In some embodiments, a liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterols, and / or one or more hydroxyl groups. In some embodiments, the liposome comprises a sterol-based cationic lipid and one or more PEG-modified lipids. In some embodiments, the liposome comprises three or fewer distinct lipid components. In some embodiments, one distinct lipid component is a sterol-based cationic lipid. cationic lipids
[0210] As used herein, the phrase "cationic lipid" refers to any of a number of lipid species that have a net positive charge at a selected pH, such as physiological pH.
[0211] Suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described in International Patent Publication No. 2010 / 144740, which is incorporated herein by reference.In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure: (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate: [ka] and pharmaceutically acceptable salts thereof.
[0212] Other suitable cationic lipids for use in the compositions and methods of the present invention include the ionizable cationic lipids described in International Patent Publication No. 2013 / 149140, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of one of the following formulas: [ka] or a pharmaceutically acceptable salt thereof, wherein R and R are each independently hydrogen, an optionally substituted variably saturated or unsaturated C-C 20 Alkyl, and optionally substituted variably saturated or unsaturated C-C 20 acyl; L and L are each independently selected from the group consisting of hydrogen, optionally substituted C-C 30 Alkyl, optionally substituted variably unsaturated C-C 30 Alkenyl, and optionally substituted C-C 30 alkynyl, m and o are each independently selected from the group consisting of zero and any positive integer (e.g., m is 3), and n is zero or any positive integer (e.g., n is 1). In certain embodiments, the compositions and methods of the present invention provide a cationic lipid (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine ("HGT5000"), having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine ("HGT5001") having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine ("HGT5002"): [ka] and pharmaceutically acceptable salts thereof.
[0213] Other suitable cationic lipids for use in the compositions and methods of the present invention include the cationic lipids described as amino alcohol lipidoids in International Patent Publication No. 2010 / 053572, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0214] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2016 / 118725, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0215] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2016 / 118724, which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0216] Other suitable cationic lipids for use in the compositions and methods of the present invention include cationic lipids having the formula 14,25-ditridecyl 15,18,21,24-tetraaza-octatriacontane, and pharmaceutically acceptable salts thereof.
[0217] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publications 2013 / 063468 and 2016 / 205691, each of which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein R L each instance of is independently an optionally substituted C6-C 40 In certain embodiments, the compositions and methods of the present invention provide cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0218] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2015 / 184256, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein each X is independently O or S, each Y is independently O or S, each m is independently 0 to 20, each n is independently 1 to 6, and R A are each independently hydrogen, optionally substituted C alkyl, optionally substituted C alkenyl, optionally substituted C alkynyl, optionally substituted C carbocyclyl, optionally substituted 3-14 membered heterocyclyl, optionally substituted C aryl, optionally substituted 5-14 membered heteroaryl or halogen; R Bare each independently hydrogen, an optionally substituted C1-50 alkyl, an optionally substituted C2-50 alkenyl, an optionally substituted C2-50 alkynyl, an optionally substituted C3-10 carbocyclyl, an optionally substituted 3-14 membered heterocyclyl, an optionally substituted C6-14 aryl, an optionally substituted 5-14 membered heteroaryl, or a halogen. In certain embodiments, the compositions and methods of the invention provide a cationic lipid, "Target 23," having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0219] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2016 / 004202, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid having the following compound structure: [ka] or a pharmaceutically acceptable salt thereof.
[0220] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in U.S. Provisional Patent Application No. 62 / 758,179, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein R 1 and R 2 are each independently H or a C1-C6 aliphatic group, each m is independently an integer having a value of 1 to 4, each A is independently a covalent bond or arylene, and L 1 are each independently an ester, thioester, disulfide, or anhydride group; L 2 are each independently, C2-C 10 Aliphatic, X 1 are each independently H or OH, and R 3 are each independently, C6-C 20 In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the compositions and methods of the present invention comprise a cationic lipid of the following formula: [ka] or a pharmaceutically acceptable salt thereof.
[0221] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in J. McClellan, MCKing, Cell, 1999, 14, 149-152, which are incorporated herein by reference. 2010, 141, 210-217 and Whitehead et al., Nature Communications (2014) 5:4277. In certain embodiments, the cationic lipid of the compositions and methods of the present invention is a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0222] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2015 / 199952, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0223] Other suitable cationic lipids for use in the compositions and methods of the invention include those described in International Patent Publication No. 2017 / 004143, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0224] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2017 / 075531, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention comprise cationic lipids of the following formula: [ka] or a pharmaceutically acceptable salt thereof, wherein L 1 or L 2 One of the groups is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, -SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a-, -OC(=O)NR a -, or -NR a C(=O)O-, L 1 or L 2 The other is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x , -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-, -C(=O)NR a -, NR a C(=O)NR a -, -OC(=O)NR a - or -NR a C(=O)O- or a direct bond, and G 1 and G 2 are each independently unsubstituted C-C 12 Alkylene or C1-C 12 alkenylene, G 3 But C1-C 24 Alkylene, C1-C 24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene, and R a But H or C1-C 12 alkyl, and R 1 and R 2 are each independently, C6-C 24 Alkyl or C6-C 24 alkenyl, and R 3 But, H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 , or -NR 5 C(=O)R 4 and R 4 But C1-C 12 alkyl, and R 5 is H or C1-C6 alkyl and x is 0, 1, or 2.
[0225] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2017 / 117528, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In some embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0226] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publication No. 2017 / 049245, which is incorporated herein by reference. In some embodiments, the cationic lipid of the compositions and methods of the present invention is a compound of one of the following formulas: [ka] and pharmaceutically acceptable salts thereof. In any one of these four formulas, R4 is independently -(CH2) n Q and -(CH2) n CHQR, where Q is -OR, -OH, -O(CH2) nIn certain embodiments, the cationic lipid is selected from the group consisting of N(R), -OC(O)R, -CX, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)R, -N(H)S(O)R, -N(R)C(O)N(R), -N(H)C(O)N(R), -N(H)C(O)N(H)(R), -N(R)C(S)N(R), -N(H)C(S)N(R), -N(H)C(S)N(H)(R), and heterocycle, wherein n is 1, 2, or 3. In certain embodiments, the compositions and methods of the present invention provide cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0227] Other suitable cationic lipids for use in the compositions and methods of the present invention include those described in International Patent Publications 2017 / 173054 and 2015 / 095340, each of which is incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention comprise cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and The method includes providing a cationic lipid having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include cationic lipids having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0228] Other suitable cationic lipids for use in the compositions and methods of the invention include the cleavable cationic lipids described in International Patent Publication No. 2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the invention comprise a cationic lipid of the following formula: [ka] wherein R1 is selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl; and wherein R2 is selected from the group consisting of one of the following two formulas: [ka] wherein R and R each independently represent an optionally substituted variably saturated or unsaturated C-C 20 Alkyl and optionally substituted variably saturated or unsaturated C6-C 20acyl, wherein n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more). In certain embodiments, the compositions and methods of the present invention provide a cationic lipid "HGT4001" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4002" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4003" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4004" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the present invention include a cationic lipid "HGT4005" having the following compound structure: [ka] and pharmaceutically acceptable salts thereof.
