Microrna expression cassette, expression vector, and use thereof

By using an expression cassette that processes microRNAs within the nucleus, the production of mature microRNAs is efficiently controlled, addressing off-target issues and improving gene therapy efficacy.

JP2025135809APending Publication Date: 2025-09-19AICHI PREFECTURE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024033790
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-03-06
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Existing microRNA expression technologies face challenges in efficiently producing mature microRNAs in cells, leading to off-target effects and unclear processing pathways, limiting their effectiveness in gene therapy applications.

Method used

The introduction of an expression cassette comprising DNA from a gene's intron sequence between exons, which processes microRNAs to maturity within the nucleus, ensuring controlled and efficient production of mature microRNAs.

Benefits of technology

This approach allows for effective expression of mature microRNAs in cells without relying on random cytoplasmic degradation, enhancing the specificity and efficacy of gene regulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025135809000001_ABST
    Figure 2025135809000001_ABST
Patent Text Reader

Abstract

To provide novel means enabling expression of mature microRNA within cells.SOLUTION: The present invention provides an expression cassette comprising a first exon and a second exon, further comprising intron-derived DNA between the 3' end of the first exon and the 5' end of the second exon, wherein DNA encoding a microRNA is inserted into the intron-derived DNA; an expression vector comprising this cassette; and uses thereof.SELECTED DRAWING: Figure 2
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a microRNA expression cassette, an expression vector, and uses thereof. [Background technology]

[0002] MicroRNAs are a type of functional RNA that regulate gene expression by degrading messenger RNA transcribed from genes. MicroRNA dysfunction has been shown to be involved in various pathological conditions.

[0003] MicroRNAs contribute to the post-transcriptional regulation of gene expression in eukaryotes, including humans. Many microRNAs bind to the 3'UTR of target messenger RNAs, destabilizing the target messenger RNA and suppressing protein production through translational repression.

[0004] Most microRNAs are located in the introns of genes, and are excised from the introns as immature microRNAs during the process of becoming messenger RNA after gene transcription. Next, an enzyme called Drosha converts them into hairpin-shaped precursor microRNAs. These precursor microRNAs are then transported from the nucleus to the cytoplasm, where they are processed by an enzyme called Dicer to become mature microRNAs that control the expression of target messenger RNAs.

[0005] There are many types of microRNAs, which are thought to be involved in various biological phenomena by binding to target messenger RNAs and primarily suppressing translation. To clarify the involvement of microRNAs in biological phenomena, research is being conducted to introduce microRNAs into cultured cells and observe changes in the target biological phenomenon.

[0006] Non-Patent Document 1 describes a technology that uses a plasmid (vector) that expresses short mature microRNA. This expression vector uses a promoter for RNA polymerase III, such as H1, which limits the options for promoters and makes it unusable for specific expression in neurons, etc. Furthermore, there is a risk that reversed microRNA may be produced, which has the drawback of causing off-target effects.

[0007] Non-Patent Document 2 describes a technology that uses a vector that expresses immature microRNAs. This expression vector has the advantage that many promoters can be selected and that off-target effects can be suppressed by introducing mutations into the reverse sequence of the microRNA. However, because the immature microRNA is incorporated into the 3'UTR portion of the GFP gene within this vector, the process of producing functional mature microRNAs is unclear, as the process relies on the generation of precursors by random excision associated with RNA degradation in the cytoplasm. [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] OligoEngine, pSUPER: Manual A Vector System for Expression of Short Interfering RNA, [online], <http: / / www.oligoengine.com / products / psuper / documentation / protocols / pSUPER_protocol.pdf> [Non-patent document 2] Takara Bio Inc., "pmR-ZsGreen1 Vector", [online],<https: / / catalog.takara-bio.co.jp / product / basic_info.php?unitid=U100006389> Summary of the Invention [Problem to be solved by the invention]

[0009] To perform effective gene therapy using microRNA, it is necessary to obtain an effective amount of mature microRNA in cells. The present invention aims to provide a new means for expressing mature microRNA in cells. [Means for solving the problem]

[0010] As a result of extensive research, the present inventors discovered that by introducing into cultured cells an expression vector incorporating DNA encoding a microRNA within an intron-derived sequence located between the exons of a gene, the microRNA is produced as a mature microRNA through processing within the nucleus, and that the expression of the target messenger RNA can be significantly suppressed, thereby completing the present invention.

