Compositions and methods for TTR gene editing and treating ATTR amyloidosis

Abstract

To provide compositions and methods for editing, e.g., introducing double-stranded breaks, within the TTR gene, and to provide compositions and methods for treating subjects having amyloidosis associated with transthyretin (ATTR).SOLUTION: Provided is a method of inducing a double-stranded break (DSB) within the TTR gene, comprising delivering a composition to a cell, the composition comprising a. a guide RNA comprising a guide sequence selected from specific sequences; b. a guide RNA comprising at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from the specific sequences; or c. a guide RNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from the specific sequences.SELECTED DRAWING: None

Description

[Technical Field]

[0001] This application is a continuation of U.S. Provisional Application No. 62 / 556,236, filed September 29, 2017. and U.S. Provisional Application No. 62 / 671,902, filed May 15, 2018. The benefit of priority is claimed, and these provisional applications are incorporated by reference in their entireties.

[0002] This application contains a sequence listing which has been submitted electronically in ASCII format, which sequence listing is incorporated by reference. The foregoing was filed on September 27, 2018, and is hereby incorporated by reference in its entirety. ASCII copy is 2018-09-27_01155-0013-PCT_ST25. txt and is 417,471 bytes in size. [Background technology]

[0003] Transthyretin (TTR) is a protein produced by the TTR gene. Normally, it functions to transport retinol and thyroxine throughout the body. TTR is primarily synthesized in the liver, with a small proportion produced in the choroid plexus and retina. , which normally circulates in the blood as a soluble tetrameric protein.

[0004] Pathogenic variants of TTR that can disrupt tetramer stability are located in mutant alleles of the TTR gene. Mutant TTR may be involved in the production of amyloid (i.e., misfolded) proteins. Misfolded TTR protein can form aggregates of misfolded TTR protein. In some cases, pathogenic variants of TTR can result in amyloidosis. This can lead to diseases resulting from the accumulation of amyloid, such as myositis, Folded TTR monomers are abundant in tissues such as the peripheral nervous system, heart, and gastrointestinal tract. Amyloid plaques can also be formed by misfolding. The TTR may comprise wild-type TTR deposited on the cytoplasmic TTR.

[0005] Misfolding and deposition of wild-type TTR also occurs at age 60 or older. It has been observed in older men and is associated with heart rhythm problems, heart failure, and carpal tunnel. .

[0006] Amyloidosis characterized by TTR deposition is commonly referred to as "ATTR" or "TTR-associated amyloidosis." amyloidosis," "TTR amyloidosis," or "ATTR amyloidosis" "ATTR familial amyloidosis" (associated with gene mutations in families (if present), or "ATTRwt" or "wild-type ATTR" (misprothesis of wild-type TTR) It is sometimes called "folding" (when it results from folding and deposition).

[0007] ATTR can present with a wide range of symptoms, and patients with different classes of ATTR have different Some classes of ATTR include familial amyloidosis and Familial amyloidotic cardiomyopathy (FAP), familial amyloidotic cardiomyopathy (FAC), and wild-type TTR alleles. FAP is generally characterized by sensory FAC and wt-TTR amyloidosis commonly present with motor neuropathy. FAP and FAC are usually caused by a genetic mutation in the TTR gene. More than 100 different mutations in the TTR gene are associated with ATTR. In contrast, wt-TTR amyloidosis is associated with aging and T It is not associated with genetic mutations in TR. Approximately 50,000 patients worldwide It is suspected that the patient may be suffering from FAP and FAC.

[0008] Although more than 100 mutations in TTR are associated with ATTR, certain Mutations are more closely associated with neuropathy and / or cardiomyopathy. For example, mutations in T60 of TTR are associated with both cardiomyopathy and neuropathy. Mutations in V30 are more associated with neuropathy, and mutations in V122 are more associated with neuropathy. Mutations are more likely to be associated with cardiomyopathy.

[0009] A wide range of therapeutic approaches have been investigated for the treatment of ATTR, but few have been successful in halting disease progression or There are no approved drugs that improve quality of life. Liver transplantation is being studied for the treatment of ATTR. Although its use has been used successfully, its use carries significant risks and disease progression may continue after transplantation. Small molecule stabilizers such as diflunisal and tafamidis have been shown to inhibit ATTR Although these drugs appear to slow the progression of the disease, they do not halt disease progression.

[0010] Small interfering RNA (siRNA) knockdown targets amyloid fibrils for destruction Approaches using cloning, antisense knockdown, or monoclonal antibodies are also Although currently being studied, preliminary results regarding short-term inhibition of TTR expression have shown encouraging results. However, there is a need for therapies that can produce long-lasting inhibition of TTR.

[0011] Accordingly, the following embodiments are provided: In some embodiments, the present invention provides a CRIS RNA-guided DNA binding agents such as PR / Cas systems The TTR gene is expressed using a guide RNA along with a nucleotide-binding agent. Qualitatively reduce or knock out the TTR gene associated with ATTR. The present invention provides compositions and methods for substantially reducing or eliminating the production of TTR protein. Substantial reduction in the production of TTR protein, which is associated with ATTR, through genetic alterations Or the elimination may be a long-term reduction or elimination. Summary of the Invention

[0012] Embodiment 1: A method for inducing a double-strand break (DSB) in the TTR gene, comprising administering a composition and delivering the composition to a cell, a. a guide RNA comprising a guide sequence selected from SEQ ID NOs: 5 to 82; b. At least 17, 18, 19, or 2 of a sequence selected from SEQ ID NOs: 5 to 82 a guide RNA containing 0 consecutive nucleotides; or c. A sequence selected from SEQ ID NOs: 5 to 82, and a sequence having at least 99%, 98%, 97%, or 96% %, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences guide RNA Including, method.

[0013] Embodiment 2: A method of modifying a TTR gene, comprising delivering a composition to a cell. the composition comprises (i) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent; and (ii) a guide RNA, wherein the guide RNA a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. At least 17, 18, 19, or 2 of a sequence selected from SEQ ID NOs: 5 to 82 0 consecutive nucleotides; or c. A sequence selected from SEQ ID NOs: 5 to 82, and a sequence having at least 99%, 98%, 97%, or 96% %, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, method.

[0014] Embodiment 3: A method of treating amyloidosis associated with TTR (ATTR). and administering the composition to a subject in need thereof, thereby treating ATTR. The composition comprises: (i) an RNA-guided DNA binding agent or a and (ii) a guide RNA, wherein the guide RNA is a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. At least 17, 18, 19, or 2 of a sequence selected from SEQ ID NOs: 5 to 82 0 consecutive nucleotides; or c. A sequence selected from SEQ ID NOs: 5 to 82, and a sequence having at least 99%, 98%, 97%, or 96% %, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, method.

[0015] Embodiment 4: A method of reducing serum concentrations of TTR, comprising administering a composition to a subject in need thereof. and (i) administering to an elephant a composition comprising: RNA-guided DNA binding agents or nucleic acids encoding RNA-guided DNA binding agents and (i i) comprising a guide RNA, wherein the guide RNA is a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. At least 17, 18, 19, or 2 of a sequence selected from SEQ ID NOs: 5 to 82 0 consecutive nucleotides; or c. A sequence selected from SEQ ID NOs: 5 to 82, and a sequence having at least 99%, 98%, 97%, or 96% %, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, method.

[0016] Embodiment 5: Reducing accumulation of amyloid or amyloid fibrils containing TTR in a subject a method for preventing or inducing a pulmonary embolism comprising administering a composition to a subject in need thereof, thereby , reducing the accumulation of amyloid or amyloid fibrils, wherein the composition comprises: (i) RNA-guided DNA binding agents or nucleic acids encoding RNA-guided DNA binding agents and (i i) comprising a guide RNA, wherein the guide RNA is a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. At least 17, 18, 19, or 2 of a sequence selected from SEQ ID NOs: 5 to 82 0 consecutive nucleotides; or c. A sequence selected from SEQ ID NOs: 5 to 82, and a sequence having at least 99%, 98%, 97%, or 96% %, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, method.

[0017] Embodiment 6: A composition comprising a guide RNA, wherein the guide RNA is: a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. At least 17, 18, 19, or 2 of a sequence selected from SEQ ID NOs: 5 to 82 0 consecutive nucleotides; or c. A sequence selected from SEQ ID NOs: 5 to 82, and a sequence having at least 99%, 98%, 97%, or 96% %, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, composition.

[0018] Embodiment 7: A composition comprising a vector encoding a guide RNA, wherein the guide RNA , a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. At least 17, 18, 19, or 2 of a sequence selected from SEQ ID NOs: 5 to 82 0 consecutive nucleotides; or c. A sequence selected from SEQ ID NOs: 5 to 82, and a sequence having at least 99%, 98%, 97%, or 96% %, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, composition.

[0019] Embodiment 8: Induction of a double-strand break (DSB) in the TTR gene in a cell or subject 8. The composition of embodiment 6 or 7 for use in

[0020] Embodiment 9: A method for the preparation of a TTR gene for use in modifying a TTR gene in a cell or subject. The composition of Form 6 or 7.

[0021] Embodiment 10: Treatment of amyloidosis associated with TTR (ATTR) in a subject The composition of embodiment 6 or 7 for use in therapy.

[0022] Embodiment 11: For use in reducing the serum concentration of TTR in a subject Composition of 6 or 7.

[0023] Embodiment 12: Reducing or preventing amyloid or amyloid fibril accumulation in a subject 8. The composition of embodiment 6 or 7 for use in

[0024] Embodiment 13: Any one of embodiments 1 to 5, wherein the composition reduces serum TTR levels. or the composition for use according to any one of embodiments 8 to 12.

[0025] Embodiment 14: The serum TTR level is reduced compared to the serum TTR level before administration of the composition. 14. The composition for the method or use of embodiment 13, wherein the amount of erythrocyte colony-stimulating factor (B1) is reduced by at least 50%.

[0026] Embodiment 15: Serum TTR levels are increased by 50% or more compared to serum TTR levels before administration of the composition ~60%, 60~70%, 70~80%, 80~90%, 90~95%, 95~98%, 98 to 99%, or 99 to 100% reduction, for the method or use of embodiment 13. Composition of.

[0027] Embodiment 16: The method of any one of embodiments 1 to 5 or any combination thereof, wherein the composition results in editing of the TTR gene. A composition for use in any one of the methods or uses of 8 to 15.

[0028] Embodiment 17: Editing is calculated as the percentage of the population that is edited (percent edited) 17. The composition for the method or use of embodiment 16, wherein

[0029] Embodiment 18: The method of embodiment 17, wherein the editing percentage is 30-99% of the population; or Composition for use.

[0030] Embodiment 19: The percentage of edits is 30-35%, 35-40%, 40-45% of the population; 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75% %, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% A composition for the method or use of embodiment 17.

[0031] Embodiment 20: A method for treating atopic dermatitis, wherein the composition reduces amyloid deposition in at least one tissue. For the method of any one of embodiments 1 to 5 or the use of any one of embodiments 8 to 19 Composition of.

[0032] Embodiment 21: The at least one tissue is one of the stomach, colon, sciatic nerve, or dorsal root ganglion. 21. The composition for the method or use of embodiment 20, comprising or a plurality of

[0033] Embodiment 22: The method of embodiment 20 or 21, wherein amyloid deposits are measured 8 weeks after administration of the composition. or 21 compositions for the method or use.

[0034] Embodiment 23: Amyloid deposits are measured in a negative control or at a level measured before administration of the composition. 23. The composition for the method or use of any one of embodiments 20 to 22, as compared with

[0035] Embodiment 24: Amyloid deposits are measured in biopsy samples and / or by immunostaining. 24. The composition for the method or use of any one of embodiments 20 to 23.

[0036] Embodiment 25: Amyloid deposits are 30 to 30% of the amyloid deposits seen in the negative control 5%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60 ~65%, 65~70%, 70~75%, 75~80%, 80~85%, 85~90%, Any one of embodiments 20-24, wherein the concentration is reduced by 90-95%, or 95-99%. A composition for the method or use of.

[0037] Embodiment 26: The amyloid deposits are 30 to 40% of the amyloid deposits seen prior to administration of the composition. 35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 6 0-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90% 26. Any one of embodiments 20 to 25, wherein the ion exchange rate is reduced by 90 to 95%, or 95 to 99%. A composition for one method or use.

[0038] Embodiment 27: The composition of any of embodiments 1-5 or 8, wherein the composition is administered or delivered at least twice. 26. A composition for any one of the methods or uses.

[0039] Embodiment 28: The method of embodiment 27, wherein the composition is administered or delivered at least three times. Composition for use.

[0040] Embodiment 29: The method of embodiment 27, wherein the composition is administered or delivered at least four times. Composition for use.

[0041] Embodiment 30: The composition is administered or delivered up to 5, 6, 7, 8, 9, or 10 times. 28. The composition for the method or use of embodiment 27.

[0042] Embodiment 31: The administration or delivery is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, Any one of embodiments 27-30, wherein the administration is performed at intervals of 12, 13, 14, or 15 days. A composition for the method or use of.

[0043] Embodiment 32: The administration or delivery is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, Any one of embodiments 27-30, administered at 12, 13, 14, or 15 week intervals. A composition for the method or use of.

[0044] Embodiment 33: The administration or delivery comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, Any one of embodiments 27 to 30, wherein the administration is performed at intervals of 12, 13, 14, or 15 months. A composition for one method or use.

[0045] Embodiment 34: The method of any of embodiments 1 to 33, wherein the guide sequence is selected from SEQ ID NOs: 5 to 82. Any one of the methods or compositions.

[0046] Embodiment 35: The guide RNA is a nucleic acid sequence encoding at least a portion of a target sequence present in the human TTR gene. 35. The method or composition of any one of embodiments 1-34, wherein the two or more of ...

[0047] Embodiment 36: The target sequence is in exon 1, 2, 3, or 4 of the human TTR gene. The method or composition of embodiment 35.

[0048] Embodiment 37: The method of embodiment 35, wherein the target sequence is in exon 1 of the human TTR gene. Or composition.

[0049] Embodiment 38: The method of embodiment 35, wherein the target sequence is in exon 2 of the human TTR gene. Or composition.

[0050] Embodiment 39: The method of embodiment 35, wherein the target sequence is in exon 3 of the human TTR gene. Or composition.

[0051] Embodiment 40: The method of embodiment 35, wherein the target sequence is in exon 4 of the human TTR gene. Or composition.

[0052] Embodiment 41: The guide sequence is complementary to a target sequence in the positive strand of TTR, as described in embodiments 1-4. 10. Any one of the methods or compositions of claim 1.

[0053] Embodiment 42: Embodiments 1-4, wherein the guide sequence is complementary to a target sequence in the negative strand of TTR. 10. Any one of the methods or compositions of claim 1.

[0054] Embodiment 43: The first guide sequence is complementary to a first target sequence in the positive strand of the TTR gene. and the composition comprises a second guide sequence complementary to a second target sequence in the negative strand of the TTR gene. 41. The method or composition of any one of embodiments 1-40, further comprising an array.

[0055] Embodiment 44: The guide RNA comprises a guide sequence and the nucleotide sequence of SEQ ID NO: 126 and a crRNA further comprising the sequence, wherein the nucleotides of SEQ ID NO: 126 correspond to the guide sequence. 44. The method or composition of any one of embodiments 1-43, wherein at the 3' end thereof follows:

[0056] Embodiment 45: The guide RNA is a dual guide (dgRNA), as described in embodiments 1 to 44. Any one of the methods or compositions.

[0057] Embodiment 46: The dual guide RNA comprises a crRNA and a trRNA, A comprises the nucleotide sequence of SEQ ID NO: 126, and the nucleotide of SEQ ID NO: 126 is 46. ​​The method or composition of embodiment 45, wherein the guide sequence is followed at its 3' end.

[0058] Embodiment 47: The guide RNA is a single guide (sgRNA), as described in embodiments 1 to 43. Any one of the methods or compositions.

[0059] Embodiment 48: An embodiment in which the sgRNA comprises a guide sequence having the pattern of SEQ ID NO: 3. 48. The method or composition of claim 47.

[0060] Embodiment 49: The method or composition of embodiment 47, wherein the sgRNA comprises the sequence of SEQ ID NO:3. thing.

[0061] Embodiment 50: Each N in SEQ ID NO:3 is any natural or non-natural nucleotide. , N forms a guide sequence, and the guide sequence targets Cas9 to the TTR gene; 50. The method or composition of embodiment 48 or 49.

[0062] Embodiment 51: The sgRNA comprises any one of the guide sequences of SEQ ID NOs: 5 to 82 and a sequence 51. The method of any one of embodiments 47 to 50, comprising the nucleotide of sequence number 126; or composition.

[0063] Embodiment 52: The sgRNA is selected from the group consisting of SEQ ID NOs: 87 to 124 and at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 9 52. The method or composition of any one of embodiments 47-51, comprising 0% identical guide sequences.

[0064] Embodiment 53: An embodiment in which the sgRNA comprises a sequence selected from SEQ ID NOs: 87 to 124. 48. The method or composition of claim 47.

[0065] Embodiment 54: Any of embodiments 1 to 53, wherein the guide RNA comprises at least one modification. or one method or composition.

[0066] Embodiment 55: At least one modification is a 2'-O-methyl (2'-O-Me) modified nucleotide. 55. The method or composition of embodiment 54, comprising an otide.

[0067] Embodiment 56: At least one modification is an internucleotide phosphorothioate (PS) 56. The method or composition of embodiment 54 or 55, comprising binding.

[0068] Embodiment 57: At least one modification is a 2'-fluoro (2'-F) modified nucleotide. 57. The method or composition of any one of embodiments 54 to 56, comprising

[0069] Embodiment 58: At least one modification is of the first five nucleotides at the 5' end 58. The method or composition of any one of embodiments 54 to 57, comprising one or more modifications. Finished product.

[0070] Embodiment 59: At least one modification is of the last five nucleotides at the 3' end 59. The method or composition of any one of embodiments 54 to 58, comprising one or more modifications. Finished product.

[0071] Embodiment 60: At least one modification comprises a PS bond between the first four nucleotides. Including the method or composition of any one of embodiments 54 to 59.

[0072] Embodiment 61: At least one modification comprises a PS bond between the last four nucleotides. 61. The method or composition of any one of embodiments 54 to 60.

[0073] Embodiment 62: At least one modification is in the first three nucleotides at the 5' end 62. The method of any one of embodiments 54 to 61, comprising 2'-O-Me modified nucleotides. Method or composition.

[0074] Embodiment 63: At least one modification is in the last three nucleotides at the 3' end 63. The method of any one of embodiments 54 to 62, comprising 2'-O-Me modified nucleotides. Method or composition.

[0075] Embodiment 64: Embodiments 54 to 58, wherein the guide RNA comprises modified nucleotides of SEQ ID NO: 3. 63. Any one of the methods or compositions of claim 63.

[0076] Embodiment 65: The method of any one of embodiments 1 to 64, wherein the composition further comprises a pharmaceutically acceptable excipient. Any one of the methods or compositions.

[0077] Embodiment 66: Any of embodiments 1 to 6, wherein the guide RNA is associated with a lipid nanoparticle (LNP). 5. Any one of the methods or compositions.

[0078] Embodiment 67: The method or composition of embodiment 66, wherein the LNP comprises a CCD lipid.

[0079] Embodiment 68: The method of embodiment 67, wherein the CCD lipid is lipid a or lipid B. composition.

[0080] Embodiment 69: The method or composition of embodiments 66-68, wherein the LNP comprises a neutral lipid.

[0081] Embodiment 70: The method or composition of embodiment 69, wherein the neutral lipid is DSPC.

[0082] Embodiment 71: The method of any one of embodiments 66 to 70, wherein the LNP comprises a helper lipid. Or composition.

[0083] Embodiment 72: The method or composition of embodiment 71, wherein the helper lipid is cholesterol. .

[0084] Embodiment 73: The method of any one of embodiments 66-72, wherein the LNP comprises a stealth lipid. Or composition.

[0085] Embodiment 74: The method or composition of embodiment 73, wherein the stealth lipid is PEG2k-DMG. Finished product.

[0086] Embodiment 75: The method of any of embodiments 1 to 74, wherein the composition further comprises an RNA-guided DNA binding agent. Any one of the methods or compositions.

[0087] Embodiment 76: The composition further comprises an mRNA encoding an RNA-guided DNA-binding agent. , The method or composition of any one of embodiments 1 to 75.

[0088] Embodiment 77: The method of embodiment 75 or embodiment 76, wherein the RNA-guided DNA binding agent is a Caspase. 76 methods or compositions.

[0089] Embodiment 78: The method of embodiment 77, wherein the RNA-guided DNA-binding agent is Cas9. composition.

[0090] Embodiment 79: Any of embodiments 75 to 78, wherein the RNA-guided DNA binder is modified. any one of the methods or compositions.

[0091] Embodiment 80: The method of any of embodiments 75 to 79, wherein the RNA-guided DNA binding agent is a nickase. Any one of the methods or compositions.

[0092] Embodiment 81: The modified RNA-guided DNA binder contains a nuclear localization signal (NLS). 81. The method or composition of embodiment 79 or 80, comprising

[0093] Embodiment 82: The RNA-guided DNA binding agent is a molecule derived from a type II CRISPR / Cas system. 82. The method or composition of any one of embodiments 75-81, wherein the Cas is Cas.

[0094] Embodiment 83: The composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier. The method or composition of any one of embodiments 1-82.

[0095] Embodiment 84: The composition reduces amyloid or amyloid fibrils containing TTR. or preventing the use of any one of embodiments 1 to 5 or 8 to 83. composition.

[0096] Embodiment 85: The amyloid or amyloid fibrils are directed against the nervous, cardiac, or gastrointestinal tract (ga 85. The method or use of embodiment 84, wherein the Composition for.

[0097] Embodiment 86: Non-homologous end joining (NHEJ) during repair of a DSB in the TTR gene. 84. The method or use of any one of embodiments 1 to 5 or 8 to 83, wherein the method or use results in a mutation in Composition for.

[0098] Embodiment 87: NHEJ is a method for repairing a nucleotide deletion during repair of a DSB in the TTR gene. 87. The composition for the method or use of embodiment 86, which results in a deletion or insertion.

[0099] Embodiment 88: The deletion or insertion of nucleotides results in a frameshift in the TTR gene. 88. The method or composition for use of embodiment 87, which induces a nonsense mutation.

[0100] Embodiment 89: A frameshift or nonsense mutation is present in at least 50% of hepatocytes 88. The composition for the method or use of embodiment 87, wherein the TTR gene of

[0101] Embodiment 90: Frameshift or nonsense mutations are present in 50% to 60%, 60% to 70%, 70% or 80%, 80%-90%, 90-95%, 95%-99%, or 99. The method of embodiment 89, wherein the TTR gene is induced in 99% to 100% of hepatocytes. Composition for use.

[0102] Embodiment 91: Nucleotide deletions or insertions are less frequent than at off-target sites. Any of embodiments 87-90, wherein at least 50 times or more of the TTR gene A composition for any one of the methods or uses.

[0103] Embodiment 92: Nucleotide deletions or insertions are at 5 or more off-target sites 0x~150x, 150x~500x, 500x~1500x, 1500x~5000x , 5000x to 15000x, 15000x to 30000x, or 30000x to 60 92. The composition of claim 91, wherein the TTR gene is 0,000 times more abundant than the TTR gene. thing.

[0104] Embodiment 93: Nucleotide deletions or insertions are performed in primary human hepatocytes by culturing 3, 2, 1, or less than 0 or equal to 3, 2, 1, or 0 at off-target sites and optionally, the off-target site is a protein in the genome of the primary human hepatocyte. 93. The method of any one of embodiments 87-92, wherein the sequence does not occur in a coding region; or Composition for use.