[0229] Other suitable cationic lipids for use in the compositions and methods of the invention include the cleavable cationic lipids described in U.S. Provisional Application No. 62 / 672,194, filed May 16, 2018, and incorporated herein by reference. In certain embodiments, the compositions and methods of the invention comprise a cationic lipid having any of the general formulas or structures (1a)-(21a), (1b)-(21b), and (22)-(237) described in U.S. Provisional Application No. 62 / 672,194. In certain embodiments, the compositions and methods of the invention comprise a cationic lipid having a structure according to formula (I'): [ka] During the ceremony, R X are independent, -H, -L 1 -R 1 , or -L 5A -L 5B -B', L 1 , L 2 , and L 3 each independently represents a covalent bond, —C(O)—, —C(O)O—, —C(O)S—, or —C(O)NR L - and L 4A and L 5A are each independently —C(O)—, —C(O)O—, or —C(O)NR L - and L 4B and L 5B are each independently, C1-C 20 Alkylene, C2-C 20 Alkenylene, or C2-C 20 is alkynylene, B and B' are each NR 4 R 5 or a 5- to 10-membered nitrogen-containing heteroaryl; R 1 , R 2 , and R 3 are each independently, C6-C 30 Alkyl, C6-C 30Alkenyl, or C6-C 30 is alkynyl, R 4 and R 5 are each independently hydrogen, C1-C 10 Alkyl, C2-C 10 Alkenyl, or C2-C 10 is alkynyl, R L are each independently hydrogen, C1-C 20 Alkyl, C2-C 20 Alkenyl, or C2-C 20 Includes cationic lipids that are alkynyl. In certain embodiments, the compositions and methods of the present invention include a cationic lipid that is compound (139) of 62 / 672,194, having the following compound structure: [ka]
[0230] In some embodiments, the compositions and methods of the present invention comprise a cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride. ("DOTMA") (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Pat. No. 4,897,355), which are incorporated herein by reference. Other cationic lipids suitable for the compositions and methods of the present invention include, for example, 5-carboxyspermylglycinedioctadecylamide ("DOGS"), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium ("DOSPA") (Behr et al. al. Proc. Nat. Acad. Sci. 86, 6982 (1989); U.S. Patent No. 5,171,678, U.S. Patent No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane ("DODAP"), 1,2-dioleoyl-3-trimethylammonium-propane ("DOTAP").
[0231] Additional exemplary cationic lipids suitable for the compositions and methods of the present invention also include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane ("DSDMA"); 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane ("DODMA"); 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane ("DLinDMA"); 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane ("DLenDMA"); N-dioleyl-N,N-dimethylammoni ammonium chloride ("DODAC"), N,N-distearyl-N,N-dimethylammonium bromide ("DDAB"), N-(l,2-dimyrityloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide ("DMRIE"), 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutan-4-oxy)-l-(cis,cis-9,12-octadecadienooxy)propane ("CLinDMA"); 2-[5'-(cholest-5-ene-3-beta-oxybutan-4-yl)]-1-(cis,cis-9,12-octadecadienooxy)propane ("CLinDMA"); N,N-dimethyl-3,4-dioleyloxybenzylamine ("DMOBA"); 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); 2,3-dilinoleoyloxy-N,N-dimethylpropylamine ("DLinDAP"); 1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane ("DOcarbDAP"); 2,3-dilinoleoyloxy-N,N-dimethylpropylamine ("DLinDAP"); l,2-Dilinoleylcarbamyl-3-dimethylaminopropane ("DLincarbDAP"); l,2-Dilinoleylcarbamyl-3-dimethylaminopropane ("DLinCDAP"); 2,2-Dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane ("DLin-K-DMA"); 2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA");(2R)-2-((8-[(3beta)-cholest-5-en-3-yloxy]octyl)oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine ("Octyl-CLinDMA(2R)"); (2S)-2-((8-[(3P)-cholest-5-en-3-yloxy]octyl)oxy)-N,fsl-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propane- 1-amine ("Octyl-CLinDMA(2S)"); 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane ("DLin-K-XTC2-DMA"), and 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine ("DLin-KC2-DMA") (see WO 2010 / 042877; Semple et al., Nature Biotech. 28:172-176 (2010)), which are incorporated herein by reference. (Heyes, J., et al., J Controlled Release 107:276-287(2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8):1003-1007(2005); International Patent Publication No. 2005 / 121348). ; In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole moiety, a dialkylamino moiety, or a guanidinium moiety.
[0232] In some embodiments, the one or more cationic lipids suitable for the compositions and methods of the present invention include 2,2-dilinoleyl-1-4-dimethylaminoethyl-1-[1,3]-dioxolane ("XTC"), (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine ("ALNY-100"), and / or 4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide ("NC98-5").
[0233] In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., measured by weight of lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipid content in the composition, e.g., measured by mole % of lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid content in the composition, e.g., measured by weight of lipid nanoparticles. In some embodiments, the compositions of the present invention comprise one or more cationic lipids that constitute about 30-70% (e.g., about 30-65%, about 30-60%, about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipid content in the composition, e.g., measured by mol% of lipid nanoparticles. Non-cationic / Helper Lipids
[0234] In some embodiments, the provided liposomes comprise one or more non-cationic ("helper") lipids. As used herein, the phrase "non-cationic lipid" refers to any neutral lipid, zwitterionic lipid, or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that carry a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine (DPPG), dioleoyl- ...DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoyl-phosphatidylethanolamine (DPPG), dioleoyl-phosphatidylethanolamine (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoyl-phosphatidylethanolamine (DPPG), dioleoyl-phosphatidylethanolamine (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoyl-phosphatidylethanolamine (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleo amine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl-phosphatidiethanolamine (SOPE), or mixtures thereof.