[0011] That is, the present invention provides the following. [1] A first exon and a second exon, and an intron-derived DNA between the 3' end of the first exon and the 5' end of the second exon; An expression cassette in which DNA encoding a microRNA is inserted into DNA derived from an intron. [2] The expression cassette according to [1], wherein the DNA derived from the first exon, the second exon, and the intron is derived from the same gene. [3] The expression cassette according to [1] or [2], wherein the first exon has an initiation codon at the 5' end. [4] An expression cassette according to any one of [1] to [3], wherein the first exon is exon 18 of the human R3HDM1 gene, the second exon is exon 19 of the human R3HDM1 gene, and the intron-derived DNA is DNA derived from intron 18 of the human R3HDM1 gene. [5] The expression cassette according to any one of [1] to [4], wherein the intron-derived DNA contains a multicloning site. [6] An expression cassette according to any one of [1] to [5], in which one or more DNAs encoding microRNAs are inserted into a multicloning site. [7] The expression cassette according to any one of [1] to [6], wherein DNA encoding one or more types of microRNA is inserted into a multicloning site. [8] The expression cassette according to any one of [1] to [7], wherein the microRNA is miR128. [9] An expression cassette described in any one of [1] to [8], wherein the intron-derived DNA includes a contiguous base sequence of at least 6 bases from the 5' end of the intron and a contiguous base sequence of at least 6 bases from the 3' end of the intron, and encodes a sequence that is removed from messenger RNA by splicing.

[10] An expression cassette described in any one of [1] to [8], wherein the intron-derived DNA comprises a contiguous base sequence of at least 50 bases from the 5' end of the intron and a contiguous base sequence of at least 50 bases from the 3' end of the intron, and encodes a sequence that is removed from messenger RNA by splicing.

[11] An expression cassette described in any one of [1] to [8], wherein the intron-derived DNA comprises a contiguous base sequence of at least 100 bases from the 5' end of the intron and a contiguous base sequence of at least 100 bases from the 3' end of the intron, and encodes a sequence that is removed from messenger RNA by splicing.

[12] The expression cassette according to any one of [1] to

[11] , further comprising DNA encoding a labeled protein.

[13] The first exon is composed of DNA having the base sequence of SEQ ID NO: 1; The second exon is composed of DNA having the base sequence of SEQ ID NO: 5, The intron-derived DNA containing a multicloning site consists of DNA having the base sequence of SEQ ID NO: 8. The expression cassette according to any one of [1] to

[12] .

[14] An expression vector comprising the expression cassette according to any one of [1] to

[13] .

[15] A pharmaceutical composition comprising the expression cassette according to any one of [1] to

[13] or the expression vector according to

[14] . [Effects of the Invention]

[0012] According to the present invention, mature microRNAs can be expressed in cells without relying on random RNA degradation in the cytoplasm. [Brief explanation of the drawings]

[0013] [Figure 1] A microRNA expression vector is shown. [Figure 2] A microRNA expression vector incorporating miR128 is shown. [Figure 3] 1 shows the expression of microRNAs in cultured cells. [Figure 4] This shows the effect of suppressing messenger RNA expression by a microRNA expression vector incorporating miR128. [Figure 5] This shows the results of intranuclear splicing of a microRNA expression vector incorporating miR128. DETAILED DESCRIPTION OF THE INVENTION

[0014] The present invention is described in detail below. The features of the present invention described below can be combined in any combination. In the following, expressions such as "including..." and "having..." indicate that other features may be included, and each of these features can be arbitrarily replaced with expressions such as "consisting of..." and "consisting only of...". "Consisting of..." or "consisting only of..." indicates that no other unspecified features are included.

[0015] [Expression cassette] In one aspect, the present invention relates to an expression cassette (hereinafter, sometimes referred to as the expression cassette of the present invention). In the present invention, an expression cassette refers to a unit consisting of DNA for expressing a predetermined gene. The expression cassette of the present invention includes at least a first exon and a second exon, and also includes intron-derived DNA between the 3' end of the first exon and the 5' end of the second exon. Furthermore, in the expression cassette of the present invention, DNA encoding a microRNA is inserted into the intron-derived DNA.

