Adeno-associated virus delivery of CLN3 polynucleotide
Recombinant adeno-associated virus (rAAV9) vectors encoding the CLN3 polypeptide provide a therapeutic approach for CLN3-Batten disease, effectively reducing disease progression and neuroinflammation by delivering the CLN3 gene, addressing the need for a treatment that slows the disease's progression.
Patent Information
- Application Number
- JP2025090921
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-02-04
- Filing Date
- 2025-05-30
- Publication Date
- 2025-09-25
AI Technical Summary
There is a need for an effective treatment for CLN3-Batten disease, a severe neurodegenerative disorder caused by mutations in the CLN3 gene, which leads to progressive vision loss, cognitive decline, seizures, and early mortality, with current therapies primarily focusing on symptom management rather than disease progression.
The use of recombinant adeno-associated virus (rAAV) vectors, specifically rAAV9, encoding the CLN3 polypeptide, is employed for CLN3 gene therapy, with self-complementary and single-stranded forms, incorporating specific promoters and terminal repeats, to deliver the CLN3 gene to neuronal cells.
The rAAV9-mediated CLN3 gene therapy reduces lysosomal accumulation of autofluorescent storage materials, delays neuroinflammation, and stabilizes disease progression, as evidenced by improved Unified Batten Disease Rating Scale scores and reduced brain atrophy.
Smart Images

Figure 2025138648000001 
Figure 2025138648000002 
Figure 2025138648000003
Abstract
Description
[Technical Field]
[0001] This application claims priority to U.S. Provisional Patent Application No. 62 / 800,911, filed February 4, 2019, which is incorporated herein by reference in its entirety.
[0002] Incorporation by reference of sequence listing This application contains, as a separate part of the disclosure, a Sequence Listing in computer-readable format (Filename: 53576_SeqListing.txt, 26,705 byte, ASCII text file created on January 31, 2020), which is incorporated herein by reference in its entirety.
[0003] This disclosure relates to recombinant adeno-associated virus (rAAV) delivery of ceroid lipofuscinosis neuron 3 (CLN3) polynucleotides. This disclosure provides rAAV and methods of using rAAV for CLN3 gene therapy of neuronal ceroid lipofuscinosis (NCL) or CLN3-Batten disease. [Background technology]
[0004] Neuronal ceroid lipofuscinoses (NCLs) are a group of severe neurodegenerative disorders.
[0005] Mutations in the CLN3 gene cause juvenile NCL or CLN3-Batten disease (Kitzmu et al., Human Molecular Genetics 2008;17(2):303-312; Munroe et al., Am J Hum Genet. 1997;61:310-316), also known as Spielmeier-Sjögren-Voigt disease. The mutations disrupt the lysosomal storage clearance process. To date, 67 disease-causing mutations have been reported. However, 85% of patients are homozygous for a 1.02-kb deletion, which results in the loss of exons 7 and 8. The CLN3 mutations found in patients primarily cause a decrease in the amount or functionality of the protein (battenin).
[0006] CLN3-Batten disease typically presents between the ages of 4 and 7 years, with insidious but rapidly progressive vision loss. Children with juvenile NCL transition from normal vision to blindness over the course of several months, but can maintain light and dark perception for several years thereafter. Cognitive and motor decline typically occurs later (7–10 years), accompanied by behavioral problems such as aggression (8–10 years) and subsequent seizures (10–12 years). Parkinsonian features develop between the ages of 11 and 13 years. Cardiac conduction abnormalities have been reported in individuals in the later stages of the disease. While there is considerable phenotypic diversity among individuals affected with CLN3-Batten disease, all share low vision or progressive blindness. Furthermore, the physical subscale of the Unified Batten Disease Rating Scale (UBDRS), validated in 82 patients, demonstrates a steady and measurable decline of 2.86 points per year (2.27–3.45, p<0.0001). The average survival time is usually 15 years from the onset of symptoms to the end of life.
[0007] Treatment strategies for CLN3-Batten disease range widely in efforts to modify the disease. These include medications such as EGIS-8332 and talampanel that target AMPA receptors, drugs that allow readthrough of premature termination mutations, drugs that aid in the breakdown of accumulated storage materials (cystagon / cysteamine), and even immunosuppressive therapies (mycophenolate, prednisolone). Enzyme replacement therapy and stem cell therapy are also being evaluated. Many therapeutic avenues have been investigated, but few have been evaluated in clinical settings. None are available to slow progression or cure the disease. Patients and families rely on treatments to improve symptoms and palliative care.
[0008] Cln3 Δex7 / 8A mouse model was created in the early 2000s to mimic the most common disease-causing mutation in CLN3-Batten disease patients: a ∼1 kb mutation that eliminates exons 7 and 8 from the CLN3 gene (Cotman et al., Hum Mol Genet. 2002;11(22):2709-2721; Mole et al., Eur J Paediatr Neurol. 2001;5:7-10). This mutation is found in 85% of patients as a homozygous mutation and in an additional 15% as a heterozygous mutation in combination with a point mutation on another allele. The loss of the exon is predicted to result in a frameshift mutation, resulting in a short, truncated protein product with lost or reduced activity (Lerner et al., Cell. 1995 Sep 22;82(6):949-57; Kitzmuller et al., Hum Mol Genet. 2008 Jan 15;17(2):303-12). In their initial study, Cotman et al. Δex7 / 8 We demonstrated that the mouse model successfully recapitulated some aspects of CLN3 disease. Δex7 / 8 Animals accumulated autofluorescent storage materials and ATP synthase subunit C in the nervous system at various time points and showed astrocyte reactivity in the brain from 10 months of age. Subsequent studies detailed alterations in glutamate receptor function in the cerebellum, which corresponded to motor deficits in the accelerating rotarod assay (Cotman et al., Hum Mol Genet. 2002;11(22):2709-2721). Behaviorally, CLN3 Δex7 / 8 Mice have been characterized at both juvenile and adult ages, and neonatal and young adult mice exhibit neurodevelopmental motor delays, with impaired gait and hindlimb grasp at 10-12 months of age (Cotman et al., Hum Mol Genet. 2002;11(22):2709-2721; Osorio et al., Genes Brain Behav. 2009 Apr;8(3):337-345). CLN3 Δex7 / 8Mice do not appear to have functional visual impairments but do show a slight survival impairment when compared with 12-month-old controls (Cotman et al., Hum Mol Genet. 2002;11(22):2709-2721; Seigel et al., Mol Cell Neurosci. 2002 Apr;19(4):515-27). Taken together, CLN3 harboring the most frequent human mutations Δex7 / 8 The mouse model exhibits numerous cellular and behavioral changes consistent with CLN3-Batten disease, making it a suitable model for testing therapies.
[0009] Thus, there remains a need in the art for a treatment for CLN3-Batten disease. Summary of the Invention
[0010] Provided herein are methods and products for CLN3 gene therapy using recombinant AAV.
[0011] Provided herein is a recombinant adeno-associated virus 9 (rAAV9) encoding a CLN3 polypeptide, comprising an rAAV9 genome comprising, in 5' to 3' order, a P546 promoter and a polynucleotide encoding a CLN3 polypeptide. In some embodiments, the rAAV9 genome comprises a self-complementary genome. In some embodiments, the rAAV9 genome comprises a single-stranded genome.
[0012] Provided is a self-complementary recombinant adeno-associated virus 9 (scAAV9) encoding the CLN3 polypeptide set forth in SEQ ID NO:1, wherein the genome of the scAAV9 comprises, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO:3, a polynucleotide encoding the CLN3 polypeptide set forth in SEQ ID NO:1, and a second AAV inverted terminal repeat. The polynucleotide encoding the CLN3 polypeptide can be at least 90% identical to SEQ ID NO:2.
[0013] Also provided is an scAAV9 having a genome comprising, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO:3, an SV40 intron, a polynucleotide encoding the CLN3 polypeptide of SEQ ID NO:1, and a second AAV inverted terminal repeat; and an scAAV9 having a genome comprising, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO:3, a polynucleotide encoding the CLN3 polypeptide of SEQ ID NO:1, a bovine growth hormone polyadenylation polyA sequence, and the second AAV inverted terminal repeat. In an exemplary embodiment, the scAAV9 has a genome comprising the gene cassette set forth in SEQ ID NO:4.
[0014] A single-stranded recombinant adeno-associated virus 9 (ssAAV9) is provided that encodes the CLN3 polypeptide set forth in SEQ ID NO:1, wherein the genome of the ssAAV9 comprises, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO:3, a polynucleotide encoding the CLN3 polypeptide set forth in SEQ ID NO:1, and a second AAV inverted terminal repeat. The polynucleotide encoding the CLN3 polypeptide can be at least 90% identical to SEQ ID NO:2. Also provided are ssAAV9 having a genome comprising, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, an SV40 intron, a polynucleotide encoding the CLN3 polypeptide of SEQ ID NO: 1, and a second AAV inverted terminal repeat; and ssAAV9 having a genome comprising, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, a polynucleotide encoding the CLN3 polypeptide of SEQ ID NO: 1, a bovine growth hormone polyadenylation polyA sequence, and a second AAV inverted terminal repeat.
[0015] The nucleic acid sequence set forth in SEQ ID NO:4 is the gene cassette provided in Figure 1 A. Provided is an rAAV9 having an scAAV9 genome or an ssAAV9 genome that includes a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:4, or at least 95% identical to the nucleic acid sequence of SEQ ID NO:4, or at least 98% identical to the nucleic acid sequence of SEQ ID NO:4.
[0016] Also provided is a nucleic acid molecule comprising a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, a nucleic acid sequence encoding the CLN3 polypeptide of SEQ ID NO: 1, and a second AAV inverted terminal repeat. In some embodiments, the polynucleotide encoding the CLN3 polypeptide may be at least 90% identical to SEQ ID NO: 2.
[0017] Also provided is a nucleic acid molecule comprising a first AAV inverted terminal repeat, a P546 promoter comprising the nucleotide sequence of SEQ ID NO: 3, an SV40 intron, a nucleic acid sequence encoding the CLN3 polypeptide of SEQ ID NO: 1, and a second AAV inverted terminal repeat. Further provided is a polynucleotide comprising a first AAV inverted terminal repeat, a P546 promoter comprising the sequence of SEQ ID NO: 3, a nucleic acid encoding the CLN3 polypeptide of SEQ ID NO: 1, a bovine growth hormone polyadenylation polyA sequence, and a second AAV inverted terminal repeat. In any of the provided polynucleotides, the CLN3 polypeptide can be encoded by the nucleic acid sequence set forth in SEQ ID NO: 2, or a sequence at least 90% identical to SEQ ID NO: 2.
[0018] rAAV9, scAAV9, or ssAAV9 comprising any of these polynucleotides are provided. rAAVs having a single-stranded genome are also provided.
[0019] Also provided are rAAV9 viral particles encoding a CLN3 polypeptide, wherein the rAAV9 genome comprises, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising a nucleic acid sequence at least 90% identical to SEQ ID NO:3, a polynucleotide encoding a CLN3 polypeptide at least 90% identical to SEQ ID NO:1, and a second AAV inverted terminal repeat. The provided rAAV9 particles may comprise a polynucleotide encoding a CLN3 polypeptide comprising an amino acid sequence at least 90% identical to SEQ ID NO:1. In addition, the rAAV9 viral particles may comprise an AAV9 genome comprising a nucleic acid sequence at least 90% identical to the nucleic acid sequence of SEQ ID NO:4, at least 95% identical to the nucleic acid sequence of SEQ ID NO:4, or at least 98% identical to the nucleic acid sequence of SEQ ID NO:4. Any of the rAAV9 viral particles may further comprise an SV40 intron and / or a BGH polyA sequence.
[0020] In any of the provided rAAV, ssAAV, and scAAV, the AAV inverted terminal repeats can be AAV2 inverted terminal repeats.
[0021] Also provided is a nucleic acid molecule comprising an rAAV9 genome comprising, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising a nucleic acid sequence at least 90% identical to SEQ ID NO: 3, and a polynucleotide encoding a CLN3 polypeptide at least 90% identical to SEQ ID NO: 1. The provided nucleic acid molecules can comprise self-complementary genomes or single-stranded genomes.
[0022] Also provided is a nucleic acid molecule comprising an rAAV9 genome comprising, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter comprising a nucleic acid sequence at least 90% identical to SEQ ID NO:3, a polynucleotide encoding a CLN3 polypeptide at least 90% identical to SEQ ID NO:1, and a second AAV inverted terminal repeat. The provided nucleic acid molecule may comprise a polynucleotide encoding a CLN3 polypeptide comprising an amino acid sequence at least 90% identical to the amino acid sequence of SEQ ID NO:1. Additionally, the nucleic acid molecule may comprise an AAV9 genome comprising a nucleic acid sequence at least 90% identical to the nucleic acid sequence of SEQ ID NO:4, at least 95% identical to the nucleic acid sequence of SEQ ID NO:4, or at least 98% identical to the nucleic acid sequence of SEQ ID NO:4. Any of the provided nucleic acid molecules may further comprise an SV40 intron and / or a BGH polyA sequence.