[0235] In some embodiments, such non-cationic lipids can be used alone, but are preferably used in combination with other lipids, e.g., cationic lipids. In some embodiments, the non-cationic lipid may comprise a molar ratio of about 5% to about 90%, or about 10% to about 70%, of the total lipid present in the liposome. In some embodiments, the non-cationic lipid is a neutral lipid, i.e., a lipid that carries no net charge under the conditions in which the composition is formulated and / or administered. In some embodiments, the percentage of non-cationic lipid in the liposome may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%. Cholesterol-based lipids
[0236] In some embodiments, the provided liposomes contain one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al., Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al., BioTechniques 23, 139 (1997); U.S. Patent No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid may comprise about 2% to about 30%, or about 5% to about 20% by molar ratio of the total lipid present in the liposome. In some embodiments, the percentage of cholesterol-based lipid in the lipid nanoparticle may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%. PEG modified lipid
[0237] The use of polyethylene glycol (PEG)-modified phospholipids and derivatized lipids, such as derivatized ceramides (PEG-CER), including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), alone or preferably in combination with other lipid formulations, including transfer vehicles (e.g., lipid nanoparticles), is also contemplated by the present invention. Contemplated PEG-modified lipids range in length from C6 to C8. 20Examples of suitable exchangeable lipids include, but are not limited to, polyethylene glycol chains of up to 5 kDa in length covalently attached to lipids having alkyl chains of up to 5 kDa. The addition of such moieties can prevent aggregation of the complex and can also increase circulatory lifetime, providing a means for increasing delivery of lipid-nucleic acid compositions to target tissues (Klibanov et al. (1990) FEBS Letters, 268(1):235-237). Alternatively, these moieties can be selected to rapidly exchange out of the formulation in vivo (see U.S. Pat. No. 5,885,613). Particularly useful exchangeable lipids are PEG-ceramides with shorter acyl chains (e.g., C14 or C18). PEG-modified phospholipids and derivatized lipids of the present invention can comprise a molar proportion of about 0% to about 20%, about 0.5% to about 20%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipids present in the liposome transfer vehicle.
[0238] According to various embodiments, the selection of cationic lipid, non-cationic lipid, and / or PEG-modified lipid, which comprise lipid nanoparticles, and the relative molar ratio of these lipids are based on the properties of the selected lipid, the properties of the intended target cell, and the properties of the MCNA to be delivered.Additional considerations include, for example, the saturation degree of the alkyl chain of the selected lipid, as well as size, charge, pH, pKa, fusogenicity, and toxicity.Therefore, the molar ratio can be adjusted accordingly. polymer
[0239] In some embodiments, suitable delivery vehicles are formulated using polymers as carriers, alone or in combination with other carriers, including various lipids as described herein.Thus, in some embodiments, the liposome delivery vehicles used herein also include nanoparticles containing polymers.Suitable polymers include, for example, polyacrylates, polyalkoxyacrylates, polylactides, and polylactide-polyglycolides. Examples of suitable polymers include cyclodextrins, polycaprolactones, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrins, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is included, the PEI can be a branched PEI having a molecular weight ranging from 10 to 40 kDa, for example, a 25 kDa branched PEI (Sigma #408727).
[0240] Liposomes suitable for the present invention may contain one or more of the cationic lipids, non-cationic lipids, cholesterol lipids, PEG-modified lipids, and / or polymers described herein in various proportions. As a non-limiting example, a suitable liposome formulation may contain a combination selected from cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; ICE, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, and DMG-PEG2K.
[0241] In various embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) comprises about 30-60% (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome by molar ratio. In some embodiments, the percentage of cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) is about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% or more of the liposome by molar ratio.
[0242] In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid can be about 30-60:25-35:20-30:1-15, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is approximately 40:30:20:10, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is approximately 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is approximately 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipid:non-cationic lipid:cholesterol-based lipid:PEG-modified lipid is approximately 50:25:20:5. Ratio of individual lipid components
[0243] In embodiments in which the lipid nanoparticle comprises three or fewer distinct components of lipid, the ratio of the total lipid content (i.e., the ratio of lipid component (1):lipid component (2):lipid component (3)) may be expressed as x:y:z, (y+z)=100-x.
[0244] In some embodiments, "x," "y," and "z" each represent the mole percentage of three separate components of the lipid, and the ratios are molar ratios.
[0245] In some embodiments, "x," "y," and "z" each represent the weight percentage of three separate components of the lipid, and the ratios are by weight.
[0246] In some embodiments, the lipid component (1), represented by the variable "x," is a sterol-based cationic lipid.
[0247] In some embodiments, the lipid component (2), represented by the variable "y", is a helper lipid. do.
[0248] In some embodiments, the lipid component (3), represented by the variable "z," is a PEG lipid.
[0249] In some embodiments, the variable "x", which represents the mole percent of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.
[0250] In some embodiments, the variable "x," representing the mole percent of lipid component (1) (e.g., sterol-based cationic lipid), is about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less. In embodiments, the variable "x" is about 65% or less, about 60% or less, about 55% or less, about 50% or less, or about 40% or less.
[0251] In some embodiments, the variable "x," representing the mole percent of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 50% to less than about 95%, at least about 50% to less than about 90%, at least about 50% to less than about 85%, at least about 50% to less than about 80%, at least about 50% to less than about 75%, at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%. In some embodiments, the variable "x" is at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%.
[0252] In some embodiments, the variable "x," representing the weight percent of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.
[0253] In some embodiments, the variable "x," representing the weight percent of lipid component (1) (e.g., sterol-based cationic lipid), is about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less. In embodiments, the variable "x" is about 65% or less, about 60% or less, about 55% or less, about 50% or less, or about 40% or less.
[0254] In some embodiments, the variable "x," representing the weight percent of lipid component (1) (e.g., sterol-based cationic lipid), is at least about 50% to less than about 95%, at least about 50% to less than about 90%, at least about 50% to less than about 85%, at least about 50% to less than about 80%, at least about 50% to less than about 75%, at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%. In some embodiments, the variable "x" is at least about 50% to less than about 70%, at least about 50% to less than about 65%, or at least about 50% to less than about 60%.
[0255] In some embodiments, the variable "z", representing the mole percent of lipid component (3) (e.g., PEG lipid), is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or 25% or less. In some embodiments, the variable "z", representing the mole percent of lipid component (3) (e.g., PEG lipid), is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, or 15%. In some embodiments, the variable "z", representing the mole percent of lipid component (3) (e.g., PEG lipid), is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. For example, the variable "z," representing the mole percent of PEG (lipid), is between about 1% and about 10%, between about 2% and about 10%, between about 3% and about 10%, between about 4% and about 10%, between about 1% and about 7.5%, between about 2.5% and about 10%, between about 2.5% and about 7.5%, between about 2.5% and about 5%, between about 5% and about 7.5%, or between about 5% and about 10%.
[0256] In some embodiments, the variable "z", representing the weight percent of lipid component (3) (e.g., PEG lipid), is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, or 25% or less. In some embodiments, the variable "z", representing the weight percent of lipid component (3) (e.g., PEG lipid), is about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%. In embodiments, the variable "z," representing the weight percent of lipid component (3) (e.g., PEG lipid), is between about 1% and about 10%, between about 2% and about 10%, between about 3% and about 10%, between about 4% and about 10%, between about 1% and about 7.5%, between about 2.5% and about 10%, between about 2.5% and about 7.5%, between about 2.5% and about 5%, between about 5% and about 7.5%, or between about 5% and about 10%.