[0016] (exons, introns) Premature messenger RNA transcribed from DNA undergoes splicing in the nucleus to become mature messenger RNA. In the present invention, "splicing" refers to the removal of a region from the premature messenger RNA and the joining of the two sides excluding the removed region. In the process of splicing from premature messenger RNA to mature messenger RNA, there is a portion (a) that is removed from the premature messenger RNA and a portion (b) that remains in the mature messenger RNA. (a) includes a coding region (CDS) that is translated into protein and an untranslated region (UTR) that is not translated. (b) is not translated into protein. In the present invention, the terms exon and intron refer to the portion of DNA that is transcribed to become (a) or (b), respectively.

[0017] The first exon and the second exon in the expression cassette of the present invention may be any exon that is transcribed in DNA and remains in mature messenger RNA after splicing.

[0018] The intron-derived DNA in the expression cassette of the present invention is DNA having a nucleotide sequence contained in an intron and encoding a sequence that is removed from messenger RNA by splicing. The intron-derived DNA may be designed appropriately depending on the type of gene and intron, as long as it encodes a sequence that is removed from messenger RNA by splicing. In one embodiment, the intron-derived DNA comprises a contiguous nucleotide sequence of at least 6 bases from the 5'-end of the intron and a contiguous nucleotide sequence of at least 6 bases from the 3'-end of the intron.

[0019] Furthermore, because the sequences of 50 bases from the 5' and 3' ends of an intron may contain motifs necessary for regulating splicing, in a preferred embodiment, the intron-derived DNA contains a contiguous base sequence of at least 50 bases from the 5' end of the intron and a contiguous base sequence of at least 50 bases from the 3' end of the intron. In another preferred embodiment, the intron-derived DNA contains two independent contiguous base sequences of at least 50 bases contained in the intron (provided that the two base sequences do not overlap with each other), and has the base sequence GT (5'-GT) at the 5' end and the base sequence AG (AG-3') at the 3' end. Such ends are suitable for splicing.

[0020] In a preferred embodiment, the intron-derived DNA comprises a contiguous base sequence of at least 100 bases or 110 bases or more from the 5'-end of the intron, and a contiguous base sequence of at least 100 bases, 110 bases, or 120 bases or more from the 3'-end of the intron. In a particularly preferred embodiment, the intron-derived DNA comprises a contiguous base sequence of at least 112 bases or 500 bases from the 5'-end of the intron, and a contiguous base sequence of at least 135 bases or 500 bases from the 3'-end of the intron. In another preferred embodiment, the intron-derived DNA comprises two independent contiguous base sequences contained in the intron, each of which is at least 100 bases long, preferably at least 112 bases long, at least 135 bases long, or at least 500 bases long (provided that the two base sequences do not overlap with each other), and each has the base sequence GT (5'-GT) at the 5' end and the base sequence AG (AG-3') at the 3' end. In one embodiment, the intron-derived DNA consists of the full-length base sequence of the intron.

[0021] In a preferred embodiment, the DNA derived from the first exon, second exon, and intron in the expression cassette of the present invention is derived from the same gene. In one embodiment, the first exon in the expression cassette of the present invention has an initiation codon at its 5' end. The initiation codon is a codon that specifies the initiation of translation of messenger RNA into protein and is represented by the base sequence ATG.

[0022] In one embodiment, the first exon, second exon, and intron-derived DNA in the expression cassette of the present invention are all derived from the human R3HDM1 gene. The R3HDM1 protein is highly expressed in the brain and is involved in various brain functions. In a further embodiment, in the expression cassette of the present invention, the first exon is exon 18 (SEQ ID NO: 1) of the human R3HDM1 gene, the second exon is exon 19 (SEQ ID NO: 5) of the human R3HDM1 gene, and the intron-derived DNA is DNA derived from intron 18 of the human R3HDM1 gene.

[0023] The cassette of the present invention may further contain DNA derived from exons and introns in addition to DNA derived from the first exon, the second exon, and the intron therebetween (in the present invention, DNA derived from exons and introns other than the DNA derived from the first exon, the second exon, and the intron therebetween may be referred to as "other exons" or "DNA derived from other introns"). The DNA derived from other exons and other introns may be transcribed and spliced ​​in the nucleus. For example, the DNA derived from other introns may be transcribed and become a portion located between the 3' end of the second exon and the 5' end of the other exon to be removed by splicing, or may be located between the 3' end of the other exon and the 5' end of the first exon to be removed by splicing, or may be located between two other exons to be removed by splicing.