[0023] Also provided are compositions comprising a scAAV9 described herein, a ssAAV9 described herein, a nucleic acid molecule described herein, or a rAAV viral particle described herein, and at least one pharmaceutically acceptable excipient. In some cases, the pharmaceutically acceptable excipient comprises a non-ionic hypo-osmolar compound, a buffer, a polymer, a salt, or a combination thereof. In some embodiments, the polymer is a copolymer. In some embodiments, the copolymer is a poloxamer. For example, the composition can include at least a pharmaceutically acceptable excipient comprising a non-ionic hypo-osmolar compound. For example, the pharmaceutically acceptable excipient comprises about 20-40% of a non-ionic hypo-osmolar compound, or about 25% to about 35% of a non-ionic hypo-osmolar compound. An exemplary composition includes scAAV formulated in 20 mM Tris (pH 8.0), 1 mM MgCl, 200 mM NaCl, 0.001% poloxamer 188, and about 25% to about 35% of a non-ionic hypoosmolar compound. Another exemplary composition includes scAAV formulated in 1× PBS and 0.001% Pluronic F68.
[0024] Also provided is a method of treating CLN3-Batten disease in a subject, comprising administering to the subject a composition comprising a therapeutically effective amount of any of the rAAV9 viral particles disclosed herein, any of the scAAV9s disclosed herein, any of the ssAAV9s disclosed herein, any of the nucleic acid molecules described herein, or any of the compositions described herein.
[0025] In any of the provided methods, the composition, rAAV9, ssAAV9, scAAV9 and / or nucleic acid molecule is administered via a route selected from the group consisting of intrathecal, intracerebroventricular, intraparenchymal, intravenous, and combinations thereof.
[0026] Use of a therapeutically effective amount of any of the rAAV9 viral particles disclosed herein, any of the scAAV9s disclosed herein, any of the ssAAV9s disclosed herein, any of the nucleic acid molecules described herein, or any of the compositions described herein for the preparation of a medicament for the treatment of CLN3-Batten disease in a subject in need thereof.
[0027] Also provided is a composition comprising a therapeutically effective amount of any of the rAAV9 viral particles disclosed herein, any of the scAAV9s disclosed herein, any of the ssAAV9s disclosed herein, any of the nucleic acid molecules described herein, or any of the described compositions for treating CLN3-Batten disease in a subject in need thereof.
[0028] Exemplary doses of scAAV9, ssAAV9, or rAAV9 administered by the intrathecal route are from about 1 x 10 vg of scAAV9, ssAAV9, or rAAV9 viral particles per subject to about 2 x 10 vg per subject, or from about 1 x 10 vg of scAAV9, ssAAV9, or rAAV9 viral particles per subject to about 1 x 10 vg of scAAV9, ssAAV9, or rAAV9 viral particles per subject. or from about 1 x 10 vg of scAAV9, ssAAV9, or rAAV9 viral particles per subject to about 1 x 10 vg of scAAV9, ssAAV9, or AAV9 viral particles per subject, or from about 1 x 10 vg of scAAV9, ssAAV9, or rAAV9 viral particles per subject to about 1 x 10 vg of scAAV9, ssAAV9, or AAV9 viral particles per subject. For example, about 1 x 10 vg of scAAV9, ssAAV9, or AAV9 viral particles is administered to the subject, or about 1.5 x 10 scAAV9, ssAAV9, or AAV9 viral particles is administered to the subject, or about 3.4 x 10 scAAV9, ssAAV9, or AAV9 viral particles is administered to the subject, or about 6 x 10 vg of scAAV9, ssAAV9, or AAV9 viral particles is administered to the subject, or about 1.2 x 10 scAAV9, ssAAV9, or AAV9 viral particles is administered to the subject, or about 2 x 10 scAAV9, ssAAV9, or AAV9 viral particles are administered to the subject.
[0029] The treatment method, agent, or composition results in one or more of the following in a subject compared to a pre-treatment subject or an untreated CLN3-Batten disease patient: (a) reduced or delayed lysosomal accumulation of autofluorescent storage material, (b) reduced or delayed lysosomal accumulation of ATP synthase subunit C, (c) reduced or delayed glial activation (astrocytes and / or microglia), (d) reduced or delayed astrocytosis, (e) reduced or delayed brain volume loss as measured by MRI, (f) reduced or delayed onset of seizures, and (g) stabilization, reduced or delayed progression, or improvement in one or more of the scales used to assess the progression and / or improvement of CLN3 Batten disease, e.g., the Unified Batten Disease Rating System (UBDRS) scale or the Hamburg Motor and Language Scale. The subject may be held in the Trendelenberg position after administration of the rAAV9, ssAAV9, or scAAV or nucleic acid molecule disclosed herein.
[0030] Also provided is a method of treating CLN3 disease in a subject in need of treatment, comprising delivering any one of the rAAV viruses disclosed herein, any of the scAAV9s disclosed herein, any of the ssAAV9s disclosed herein, a composition comprising any of the nucleic acid molecules described herein, or any of the compositions described herein or any of the agents described herein to the brain or spinal cord of a patient in need of treatment.
[0031] In any of the provided methods or uses, the composition or agent can be delivered by intrathecal, intraventricular, intracerebral parenchymal, or intravenous injection, or a combination thereof. Any of the provided methods can further comprise placing the patient in Trendelenberg position after intrathecal injection of the composition, rAAV9 viral particle or scAAV, or nucleic acid molecule disclosed herein.
[0032] In any of the provided methods or uses, the composition or medicament can include a non-ionic low-osmolar contrast agent, for example, the composition includes a non-ionic low-osmolar contrast agent selected from the group consisting of iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, ioxilan, and combinations thereof.
[0033] The administered composition or medicament may contain a pharmaceutically acceptable excipient. For example, the pharmaceutically acceptable excipient may contain about 20-40% of a non-ionic hypo-osmolar compound, or about 25% to about 35% of a non-ionic hypo-osmolar compound. An exemplary composition includes scAAV formulated in 20 mM Tris (pH 8.0), 1 mM MgCl2, 200 mM NaCl, 0.001% poloxamer 188, and about 25% to about 35% of a non-ionic hypo-osmolar compound. Another exemplary composition includes scAAV formulated in 1x PBS and 0.001% Pluronic F68.
[0034] In any of the provided methods or uses, when composition or agent is delivered to brain or spinal cord, composition can be delivered to brainstem, or can be delivered to cerebellum, or can be delivered to visual cortex, or can be delivered to motor cortex.Furthermore, in any of the provided methods or uses, when composition or agent is delivered to brain or spinal cord, composition can be delivered to nerve cells, glial cells, or both.For example, delivering to brain or spinal cord includes delivery to nervous system cells such as neurons, lower motor neurons, microglial cells, oligodendrocytes, astrocytes, Schwann cells, or combinations thereof.
[0035] The method, use, or administration of the composition or agent results in a subject experiencing one or more of the following, compared to a pre-treatment or untreated subject: (a) reduced or delayed lysosomal accumulation of autofluorescent storage material; (b) reduced or delayed lysosomal accumulation of ATP synthase subunit C; (c) reduced or delayed glial activation (astrocyte and / or microglia) activation; (d) reduced or delayed astrocytosis; (e) reduced or delayed brain volume loss as measured by MRI; (f) reduced or delayed onset of seizures; and (g) stabilization, reduced or delayed progression, or improvement in one or more of the scales used to assess the progression and / or improvement of CLN3 Batten disease, e.g., the Unified Batten Disease Rating System (UBDRS) rating scale or the Hamburg Motor and Language Scale.
[0036] Headings herein are for the convenience of the reader and are not intended to be limiting.
[0037] The use of "may" and "can" herein is intended to describe various embodiments that may be included within the claims, and is not intended to imply uncertainty about the scope of the claims. [Brief explanation of the drawings]
[0038] [Figure 1] A schematic diagram of the scAAV9.P546.CLN3 gene cassette (Figure 1A) and the plasmid construct pAAV.P546.CLN3.KAN (Figure 1B) used to produce scAAV9.P546.CLN3 are provided. The human CLN3 cDNA was inserted under the control of the P546 promoter between the AAV2-derived inverted terminal repeat (ITR) structures. The SV40 intron (upstream of the human CLN3 cDNA) and bovine growth hormone polyadenylation (BGH polyA) terminator sequence (downstream of the human CLN3 cDNA) aid in mRNA processing and enhance transgene expression. The sequence of the plasmid construct pAAV.P546.CLN3.KAN is set forth in SEQ ID NO: 5. This genome is packaged into the AAV9 capsid protein. [Figure 2]1 provides an image showing the presence of human CLN3 transcripts in CLN3Δex7 / 8 mice injected with scAAV9.P546.CLN3. [Figure 3] This figure provides graphs showing the early decrease in ASM accumulation in CLN3Δex7 / 8 mice injected with scAAV9.P546.CLN3 at 2 months post-injection. The y-axis of all graphs shown represents the total area of ASM accumulation. Black bars represent wild-type mice (WT-PBS), light gray bars represent PBS-injected CLN3Δex7 / 8 mice, and dark gray bars represent scAAV9.P546.CLN3-injected CLN3Δex7 / 8 mice. [Figure 4] Graphs are provided for CLN3Δex7 / 8 mice injected with scAAV9.P546.CLN3 showing a significant reduction in ASM accumulation at 4 and 6 months post-injection in various brain regions in PBS-injected wild-type mice (“WT”), PBS-injected CLN3Δex7 / 8 (“CLN3”), and scAAV9.P546.CLN3-injected CLN3Δex7 / 8 (“CLN3-AAV”). [Figure 5]Images and graphs are provided showing that ICV administration of scAAV9.P546.CLN3 reduced the abnormal lysosomal accumulation of the mitochondrial protein ATP synthase subunit C in the brains of 4- and 6-month-old CLN3Δex7 / 8 mice. Representative images of frozen tissue sections stained for ATP synthase subunit C and visualized by DAB staining at 6 months are provided in the upper panel. The graph in the lower panel provides quantification of subunit C accumulation in the somatosensory 1 barrel field (S1BF) of the cortex at 4 months (4M) and 6 months (6M) post-injection, and in the ventral posteromedial / ventral posterolateral nuclei (VPM / VPL) of PBS-injected WT ("WT"), PBS-injected CLN3Δex7 / 8 ("CLN3"), and scAAV9.P546.CLN3-injected CLN3Δex7 / 8 ("CLN3-AAV") mice at 4 months (4M) and 6 months (6M) post-injection. N=5, p≦0.0001 between untreated CLN3Δex7 / 8 and scAAV9.P546.CLN3-treated animals and between wild-type animals, p≦0.5 between wild-type and treated CLN3Δex7 / 8 mice in SIBF at 4 and 6 months post-injection. [Figure 6] Images and graphs are provided showing that ICV administration of scAAV9.P546.CLN3 reduced astrocytosis in the brains of 4- and 6-month-old CLN3Δex7 / 8 mice. Top: Representative images of fixed tissue sections (6 months) stained for GFAP as a marker for activated astrocytes and visualized with DAB staining. Bottom: Quantification of GFAP-positive areas at 4 and 6 months post-injection in PBS-injected WT ("WT"), PBS-injected CLN3Δex7 / 8 ("CLN3"), and scAAV9.P546.CLN3-injected CLN3Δex7 / 8 ("CLN3-AAV") mice. N=5 for each group and time point. S1BF=barrel cortex. VPM / VPL=ventral posteromedial nucleus / ventral posterolateral nucleus. [Figure 7]Images and graphs are provided showing that ICV administration of scAAV9.P546.hCLN3 reduced microglial activation in the brains of 4- and 6-month-old CLN3Δex7 / 8 mice. Top: Representative images of fixed tissue sections (6 months) stained for CD68 as a marker of activated microglia and visualized with DAB staining. Bottom: Quantification of CD68-positive areas at 4 and 6 months post-injection in PBS-injected WT ("WT"), PBS-injected CLN3Δex7 / 8 ("CLN3"), and scAAV9.P546.CLN3-injected CLN3Δex7 / 8 ("CLN3-AAV") mice. N=5 for each group and time point. S1BF=barrel cortex. VPM / VPL=ventral posteromedial nucleus / ventral posterolateral nucleus. [Figure 8] Graphs are provided showing rotarod analysis of wild-type and PBS- or treated CLN3Δex7 / 8 mice up to 18 months post-injection: all mice of both sexes (top panel), males only (middle panel), and females only (bottom panel). [Figure 9] Graphs are provided showing Morris water maze performance of wild-type and PBS- or scAAV9.P546.CLN3-treated CLN3Δex78 mice up to 18 months post-injection for all mice (top panel), males only (middle panel), and females only (bottom panel). [Figure 10] Graphs showing the performance of scAAV9.P546.CLN3-treated CLN3Δex7 / 8 mice and PBS-treated mice in a pole-climbing assay, in which mice are placed facing up onto a vertical pole, and the number of falls along with the time it takes for the mouse to turn and descend measures balance and agility. All mice (top panel), males only (middle panel), and females only (bottom panel). [Figure 11]Graphs are provided showing that scAAV9.P546.CLN3-treated CLN3Δex7 / 8 mice fell less frequently from a vertical pole compared to PBS-treated CLN3Δex7 / 8 mice. Mice were placed facing up on a vertical pole and the number of times they fell while trying to turn around was counted to measure balance and agility. All mice (top panel), males only (middle panel), and females only (bottom panel). [Figure 12] 1 provides images showing immunofluorescence Western blot detection of GFP protein in various brain regions as well as peripheral mouse tissues 3 weeks after injection of scAAV9.P546.GFP. [Figure 13] This figure shows reverse transcription quantitative PCR of the expression of human CLN3 in various brain regions of a 4-year-old cynomolgus monkey (Cynomolgus Macaque) 12 weeks after intrathecal lumbar injection of 3 x 10 vg of scAAV9.P546.CLN3. These values were normalized to the level of CLN3 protein in lumbar spinal cord regions 4-7. [Figure 14] The nucleic acid sequence of the scAAV9.P546.CLN3 gene cassette (SEQ ID NO:4) is provided. The AAV2 ITR nucleic acid sequence is shown in italics (5' ITR is set forth as SEQ ID NO:6 and 3' ITR is set forth as SEQ ID NO:9), the P546 promoter nucleic acid sequence (SEQ ID NO:3) is single underlined, the SV40 intron nucleic acid sequence (SEQ ID NO:7) is double underlined, the nucleic acid sequence of the human CLN3 cDNA sequence (SEQ ID NO:2) is shown in bold, and the nucleic acid sequence of the BGH polyA terminator (SEQ ID NO:8) is underlined with a dotted line. [Figure 15] The nucleic acid sequence of full-length AAV9.P546.CLN3 (SEQ ID NO:5) is provided. [Figure 16] Data are provided showing that scAAV9.p546.CLN3 treatment increases hCLN3 transcript expression levels in the cerebral cortex and spinal cord of Cln3Δ7 / 8 mice by 24 months of age, as measured by qPCR. Mean ± SEM, ordinary one-way ANOVA for each month; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 [Figure 17] 10 provides images showing that scAAV9.p546.CLN3 treatment produces stable hCLN3 transcripts throughout the brain of Cln3Δ7 / 8 mice up to 24 months of age as measured by RNAscope (red fluorescence). Images taken at 20x magnification. [Figure 18] Data are provided showing that scAAV9.p546.CLN3 treatment prevented and reduced ASM accumulation in two brain regions of Cln3Δ7 / 8 mice by 24 months of age. Mean ± SEM, ordinary one-way ANOVA for each month; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Images taken at 20x magnification. [Figure 19] Data are presented showing that scAAV9.p546.CLN3 treatment prevented massive subunit C accumulation (a component of ASM) in two brain regions of Cln3Δ7 / 8 mice by 24 months of age. Mean ± SEM, ordinary one-way ANOVA for each month; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Images taken at 20x magnification. [Figure 20] Data are provided showing that scAAV9.p546.CLN3 treatment prevented astrocyte activation (GFAP+) in two brain regions of Cln3Δ7 / 8 mice by 24 months of age. Mean ± SEM, ordinary one-way ANOVA for each month; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Images taken at 20x magnification. [Figure 21] Data are provided showing that scAAV9.p546.CLN3 treatment prevented significant microglial activation (CD68+) in two regions of the Cln3Δ7 / 8 brain up to 24 months of age, depending on the time point. Mean ± SEM, ordinary one-way ANOVA for each month, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Images taken at 20x magnification. [Figure 22]Data are provided showing that scAAV9.CB.CLN3 treatment is similarly effective in preventing various Batten disease pathologies in 6- and 12-month-old Cln3Δ7 / 8 mice. Mean ± SEM, ordinary two-way ANOVA, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 23] Data are presented showing the absence of erythrocyte abnormalities in Cln3Δ7 / 8 measured up to 24 months of age. Mean ± SEM, ordinary two-way ANOVA. [Figure 24] Data provide evidence of no leukocyte abnormalities in Cln3Δ7 / 8 mice measured up to 24 months of age. Mean ± SEM, ordinary two-way ANOVA. [Figure 25] Figure 1 shows that scAAV9.p546.CLN3-treated mice exhibit different levels of sub-C accumulation in the CA3 region of the hippocampus based on gender at 12 months of age. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 26] Figure 1 shows that scAAV9.p546.CLN3 mice exhibit slightly different levels of sub-C accumulation in the piriform cortex (PIRC) based on sex at multiple time points. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 27] Figure 1 shows that scAAV9.p546.CLN3 mice exhibit different levels of sub-C accumulation in the reticular thalamic nucleus (RTN) based on sex at multiple time points. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 28] Figure 1 shows that scAAV9.p546.CLN3 mice exhibit different levels of sub-C accumulation in the somatosensory cortex based on sex at 12 months. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 29]Figure 1 shows that scAAV9.p546.CLN3 mice exhibit different levels of sub-C accumulation in the VPM / VPL of the thalamus based on sex at 12 months. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 30] Figure 1 shows that scAAV9.p546.CLN3 mice exhibit different levels of sub-C accumulation in the basolateral amygdala (BLA) based on sex at 12 months. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 31] Figure 1 shows that scAAV9.p546.CLN3 mice exhibit different levels of sub-C accumulation in the polymorphic layer of the dentate gyrus (DG) based on sex at 12 and 18 months. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 32] Figure 1 shows that scAAV9.p546.CLN3 mice exhibit different levels of sub-C accumulation in the habenula (Hab) based on sex at 12 and 18 months. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 33] Data are provided showing that scAAV9.p546.CLN3 mice exhibit different levels of sub-C accumulation in the dorsomedial nucleus (MD) based on sex at 12 and 18 months. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 34]scAAV9.p546.CLN3 mice show no difference in sub-C accumulation levels in the retrosplenial cortex (RSC) based on sex. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 35] Figure 1 shows that scAAV9.p546.CLN3 mice exhibit different levels of activated microglia (CD68+) in the somatosensory cortex (S1BF) based on sex at 6 months. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 36] Figure 1 shows that scAAV9.p546.CLN3 mice exhibit different levels of microglial (CD68+) activation in the VPM-VPL and thalamus based on sex. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 37] Figure 1 shows that scAAV9.p546.CLN3 mice exhibit different levels of activated microglia (CD68+) in the dorsomedial nucleus (MD) based on gender. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 38] Figure 1 shows that scAAV9.p546.CLN3 mice exhibit different levels of activated microglia (CD68+) in the submedial nucleus (SM) based on gender. Mean ± SEM, ordinary two-way ANOVA with Tukey's post-hoc test, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. DETAILED DESCRIPTION OF THE INVENTION
[0039] The present disclosure provides methods and products for treating CLN3-Batten disease. The methods involve delivering a CLN3 polynucleotide to a subject using rAAV as a gene delivery vector.
[0040] Adeno-associated virus (AAV) is a replication-deficient parvovirus whose single-stranded DNA genome is approximately 4.7 kb long, including 145 nucleotide inverted terminal repeats (ITRs). The term can refer to the virus itself or its derivatives. Unless otherwise specified, the term encompasses all subtypes and both naturally occurring and recombinant forms. There are multiple serotypes of AAV. Each AAV serotype is associated with a specific clade, whose members share serological and functional similarities. Therefore, AAVs may be referred to by clade. For example, the AAV9 sequence is referred to as a "clade F" sequence (Gao et al., J. Virol., 78:6381-6388 (2004)). The present disclosure contemplates the use of any sequence within a particular clade, e.g., clade F. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank accession number NC_002077, and the complete genome of AAV-2 is provided in GenBank accession number NC_001401 and in Srivastava et al. al., J. Virol., 45:555-564 {1983), the complete genome of AAV-3 is provided under GenBank accession number NC_1829, the complete genome of AAV-4 is provided under GenBank accession number NC_001829, the AAV-5 genome is provided under GenBank accession number AF085716, the complete genome of AAV-6 is provided under GenBank accession number NC_001862, at least portions of the AAV-7 and AAV-8 genomes are provided under GenBank accession numbers AX753246 and AX753249, respectively, and the AAV-9 genome is provided by Gao et al. al., J. Virol., 78:6381-6388 (2004), the AAV-10 genome is provided in Mol. Ther., 13(1):67-76 (2006), the AAV-11 genome is provided in Virology, 330(2):375-383 (2004), a portion of the AAV-12 genome is provided in GenBank accession number DQ813647, and a portion of the AAV-13 genome is provided in GenBank accession number EU285562.The sequence of the AAV rh.74 genome is provided in U.S. Patent No. 9,434,928, which is incorporated herein by reference. The sequence of the AAV-B1 genome is provided in Choudhury et al., Mol. The., 24(7):1247-1257 (2016). Cis-acting sequences that direct viral DNA replication (rep), encapsidation / packaging, and host cell chromosomal integration are contained within the ITRs. Three AAV promoters (designated p5, p19, and p40 for their relative map positions) drive the expression of two AAV internal open reading frames encoding the rep and cap genes. Coupled with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), the two rep promoters (p5 and p19) drive the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep protein possesses multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter and encodes three capsid proteins, VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are involved in the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).
[0041] AAV has unique characteristics that make it attractive as a vector for delivering foreign DNA into cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV can infect many mammalian cells, enabling the potential for targeting many different tissues in vivo. Furthermore, AAV can transduce slowly dividing and non-dividing cells and persist essentially for the lifespan of those cells as transcriptionally active nuclear episomes (extrachromosomal elements). The native AAV proviral genome is infectious as cloned DNA in a plasmid, making the construction of recombinant genomes feasible. Furthermore, because signals directing AAV replication, genome encapsidation, and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding the replication and structural capsid protein, rep-cap) can be replaced by contacting it with foreign DNA, such as a gene cassette containing a promoter, DNA of interest, and a polyadenylation signal. In some cases, the rep and cap proteins are provided in trans. Another important feature of AAV is that it is an extremely stable and robust virus. It easily withstands the conditions used to inactivate adenovirus (56°C to 65°C for several hours), making cryopreservation of AAV less important. AAV can be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.
[0042] As used herein, the term "AAV" refers to wild-type AAV virus or virus particles. The terms "AAV," "AAV virus," and "AAV virus particle" are used interchangeably herein. The term "rAAV" refers to recombinant AAV virus or recombinant infectious encapsulated virus particles. The terms "rAAV," "rAAV virus," and "rAAV virus particle" are used interchangeably herein.
[0043] The term "rAAV genome" refers to a polynucleotide sequence derived from a native AAV genome that has been modified. In some embodiments, the rAAV genome has been modified to remove the native cap and rep genes. In some embodiments, the rAAV genome comprises endogenous 5' and 3' inverted terminal repeats (ITRs). In some embodiments, the rAAV genome comprises ITRs from an AAV serotype different from the AAV serotype from which the AAV genome is derived. In some embodiments, the rAAV genome comprises a transgene of interest (e.g., a polynucleotide encoding CLN3) flanked on the 5' and 3' ends by inverted terminal repeats (ITRs). In some embodiments, the rAAV genome comprises a "gene cassette." An exemplary gene cassette is set forth in FIG. 1A and the nucleic acid sequence of SEQ ID NO: 4. The rAAV genome may be a self-complementary (sc) genome, referred to herein as an "scAAV genome." Alternatively, the rAAV genome may be a single-stranded (ss) genome, referred to herein as an "ssAAV genome."
[0044] The term "scAAV" refers to a rAAV virus or rAAV viral particle that contains a self-complementary genome. The term "ssAAV" refers to a rAAV virus or rAAV viral particle that contains a single-stranded genome.
[0045] The rAAV genomes provided herein can include a polynucleotide encoding a CLN3 polypeptide. The CLN3 polypeptide includes a polypeptide having an amino acid sequence that includes the amino acid sequence set forth in SEQ ID NO: 1 or that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth in SEQ ID NO: 1, and encodes a polypeptide that has CLN3 activity (e.g., at least one of increased clearance of lysosomal autofluorescent storage materials, decreased lysosomal accumulation of ATP synthase subunit C, and decreased astrocyte and microglial activation in treated patients, e.g., compared to patients before treatment).
[0046] The rAAV genomes provided herein optionally include a polynucleotide encoding a CLN3 polypeptide, wherein the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO:2 or is at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID NO:2, and encodes a polypeptide having CLN3 activity (e.g., at least one of increased clearance of lysosomal autofluorescent storage material, decreased lysosomal accumulation of ATP synthase subunit C, and decreased astrocyte and microglial activation in a treated patient, e.g., compared to a patient before treatment).
[0047] In some embodiments, the rAAV genome provided herein comprises a polynucleotide sequence that encodes a polypeptide having CLN3 activity and hybridizes under stringent conditions to the nucleic acid sequence of SEQ ID NO: 2, or its complement. The term "stringent" is used to refer to conditions generally understood in the art as stringent. Hybridization stringency is determined primarily by temperature, ionic strength, and the concentration of denaturing agents, such as formamide. Examples of stringent conditions for hybridization and washing are 0.015 M sodium chloride, 0.0015 M sodium citrate at 65-68°C, or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 50% formamide at 42°C. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, (Cold Spring Harbor, NY 1989).
[0048] In some embodiments, the rAAV genome provided herein comprises one or more AAV ITRs flanking a polynucleotide encoding a CLN3 polypeptide. The CLN3 polynucleotide is operably linked to transcriptional control elements (including, but not limited to, promoters, enhancers, and / or polyadenylation signal sequences) that are functional in the target cell to form a gene cassette. Exemplary promoters are the chicken β-actin promoter and the P546 promoter. Additional promoters are contemplated herein, including, but not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters (e.g., but not limited to, actin promoter, myosin promoter, elongation factor-1a promoter, hemoglobin promoter, and creatine kinase promoter). Further provided herein are promoters having P546 transactivation activity, including the P546 promoter sequence set forth in SEQ ID NO: 3, and promoter sequences at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 3. Other examples of transcriptional regulators are tissue-specific regulators, such as promoters that enable specific expression in neurons or astrocytes. Examples include the neuron-specific enolase and glial fibrillary acidic protein promoters. Inducible promoters are also contemplated. Non-limiting examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline-regulated promoters.The gene cassette may also contain an intron sequence to facilitate the processing of the CLN3 RNA transcript when expressed in mammalian cells. An example of such an intron is the SV40 intron. "Packaging" refers to a series of intracellular events that result in the assembly and encapsidation of AAV particles. The term "production" refers to the process of producing rAAV (infectious, encapsulated rAAV particles) by the packaged cell.
[0049] AAV "rep" and "cap" genes refer to polynucleotide sequences that encode the replication and encapsidation proteins, respectively, of adeno-associated virus. AAV rep and cap are referred to herein as AAV "packaging genes."