[0257] For compositions having only three distinct lipid components, the variables "x," "y," and "z" may be in any combination as long as the sum of the three variables equals 100% of the total lipid content. Formulation of liposomes encapsulating mRNA
[0258] The liposome transfer vehicle for use in the compositions of the present invention can be prepared by various techniques currently known in the art. The liposomes for use in the provided compositions can be prepared by various techniques currently known in the art. For example, multilamellar vesicles (MLVs) can be prepared according to conventional techniques by dissolving the lipids in a suitable solvent, depositing selected lipids on the inner wall of a suitable container or vessel, and then evaporating the solvent to leave a thin film on the inside of the vessel, or by spray drying. Subsequently, an aqueous phase can be added to the vessel with vortexing, thereby forming MLVs. Unilamellar vesicles (ULVs) can then be formed by homogenizing, sonicating, or extruding the multilamellar vesicles. In addition, unilamellar vesicles can be formed by detergent removal techniques.
[0259] In certain embodiments, provided compositions comprise liposome, in this case mRNA is associated on both surfaces of liposome and is encapsulated in the liposome.For example, during the preparation of the compositions of the present invention, cationic liposome can be associated with mRNA by electrostatic interaction.For example, during the preparation of the compositions of the present invention, cationic liposome can be associated with mRNA by electrostatic interaction.
[0260] In some embodiments, the compositions and methods of the present invention comprise mRNA encapsulated in liposomes. In some embodiments, one or more mRNA species may be encapsulated in the same liposome. In some embodiments, one or more mRNA species may be encapsulated in different liposomes. In some embodiments, the mRNA is encapsulated in one or more liposomes, which differ in their lipid composition, molar ratio of lipid components, size, charge (zeta potential), targeting ligand, and / or combinations thereof. In some embodiments, one or more liposomes may have different compositions of sterol-based cationic lipids, neutral lipids, PEG-modified lipids, and / or combinations thereof. In some embodiments, one or more liposomes may have different molar ratios of cholesterol-based cationic lipids, neutral lipids, and PEG-modified lipids used to make the liposomes.
[0261] The process of incorporating desired mRNA into liposomes is called "loading." )." Exemplary methods are described in Lasic, et al., FEBS Lett., 312:255-258, 1992, which is incorporated herein by reference. The liposome-incorporated nucleic acid may be located completely or partially within the interior space of the liposome, i.e., within the liposome's bilayer membrane, or may be associated with the outer surface of the liposome membrane. The incorporation of nucleic acids into liposomes is also referred to herein as "encapsulation," in which the nucleic acid is completely contained within the interior space of the liposome. The purpose of incorporating mRNA into a transfer vehicle, such as a liposome, is often to protect the nucleic acid from an environment that may contain enzymes or chemicals that degrade the nucleic acid and / or systems or receptors that result in the rapid excretion of the nucleic acid. Thus, in some embodiments, a suitable delivery vehicle can enhance the stability of the mRNA contained therein and / or facilitate delivery of the mRNA to target cells or tissues.
[0262] Suitable liposomes according to the present invention can be prepared in a variety of sizes. In some embodiments, the provided liposomes can be prepared smaller than previously known mRNA-encapsulating liposomes. In some embodiments, reduced liposome size increases the efficiency of mRNA delivery. The appropriate liposome size can be selected taking into account the site of the target cell or tissue, and in part, the intended use of the liposomes.
[0263] In some embodiments, liposomes of appropriate size are selected to promote the systemic distribution of the antibody encoded by mRNA.In some embodiments, it may be desirable to limit the transfection of mRNA to specific cells or tissues.For example, to target hepatocytes, liposomes can be sized so that their dimensions are smaller than the fenestrations of the endothelial layer covering the hepatic sinusoids of the liver, so that liposomes can easily penetrate the endothelial fenestrations and reach the target hepatocytes.
[0264] Alternatively or additionally, liposomes may be sized such that the liposomes are of sufficient diameter to limit or intentionally prevent distribution within particular cells or tissues.
[0265] Various alternative methods known in the art are available for sizing liposome populations. One such sizing method is described in U.S. Pat. No. 4,737,323, which is incorporated herein by reference. Sonication of liposome suspensions, either by bath or probe sonication, results in a gradual reduction in size to small ULVs with diameters of less than about 0.05 micrometers. Homogenization is another method that utilizes shear energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, MLVs are recirculated using a standard emulsion homogenizer until a selected liposome size, typically about 0.1 to 0.5 micrometers, is observed. Liposome size can be calculated by quasi-electric light scattering (QELS) as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981), incorporated herein by reference. The average liposome diameter can be reduced by sonicating the formed liposomes. Intermittent sonication cycles can be alternated with QELS assessment to guide efficient liposome synthesis. [Example]
[0266] While certain compounds, compositions, and methods of the present invention have been specifically described in accordance with certain embodiments, the following examples serve only to illustrate the compounds of the present invention and are not intended to limit it. Example 1. Construct design
[0267] Exemplary methods and designs of mRNA constructs for substrate-specific E3 ubiquitin ligases and their mutations are provided in this example.
[0268] The basic design of a substrate-specific E3 ubiquitin ligase mRNA construct includes 1) a sequence encoding a substrate-binding domain, and 2) a sequence encoding a fragment or full-length E3 ubiquitin ligase. Optionally, the construct may further include a sequence encoding an endoplasmic reticulum (ER) signal peptide, a nuclear localization signal (NLS), and / or an ER retention signal.
[0269] In this study, green fluorescent protein (GFP) was selected as the target substrate. Various mRNA constructs were prepared as shown in Figure 1A. vhhGFP4, a nanobody that specifically recognizes GFP, was used as the substrate-binding domain. In each construct, vhhGFP4 was fused to an E3 ligase (ΔSPOP, hVHL, or ΔCHIP) with or without a flexible linker (as indicated by ^ in Figure 1A). Each construct was tagged with FLAG, allowing visualization with anti-FLAG Cy3 dye. Constructs C and E further contain sequences encoding an ER signal peptide and an ER retention signal. The components of each construct are listed in Table 1. Any number of variations of the above constructs can be implemented. For example, the linker may be modified, multiple E3 ligases may be used, or sequences encoding E2 ubiquitin-conjugating enzymes may be introduced. Additionally, different combinations of substrate binding domains, E3 ligases, ER signal peptides, and ER retention signals can be envisioned.
[0270] The construct design allows for specific intracellular targeting of the target protein. For example, degrading the target protein in some intracellular compartments may be toxic. To avoid toxicity, targeting of the target protein can be limited to a specific intracellular compartment using the mRNA constructs provided herein. Furthermore, the use of intracellular targeting signals is advantageous over other therapeutic strategies, such as the use of small molecules. Exemplary intracellular localization using the constructs described herein is shown in Figure 1B. As shown in Figure 1B, the use of construct A provides precise nuclear localization of the PROTAC, while the use of construct E provides cytoplasmic localization of the PROTAC.