[0024] (microRNA) In the expression cassette of the present invention, DNA encoding a microRNA is inserted into DNA derived from an intron. MicroRNAs are endogenous non-coding RNAs consisting of single strands 20 to 25 bases long. Many microRNAs bind to the 3'UTR of target messenger RNAs, destabilizing the target messenger RNA and suppressing translation, thereby suppressing protein production. Most microRNAs are present in gene introns and are excised from the intron as immature microRNAs during the process of becoming messenger RNA after gene transcription. Subsequently, the microRNA undergoes the following steps: 1) forming a hairpin structure by an enzyme called Drosha, becoming a precursor microRNA; 2) the precursor microRNA is transported from the nucleus to the cytoplasm and processed by an enzyme called Dicer to become a double-stranded mature microRNA; and 3) the mature microRNA is exported out of the nucleus and incorporated into the RNA-induced silencing complex (RISC) to become a single-stranded microRNA.

[0025] There are various molecular species of microRNAs, each of which is expressed in various tissues and is known to target various messenger RNAs.The molecular species of microRNA in the expression vector of the present invention may be appropriately selected depending on the target messenger RNA, and examples thereof include miR128, miR219-1-3p, miR219-2-3p, miR219-5p, miR21, miR34, miR124-5p, miR125a-3p, miR125a-5p, miR125b-1-3p, miR125b-2-3p, miR125b-5p, miR1271-3p, miR1271-5p, miR132-5p, miR135a-3p, miR135a-5p, miR135b-3p, miR135b-5p, miR137, miR139-5p, miR139-3p, miR149-3p, miR149-5p, miR153, miR181c-3p, miR181c-5p, miR183-3p, miR183-5p, miR190a, miR190 b, miR212-3p, miR212-5p, miR23a-3p, miR23a-5p, miR30a-5p, miR30b-3p, miR30b-5p, miR30c-1-3p, miR30c-2-3p, miR30c-5p, miR30d-3p, miR30d -5p, miR329, miR342-3p, miR3665, miR3666, miR380-3p, miR380-5p, miR383, miR410, miR425-3p, miR425-5p, miR454-3p, miR454-5p, miR483, miR 510, miR516a-3p, miR548b-5p, miR548c-5p, miR571, miR7-1-3p, miR7-2-3p, miR7-5p, miR802, miR922, miR9-3p, miR9-5p, miR132-3p, miR132-3p, It may be miR148b-3p, miR148b-5p, miR151a-3p, miR151a-5p, miR212-3p, miR212-5p, miR320b, miR320e, miR323a-3p, miR323a-5p, miR324-5p, miR325, miR326, miR328, miR922, miR1250, miR23a-3p, miR23a-5p, miR3065-3p, miR3065-5p, miR30e-3p, miR30e-5p, miR32-5p, miR338-5p, miR657, etc.In one embodiment, the microRNA in the expression vector of the present invention is miR128.

[0026] In the expression cassette of the present invention, the DNA encoding the microRNA inserted into the intron-derived DNA may be one or more. Also, in the expression cassette of the present invention, the DNA encoding the microRNA inserted into the intron-derived DNA may be one or more types.

[0027] (multi-cloning site) The expression cassette of the present invention may contain a multicloning site. A multicloning site refers to a portion containing multiple restriction enzyme recognition sites. By containing a multicloning site, it becomes possible to clone DNA fragments cleaved with various restriction enzymes into the vector. In one embodiment, the multicloning site contains DNA consisting of the nucleotide sequence of SEQ ID NO: 3.

[0028] In one embodiment of the expression cassette of the present invention, an intron contains a multi-cloning site. While an intron may contain a multi-cloning site at any position, in a specific embodiment, the intron-derived DNA containing the multi-cloning site is represented by DNA consisting of the nucleotide sequence of SEQ ID NO:8.