[0050] "Helper virus" for AAV refers to a virus that allows AAV (e.g., wild-type AAV) to be replicated and packaged by mammalian cells. A variety of such helper viruses for AAV are known in the art, including adenovirus, herpesvirus, and poxvirus such as vaccinia. Adenoviruses can include several different subgroups, but adenovirus type 5 of subgroup C is the most commonly used. Many adenoviruses of human, non-human mammalian, and avian origin are known and can be obtained from depositories such as ATCC. Herpes virus includes, for example, herpes simplex virus (HSV) and Epstein-Barr virus (EBV), as well as cytomegalovirus (CMV) and pseudorabies virus (PRV), which can also be obtained from depositories such as ATCC.
[0051] "Helper virus functions" refer to functions encoded in the helper virus genome that enable AAV replication and packaging (in conjunction with other requirements for replication and packaging as described herein). As described herein, "helper virus functions" can be provided in a number of ways, including by providing a helper virus or, for example, by providing polynucleotide sequences encoding the necessary functions to the producer cell in trans.
[0052] The rAAV genome provided herein lacks AAV rep and cap DNA. The AAV DNA in the rAAV genome (e.g., ITR) contemplated herein can be from any AAV serotype suitable for deriving recombinant viruses, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV rh.74, and AAV-B1. As described above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. rAAVs with capsid mutations are also contemplated. For example, see Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). Modified capsids are also contemplated herein, including capsids with various post-translational modifications, such as glycosylation and deamidation. Deamidation of asparagine or glutamine side chains to convert asparagine residues to aspartic acid or isoaspartic acid residues, and conversion of glutamine to glutamic acid or isoglutamic acid are contemplated in the rAAV capsids provided herein. See, for example, Giles et al. Molecular Therapy, 26(12):2848-2862 (2018). Modified capsids herein are also contemplated to include targeting sequences that direct rAAV to diseased tissues and organs in need of treatment.
[0053] The DNA plasmids provided herein contain the rAAV genome described herein. The DNA plasmids are introduced into cells permissive for infection with an AAV helper virus (e.g., adenovirus, E1-deleted adenovirus, or herpesvirus) to assemble the rAAV genome into infectious viral particles using AAV9 capsid proteins. Techniques for producing rAAV, in which the rAAV genome to be packaged, rep and cap genes, and helper virus functions are provided in cells, are standard in the art. The production of rAAV particles requires the presence of the following components in a single cell (referred to herein as a packaging cell): the rAAV genome, AAV rep and cap genes separated from (i.e., not present in) the rAAV genome, and helper virus functions. The AAV rep and cap genes may be derived from any AAV serotype from which a recombinant virus can be derived, or may be derived from an AAV serotype different from the rAAV genome ITRs. The production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692, which is incorporated herein by reference in its entirety.In various embodiments, AAV capsid protein can be modified to enhance the delivery of recombinant rAAV.Modifications to capsid protein are generally known in the art.See, for example, US2005 / 0053922 and US2009 / 0202490, the disclosures of which are incorporated herein by reference in their entirety.
[0054] A method for generating packaging cells is to create a cell line that stably expresses all components necessary for rAAV production. For example, a plasmid (or multiple plasmids) containing an rAAV genome lacking the AAV rep and cap genes, the AAV rep and cap genes separated from the rAAV genome, and a selectable marker such as a neomycin resistance gene may be integrated into the genome of the cell. The rAAV genome may also be introduced into a bacterial plasmid by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081), the addition of a synthetic linker containing a restriction endonuclease cleavage site (Laughlin et al., 1983, Gene, 23:65-73), or direct blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line can then be infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and suitable for large-scale production of rAAV. Another example of a suitable method uses adenovirus or baculovirus rather than a plasmid to introduce the rAAV genome and / or rep and cap genes into the packaging cell.
[0055] The general principles of rAAV particle production are reviewed, for example, in Carter, 1992, Current Opinions in Biotechnology, 1533-539, and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158:97-129). Various approaches include Ratschin et al., Mol. Cell. Biol. 4:2072 (1984), Hermonat et al., Proc. Natl. Acad. Sci. USA, 81: 6466 (1984), Tratschin et al., Mo 1. Cell. Biol. al., J. Virol., 62:1963 (1988), and Lebkowski et al., 1988 Mol. Cell. Biol., 7: 349 (1988), Samulski et al. al. (1989, J. Virol., 63:3822-3828), U.S. Pat. No. 5,173,414, WO95 / 13365 and corresponding U.S. Pat. No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al. (1995) Vaccine 13:1244-1250, Paul et al. al. (1993) Human Gene Therapy 4:609-615, Clark et al. (1996) Gene Therapy 3:1124-1132, U.S. Patent No. 5,786,211, U.S. Patent No. 5,871,982, and U.S. Patent No. 6,258,595. The foregoing documents are incorporated herein by reference in their entireties, with particular emphasis being placed on the portions of the documents relating to rAAV particle production.
[0056] Also provided herein are packaging cells that produce infectious rAAV particles. In one embodiment, the packaging cells can be stably transformed cancer cells such as HeLa cells, 293 cells, and PerC.6 cells (synonymous 293 cells). In another embodiment, the packaging cells can be cells that are not transformed cancer cells, such as low-passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (rhesus fetal lung cells).
[0057] Also provided herein are rAAVs (e.g., infectious, encapsidated rAAV particles) comprising the rAAV genome of the present disclosure. The genome of the rAAV lacks AAV rep and cap DNA, i.e., there is no AAV rep or cap DNA between the ITRs of the rAAV genome. The rAAV genome can be a self-complementary (sc) genome. An rAAV having an sc genome is referred to herein as scAAV. The rAAV genome can be a single-stranded (ss) genome. An rAAV having a single-stranded genome is referred to herein as ssAAV.
[0058] An exemplary rAAV provided herein is a scAAV designated "scAAV9.P546.CLN3." The scAAV9.P546.CLN3 scAAV contains a scAAV genome including a human CLN3 cDNA under the control of the P546 promoter (SEQ ID NO: 3). The scAAV genome also contains an SV40 intron (upstream of the human CLN3 cDNA) and a bovine growth hormone polyadenylation (BGH polyA) terminator sequence (downstream of the human CLN3 cDNA). The sequence of this scAAV9.P546.CLN3 gene cassette is set forth in SEQ ID NO: 4. The scAAV genome is packaged into an AAV9 capsid and contains AAV2 ITRs (one ITR is upstream of the P546 promoter and the other ITR is downstream of the BGH polyA terminator sequence).
[0059] rAAV can be purified by standard methods in the art, such as column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper viruses are known in the art and can include, for example, the methods disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002), U.S. Patent No. 6,566,118, and WO98 / 09657.
[0060] Also provided is a composition comprising rAAV.The composition comprises rAAV encoding CLN3 polypeptide.The composition can comprise two or more rAAV encoding different polypeptides of interest.In some embodiments, rAAV is scAAV or ssAAV.
[0061] The compositions provided herein comprise rAAV and one or more pharmaceutically acceptable excipients. Acceptable excipients are non-toxic to recipients and preferably inert at the dosages and concentrations used, and include, but are not limited to, buffers such as phosphate (e.g., phosphate-buffered saline (PBS)), citrate, or other organic acids; antioxidants such as ascorbic acid; low-molecular-weight polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or non-ionic surfactants such as Tween, copolymers such as poloxamer 188, pluronics (e.g., pluronic F68), or polyethylene glycol (PEG). The compositions provided herein can include a pharmaceutically acceptable aqueous excipient containing a non-ionic hypo-osmolar compound, such as iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan, and the aqueous excipient containing the non-ionic hypo-osmolar compound can have one or more of the following properties: an osmolality of about 180 mg / mL, about 322 mOsm / kg water by vapor pressure osmometry, an osmolality of about 273 mOsm / L, an absolute viscosity of about 2.3 cp at 20° C. and about 1.5 cp at 37° C., and a specific gravity of about 1.164 at 37° C. Exemplary compositions include about 20-40% non-ionic hypo-osmolar compound, or about 25% to about 35% non-ionic hypo-osmolar compound. An exemplary composition includes scAAV or rAAV viral particles formulated in 20 mM Tris (pH 8.0), 1 mM MgCl, 200 mM NaCl, 0.001% poloxamer 188, and about 25% to about 35% of a non-ionic hypoosmolar compound. Another exemplary composition includes scAAV formulated in 1× PBS and 0.001% Pluronic F68.
[0062] The dosage of rAAV administered in the methods of the present disclosure will vary depending on, for example, the specific rAAV, the mode of administration, the time of administration, the therapeutic goal, the individual, and the targeted cell type, and can be determined by standard methods in the art. The dosage may be expressed in units of viral genome (vg). The dosage contemplated herein is about 1 x 10 11 , about 1×10 12 , about 1×10 13 , about 1.1×10 13 , about 1.2×10 13 , about 1.3×10 13 , about 1.5×10 13 , about 2×10 13 , about 2.5×10 13 , about 3×10 13 , about 3.4×10 13 , about 3.5×10 13 , about 4×10 13 , about 4.5×10 13 , about 5×10 13 , about 6×10 13 , about 1×10 14 , about 1.2×10 14 , about 2×10 14 , about 3×10 14 , about 4×10 14 , about 5×10 14 , about 1×10 15 , about 1×10 16 Contains up to or more than 1 x 10 total viral genomes. 11 ~Approx. 1×10 15 vg, approx. 1×10 12 ~Approx. 1×10 15 vg, approx. 1×10 12 ~Approx. 1×10 14 vg, approx. 1×10 13 ~about 6×10 14 vg, and approximately 6 × 10 13 ~Approx. 1.2×10 14 Dosages of 6×10 vg are also contemplated. The doses exemplified herein are 13 vg. Other doses exemplified herein are 1.2 x 10 14 is.
[0063] Methods are provided for transducing target cells with rAAV, including, but not limited to, cells of the nervous system, neuronal cells, or glial cells. Cells of the nervous system include neurons, lower motor neurons, microglial cells, oligodendrocytes, astrocytes, Schwann cells, or combinations thereof.
[0064] The term "transduction" refers to the administration / delivery of a CLN3 polynucleotide to a target cell, either in vivo or in vitro, via a replication-deficient rAAV of the present disclosure, resulting in expression of a functional polypeptide by the recipient cell. Transduction of cells with the rAAV of the present disclosure results in sustained expression of the polypeptide or RNA encoded by the rAAV. Thus, the present disclosure provides a method for administering / delivering an rAAV encoding a CLN3 polypeptide to a subject via intrathecal, intraventricular, intraparenchymal, or intravenous routes, or any combination thereof. Intrathecal delivery refers to delivery to the subarachnoid space of the brain or spinal cord. In some embodiments, intrathecal administration is by intracisternal administration.
[0065] Intrathecal administration is exemplified herein. These methods include transducing target cells (including, but not limited to, neuronal cells and / or glial cells) with one or more rAAVs described herein. In some embodiments, rAAV viral particles containing a polynucleotide encoding a CLN3 polypeptide are administered or delivered to the brain and / or spinal cord of a patient. In some embodiments, the polynucleotide is delivered to the brain. Brain regions contemplated for delivery include, but are not limited to, the motor cortex, visual cortex, cerebellum, and brainstem. In some embodiments, the polynucleotide is delivered to the spinal cord. In some embodiments, the polynucleotide is delivered to neurons or lower motor neurons. The polynucleotide can be delivered to neuronal cells and glial cells. The glial cells are microglial cells, oligodendrocytes, or astrocytes. In some embodiments, the polynucleotide is delivered to Schwann cells.
[0066] In some embodiments of the methods provided herein, the patient is maintained in the Trendelenberg position (head down position) after administration of the rAAV (e.g., for about 5, about 10, about 15, or about 20 minutes). For example, the patient may be tilted in the head down position at an angle of about 1 to about 30 degrees, about 15 to about 30 degrees, about 30 to about 60 degrees, about 60 to about 90 degrees, or about 90 to about 180 degrees.
[0067] The methods provided herein include administering an effective dose or effective multiple doses of a composition comprising the rAAV provided herein to a subject (e.g., an animal, including, but not limited to, a human patient) in need thereof. When the dose is administered before the onset of CLN3-Batten disease, the administration is prophylactic. When the dose is administered after the onset of CLN3-Batten disease, the administration is therapeutic. An effective dose is one that alleviates (eliminates or reduces) at least one symptom associated with the disease, slows or prevents disease progression, reduces the extent of the disease, results in disease remission (partial or complete), and / or prolongs survival. Compared to pre-treatment subjects or untreated subjects, the methods provided herein result in stabilization, reduced progression, or improvement in one or more of the measures used to assess the progression and / or improvement of CLN3 Batten disease, such as the Unified Batten Disease Rating System (UBDRS) or the Hamburg Motor and Language Scale. The UBDRS rating scale (Marshall et al., Neurology. 2005 65(2):275-279) [including the UBDRS Physical Rating Scale, UBDRS Seizure Rating Scale, UBDRS Behavioral Rating Scale, UBDRS Ability Rating Scale, UBDRS Symptom Sequence, and UBDRS Clinical Global Impression (CGI)], and the Pediatric Quality of Life Scale (PEDSQOL) measure motor function, language function, cognitive function, and survival. Compared to pre-treatment subjects or to untreated subjects, the methods provided herein may result in one or more of the following: reduced or delayed lysosomal accumulation of autofluorescent storage material, reduced or delayed lysosomal accumulation of ATP synthase subunit C, reduced or delayed glial activation (astrocyte and / or microglia), reduced or delayed astrocytosis, and reduced or delayed brain volume loss as measured by MRI.