[0271] [Table 3] Example 2. In vitro expression and efficacy of mRNA for substrate-specific E3 ubiquitin ligase proteolysis
[0272] This example demonstrates the successful in vitro transfection, expression, and efficacy of mRNA encoding a substrate-specific E3 ubiquitin ligase.
[0273] GFP-expressing HeLa cells were transfected with mRNA of constructs A, C, D, E, and F. 24 hours after transfection, untreated and transfected cells were stained and imaged using a microscope.
[0274] The expressed GFP protein and DNA were visualized by immunofluorescence, as shown in Figure 2A. No signal was observed for anti-FLAG Cy3 in untreated cells. A magnified merged image of the GFP and FLAG signals in untreated cells is shown in Figure 2B.
[0275] As shown in Figures 3A-7B, cells transfected with various mRNA constructs listed in Table 1 successfully expressed substrate-specific E3 ubiquitin ligases. Notably, as shown in the merged images of Figures 3B, 4B, 5B, 6B, and 7B, the expressed E3 ubiquitin ligases colocalized with GFP, indicating that the expressed E3 ligases were able to bind to their target, GFP.
[0276] Cells transfected with construct A mRNA, which does not contain the ER signal peptide or ER retention signal, exhibited nuclear-associated speckles (Figure 3B). Without intending to be bound by theory, this indicates that the GFP-specific E3 ubiquitin ligase encoded by construct A bound to GFP in transfected cells and translocated GFP to the nucleus due to the lack or ER retention signal peptide.
[0277] Construct C or Construct B, which contains the ER signal peptide and ER retention signal Cells transfected with lactoE mRNA are shown in Figure 4B and Figure 6B, respectively. Interestingly, in these transfected cells, which show expression of both GFP and the E3 ubiquitin ligase (dashed arrow), GFP is sequestered outside the nucleus.
[0278] Cells transfected with construct F mRNA, which does not contain an ER signal or ER retention signal peptide, are shown in Figure 7B. Notably, in cells showing expression and colocalization of GFP and E3 ubiquitin ligase, "holes" were visible in the nucleus, demonstrating GFP degradation mediated by the ubiquitin degradation pathway (see blue arrows in Figure 7B).
[0279] Overall, this example shows that cells transfected with various mRNA constructs successfully expressed GFP-specific E3 ubiquitin ligases, which then bound to GFP and induced selective protein degradation. Example 3. Time course study of mRNA expression and efficacy on proteolysis of substrate-specific E3 ubiquitin ligases
[0280] This example demonstrates successful expression and availability of mRNA encoding a substrate-specific E3 ubiquitin ligase 6 and 24 hours after transfection.
[0281] HEK293 cells were transfected with construct A or construct E mRNA, or GFP mRNA alone. Additionally, HEK293 cells were co-transfected with GFP mRNA and mRNA construct A or construct E. Six or 24 hours after transfection, cells were stained and imaged under a microscope at 40x magnification. The study design is shown in Table 2.
[0282] [Table 4]
[0283] In Figure 8A, single construct transfections of each mRNA (samples 2-4 in Table 2) moderately expressed either GFP or E3 ligase 6 hours after transfection compared to untreated sample 1. For sample 2, the transfected GFP was uniformly present throughout the cells. For sample 2 transfected with construct A, which contains an NLS but no ER signal peptide or ER retention signal, the expressed E3 ligase was shown to be localized in nuclear speckles. Sample 4, which was transfected with construct E containing a signal peptide and an ER retention signal, showed that the expressed E3 ligase remained in the cytoplasm.
[0284] In Figure 8B, each construct showed increased expression 24 hours after transfection (samples 8–10). The localization of the expressed protein was similar to that observed in samples 6 hours after transfection.
[0285] Next, HEK293 cells were co-transfected with GFP mRNA with construct A or construct E, as indicated by samples 5, 6, 11, and 12 in Table 2, and imaged 6 or 24 hours after transfection.
[0286] When cells were transfected with GFP mRNA alone, GFP was expressed throughout the cells, as shown in Figures 8A and 8B (samples 2 and 8). However, when cells were co-transfected with GFP mRNA and construct A containing the NLS, the expressed GFP was sequestered in the nucleus, indicating that the expressed E3 ligase could bind to GFP and translocate into the nucleus (Figures 9A and 9B). Furthermore, "holes" were visible in the nucleus, suggesting GFP degradation mediated by the ubiquitin degradation pathway.
[0287] Figures 10A and 10B show that cells transfected with GFP mRNA and Construct E (samples 6 and 12) showed a decrease in cytoplasmic GFP signal in the E3 ligase-expressing region, while nuclear GFP signal remained at both 6 and 24 hours posttransfection, indicating that the E3 ligase expressed by Construct E degraded cytoplasmic GFP. 24 hours posttransfection, nuclear GFP appeared to be slightly decreased, suggesting that the E3 ligase may have degraded GFP before translocating out of the nucleus, causing its nuclear depletion.
[0288] Overall, this example demonstrates that the E3 ligase expressed by the transfected mRNA successfully binds to GFP and induces selective protein degradation, further demonstrating that the E3 ubiquitin ligase-induced protein degradation of the present invention can be made specific within a subcellular compartment. Example 4. In vitro efficacy of E3 ubiquitin ligase-induced proteolysis of GFP nuclei
[0289] This example demonstrates that an expressed E3 ubiquitin ligase can bind to its target substrate in the nucleus and induce protein degradation.
[0290] A HeLa cell line stably expressing GFP modified with a histone H2B tag was transfected with construct A or construct E. Histone H2B is one of the four major histone proteins that form nucleosomes; therefore, H2B-tagged GFP is localized exclusively in the nucleus. Furthermore, the H2B tag appears to slightly alter the structure of GFP, potentially increasing its susceptibility to multiubiquitination or proteasomal degradation.
[0291] Transfected cells were stained 24 hours after transfection and imaged at 40x magnification using a microscope. Figure 11 shows images of cells transfected with construct A and H2B-tagged GFP mRNA. As shown in the upper right panel, GFP was localized exclusively to the nucleus due to the H2B tag. Furthermore, as previously described and seen in the lower left panel, the E3 ligase encoded by construct A localized to nuclear speckles. Interestingly, as shown in the lower right panel of Figure 11, the E3 ligase did not show any colocalization with GFP, indicating that H2B-tagged GFP was effective in the nucleus. This suggests that the material is decomposed efficiently.
[0292] Figure 12 shows staining images of cells transfected with construct E and H2B-tagged GFP mRNA. Similar to Figure 11, the images show that GFP was localized in the nucleus. Because construct E contains an ER signal peptide and an ER retention signal, the E3 ligase encoded by the transfected mRNA was localized in the cytoplasm, as shown in the lower left panel of Figure 12. In contrast to Figure 11, the merged image in the lower right panel shows that nuclear GFP was clearly present in cells that expressed E3 ligase (Figure 12, lower right panel). Because H2B-tagged GFP was restricted to the nucleus, GFP could not be degraded by the E3 ligase-induced proteolytic pathway. Example 5. Concentration-dependent response of E3 ubiquitin ligase-induced GFP proteolysis
[0293] This example shows that protein degradation induced by expressed E3 ubiquitin ligase is concentration dependent.