[0029] In one embodiment of the expression cassette of the present invention, the multiple cloning site contains DNA encoding a microRNA. In one embodiment of the expression cassette of the present invention, one or more DNAs encoding microRNAs are inserted into the multiple cloning site. In one embodiment of the expression cassette of the present invention, one or more DNAs encoding microRNAs are inserted into the multiple cloning site.

[0030] (labeled protein) The expression cassette of the present invention may contain DNA encoding a marker protein. A marker protein is a protein whose activity can be used to determine the presence or absence of gene expression. The marker protein may be selected from, for example, fluorescent proteins such as GFP (Green Fluorescent Protein) and RFP (Red Fluorescent Protein), luminescent proteins such as luciferin, and antibiotic-inactivating proteins such as NPT II (Neomycin Phosphotransferase II). In one embodiment, the marker protein is GFP, and the DNA encoding GFP is DNA consisting of the nucleotide sequence of SEQ ID NO: 6.

[0031] The DNA encoding the labeled protein is preferably located at the 3' or 5' end of the coding region (e.g., the region from the first exon to the second exon in the expression vector of the present invention), and more preferably at the 3' end of the coding region.

[0032] (others) The expression cassette of the present invention may optionally contain DNA other than those described above, as long as the desired effect is achieved. A non-limiting example of such a DNA is a spacer. In the present invention, a spacer refers to a DNA that does not have a function of its own but is used to adjust the overall size of the expression cassette or to improve the function of the expression cassette (e.g., transcription function, translation function, etc.). The spacer may be composed of any base sequence, and its size may be, for example, 3 to 30 bases long. Furthermore, the expression cassette may contain one or more spacers.

[0033] [Expression vector] In one aspect, the present invention relates to an expression vector comprising the expression cassette of the present invention (hereinafter, sometimes referred to as the expression vector of the present invention). An expression vector is a vector that can be used for the purpose of gene expression in cells. The microRNA expression unit is short, approximately 1.5 kb, and can be incorporated into an adenovirus vector or the like for introduction into neurons. The vector of the present invention may be, for example, a plasmid vector or a non-plasmid vector such as a viral vector, and is not particularly limited as long as it can be used for the purpose of gene expression in cells.

[0034] The expression vector of the present invention may further comprise a promoter, a terminator, a replication origin, an enhancer, DNA encoding a signal peptide, a spacer, and the like, as long as the desired effect is achieved.

[0035] The promoter is not particularly limited as long as it can obtain transcriptional activity of the gene of interest, and may be, for example, a viral promoter such as SV40, cytomegalovirus (CMV), retrovirus, or adenovirus, or a cell-derived promoter such as β-actin, elongation factor 1, or U6. The promoter is preferably located upstream of the coding region (i.e., on the 5' side of the coding region).

[0036] The terminator is not particularly limited as long as it can terminate transcription of the gene of interest, and may be, for example, a T7 terminator. The terminator is preferably located downstream of the coding region (i.e., on the 3' side of the coding region). The expression vector of the present invention may also have a polyA signal (AATAAA: SEQ ID NO: 9) instead of a terminator.

[0037] The replication origin may be selected appropriately depending on the type of host into which the vector is to be introduced, and may be, for example, the f1 origin, SV40 origin, pUC origin, pBR322 origin, ColE1 origin, pMB origin, etc.

[0038] The enhancer is not particularly limited as long as it can activate the transcription of the gene of interest, and may be, for example, an SV40 enhancer, a CMV enhancer, etc., depending on the promoter used. The enhancer is preferably located upstream of the promoter.

[0039] The signal peptide is not particularly limited as long as it achieves the desired localization, and may be, for example, a nuclear localization signal peptide, such as those from SV40 T antigen (PKKKRKV: SEQ ID NO: 10), c-myc (PAAKRVKLD: SEQ ID NO: 11), p53 (PQPKKKP: SEQ ID NO: 12), or NF-κB p50 (QRKRQK: SEQ ID NO: 13).

[0040] The spacer may be selected as described in the section [Expression Cassette].

[0041] (Production method) The expression cassette or expression vector of the present invention can be prepared by any method known to those skilled in the art. For example, the method may involve constructing a cassette containing DNA derived from the first exon, the second exon, and an intron, as well as a multicloning site and DNA encoding a labeled protein, and then inserting the cassette into any expression vector. The expression vector into which the cassette is inserted may be, for example, a commercially available vector or one that already contains a labeled protein, etc.