[0068] Combination therapy is also provided. As used herein, "combination" includes either simultaneous or sequential therapy. The combination of the methods described herein with standard drug therapy is specifically contemplated. Furthermore, the combination of compositions for use according to the present invention (for example, the combination of scAAV9.P546.CLN3 and the imaging agent disclosed herein) (either simultaneous or sequential therapy) is specifically contemplated.
[0069] Postnatal delivery to a subject in need is contemplated, although intrauterine delivery to a fetus is also contemplated. [Example]
[0070] While the following examples illustrate particular embodiments, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the claims should be placed on the invention.
[0071] In the examples, a self-complementary AAV carrying CLN3 cDNA under the control of the P546 promoter (designated scAAV9.P546.CLN3) was produced. The P546 promoter is a truncated version of the MeCP2 promoter, allowing for moderate levels of transgene expression in both neurons and astrocytes. The efficacy of this gene therapy vector was confirmed by the expression of CLN3, which has the most frequently observed mutation in human patients. Δex7 / 8 The safety and efficacy of scAAV9.P546.CLN3 were tested in a knock-in mouse model. Δex7 / 8 This was evaluated in vivo in knock-in mouse models, wild-type mice, and non-human primates. Data from mice and non-human primates clearly demonstrate efficient transduction of astrocytes and neurons throughout the brain and spinal cord, including deep brain structures such as the thalamus, hippocampus, striatum, amygdala, medulla, and cerebellum.
[0072] Example 1 Production of scAAV9.P546.CLN3 DNA containing the open reading frame of human CLN3 (SEQ ID NO: 2) between two Not1 restriction sites was synthesized by Eurofin Genomics, USA, and then inserted into a double-stranded AAV2-ITR-based production plasmid. A schematic diagram of the plasmid construct showing the CLN3 DNA inserted between the AAV2 ITRs [the 5' ITR was modified as previously described by McCarty et al., Gene Therapy 8:1248-1254 (2001) to generate scAAV] is shown in Figure 1. The plasmid construct also contains a P546 promoter, an SV40 chimeric intron, and a bovine growth hormone (BGH) polyadenylation signal.
[0073] scAAV9.P546.CLN3 was produced under cGMP conditions by transient triple-plasmid transfection using a double-stranded AAV2-ITR-based production plasmid and a plasmid encoding the Rep2Cap9 sequence, as previously described (Gao et al., J. Virol., 78:6381-6388 (2004)), together with the adenovirus helper plasmid pHelper (Stratagene, Santa Clara, CA) in HEK293 cells. Virus was purified by two cesium chloride density gradient purification steps, dialyzed against PBS, formulated with 0.001% Pluronic-F68 to prevent viral aggregation, and stored at 4°C. All scAAV preparations were titrated by quantitative PCR using Taq-Man technology. The purity of the scAAV was assessed by 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, CA).
[0074] Example 2 CLN3 Δex7 / 8 Long-term efficacy study of CSF-delivered scAAV9.P546.CLN3 in mice Cell Targeting and Expression To confirm the expression and biodistribution of virally transduced human CLN3 in mice, scAAV9.P546.CLN3 was formulated in 1x PBS and 0.001% Pluronic F68 or in 20 mM Tris (pH 8.0), 1 mM MgCl2, 200 mM NaCl, 0.001% Poloxamer 188, and administered intracerebroventricularly (ICV) within 36 hours of birth. Δex7 / 8 The expression of CLN3 was monitored at various time points. Δex7 / 8 Mice were used as controls. The effective dose was 2.2 × 10 using the NCH viral vector core titer. 10 vg / mouse.
[0075] To obtain a detailed brain distribution profile, we used RNAscope in situ hybridization technology to specifically identify human CLN3 mRNA in the brain, cervical, thoracic, and lumbar spinal cord. This technique involves using RNA in situ hybridization with a specific probe to detect only the human transgene encoded by scAAV9.P546.CLN3. A strong signal was observed in CLN3 cells injected with scAAV9.P546.CLN3 compared to no signal in the PBS-injected control. Δex7 / 8 This was observed at 4 and 6 months post-injection, particularly in the cortex (areas A-C) of mice. Analysis demonstrated that the AAV9-delivered CLN3 transgene was expressed at appropriate levels in various brain regions, including the cortex, thalamus, hindbrain, cerebellum, and spinal cord. In the cerebellum, the signal was particularly strong in Purkinje neurons. Transgene expression was also detected in all brain and spinal cord regions by reverse transcription-PCR at 4 and 6 months (Figure 2).
[0076] In summary, CLN3 Δex7 / 8Reverse transcription-PCR data and RNAscope analysis performed on tissues from mice confirmed that a single ICV injection of scAAV9.P546.CLN3 resulted in successful targeting and expression of human CLN3 throughout the brain and spinal cord for up to 6 months after injection. This confirms the validity of ICV-mediated delivery of scAAV9 to specifically target cells disproportionately involved in the pathogenesis of CLN3-Batten disease. Δex7 / 8 The expression data in the mouse model were further confirmed in studies in wild-type mice using the same primers for detection of the human transgene by quantitative RT-PCR.
[0077] Amelioration of pathology after delivery of scAAV9.P546.CLN3 Accumulation of autofluorescent storage material (ASM) Accumulation of autofluorescent storage material (ASM) is a characteristic histological marker for the progression of Batten disease (Mole et al., Biochim Biophys Acta-Mol Basis Dis. 2015; 1852(10):2237-2241; Cotman et al., Clin Lipidol. 2012 Feb; 7(1):79-91; Seehafer et al., Neurobiol Aging. 2006; 27:576-588). Accumulation of ASM is a strong indicator of disease progression for many forms of Batten disease (Bosch et al., J Neurosci. 2016; 36(37):9669-9682; Morgan et al., PloS One. 2013; 8(11):e78694). It is contemplated herein that a decrease in ASM is used as an indicator of successful treatment. ASM is one of the earliest detectable signs of CLN3-Batten disease, with CLN3 being present by 2 months of age. Δex7 / 8 It has already been seen in multiple brain regions in mice (Fig. 3).
[0078] Automated quantification of fluorescent pixel area in 2-month-old scAAV9.P546.CLN3-injected CLN3 mice Δex7 / 8We observed a significant reduction in accumulated ASM in the somatosensory cortex and thalamus in PBS-treated CLN3 mice. At this early time point, higher variability in ASM accumulation in the motor and visual cortices was observed in PBS-treated CLN3 mice. Δex7 / 8 At 4 and 6 months post-injection, all four brain regions were significantly higher than those in PBS-treated CLN3 mice. Δex7 / 8 The scAAV9.P546.CLN3-injected mice showed a highly significant reduction in ASM accumulation compared to CLN3 mice (Figure 4). Δex7 / 8 When comparing mice to wild-type animals, slightly higher ASM levels were observed in scAAV9.P546.CLN3-injected CLN3 mice at 4 months post-injection. Δex7 / 8 In mice, wild-type and scAAV9.P546.CLN3-injected CLN3 were found in the somatosensory and visual cortex, whereas in the motor cortex and thalamus. Δex7 / 8 At 6 months post-injection, all regions were significantly different in wild-type and scAAV9.P546.CLN3-treated CLN3 mice. Δex7 / 8 showed comparable low levels of ASM in PBS-treated CLN3 mice. Δex7 / 8 The ASM accumulation was much lower in PBS- and scAAV9.P546.CLN3-treated animals compared to PBS-treated mice, confirming a long-lasting and highly efficient reduction in ASM accumulation (p<0.0001). p<0.0001 for all but the visual cortex at 4 months post-injection (p<0.001) and the motor cortex at 6 months post-injection (p<0.001) between PBS- and scAAV9.P546.CLN3-treated animals (N=10 per group).
[0079] Accumulation of mitochondrial protein ATP synthase subunit C Wild-type and CLN3 Δex7 / 8 Brain tissue from PBS- or scAAV9.P546.CLN3-injected mice was analyzed for the accumulation of ATP synthase subunit C. In healthy individuals, this protein is part of the respiratory chain in the mitochondrial membrane, but in patients with Batten disease, this protein abnormally accumulates within lysosomes (Palmer et al., Am J Med Genet. 1992;42(4):561-567). Δex7 / 8In mice, accumulation of subunit C was evident in the ventral posteromedial and ventral posterolateral nuclei (VPM / VPL regions) of the thalamus by 4 months of age compared with wild-type animals, a brain region often affected early in NCL mouse models (Morgan et al., PLoS One. 2013;8(11):e78694; Pontikis et al., Neurobiol Dis. 2005;20(3):823-836). Untreated animals showed strong signals for ATP synthase subunit C accumulated in the somatosensory cortex and VPM / VPL regions of the thalamus, whereas scAAV9.P546.CLN3-treated animals showed minimal signals comparable to wild-type animals at both 4 and 6 months post-injection (Figure 5) (p ≤ 0.0001 between PBS and scAAV9.P546.CLN3-treated animals).
[0080] Glial and astrocyte activation In addition to abnormal accumulation of storage materials and ATP synthase sub-C, other histological markers of disease progression in both human patients and animal models include activation of astrocytes and microglia (Cotman et al., Hum Mol Genet. 2002;11(22):2709-2721; Morgan et al., PLoS One. 2013;8(11):e78694; Pontikis et al., Neurobiol Dis. 2005;20(3):823-836; Palmer et al., Am J Med Genet. 1992;42(4):561-567). In particular, reactive microglia are primed to release proinflammatory mediators, such as IL1-β26, which may be a major cause of neuronal cell death in the later stages of CLN3-Batten disease. Activated astrocytes were identified in VPM / VPL sections of the thalamus and somatosensory cortex sections by staining for glial fibrillary acidic protein (GFAP) at 4 and 6 months. For the somatosensory cortex, quantification was performed in the barrel cortex within cortical layer IV of the somatosensory cortex. Representative images 6 months post-injection are shown in Figure 6.
[0081] Quantification of GFAP-positive areas 4 and 6 months after treatment demonstrated that astrocyte activation was significantly greater in PBS-injected CLN3 mice than in PBS-injected mice. Δex7 / 8 Compared with mice injected with scAAV9.P546.CLN3, CLN3 Δex7 / 8 The results show that the CLN3 signaling pathway was significantly reduced in both brain regions of mice injected with scAAV9.P546.CLN3 (Figure 6). Δex7 / 8 The level of GFAP staining in PBS-treated CLN3 mice was significantly higher than that in PBS-treated CLN3 mice. Δex7 / 8 Although much lower compared to mice, these remained above wild-type levels at both 4 and 6 months post-injection for most regions analyzed.
[0082] Glial activation was also determined in VPM / VPL and somatosensory cortex sections using anti-CD68 staining as a marker of activated microglia. CD68 is a lysosomal protein that is upregulated in cells primed for proinflammatory functions such as phagocytosis (Seehafer et al., J Neuroimmunol. 2011;230:169-172). Similar to what was observed in astrocytes, glial activation was observed in PBS-injected CLN3 mice after 4 months. Δex7 / 8 Compared with AAV9-injected CLN3 mice Δex7 / 8 The CD68 staining was significantly reduced in the VPM / VPL and somatosensory cortex regions of the mice (Figure 7). In the somatosensory cortex, treatment with scAAV9.P546.CLN3 reduced CD68 staining to levels comparable to wild-type mice. At 6 months, in the VPM / VPL region, PBS-treated CLN3 mice showed significantly reduced CD68 staining. Δex7 / 8 Although there was no significant improvement in the level of CD68 staining in scAAV9.P546.CLN3-treated compared with scAAV9.P546.CLN3-treated mice, there was still a significant reduction in reactive glia in the somatosensory cortex of scAAV9.P546.CLN3-treated mice (Figure 7).
[0083] Improved behavior after delivery of scAAV9.P546.CLN3 In human CLN3-Batten disease patients, neurological disorders such as motor and cognitive dysfunction become apparent much later than in early-onset disease variants such as CLN3-Batten disease (late-onset childhood Batten disease), which may be due to residual function of the short, incomplete CLN3 protein (Kitzmuller et al., Hum Mol Genet. 2008 Jan 15;17(2):303-12). This delayed phenotype is also due to the CLN3 Δex7 / 8 Efficacy testing of scAAV9.P546.CLN3 has also been demonstrated in mouse models. Starting at 2 months of age and continuing at 2-month intervals, mice underwent a series of behavioral testing paradigms, including an accelerating rotarod assay and pole climbing to test motor function and coordination, and a Morris water maze to assess learning and memory. Currently, animals are being followed for 10 months post-injection, and the study is ongoing. Previous publications characterizing this mouse model have shown an initial delay in neurodevelopmental behavior, followed by normalization and subsequent decline from approximately 10–12 months of age (Osorio et al., Genes Brain Behav. 2009 Apr;8(3):337–345).
[0084] Rotarod analysis showed that wild-type and PBS- or CLN3-treated mice were significantly different in guinea pigs up to 18 months after injection. Δex7 / 8 There was no statistically significant difference between the mice.