[0105] Embodiment 94: Nucleotide deletions or insertions are detected in Cas9-overexpressing cells. In primary human hepatocytes, the number of off-target sites where nucleotide deletions or insertions occur is less than the number of off-target sites where nucleotide deletions or insertions occur. Optionally, the off-target sites occur in the primary human 93. The method of claim 93, wherein the method of claim 93 does not occur in a protein-coding region in the genome of a hepatocyte. A composition for the method or use of.

[0106] Embodiment 95: The Cas9-overexpressing cells are HEK293 cells stably expressing Cas9. 95. The composition for the method or use of embodiment 94, wherein

[0107] Embodiment 96: The number of off-target sites in primary human hepatocytes is determined in vitro. from primary human hepatocytes transfected with Cas9 mRNA and guide RNA The off-target site is determined by analyzing genomic DNA, and optionally, does not occur in protein coding regions in the genome of human hepatocytes, 96. A composition for the method or use of any one of aspects 93 to 95.

[0108] Embodiment 97: The number of off-target sites in primary human hepatocytes is determined in vitro. Transfect Cas9 mRNA, guide RNA, and donor oligonucleotides Analysis of genomic DNA from cultured primary human hepatocytes using oligonucleotide insertion techniques and optionally, off-target sites are determined by a transfection assay in primary human hepatocytes. 96. Any of embodiments 93 to 95, wherein the sequence does not occur in a protein coding region in the genome. A composition for any one of the methods or uses.

[0109] Embodiment 98: The sequence of the guide RNA is: a) SEQ ID NO: 92 or 104; b) SEQ ID NO: 87, 89, 96, or 113; c) SEQ ID NO: 100, 102, 106, 111, or 112; or d) SEQ ID NOs: 88, 90, 91, 93, 94, 95, 97, 101, 103, 108 , or 109 and optionally, the guide RNA is a protein coding sequence in the genome of the primary human hepatocyte. does not generate indels at off-target sites occurring in the loading region, The method or composition of any one of aspects 1-43 or 47-97.

[0110] Embodiment 99: A method of administering a composition to a subject, wherein administering the composition reduces the level of TTR in the subject. A composition for the method or use of any one of embodiments 1 to 5 or 8 to 98.

[0111] Embodiment 100: The method of embodiment 99, wherein the level of TTR is reduced by at least 50%. or compositions for use.

[0112] Embodiment 101: The level of TTR is 50% to 60%, 60% to 70%, 70% or 8% 0%, 80% to 90%, 90% to 95%, 95% to 99%, or 99% to 100% reduced 101. The composition for the method or use of embodiment 100.

[0113] Embodiment 102: The level of TTR is measured in serum, plasma, blood, cerebrospinal fluid, or sputum. 102. The composition for the method or use of embodiment 100 or 101, as defined above.

[0114] Embodiment 103: The level of TTR is measured in the liver, choroid plexus, and / or retina. 102. The composition for the method or use of embodiment 100 or 101,

[0115] Embodiment 104: The level of TTR is measured via enzyme-linked immunosorbent assay (ELISA). The composition for the method or use of any one of embodiments 99 to 103, wherein

[0116] Embodiment 105: Any of embodiments 1-5 or 8-104, wherein the subject has ATTR. A composition for one method or use.

[0117] Embodiment 106: The method of any one of embodiments 1 to 5 or 8 to 105, wherein the subject is a human. Compositions for the methods or uses.

[0118] Embodiment 107: The method of embodiment 105 or 106, wherein the subject has ATTRwt. Composition for use.

[0119] Embodiment 108: The method of embodiment 105 or 106, wherein the subject has an inherited ATTR. or compositions for use.

[0120] Embodiment 109: Any of embodiments 1-5, 8-106, or any ...8-106, wherein the subject has a family history of ATTR. 108. A composition for any one of the methods or uses.

[0121] Embodiment 110: The subject has familial amyloid polyneuropathy. , 8 to 106, or 108 to 109.

[0122] Embodiment 111: The subject has only or primarily neurological symptoms of ATTR. For the method or use of any one of embodiments 1 to 5 or 8 to 110, Composition for

[0123] Embodiment 112: The method of embodiment 1-5 or 8-1, wherein the subject has familial amyloidotic cardiomyopathy. 10. A composition for any one of the methods or uses of claim 10.

[0124] Embodiment 113: The subject has only or primarily cardiac symptoms of ATTR. The method or method of any one of embodiments 1-5, 8-109, or 112, wherein the patient has a liver symptom. Composition for use.

[0125] Embodiment 114: The method of any one of embodiments 1 to 5, wherein the subject expresses TTR with a V30 mutation. or a composition for use in any one of the methods or uses of 8 to 113.

[0126] Embodiment 115: The V30 mutation is V30A, V30G, V30L, or V30M. A composition for the method or use of embodiment 114.

[0127] Embodiment 116: The method of any one of embodiments 1 to 5, wherein the subject expresses TTR with a T60 mutation. or a composition for the method or use of any one of embodiments 8 to 113.

[0128] Embodiment 117: The method or use of embodiment 116, wherein the T60 mutation is T60A. Composition for.

[0129] Embodiment 118: The subject expresses TTR with a V122 mutation, as described in any of embodiments 1 to 5. Or a composition for the method or use of any one of embodiments 8 to 113.

[0130] Embodiment 119: The V122 mutation is V122A, V122I, or V122(-) 119. The composition for the method or use of embodiment 118, wherein

[0131] Embodiment 120: The method of any of embodiments 1-5 or 8-119, wherein the subject expresses wild-type TTR. A composition for any one of the methods or uses.

[0132] Embodiment 121: The subject develops a TTR with a V30, T60, or V122 mutation. The method or use of any one of embodiments 1-5, 8-107, or 120, Composition for.

[0133] Embodiment 122: The subject does not express TTR with a pathological mutation, 5, 8-107, or 120-121. .

[0134] Embodiment 123: The method of embodiment 121, wherein the subject is homozygous for wild-type TTR. or compositions for use.

[0135] Embodiment 124: After administration, the subject experiences improvement, stabilization, or a decrease in the symptoms of sensorimotor neuropathy. 123. The method of any one of embodiments 1 to 5 or 8 to 123, wherein the change is accelerated or slowed. Method or composition for use.

[0136] Embodiment 125: The improvement, stabilization, or slowing of changes in sensory neuropathy is Embodiment 12, wherein the outcome is measured using electromyography, nerve conduction studies, or patient-reported outcomes. 4. A composition for the method or use of claim 4.

[0137] Embodiment 126: The subject is experiencing improvement, stabilization, or slow change in symptoms of congestive heart failure. 126. The method or use of any one of embodiments 1 to 5 or 8 to 125, comprising composition.

[0138] Embodiment 127: The improvement, stabilization, or slowing of changes in congestive heart failure is achieved by cardiac biopsy. Actual risk factors, measured using marker tests, pulmonary function tests, chest x-rays, or electrocardiography 127. A composition for the method or use of embodiment 126.

[0139] Embodiment 128: The composition or pharmaceutical formulation is administered via a viral vector. A composition for the method or use of any one of forms 1-5 or 8-127.

[0140] Embodiment 129: An embodiment in which the composition or pharmaceutical formulation is administered via lipid nanoparticles A composition for the method or use of any one of 1 to 5 or 8 to 127.

[0141] Embodiment 130: The subject has a specific gene in the TTR gene prior to administering the composition or formulation. 129. The method of any one of embodiments 1-5 or 8-129, wherein the mutation or a composition for use.

[0142] Embodiment 131: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 5. 131. The method or composition of any one of aspects 1 to 130.

[0143] Embodiment 132: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 6. 131. The method or composition of any one of aspects 1 to 130.

[0144] Embodiment 133: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 7. 131. The method or composition of any one of aspects 1 to 130.

[0145] Embodiment 134: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 8. 131. The method or composition of any one of aspects 1 to 130.

[0146] Embodiment 135: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 9. 131. The method or composition of any one of aspects 1 to 130.

[0147] Embodiment 136: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 10. 131. The method or composition of any one of forms 1-130.

[0148] Embodiment 137: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 11. 131. The method or composition of any one of forms 1-130.

[0149] Embodiment 138: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 12. 131. The method or composition of any one of forms 1-130.

[0150] Embodiment 139: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 13. 131. The method or composition of any one of forms 1-130.

[0151] Embodiment 140: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 14. 131. The method or composition of any one of forms 1-130.

[0152] Embodiment 141: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 15. 131. The method or composition of any one of forms 1-130.

[0153] Embodiment 142: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 16. 131. The method or composition of any one of forms 1-130.

[0154] Embodiment 143: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 17. 131. The method or composition of any one of forms 1-130.

[0155] Embodiment 144: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 18. 131. The method or composition of any one of forms 1-130.

[0156] Embodiment 145: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 19. 131. The method or composition of any one of forms 1-130.

[0157] Embodiment 146: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 20. 131. The method or composition of any one of forms 1-130.

[0158] Embodiment 147: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 21. 131. The method or composition of any one of forms 1-130.

[0159] Embodiment 148: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 22. 131. The method or composition of any one of forms 1-130.

[0160] Embodiment 149: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 23. 131. The method or composition of any one of forms 1-130.

[0161] Embodiment 150: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 24. 131. The method or composition of any one of forms 1-130.

[0162] Embodiment 151: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 25. 131. The method or composition of any one of forms 1-130.

[0163] Embodiment 152: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 26. 131. The method or composition of any one of forms 1-130.

[0164] Embodiment 153: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 27. 131. The method or composition of any one of forms 1-130.

[0165] Embodiment 154: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 28. 131. The method or composition of any one of forms 1-130.

[0166] Embodiment 155: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 29. 131. The method or composition of any one of forms 1-130.

[0167] Embodiment 156: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 30. 131. The method or composition of any one of forms 1-130.

[0168] Embodiment 157: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 31. 131. The method or composition of any one of forms 1-130.

[0169] Embodiment 158: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 32. 131. The method or composition of any one of forms 1-130.

[0170] Embodiment 159: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 33. 131. The method or composition of any one of forms 1-130.

[0171] Embodiment 160: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 34. 131. The method or composition of any one of forms 1-130.

[0172] Embodiment 161: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 35. 131. The method or composition of any one of forms 1-130.

[0173] Embodiment 162: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 36. 131. The method or composition of any one of forms 1-130.

[0174] Embodiment 163: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 37. 131. The method or composition of any one of forms 1-130.

[0175] Embodiment 164: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 38. 131. The method or composition of any one of forms 1-130.

[0176] Embodiment 165: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 39. 131. The method or composition of any one of forms 1-130.

[0177] Embodiment 166: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 40. 131. The method or composition of any one of forms 1-130.

[0178] Embodiment 167: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 41. 131. The method or composition of any one of forms 1-130.

[0179] Embodiment 168: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 42. 131. The method or composition of any one of forms 1-130.

[0180] Embodiment 169: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 43. 131. The method or composition of any one of forms 1-130.

[0181] Embodiment 170: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 44. 131. The method or composition of any one of forms 1-130.

[0182] Embodiment 171: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 45. 131. The method or composition of any one of forms 1-130.

[0183] Embodiment 172: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 46. 131. The method or composition of any one of forms 1-130.

[0184] Embodiment 173: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 47. 131. The method or composition of any one of forms 1-130.

[0185] Embodiment 174: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 48. 131. The method or composition of any one of forms 1-130.

[0186] Embodiment 175: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 49. 131. The method or composition of any one of forms 1-130.

[0187] Embodiment 176: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 50. 131. The method or composition of any one of forms 1-130.

[0188] Embodiment 177: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 51. 131. The method or composition of any one of forms 1-130.

[0189] Embodiment 178: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 52. 131. The method or composition of any one of forms 1-130.

[0190] Embodiment 179: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 53. 131. The method or composition of any one of forms 1-130.

[0191] Embodiment 180: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 54. 131. The method or composition of any one of forms 1-130.

[0192] Embodiment 181: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 55. 131. The method or composition of any one of forms 1-130.

[0193] Embodiment 182: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 56. 131. The method or composition of any one of forms 1-130.

[0194] Embodiment 183: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 57. 131. The method or composition of any one of forms 1-130.

[0195] Embodiment 184: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 58. 131. The method or composition of any one of forms 1-130.

[0196] Embodiment 185: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 59. 131. The method or composition of any one of forms 1-130.

[0197] Embodiment 186: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 60. 131. The method or composition of any one of forms 1-130.

[0198] Embodiment 187: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 61. 131. The method or composition of any one of forms 1-130.

[0199] Embodiment 188: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 62. 131. The method or composition of any one of forms 1-130.

[0200] Embodiment 189: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 63. 131. The method or composition of any one of forms 1-130.

[0201] Embodiment 190: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 64. 131. The method or composition of any one of forms 1-130.

[0202] Embodiment 191: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 65. 131. The method or composition of any one of forms 1-130.

[0203] Embodiment 192: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 66. 131. The method or composition of any one of forms 1-130.

[0204] Embodiment 193: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 67. 131. The method or composition of any one of forms 1-130.

[0205] Embodiment 194: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 68. 131. The method or composition of any one of forms 1-130.

[0206] Embodiment 195: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 69. 131. The method or composition of any one of forms 1-130.

[0207] Embodiment 196: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 70. 131. The method or composition of any one of forms 1-130.

[0208] Embodiment 197: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 71. 131. The method or composition of any one of forms 1-130.

[0209] Embodiment 198: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 72. 131. The method or composition of any one of forms 1-130.

[0210] Embodiment 199: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 73. 131. The method or composition of any one of forms 1-130.

[0211] Embodiment 200: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 74. 131. The method or composition of any one of forms 1-130.

[0212] Embodiment 201: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 75. 131. The method or composition of any one of forms 1-130.

[0213] Embodiment 202: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 76. 131. The method or composition of any one of forms 1-130.

[0214] Embodiment 203: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 77. 131. The method or composition of any one of forms 1-130.

[0215] Embodiment 204: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 78. 131. The method or composition of any one of forms 1-130.

[0216] Embodiment 205: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 79. 131. The method or composition of any one of forms 1-130.

[0217] Embodiment 206: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 80. 131. The method or composition of any one of forms 1-130.

[0218] Embodiment 207: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 81. 131. The method or composition of any one of forms 1-130.

[0219] Embodiment 208: The sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 82. 131. The method or composition of any one of forms 1-130.

[0220] Embodiment 209: A method for the preparation of a medicament for treating a human subject with ATTR. Use of a composition or formulation of any of Forms 6 to 208.

[0221] any of the preceding embodiments for the preparation of a medicament for treating a human subject having ATTR. Use of any of the compositions or formulations is also disclosed. or modifications of the TTR gene (e.g., formation of indels in the TTR gene, if for use in the formation of a mutation (or frameshift or nonsense mutation) Also disclosed are any compositions or formulations that: [Brief explanation of the drawings]

[0222] [Figure 1]FIG. 1 shows a schematic of chromosome 18 with the regions of the TTR gene targeted by the guide sequences provided in Table 1. [Figure 2] Figure 2 shows off-target analysis of certain dual guide RNAs targeting TTR in HEK293_Cas9 cells. For each dual guide RNA tested, on-target sites are indicated by filled boxes, while filled circles represent potential off-target sites. [Figure 3] Figure 3 shows off-target analysis of certain single guide RNAs targeting TTR in HEK_Cas9 cells. For each single guide RNA tested, on-target sites are indicated by filled boxes, while open circles represent potential off-target sites. [Figure 4] Figure 4 shows the dose-response curve of lipid nanoparticle-formulated human TTR-specific sgRNA in primary human hepatocytes. [Figure 5] Figure 5 shows the dose-response curve of lipid nanoparticle-formulated human TTR-specific sgRNA in primary cynomolgus monkey (cyno) hepatocytes. [Figure 6] Figure 6 shows the dose-response curve of lipid nanoparticle-formulated cynomolgus monkey TTR-specific sgRNA in primary cynomolgus monkey hepatocytes. [Figure 7] Figure 7 shows percent editing of TTR (% edit) and reduction in secreted TTR following administration of the guide sequences provided on the x-axis in HUH7 cells. Values ​​are normalized to the amount of alpha-1-antitrypsin (AAT) protein. [Figure 8] FIG. 8 shows Western blot analysis of intracellular TTR following administration of targeted guides (listed in Table 1) in HUH7 cells. [Figure 9] Figure 9 shows the percentage of hepatic editing of TTR observed after administration of LNP formulations to mice harboring humanized (G481-G499) or murine (G282) TTR. Note: The first three "0"s in each guide ID have been omitted from the figure; for example, "G481" is "G000481" in Tables 2 and 3. [Figure 10A]Figures 10A-B show the serum TTR levels observed after the dosing regimen indicated on the horizontal axis as μg / ml (Figure 10A) or percentage of TSS control (Figure 10B). MPK = mg / kg throughout. [Figure 10B] Same as above. [Figure 11A] Figures 11A-B show serum TTR levels observed after the dosing regimens indicated on the horizontal axis for a 1 mg / kg (Figure 11A) or 0.5 mg / kg dose (Figure 11B). Data for a single 2 mg / kg dose are included as the right column in both panels. [Figure 11B] Same as above. [Figure 12A] Figures 12A-B show the percentage of liver editing observed after the dosing regimen indicated on the horizontal axis for a dose of 1 mg / kg (Figure 12A) or 0.5 mg / kg (Figure 12B). Figure 12C shows the percentage of liver editing observed after a single dose at 0.5, 1, or 2 mg / kg. [Figure 12B] Same as above. [Figure 12C] Same as above. [Figure 13] Figure 13 shows the percent liver editing observed after administration of LNP formulations to mice humanized for the TTR gene. Note: The first three "0"s in each guide ID have been omitted from the figure, e.g., "G481" is "G000481" in Tables 2 and 3. [Figure 14A] Figures 14A-B show a correlation between liver editing (Figure 14A) and serum human TTR levels (Figure 14B) after administration of LNP formulations to mice humanized for the TTR gene. Note: The first three "0"s in each guide ID have been omitted from the figure; for example, "G481" is "G000481" in Tables 2 and 3. [Figure 14B] Same as above. [Figure 15A] Figures 15A-B show that there is a dose response in terms of percent editing (Figure 15A) and serum TTR levels (Figure 15B) in wild-type mice following administration of an LNP formulation containing guide G502, which is cross-homologous between mouse and cynomolgus monkey. [Figure 15B] Same as above. [Figure 16] Figure 16 shows the dose-response curve of lipid nanoparticle-formulated human TTR-specific sgRNA in primary cynomolgus monkey hepatocytes. [Figure 17] Figure 17 shows the dose response curve of lipid nanoparticle-formulated cynomolgus monkey TTR-specific sgRNA in primary human hepatocytes. [Figure 18] Figure 18 shows the dose response curve of lipid nanoparticle-formulated cynomolgus TTR-specific sgRNA in primary cynomolgus hepatocytes. [Figure 19A] Figures 19A-D show serum TTR (% of TSS; Figures 19A and 19C) and edited results (Figures 19B and 19D) following administration of LNP formulations at the indicated ratios and amounts. [Figure 19B] Same as above. [Figure 19C] Same as above. [Figure 19D] Same as above. [Figure 20] Figure 20 shows off-target analysis of certain single guide RNAs targeting TTR in primary human hepatocytes (PHH). In the graph, filled squares represent the identification of on-target cleavage sites, and open circles represent the identification of potential off-target sites. [Figure 21A] Figures 21A-B show percent editing at on-target (ONT, Figure 21A) and two off-target sites (OT2 and OT4) in primary human hepatocytes after administration of lipid nanoparticle-formulated G000480. Figure 21B is a rescaled version of the OT2, OT4, and negative control data in Figure 21A. [Figure 21B] Same as above. [Figure 22A] Figures 22A-B show percent editing at on-target (ONT, Figure 22A) and off-target sites (OT4) in primary human hepatocytes after administration of lipid nanoparticle-formulated G000486. Figure 22B is a rescaled version of the OT4 and negative control data in Figure 22A. [Figure 22B] Same as above. [Figure 23A]Figures 23A-B show the percent editing (Figure 23A) and the number of insertion and deletion events (Figure 23B) at the TTR locus. Figure 23A shows the percent editing at the TTR locus in the control and treatment (lipid nanoparticle-formulated TTR-specific sgRNA administered) groups. Figure 23B shows the number of insertion and deletion events at the TTR locus when editing was observed in the treatment group of Figure 23A. [Figure 23B] Same as above. [Figure 24A] Figures 24A-B show TTR levels (µg / mL) in circulating serum (Figure 24A) and cerebrospinal fluid (CSF) (Figure 24B) for the control and treatment (treated with lipid nanoparticle-formulated TTR-specific sgRNA) groups, respectively. Treatment resulted in >99% knockdown of TTR levels in serum. [Figure 24B] Same as above. [Figure 25A] Figures 25A-D show immunohistochemistry images with staining for TTR in the stomach (Figure 25A), colon (Figure 25B), sciatic nerve (Figure 25C), and dorsal root ganglion (DRG) (Figure 25D) from control and treated (administered lipid nanoparticle-formulated TTR-specific sgRNA) mice. The bar graphs on the right show the reduction in TTR staining in treated mice after 8 weeks of treatment, as measured by percent area occupied for each tissue type. [Figure 25B] Same as above. [Figure 25C] Same as above. [Figure 25D] Same as above. [Figure 26A] Figures 26A-C show liver TTR editing (Figure 26A) and serum TTR results (μg / mL (Figure 26B) and percentage of TSS-treated controls (Figure 26C)), respectively, from humanized TTR mice administered a range of doses of LNP formulations containing Cas9 mRNA (SEQ ID NO: 1) at a 1:1 weight ratio to guides, with guides G000480, G000488, G000489, and G000502. [Figure 26B] Same as above. [Figure 26C] Same as above. [Figure 27A]Figures 27A-C show liver TTR editing (Figure 27A) and serum TTR results (μg / mL (Figure 27B) and percentage of TSS-treated controls (Figure 27C)), respectively, from humanized TTR mice administered a range of doses of LNP formulations with guides G000481, G000482, G000486, and G000499 and containing Cas9 mRNA (SEQ ID NO: 1) at a 1:1 weight ratio to the guide. [Figure 27B] Same as above. [Figure 27C] Same as above. [Figure 28A] Figures 28A-C show liver TTR editing (Figure 28A) and serum TTR results (μg / mL (Figure 28B) and percentage of TSS-treated controls (Figure 28C)), respectively, from humanized TTR mice administered a range of doses of LNP formulations containing Cas9 mRNA (SEQ ID NO: 1) with guides G000480, G000481, G000486, G000499, and G000502 at a 1:2 weight ratio to guide. [Figure 28B] Same as above. [Figure 28C] Same as above. [Figure 29] Figure 29 shows the relative expression of TTR mRNA in primary human hepatocytes (PHH) following treatment with LNPs containing Cas9 mRNA and gRNA as indicated compared to negative (untreated) controls. [Figure 30] Figure 30 shows the relative expression of TTR mRNA in primary human hepatocytes (PHHs) following treatment with LNPs containing Cas9 mRNA and gRNA as indicated compared to negative (untreated) controls. DETAILED DESCRIPTION OF THE INVENTION

[0223] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. Although the invention will be described in conjunction with the illustrated embodiments, they are not intended to limit the invention to those implementations. It will be understood that the present invention is not intended to be limited to the embodiments described herein. All alternatives, modifications, and equivalents that may be included within the invention as defined by the claims. is intended to cover.

[0224] Before describing the present teachings in detail, it is understood that the disclosure is not limited to particular compositions or method steps. It should be understood that the scope of the present specification and the appended claims may vary. When used in conjunction with a single word, the singular forms "a," "an," and "the" are used where the context is clear. It should be noted that unless otherwise specified, "a" includes plural references. Thus, for example, a reference to "a conjugate" is a plural includes conjugates, a reference to "a cell" includes a plurality of cells, etc. be.