[0294] A HeLa cell line that does not endogenously express GFP was co-transfected with 1 μg of GFP mRNA and various concentrations of Construct E. The co-transfected cells were stained and imaged 24 hours after transfection. The amount of GFP was quantified and plotted as shown in Figures 13A-B and 13D. Figure 13C is a FLAG Western blot showing a concentration-dependent decrease in GFP expression by Construct E. Figure 13D is a GFP Western blot showing a concentration-dependent decrease in GFP expression by Construct E. Overall, the results indicate that the E3 ubiquitin ligase encoded by Construct E mRNA efficiently induced GFP degradation in a concentration-dependent manner.
[0295] Another E3 ubiquitin ligase was tested and shown to provide targeted protein degradation in a concentration-dependent manner. This ubiquitin construct, Construct G, contains the E3 ligase cereblon, an ER signal, an ER retention sequence, and vhhGFP. Data from this study showed that Construct G reduced GFP expression in a concentration-dependent manner (Figures 21A-B). The study design was as described in the previous paragraph. Additional data were generated using Construct G, which demonstrated a concentration-dependent response of Construct G on GFP expression. These data are shown in Figure 21C, which shows flow cytometry plots using HeLA cells exposed to Construct G:GFP RNA ratios of 1:1, 4:1, and 10:1. These data are presented as a bar graph in Figure 21D. Overall, these data demonstrated a concentration-dependent decrease in the amount of GFP with increasing ratios of Construct G. Specifically, the data showed a 46% decrease in GFP mean fluorescence intensity (MFI) at a 10:1 ratio of construct G:GFP RNA blocked with 5 μM MG132. Example 6. Time course study of E3 ubiquitin ligase-induced GFP proteolysis
[0296] This example investigates the time course of GFP degradation induced by an E3 ubiquitin ligase encoded by the administered mRNA.
[0297] A HeLa cell line that does not endogenously express GFP was co-transfected with GFP mRNA and construct E. The amount of GFP in the co-transfected cells was measured at various time points up to 34 hours after transfection. As a negative control, a HeLa cell line that does not endogenously express GFP transfected with GFP mRNA alone was also measured for GFP concentration.
[0298] The amount of GFP at various time points is plotted in Figure 14. The GFP levels in cells transfected with GFP mRNA and E3 ubiquitin were compared to the GFP levels in cells transfected with GFP mRNA alone. GFP levels in cells cotransfected with construct E, encoding the ligase, were significantly reduced at all time points. The results also show that the E3 ubiquitin ligase encoded by the administered mRNA is effective as early as 6 hours posttransfection (when GFP expression becomes detectable) and that its effect persists 34 hours posttransfection.
[0299] Next, a HeLa cell line stably expressing GFP modified with a histone H2B tag was transfected with construct A. Construct A contains a nuclear localization signal, thus inducing expression of the E3 ubiquitin ligase in the nucleus. The amount of GFP in the transfected cells was measured at various time points up to 72 hours posttransfection. As a negative control, a HeLa cell line constitutively expressing GFP that was not transfected with construct A was also measured for GFP concentration.
[0300] The amount of GFP at various time points is plotted in Figure 15. Compared to the negative control, there was no significant change in GFP levels before 10 hours post-transfection. At 24 and 48 hours, a clear decrease in GFP concentration was observed compared to the negative control. Example 7. In vitro efficacy of E3 ubiquitin ligase-induced proteolysis of GFP in a cell-free system
[0301] This example examines E3 ubiquitin ligase-induced proteolysis of a GFP in vitro translation system (cell-free system). The study design is shown in Figure 16. Briefly, cytoplasmic extracts of HeLa cells were prepared according to methods known in the art. E3 ligase mRNA and target mRNA or protein were added to the cytoplasmic extract containing a functional translation system. The amount of mRNA or GFP was quantified by ELISA, Western blot, or qPCR.
[0302] In an in vitro cell-free system, we investigated the efficacy of GFP degradation induced by administration of mRNA encoding an E3 ubiquitin ligase. Cytoplasmic extracts were added with various components at different ratios, as shown in Table 3.
[0303] [Table 5]
[0304] As shown in Figure 17, the sample containing only GFP mRNA (Sample 1) produced significantly higher amounts of GFP protein, whereas the sample to which no mRNA was added (Sample 6) contained undetectable amounts of GFP. Samples 2-4, supplemented with various amounts of Construct E, showed a dose-dependent decrease in GFP, indicating that the E3 ubiquitin ligase encoded by Construct E successfully induced GFP protein degradation. To investigate whether there was any difference in the expression of GFP in Sample 4 compared to Sample 5, mRNA encoding a non-GFP-targeting E3 ubiquitin ligase was added (Sample 5). The results showed no significant difference between the GFP expression in Sample 4 compared to Sample 5, indicating that the production of GFP and / or E3 ubiquitin ligase is not limited by translation efficiency. Figure 17B shows data demonstrating the degradation of recombinant GFP using Construct E in a cell-free translation system (CFTS). Data from this study showed that bioPROTAC activity was observed in CFTS after 30 minutes.
[0305] A cell-free translation system (CFTS) was also used to evaluate anti-GFP bioPROTACs using construct G, an E3 ligase cereblon (Figures 17C-E). Figure 17C is a schematic showing constructs containing construct G and GFP RNA. These CFTS studies demonstrated both an anti-GFP concentration response with construct G (Figure 17D) and a progressive decrease in anti-GFP over a 3-hour time course (Figure 17E). Total RNA / sample was 3.5 pmol. The data demonstrated significant GFP knockdown using construct E, even at 0.2 equivalents.
[0306] Another CFTS study was performed using cereblon and an E3 ligase bioPROTAC containing either an anti-PNPLA3 scFv antibody (construct) or ABHD5 (Figure 17F). ABHD5 is a PNPLA3 protein binder. Figure 17F is a schematic diagram showing cereblon containing the E3 ligase bioPROTAC and also showing the PNPLA3-GFP fusion. For these studies, the PNPLA3-GFP fusion construct and / or Construct M or Construct N were used in the CFTS system. The data showed a concentration-dependent decrease in the amount of PNPLA3-GFP with increasing amounts of Construct M or Construct N (Figure 17G). These data indicated that the use of a cereblon-based E3 ligase reduced the presence of the target protein in a concentration-dependent manner. Example 8. Effect of linker length on E3 ubiquitin ligase-induced proteolysis of GFP
[0307] This example demonstrates that the linker length between vhhGFP4 (substrate binding domain) and ΔSSPOP (ubiquitin pathway portion) does not significantly affect E3 ubiquitin ligase-induced proteolysis of GFP.