[0085] Rotarod assays were performed every two months. Mice were placed on an accelerating wheel and the time it took for the mice to fall was measured. At each time point, mice were trained in the morning and tested 4 hours later in the afternoon. Unlike previously published data (Bosch et al., J Neurosci. 2016;36(37):9669-9682), wild-type and PBS-injected CLN3 mice showed no significant improvement up to 18 months after injection. Δex7 / 8 No significant differences were observed in the performance of the mice. However, PBS-treated CLN3 Δex7 / 8A significant difference in the latency to fall was observed in female WT mice compared with male WT mice at 2 months post-injection. This discrepancy compared to previous data is most likely due to the design of the testing protocol and / or environmental factors in the housing. The current protocol used in this study tested animals only on one day at each time point, whereas the previously published data repeated the test over four days. Furthermore, the protocol used in this study had a slightly lower starting speed (36 rpm vs. 40 rpm) and a longer time interval between the morning training and afternoon test periods (4 h rest vs. 2 h rest) compared to the previously published data. Furthermore, the morning training setup was also different: in the previous study, mice were trained on a wheel rotating at 5 rpm for 5 min only in the morning, whereas animals in the current study were trained on the exact same setup applied in the afternoon test, resulting in wheel acceleration of up to 0.3 rpm every 2 s. In summary, using the described setup, by 18 months post-injection, mice in untreated or scAAV9.P546.CLN3-treated CLN3 mice showed significantly higher latency to fall compared to wild-type animals. Δex7 / 8 No impairment in the ability to hold the accelerating rotarod wheel was observed in mice (top panel of Figure 8).
[0086] Morris water maze analysis showed significant differences between wild-type and CLN3 mice at 2, 4, 16, and 18 months post-injection. Δex7 / 8 There was a statistically significant difference between the mice.
[0087] In the Morris water maze test, animals were placed in a water-filled pool containing a hidden platform. After training, the time it took animals to find the hidden platform using environmental cues for orientation was measured as a sign of learning and memory ability. At 2 and 4 months post-injection, wild-type animals and PBS- or scAAV9.P546.CLN3-treated CLN3 mice were compared. Δex7 / 8A statistically significant difference was observed between wild-type and PBS- or scAAV9.P546.CLN3-treated CLN3 mice, indicating that learning and memory were measurably impaired at this time point in the disease, resulting in a latency for the animals to find the hidden platform. Furthermore, at 16 and 18 months, there was a statistically significant difference between wild-type and PBS- or scAAV9.P546.CLN3-treated CLN3 mice. Δex7 / 8 A more significant statistical difference in latency was observed between PBS-treated CLN3 mice (Figure 9, top left panel). The increase in latency at 16 months was also observed in PBS-treated CLN3 mice. Δex7 / 8 The increase in swimming speed correlated with the increase in swimming speed for the scAAV9.P546.CLN3-treated mice (Figure 9, upper right panel). In addition, when stratified by sex, the increase in swimming speed was significantly greater in male wild-type and scAAV9.P546.CLN3-treated CLN3 mice at 16 and 18 months of age. Δex7 / 8 A statistical difference in latency was observed between the scAAV9.P546.CLN3-treated CLN3 mice (Figure 9, left center panel), whereas the scAAV9.P546.CLN3-treated CLN3 mice Δex7 / 8 The swimming speed of male mice was significantly reduced at 16 months (Figure 9, right center panel). Δex7 / 8 Mice were cultured at 18 months with wild-type or PBS-treated CLN3 Δex7 / 8 mice (Fig. 9, lower left panel), whereas PBS-treated CLN3 mice showed significantly increased latency compared to control mice (Fig. 9, lower left panel). Δex7 / 8 Swimming speed in male mice increased significantly at 16 months (Fig. 9, bottom right panel).
[0088] Pole climbing assays showed significantly higher serotonin levels in scAAV9.P546.CLN3-treated CLN3 compared to PBS-injected animals. Δex7 / 8 showed improved performance.
[0089] The pole climbing test measures the time it takes a mouse to turn around on a vertical pole when placed face up, and to descend the pole when placed face down. In addition, the number of falls from the pole while attempting to turn or descend may also be measured. This test assesses coordination and balance.
[0090] At 10 and 12 months post-injection, scAAV9.P546.CLN3 animals exhibited significantly faster pole descent compared to PBS-treated animals (Figure 10, upper left panel). Δex7 / 8 There was a statistically significant difference in the time it took animals to descend the pole, whereas wild-type and scAAV9.P546.CLN3-treated CLN3 Δex7 / 8 At 2 and 16 months of age, wild-type animals were significantly slower than those treated with scAAV9.P546.CLN3 and PBS-treated CLN3 than those treated with scAAV9.P546.CLN3 (Figure 10, top left panel). Two statistically significant differences were observed regarding the time it took for animals to turn from up to down. At 2 and 16 months of age, wild-type animals were significantly slower than those treated with scAAV9.P546.CLN3 and PBS-treated CLN3. Δex7 / 8 The 2-month and 16-month time points were the only time points where a difference in this parameter was observed between study groups (Figure 10, upper left panel).
[0091] An additional statistically significant difference was observed in the mean number of falls from the pole, with PBS-treated CLN3 Δex7 / 8 Male and female mice fell more frequently compared to wild-type and scAAV9.P546.CLN3-treated animals (Figure 11). Top graph: A significant difference in the number of falls was seen at 2 months between scAAV9.P546.CLN3-treated and PBS-treated animals. A statistically significant difference was also seen between wild-type mice and PBS-treated CLN3-treated animals at 16 months post-injection. Δex7 / 8 The results were observed between PBS-treated CLN3 mice. Middle graph: Males only. Δex7 / 8Mice fell off the pole more frequently than other treatment groups, with the greatest statistical significance at 16 months post-injection. Bottom graph: For females, the difference in falls was significant at 8 months post-injection, but this trend was seen throughout the study. N=5 (5M / 5F) for each treatment group. Interestingly, the difference in falls off the pole was seen throughout the entire 18 months, being statistically significant at the early time point (4 months) as well as at 8 and 16 months. At 8 months, this difference was only statistically significant in females, but a clear trend was also present in males, which was statistically significant at 16 months post-injection. In general, PBS-treated CLN3 Δex7 / 8 Males in the 100% treated group fell off the pole more frequently than males in the other treatment groups.
[0092] In summary, CLN3 Δex7 / 8 There is strong evidence that treatment of mice with scAAV9.P546.CLN3 prevents the accumulation of ASM material, as well as ATP synthase subunit C, both of which are key features of CLN3-Batten disease progression. These data correlate with a strong reduction in glial (astrocytic and microglial) activation. Although early in the disease course, initial trends toward improved behavioral phenotypes are becoming apparent: scAAV9.P546.CLN3-treated CLN3 Δex7 / 8 Mice were more able to descend a vertical pole compared to PBS-treated animals, as they moved faster and were less likely to fall. Overall, these data support scAAV9.P546.CLN3 gene therapy as a therapeutic strategy for this disease.
[0093] Example 3 Expression studies using scAAV9.P546.GFP in mice The P546 promoter allows transgene expression throughout the CNS in a manner similar to the chicken beta-actin (CBA) promoter. To compare the two promoters side-by-side, mice were injected at postnatal day 1 with either scAAV9.CB.GFP or scAAV9.P546.GFP formulated in 1x PBS and 0.001% Pluronic F68 or 20 mM Tris (pH 8.0), 1 mM MgCl2, 200 mM NaCl, 0.001% Poloxamer 188 at 5x10 per animal. 10 The animals were injected with the viral genome. Three weeks later, the animals were sacrificed and the brains were placed directly under a fluorescent dissecting microscope. Fluorescent images revealed that although GFP distribution was similar, fluorescence levels were lower in animals that received scAAV9.P546.GFP compared to animals that received scAAV9.CB.GFP, confirming that the P546 promoter results in more moderate levels of transgene expression compared to the CBA promoter.
[0094] Another mouse was injected with scAAV9.P546.GFP and allowed to survive for 200 days. After 200 days, the animal was sacrificed, and whole-brain sagittal sections were stained for GFP expression. Even at 200 days post-injection, widespread expression of the GFP transgene was observed throughout the brain, including the cortex, hippocampus, midbrain, medulla, amygdala, and cerebellum, further suggesting that the P546 promoter is an excellent candidate for CNS gene therapy.
[0095] Data from GFP fluorescence and GFP immunofluorescence staining were further supported by Western blot data from various tissues and brain regions. GFP expression was readily detectable in fluorescent Western blots using the Liquor system in mice treated with scAAV9.P546.GFP (n = 3) at 3 weeks post-injection, whereas no band was detected in the PBS-injected animal (n = 1) used as a control. Transgene expression was evident in whole-brain lysates as well as region-specific lysates, including the cortex, medulla, midbrain, hippocampus, cerebellum, and spinal cord.
[0096] Furthermore, GFP expression was also confirmed in the heart and liver, whereas the lungs and spleen showed little to no transcript expression (Figure 12). Western blot data with scAAV9.P546.GFP are consistent with expression data from mouse and non-human primate safety studies, where very similar expression profiles were observed. Furthermore, this expression pattern in the brain and peripheral organs is comparable to that seen with scAAV9.CB.GFP.
[0097] Taken together, extensive expression analysis in mice using immunostaining and Western blot techniques shows that the P546 promoter results in a highly similar and long-lasting expression profile throughout the nervous system, while allowing more modest expression levels compared to the strong CBA promoter.
[0098] Example 4 Expression studies using scAAV9.P546.CLN3 in non-human primates 3.4×10 13 A single dose of 1000 mg of scAAV9.P546.CLN3 in 1x PBS and 0.001% Pluronic F68 was administered to three 3-4 year old cynomolgus monkeys.
[0099] In targeting analysis in brain tissue from cynomolgus monkeys injected with scAAV9.P546.CLN3, the target was analyzed at the RNA level using primers specific for the human CLN3 transgene and that did not cross-react with endogenous non-human primate CLN3 RNA. Reverse transcription quantitative PCR in tissue from various brain regions of one cynomolgus monkey sacrificed 12 weeks after injection revealed expression of human CLN3 at all levels: spinal cord, cortex, thalamus, striatum, cerebellum, and retina, further highlighting the broad reach of scAAV9 driven by the P546 promoter and transcript expression throughout the brain and spinal cord (Figure 13). Notably, the primers used to detect vector-derived human CLN3 do not cross-react with endogenous NHP CLN3 transcripts. Therefore, normalization to zero was not possible; therefore, normalization was performed against vector-derived CLN3 RNA levels found in the lumbar spinal cord, which was set to 1, rather than against saline-injected or uninjected animals. Actin was used as the normalization gene.
[0100] Collectively, the data from non-human primates demonstrate that scAAV9 can penetrate the nervous system and likely reach broad regions of the CNS after a single intrathecal lumbar injection. Notably, all non-human primates treated with intrathecal injection of scAAV9.P546.CLN3 tolerated the treatment well, with no adverse effects observed in any animal at any time point up to 6 months post-injection.
[0101] Example 5 Clinical trial of scAAV9.P546.CLN3 gene therapy scAAV9.P546.CLN3 will be delivered intrathecally to human patients with CLN3-Batten disease.
[0102] scAAV for clinical trials will be produced by the Nationwide Children's Hospital Clinical Manufacturing Facility using a triple transfection method in HEK293 cells under cGMP conditions as described in Example 1.
[0103] Patients selected for participation will be aged 3-10 years, diagnosed with CLN3 disease as determined by genotype. The first cohort (n=3) will consist of 6 x 10 patients per patient. 13 Each subject will receive a one-time gene transfer dose of 1000 mg of total scAAV. scAAV9.P546.CLN3 will be formulated at 20 mM in 1 mM MgCl2, 200 mM NaCl, and 0.001% poloxamer 188 Tris (pH 8.0) and delivered once via an intrathecal catheter inserted via lumbar puncture into the interstitial space of the lumbar sac. Safety will be assessed based on clinical evidence and by reviewing the safety label. There will be a minimum of 4 weeks between enrollment of each subject to allow for review of safety data 30 days after gene transfer. If there are no safety concerns, a second cohort of four additional subjects will be enrolled after the third subject is evaluated 1 month after injection. Each subject in Cohort 2 (n=4) will receive 1.2 x 10 14 Subjects will receive escalating doses of vg total scAAV. There will be a window of at least 6 weeks between the completion of Cohort 1 and the start of Cohort 2 to allow for safety analyses from five time points (days 1, 2, 7, 14, and 21) as well as DSMB review before dosing the next subject.
[0104] Disease progression will be measured using the UBDRS scale (mentioned in the detailed description above) and the impact of treatment on quality of life using the Pediatric Quality of Life (PEDSQOL) scale, and the likelihood of long-term survival.
[0105] The primary efficacy analysis will be evaluated when all patients have completed the 3-year study. Efficacy will be determined by disease stabilization or reduction in progression based on the established Unified Batten Disease Rating Scale (UBDRS), which was developed specifically for CLN3-Batten disease. At the end of the 3-year study period, patients will be monitored annually for 5 years, in accordance with FDA guidance.
[0106] Example 6 Cln3Δ7 / 8 Further studies in mouse models As described in the Examples, two wild-type (WT) and two Cln3Δ7 / 8 mice were administered either PBS, scAAV9.p546.CLN3, or scAAV9.CB.CLN3 gene therapy via intracerebroventricular (ICV) injection on postnatal day 1. In this study, mice were administered 5x1010 vg / animal (4 µL volume).
[0107] The injection method and timing were chosen to target specific neuronal populations associated with CLN3-Batten disease. Animals were sedated by hypothermia during the procedure, monitored until full recovery, and genotyped as previously described (see Morgan et al., PLoS One 8, and Laboratory, TJ Protocol 18257: Standard PCR Assay).
[0108] Statistical analyses were performed using GraphPad Prism and are detailed in the figure legends. Generally, two-way ANOVAs were used with appropriate post-hoc tests, and outliers were removed with the ROUT method (Q = 0.1–1%). When necessary, unpaired t-tests were used.