[0225] Numerical ranges include the numbers that define the range. Measurements and measurables are associated with measurements. It is understood that these figures are approximate and take into account significant digits and errors. "comprise", "comprises", "contains" containing, "contain", "contain s), "containing", "include", "comprise" The use of "includes" and "including" is exclusive It is not intended that both the foregoing general description and the detailed description be considered exemplary and explanatory only. It should be understood that this is not intended to be limiting of the teachings.

[0226] Unless otherwise stated in the above definition, the present invention may be described as "comprising" various ingredients. The embodiments herein may also be those that "consist" or "consist essentially of" the listed components. and embodiments herein that describe "consisting of" various components are also envisioned as It is envisioned as "comprising" or "consisting essentially of" the listed ingredients, and various Embodiments herein that describe "consisting essentially of" certain components also include those components described. It is contemplated that the composition "consists of" or "includes" the component (this interchangeability is (This does not apply to the use of these terms in the claims.) The term "or" is used in an inclusive sense, i.e., unless the context clearly indicates otherwise. , which is equivalent to "and / or."

[0227] The section headings used herein are for organizational purposes only. , should not be construed as limiting the desired subject matter in any way. Any material incorporated herein by any term or term defined herein shall not be construed as a substitute for the In the event of a conflict with any other statement in the specification, the present specification will control. Although described in conjunction with embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings are intended to embrace various alternatives, modifications, and variations therein, as will be appreciated by those skilled in the art. and equivalents.

[0228] I. Definition Unless otherwise stated, the following terms and phrases are used herein: It is intended to have meaning.

[0229] "Polynucleotide" and "nucleic acid" refer to a group of nucleic acids consisting of nitrogen-containing heterocyclic bases or heterocyclic bases linked along a backbone. Multimers containing nucleosides or nucleoside analogs with base analogs Used herein to refer to compounds, including conventional RNA, DNA, and RNA-DNA mixtures. The nucleic acid "backbone" is a sugar-phosphorylated Diester bonds, peptide-nucleic acid bonds ("peptide nucleic acids" or PNA; PCT Publication No. WO9 No. 5 / 32305), phosphorothioate linkage, methylphosphonate linkage, or The sugar moiety of the nucleic acid may be composed of various linkages, such as one or more of the following combinations: may be ribose, deoxyribose, or substituted, for example, 2' methoxy or 2' halo The nitrogenous bases can be any of the common bases (A, G, C, , T, U), their analogs (e.g., modified uridines, e.g., 5-methoxyuridine , pseudouridine, or N1-methylpseudouridine, or other); wild boar purine or pyrimidine derivatives (e.g., N 4 -Methyldeoxyguanosine, Dea aza or azapurines, deaza or azapyrimidines, pyrimidines with a substituent at the 5th or 6th position, Propionyl cytosine bases (e.g., 5-methylcytosine), propionyl cytosine bases with substituents at the 2, 6, or 8 positions Phosphorus base, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio- pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 -Alkyl-pyrimidines; U.S. Pat. No. 5,378,825 and PCT WO9 For a general discussion, see The Biochemistry of the Nucleic Acids 5-36, Adams et al. , ed., 11th ed., 1992. Nucleic acids are polymers in which the backbone is It may contain one or more "abasic" residues that do not contain nitrogenous bases (US (Patent No. 5,585,481) Nucleic acids are composed of sugars and bases of ordinary RNA or DNA. and linkages only, or may contain both regular components and substitutions. (e.g., a normal base with a 2' methoxy linkage, or a normal base and one or polymers containing multiple base analogs). Nucleic acids are "locked nucleic acids" (LNAs). , which enhances hybridization affinity to complementary RNA and DNA sequences , one or more bicyclic furanose units locked into RNA that mimic the sugar structure. Analogs containing several LNA nucleotide monomers (Vester and We ngel, 2004, Biochemistry 43(42):13233-41 RNA and DNA have different sugar moieties, uracil in RNA or its analogue. It may vary depending on the presence of thymine or its analogs in the log and DNA.

[0230] "Guide RNA," "gRNA," and "guide" refer to the CRISPR RNA), or a combination of crRNA and trRNA (tracrRNA and These terms are used interchangeably herein to refer to either the crRN or the CRRN. A and trRNA are expressed as a single RNA molecule (single guide RNA, sgRNA). or as two separate RNA molecules (dual guide RNA, dgRNA). The terms "guide RNA" or "gRNA" refer to each type. or a trR having a modification or variation compared to the naturally occurring sequence. It may also be an NA sequence.

[0231] As used herein, a "guide sequence" is a sequence that is complementary to a target sequence and , a guide RNA for binding or modification (e.g., cleavage) by an RNA-guided DNA binding agent. The "guide sequence" refers to a sequence within the guide RNA that serves to direct A to the target sequence. " may also be referred to as a "targeting sequence" or a "spacer sequence." For example, Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs, a 20 base pair Shorter or longer sequences can also be used as guides, The sequence may be, for example, 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length. For example, in some embodiments, the guide sequence is SEQ ID NO:5 At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from In some embodiments, the target sequence is, for example, in a gene or on a chromosome. In some embodiments, the guide sequence and its corresponding target sequence The degree of complementarity or identity between the sequences is about 75%, 80%, 85%, 88%, 90%, It may be 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the guide sequence is at least one of a sequence selected from SEQ ID NOs: 5-82. 17, 18, 19, or 20 consecutive nucleotides and approximately 75%, 80%, 85%, 8 8%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity In some embodiments, the guide sequence and the target region are 100% complementary. In other embodiments, the guide sequence and target region may be: The guide sequence and the target sequence may contain at least one mismatch. For example, The target sequence may contain 1, 2, 3, or 4 mismatches, and the total length of the target sequence is at least In some embodiments, the guide sequence is 17, 18, 19, 20 or more base pairs. The sequence and target region may contain 1 to 4 mismatches, and the guide sequence must be at least In some embodiments, the sequence comprises 17, 18, 19, 20 or more nucleotides. The guide sequence and the target region may contain 1, 2, 3, or 4 mismatches; The guide sequence contains 20 nucleotides.

[0232] The target sequence of Cas protein is a double-stranded nucleic acid. Therefore, both the positive and negative strands of genomic DNA (i.e., a given sequence and the reverse of that sequence) Therefore, a guide sequence is described as being "complementary to a target sequence." When used in a target sequence, the guide sequence directs the guide RNA to bind to the reverse complement of the target sequence. It should be understood that in some embodiments, the guide sequence may be When binding to the reverse complement of a target sequence, the guide sequence is regulated by U for T in the guide sequence. A specific nucleotide in the target sequence (e.g., a target sequence without a PAM) is deleted except for the substitution. It is the same as

[0233] As used herein, an "RNA-guided DNA binder" refers to a compound that binds RNA and DNA. A polypeptide or a complex of polypeptides having NA-binding activity, or such a complex It is a DNA-binding subunit of the ribosomal ATPase, and its DNA-binding activity is sequence-specific and dependent on the RNA sequence. Exemplary RNA-guided DNA binding agents include the Cas cleavage enzyme. Examples include dCas / nickases and their inactivated forms ("dCas DNA binders"). "Cas nuclease," also referred to as "Cas protein," is used herein. When used, it contains Cas cleavage, Cas nickase, and dCas DNA binder. Cas cleavase / nickases and dCas DNA binders include type III Csm or Cmr complex of the CRISPR system, its Cas10, Csm1, or Cmr2 subunit, Cascade complex of type I CRISPR system, and its Cas3 subunit subunits, and class 2 Cas nucleases. When engineered, "Class 2 Cas nucleases" possess RNA-guided DNA-binding activity. A single-chain polypeptide, such as a Cas9 nuclease or a Cpf1 nuclease, Class 2 Cas nucleases include RNA-guided DNA cleavage or Class 2 Caspase and Class 2 Caspase with additional casein activity Ze (e.g., H840A, D10A, or N863A variants), and cribasis / nickel Class 2 dCas DNA binders with inactivated dCasase activity are also included. Examples of Cas nucleases include Cas9, Cpf1, C2c1, C2c2, and C 2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A mutations) species), HypaCas9 (e.g., N692A, M694A, Q695A, H698A mutations), species), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A mutations) species), and eSPCas9(1.1) (e.g., K848A, K1003A, R106 0A variant) proteins and modifications thereof. Zetsche et al. ,Cell,163:1-13(2015) Cpf1 protein is homologous to Cas9 It contains a RuvC-like nuclease domain. The Cpf1 sequence of Zetsche is shown in reference See, e.g., Zetsche, Tables S1 and S3. See "Cas9" for a variant of Cas9 listed herein, SpyCa s9, and equivalents thereof. See, e.g., Makarova et al., Nat Rev Microbiol,13(11):722-36 (2015);Shma kov et al.,Molecular Cell,60:385-397(201 See 5).

[0234] "Modified uridine" refers to a compound that has the same hydrogen bond acceptor as uridine and has one or more hydrogen bond residues from uridine. The term "thymidine" is used herein to refer to nucleosides other than thymidine that have one or more structural variations. In some embodiments, the modified uridine is a substituted uridine, i.e., one or more is a group in which multiple aprotic substituents (e.g., alkoxy, e.g., methoxy) replace the protons. In some embodiments, the modified uridine is a pseudouridine. In this embodiment, the modified uridine is a substituted pseudouridine, i.e., a uridine having one or more non- Pseudourinium, where a proton substituent (e.g., alkyl, e.g., methyl) replaces the proton In some embodiments, the modified uridine is a substituted uridine, a pseudouridine, or a substituted pseudouridine.

[0235] As used herein, a "uridine position" refers to a position that is occupied by a uridine or modified uridine. Thus, for example, "a uridine position 1" refers to a position in a polynucleotide that is occupied. A polynucleotide that is 100% modified uridines is a polynucleotide that is identical to a normal RNA (all salts) of the same sequence. Any position where the base is a uridine in Unless otherwise indicated, the or in the polynucleotide sequences of the sequence listing accompanying this disclosure, U represents uridine or modified It may be a decorated uridine.

[0236] As used herein, alignment of a first sequence to a second sequence refers to: Indicates that X% or more of the positions in the second sequence match the first sequence and the first sequence "contains a sequence having at least X% identity" to the second sequence. For example, the sequence AAGA has 100% identity to the sequence AAG. because it matches all three positions of the second sequence. This is because the difference between RNA and DNA (generally the difference between thymidine and The presence of nucleoside analogs such as uridine (replacement by uridine or vice versa) and modified uridines The presence of related nucleotides (e.g., thymidine, uridine, or modified uridine) As long as they have the same complement (e.g., thymidine, uridine, or modified uridine), another example is cytosine and 5-methylcytosine, both of which are complementary guanosine or modified guanosine as the base), Thus, for example, the sequence 5'-AXG (where X is any Modified uridines, such as pseudouridine, N1-methylpseudouridine, or 5- methoxyuridine) is considered 100% identical to AUG, which means that both This is because it is perfectly complementary to the same sequence (5'-CAU). The rhythm is based on the Smith-Waterman algorithm and the Needleman-Wun sch algorithms, which are well known in the art. The rhythm selection and parameter settings are Those skilled in the art will understand that suitable sequences will generally have similar lengths and be >50% or less in amino acids. For sequences with a predicted identity of >75% for any nucleotide, see www. Needleman provided by EBI on the ebi.ac.uk web server - Needlem with default settings for the Wunsch algorithm interface The an-Wunsch algorithm is generally suitable.

[0237] "mRNA" can be translated into a polypeptide (i.e., by ribosomes and amino acids). open reading frame that can serve as a substrate for translation by acylated tRNA Used herein to refer to a non-DNA polynucleotide containing a frame mRNA contains ribose residues or their analogs, e.g., 2'-methoxyribose residues. In some embodiments, the mRNA phosphate sugar backbone may comprise a phosphate sugar backbone comprising a group. The sugars consist essentially of ribose residues, 2'-methoxyribose residues, or a combination of these. Generally, mRNA does not contain substantial amounts of thymidine residues (e.g., 0 residues). or less than 30, 20, 10, 5, 4, 3, or 2 thymidine residues; or 10 %, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2 % or less than 0.1% thymidine content). mRNA contains or all may contain modified uridines.

[0238] As used herein, the term "sequence number" refers to the sequence of a given open reading frame (ORF). "Minimum uridine content" means (a) using minimal uridine codons at all positions; and (b) the uridine content of an ORF that encodes the same amino acid sequence as the given ORF. The minimal uridine codon(s) for a given amino acid are the least abundant uridine codon(s). Lysine (usually the minimum uridine codon for phenylalanine is two uridines) A codon (or codons) with 0 or 1 except for the codons The amino acid residue is considered equivalent to uridine for the purpose of assessing the minimum uridine content. do.

[0239] As used herein, the term "sequence number" refers to the sequence of a given open reading frame (ORF). "Minimum uridine dinucleotide content" means (a) at any position (as discussed above) (b) use minimal uridine codons (such as The lowest possible uridine dinucleotide (UU) content of the ORF encoding the uridine dinucleotide. The dinucleotide (UU) content is expressed as the absolute number of UU dinucleotides in the ORF. The percentage of positions occupied by uridine in the definition or in the uridine dinucleotide ratio as an index (e.g., AUUAU indicates that two of the five positions are uridine dinucleotides). (It has a uridine dinucleotide content of 40% because it is occupied by uridine of the The modified uridine residue can be expressed based on the minimum uridine dinucleotide content. For purposes of assessing quantity, it is considered equivalent to uridine.

[0240] As used herein, "TTR" refers to TTR, the gene product of the TTR gene. Refers to transthyretin.

[0241] As used herein, "amyloid" refers to a protein or protein complex that is normally soluble. Amyloid refers to abnormal aggregates of proteins or peptides. Amyloid is insoluble and accumulates in organs and Proteins or peptides in amyloid can form in the blood and tissues. is a form that allows many copies of a protein to attach to each other to form fibrils Some forms of amyloid can misfold and function normally in the human body. As used herein, "amyloid" refers to an abnormal or Amyloid refers to a pathological aggregate formed by a single protein or peptide, such as TTR. or may contain multiple proteins or peptides, such as TTR and an additional protein. The compound may contain peptides.

[0242] As used herein, "amyloid fibrils" refer to amyloid that is resistant to degradation. Amyloid fibrils are insoluble fibers of certain proteins or peptides, as well as It can cause symptoms based on the type of tissue and cell it aggregates with.

[0243] As used herein, "amyloidosis" refers to amyloid or amyloidosis. It refers to a disease characterized by symptoms caused by the deposition of amyloid fibrils. Dorsia affects the heart, kidneys, liver, spleen, nervous system, and digestive tract. It can affect multiple organs, including the rectum.

[0244] As used herein, "ATTR," "TTR-related amyloidosis," "TTR amyloidosis," "ATTR amyloidosis," or "TTR-associated amyloidosis" "Amyloidosis associated with TTR deposition" refers to amyloidosis associated with TTR deposition. .

[0245] As used herein, "familial amyloidotic cardiomyopathy" or "FAC" refers to: Hereditary transthyretin amyloidosis (A) is primarily characterized by restrictive cardiomyopathy. Congestive heart failure is common in FAC. The average age of onset is approximately 60. ~70 years of age, with an estimated life expectancy of 4-5 years after diagnosis.

[0246] As used herein, "familial amyloid polyneuropathy" or " FAP is a hereditary transthyretinopathy characterized primarily by sensorimotor neuropathy. Autonomic neuropathy is common in FAP. Although neuropathy is the primary feature, symptoms of FAP also include cachexia, FAP is a condition characterized by a variety of symptoms, including kidney failure and heart disease. The average age at onset is about 30-50 years. The average life expectancy after diagnosis is estimated at 5 to 15 years.

[0247] As used herein, "wild-type ATTR" and "ATTRwt" refer to Common TTR mutations, e.g., T60A, V30M, V30A, V30G, V30L, V Refers to ATTR that is not associated with 122I, V122A, or V122(-). TRwt has also been called senile systemic amyloidosis. Onset is typically: It occurs in men aged 60 or older, and the most common symptom is congestive heart failure. Symptoms include: sudden and abnormal heart rhythms, e.g., atrial fibrillation. Positive consequences, such as shortness of breath, fatigue, dizziness, swelling (especially in the legs), nausea, angina, Symptoms include sleep disturbances and weight loss. A history of carpal tunnel syndrome is a risk factor for ATTRwt. ATTRwt indicates an increase in ATTR and in some cases may be an indicator of early disease. This leads to a time-dependent decline in cardiac function, whereas wild-type TTR deposits accumulate more slowly. It may have a better prognosis than hereditary ATTR. Existing treatments are similar to other forms of ATTR. (other than liver transplantation), and generally targeting support or improvement of cardiac function, diuretics and limited fluid and salt intake, to anticoagulants, and in severe cases, heart transplants. Nevertheless, like FAC, ATTRwt may be 3-5 times more diagnostically accurate. Within a year, death from heart failure can result.

[0248] Guide sequences useful in the guide RNA compositions and methods described herein are listed in Table 1. and throughout this application.

[0249] As used herein, "inherited ATTR" refers to a mutation in the sequence of the TTR gene. This refers to the ATTR gene associated with a natural mutation. The mutations are T60A, V30M, V30A, V30G, V30L, and V122. resulting in TTR with substitutions of I, V122A, or V122(-) Examples include:

[0250] As used herein, an "indel" refers to a double-strand break (DSB) in a target nucleic acid. ) insertion / deletion mutation consisting of a certain number of nucleotides inserted or deleted at the site To point out something different.

[0251] As used herein, "knockdown" refers to the reduction of a particular gene product (e.g., Protein knockdown refers to a decrease in expression of a protein, mRNA, or both. , proteins secreted by a tissue or population of cells (e.g., in serum or cell culture medium) by detecting proteins or by detecting total cellular fractions of proteins from tissues or cell populations of interest. It can be measured by detecting the amount of cells. Methods are known and involve sequencing mRNA isolated from tissues or cell populations of interest. In some embodiments, "knockdown" refers to the partial reduction of expression of a particular gene product. loss of a part, e.g., a population of cells (e.g., in vivo, such as those found in tissues) a decrease in the amount of mRNA transcribed by the It can refer to a decrease.

[0252] As used herein, "knockout" refers to the deletion of a particular protein in a cell. Knockout refers to the loss of expression in a tissue or population of cells (e.g., serum or cellular by detecting the amount of protein secreted from the cell culture medium or from tissues or cells The total cellular amount of the protein in the population can be measured by detecting the total cellular amount of the protein. In some embodiments, the disclosed methods involve the use of one or more cells (e.g., those found in a tissue). "Knock out" TTR in a population of cells (e.g., a population of cells in vivo). In embodiments, the knockout is a mutant TTR gene, e.g., created by an indel. It is not the formation of a protein, but rather the complete loss of expression of the TTR protein in the cell.

[0253] As used herein, a "mutant TTR" refers to a mutant TTR that has the wild-type amino acid sequence of TTR. The TTR gene product (i.e., the nucleotide sequence of ... The human wild-type TTR sequence is located in NCBI Gene ID: 727 6;Available at Ensembl:Ensembl:ENSG00000118271 For example, in humans, the mutant form of TTR associated with ATTR is For T60A, V30M, V30A, V30G, V30L, V122I, V122A, Or V122(-).

[0254] As used herein, "mutant TTR" or "mutant TTR antigen" refers to a TTR antigen. "Allele" refers to the wild-type sequence (NCBI gene ID: 7276; Ensembl: ENSG00 TTR with changes in the nucleotide sequence of TTR compared to TTR (000118271) Points to an array.

[0255] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a The "coalescence" refers to a Cas nuclease, e.g., a Cas cleavase, a Cas nickase, or together with an RNA-guided DNA binding agent, such as a dCas DNA binding agent (e.g., Cas9). In some embodiments, the guide RNA refers to an RNA guide RNA, such as Cas9. The guide RNA guides the DNA binding agent to the target sequence, and the guide RNA hybridizes with the target sequence; The agent binds to the target sequence and, if the agent is a cleavase or nickase, is cleaved after binding. Or nicking may occur.

[0256] As used herein, a "target sequence" refers to a sequence that is relative to the guide sequence of a gRNA. The interaction of a target sequence and a guide sequence is referred to as a sequence of nucleic acid in a target gene that has complementarity. , the RNA-guided DNA binder binds within the target sequence and optionally nicks or cleaves ( The instruction is to carry out the following (depending on the activity of the agent).

[0257] As used herein, "treatment" refers to the treatment of a disease or disorder in a subject. Refers to any administration or application of a therapeutic agent that inhibits a disease, prevents its onset, or reduces the effectiveness of one or more of the diseases. is intended to alleviate multiple symptoms, cure a disease, or prevent the recurrence of one or more symptoms of a disease. For example, treating ATTR can include alleviating the symptoms of ATTR.

[0258] "Modified uridine" refers to a compound that has the same hydrogen bond acceptor as uridine and has one or more hydrogen bond residues from uridine. The term "thymidine" is used herein to refer to nucleosides other than thymidine that have one or more structural variations. In some embodiments, the modified uridine is a substituted uridine, i.e., one or more is a group in which multiple aprotic substituents (e.g., alkoxy, e.g., methoxy) replace the protons. In some embodiments, the modified uridine is a pseudouridine. In this embodiment, the modified uridine is a substituted pseudouridine, i.e., a uridine having one or more non- Pseudourinium, where a proton substituent (e.g., alkyl, e.g., methyl) replaces the proton In some embodiments, the modified uridine is a uridine such as N1-methylpseudouridine. The amine is either a substituted uridine, a pseudouridine, or a substituted pseudouridine. .

[0259] As used herein, alignment of a first sequence to a second sequence refers to: Indicates that X% or more of the positions in the second sequence match the first sequence and the first sequence "contains a sequence having at least X% identity" to the second sequence. For example, the sequence AAGA has 100% identity to the sequence AAG. because it matches all three positions of the second sequence. This is because the difference between RNA and DNA (generally the difference between thymidine and The presence of nucleoside analogs such as uridine (replacement by uridine or vice versa) and modified uridines The presence of related nucleotides (e.g., thymidine, uridine, or modified uridine) As long as they have the same complement (e.g., thymidine, uridine, or modified uridine), another example is cytosine and 5-methylcytosine, both of which are complementary guanosine as the base), depending on the identity or complementarity differences between polynucleotides. Thus, for example, the sequence 5'-AXG (where X is any modified uridine, e.g. , pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine ) is considered 100% identical to AUG, because both have the same sequence (5'-CAU ) is perfectly complementary to the sequence of the sequence of the nucleotides in the sequence. Waterman and Needleman-Wunsch algorithms These are well known in the art. Those skilled in the art will appreciate that the parameter settings are appropriate for a given pair of sequences to be aligned. understand, generally have similar lengths and are >50% identical for amino acids or >50% identical for nucleotides For sequences with a predicted identity of >75% to the The Needleman-Wunsch algorithm provided by EBI on the web server Needleman-Wunsch app with default settings for rhythm interface The algorithm is generally appropriate.

[0260] The terms "about" or "approximately" mean a value The specific values ​​as determined by one of ordinary skill in the art will depend in part on the method by which the value is measured or determined. This means the allowable error in the

[0261] II. Composition A. Compositions Comprising Guide RNA (gRNA) For example, guide RNAs can be coupled to RNA-guided DNA binding agents (e.g., CRISPR / Cas systems). Compositions useful for editing the TTR gene, used in conjunction with a TTR gene stem, are described herein. The compositions are provided for use in subjects having wild-type or non-wild-type TTR gene sequences, e.g. ATTR, which may be ATTRwt, or a hereditary or familial form of ATTR. The guide sequence targeting the TTR gene may be administered to a subject. ~82 shown. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]

[0262] Each of the above guide sequences may further comprise additional nucleotides to form, e.g., a guide The sequence is followed at its 3' end by the following exemplary nucleotide sequence: GUUUUAG A crRNA containing AGCUAUGCUGUUUUG (SEQ ID NO: 126) may be generated. In the case of sgRNA, the guide sequence described above can be further enhanced by including additional nucleotides. For example, the 3' end of the guide sequence is followed in a 5' to 3' direction by the following exemplary nucleic acid: Nucleotide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAA GGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG An sgRNA may be formed that contains GUGCUUUU (SEQ ID NO: 125).