[0042] [Gene transfection] The expression vector of the present invention can be introduced into a host cell to express a microRNA in the host cell. The host cell may be a prokaryotic cell or a eukaryotic cell, preferably a eukaryotic cell, more preferably an animal cell, and even more preferably a human cell. The method for introducing the expression vector into the host cell can be appropriately selected from methods known to those skilled in the art depending on the type of host cell and the purpose of introduction. The introduction method may be, for example, conjugation, the protoplast method, competent cell, electroporation, etc.

[0043] The expression of a microRNA in a host cell may be confirmed, for example, by confirming that the expression of a messenger RNA targeted by the introduced microRNA in the host cell is reduced compared to a control in which the microRNA is not introduced. A method for confirming a change in messenger RNA expression may include, for example, labeling a target gene of the microRNA with a luminescent protein or the like and detecting a change in a signal from the luminescent protein due to the expression of the microRNA. Alternatively, a method for confirming a change in messenger RNA expression may include, for example, quantifying the expression of messenger RNA in the host cell by real-time RT-PCR or the like.

[0044] In one aspect, the present invention relates to a method for expressing a microRNA in a host cell using the expression vector of the present invention. In another aspect, the present invention relates to a method for suppressing expression of a target messenger RNA in a host cell, comprising introducing the expression vector of the present invention into the host cell. These methods may not involve medical treatment of humans. As described above, the vector of the present invention allows for efficient expression of the microRNA because mature microRNA is obtained in the nucleus and does not depend on random cleavage due to RNA degradation in the cytoplasm.

[0045] [Pharmaceutical composition] In one aspect, the present invention relates to a pharmaceutical composition comprising the expression cassette or expression vector of the present invention (hereinafter, also referred to as the pharmaceutical composition of the present invention). Abnormal expression of microRNA in vivo is known to be associated with various diseases and physiological functions. The pharmaceutical composition of the present invention has potential for use in gene therapy of diseases associated with abnormal expression of microRNA.

[0046] In the pharmaceutical composition of the present invention, the expression cassette or expression vector of the present invention may be configured as described in the sections [Expression Cassette] and [Expression Vector]. The content of the expression cassette or expression vector of the present invention as an active ingredient in the pharmaceutical composition of the present invention is not particularly limited and may be, for example, 0.1 to 99.9% (w / w).

[0047] The pharmaceutical composition of the present invention may be administered parenterally (e.g., intravenously, intratumorally, intramuscularly, intraperitoneally, intraventricularly, or intrathecally) or orally.

[0048] The pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier, additive, etc. "Pharmaceutically acceptable" means that it does not cause adverse events when administered to a living body and does not cause adverse interactions with other components contained in the pharmaceutical composition. Pharmaceutically acceptable carriers may be, for example, microcapsules, liposomes, polymer micelles, microspheres, nanospheres, nanosuspensions, etc. Pharmaceutically acceptable additives may be, for example, excipients, suspending agents, emulsifiers, preservatives, surfactants, isotonicity agents, antioxidants, pH adjusters, stabilizers, thickeners, etc.

[0049] The subjects to which the pharmaceutical composition of the present invention is administered may be mammals such as humans, monkeys, mice, rats, guinea pigs, rabbits, hamsters, dogs, cats, weasels, cows, and pigs, and preferably humans.

[0050] The dosage of the pharmaceutical composition of the present invention can be appropriately determined depending on various conditions such as the purpose of treatment, the age and general condition of the subject, the route of administration, and the presence or absence of concomitant drugs. The dosage of the pharmaceutical composition of the present invention can be, for example, 10 -7 mg / kg or more, 10 -6 mg / kg or more, 10 -5 mg / kg or more, 10 -4 mg / kg or more, 10 -3 mg / kg or more, 10 -2 mg / kg or more, 10 -1mg / kg or more, 1 mg / kg, 10 mg / kg or more, 10 2 The dosage of the pharmaceutical composition of the present invention may be, for example, 10 mg / kg as the dosage of the expression vector. 7 vg / kg or more, 10 8 vg / kg or more, 10 9 vg / kg or more, 10 10 vg / kg or more, 10 11 vg / kg or more, 10 12 vg / kg or more.