[0109] Expression and distribution of hCLN3 transcripts in the brain Quantitative PCR was performed to measure hCLN3 transcripts in the brains of treated mice. Total RNA and cDNA were generated as previously described (see Cain et al., Mol Ther., 2019). The 2^-delta-delta Ct method was used to calculate relative gene expression of human CLN3 transcripts normalized to Gapdh as a housekeeping control. The hCLN3 forward primer sequence was CGCTAGCATCTCATCAGGCCTTG (SEQ ID NO: 11), and the hCLN3 reverse primer sequence was AGCATGGACAGCAGGGTCTG (SEQ ID NO: 12).
[0110] As shown in Figure 16, scAAV9.p546.CLN3 treatment reduced Cln3 expression as measured by qPCR up to 24 months of age. Δ7 / 8 Expression levels of hCLN3 transcripts were elevated in the cerebral cortex and spinal cord of mice. Thus, a single neonatal ICV administration of scAAV9.p546.CLN3 resulted in sustained and well-targeted expression of hCLN3.
[0111] Additionally, RNAscope was performed to detect CLN3 transcripts in the brains of treated mice. Mice were euthanized with CO2 and the hearts were perfused with PBS. Brains were collected and arranged in 1 mm sagittal brain blocks. Brains were sliced at the midline and 3 mm right of the midline. 3 mm sagittal sections were snap-frozen in isopentane at -50°C, sectioned at 16 μm using a cryostat, and placed on slides. Slides were then processed according to the manufacturer's recommended protocol (ACDBio manuals 320293 and 320513). Sections were labeled with a human-specific CLN3 probe (ACDBio catalog number 470241), which consisted of 20 double Z pairs in the region of the CLN3 gene (region 631-1711) that shows little homology between mouse and human CLN3. Slides were fluorescently labeled with the RNAscope Fluorescent Multiplex Kit (ACDBio catalog no. 320850) using Amp4-FL-AltC, a 550 nm fluorophore tagged hCLN3 probe, and counterstained with DAPI to label nuclei. Tissue sections were mounted on slides under coverslips using antifade mounting medium (Dako faramount, Agilent). Slides were stored in the dark before imaging. Sections were imaged and analyzed using a Nikon NiE microscope with NIS-Elements Advanced Research software (v4.20).
[0112] As shown in Figure 17, scAAV9.p546.CLN3 treatment reduced Cln3 expression as measured by RNAscope (red fluorescence) up to 24 months of age. Δ7 / 8Stable hCLN3 transcripts are generated throughout the mouse brain. Quantitative PCR and RNAscope assays confirm that a single, neonatal ICV administration of scAAV9.p546 results in sustained and well-targeted expression of hCLN3. scAAV9.p546.CLN3 gene therapy increases hCLN3 gene expression throughout the brain and spinal cord by 24 months of age.
[0113] Classic Batten disease pathology Administration of scAAV9.p546.CLN3 resulted in Cln3 Δ7 / 8 To determine whether classic Batten disease pathology was prevented in the mouse brain, we examined accumulation of storage material (ASM) and glial reactivity after ICV administration of wild-type and CLN3 mice. Δ7 / 8 Mice were euthanized with CO2, perfused with PBS, and tissues were fixed in 4% PFA. Fixed brains were sectioned at 50 μm using a vibratome (Leica VT10008). Sections were processed using standard immunofluorescence and DAB staining protocols. Primary antibodies included anti-CD68 (AbD Serotec, MCA1957, 1:2000), anti-GFAP (Dako, Z0334, 1:8000), and anti-ATP synthase subunit C (Abcam, ab181243, 1:1000). Secondary antibodies included anti-rat and anti-rabbit biotinylated antibodies (Vector Labs, BA-9400, 1:2000). Sections were imaged and analyzed using an Aperio slide scanning microscope at 20x magnification. Images were extracted from the VPM / VPL of the thalamus and layers 2 / 3 of the somatosensory cortex. Multiple images were taken from multiple tissues in each animal. The total area of immunoreactivity was quantified using threshold analysis in ImageJ.
[0114] Figure 18 shows that scAAV9.p546.CLN3 treatment reduces Cln3 up to 24 months of age. Δ7 / 8 Figure 19 shows that scAAV9.p546.CLN3 treatment prevents and reduces ASM accumulation in two regions of the mouse brain. Δ7 / 8Figure 20 shows that scAAV9.p546.CLN3 treatment largely prevents the accumulation of abundant subunit C (a component of ASM) in two brain regions of Cln3Δ7 / 8 mice by 24 months of age. Figure 21 shows that scAAV9.p546.CLN3 treatment largely prevents astrocyte activation (GFAP+) in two brain regions of Cln3Δ7 / 8 mice by 24 months of age, depending on the time point. Thus, scAAV9.p546.CLN3 prevents the accumulation of memory material and glial reactivity in two brain regions of Cln3Δ7 / 8 mice by 24 months of age. Δ7 / 8 Figure 22 shows that scAAV9.CB.CLN3 treatment prevented classical Batten disease pathology in the mouse brains at 6 and 12 months of age. Δ7 / 8 It has been shown to be similarly effective in preventing various forms of Batten disease in mice.
[0115] Additionally, treatment with scAAV9.p546.CLN3 did not result in any red blood cell (CBC) or white blood cell (WBC) abnormalities measured up to 24 months after ICV administration. Figure 23 provides data for the following CBC parameters: RBC count, hemoglobin, hematocrit, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, RBC distribution, platelet count, and mean platelet volume. Figure 24 provides data for the following WBC parameters: WBC count, percent lymphocyte count, percent monocyte, and percent granules.
[0116] scAAV9.p546.CLN3 gene therapy prevents many of the cellular hallmarks of CLN3-Batten disease in Cln3Δ7 / 8 mice by 24 months of age, including expression of ASM, subunit C, GFAP, and CD68. In addition, scAAV9.CB.CLN3 gene therapy prevents many of the cellular hallmarks of Cln3-Batten disease, including expression of ASM, subunit C, GFAP, and CD68. Δ7 / 8 CLN3- prevents many of the cellular hallmarks of Batten disease in mice up to 24 months of age.
[0117] Example 7 Cln3 Δ7 / 8Gender-based histopathological analysis in mouse models Wild-type (WT) and Cln3Δ7 / 8 mice were administered either PBS, scAAV9.p546.CLN3, or scAAV9.CB.CLN3 gene therapy via intracerebroventricular (ICV) injection on postnatal day 1 as described in Example 2. In this study, mice were administered 5x10 10 vg / animal (4 μL volume) was administered.
[0118] Wild-type and CLN3 Δ7 / 8 Mice were euthanized with CO2, perfused with PBS, and tissues were fixed in 4% PFA. Fixed brains were sectioned at 50 μm using a vibratome (Leica VT10008). Sections were processed using standard immunofluorescence and DAB staining protocols. Primary antibodies included anti-CD68 (AbD Serotec, MCA1957, 1:2000) and anti-ATP synthase subunit C (Abcam, ab181243, 1:1000). Secondary antibodies included anti-rat and anti-rabbit biotinylated antibodies (Vector Labs, BA-9400, 1:2000). Sections were imaged and analyzed using an Aperio slide scanning microscope at 20x magnification. Images were extracted from the following regions: CA2 / CA3 of the hippocampus, the polymorphic layer of the dentate gyrus, the basolateral amygdala, the habenula, the thalamic reticular nucleus, the ventral posterolateral / ventral posteromedial thalamic nuclei, the dorsomedial and inframedial thalamic regions, the piriform cortex, the retrosplenial cortex, and layers 2 / 3 of the somatosensory cortex. Multiple images were taken from multiple tissues in each animal. The total area of immunoreactivity was quantified using threshold analysis in ImageJ.
[0119] Figure 25 shows that mice treated with scAAV9.p546.CLN3 exhibit different levels of sub-C accumulation in the CA3 region of the hippocampus based on sex at 12 months of age. Δ7 / 8 Although mice accumulated significantly more subC than wild-type mice, subC accumulation in treated males did not differ from wild-type, although this difference was not seen at any other time point analyzed.
[0120] Figure 26 shows that mice treated with scAAV9.p546.CLN3 exhibited slightly different levels of subC accumulation in the piriform cortex (PIRC) based on sex at multiple time points. At 12 months of age, treated female mutant CLN3 mice accumulated significantly more subC than wild-type mice, and AAV treatment did not prevent accumulation below PBS mutant levels, whereas treated male subC accumulation did not differ from wild-type. However, this correlation was not seen at any other time points analyzed and was not consistent with the findings at 18 months of age, where treated female subC accumulation was not significantly different from wild-type and significantly lower than untreated mutant mice. At 18 months of age, treated male subC accumulation was significantly higher than WT levels.
[0121] Figure 27 shows that scAAV9.p546.CLN3-treated mice exhibited different levels of subC accumulation in the reticular thalamic nucleus (RTN) based on sex at multiple time points. At 6 months of age, treated female mutant CLN3 mice accumulated significantly more subC than wild-type mice, while subC accumulation in treated males did not differ from wild-type mice. At 12 months of age, treated males remained at wild-type levels, while treated females had significantly more subC than both wild-type and untreated mutant mice. This difference between treated female mutants and untreated mutants was absent at 18 months, when subC was significantly higher than WT but significantly lower than untreated mutants in both males and females.
[0122] Figure 28 shows that scAAV9.p546.CLN3-treated mice exhibit different levels of subC accumulation in the somatosensory cortex based on sex at 12 months of age. At 12 months of age, treatment with AAV did not reduce subC accumulation compared to untreated mutant females, but subC accumulation in treated males was prevented and did not differ from wild-type. However, this difference was not seen at any other time points analyzed.
[0123] Figure 29 shows that mice treated with scAAV9.p546.CLN3 exhibited different levels of subC accumulation in the VPM / VPL of the thalamus based on sex at 12 months. At 6 months of age, treated females accumulated significantly less subC than untreated mutant females, but significantly more than wild-type females. This difference persisted from 12 to 18 months, with no differences between wild-type and treated males at any time point analyzed.
[0124] Figure 30 shows that mice treated with scAAV9.p546.CLN3 exhibit different levels of sub-C accumulation in the basolateral amygdala (BLA) based on sex at 12 months. At 12 months of age, AAV did not significantly prevent sub-C accumulation in treated female animals. At 18 months, sub-C accumulation in treated females remained significantly higher than wild-type but lower than untreated females. By 18 months, treated males began to have significantly more sub-C than wild-type males, similar to what was seen in the female group.
[0125] Figure 31 shows that scAAV9.p546.CLN3-treated mice exhibited different levels of subC accumulation in the polymorphic layer of the dentate gyrus (DG) based on gender at 12 and 18 months of age. At 12 months of age, treated females appeared to have accumulated significantly more subC than both wild-type and untreated mutant females. Raw images (not shown) revealed a darkened granule cell layer surrounding the polymorphic layer of the dentate gyrus, which may have influenced the thresholding results. This darkened area was present only in this group and only at 12 months of age. This increase was no longer seen in females at 18 months of age, whereas treated males began to show greater subC accumulation than wild-type males at 18 months of age.
[0126] Figure 32 shows that scAAV9.p546.CLN3-treated mice exhibit different levels of subC accumulation in the habenula based on sex at 12 and 18 months of age. At 12 months of age, treated females accumulated significantly less subC than untreated mutant females, but significantly more than wild-type females. This difference was also seen at 18 months, although there were no differences between wild-type and treated males at any time point analyzed.
[0127] Figure 33 shows that mice treated with scAAV9.p546.CLN3 exhibited different levels of subC accumulation in the dorsomedial nucleus based on sex at 12 and 18 months of age. At 12 months of age, treated females accumulated significantly less subC than untreated mutant females, but significantly more than wild-type females. This difference was also seen at 18 months, although there were no differences between wild-type and treated males at any time point analyzed.
[0128] Figure 34 shows that mice treated with scAAV9.p546.CLN3 showed no differences in sub-C accumulation levels in the retrosplenial cortex (RSC) based on sex. There were no differences between wild-type and treated males at any time point analyzed.
[0129] Figure 35 shows that mice treated with scAAV9.p546.CLN3 had different levels of activated microglia (CD68) in the somatosensory cortex (S1BF) based on sex at 6 months. + At 6 months of age, treated females showed increased microglial activation compared to wild-type and untreated females, whereas treated males showed higher activation than wild-type but lower activation than untreated. No sex differences were observed at 12 and 18 months of age.
[0130] Figure 36 shows that mice treated with scAAV9.p546.CLN3 exhibit different levels of microglial activation in the VPM-VPL and thalamus based on sex. At 6 months of age, treated females exhibit increased microglial activation compared to wild-type and untreated females, while treated males exhibited higher levels than wild-type but lower levels than untreated. This difference persists at 12 months. A similar pattern is observed in the 18-month-old female group, although treated males are not significantly different from wild-type at this time point.
[0131] Figure 37 shows that scAAV9.p546.CLN3 mice have different levels of activated microglia (CD68) in the dorsomedial nucleus (MD) based on gender. + At 6 months of age, treated females had increased microglial activation compared to wild-type and untreated females, and treated males had higher activation than wild-type but not different from untreated males. At both 12 and 18 months of age, treated males had higher microglial activation than wild-type and lower activation than untreated males, but treatment did not appear to affect females.
[0132] Figure 38 shows that mice treated with scAAV9.p546.CLN3 exhibited different levels of activated microglia in the submedial nucleus (SM) based on sex. At 6 months of age, treated females had increased microglial activation compared to wild-type and untreated females, while treated males were not significantly different from untreated males, both of which were more active than wild-type. By 12 months of age, treatment did not appear to affect the degree of microglial activation in either sex. By 18 months of age, treated males had decreased to wild-type levels of microglial activation, while treated females remained as activated as untreated females.