[0263] In some embodiments, the sgRNA is modified. contains the modification pattern shown in SEQ ID NO:3 below, where N is any natural or non-natural nucleotide. and N comprises a guide sequence as described herein in its entirety, or The modified sgRNA has the following sequence: mN*mN*mN*NNNNNNNNNNNNNNN NNGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUA AAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmA mAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU *mU*mU*mU (SEQ ID NO: 3), where "N" is any natural or unnatural nucleoside. For example, in SEQ ID NO: 3, N may be a nucleotide as disclosed herein. Any guide sequence substitution is encompassed herein. Although N is replaced by N, the modification remains as shown in SEQ ID NO:3. That is, the guide nucleotide replaces the "N", but the first three nucleotides are 2 'OMe modified and between the first and second nucleotides, 2 Between the 3rd and 4th nucleotides and between the 3rd and 4th nucleotides There are phosphorothioate linkages between the nucleotides.

[0264] In some embodiments, any one of the sequences set forth in Table 2 is included. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]

[0265] Besides the alignment mapping of guide IDs with corresponding sgRNA IDs, The homology to the macaque genome and the matched guide ID for cynomolgus macaques are provided in Table 3 . [Table 3-1] [Table 3-2]

[0266] In some embodiments, the present invention provides a method for producing a nuclease (e.g., a Cas nuclease, e.g., The RNA-guided DNA binding agent, which may be Cas9, is directed to the target DNA sequence in TTR. The present invention provides a composition comprising one or more guide RNAs (gRNAs) containing a guide sequence comprising: The gRNA may comprise a crRNA containing a guide sequence as shown in Table 1. 1. A cr containing 17, 18, 19, or 20 consecutive nucleotides of the guide sequence shown in In some embodiments, the gRNA may comprise at least one of the guide sequences shown in Table 1. Approximately 75%, 80% for at least 17, 18, 19, or 20 consecutive nucleotides , 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity In some embodiments, the gRNA comprises a crRNA comprising a sequence having the sequence shown in Table 1. Approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, and 98% for the id sequence , 99%, or 100% identity. Each of the composition and method embodiments described herein may further comprise rRNA. Although crRNA and trRNA may associate as a single RNA (sgRNA), or on a separate RNA (dgRNA). The crRNA and trRNA components may be linked together by, for example, a phosphodiester bond or other covalent bond. They may be linked by a covalent bond via a bond.

[0267] In each embodiment of the compositions, uses, and methods described herein, the guide RNA is May contain two RNA molecules as a "dual guide RNA" or "dgRNA" The dgRNA is, for example, a first RNA fragment containing a crRNA containing a guide sequence shown in Table 1. The first and second RNA molecules contain a first RNA molecule, a second RNA molecule containing a trRNA, and a second RNA molecule containing a trRNA. The bases between the crRNA and trRNA portions may not be linked by a bond. It may form an RNA duplex through pairing.

[0268] In each embodiment of the compositions, uses, and methods described herein, the guide RNA is May contain a single RNA molecule as a "single guide RNA" or "sgRNA" The sgRNA contains a guide sequence, shown in Table 1, covalently linked to a trRNA. The sgRNA may comprise one of the guide sequences shown in Table 1. It may comprise 7, 18, 19, or 20 contiguous nucleotides. In this example, the crRNA and trRNA are covalently linked via a linker. In some embodiments, the sgRNA comprises a nucleic acid sequence that encodes ... In some embodiments, the crRNA and trRN form a stem-loop structure via A is covalently linked via one or more bonds that are not phosphodiester bonds It has been done.

[0269] In some embodiments, the trRNA is a CRISPR / Cas gene that is encoded by a naturally occurring CRISPR / Cas system. In some embodiments, the trRNA sequence may comprise the entire or a portion of the trRNA sequence from which it is derived. The trRNAs include truncated or modified wild-type trRNAs. In some embodiments, the trRNA is a CRISPR / Cas system. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 , 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 In some embodiments, the trRNA comprises or consists of a specific dinucleotide. secondary structure, e.g., one or more hairpin or stem-loop structures, or Alternatively, it may include a plurality of bulge structures.

[0270] In some embodiments, the present invention provides a method for the preparation of a nucleic acid sequence comprising a guide sequence of any one of SEQ ID NOs: 5 to 82. The present invention provides compositions comprising one or more guide RNAs comprising:

[0271] In one aspect, the present invention relates to a method for identifying a nucleic acid having at least 99%, 99%, or 99% identity with any of the nucleic acids of SEQ ID NOs: 5 to 82. 8%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical Compositions are provided that include a gRNA that includes a guide sequence.

[0272] In other embodiments, the composition comprises any two or more of the guide sequences of SEQ ID NOs: 5-82. at least one, e.g., at least two, containing a guide sequence selected from In some embodiments, the composition comprises a gRNA. and at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91 %, or at least two gRNAs each containing 90% identical guide sequences.

[0273] In some embodiments, the gRNA has any of the sequences shown in Table 2 (SEQ ID NOs: 87-124). In some embodiments, the gRNA is an sgRNA comprising one of the sequences shown in Table 2 (SEQ ID NO: 1). Sequence numbers 87 to 124, but do not have the modifications shown (i.e., unmodified SEQ ID NO: 87 to 124). A is a nucleic acid having at least 99%, 98%, 97%, or 99% affinity to any of the nucleic acids of SEQ ID NOs: 87 to 124. Contains sequences that are 6%, 95%, 94%, 93%, 92%, 91%, or 90% identical. In this embodiment, the sgRNA has at least 9 copies of any of the nucleic acids of SEQ ID NOs: 87-124. 9%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90 % identical to the sequences without the modifications as shown (i.e., unmodified SEQ ID NOs: 87-1 24). In some embodiments, the sgRNA comprises a sequence of Table 2, with or without modifications. Instead of the guide sequences shown in Table 1, use the guide sequences shown in Table 1 for sgRNA sequences 87 to 124. It contains one of the following code sequences:

[0274] The guide RNA compositions of the present invention recognize a target sequence in the TTR gene (e.g., For example, the TTR target sequence is designed to hybridize to the guide RNA. In some embodiments, the cleavage may be performed by a provided Cas gene. In this study, RNA-guided DNA binding agents such as Caspase cleavage mediate the transcription of TTR by guide RNA. The guide RNA may be directed to a target sequence of a gene, and the guide sequence of the guide RNA may hybridize with the target sequence. The RNA-guided DNA binder, such as Caspase, cleaves the target sequence. .

[0275] In some embodiments, the selection of one or more guide RNAs comprises targeting a target within the TTR gene. It is determined based on the sequence.

[0276] Without being bound by any particular theory, mutations in certain regions of the gene heterogeneity (e.g., resulting from indels that occur as a result of nuclease-mediated DSBs) frameshift mutations) are less tolerated than mutations in other regions of the gene. Because DSBs can be permissive, the location of the DSB can influence the protein knockdown that may occur. In some embodiments, the amount or type of specific To direct the RNA-guided DNA binding agent to the target position, In some embodiments, a gRNA is used that is complementary to the TTR gene. complementary to a target sequence in exon 1, exon 2, exon 3, or exon 4 of Alternatively, the nucleic acid sequence may be designed to have a complementary guide sequence.

[0277] In some embodiments, the guide sequence is at least as similar to the target sequence present in the human TTR gene. 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, and In some embodiments, the target sequence is 90% identical to the guide sequence of the guide RNA. In some embodiments, the guide sequence of a guide RNA and its corresponding target The degree of complementarity or identity with the target sequence is at least 80%, 85%, 90%, 95%, It may be 96%, 97%, 98%, 99%, or 100%. , the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or or 4 mismatches, for a total length of 20. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1 to 4 mismatches. The guide sequence is 20 nucleotides.

[0278] In some embodiments, the compositions or formulations disclosed herein are The RNA-guided DNA binding agent, such as a Cas nuclease, is encoded by an RNA-guided DNA binding agent. In some embodiments, the mRNA comprises an open reading frame (ORF). mRNAs containing ORFs encoding RNA-guided DNA binders such as nucleases have been proposed. To be offered, used, or administered.

[0279] In some embodiments, the RNA-guided DNA binding agent is a class 2 Cas nuclease. In some embodiments, the RNA-guided DNA-binding agent has double-stranded endonuclease activity. In some embodiments, RNA-guided DNA binding has cleavage activity, which may also be referred to as cleavage activity. The agent inhibits class 2 Cas nucleases (e.g., type II, type V, or type VI Cas nucleases). Class 2 Cas nucleases include Cas nucleases such as Cas nucleases (which may be nucleases). Examples of enzymes include Cas9, Cpf1, C2c1, C2c2, and C2c3. Examples of Cas9 nucleases include those from S. S. pyogenes, S. aureus, and other prokaryotes (e.g., Cas9 nucleases in type II CRISPR systems (see list in next paragraph for examples) , as well as modified (e.g., engineered or mutant) forms thereof. For example, U See S2016 / 0312198 A1; US ​​2016 / 0312199 A1. C Other examples of as nucleases include Csm or C in type III CRISPR systems. the mr complex or its Cas10, Csm1, or Cmr2 subunit; and I The Cascade complex of the CRISPR system or its Cas3 subunit are examples of In some embodiments, the Cas nuclease is type IIA, type IIB, or type IIC. These may be from various CRISPR systems and Cas nuclei. For a discussion of ase, see, for example, Makarova et al., NAT.REV.M ICROBIOL.9:467-477(2011);Makarova et al. ,NAT.REV.MICROBIOL,13:722-36(2015);Shmak ov et al., MOLECULAR CELL,60:385-397(2015 ).

[0280] Non-limiting exemplary species from which Cas nucleases can be derived include Streptococcus Streptococcus pyogenes, Streptococcus thermophilus Streptococcus thermophilus, Streptococcus sp., Staphylococcus Staphylococcus aureus, Listeria innocua a innocua), Lactobacillus gasseri, Francisella novi Fern (Francisella novicida), Wolinella succinogenes ), Sutterella wadsworthensis, Gammaproteobacterium Gammaproteobacterium, Neisseria meningitidis idis), Campylobacter jejuni, Pasteurella mult Fern (Pasteurella multocida), Fibrobacter succinogenes (Fibrobacter suc cinogene), Rhodospirillum rubrum, Nocardiopsis Nocardiopsis dassonvillei, Streptomyces pristinaspira Squirrel (Streptomyces pristinaespiralis), Streptomyces viridochromogenes (St reptomyces viridochromogenes, Streptomyces viridochromogenes (Streptomyc es viridochromogenes), Streptosporangium roseum (Streptosporangium ro seum), Streptosporangium roseum, Alisik Alicyclobacillus acidocaldarius, Bacillus Bacillus pseudomycoides, Bacillus selenitireducens illus selenitireducens), Exiguobacterium sibiricum biricum), Lactobacillus delbrueckii, Lactobacillus Bacillus salivarius (Lactobacillus salivarius), Lactobacillus buchneri (La ctobacillus buchneri, Treponema denticola, Microorganisms Microscilla marina, a Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa ginosa), Synechococcus sp., Acetohalobium arabatica Acetohalobium arabaticum, Ammonifex degens ii), Caldicelulosiruptor becscii, Candida Candidatus Desulforudis, Clostridium botulinum Clostridium botulinum, Clostridium difficile le), Finegoldia magna, Natlanaerobius thermoph Natranaerobius thermophilus, Pelotomaculum thermopropionicum otomaculum thermopropionicum), Acidithiobacillus caldus s caldus), Acidithiobacillus ferrooxidans dans), Allochromatium vinosum, Marinobacter spp. (Marinobacter sp.), Nitrosococcus halophilus , Nitrosococcus watsoni, Pseudoalteromonas Haloplanktis (Pseudoalteromonas haloplanktis), Ctedonobacter racemosa fer (Ktedonobacter racemifer), Methanohalobium ebestigatum (Methanoha lobium evestigatum), Anabaena variabilis, Nodulari Nodularia spumigena, Nostoc sp., Arthrospi Arthrospira maxima, Arthrospira platensis atensis, Arthrospira sp., Lyngbya sp. , Microcoleus chthonoplastes, Oscillatoria sp. Fungus (Oscillatoria sp.), Petrotoga mobilis, Thermosipho africanus (Thermosipho africanus), Streptococcus pasteurianus (Str eptococcus pasteurianus, Neisseria cinerea, Campylobacter Campylobacter lari, Parvibacter lavamentivorans aculum lavamentivorans, Corynebacterium diphtheriae eria), Acidaminococcus sp., Lachnospiraceae hnospiraceae bacterium ND2006, and Acaryochloris marina rina) is an example.

[0281] In some embodiments, the Cas nuclease is selected from the group consisting of Streptococcus pyogenes (Stre In some embodiments, the Cas9 nuclease is a Cas9 nuclease from Proteus pyogenes. C clease of Streptococcus thermophilus In some embodiments, the Cas nuclease is a Neisseria as9 nuclease. Cas9 nuclease from Neisseria meningitidis. In its morphology, Cas nucleases are found in Staphylococcus aureus ( In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptomyces ureus. Cpf1 nuclease from Francisella novicida. In one embodiment, the Cas nuclease is derived from Acidaminococcus In some embodiments, the Cas nuclease is a Cpf1 nuclease from La Cpf1 nuclease of the Lachnospiraceae bacterium ND2006 In a further embodiment, the Cas nuclease is derived from Francisella tularensis (Francisella sella tularensis, Lachnospiraceae bacteria, Butyrivibrio Butyrivibrio proteoclasticus, Peregrinibacterium Grinibacteria, Parcubacteria, Smithella ), Acidaminococcus, Candidatus Methanoplasma ter Candidatus Methanoplasma termitum, Eubacterium erythrocytes terium eligens, Moraxella bovoculi, Leptospira ina Leptospira inadai, Porphyromonas cre vioricanis, Prevotella disiens, or Porphyromonas The Cpf1 nuclease from Porphyromonas macacae. In embodiments, the Cas nuclease is derived from Acidaminococcus or or the Cpf1 nuclease of the Lachnospiraceae genus.

[0282] Wild-type Cas9 has two nuclease domains: RuvC and HNH. The uvC domain cleaves non-target DNA strands, while the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 nuclease comprises more than one RuvC domain and and / or one or more HNH domains. In some embodiments, the Cas9 is a wild-type Cas9. In certain embodiments, the Cas nuclease can induce strand breaks. It may cleave DNA, cleave one strand of dsDNA, or cleave DNA. Exemplary Cas9 amino acid sequences include: is provided as SEQ ID NO: 203. An exemplary Ca The s9 mRNA ORF sequence is provided as SEQ ID NO: 204. Exemplary Cas9 mRNA coding sequences suitable for inclusion are SEQ ID NO:210 and and provided.

[0283] In some embodiments, a chimeric Cas nuclease is used, In enzymes, one domain or region of a protein is replaced by a portion of a different protein. In some embodiments, the Cas nuclease domain is a different nuclease domain, such as Fok1. In some embodiments, the domain from a Cas nuclease may be substituted. The nuclease may be a modified nuclease.

[0284] In other embodiments, the Cas nuclease is from a Type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a type I CRISPR / It may be a component of the cascade complex of the Cas system. The nuclease may be a Cas3 protein. The ase may be from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.

[0285] In some embodiments, the RNA-guided DNA binding agent has single-stranded nickase activity, i.e. that is, cleaving one DNA strand to create a single-strand break, also known as a "nick" In some embodiments, the RNA-guided DNA binding agent comprises a Cas nickase. Nickase creates a nick in dsDNA, i.e., one end of the DNA double helix is ​​broken. In some embodiments, the Cas nickase is an enzyme that cleaves one strand but not the other. , the endonuclease cleavage active site may be modified by one or more alterations in, for example, the catalytic domain ( A version of the Cas nuclease (e.g., a point mutation) that is inactivated For example, Cas nucleases, as discussed above. For example, Cas nickases and See U.S. Patent No. 8,889,356 for a discussion of exemplary catalytic domain alterations. In some embodiments, the Cas nickase, such as the Cas9 nickase, is inactivated. The amino acid sequence of an exemplary Cas9 nickase is Provided as SEQ ID NO: 206. An exemplary Cas sequence including a start codon and a stop codon The 9 nickase mRNA ORF sequence is provided as SEQ ID NO: 207. Fusion Protein An exemplary Cas9 nickase mRNA coding sequence suitable for inclusion in the material is SEQ ID NO: It is provided as No. 211.

[0286] In some embodiments, the RNA-guided DNA binder contains only one functional nuclease. For example, the protein of the agent may be modified to contain a nuclease domain. One of the amino acids is mutated or completely or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, the RuvC domain may be modified to have reduced activity. In some embodiments, a nickase having an inactive RuvC domain is used. In some embodiments, a nickase having reduced activity is used. In some embodiments, a nickase having an inactive HNH domain is used. A nickase having a hydroxyl group is used.

[0287] In some embodiments, conserved amino acids within a Cas protein nuclease domain is substituted to reduce or alter nuclease activity. Cas nucleases bind to amino acids in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include: The amino acid substitution was D10A (in the S. pyogenes Cas9 protein). For example, Zetsche et al. (2015) Cell See Oct 22:163(3):759-771. In some embodiments, the Cas nucleic acid The nuclease may contain amino acid substitutions in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E 762A, H840A, N863A, H983A, and D986A ( S. pyogenes ( S. pyogenes) based on the Cas9 protein. See, e.g., J.M. et al. (2015). Further exemplary amino acid substitutions include D917A , E1006A, and D1255A (Francisella novicida )U112 Cpf1 (FnCpf1) sequence (UniProtKB-A0Q7Q2(CP F1_FRATN) are listed.

[0288] In some embodiments, the mRNA encoding the nickase is a target sequence that encodes both sense and alignant sequences. The antisense strand is provided in combination with a pair of guide RNAs, each complementary to the other. In an embodiment, the guide RNA directs the nickase to the target sequence and nicks the opposite strand of the target sequence. DSBs are introduced by creating a gap (i.e., double nicking). In this embodiment, the use of double nicking improves specificity and reduces off-target effects. In some embodiments, the nickase may target opposite strands of DNA to form a nucleotide sequence in the target DNA. In some embodiments, the nucleic acid sequence is used with two separate guide RNAs that generate a double nick in the target sequence. The nickases are selected to generate double nicks in the target DNA in close proximity. are used with separate guide RNAs.

[0289] In some embodiments, the RNA-guided DNA binding agent has cleavase and nickase activity. In some embodiments, the RNA-guided DNA-binding agent lacks dCas DNA binding. The dCas polypeptide has DNA binding activity and catalytic activity ( In some embodiments, the dCas polypeptide essentially lacks cleavase / nickase activity. The polypeptide is a dCas9 polypeptide. In some embodiments, the cleavage and RNA-guided DNA binders lacking chromatinase activity, or dCas DNA-binding polypeptides The endonuclease cleavage active site is, for example, one or more of the catalytic domains. The Cas gene is inactivated by multiple changes (e.g., point mutations). nucleases (e.g., Cas nucleases discussed above). See US 2014 / 0186958 A1; US ​​2015 / 0166980 A1. The dCas9 amino acid sequence is provided as SEQ ID NO: 208. The start and stop codons An exemplary dCas9 mRNA ORF sequence containing the dCas9 mRNA ORF is provided as SEQ ID NO:209. Exemplary dCas9 mRNA coding sequences suitable for inclusion in fusion proteins are: The sequence is provided as SEQ ID NO:212.

[0290] In some embodiments, the RNA-guided DNA binding agent comprises one or more heterologous functional domains. The polypeptide may be or may comprise a fusion polypeptide.

[0291] In some embodiments, the heterologous functional domain is a functional domain that is capable of directing the delivery of the RNA-guided DNA-binding agent to the nucleus of a cell. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binder is fused with 1 to 10 NLSs. In some embodiments, the RNA-guided DNA binder may have 1 to 5 NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused to one NL When one NLS is used, the NLS may be fused to an RNA-guided DNA fragment. It may be linked at the N-terminus or C-terminus of the A binder sequence. In other embodiments, the RNA-guided DNA binding agent may be inserted within the sequence of the RNA-guided DNA binding agent. In some embodiments, the RNA guide may be fused to more than one NLS. The DNA binding agent may be fused to 2, 3, 4, or 5 NLSs. In some embodiments, the RNA-guided DNA binder may be fused to two NLSs. In some situations, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the RNA-guided DNA-binding agent is linked at the carboxy terminus. In some embodiments, the RNA guide is fused to two SV40 NLS sequences. The DNA binder may be fused to two NLSs, one at the N-terminus and one In some embodiments, the RNA-guided DNA binding In some embodiments, the agent may be fused to three NLSs. The combination may not be fused to an NLS. In some embodiments, the NLS may be, for example, S V40 NLS, PKKKRKV (SEQ ID NO: 274) or PKKKRRV (SEQ ID NO: 275) In some embodiments, the NLS may be a monokaryotic sequence such as a nucleoside. Plasmin NLS, KRPAATKKAGQAKKKK (SEQ ID NO: 276), and other In certain embodiments, a single PKKKRKV (SEQ ID NO: 27) 4) The NLS may be linked at the C-terminus of the RNA-guided DNA binder. Alternatively, multiple linkers are optionally included at the fusion site.

[0292] In some embodiments, the heterologous functional domain may be a functional domain that modulates the intracellular half-life of the RNA-guided DNA binding agent. In some embodiments, the half of the RNA-guided DNA binder may be modified. The half-life may be increased. In some embodiments, the half-life of the RNA-guided DNA binding agent is low. In some embodiments, the heterologous functional domain may be an RNA-guided DNA binding agent. In some embodiments, the heterologous function may be increased. The domain can reduce the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain may be a signal peptide for proteolysis. In some embodiments, proteolysis may involve, for example, proteasome degradation. proteolytic enzymes such as lysosomal proteases, calpain proteases, or In some embodiments, the heterologous functional domain may be mediated by a PEST sequence. In some embodiments, the RNA-guided DNA binding agent may comprise ubiquitin or poly(Asp-Asp-Asp). In some embodiments, ubiquitin may be modified by the addition of a ubiquitin chain. It may also be a chitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins These include small ubiquitin-like modifiers (SUMO), ubiquitin cross-reactive proteins (U CRP, also known as interferon-stimulated gene 15 (ISG15), ubiquitin-associated Unrestricted receptor modifier 1 (URM1), neural progenitor cell expressed, developmentally downregulated protein 8(neuronal-precursor-cell-expressed d evelopmentally downregulated protein-8;N EDD8 (also called Rub1 in S. cerevisiae), human white blood cell human leukocyte antigen F-assoc iated; FAT10), autophagy 8 (ATG8) and 12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin Ubiquitin-like protein 5 (UBL5) and ubiquitin-modifying factor 1 (UFM1) Examples include:

[0293] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of domains include fluorescent proteins, purification tags, epitope tags, and In some embodiments, the marker domain may be a fluorescent tag. Non-limiting examples of suitable fluorescent proteins include green fluorescent protein (GFP) and Proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, E GFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent protein ( For example, YFP, EYFP, Citrine, Venus, YPet, PhiYFP, Z sYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azuri te, mKalamal, GFPuv, Sapphire, T-sapphire), Fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan) 1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, m Kate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed -Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), and orange fluorescent protein (mOrange, m KO, Kusabira-Orange, Monomeric Kusabira-Or Tangerine, mTangerine, tdTomato) or any other suitable fluorescent tan In other embodiments, the marker domain may be a purification tag and / or an enzyme. Non-limiting exemplary tags include glutathione-S-tetope tags. transferase (GST), chitin-binding protein (CBP), maltose-binding protein Protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity - Purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLA G, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu -Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHi s, biotin carboxyl carrier protein (BCCP), polyHis, and Calmo Non-limiting exemplary reporter genes include glutathione- S-transferase (GST), horseradish peroxidase (HRP), Chloramphenicol acetyltransferase (CAT), beta-galactosidase , beta-glucuronidase, luciferase, or fluorescent proteins.