[0051] The frequency or number of administrations of the pharmaceutical composition of the present invention can be appropriately determined depending on various conditions such as the purpose of treatment, the age and general condition of the subject, the route of administration, the presence or absence of concomitant medications, metabolic function, and excretory function, and may be, for example, once every three months, once a month, once a week, once every two days, once a day, or twice a day. [Example]

[0052] The present invention will be described in more detail below by way of examples, but the present invention should not be construed as being limited to the specific embodiments shown in the examples.

[0053] <Example 1. Construction of microRNA expression vector> A cassette containing human R3HDM1 exon 18 (SEQ ID NO: 1), a portion of intron 18 (SEQ ID NO: 2, a 112-base region from the 5' end of intron 18), a multiple cloning site (SEQ ID NO: 3), a portion of intron 18 (SEQ ID NO: 4, a 135-base region from the 3' end of intron 18), exon 19 (SEQ ID NO: 5), and a fluorescent protein gene (SEQ ID NO: 6) was constructed. This cassette was ligated downstream of the CMV promoter of the commercially available pCI-neo vector to create a microRNA expression vector (SEQ ID NO: 7) (Figure 1).

[0054] To investigate the effect of this microRNA expression vector, we constructed a miR128-1 microRNA expression vector by incorporating miR128-1 twice consecutively into the multicloning site (Fig. 2).

[0055] <Example 2. Gene transfer test of microRNA expression vector> To verify the transduction of microRNA expression vectors into cells, HEK293 cells were transfected with either the miR128-1 microRNA expression vector or a microRNA expression vector lacking miR128-1, along with a reporter vector containing the 3' UTR sequence of PHF6, one of miR128's targets, integrated into the 3' UTR of the luciferase gene, and a vector expressing β-galactosidase to measure transduction efficiency. After 48 hours, fluorescent protein was detected using a fluorescence microscope. Expression of the fluorescent protein derived from the microRNA expression vector was observed in HEK293 cells (Figure 3). This confirms that the fluorescent protein fused to the peptide portion from exon 18 to exon 19 of R3HDM1 can label transfected cells in the same way as conventional fluorescent proteins. Furthermore, no cytotoxicity, such as cell death, was observed due to the fused fluorescent protein (Figure 3).

[0056] Example 3. Messenger RNA expression suppression test using microRNA expression vector For HEK293 cells transfected with the miR128-1 microRNA expression vector in Example 2, the cells were harvested 48 hours later and luciferase activity and β-galactosidase activity were measured. The ratio of the respective activity values ​​(luciferase activity / β-galactosidase activity) was calculated and compared with the value for cells transfected with a microRNA expression vector that did not contain miR128-1. As a result, in cells transfected with the miR128-1 microRNA expression vector, the activity was reduced to 38%, confirming the effect of suppressing messenger RNA expression (Figure 4).

[0057] <Example 4. Confirmation of intranuclear splicing of microRNA expression vector> For HEK293 cells transfected with the miR128-1 microRNA expression vector in Example 2, the cells were harvested 48 hours later, and RNA was extracted. A transcript was obtained from this RNA by reverse transcription, and PCR was performed using this as a template to detect splicing products derived from the miR128-1 microRNA expression vector. As a result, a splicing product of intron 18-19 (Figure 5, "S") was confirmed, confirming that the microRNA expression vector was spliced ​​in the nucleus.

[0058] In addition, expression vectors were created in the same manner as in Example 1 using a 500-base region from the 5' end of intron 18 and a 500-base region from the 3' end of intron 18 instead of sequence number 2 and sequence number 4, respectively, and experiments similar to those in Examples 2 to 4 were performed.As with the use of sequence number 2 and sequence number 4, microRNA expression, suppression of target messenger RNA expression, and splicing within the nucleus were confirmed (results not shown).