[0133] The data presented above demonstrate that scAAV9.p546.CLN3-treated animals exhibited Cln3 Δ7 / 8 Accumulation of ATP synthase subunit C and CD68 in several regions of the mouse brain +We demonstrate gender-based pathology differences in microglial activation. Gender-specific pathological differences appear to be female-specific. The majority of differences are most consistently seen at 12 months, with many only evident at 12 months and disappearing by 18 months.
[0134] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the invention. It is understood that various alternatives to the embodiments described herein may be employed. The following claims define the scope of the invention, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.
[0135] All documents referenced in this application are incorporated herein by reference in their entirety.
Claims
1. 1. A self-complementary recombinant adeno-associated virus 9 (scAAV9) encoding a CLN3 polypeptide, comprising: a P546 promoter comprising, in 5' to 3' order, the nucleotide sequence of SEQ ID NO:3; and a polynucleotide encoding said CLN3 polypeptide of SEQ ID NO:
1.
2. The scAAV9 of claim 1, wherein the scAAV9 genome comprises, in 5' to 3' order, a P546 promoter comprising the nucleotide sequence of SEQ ID NO:3, an SV40 intron, and a polynucleotide encoding the CLN3 polypeptide of SEQ ID NO:
1.
3. The scAAV9 of claim 1, wherein the scAAV9 genome comprises, in 5' to 3' order, a P546 promoter comprising the sequence of SEQ ID NO: 3, a polynucleotide encoding the CLN3 polypeptide of SEQ ID NO: 1, and a bovine growth hormone polyadenylation poly A sequence.
4. The scAAV9 of any one of claims 1 to 3, further comprising two AAV inverted terminal repeats.
5. The scAAV9 of any one of claims 1 to 4, wherein the polynucleotide encoding the CLN3 polypeptide comprises a sequence that is at least 90% identical to SEQ ID NO:
2.
6. The scAAV9 of any one of claims 1 to 4, wherein the polynucleotide encoding the CLN3 polypeptide comprises the nucleic acid sequence of SEQ ID NO:
2.
7. The scAAV9 of any one of claims 1 to 6, wherein the scAAV9 genome comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO:
4.
8. The scAAV9 of any one of claims 1 to 6, wherein the scAAV9 genome comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO:
4.
9. The scAAV9 of any one of claims 1 to 6, wherein the scAAV9 genome comprises the nucleic acid sequence of SEQ ID NO:
4.
10. The scAAV9 of any one of claims 1 to 9, wherein the AAV inverted terminal repeats are AAV2 inverted terminal repeats.
11. The scAAV9 of any one of claims 1 to 10, wherein the rAAV9 genome comprises a single-stranded genome.
12. A nucleic acid molecule comprising a first AAV inverted terminal repeat sequence, a P546 promoter comprising the sequence of SEQ ID NO:3, a nucleic acid sequence encoding a CLN3 polypeptide of SEQ ID NO:1, and a second inverted terminal repeat sequence.
13. 13. The nucleic acid molecule of claim 12, comprising a first AAV inverted terminal repeat sequence, a P546 promoter comprising the nucleotide sequence of SEQ ID NO: 3, an SV40 intron, a nucleic acid sequence encoding the CLN3 polypeptide of SEQ ID NO: 1, and a second AAV inverted terminal repeat sequence.
14. 13. The nucleic acid molecule of claim 12, comprising a first AAV inverted terminal repeat sequence, a P546 promoter comprising the nucleotide sequence of SEQ ID NO:3, a nucleic acid encoding the CLN3 polypeptide of SEQ ID NO:1, a bovine growth hormone polyadenylation polyA sequence, and a second AAV inverted terminal repeat sequence.
15. 15. The nucleic acid molecule of any one of claims 12 to 14, wherein the nucleic acid encoding the CLN3 polypeptide comprises a sequence that is at least 90% identical to SEQ ID NO:
2.
16. The nucleic acid molecule of any one of claims 12 to 14, wherein the nucleic acid encoding the CLN3 polypeptide comprises the nucleic acid sequence of SEQ ID NO:
2.
17. The nucleic acid molecule according to any one of claims 12 to 16, comprising a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:
4.
18. 17. The nucleic acid molecule according to any one of claims 12 to 16, comprising a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:
4.
19. The nucleic acid molecule according to any one of claims 12 to 17, comprising the nucleic acid sequence of SEQ ID NO:
4.
20. 21. The nucleic acid molecule of any one of claims 15 to 20, wherein the AAV inverted terminal repeat is an AAV2 inverted terminal repeat.
21. A self-complementary recombinant adeno-associated virus 9 (scAAV9) comprising a nucleic acid molecule according to any one of claims 12 to 20.
22. 22. The scAAV9 of claim 21, wherein the scAAV9 comprises a single-stranded genome.
23. An rAAV particle comprising the nucleic acid molecule of any one of claims 12 to 20.
24. The rAAV particle of claim 23, wherein the rAAV particle comprises a single-stranded genome.
25. A recombinant adeno-associated virus 9 (rAAV9) viral particle encoding a CLN3 polypeptide, the recombinant adeno-associated virus 9 (rAAV9) viral particle comprising, in 5' to 3' order, a P546 promoter and an rAAV9 genome comprising a polynucleotide encoding the CLN3 polypeptide.
26. 26. The rAAV9 viral particle of claim 25, wherein the rAAV9 genome comprises a self-complementary genome.
27. 26. The rAAV9 viral particle of claim 25, wherein the rAAV9 genome comprises a single-stranded genome.
28. 28. The rAAV9 viral particle of any one of claims 25 to 27, wherein the rAAV9 genome comprises, in 5' to 3' order, a first AAV inverted terminal repeat, the P546 promoter, the polynucleotide encoding the CLN3 polypeptide, and a second AAV inverted terminal repeat.
29. 29. The rAAV9 viral particle of any one of claims 25 to 28, wherein the P546 promoter comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:
3.
30. 30. The rAAV9 viral particle of any one of claims 25 to 29, wherein the CLN3 polypeptide comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:
1.
31. 31. The rAAV9 viral particle of any one of claims 25 to 30, wherein the polynucleotide encoding the CLN3 polypeptide comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:
2.
32. 32. The rAAV9 viral particle of any one of claims 25 to 31, wherein the rAAV9 genome comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:
4.
33. 32. The rAAV9 viral particle of any one of claims 25 to 31, wherein the rAAV9 genome comprises a sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:
4.
34. 34. The rAAV9 viral particle of any one of claims 28 to 33, wherein the AAV inverted terminal repeat is an AAV2 inverted terminal repeat.
35. The rAAV9 viral particle of any one of claims 25 to 34, wherein the rAAV9 genome further comprises an SV40 intron.
36. The rAAV9 viral particle of any one of claims 25 to 35, wherein the rAAV9 genome further comprises a BGH polyA sequence.
37. A nucleic acid molecule comprising an rAAV9 genome comprising, in 5' to 3' order, a first AAV inverted terminal repeat, a P546 promoter, a polynucleotide encoding a CLN3 polypeptide, and a second AAV inverted terminal repeat.
38. 38. The nucleic acid molecule of claim 37, wherein the rAAV9 comprises a self-complementary genome.
39. 38. The nucleic acid molecule of claim 37, wherein the rAAV9 comprises a single-stranded genome.
40. 40. The nucleic acid molecule of any one of claims 37 to 39, wherein the rAAV9 genome comprises, in 5' to 3' order, a first AAV inverted terminal repeat, the P546 promoter, the polynucleotide encoding the CLN3 polypeptide, and a second AAV inverted terminal repeat.
41. 41. The nucleic acid molecule of any one of claims 37 to 40, wherein the P546 promoter comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:
3.
42. 42. The nucleic acid molecule of claim 37 or 41, wherein the CLN3 polypeptide comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:
1.
43. 43. The nucleic acid molecule of any one of claims 37 to 42, wherein the polynucleotide encoding the CLN3 polypeptide comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:
2.
44. 44. The nucleic acid molecule of any one of claims 37 to 43, wherein the rAAV9 genome comprises a sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO:
4.
45. 45. The nucleic acid molecule of any one of claims 37 to 44, wherein the AAV inverted terminal repeat is an AAV2 inverted terminal repeat.
46. The nucleic acid molecule of any one of claims 37 to 4537, wherein the rAAV9 genome comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO:
4.
47. The nucleic acid molecule of any one of claims 377-46, wherein the rAAV9 genome further comprises an SV40 intron.
48. 48. The nucleic acid molecule of any one of claims 37 to 47, wherein the rAAV9 genome further comprises a bovine growth hormone (BGH) polyA sequence.
49. 10. A composition comprising the scAAV of any one of claims 1 to 12, 21 or 22, the nucleic acid molecule of any one of claims 12 to 20 or 37 to 48, the rAAV9 viral particle of any one of claims 23 to 36, and a pharmaceutically acceptable excipient, carrier, or diluent.
50. 50. The composition of claim 49, wherein the excipient comprises a non-ionic hypo-osmotic compound, a buffer, a polymer, a salt, or a combination thereof.
51. 10. A method of treating CLN3-Batten disease in a subject, comprising administering to the subject a therapeutically effective amount of a composition comprising the scAAV of any one of claims 1-12, 21 or 22, the nucleic acid molecule of any one of claims 12-20 or 37-48, the rAAV9 viral particle of any one of claims 23-36, the nucleic acid of any one of claims 37-48, or the composition of claim 49 or claim 50.
52. 52. The method of claim 51, wherein the composition is administered via a route selected from the group consisting of intrathecal, intraventricular, intraparenchymal, intravenous, and combinations thereof.
53. 52. The method of claim 51, wherein the composition is administered intrathecally.
54. 52. The method of claim 51, wherein the composition is administered intracerebroventricularly.
55. 52. The method of claim 51, wherein the composition is administered intravenously.
56. Approximately 1×10 12 ~Approx. 1×10 15 56. The method of claim 51 or 55, wherein the rAAV9 viral particles are administered in an amount of 0.5 mg / kg.
57. Approximately 6×10 13 ~Approx. 1.2×10 14 57. The method of claim 51 or 56, wherein the rAAV9 viral particles are administered in an amount of 1000 mg / mL.
58. Treatment, (a) reduced or delayed lysosomal accumulation of autofluorescent storage materials; (b) reduced or delayed lysosomal accumulation of ATP synthase subunit C; (c) reduced or delayed glial activation (astrocytic and / or microglial) activation; (d) reduction or delay of astrocytosis; (e) reduction or delay of brain volume loss as measured by MRI; (f) reducing or delaying the onset of seizures; (g) reducing one or more symptoms of CLN3-Batten disease selected from stabilization, reduction or delay in progression, or improvement in one or more of the UBDRS rating scales, wherein said reduction, stabilization, or improvement is compared to said subject or an untreated CLN3-Batten disease patient before administering said composition.
59. 59. The method of claims 51-58, further comprising placing the subject in Trendelenberg position after administering the rAAV9 viral particles.
60. 1. A method of treating CLN3 disease in a subject in need thereof, comprising delivering a composition comprising the scAAV of any one of claims 1-12, 21 or 22, the nucleic acid molecule of any one of claims 12-20 or 37-48, or the rAAV9 viral particle of any one of claims 23-36 to the brain or spinal cord of a subject in need thereof.
61. 61. The method of claim 60, wherein the composition is delivered by intrathecal injection, intraventricular injection, intraparenchymal injection, intravenous injection, or a combination thereof.
62. 62. The method of claim 61, further comprising placing the subject in the Trendelenberg position after intrathecal injection of the composition.
63. 63. The method of any one of claims 60 to 62, wherein the composition comprises a non-ionic, low-osmolar contrast agent.
64. The method of claim 6363, wherein the non-ionic low osmolar contrast agent is selected from the group consisting of iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, ioxilan, and combinations thereof.
65. 65. The method of any one of claims 60 to 64, wherein delivering to the brain or spinal cord comprises delivery to the brainstem.
66. 65. The method of any one of claims 60 to 64, wherein delivering to the brain or spinal cord comprises delivery to the cerebellum.
67. 65. The method of any one of claims 60 to 64, wherein delivering to the brain or spinal cord comprises delivery to the visual cortex.
68. 65. The method of any one of claims 60-64, wherein delivering to the brain or spinal cord comprises delivery to the motor cortex.
69. 65. The method of any one of claims 60-64, wherein delivering to the brain or spinal cord comprises delivery to neuronal cells, glial cells, or both.
70. 70. The method of any one of claims 60-69, wherein delivering to the brain or spinal cord comprises delivery to neurons, lower motor neurons, microglial cells, oligodendrocytes, astrocytes, Schwann cells, or combinations thereof.
71. Treatment, (a) reduced lysosomal accumulation of autofluorescent storage materials; (b) reduced lysosomal accumulation of ATP synthase subunit C; (c) reduced glial activation (astrocytic and / or microglial) activation; (d) reduction in astrocytosis; (e) reduction in brain volume loss measured by MRI; (f) a reduction in the incidence of seizures, and (g) resulting in one or more of stabilization, reduction in progression, or improvement in one or more of the UBDRS rating scales, wherein the reduction, stabilization, or improvement is compared to the subject or an untreated CLN3-Batten disease patient before delivery of the composition.
Citation Information
Patent Citations
Gene therapy for juvenile-onset Batten disease
JP2018500311A
Adeno-Associated Virus Delivery of CLN3 Polynucleotide
JP7691367B2
Intrathecal delivery of recombinant adeno-associated virus encoding methyl-CPG binding protein 2
WO2018094251A1