[0294] In additional embodiments, the heterologous functional domain targets the RNA-guided DNA-binding agent to specific subcellular compartments. In some embodiments, the heterologous functional domain may be targeted to an organ, cell type, tissue, or organ. Mainly, RNA-guided DNA binding agents may be targeted to mitochondria.

[0295] In a further embodiment, the heterologous functional domain may be an effector domain. When a NA-guided DNA binder is directed to its target sequence, e.g., a Cas nuclease When the enzyme is directed to the target sequence by the gRNA, the effector domain binds to the target sequence. In some embodiments, the effector domain may modify or affect the target sequence. are nucleic acid binding domains, nuclease domains (e.g., non-Cas nuclease domains) ), epigenetic modification domain, transcriptional activation domain, or transcriptional repressor In some embodiments, the heterologous functional domain may be selected from the FokI nucleic acid. Nucleases such as nucleases are described in, for example, U.S. Pat. No. 9,023,649. In some embodiments, the heterologous functional domain is a transcriptional activator or repressor. For example, Qi et al., “Repurposing CRISPR as a n RNA-guided platform for sequence-speci fic control of gene expression,”Cell 152 :1173-83(2013);Perez-Pinera et al., “RNA- guided gene activation by CRISPR-Cas9-ba sed transcription factors,”Nat.Methods 1 0:973-6(2013);Mali et al., “CAS9 transcript ptional activators for target specificit y screening and paired nickases for coop erative genome engineering,” Nat.Biotech nol.31:833-8(2013);Gilbert et al., “CRISP R-mediated modular RNA-guided regulation of transcription in eukaryotes,”Cell 15 4:442-51 (2013). Therefore, RNA-guided DNA binders are essentially This results in a transcription factor that can bind to a desired target sequence in a directed manner using a guide RNA. .

[0296] B. Modified gRNA and mRNA In some embodiments, the gRNA is chemically modified. gRNAs containing nucleotides or amino acids instead of the standard A, G, C, and U residues one or more naturally occurring and / or To describe the presence of naturally occurring components or constructs, we use the term "modified" gRNA or "chemically In some embodiments, modified gRNAs are referred to as "modified" gRNAs. modified nucleotides or nucleotides, which are referred to herein as "modified" Modified nucleosides and nucleotides include (i) unlinked phosphodiester backbone linkages; one or both of the soluble phosphate oxygens and / or one or more of the linking phosphate oxygens (ii) modifications, e.g., substitutions (exemplary backbone modifications); (iii) modifications of the ribose sugar, e.g., (iii) alteration of the 2' hydroxyl of the parent sugar, e.g., substitution (exemplary sugar modifications); (iv) extensive replacement of the phosphate moiety with a phosphate linker (an exemplary backbone modification); Modification or substitution of naturally occurring nucleobases, such as with quasi-nucleobases (example base modifications (v) ribose phosphate backbone substitutions or modifications (exemplary backbone modifications); (vi) oligo Modification of the 3' or 5' end of a nucleotide, e.g., removal of the terminal phosphate group, modification or or substitution, or conjugation of a moiety, cap, or linker (such as a 3' or 5' (vii) sugar modifications; and (vii) sugar modifications. or substitutions (exemplary sugar modifications).

[0297] As noted above, in some embodiments, the compositions or formulations disclosed herein RNA-guided DNA-binding agents, such as Cas nucleases as described herein, The mRNA contains an open reading frame (ORF) encoding the In some forms, they contain ORFs encoding RNA-guided DNA binders such as Cas nucleases. In some embodiments, an mRNA containing the RNA is provided, used, or administered. The ORF encoding the modified DNA nuclease is called a "modified RNA-guided DNA binder ORF." or simply "modified ORF", which means that the ORF has been modified in one or more of the following ways: The modified ORF is used as an abbreviation to indicate that the ORF is modified: (1) uridine content within the range from the minimum uridine content to 150% of the minimum uridine content (2) the modified ORF has a minimum uridine dinucleotide content; Uridine dinucleotide content within a range of up to 150% of the lysine dinucleotide content (3) the modified ORF has SEQ ID NOs: 201, 204, 210, 214, 215, 2 For one of 23, 224, 250, 252, 254, 265, or 266 (4) the modified ORF has at least 75% codon identity; a set of codons in which the minimum uridine codon is a codon listed in Table 3A; and (5) The modified ORF comprises at least one modified uridine. In some embodiments, the modified The ORF is modified in at least two, three, or four of the above ways. In an embodiment, the modified ORF comprises at least one modified uridine and is selected from the group consisting of (1) to (3) above. (4) modified in at least one, two, three, or all of the above. [Table 3A]

[0298] In any of the above embodiments, the modified ORF is at least 75%, 80%, 85%, 90%, Table showing %, 95%, 98%, 99%, or 100% of codons are minimal uridine codons It may consist of a set of codons that are the codons listed in Figure 3A.

[0299] In any of the above embodiments, the modified ORF is selected from the group consisting of SEQ ID NOs: 201, 204, 210, 21 4, 215, 223, 224, 250, 252, 254, 265, or 266 or at least 90%, 95%, 98%, 99%, or 100% identity to one of The amino acid sequence may include an array having the following structure:

[0300] In any of the above embodiments, the modified ORF may be modified by adding a minimum uridine content to a minimum uridine content of at least 1000 nucleotides. 150%, 145%, 140%, 135%, 130%, 125%, 120%, 1 Ranges from 15%, 110%, 105%, 104%, 103%, 102%, or 101% The uridine content may be within the range.

[0301] In any of the above embodiments, the modified ORF may be 150%, 145%, 140%, 135%, and 13% of the minimum uridine dinucleotide content 0%, 125%, 120%, 115%, 110%, 105%, 104%, 103%, 10 It may have a uridine dinucleotide content ranging from 2% to 101%.

[0302] In any of the above embodiments, the modified ORF may be a nucleotide sequence of at least one, more than one, or all of the nucleotide sequences of the ubiquitin-binding domain. In some embodiments, the modified uridine may comprise a modified uridine at the amino acid position. Uridine modified at the 5 position, e.g., with halogen, methyl, or ethyl. In some embodiments, the modified uridine has a hydroxyl group at the 1-position, e.g., a halogen, a methyl or ethyl-modified pseudouridine. Modified uridines include, for example, Pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodo In some embodiments, the modified uridine may be 5-amino-2-methyl-2-propanol, ... In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. Uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is N1-methylpseudouridine and 5- In some embodiments, the modified uridine is a 5-iodo-2-methyl-2-oxo-2-methyl-1-propanol (5-iodo-2-methyl-1-oxo-2-methyl-1-propanol) in combination with methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methyl-pseudouridine. The modified uridine is a combination of pseudouridine and 5-iodouridine. In one embodiment, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine. .

[0303] In some embodiments, at least 10%, ... 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 6 5%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 10 In some embodiments, uridine positions in an mRNA according to the present disclosure are 10%~25%, 15~25%, 25~35%, 35~45%, 45~55%, 55 ~65%, 65-75%, 75-85%, 85-95%, or 90-100% are modified Lysines, such as 5-methoxyuridine, 5-iodouridine, N1-methylpseudouridine In some embodiments, the present disclosure provides a method for the preparation of uridine-containing amino acids, such as lysine, pseudouridine, or a combination thereof. 10%-25%, 15-25%, 25-35%, 35% of uridine positions in mRNA ~45%, 45~55%, 55~65%, 65~75%, 75~85%, 85~95%, Or 90-100% is 5-methoxyuridine. 10%-25%, 15-25%, 25-35%, 35-4% of uridine positions in mRNA 5%, 45-55%, 55-65%, 65-75%, 75-85%, 85-95%, and In some embodiments, the mRNA of the present disclosure is 90-100% pseudouridine. 10%-25%, 15-25%, 25-35%, 35-45%, 4% of uridine positions in A 5-55%, 55-65%, 65-75%, 75-85%, 85-95%, or 90- 100% is N1-methylpseudouridine. In some embodiments, m 10%-25%, 15-25%, 25-35%, 35-45% of uridine positions in RNA , 45-55%, 55-65%, 65-75%, 75-85%, 85-95%, or 9 In some embodiments, the mRNA of the present disclosure is 10%-25%, 15-25%, 25-35%, 35-45%, 45% of uridine positions in ~55%, 55~65%, 65~75%, 75~85%, 85~95%, or 90~1 00% is 5-methoxyuridine, and the remaining portion is N1-methylpseudouridine. In some embodiments, 10% to 25% of the uridine positions in an mRNA according to the present disclosure are %, 15-25%, 25-35%, 35-45%, 45-55%, 55-65%, 65- 75%, 75-85%, 85-95%, or 90-100% is 5-iodouridine and the remaining portion is N1-methylpseudouridine.

[0304] In some embodiments, the mRNA is expressed mammalian, such as a constitutively expressed mRNA. The mRNA contains at least one UTR from an animal mRNA. A gene is constitutively expressed in mammals if it is continuously transcribed in at least one tissue. In some embodiments, the mRNA is constitutively expressed mammalian 5'UTR, 3'UTR, or 5'UTR from an expressed mammalian RNA such as mRNA and 3'UTR. Actin mRNA is an example of a constitutively expressed mRNA.

[0305] In some embodiments, the mRNA is a hydroxysteroid 17-beta dehydrogenase. at least one UTR from ase 4 (HSD17B4 or HSD), e.g., from HSD In some embodiments, the mRNA comprises a 5' UTR of a globin mRNA, e.g., Human alpha globin (HBA) mRNA, human beta globin (HBB) mRNA, or or at least one UT from Xenopus beta globin (XBG) mRNA In some embodiments, the mRNA comprises a globulin R, such as HBA, HBB, or XBG. Contains the 5'UTR, 3'UTR, or 5' and 3'UTR from a bin mRNA. In this embodiment, the mRNA is from bovine growth hormone, cytomegalovirus (CMV), mammary gland (MD) or ovarian tumor suppressor (MVD). 5 from mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG In some embodiments, the mRNA comprises a UTR. virus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XB In some embodiments, the mRNA comprises a 3'UTR from bovine growth hormone, rhesus malabsorbent. Tomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, XBG, heat shock protein 90 (Hsp90), glyceraldehyde 3-phosphate dehydrogenase Glycogenase (GAPDH), beta-actin, alpha-tubulin, tumor protein containing the 5' and 3' UTRs from the protein (p53), or epidermal growth factor receptor (EGFR). nothing.

[0306] In some embodiments, the mRNA is from the same source, e.g., constitutively expressed mRNA. , e.g., actin, albumin, or globin, e.g., HBA, HBB, or X Contains the 5' and 3' UTRs from BG.

[0307] In some embodiments, the mRNA does not include a 5' UTR, e.g., a 5' cap and start codon. In some embodiments, the mRNA has a 5' end and no additional nucleotides between the end and the 5' end. It contains a Kozak sequence (described below) between the cap and the start codon, but In some embodiments, the mRNA does not include a 3' UTR, e.g., a 5' UTR. For example, there are no additional nucleotides between the stop codon and the poly A tail.

[0308] In some embodiments, the mRNA comprises a Kozak sequence. This can affect translation initiation and the overall yield of polypeptides translated from K. The ozak sequence contains a methionine codon that can function as an initiation codon. The Kozak sequence of is NNNRUGN, and at least one of the following is true: N is A or G, and the second N is G. In the context of a nucleotide sequence , R represents a purine (A or G). In some embodiments, the Kozak sequence is NRUGN, NNNRUGG, RNNRUGG, RNNAUGN, NNNAUGG, also In some embodiments, the Kozak sequence is rccRUGg. , which allows 0 mismatches or at most 1 or 2 mismatches for lowercase positions. In some embodiments, the Kozak sequence is rccAUGg, which has 0 amino acids. There are a maximum of one or two mismatches for the lowercase or lowercase positions. In an embodiment, the Kozak sequence is gccRccAUGG (SEQ ID NO: 277), which allows 0 mismatches or up to 1, 2, or 3 mismatches for lowercase positions In some embodiments, the Kozak sequence is gccAccAUG, which has 0 mismatches or up to 1, 2, 3, or 4 mismatches for lowercase letters In some embodiments, the Kozak sequence is GCCACCAUG. In this embodiment, the Kozak sequence is gccgccRccAUGG (SEQ ID NO: 278). This means 0 mismatches or up to 1, 2, 3, or 4 mismatches for lowercase positions. It has a switch.

[0309] In some embodiments, the mRNA comprising an ORF encoding the RNA-guided DNA binder is , a sequence having at least 90% identity to SEQ ID NO: 1, and optionally The ORF of SEQ ID NO: 1 (i.e., SEQ ID NO: 204) is a sequence similar to SEQ ID NOs: 210, 214, One of 215, 223, 224, 250, 252, 254, 265, or 266 It has been replaced by two alternative ORFs.

[0310] In some embodiments, the mRNA comprising an ORF encoding the RNA-guided DNA binder is , comprising a sequence having at least 90% identity to SEQ ID NO: 244, and optionally The ORF of SEQ ID NO: 244 (i.e., SEQ ID NO: 204) is SEQ ID NO: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266 It has been replaced by one of the alternative ORFs.

[0311] In some embodiments, the mRNA comprising an ORF encoding the RNA-guided DNA binder is , comprising a sequence having at least 90% identity to SEQ ID NO: 256, and optionally The ORF of SEQ ID NO: 256 (i.e., SEQ ID NO: 204) is SEQ ID NO: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266 It has been replaced by one of the alternative ORFs.

[0312] In some embodiments, the mRNA comprising an ORF encoding the RNA-guided DNA binder is , a sequence having at least 90% identity to SEQ ID NO: 257, and optionally The ORF of SEQ ID NO: 257 (i.e., SEQ ID NO: 204) is SEQ ID NO: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266 It has been replaced by one of the alternative ORFs.

[0313] In some embodiments, the mRNA comprising an ORF encoding the RNA-guided DNA binder is , a sequence having at least 90% identity to SEQ ID NO: 257, and optionally The ORF of SEQ ID NO: 258 (i.e., SEQ ID NO: 204) is SEQ ID NO: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266 It has been replaced by one of the alternative ORFs.

[0314] In some embodiments, the mRNA comprising an ORF encoding the RNA-guided DNA binder is , a sequence having at least 90% identity to SEQ ID NO: 259, and optionally The ORF of SEQ ID NO: 259 (i.e., SEQ ID NO: 204) is SEQ ID NO: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266 It has been replaced by one of the alternative ORFs.

[0315] In some embodiments, the mRNA comprising an ORF encoding the RNA-guided DNA binder is , a sequence having at least 90% identity to SEQ ID NO: 260, and optionally The ORF of SEQ ID NO: 260 (i.e., SEQ ID NO: 204) is SEQ ID NO: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266 It has been replaced by one of the alternative ORFs.

[0316] In some embodiments, the mRNA comprising an ORF encoding the RNA-guided DNA binder is , comprising a sequence having at least 90% identity to SEQ ID NO: 261, and optionally The ORF of SEQ ID NO: 261 (i.e., SEQ ID NO: 204) is SEQ ID NO: 210, 214, 215, 223, 224, 250, 252, 254, 265, or 266 It has been replaced by one of the alternative ORFs.

[0317] In some embodiments, the amino acid sequence of SEQ ID NO: 243, 244, or optionally 256-261 is The degree of identity to the sequence being substituted is 95%. Identification of optionally substituted sequences of Nos. 243, 244, or 256-261 The degree of identity is 98%. In some embodiments, SEQ ID NO: 243, 244, or 25 The degree of identity for the optionally substituted sequences of 6 to 261 is 99%. In some embodiments, the amino acid sequence of SEQ ID NO: 243, 244, or 256-261 is optionally substituted. The degree of identity to the sequence shown is 100%.

[0318] In some embodiments, the mRNA disclosed herein is selected from the group consisting of Cap0, Cap1, or Cap2. The 5' cap is generally located at the 5' end of the mRNA. the first nucleotide of the 3' strand, i.e., the 5'th nucleotide of the first cap-adjacent nucleotide 7-methylguanine ribonucleotide linked to the 5' position through the triphosphate (which is (which may be further modified, for example, as discussed below with respect to ARCA). At p0, both the riboses of the first and second cap-adjacent nucleotides of the mRNA are 2 Cap1 contains a '-hydroxyl. The first and second transcribed nucleotides of the mRNA The ribose of the capsid contains a 2'-methoxy and a 2'-hydroxyl group. In 2, both the riboses of the first and second cap-adjacent nucleotides of the mRNA are 2' -Methoxy. See, for example, Katibah et al. (2014) Proc Na tl Acad Sci USA 111(33):12025-30;Abbas e t al.(2017)Proc Natl Acad Sci USA 114(11 ): See E2106-E2115. Most mammalian mRNAs, including human mRNAs, All endogenous higher eukaryotic mRNAs contain Cap1 or Cap2. Other cap structures distinct from Cap1 and Cap2 are IFIT-1 and IFIT- In mammals, including humans, this occurs due to recognition as "non-self" by components of the innate immune system, such as 5. may be immunogenic in some cases, resulting in increased levels of cytokines such as type I interferon. Components of the innate immune system, such as IFIT-1 and IFIT-5, also investigated the binding of eIF to mRNAs with caps other than Cap1 or Cap2. It may compete with 4E and inhibit mRNA translation.

[0319] A cap can be included simultaneously with transcription. For example, ARCA (Anti-Reverse Cap Amplification Assay) Analog; Thermo Fisher Scientific, Cat. No. AM804 5) is a guanine ribonucleoside that can be incorporated into transcripts in vitro at initiation. A chiral nucleotide containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of the nucleotide ARCA is a cap analogue. The 2' position of the first cap-adjacent nucleotide is hydrolyzed. This results in a Cap0 cap, which is a hydroxyl. For example, Stepinski et al. t al.,(2001)“Synthesis and properties of mRNAs containing the novel'anti-reverse 'cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG,”RNA 7:1486-1 See 495. The structure of ARCA is shown below. [ka]

[0320] CleanCap(TM)AG(m7G(5')ppp(5')(2'OMeA)pG TriLink Biotechnologies, Catalog No. N-7113) or is CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG (TriLink Biotechnologies, Cat. No. N-7133) The 3'-O-methylated form of C can be used to provide the Cap1 structure simultaneously with transcription. LeanCap™ AG and CleanCap™ GG are also available, each with a TriLink Biotechnol under log numbers N-7413 and N-7433 The structure of CleanCap™ AG is shown below: [ka]

[0321] Alternatively, the cap may be added after RNA transcription. The enzyme is commercially available (New England BioLabs, catalog no. M2080S), which is an RNA triphosphatase provided by its D1 subunit. lyase and guanylyltransferase activities, and its D12 subunit It has a guanine methyltransferase that is provided, so it can bind to S-adeno In the presence of methylmethionine and GTP, 7-methylguanine is added to RNA to form Cap 0 can be given. For example, Guo, P. and Moss, B. (1990) P roc.Natl.Acad.Sci.USA 87,4023-4027;Mao,X .and Shuman, S. (1994) J. Biol. Chem. 269, 2447 See 2-24479 for additional discussion of caps and cap formation approaches. For example, WO2017 / 053297 and Ishikawa et al., Nucl See Acids Symp. Ser. (2009) No. 53, 129-130.

[0322] In some embodiments, the mRNA further comprises a polyadenylation (polyA) tail. In some embodiments, the poly A tail is at least 20, 30, 40, 50, 60, 70, Contains 80, 90, or 100 adenines, optionally up to 300 adenines. In some embodiments, the poly A tail is 95, 96, 97, 98, 99, or 100 amino acids. In some cases, the polyA tail contains 1 adenine nucleotide within the polyA tail. by one or more non-adenine nucleotide "anchors" at one or more positions The poly A tail is "interrupted" by at least eight consecutive adenine nucleotides. The present invention may contain adenine nucleotides, but may also contain one or more non-adenine nucleotides. As used herein, a "non-adenine nucleotide" refers to any nucleotide that does not contain adenine. refers to natural or non-natural nucleotides. Adenine nucleotides are exemplary non-adenine nucleotides. The polyA tail on A is a nucleotide sequence encoding an RNA-guided DNA binder or a target molecule. In some cases, the sequence may include consecutive adenine nucleotides located 3' of the sequence. The polyA tail on the mRNA contains nucleotides encoding the RNA-guided DNA binder. or non-adenine nucleotides located 3' of the sequence of interest, Nucleotides interrupt the adenine nucleotides at regular or irregular intervals.

[0323] In some embodiments, the one or more non-adenine nucleotides are consecutive adenines. It is positioned to interpose on the nucleotide, thereby forming a poly(A) binding protein. is capable of binding to a stretch of consecutive adenine nucleotides. In some embodiments, the one or more non-adenine nucleotides are at least 8, 9, 10, 11, or after 12 consecutive adenine nucleotides. The non-adenine nucleotides are at least 8 to 50 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are located after the The nucleotide is located after at least 8 to 100 consecutive adenine nucleotides. In this embodiment, the non-adenine nucleotides are 1, 2, 3, 4, 5, 6, or 7 adenine nucleotides. Adenine nucleotide followed by at least eight consecutive adenine nucleotides is followed by.

[0324] The poly A tail consists of consecutive adenine nucleotides followed by one or more a non-adenine nucleotide, and optionally followed by an additional adenine nucleotide. It may contain one sequence of octides.

[0325] In some embodiments, the poly-A tail is comprised of one non-adenine nucleotide or 2 to 10 containing or containing one contiguous stretch of non-adenine nucleotides. In embodiments, the non-adenine nucleotide(s) is / are at least 8, 9, 1 It is located after 0, 11, or 12 consecutive adenine nucleotides. The one or more non-adenine nucleotides are present in a sequence of at least 8 to 50 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are located after the adenine nucleotide. Nucleotides must be at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3 1, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 , 45, 46, 47, 48, 49, or 50 consecutive adenine nucleotides Located.

[0326] In some embodiments, the non-adenine nucleotide is guanine, cytosine, or thymine. In some cases, the non-adenine nucleotide is a guanine nucleotide. In some embodiments, the non-adenine nucleotide is a cytosine nucleotide. In some cases, the non-adenine nucleotide is a thymine nucleotide. If more non-adenine nucleotides are present, the non-adenine nucleotides are: a) guaiamin; a) guanine and thymine nucleotides; b) guanine and cytosine nucleotides; c) thymine and cytosine nucleotides; or d) guanine, thymine and cytosine nucleotides. An exemplary poly A tail containing non-adenine nucleotides may be selected from SEQ ID NO: Served as :4.

[0327] In some embodiments, the mRNA further comprises a polyadenylation (polyA) tail. In this case, the polyA tail may be one or more amino acids at one or more positions within the polyA tail. is "interrupted" by multiple non-adenine nucleotide "anchors". The sequence may contain at least eight consecutive adenine nucleotides, but may contain one or more As used herein, "non-adenine" refers to a group of nucleotides that may contain a number of non-adenine nucleotides. "Adenine nucleotide" refers to any natural or unnatural nucleotide that does not contain adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Therefore, the polyA tail on the mRNA described herein is an RNA guide Nucleotides encoding a DNA binding agent or contiguous nucleotides located 3' of the sequence of interest In some cases, the polyA tail on the mRNA may contain ribonucleotides. A guide consisting of a sequence of nucleotides encoding a DNA binder or a sequence located 3' of the sequence of interest. Non-adenine nucleotides can be either regular or irregular. It interrupts the adenine nucleotides at intervals.