[0059] (Sequences described in the specification) SEQ ID NO: 1: human R3HDM1 exon 18 ATGCCAGCCTGTTATTGCGCTCCAGGCCACTATCACTCCAGCCAACCTCAGTATCGCCCAGTCCCTTCTGTTCATTACAATTCACATCTAAACCAACCACTGCCACAACCTGCGCAGCAGACAG

[0060] SEQ ID NO: 2: human R3HDM1 intron 18 donor side GTGAGTTGTGTTTCTTATGTCATAACTTCTGAGCCACACTTTTTTCCATCTTCTATTTCAGTGTTGCTCTTAAGATAGTACCTACTCAGTCTCTCAGGATCTCGAA

[0061] Sequence number 3: Multi-cloning site (MCS) used in Example cTCGACCGCGGTCGACGATATCTAGACGCGTCTCGAG

[0062] Accession No. 4: human R3HDM1 intron 18 acceptor side AGATGGTTTTAGGGGCTTACCATTTAATCAAAATTTTATCATTTTAGAGCATAAAAGTACTCGCTTAAATTTTTTTTTAAATCTTACTAGATGAAATGAATTCAGAGCAGGATTTAACTCATTGTACCATTACAG

[0063] Accession No. 5: human R3HDM1 exon 19 GTTATCAAGTTATACCCAACCAGCAGCAAAACTACCAAGGAATAGTTGGAGTTCAGCAACCCCAGAGTCAGAGCCTAGTCAGTGGCCAACCCAACAGCATTGGAAATCAGATTCAAGGAGTGGTCATCCCCTATACTTCAGTGCCAACATATCAG

[0064] Accession No. 6: DNA encoding GFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0065] SEQ ID NO: 7: vector showed in Figure 1

[0066] SEQ ID NO: 8: Human R3HDM1 intron 18-derived DNA including MCS, used in Example GTGAGTTGTGTTTCTTATGTCATAACTTCTGAGCCACACTTTTTTCCATCTTCTATTTCAGTGTTGCTCTTAAGATAGTACCTACTCAGTCTCTCAGGATCTCGAACTCGACCGCGGTCGACGATATCTAGACGCGTCT CGAGAGATGGTTTTAGGGGCTTACCATTTAATCAAAATTTTATCATTTTAGAGCATAAAAGTACTCGCTTAAATTTTTTTTAAATCTTACTAGATGAAATGAATTCAGAGCAGGATTTAACTCATTGTACCATTACAG

[0067] SEQ ID NO: 9: Poly A signal AATAAA

[0068] SEQ ID NO: 10: SV40 T antigen PKKKRKV

[0069] Sequence number 11:c-myc PAAKRVKLD

[0070] SEQ ID NO: 12: p53 PQPKKKP

[0071] SEQ ID NO: 13: NF-κB p50 QRKRQK

Claims

1. a first exon and a second exon, and an intron-derived DNA between the 3' end of the first exon and the 5' end of the second exon; An expression cassette in which DNA encoding a microRNA is inserted into DNA derived from an intron.

2. 2. The expression cassette of claim 1, wherein the DNA from the first exon, the second exon, and the intron are from the same gene.

3. The expression cassette of claim 1 , wherein the first exon has an initiation codon at the 5′ end.

4. The expression cassette of claim 1, wherein the first exon is exon 18 of the human R3HDM1 gene, the second exon is exon 19 of the human R3HDM1 gene, and the intron-derived DNA is DNA derived from intron 18 of the human R3HDM1 gene.

5. The expression cassette of claim 1 , wherein the intron-derived DNA comprises a multiple cloning site.

6. The expression cassette of claim 5 , wherein one or more DNAs encoding microRNAs are inserted into the multiple cloning site.

7. The expression cassette according to claim 5 , wherein DNA encoding one or more types of microRNA is inserted into the multicloning site.

8. The expression cassette of claim 1 , wherein the microRNA is miR128.

9. 2. The expression cassette of claim 1, wherein the intron-derived DNA comprises a contiguous base sequence of at least 6 bases from the 5' end of the intron and a contiguous base sequence of at least 6 bases from the 3' end of the intron, and encodes a sequence that is removed from the messenger RNA by splicing.

10. The expression cassette of claim 1 further comprising DNA encoding a marker protein.

11. the first exon is composed of DNA having the base sequence of SEQ ID NO: 1, The second exon is composed of DNA having the base sequence of SEQ ID NO: 5, The intron-derived DNA containing a multicloning site consists of DNA having the base sequence of SEQ ID NO:

8. The expression cassette of claim 5.

12. An expression vector comprising the expression cassette of claim 1.

13. A pharmaceutical composition comprising the expression cassette according to any one of claims 1 to 11 or the expression vector according to claim 12.