[0308] Constructs with various linker lengths between the vhhGFP4 nanobody and the ΔSPOP E3 ligase are shown in Figure 18A and Table 4.
[0309] [Table 6]
[0310] Cytoplasmic extracts as described in Example 7 were supplemented with various constructs shown in Table 4 in addition to GFP mRNA. At different time points, the amount of GFP was quantified by ELISA and plotted as shown in Figure 18B. The results show that the vhhGFP4 nanobody and ΔSPOP This shows that the linker length between the E3 ligases did not significantly affect the GFP degradation efficiency. All constructs with various linker lengths were able to effectively reduce the amount of GFP in the samples. It is reasonable that no differential effect of various linker lengths was observed in this particular experiment, since the degradation induced by the administered constructs was quite robust. Example 9. Concentration-dependent response of E3 ubiquitin ligase-induced proteolysis of A1AT
[0311] This example demonstrates that the expressed E3 ubiquitin ligase can bind to its target, A1AT, and induce its proteolysis.
[0312] Various mRNA constructs were prepared as shown in Figure 19. The single-chain variable fragment scFv4B12, which specifically recognizes A1AT, was used as the substrate-binding domain. In each construct, scFv4B12 was fused to an E3 ligase (hVHL or ΔCHIP) with a flexible linker (indicated by "^" in Figure 19). Each construct was tagged with FLAG, allowing visualization with anti-FLAG Cy3 dye. Constructs H, J, and K further comprise sequences encoding an ER signal peptide and an ER retention signal. Any number of variations of the above constructs can be implemented. For example, the linker can be modified, multiple E3 ligases can be used, or sequences encoding an E2 ubiquitin-conjugating enzyme can be introduced. Furthermore, different combinations of substrate-binding domains, E3 ligases, ER signal peptides, and ER retention signals can be contemplated.
[0313] In vitro experiments were performed to examine the dose-response efficacy of the E3 ubiquitin ligase encoded by the transfected mRNA on the proteolysis of A1AT protein. Cells were cultured at 1 ug / 1x10 6 The A1AT plasmid was co-transfected with cells and one of the constructs GK (FIG. 19) at various concentrations.
[0314] As shown in Figure 20A, the E3 ubiquitin ligase encoded by construct GK The gauze was able to induce the degradation of A1AT in a concentration-dependent manner. In this particular example, degradation of A1AT was observed when the mRNA construct was added at a ratio of at least 1:1 (construct mRNA:A1AT plasmid).
[0315] Next, we used an in vitro cell-free translation system to examine the dose-response efficacy of the E3 ubiquitin ligase encoded by the transfected mRNA on the proteolysis of the A1AT protein. Cytoplasmic extracts were supplemented with 4 pmol of A1AT mRNA and various ratios of construct K, as shown in Figure 19. As shown in Figure 20B, the A1AT Samples containing only mRNA produced large amounts of A1AT. When samples were supplemented with various amounts of construct K, a dose-dependent decrease in A1AT was observed, indicating that the E3 ubiquitin ligase encoded by construct K successfully induced A1AT proteolysis. Example 10: bioPROTAC-mediated degradation is driven by the proteasome
[0316] This example demonstrates that bioPROTAC-mediated degradation is driven by the proteasome. For these studies, construct G was used as a representative mRNA construct. To identify the involvement of the proteasome in bioPROTAC-mediated degradation, HeLA cells were treated with construct G with or without 5 μM proteasome inhibitor MG-132. Cell isolates were obtained and GFP ELISA was performed. The results of these studies show that GFP increased in all cells treated with MG-132. These data indicate that construct G resulted in significant proteasome-dependent degradation of GFP (Figures 22A and 22B). Example 11: Comparison of different E3 ligase bioPROTAC designs for target degradation
[0317] In this example, various E3 ligase designs were compared for target protein knockdown. The bioPROTAC designs tested included Construct E and two bispecific anti-cereblon bioPROTACs (bispecific RNA A and bispecific RNA B). B) were included (Figures 23A and 23B). Figure 23B is a schematic showing the binding of bispecific bioPROTACs to cereblon.
[0318] For these studies, HeLa cells were co-transfected with GFP RNA and one of the bioPROTAC designs shown in Figure 23A. Data from these studies showed that all bioPROTAC designs tested caused specific GFP knockdown. These data also show that Construct E outperforms each of the anti-cereblon (bispecific) bioPROTACs in reducing the presence of the target protein (Figure 23C). Example 12: Onset duration study of GFP bioPROTAC effects in mice
[0319] The purpose of the studies described in this example was to determine the expression period of bioPROTACs administered to mice. The bioPROTACs used in this study are shown in Figure 24A. For these studies, 6- to 8-week-old CD-1 mice were injected via the tail vein with GFP RNA and / or one of the bioPROTACs shown in Figure 24A. Liver GFP expression was then assessed 6 and 24 hours after administration. Data from these studies showed no statistically significant differences between the bioPROTAC-treated groups. The data also show a trend toward decreased liver GFP expression in mice administered construct G (Figure 24B). equivalent
[0320] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above description, but rather is set forth in the following claims. This is true.
Claims
1. A messenger RNA (mRNA) encoding a portion of the ubiquitin pathway and a binding peptide that binds to a target protein, wherein the mRNA is encapsulated within a lipid nanoparticle.
2. The mRNA of claim 1 , wherein the ubiquitin pathway portion and the binding peptide are separated by a linker.
3. The mRNA of claim 2, wherein the linker is a GS linker.
4. The mRNA of claim 1 , wherein the ubiquitin pathway portion and the binding peptide are not separated by a linker.
5. The mRNA of any one of claims 1 to 4, wherein the ubiquitin pathway portion is a ubiquitin pathway protein.
6. The mRNA of any one of claims 1 to 5, wherein the ubiquitin pathway part is an E3 adaptor protein.
7. The mRNA of claim 6, wherein the E3 adaptor protein is engineered to replace its substrate recognition domain with the binding peptide.
8. 8. The mRNA of claim 6 or 7, wherein the E3 adaptor protein is selected from SPOP, CHIP, CRBN, VHL, XIAP, MDM2, and cIAP.
9. The mRNA of any one of claims 1 to 4, wherein the ubiquitin pathway moiety is an antibody that specifically binds to an E3 adaptor protein or an E3 ligase.
10. 10. The mRNA of claim 9, wherein the antibody specifically binds to an E3 adaptor protein selected from SPOP, CHIP, CRBN, VHL, XIAP, MDM2, and cIAP.
11. The mRNA of any one of claims 1 to 10, wherein the binding peptide is an antibody or antibody fragment that specifically binds to the target protein.
12. The mRNA of any one of claims 1 to 10, wherein the binding peptide is a protein that binds to or forms a complex with the target protein.