[0328] In some embodiments, the one or more non-adenine nucleotides are consecutive adenines. It is positioned to interpose on the nucleotide, thereby forming a poly(A) binding protein. is capable of binding to a stretch of consecutive adenine nucleotides. In some embodiments, the one or more non-adenine nucleotides are at least 8, 9, 10, 11, or after 12 consecutive adenine nucleotides. The non-adenine nucleotides are at least 8 to 50 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are located after the The nucleotide is located after at least 8 to 100 consecutive adenine nucleotides. In this embodiment, the non-adenine nucleotides are 1, 2, 3, 4, 5, 6, or 7 adenine nucleotides. Adenine nucleotide followed by at least eight consecutive adenine nucleotides is followed by.

[0329] The poly A tail of the present invention is a poly A tail consisting of consecutive adenine nucleotides followed by one or more or multiple non-adenine nucleotides, and optionally followed by an additional adenine nucleotide. It may comprise a single sequence of nucleotides.

[0330] In some embodiments, the poly-A tail is comprised of one non-adenine nucleotide or 2 to 10 containing or containing one contiguous stretch of non-adenine nucleotides. In embodiments, the non-adenine nucleotide(s) is / are at least 8, 9, 1 It is located after 0, 11, or 12 consecutive adenine nucleotides. The one or more non-adenine nucleotides are present in a sequence of at least 8 to 50 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are located after the adenine nucleotide. Nucleotides must be at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3 1, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 , 45, 46, 47, 48, 49, or 50 consecutive adenine nucleotides Located.

[0331] In some embodiments, the non-adenine nucleotide is guanine, cytosine, or thymine. In some cases, the non-adenine nucleotide is a guanine nucleotide. In some embodiments, the non-adenine nucleotide is a cytosine nucleotide. In some cases, the non-adenine nucleotide is a thymine nucleotide. When many non-adenine nucleotides are present, the non-adenine nucleotides are a) guanidinium a) guanine and cytosine nucleotides; c) thymine and and cytosine nucleotides; or d) guanine, thymine, and cytosine nucleotides. An exemplary poly A tail containing non-adenine nucleotides may be selected from SEQ ID NO: :4 is provided as: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCGAAAAAAA AAAAAAAAAAAAAAAAAAAAAAACCGAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA.

[0332] Chemical modifications such as those listed above can be combined to form two, three, four, or more modifications. Modified gRNA containing nucleosides and nucleotides (collectively "residues") that may have modifications and / or mRNA. For example, modified residues can include modified sugars and modified In some embodiments, every base of the gRNA is modified. For example, all bases have modified phosphate groups, such as phosphorothioate groups. In this embodiment, all or substantially all of the phosphate groups of the gRNA molecule are phosphorothioate. In some embodiments, the modified gRNA is substituted with a 5' end of the RNA. In some embodiments, the amino acid sequence includes at least one modified residue at or near The modified gRNA may have at least one nucleotide sequence at or near the 3' end of the RNA. Contains modified residues.

[0333] In some embodiments, the gRNA comprises one, two, three or more modified residues. In this embodiment, at least 5% (e.g., at least 5%, at least at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, At least 55%, at least 60%, at least 65%, at least 70%, at least At least 75%, at least 80%, at least 85%, at least 90%, at least 95% , or 100%) is a modified nucleoside or nucleotide.

[0334] Unmodified nucleic acids can be degraded by, for example, intracellular nucleases or those found in serum. For example, nucleases can break down the phosphodiester bonds of nucleic acids. Thus, in one aspect, the gRNAs described herein can be hydrolyzed. For example, one may use a nucleotide sequence to introduce stability against intracellular or serum-based nucleases. or may contain multiple modified nucleosides or nucleotides. In some embodiments, the modified gRNA molecules described herein can be used in vivo and ex vivo Both vo and vo exhibit a reduced innate immune response when introduced into a population of cells. The term "innate immune response" refers to cytokine expression and release, particularly immune responses. Cellular response to exogenous nucleic acids, such as single-stranded nucleic acids, with induction of cell death, as well as terferons. Contains the response.

[0335] In some embodiments of the backbone modification, one or more of the oxygens are replaced with a different substituent. The phosphate group of the modified residue can be modified by the above procedure. Modified residues present in modified nucleic acids may be substituted with modified residues as described herein for unmodified phosphate moieties. In some embodiments, the phosphate backbone may be extensively substituted with phosphate groups. The modifications involve either uncharged linkers or charged linkers with asymmetric charge distribution. It can include the resulting changes.

[0336] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, and boranophosphates. phosphate, boranophosphate, hydrogen phosphonate, phosphoramidate, alkyl or Examples include aryl phosphonates and phosphate triesters. However, the non-bridged bond formed by one or a group of atoms listed above is achiral. Substitution of one of the di-forming oxygens can make the phosphorus atom chiral. An asymmetric phosphorus atom is either the "R" configuration (herein Rp) or the "S" configuration (herein Sp) The backbone can also have nitrogen (bridging phosphoramidates), sulfur (bridging Phosphorothioates) and carbon-bridged methylene phosphonates It can be modified by substitution of the oxygen atom (i.e., the oxygen that connects the phosphate to the nucleoside). Substitution can occur at either or both of the linking oxygens. .

[0337] The phosphate group can be replaced by non-phosphorus-containing attachment factors in certain backbone modifications. In some embodiments, the charged phosphate group can be replaced with a neutral moiety. Examples of moieties that can replace the phosphate group include, for example, methylphosphonate, hydroxyl group, hydroxyamino, siloxane, carbonate, carboxymethyl, carbamate, amide, Thioether, ethylene oxide linker, sulfonate, sulfonamide, thioform Acetal, formacetal, oxime, methyleneimino, methylenemethylimino, methyl Examples include methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino. It can be, but is not limited to, these.

[0338] Scaffolds that can mimic nucleic acids can also be constructed, In this field, a phosphate linker and a ribose sugar form a nuclease-resistant nucleoside. or nucleotide surrogates. Such modifications include modifications of the backbone and sugar In some embodiments, the nucleobases are tethered by a surrogate backbone. Examples include morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acids ( Examples of suitable nucleoside surrogates include, but are not limited to, nucleoside surrogates (PNAs).

[0339] Modified nucleosides and nucleotides contain one or more sugar groups, i.e., sugar modifications. For example, the 2' hydroxyl group (OH) may be modified, e.g., For example, it can be substituted with a number of different "oxy" or "deoxy" substituents. In some embodiments, modification of the 2' hydroxyl group can increase the stability of the nucleic acid. The reason is that the hydroxyl is no longer deprotonated to form the 2'-alkoxide ion. Because it cannot be achieved.

[0340] Examples of 2' hydroxyl group modifications include alkoxy or aryloxy (OR; "R " is, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or may be a sugar); polyethylene glycol (PEG), O(CH2CH2O) n CH2 CH2OR (where R can be, for example, H or optionally substituted alkyl, n is 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 1 0, 1-16, 1-20, 2-4, 2-8, 2-10, 2-16, 2-20, 4-8, 4 Examples of the integers include 4 to 10, 4 to 16, and 4 to 20. In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me. In the case of 2' hydroxyl group modification, the 2' hydroxyl group modification can be a 2'-fluoro modification, which is In some embodiments, the 2' hydroxyl group modification is substituted with fluoride. These may include "locked" nucleic acids (LNA), in which the 2' hydroxyl is, for example, C 1~6 Alkylene or C 1~6 The heteroalkylene bridge connects the 4' Exemplary bridges include methylene, propylene, ether, or amino bridge; O-amino (amino is, for example, NH; alkylamino, dialkylamino alkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamin (It may be a heteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, O(CH2) n -amino (amino is, for example, NH2; alkyl arylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, Heteroarylamino, or diheteroarylamino, ethylenediamine, or polya In some embodiments, the 2' hydroxyl group modification may be can contain "unlocked" nucleic acids (UNAs), in which the ribose ring is at C2 In some embodiments, the 2' hydroxyl group modification is a methacrylate. containing a diethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative) can be done.

[0341] "Deoxy" 2' modifications include hydrogen (i.e., partially deoxyribonucleotides) in dsRNA. Deoxyribose sugars in the bar-hanging portion; halo (e.g., bromo, chloro, fluoro) iodo, or iodo); amino (amino is, for example, NH2; alkylamino, dialkylamino arylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino , diheteroarylamino, or amino acid; NH(CH2CH2NH) n CH2CH2-amino (amino can be, for example, as described herein) ), -NHC(O)R (wherein R is, for example, alkyl, cycloalkyl, aryl, aralkyl, aryl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkanol alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and and alkynyl (which may optionally be substituted, for example, with amino as described herein). and the like, which may be substituted by

[0342] Sugar modifications are one or more carbons that have the opposite stereochemical configuration to the corresponding carbon in ribose. Thus, modified nucleic acids can include, for example, sugar groups that may also contain carbons The modified nucleic acid may also include nucleotides containing arabinose as the base. These abasic sugars may also contain a base sugar at one or more of the constituent sugar atoms. Modified nucleic acids can also be further modified by one or more sugars in the L-form, e.g., L-nucleic acid. It may contain leiosides.

[0343] The modified nucleosides and modifications described herein that can be incorporated into modified nucleic acids Nucleotides can also contain modified bases, also called nucleobases. Examples of nucleobases include These include adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases may be modified or substituted entirely, such as, but not limited to: Modified residues can be provided that can be incorporated into modified nucleic acids. The base may be independently a purine, pyrimidine, purine analog, or pyrimidine analog. In some embodiments, the nucleobase can be selected from, for example, naturally occurring bases. and synthetic derivatives.

[0344] In embodiments using dual guide RNAs, the crRNA and tracrRNA Each can contain modifications. Such modifications can be made to the crRNA and / or The sgRNA may be at one or both ends of the tracr RNA. In this embodiment, one or more residues at one or both ends of the sgRNA are chemically The sgRNA may be selectively modified, or the entire sgRNA may be chemically modified. Certain embodiments include a 5'-end modification. Certain embodiments include a 3'-end modification. In certain embodiments, one of the nucleotides in the single-stranded overhang of the guide RNA molecule Alternatively, some or all are deoxynucleotides.

[0345] In some embodiments, the guide RNAs disclosed herein are "Chemically Modified Guide RNAs" filed on the 8th No. 62 / 431,756, the contents of which are incorporated herein by reference in their entirety. The present invention includes one of the modification patterns disclosed in the above document (which is incorporated herein by reference).

[0346] In some embodiments, the present invention includes gRNAs that include one or more modifications. In embodiments, the modifications include 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the modification comprises an internucleotide phosphorothioate (PS) bond.

[0347] The terms "mA," "mC," "mU," or "mG" refer to 2'-O-Me modified It can be used to represent a nucleotide that is

[0348] The 2'-O-methyl modification can be represented as follows: [ka]

[0349] Another chemical modification that has been shown to affect the sugar ring of nucleotides is halogen substitution. For example, 2'-fluoro (2'-F) substitutions on the sugar ring of a nucleotide can The binding affinity and nuclease stability of the protease can be increased.

[0350] In this application, the terms "fA," "fC," "fU," or "fG" refer to 2' It can be used to represent a nucleotide substituted with -F.

[0351] The 2'-F substitution can be represented as follows: [ka]

[0352] Phosphorothioate (PS) linkages or bonds are those in which sulfur is bonded between, for example, nucleotide bases. A bond replacing one non-bridging phosphate oxygen in a phosphodiester linkage When phosphorothioates are used to generate oligonucleotides, the modified oligo Oligonucleotides may also be referred to as S-oligos.

[0353] "*" may be used to represent PS modifications. In this application, A*, C*, U*, Alternatively, the term G* refers to a nucleotide linked to the next (e.g., 3') nucleotide by a PS bond. It can be used to represent a nucleotide that is

[0354] In this application, the terms "mA*," "mC*," "mU*," or "mG*" is substituted by 2'-O-Me and is connected to the next (e.g., 3') nucleoside by a PS bond. It can be used to refer to a nucleotide linked to a nucleotide.

[0355] The diagram below shows the substitution of S for a non-bridging phosphate oxygen, which allows for the formation of a phosphodiester bond. Instead of this, a PS bond is formed. [ka]

[0356] An abasic nucleotide is a nucleotide that lacks a nitrogenous base. 1 represents an oligonucleotide with a missing abasic (also known as apurinic) site. [ka]

[0357] Inverted bases are linkages that are reversed (i.e., 5' to 5') from the normal 5' to 3' linkage. linkage or 3' to 3' linkage). For example, [ka]

[0358] Abasic nucleotides can be attached using inverted ligation. The nucleotide may be attached to the terminal 5' nucleotide via a 5' to 5' linkage. Alternatively, the abasic nucleotide may be attached to the terminal 3' nucleotide via a 3' to 3' linkage. Inverted deletions at either the terminal 5' or 3' nucleotide may be used. The basic nucleotide may also be referred to as an inverted abasic end cap.

[0359] In some embodiments, one of the first 3, 4, or 5 nucleotides at the 5' end or more, and one or more of the last 3, 4, or 5 nucleotides at the 3' end In some embodiments, the modifications include 2'-O-Me, 2'-F, reverse Abasic nucleotides, PS binding, or increasing stability and / or performance are other nucleotide modifications well known in the art.

[0360] In some embodiments, the first four nucleotides at the 5' end and the The last four nucleotides are linked by phosphorothioate (PS) bonds. .

[0361] In some embodiments, the first three nucleotides at the 5' end and the The last three nucleotides are 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the The last three nucleotides in In some embodiments, the first three nucleotides at the 5' end and The last three nucleotides in the nucleotide sequence contain inverted abasic nucleotides.

[0362] In some embodiments, the guide RNA comprises a modified sgRNA. The gRNA comprises the modification pattern shown in SEQ ID NO:3, where N is any natural or non-natural nucleotide. The entire N represents a guide sequence that directs the nuclease to the target sequence. include.

[0363] In some embodiments, the guide RNA is set forth in any one of SEQ ID NOs: 87-124. In some embodiments, the guide RNA comprises a guide RNA of SEQ ID NOs: 5-82. and an sgRNA comprising the nucleotides of SEQ ID NO: 125, The nucleotide at sequence number 125 is at the 3' end of the guide sequence, and the guide sequence is It may be modified as shown in column number 3.

[0364] C. Ribonucleoprotein complex In some embodiments, one or more guide sequences comprising one or more guide sequences from Table 1 are Several gRNAs or one or more sgRNAs and RNA guide DNA from Table 2 A composition comprising a binding agent, e.g., a nuclease, e.g., a Cas nuclease such as Cas9. In some embodiments, the encoded RNA-guided DNA-binding agent is a double-stranded endogenous DNA-binding agent. In some embodiments, R NA-guided DNA binders include Cas nucleases. Cas9 nuclease is an example. S. pyogenes, S. aureus, and other prokaryotes Cas9 nucleic acid sequences of type II CRISPR systems (see the list in the next paragraph for examples) Examples include cleases, as well as modified (e.g., engineered or mutant) forms thereof. For example, US2016 / 0312198 A1; US ​​2016 / 0312199 A1 Other examples of Cas nucleases include Csm in type III CRISPR systems. or the Cmr complex or its Cas10, Csm1, or Cmr2 subunits; and the Cascade complex of the type I CRISPR system, or its Cas3 subunit In some embodiments, the Cas nuclease is a type IIA, type IIB, or may be from a type IIC system. Various CRISPR systems and Ca For a discussion of s-nucleases, see, e.g., Makarova et al., NAT. REV. MICROBIOL. 9:467-477 (2011);Makaro va et al., NAT. REV. MICROBIOL, 13: 722- 36 (2015);Shmakov et al., MOLECULAR CELL , 60:385-397 (2015).

[0365] Non-limiting exemplary species from which Cas nucleases can be derived include Streptococcus Streptococcus pyogenes, Streptococcus thermophilus Streptococcus thermophilus, Streptococcus sp., Staphylococcus Staphylococcus aureus, Listeria innocua a innocua), Lactobacillus gasseri, Francisella novi Fern (Francisella novicida), Wolinella succinogenes ), Sutterella wadsworthensis, Gammaproteobacterium Gammaproteobacterium, Neisseria meningitidis idis), Campylobacter jejuni, Pasteurella mult Fern (Pasteurella multocida), Fibrobacter succinogenes (Fibrobacter suc cinogene), Rhodospirillum rubrum, Nocardiopsis Nocardiopsis dassonvillei, Streptomyces pristinaspira Squirrel (Streptomyces pristinaespiralis), Streptomyces viridochromogenes (St reptomyces viridochromogenes, Streptomyces viridochromogenes (Streptomyc es viridochromogenes), Streptosporangium roseum (Streptosporangium ro seum), Streptosporangium roseum, Alisik Alicyclobacillus acidocaldarius, Bacillus Bacillus pseudomycoides, Bacillus selenitireducens illus selenitireducens), Exiguobacterium sibiricum biricum), Lactobacillus delbrueckii, Lactobacillus Bacillus salivarius (Lactobacillus salivarius), Lactobacillus buchneri (La ctobacillus buchneri, Treponema denticola, Microorganisms Microscilla marina, a Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa ginosa), Synechococcus sp., Acetohalobium arabatica Acetohalobium arabaticum, Ammonifex degens ii), Caldicelulosiruptor becscii, Candida Candidatus Desulforudis, Clostridium botulinum Clostridium botulinum, Clostridium difficile le), Finegoldia magna, Natlanaerobius thermoph Natranaerobius thermophilus, Pelotomaculum thermopropionicum otomaculum thermopropionicum), Acidithiobacillus caldus s caldus), Acidithiobacillus ferrooxidans dans), Allochromatium vinosum, Marinobacter spp. (Marinobacter sp.), Nitrosococcus halophilus , Nitrosococcus watsoni, Pseudoalteromonas Haloplanktis (Pseudoalteromonas haloplanktis), Ctedonobacter racemosa fer (Ktedonobacter racemifer), Methanohalobium ebestigatum (Methanoha lobium evestigatum), Anabaena variabilis, Nodulari Nodularia spumigena, Nostoc sp., Arthrospi Arthrospira maxima, Arthrospira platensis atensis, Arthrospira sp., Lyngbya sp. , Microcoleus chthonoplastes, Oscillatoria sp. Fungus (Oscillatoria sp.), Petrotoga mobilis, Thermosipho africanus (Thermosipho africanus), Streptococcus pasteurianus (Str eptococcus pasteurianus, Neisseria cinerea, Campylobacter Campylobacter lari, Parvibacter lavamentivorans aculum lavamentivorans, Corynebacterium diphtheriae eria), Acidaminococcus sp., Lachnospiraceae hnospiraceae bacterium ND2006, and Acaryochloris marina rina) is an example.

[0366] In some embodiments, the Cas nuclease is selected from the group consisting of Streptococcus pyogenes (Stre In some embodiments, the Cas9 nuclease is a Cas9 nuclease from Proteus pyogenes. C clease of Streptococcus thermophilus In some embodiments, the Cas nuclease is a Neisseria as9 nuclease. Cas9 nuclease from Neisseria meningitidis. In its morphology, Cas nucleases are found in Staphylococcus aureus ( In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptomyces ureus. Cpf1 nuclease from Francisella novicida. In one embodiment, the Cas nuclease is derived from Acidaminococcus In some embodiments, the Cas nuclease is a Cpf1 nuclease from La Cpf1 nuclease of the Lachnospiraceae bacterium ND2006 In a further embodiment, the Cas nuclease is derived from Francisella tularensis (Francisella sella tularensis, Lachnospiraceae bacteria, Butyrivibrio Butyrivibrio proteoclasticus, Peregrinibacterium Grinibacteria, Parcubacteria, Smithella ), Acidaminococcus, Candidatus Methanoplasma ter Candidatus Methanoplasma termitum, Eubacterium erythrocytes terium eligens, Moraxella bovoculi, Leptospira ina Leptospira inadai, Porphyromonas cre vioricanis, Prevotella disiens, or Porphyromonas The Cpf1 nuclease from Porphyromonas macacae. In embodiments, the Cas nuclease is derived from Acidaminococcus or or the Cpf1 nuclease of the Lachnospiraceae genus.

[0367] In some embodiments, the gRNA in combination with the RNA-guided DNA-binding agent is a ribonucleoprotein. In some embodiments, the RNA-guided DNA binding agent is referred to as a Ca 2+ complex (RNP). In some embodiments, the gRNA in combination with the Cas nuclease is In some embodiments, the RNP is a type I, type II, or type II RNP. In some embodiments, the Cas nuclease comprises a Type I component. In some embodiments, the Cas9 protein is a Cas9 protein from the Cas9 system. The gRNA is called Cas9 RNP.

[0368] Wild-type Cas9 has two nuclease domains: RuvC and HNH. The uvC domain cleaves non-target DNA strands, while the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 protein comprises more than one RuvC domain and and / or more than one HNH domain. In some embodiments, the Cas9 protein In each of the composition, use, and method embodiments, Cas induces double-strand breaks in target DNA.

[0369] Wild-type Cas9 has two nuclease domains: RuvC and HNH. The uvC domain cleaves non-target DNA strands, while the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 nuclease comprises more than one RuvC domain and and / or one or more HNH domains. In some embodiments, the Cas9 is a wild-type Cas9. In certain embodiments, the Cas nuclease can induce strand breaks. It may cleave DNA, cleave one strand of dsDNA, or cleave DNA. Exemplary Cas9 amino acid sequences include: is provided as SEQ ID NO: 203. An exemplary Ca The s9 mRNA ORF sequence is provided as SEQ ID NO: 204. Exemplary Cas9 mRNA coding sequences suitable for inclusion are SEQ ID NO:210 and and provided.

[0370] In some embodiments, a chimeric Cas nuclease is used, In enzymes, one domain or region of a protein is replaced by a portion of a different protein. In some embodiments, the Cas nuclease domain is a different nuclease domain, such as Fok1. In some embodiments, the domain from a Cas nuclease may be substituted. The nuclease may be a modified nuclease.

[0371] In other embodiments, the Cas nuclease is from a Type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a type I CRISPR / It may be a component of the cascade complex of the Cas system. The nuclease may be a Cas3 protein. The ase may be from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.

[0372] In some embodiments, the RNA-guided DNA binding agent has single-stranded nickase activity, i.e. that is, cleaving one DNA strand to create a single-strand break, also known as a "nick" In some embodiments, the RNA-guided DNA binding agent comprises a Cas nickase. Nickase creates a nick in dsDNA, i.e., one end of the DNA double helix is ​​broken. In some embodiments, the Cas nickase is an enzyme that cleaves one strand but not the other. , the endonuclease cleavage active site may be modified by one or more alterations in, for example, the catalytic domain ( A version of the Cas nuclease (e.g., a point mutation) that is inactivated For example, Cas nucleases, as discussed above. For example, Cas nickases and See U.S. Patent No. 8,889,356 for a discussion of exemplary catalytic domain alterations. In some embodiments, the Cas nickase, such as the Cas9 nickase, is inactivated. The amino acid sequence of an exemplary Cas9 nickase is Provided as SEQ ID NO: 206. An exemplary Cas sequence including a start codon and a stop codon The 9 nickase mRNA ORF sequence is provided as SEQ ID NO: 207. Fusion Protein An exemplary Cas9 nickase mRNA coding sequence suitable for inclusion in the material is SEQ ID NO: It is provided as No. 211.

[0373] In some embodiments, the RNA-guided DNA binder contains only one functional nuclease. For example, the protein of the agent may be modified to contain a nuclease domain. One of the amino acids is mutated or completely or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, the RuvC domain may be modified to have reduced activity. In some embodiments, a nickase having an inactive RuvC domain is used. In some embodiments, a nickase having reduced activity is used. In some embodiments, a nickase having an inactive HNH domain is used. A nickase having a hydroxyl group is used.

[0374] In some embodiments, conserved amino acids within a Cas protein nuclease domain is substituted to reduce or alter nuclease activity. Cas nucleases bind to amino acids in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include: The amino acid substitution was D10A (in the S. pyogenes Cas9 protein). For example, Zetsche et al. (2015) Cel See Oct 22:163(3): 759-771. In some embodiments, Ca The s nuclease contains amino acid substitutions in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include: are E762A, H840A, N863A, H983A, and D986A ( S. piogeogae (based on the S. pyogenes Cas9 protein). See He et al. (2015). Additional exemplary amino acid substitutions include D 917A, E1006A, and D1255A (Francisella novicida) novicida) U112 Cpf1 (FnCpf1) sequence (UniProtKB - A0Q 7Q2 (based on CPF1_FRATN)).

[0375] In some embodiments, the mRNA encoding the nickase is a target sequence that encodes both sense and alignant sequences. The antisense strand is provided in combination with a pair of guide RNAs, each complementary to the other. In an embodiment, the guide RNA directs the nickase to the target sequence and nicks the opposite strand of the target sequence. DSBs are introduced by creating a gap (i.e., double nicking). In this embodiment, the use of double nicking improves specificity and reduces off-target effects. In some embodiments, the nickase may target opposite strands of DNA to form a nucleotide sequence in the target DNA. In some embodiments, the nucleic acid sequence is used with two separate guide RNAs that generate a double nick in the target sequence. The nickases are selected to generate double nicks in the target DNA in close proximity. are used with separate guide RNAs.

[0376] In some embodiments, the RNA-guided DNA binding agent has cleavase and nickase activity. In some embodiments, the RNA-guided DNA-binding agent lacks dCas DNA binding. The dCas polypeptide has DNA binding activity and catalytic activity ( In some embodiments, the dCas polypeptide essentially lacks cleavase / nickase activity. The polypeptide is a dCas9 polypeptide. In some embodiments, the cleavage and RNA-guided DNA binders lacking chromatinase activity, or dCas DNA-binding polypeptides The endonuclease cleavage active site is, for example, one or more of the catalytic domains. The Cas gene is inactivated by multiple changes (e.g., point mutations). nucleases (e.g., Cas nucleases discussed above). For example, US201 See US2015 / 0166980A1. The 9 amino acid sequence is provided as SEQ ID NO: 208. An exemplary Cas9 mRNA ORF sequence containing the fusion protein is provided as SEQ ID NO: 209. An exemplary Cas9 mRNA coding sequence suitable for inclusion in a protein is SEQ ID NO: It is provided as No.:212.

[0377] In some embodiments, the RNA-guided DNA binding agent comprises one or more heterologous functional domains. The polypeptide may be or may comprise a fusion polypeptide.

[0378] In some embodiments, the heterologous functional domain is a functional domain that is capable of directing the delivery of the RNA-guided DNA-binding agent to the nucleus of a cell. For example, the heterologous functional domain may be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binder is fused with 1 to 10 NLSs. In some embodiments, the RNA-guided DNA binder may have 1 to 5 NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused to one NL When one NLS is used, the NLS may be fused to an RNA-guided DNA fragment. In some embodiments, R may be linked at the N-terminus or C-terminus of the A binder sequence. The NA-guided DNA binder may be fused to at least one NLS at the C-terminus. The NLS may also be inserted within the RNA-guided DNA binder sequence. In some cases, the RNA-guided DNA binder may be fused to more than one NLS. In embodiments, the RNA-guided DNA binder is fused with two, three, four, or five NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused to two NLSs. In certain circumstances, two NLSs may be the same (e.g., two SV4 0 NLS) or different. In some embodiments, the RNA-guided DNA-binding agent , fused to two SV40 NLS sequences linked at the carboxy terminus. In this embodiment, the RNA-guided DNA binder may be fused to two NLSs, One may be linked at the N-terminus and one at the C-terminus. In some embodiments, the RNA-guided DNA binder may be fused to three NLSs. In some embodiments, the RNA-guided DNA binder may not be fused to an NLS. In certain embodiments, the NLS may be, for example, SV40 NLS, PKKKRKV (SEQ ID NO: 274), or or a monopartite sequence such as PKKKRRV (SEQ ID NO: 275). In its morphology, the NLS is the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 276). In certain embodiments, a single P The NLS of KKKRKV (SEQ ID NO: 274) is located at the C-terminus of the RNA-guided DNA binder. One or more linkers may optionally be included at the fusion site. In some embodiments, one or more NLSs according to any of the preceding embodiments , one or more additional heterologous functions, such as any of the heterologous functional domains described below. domain in the RNA-guided DNA binder.

[0379] In some embodiments, the heterologous functional domain may be a functional domain that modulates the intracellular half-life of the RNA-guided DNA binding agent. In some embodiments, the half of the RNA-guided DNA binder may be modified. The half-life may be increased. In some embodiments, the half-life of the RNA-guided DNA binding agent is low. In some embodiments, the heterologous functional domain may be an RNA-guided DNA binding agent. In some embodiments, the heterologous function may be increased. The domain can reduce the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain may be a signal peptide for proteolysis. In some embodiments, proteolysis may involve, for example, proteasome degradation. proteolytic enzymes such as lysosomal proteases, calpain proteases, or In some embodiments, the heterologous functional domain may be mediated by a PEST sequence. In some embodiments, the RNA-guided DNA binding agent may comprise ubiquitin or poly(Asp-Asp-Asp). In some embodiments, ubiquitin may be modified by the addition of a ubiquitin chain. It may also be a chitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins These include small ubiquitin-like modifiers (SUMO), ubiquitin cross-reactive proteins (U CRP, also known as interferon-stimulated gene 15 (ISG15), ubiquitin-associated Unrestricted receptor modifier 1 (URM1), neural progenitor cell expressed, developmentally downregulated protein 8(neuronal-precursor-cell-expressed d evelopmentally downregulated protein-8;N EDD8 (also called Rub1 in S. cerevisiae), human white blood cell human leukocyte antigen F-assoc iated; FAT10), autophagy 8 (ATG8) and 12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin Ubiquitin-like protein 5 (UBL5) and ubiquitin-modifying factor 1 (UFM1) Examples include:

[0380] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of domains include fluorescent proteins, purification tags, epitope tags, and In some embodiments, the marker domain may be a fluorescent tag. Non-limiting examples of suitable fluorescent proteins include green fluorescent protein (GFP) and Proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, E GFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent protein ( For example, YFP, EYFP, Citrine, Venus, YPet, PhiYFP, Z sYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azuri te, mKalamal, GFPuv, Sapphire, T-sapphire), Fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan) 1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, m Kate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed -Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), and orange fluorescent protein (mOrange, m KO, Kusabira-Orange, Monomeric Kusabira-Or Tangerine, mTangerine, tdTomato) or any other suitable fluorescent tan In other embodiments, the marker domain may be a purification tag and / or an enzyme. Non-limiting exemplary tags include glutathione-S-tetope tags. transferase (GST), chitin-binding protein (CBP), maltose-binding protein Protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity - Purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLA G, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu -Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHi s, biotin carboxyl carrier protein (BCCP), polyHis, and Calmo Non-limiting exemplary reporter genes include glutathione- S-transferase (GST), horseradish peroxidase (HRP), Chloramphenicol acetyltransferase (CAT), beta-galactosidase , beta-glucuronidase, luciferase, or fluorescent proteins.

[0381] In additional embodiments, the heterologous functional domain targets the RNA-guided DNA-binding agent to specific subcellular compartments. In some embodiments, the heterologous functional domain may be targeted to an organ, cell type, tissue, or organ. Mainly, RNA-guided DNA binding agents may be targeted to mitochondria.

[0382] In a further embodiment, the heterologous functional domain may be an effector domain. When a NA-guided DNA binder is directed to its target sequence, e.g., a Cas nuclease When the enzyme is directed to the target sequence by the gRNA, the effector domain binds to the target sequence. In some embodiments, the effector domain may modify or affect the target sequence. are nucleic acid binding domains, nuclease domains (e.g., non-Cas nuclease domains) ), epigenetic modification domain, transcriptional activation domain, or transcriptional repressor In some embodiments, the heterologous functional domain may be selected from the FokI nucleic acid. Nucleases such as nucleases are described in, for example, U.S. Pat. No. 9,023,649. In some embodiments, the heterologous functional domain is a transcriptional activator or repressor. For example, Qi et al., “Repurposing CRISPR as a n RNA-guided platform for sequence-speci fic control of gene expression,”Cell 152 :1173-83(2013);Perez-Pinera et al., “RNA- guided gene activation by CRISPR-Cas9-ba sed transcription factors,”Nat.Methods 1 0:973-6(2013);Mali et al., “CAS9 transcript ptional activators for target specificit y screening and paired nickases for coop erative genome engineering,”Nat.Biotechn ol.31:833-8(2013);Gilbert et al., “CRISPR -mediated modular RNA-guided regulation of transcription in eukaryotes,”Cell 154 :442-51 (2013). Therefore, RNA-guided DNA binders are essentially , a transcription factor that can use a guide RNA to direct binding to a desired target sequence.

[0383] D. Determining gRNA Efficacy In some embodiments, the efficacy of the gRNA is determined by its delivery or delivery together with other components that form the RNP. is determined when expressed. In some embodiments, the gRNA is a protein that encodes a gene encoding a Cas protein, etc. In some embodiments, the gRNA is expressed together with an RNA-guided DNA nuclease. Cells that already stably express RNA-guided DNA nucleases, such as Cas proteins In some embodiments, the gRNA is delivered to or expressed in the cell line. In some embodiments, the gRNA is delivered to the cell as part of the Cas nucleus. It is delivered into cells along with mRNA encoding an RNA-guided DNA nuclease such as .

[0384] As described herein, the RNA-guided DNA nucleic acids disclosed herein The use of the ATPase and guide RNA can create a double-strand break in the DNA, Strand breaks produce errors in the form of insertion / deletion (indel) mutations when repaired by the cellular machinery. Many mutations resulting from indels can cause misreading of the reading frame. altering or introducing a premature stop codon, thus producing a non-functional protein .

[0385] In some embodiments, the efficacy of a particular gRNA can be assessed based on an in vitro model. In some embodiments, the in vitro model stably expresses Cas9. In some embodiments, the in In some embodiments, the in vitro model is HUH7 human hepatocellular carcinoma cells. In some embodiments, the in vitro model is HepG2 cells. In some embodiments, the in vitro model is a primary human hepatocyte. Regarding the use of primary human hepatocytes, experiments were carried out using commercially available primary human hepatocytes. In some embodiments, deletions or insertions can provide greater consistency between experiments. Off-target sites occur in in vitro models (e.g., primary human hepatocytes) The number of positions is determined by, for example, transfection of Cas9 mRNA and guide RNA in vitro. This is determined by analyzing genomic DNA from infected primary human hepatocytes. In some embodiments, such determination is performed by in vitro analysis of Cas9 mRNA, from primary human hepatocytes transfected with donor RNA and donor oligonucleotides. An exemplary procedure for such a determination is as follows: is provided in the examples.

[0386] In some embodiments, the efficacy of a particular gRNA can be assessed by multiple selection processes. In some embodiments, the selected g Cell line comparisons of data using RNA are performed. In some embodiments, multiple cell models Cross-screening is performed in the following cases:

[0387] In some embodiments, the efficacy of a particular gRNA is determined based on an in vivo model. In some embodiments, the in vivo model is a rodent model. In embodiments, the rodent model is a human TTR model, which may be a mutant human TTR gene. In some embodiments, the in vivo model is a mouse expressing the R gene. Primates, such as cynomolgus monkeys.

[0388] In some embodiments, the efficacy of the guide RNA is measured by percent editing of the TTR. In some embodiments, percent TTR editing is determined, for example, by in vitro modeling. in cell culture medium for models, or in serum or tissue for in vivo models. The editing parts required to achieve knockdown of the TTR protein Compared to cents.

[0389] In some embodiments, the efficacy of the guide RNA is assessed by the expression of the target cell. Measured by the number and / or frequency of indels in off-target sequences within the genome of the species. In some embodiments, indels are identified in the cell population and / or at the target site. The frequency of occurrence of HIV-1 at off-target sites is very low (e.g., <5%) compared to the frequency of production. Thus, the present disclosure provides effective guide RNAs for generating markers in target cell types. Does not exhibit off-target indel formation in cells (e.g., hepatocytes) or in cell populations <5% off-target activity compared to the frequency of indel generation at and / or the target site In some embodiments, the present disclosure provides guide RNAs that generate a frequency of twin del formation. does not exhibit any off-target indel formation in the target cell type (e.g., hepatocytes). In some embodiments, a guide RNA that does not contain a nucleotide sequence, such as one described herein, is provided. or at fewer than five off-target sites as assessed by multiple methods In some embodiments, guide RNAs are provided that generate the nucleic acid sequences described herein, for example. 4, 3, 2, or less than 1, as assessed by one or more of the methods listed Generate indels at or equal to 4, 3, 2, or 1 off-target site In some embodiments, guide RNAs are provided that target (one or more) off-target genes. The nucleotide site is located in a protein-coding region in the genome of a target cell (e.g., a hepatocyte). It doesn't happen.

[0390] In some embodiments, the formation of insertion / deletion ("indel") mutations in the target DNA and Detection of gene editing events, such as homology-directed repair (HDR) events, can be achieved using tagged primers. The linear amplification and tagged amplification products are isolated (hereinafter , "LAM-PCR," or "Linear Amplification (LA)" method).

[0391] In some embodiments, the method comprises the step of: stimulating a double strand break (DSB) to form a double strand break; Optionally, isolate cellular DNA from cells that have been provided with HDR templates to repair DSBs. performing at least one cycle of linear amplification of DNA using tagged primers; and; isolating the linear amplification product containing the tag, thereby amplifying it using non-tagged primers. discarding any isolated amplification products; optionally, further amplifying the isolated products. and analyzing the linear amplification product, or further amplification products, to identify, e.g., target The presence of editing events such as double-strand breaks, insertions, deletions, or HDR template sequences in the DNA or In some cases, editing events can be quantified. quantification used in the context of HDR and non-HDR editing events, e.g., indels (including in) the frequency of editing events in a population and / or (one or more) This includes detecting the type.

[0392] In some embodiments, only one cycle of linear amplification is performed.

[0393] In some cases, the tagged primer comprises a molecular barcode. The tagged primer contains a molecular barcode, and only one cycle of linear amplification is performed. .

[0394] In some embodiments, the analyzing step comprises synthesizing the linear amplification product or the further amplification product. Sequencing includes next-generation sequencing and cloning the linear amplification product or further amplification product into a plasmid; nucleotide sequences known to those skilled in the art, such as sequencing a plasmid or a portion of a plasmid. In other aspects, the analyzing step may involve analyzing linear amplification products or further The resulting amplified products are then subjected to digital PCR (dPCR) or droplet digital PCR. In other cases, the analysis step involves performing a linear amplification product or or further amplification products are subjected to nuclear amplification designed to identify DNA containing HDR template sequences. contacting the acid probe and linear amplification product(s) or and detecting the probe bound to the further amplification product(s). In embodiments, the method further comprises determining the location of the HDR template in the target DNA.

[0395] In certain embodiments, the method further comprises determining the sequence of the insertion site in the target DNA. The insertion site is the position where the HDR template is integrated into the target DNA, and the insertion The entry site may comprise a portion of the target DNA sequence and a portion of the HDR template sequence.

[0396] In some embodiments, linear amplification of target DNA using tagged primers can range from 1 to 50 s cycle, 1-60 cycles, 1-70 cycles, 1-80 cycles, 1-90 cycles, Or it is carried out for 1 to 100 cycles.

[0397] In some embodiments, linear amplification of target DNA using tagged primers results in DNA duplex amplification. A denaturation step to separate the plexes, followed by annealing to bind the primers In some embodiments, the linear amplification is carried out isothermally. (No change in temperature is required.) In some embodiments, isothermal linear amplification can be achieved using techniques such as loop-mediated amplification. Thermal amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification, or nicking It is an enzymatic amplification reaction.

[0398] In some embodiments, the tagged primer is located at the predicted editing event location, e.g., an insertion, deletion, or at least 50, at least 60, at least 70, or at least At least 80, at least 90, at least 100, at least 110, at least 120 , at least 130, at least 140, at least 150, at least 160, less At least 170, at least 180, at least 190, at least 200, at least 21 0, at least 220, at least 230, at least 240, at least 250, at least At least 260, at least 270, at least 280, at least 290, at least 3 00, at least 1,000, at least 5,000, or at least 10,000 The nucleotides separate and anneal to the target DNA.

[0399] In some embodiments, the tagged primer comprises a molecular barcode. In some embodiments, the molecular barcode comprises a sequence that is not complementary to the target DNA. The barcode comprises 6, 8, 10, or 12 nucleotides.

[0400] In some embodiments, the tag on the primer may be biotin, streptavidin, digoxin, or the like. sigenin, DNA sequences, or fluorescein isothiocyanate (FITC).

[0401] In some embodiments, the linear amplification product(s) are / are linked to tags on the primers. In some embodiments, the capture reagent is a bead, solid support, or a mixture of both. In some embodiments, the isolation step comprises: contacting the linear amplification product(s) with a capture reagent specific for the tag on the primer; In some embodiments, the capture reagent is biotin, streptavidin, with digoxigenin, DNA sequences, or fluorescein isothiocyanate (FITC) be.

[0402] In some embodiments, the tag is biotin and the capture reagent is streptavidin. In some embodiments, the tag is streptavidin and the capture reagent is biotin. In some embodiments, the tag is located at the 5' end of the primer, the 3' end of the primer, or is internal to the primer. In some embodiments, the tag and / or capture reagent is isolated. In some embodiments, the tag and / or capture reagent are removed after the step. and further amplification and analysis steps are performed in the presence of tags and / or capture. can be.

[0403] In some embodiments, the further amplification is non-linear. The amplification is digital PCR, qPCR, or RT-PCR. The sequencing is next-generation sequencing (NGS).

[0404] In some embodiments, the target DNA is genomic or mitochondrial DNA. In some embodiments, the target DNA is genomic DNA of a prokaryotic or eukaryotic cell. In this embodiment, the target DNA is mammalian DNA. The target DNA is expressed in non-dividing cells or In some embodiments, the target DNA may be from a dividing cell. In some embodiments, the target DNA is from a replicating cell. .

[0405] In some cases, the cellular DNA is sheared prior to linear amplification. The sheared DNA has an average size of 0.5 kb to 20 kb. Cellular DNA was measured at 0.5, 0.75, 1.0, 1.25, 1.5, 1.75, 2.0, and 2.2 5, 2.5, 2.75, 3.0, 3.25, 3.5, 3.75, 4.0, 4.25, 4. 5, 4.75, 5.0, 5.25, 5.5, 5.75, 6.0, 6.25, 6.5, 6. 75, 7.0, 7.25, 7.5, 7.75, 8.0, 8.25, 8.5, 8.75, 9 .0, 9.25, 9.5, 9.75, 10.0, 10.25, 10.5, 10.75, 1 1.0, 11.25, 11.5, 11.75, 12.0, 12.25, 12.5, 12. 75, 13.0, 13.25, 13.5, 13.75, 14.0, 14.25, 14.5 , 14.75, 15.0, 15.25, 15.5, 15.75, 16.0, 16.25, 16.5, 16.75, 17.0, 17.25, 17.5, 17.75, 18.0, 18 .25, 18.5, 18.75, 19.0, 19.25, 19.5, 19.75, or In some cases, cellular DNA is sheared to an average size of approximately 1.5 kb. It is sheared to an average size of b.

[0406] In some embodiments, the efficacy of the guide RNA is measured by the secretion of TTR. In this embodiment, TTR secretion is measured by enzyme-linked immunosorbent assay using cell culture medium or serum. In some embodiments, the TTR activity is measured using an ELISA assay. Secretion is performed using the same in vitro or in vivo system used to measure editing. In some embodiments, TTR secretion is measured in primary human stems or models. In some embodiments, TTR secretion is measured in HUH7 cells. In some embodiments, TTR secretion is measured in HepG2 cells. can be.

[0407] ELISA assays are commonly known to those skilled in the art and are used to determine serum TTR levels. In one exemplary embodiment, blood is collected and serum is isolated. Mouse Prealbumin (Transthyretin) ELISA K it(Aviva Systems Biology, Cat.OKIA00111) Total TTR serum levels were determined using a kit similar to that used to measure human TTR. If a kit is not available, a capture antibody specific for the TTR being measured can be prepared as a backup. The coated plates can then be used to develop an ELISA. The mixture is incubated at room temperature for a period of time and then washed. The conjugate is added and incubated. The antibody conjugate is removed, the plate is washed, and then reacted with the enzyme. s) A color-developing substrate solution is added. The appropriate absorbance is determined based on the enzyme and substrate used. The plate is read in an appropriate plate reader.

[0408] In some embodiments, the amount of TTR in cells (e.g., from tissue) determines the amount of gRNA. In some embodiments, the amount of TTR in the cells is measured by Western blot analysis. In some embodiments, the cells used are HUH7 cells. In some embodiments, the cells used are primary human hepatocytes. In some embodiments, the cells to be cultured are primary cells obtained from an animal. The amount of TTR regulates the production of glyceraldehyde 3-phosphate dehydrogenase (G3P) to control changes in cell number. It is compared with the amount of the enzyme GAPDH (a housekeeping gene).

[0409] III. LNP Formulations and Treatment of ATTR In some embodiments, a method for inducing a double-strand break (DSB) in the TTR gene comprises: , any one or more guide sequences of SEQ ID NOs: 5 to 82, or SEQ ID NO: 87 A composition comprising a guide RNA containing any one or more of the 124 sgRNAs is administered. In some embodiments, a method is provided that includes administering a guide of SEQ ID NOs: 5 to 82. A gRNA containing one or more of the above-mentioned sequences is administered to induce a DSB in the TTR gene. The guide RNA is an RNA such as a Cas nuclease (e.g., Cas9). RNA, such as a guide DNA nuclease or Cas nuclease (e.g., Cas9) It may be administered together with an mRNA or vector encoding a guide DNA nuclease. stomach.

[0410] In some embodiments, the method for modifying the TTR gene comprises the steps of: any one or more of the sgRNA sequences of SEQ ID NOs: 87 to 124 The method includes administering a composition comprising a guide RNA comprising one or more of In some embodiments, any one of the guide sequences of SEQ ID NOs: 5-82 is provided. or more than one, or one or more of the sgRNAs of SEQ ID NOs: 87 to 124. The gRNA containing the guide RNA is then administered to modify the TTR gene. RNA-guided DNA nucleases or Cas nucleases, such as Cas9 mRNA encoding an RNA-guided DNA nuclease such as Cas9 Alternatively, it may be administered together with a vector.

[0411] In some embodiments, the method of treating ATTR comprises administering to a subject a guide molecule of SEQ ID NOs: 5-82. Any one or more of the sequences, or any of the sgRNAs of SEQ ID NOs: 87 to 124 The method includes administering a composition comprising one or more guide RNAs. In some embodiments, any one of the guide sequences of SEQ ID NOs: 5 to 82 or or a g containing one or more of the sgRNAs of SEQ ID NOs: 87 to 124 RNA is administered to treat ATTR. The guide RNA binds to a Cas nuclease (e.g., RNA-guided DNA nucleases such as Cas9 or Cas nucleases (e.g., mRNA encoding an RNA-guided DNA nuclease such as Cas9 It may be administered together with the vector.