13. 2. The mRNA of claim 1, wherein the protein that binds to or complexes with the target protein of interest is endogenous to the target cell.
14. The mRNA of any one of claims 11 to 13, wherein the target protein is aberrantly expressed in a target cell.
15. The mRNA of claim 14, wherein the target protein is an intracellular protein.
16. The mRNA of claim 14, wherein the target protein is a nuclear protein.
17. The mRNA of any one of claims 14 to 16, wherein the target protein can be an enzyme, a protein involved in cell signaling, a protein involved in cell division or metabolism, or a protein involved in inflammatory responses.
18. A messenger RNA (mRNA) encoding at least two binding peptides, wherein a first binding peptide binds to a ubiquitin pathway portion and a second binding peptide binds to a target protein, wherein the mRNA is encapsulated within a lipid nanoparticle.
19. 19. The mRNA of claim 18, wherein the first binding peptide and the second binding peptide are separated by a linker.
20. The mRNA of claim 19, wherein the linker is a GS linker.
21. 19. The mRNA of claim 18, wherein the first binding peptide and the second binding peptide are not separated by a linker.
22. The mRNA of any one of claims 18 to 21, wherein the ubiquitin pathway portion is a ubiquitin pathway protein.
23. 23. The mRNA of claim 22, wherein the ubiquitin pathway portion is an E3 adaptor protein.
24. 24. The mRNA of Claim 23, wherein the E3 adaptor protein is selected from SPOP, CHIP, CRBN, VHL, XIAP, MDM2, cereblon, and cIAP.
25. The mRNA of any one of claims 18 to 24, wherein the first binding peptide is an antibody or antibody fragment that specifically binds to an E3 adaptor protein or E3 ligase.
26. 26. The mRNA of Claim 25, wherein the antibody specifically binds to an E3 adaptor protein selected from SPOP, CHIP, CRBN, VHL, XIAP, MDM2, and cIAP.
27. The mRNA of any one of claims 18 to 26, wherein the second binding peptide is an antibody or antibody fragment that specifically binds to the target protein.
28. The mRNA of any one of claims 18 to 26, wherein the second binding peptide is a protein that binds to or forms a complex with the target protein.
29. 29. The mRNA of claim 28, wherein the protein that binds to or complexes with the target protein is endogenous to the target cell.
30. The mRNA of any one of claims 18 to 29, wherein the target protein is aberrantly expressed in a target cell.
31. The mRNA of claim 30, wherein the target protein is an intracellular protein.
32. The mRNA of claim 30, wherein the target protein is a nuclear protein.
33. The mRNA of any one of claims 30 to 32, wherein the target protein can be an enzyme, a protein involved in cell signaling, a protein involved in cell division or metabolism, or a protein involved in inflammatory responses.
34. 28. The mRNA of any one of claims 9 to 11 or 25 to 27, wherein the antibody or antibody fragment is a nanobody, Fab, Fab', Fab'2, F(ab')2, Fd, Fv, Feb, scFv, or SMIP.
35. The mRNA of any one of claims 1 to 34, wherein the vector further encodes a signal peptide.
36. 36. The mRNA of claim 35, wherein the signal peptide is a nuclear localization sequence.
37. The mRNA of any one of claims 1 to 34, wherein the signal peptide is an endoplasmic reticulum (ER) signal sequence.
38. The mRNA of any one of claims 1 to 34 and 37, wherein the signal peptide is an endoplasmic reticulum (ER) retention sequence.
39. The mRNA of any one of claims 1 to 34 and 37 to 38, wherein the signal peptide is a cellular secretory sequence.
40. The mRNA of any one of claims 1 to 39, wherein the lipid nanoparticles comprise one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids.
41. The one or more cationic lipids may be selected from the group consisting of cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinC2DMA, ICE (imidazole based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2 41. The mRNA of claim 40, wherein the mRNA is selected from the group consisting of 5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), 5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 25), 5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 26), and combinations thereof.
42. The target protein is selected from the group consisting of a phosphorylated form of the target protein, a non-phosphorylated form of the target protein, a lipidated form of the target protein, a non-lipidated form of the target protein, a propeptide form of the target protein, a glycosylated form of the target protein, a non-glycosylated form of the target protein, an oxidized form of the target protein, a non-oxidized form of the target protein, a carbonylated form of the target protein, a non-carbonylated form of the target protein, a formylated form of the target protein, a non-formylated form of the target protein, an acylated form of the target protein, a non-acylated form of the target protein, an alkylated form of the target protein, a non-alkylated form of the target protein, a sulfonated form of the target protein, a non-sulfonated form of the target protein, an s-nitrated form of the target protein, and a hydroxyl group of the target protein.
42. The mRNA of any one of claims 1 to 41, comprising a non-s-nitrated form of the target protein, a glutathionylated form of the target protein, a non-glutathionylated form of the target protein, an adenylated form of the target protein, a non-adenylated form of the target protein, or an ATP- or ADP-bound form of the protein.
43. The mRNA of any one of claims 1 to 43, wherein the target protein is bound to a receptor.
44. A pharmaceutical composition comprising the mRNA of any one of claims 1 to 43.
45. 10. A method for inducing protein degradation, comprising administering to a subject in need thereof the mRNA of any one of the preceding claims.
46. 46. The method of claim 45, wherein the mRNA is administered intravenously, intradermally, subcutaneously, intrathecally, orally, or by inhalation or nebulization.
47. 46. The method of claim 45, wherein the mRNA is administered to the subject by pulmonary administration.
48. 48. The method of claim 47, wherein the pulmonary administration is achieved by inhalation of the mRNA encapsulated in the lipid nanoparticles.
49. 48. The method of claim 47, wherein the pulmonary administration is achieved by nebulization of the mRNA encapsulated in the lipid nanoparticles.
50. A cell comprising the mRNA of any one of claims 1 to 34.
51. 44. A method for treating a subject suffering from a disease or disorder associated with the abnormal expression of a protein, comprising administering to said subject in need thereof the mRNA of any one of claims 1 to 34, wherein administration of said mRNA results in selective degradation of said abnormally expressed protein.
45. A method for treating a subject suffering from a disease or disorder associated with the abnormal expression of a protein, comprising administering to said subject in need thereof the pharmaceutical composition of claim 44, wherein administration of said mRNA results in selective degradation of said abnormally expressed protein.
52. 53. The method of claim 51 or 52, wherein the disease or disorder is selected from prion-based diseases, polycystic kidney disease, Pelizaeus-Merzbacher disease, inflammatory diseases and cancer.
Citation Information
Patent Citations
Messenger RNA therapy for the treatment of ornithine transcarbamylase deficiency
JP2019522047A
Intracellular delivery of target-silencing protein
WO2019141806A1
Broad-spectrum proteome editing with an engineered bacterial ubiquitin ligase mimic
WO2019178604A1