[0412] In some embodiments, the method comprises reducing serum concentrations of TTR, the method comprising administering to a subject a polypeptide of SEQ ID NO:5-8. Any one or more of the guide sequences of SEQ ID NOs: 87 to 124 A method is provided, comprising administering a guide RNA comprising any one or more of A. In some embodiments, any one or more of the guide sequences of SEQ ID NOs: 5 to 82 are used. gRNAs containing one or more of the sgRNAs of SEQ ID NOs: 87 to 124 A is administered to reduce or prevent the accumulation of TTR in amyloid or amyloid fibrils. gRNAs are RNA-guided nucleases such as Cas nucleases (e.g., Cas9). RNA-guided nucleases such as A nuclease or Cas nuclease (e.g., Cas9) It may also be administered together with an mRNA or vector encoding A nuclease.

[0413] In some embodiments, the accumulation of TTR in amyloid or amyloid fibrils in a subject is reduced. A method for reducing or preventing a gene mutation, comprising administering any one of the guide sequences of SEQ ID NOs: 5 to 82 to a patient. or a plurality of sgRNAs, or one or a plurality of sgRNAs of SEQ ID NOs: 87 to 124 In some embodiments, a method is provided, comprising administering a composition comprising a guide RNA comprising the In this condition, the present invention reduces or prevents the accumulation of TTR in amyloid or amyloid fibrils in a subject. A method for preventing a tumor comprising administering any one or more of the sgRNAs of SEQ ID NOs: 87 to 113 to a tumor suppressor comprising: In some embodiments, a method is provided comprising administering a composition comprising SEQ ID NO: Any one or more of the guide sequences of SEQ ID NOs: 5 to 82 or sg of SEQ ID NOs: 87 to 124 A gRNA containing one or more of the following RNAs is administered to detect amyloid or amyloid-associated proteins: The accumulation of TTR in cytoplasmic fibrils is reduced or prevented. RNA-guided DNA nucleases or Cas nucleases, such as Cas9 mRNAs encoding RNA-guided DNA nucleases such as Cas9 Alternatively, it may be administered together with a vector.

[0414] In some embodiments, a guide sequence from Table 1 or one or more sgRNs from Table 2 A-containing gRNAs are used in conjunction with RNA-guided DNA nucleases such as Cas nucleases. , which induces DSBs and non-homologous end joining (NHEJ) during repair, In some embodiments, NHEJ results in a mutation of one or more nucleosomal regions. This results in a deletion or insertion of a nucleotide sequence that is a frameshift in the TTR gene. Induce a nucleotide or nonsense mutation.

[0415] In some embodiments, the gases of the present invention (e.g., in the compositions provided herein) Administering the antibody reduces the level (e.g., serum level) of TTR in the subject. and thus inhibit the accumulation and aggregation of TTR in amyloid or amyloid fibrils. Prevent.

[0416] In some embodiments, the accumulation of TTR in amyloid or amyloid fibrils in a subject is reduced. The reduction or prevention may involve reducing or preventing one or more of the following: In some embodiments, the method comprises reducing or preventing the deposition of TTR in a tissue. The tissue comprises the sciatic nerve or dorsal root ganglion. In some embodiments, TTR deposition is in the stomach, kidney, or other organs. It is reduced in two, three, or four of the following tissues: the gut, the dorsal root ganglion, and the sciatic nerve. The level of deposition in the tissue can be determined using biopsy samples, for example using immunostaining. In some embodiments, TTR in the subject's amyloid or amyloid fibrils can be reducing or preventing the accumulation of TTR and / or reducing or preventing the deposition of TTR Prevention is presumed based on reducing serum TTR levels over a period of time. As discussed in the Examples, the methods and uses provided herein The reduction in serum TTR levels is measured, for example, 8 weeks after administration of the composition. Clearance of deposited TTR from tissues such as those discussed above and in the Examples It has been discovered that this can result in

[0417] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a cow, pig, monkey, sheep, dog, cat, fish, or domestic animal. It is a bird.

[0418] In some embodiments, a method for preparing a medicament for treating a human subject with ATTR is provided. any of the guide sequences in Table 1 (e.g., in the compositions provided herein) or one or more guide RNAs comprising one or more sgRNAs from Table 2 The use of

[0419] In some embodiments, the guide RNAs, compositions, and formulations are administered intravenously. In some embodiments, the guide RNAs, compositions, and formulations are administered into the hepatic circulation.

[0420] In some embodiments, a single dose of a composition comprising a guide RNA provided herein The administration of the compound is sufficient to knock down expression of the mutant protein. In some embodiments, a single administration of a composition comprising a guide RNA provided herein can result in a concentration of cells. It is sufficient to knock out expression of the mutant protein in the population. In the present invention, more than one administration of a composition provided herein comprising a guide RNA may be It may be beneficial to maximize editing through a cumulative effect. The provided compositions may be administered 2, 3, 4, 5 or more times, e.g., twice. Administration can be, for example, 1 day to 2 years, for example, 1 to 7 days, 7 to 14 days, or 14 to 30 days. , 30 days to 60 days, 60 days to 120 days, 120 days to 183 days, 183 days to 274 days, 27 They may be separated by periods ranging from 4 days to 366 days, or from 366 days to 2 years.

[0421] In some embodiments, the composition contains 0.01 to 10 mg / kg (mpk), for example, 0. 01~0.1mpk, 0.1~0.3mpk, 0.3~0.5mpk, 0.5~1mpk , 1-2mpk, 2-3mpk, 3-5mpk, 5-10mpk, or 0.1, 0.2 , administered at an effective dose within the range of 0.3, 0.5, 1, 2, 3, 5, or 10 mpk .

[0422] In some embodiments, the efficacy of treatment with the compositions of the present invention is measured at 1 year, 2 years, 3 years, or 4 years after delivery. In some embodiments, the compositions of the present invention are used to treat or prevent the recurrence of ulcers or ulcers. The efficacy of the treatment was assessed by measuring serum levels of TTR before and after treatment. In some embodiments, the composition is used as assessed via a reduction in serum levels of TTR. The effectiveness of the treatment was evaluated at 1 week, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, and 6 months. It can be seen at 1 month, 7 months, 8 months, 9 months, 10 months, or 11 months.

[0423] In some embodiments, treatment slows or stops disease progression.

[0424] In some embodiments, the treatment slows or stops the progression of FAP. In these conditions, treatment includes improving the symptoms of sensorimotor or autonomic neuropathy, This results in stabilization or slowing of change.

[0425] In some embodiments, treatment results in improvement, stabilization, or slowing of change in symptoms of FAC. In some embodiments, the treatment results in symptoms of restrictive cardiomyopathy or congestive heart failure. This results in improvement, stabilization, or slowing of change in the condition.

[0426] In some embodiments, the efficacy of treatment is measured by an increase in the subject's survival time.

[0427] In some embodiments, the efficacy of treatment is measured by the reduction of symptoms of sensorimotor or autonomic neuropathy. In some embodiments, the efficacy of treatment is measured by an improvement or slowing of progression of the condition. A slowed or increased ability to move or perceive any body area. In some embodiments, the effectiveness of treatment is measured by swallowing, breathing, moving an arm, hand, leg, or or improvement or slowing of decline in the ability to use the legs or walk. In some embodiments, the efficacy of treatment is measured by an improvement or slowing of progression of neuralgia. In some embodiments, neuralgia is characterized by pain, burning, tingling, or abnormal sensations. In some embodiments, the effectiveness of treatment is characterized by the reduction of orthostatic hypotension, dizziness, gastrointestinal problems, and the like. This is measured by improvement or slowing of increase in motility, bladder, or sexual dysfunction. In some embodiments, the efficacy of treatment is measured by an improvement or slowing of progression of frailty. In some embodiments, the efficacy of treatment is assessed using electromyography, nerve conduction studies, or patient-reported outcomes. It is measured using a cam.

[0428] In some embodiments, the efficacy of treatment is measured by improvement in symptoms of congestive heart failure or CHF or In some embodiments, the efficacy of treatment is measured by a slowing of progression of shortness of breath, difficulty breathing, or fatigue, or decreased or increased swelling in the ankles, feet, legs, abdomen, or jugular veins In some embodiments, the effectiveness of treatment is measured by an improvement in fluid structure in the body. This is measured by improvement or slowing of progression, which may be due to indicators such as weight gain, frequent urination, or nighttime coughing. In some embodiments, the efficacy of treatment may be assessed by cardiac biomarkers. Tests (e.g., B-type natriuretic peptide [BNP] or N-terminal pro-b-type natriuretic peptide [BNP]) Neutropenia-proBNP (pro-brain natriuretic peptide [NT-proBNP]), pulmonary function tests, chest x-ray, or electrocardiography It is measured using

[0429] A. Combination Therapy In some embodiments, the present invention provides a method for treating a pulmonary arthritis (e.g., in a composition provided herein). Any one or more of the guide sequences disclosed in Table 1 or the sgRNAs in Table 2 Any one of the gRNAs containing one or more of the above is used to alleviate the symptoms of ATTR. The present invention also includes combination therapy comprising the treatment of a patient with an additional therapy suitable for achieving the above-mentioned objective.

[0430] In some embodiments, the additional therapy for ATTR is a sensorimotor or autonomic neurotherapy. In some embodiments, the treatment of sensorimotor or autonomic neuropathy. Treatment includes nonsteroidal anti-inflammatory drugs, antidepressants, anticonvulsants, and antiarrhythmic drugs. In some embodiments, the drug is a psychiatric medication, or an anesthetic. Antidepressants are tricyclic or serotonin-norepinephrine reuptake inhibitors. In some embodiments, the antidepressant is amitriptyline, duloxetine In some embodiments, the anticonvulsant is gabapentin, promethazine, or venlafaxine. In some embodiments, the agent is regabalin, topiramate, or carbamazepine. An additional therapy for dynamic neuropathy is transcutaneous electrical nerve stimulation.

[0431] In some embodiments, the additional therapy for ATTR is restrictive cardiomyopathy or congestive heart failure. In some embodiments, the treatment for CHF is an ACE inhibitor. , aldosterone antagonists, angiotensin receptor blockers, beta-blockers, digo The drug is an antihistamine, a diuretic, or isosorbide dinitrate / hydralazine hydrochloride. In this condition, ACE inhibitors include enalapril, captopril, ramipril, perindopril, In some embodiments, the aldosterone antagonist is imidapril or quinapril. In some embodiments, the angiotensin inhibitor is eplerenone or spironolactone. The vasodilators are azilsartan, candesartan, and ezetimibe. Prosartan, irbesartan, losartan, olmesartan, telmisartan, or In some embodiments, the beta blocker is acebutolol, atenolol, or valsartan. ol, bisoprolol, metoprolol, nadolol, nebivolol, or propranolol In some embodiments, the diuretic is chlorothiazide, chlorthalidone, hydrochloride, Lochlorothiazide, indapamide, metolazone, bumetanide, furosemide, torasemide, Amiloride, or triamterene.

[0432] In some embodiments, the combination therapy includes (e.g., a combination of ) Any one or more of the guide sequences disclosed in Table 1 or the sgRNs in Table 2 Any one of the gRNAs containing one or more of A, TTR or a mutation In some embodiments, the siRNA is a wild-type TTR siRNA. Any s that can further reduce or eliminate expression of normal or mutant TTR. In some embodiments, the siRNA is the drug patisiran (ALN-TTR 02) or ALN-TTRsc02. In some embodiments, the siRNA is Any of the guide sequences disclosed in Table 1 (e.g., in the compositions provided herein) gR comprising one or more or any one or more of the sgRNAs in Table 2 In some embodiments, the siRNA is administered after any one of the NAs described herein. The gRNA compositions are administered periodically following treatment with any of the gRNA compositions provided herein.

[0433] In some embodiments, the combination therapy includes (e.g., a combination of ) Any one or more of the guide sequences disclosed in Table 1 or the sgRNs in Table 2 Any one of the gRNAs containing one or more of A, TTR or a mutation In some embodiments, the antisense nucleotides are selected from the group consisting of TTR, TTR-specific ... The antisense nucleotides further reduce the expression of wild-type or mutant TTR. In some embodiments, the antisense nucleotide is any antisense nucleotide that can be removed. The antisense nucleotide is the drug inotersen (IONS-TTR) Rx ) Some In embodiments, the antisense nucleotides are selected from the group consisting of nucleotides (e.g., those derived from the compositions provided herein) and nucleotides (e.g., those derived from the compositions provided herein). any one or more of the guide sequences disclosed in Table 1 or s in Table 2 The gRNAs are administered after any one of the gRNAs containing any one or more of the gRNAs. In some embodiments, the antisense nucleotides are selected from the group consisting of the gRNs provided herein. A composition is administered periodically after treatment with either of the compositions.

[0434] In some embodiments, the combination therapy includes (e.g., a combination of ) Any one or more of the guide sequences disclosed in Table 1 or the sgRNs in Table 2 Any one of the gRNAs containing one or more of A was correctly folded. along with a small molecule stabilizer that promotes kinetic stabilization of the blocked tetrameric form of TTR. In this embodiment, the small molecule stabilizer is the drug tafamidis (Vyndaqel®) or is diflunisal. In some embodiments, the small molecule stabilizer is (e.g., Any one or more of the guide sequences disclosed in Table 1) in the compositions provided herein. or any one of the gRNAs comprising any one or more of the sgRNAs in Table 2. In some embodiments, the small molecule stabilizer is administered after one of the methods provided herein. The gRNA composition is administered periodically after treatment with either of the following gRNA compositions:

[0435] B. Delivery of gRNA Compositions In some embodiments, the guide RNA compositions described herein can be used alone or in combination. or encoded on multiple vectors and incorporated into lipid nanoparticles or lipid It is administered via nanoparticles. For example, the LIPID NANOPARTICLE FORMULATIONS FOR CRISPR / CA PCT / US2017 / 024973 (including See the entire contents of which are incorporated herein by reference. Any lipid nanoparticle (LNP) known to one of skill in the art that can deliver the lipid nanoparticles described herein can be used. In addition to guide RNAs, RNA-guided DNA nucleases such as Cas or Cas9 are also used. RNA guides, such as mRNA encoding the Cas or Cas9 proteins themselves. It may be used in conjunction with any of the DNA nucleases.

[0436] Various embodiments of LNP formulations for RNA, such as CRISPR / Cas cargo, are described herein. Such LNP formulations include (i) CCD lipids, e.g., amine lipids. (ii) neutral lipids, (iii) helper lipids, and (iv) stealth lipids, e.g. Some embodiments of the LNP formulation may include a helper lipid, a neutral lipid, and stealth lipids, such as PEG lipids, along with "amine lipids." A "lipid" is a group of multiple (i.e., more than one) lipids physically associated with each other by intermolecular forces. It means particles that contain molecules.

[0437] CCD lipids

[0438] Lipid compositions for delivery of CRISPR / Cas mRNA and guide RNA components to hepatocytes The composition contains CCD lipids.

[0439] In some embodiments, the CCD lipid is lipid A, wherein lipid A is (9Z,12Z)- 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(di Ethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,1 2-dienoate, 3-((4,4-bis(octyloxy)butanoyl)oxy )-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)prop Also known as propyl(9Z,12Z)-octadeca-9,12-dienoate. Lipid A can be expressed as follows:

[0440] [ka]

[0441] Lipid A can be synthesized according to WO2015 / 095340 (e.g., pages 84-86). It may be made.

[0442] In some embodiments, the CCD lipid is lipid B, which is ((5-((dimethylamino)methyl (amino)methyl)-1,3-phenylene)bis(oxy))bis(octane-8,1- diyl)bis(decanoate), ((5-((dimethylamino)methyl)-1,3 -phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate) Lipid B can be represented as follows:

[0443] [ka]

[0444] Lipid B can be prepared according to WO2014 / 136086 (e.g., pages 107-09). It may also be synthesized.

[0445] In some embodiments, the CCD lipid is lipid C, and lipid C is 2-((4-((( 3-(Dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy) Propane-1,3-diyl(9Z,9'Z,12Z,12'Z)-bis(octadeca-9 ,12-dienoate). Lipid C can be represented as follows: [ka]

[0446] In some embodiments, the CCD lipid is lipid D, and lipid D is a 3-(((3-(diamino)methyl group Methylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)trimethylamino Decyl 3-octylundecanoate.

[0447] Lipid D can be represented as follows: [ka]

[0448] Lipid C and lipid D may be synthesized according to WO2015 / 095340. stomach.

[0449] The CCD lipid may also be an equivalent of lipid A, lipid B, lipid C, or lipid D. In certain embodiments, the CCD lipids are equivalents of lipid A, equivalents of lipid B, lipid It is an equivalent of lipid C or an equivalent of lipid D.

[0450] Amine lipids

[0451] In some embodiments, LNP compositions for delivery of bioactive agents include "amine lipids," The amino lipids are lipid A, lipid B, lipid C, lipid D, or equivalents of lipid A (lipid Acetal analogues of lipid A), equivalents of lipid B, equivalents of lipid C, and lipid D is defined as the equivalent of

[0452] In some embodiments, the amine lipid is lipid A, wherein lipid A is (9Z,12Z)- 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(di Ethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,1 2-dienoate, 3-((4,4-bis(octyloxy)butanoyl)oxy )-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)prop Also known as propyl(9Z,12Z)-octadeca-9,12-dienoate. Lipid A can be expressed as follows: [ka]

[0453] Lipid A can be synthesized according to WO2015 / 095340 (e.g., pages 84-86). In certain embodiments, the amine lipid is an equivalent of lipid A.

[0454] In certain embodiments, the amine lipid is an analog of lipid A. In some embodiments, the lipid A analog is an acetal analog of lipid A. Certain LNP Compositions In some embodiments, the acetal analog is a C4 to C12 acetal analog. In some embodiments, the acetal analog is a C5-C12 acetal analog. In a further embodiment, the acetal analog is a C5-C10 acetal analog. , acetal analogs are C4, C5, C6, C7, C9, C10, C11, and C1 Two acetal analogs are selected.

[0455] Amine lipids suitable for use in the LNPs described herein are those that are Biodegradable in vo. Amine lipids have low toxicity (e.g., 10 mg / kg Doses greater than or equal to 10 mg / kg were tolerated in animal models without adverse effects. In certain embodiments, the LNPs comprising amine lipids include at least one amine lipid. 75% of patients responded within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or or those that are cleared from plasma within 10 days. In this case, LNPs containing amine lipids should contain at least 50% of the mRNA or gRNA. but 8, 10, 12, 24, or 48 hours, or 3, 4, 5, 6, 7, or 1 In certain embodiments, the anticoagulant is cleared from plasma within 0 days. Examples of LNPs containing amine lipids include lipids (e.g., amine lipids), RNA (e.g., , mRNA), or other components, at least 50% of the LNPs are , 10, 12, 24, or 48 hours, or 3, 4, 5, 6, 7, or 10 days In certain embodiments, the LNPs are cleared from the plasma within a short time. Lipid-encapsulated lipid, RNA, or nucleic acid components are measured relative to their free forms.

[0456] Lipid clearance may be measured as described in the literature. Maier, MA .,et al.Biodegradable Lipids Enabling Ra pidly Eliminated Lipid Nanoparticles for Systemic Delivery of RNAi Therapeutics. See Mol.Ther.2013,21(8),1570-78 ("Maier"). For example, Maier has developed LNP-siRNP containing luciferase-targeting siRNA. System A was administered by intravenous bolus injection via the lateral tail vein at 0.3 mg / kg for 6 to 8 weeks. The test was administered to male C57Bl / 6 mice. Blood, liver, and spleen samples were collected 0. After 0.83, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 96, and 168 hours After the mice were perfused with saline, tissue collections and blood samples were processed. Plasma was obtained. All samples were processed and analyzed by LC-MS. describes a procedure for assessing toxicity after administration of LNP-siRNA formulations. For example, luciferase-targeting siRNA was administered to male Sprague-Dawley rats at a dose of 5 mL / 0, 1, 3, 5, and 10 mg / kg via single intravenous bolus injection in a dose volume of 100 mg / kg kg (5 animals / group). After 24 hours, approximately 1 mL of the drug was administered via the jugular vein of the conscious animals. Blood was obtained and serum isolated. 72 hours after dosing, all animals were taken to hospital for necropsy. Clinical signs, body weight, serum chemistry, organ weights and histopathology were assessed. Aier describes methods for evaluating siRNA-LNP formulations, but these methods to assess the clearance, pharmacokinetics, and toxicity of administration of the LNP compositions of the present disclosure. may be applied.

[0457] Amine lipids provide an increased clearance rate. In some embodiments, the clearance The lipid clearance rate is the rate at which amine lipids are removed from blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which the RNA is cleared from the target protein. The rate at which mRNA or gRNA is clarified from blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which the LNPs are cleared from the blood. In some embodiments, the clearance rate is the rate at which the compound is cleared from the blood, serum, or plasma. The clearance rate is the rate at which LNPs are cleared from tissues such as the liver or spleen. In certain embodiments, a high clearance rate may have substantial adverse effects. Amine lipids reduce LNP accumulation in the circulation and tissues. In some embodiments, the reduction in LNP accumulation in the circulation and tissues is substantial. This results in a safety profile with no significant adverse effects.

[0458] The amine lipids of the present disclosure may be ionizable depending on the pH of the medium in which they are contained. For example, in a weakly acidic medium, the amine lipids may be protonated and have a positive charge. Therefore, in a weakly basic medium, such as blood, which has a pH of about 7.35, amine lipids In some embodiments, the amine lipids of the present disclosure may be: It may be protonated at a pH of at least about 9. In some embodiments, the present disclosure The amine lipid may be protonated at a pH of at least about 9. In the present disclosure, the amine lipids may be protonated at a pH of at least about 10. .

[0459] The ability of an amine lipid to carry a charge is related to its intrinsic pKa. The amino lipids may each independently have a pKa in the range of about 5.8 to about 6.2. For example, the amine lipids of the present disclosure each independently have a pK in the range of about 5.8 to about 6.5. Cationic lipids having a pKa in the range of about 5.1 to about 7.4 may, for example, It has been found to be effective for delivery of cargo in vivo, for example to the liver. This can be advantageous because it has a pKa in the range of about 5.3 to about 6.4. Cationic lipids having the formula (I) are effective for in vivo delivery, e.g., to tumors. It has been found that, for example, see WO2014 / 136086.

[0460] Additional fats

[0461] Suitable "neutral lipids" for use in the lipid compositions of the present disclosure include, for example, various For use in the present disclosure, various neutral, uncharged, or zwitterionic lipids are included. Examples of suitable neutral phospholipids include 5-heptadecylbenzene-1,3-diol (lecithin). dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), Sphatidylcholine (DSPC), phosphocholine (D OPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine ( PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC) , phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), Zira Dilauryloylphosphatidylcholine pholine) (DLPC), dimyristoylphosphatidylcholine (DMPC), 1- Myristoyl-2-palmitoylphosphatidylcholine (MPPC), 1-palmitoyl -2-Myristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stearate 1,2-diarachidoyl-sn-glyceroylphosphatidylcholine (PSPC), 3-Phosphocholine (DBPC), 1-Stearoyl-2-Palmitoylphosphatidylcholine Phosphorus (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (D EPC), palmitoyloleoylphosphatidylcholine (POPC), lysophosphatidylcholine dioleoylcholine, dioleoylphosphatidylethanolamine (DOPE), dilinoleoyl Distearoylphosphatidylcholine Distearoylphosphatidylethanolamine (DSPE) , dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DMPE) Phosphatidylethanolamine (DPPE), Palmitoyloleoylphosphatidylethanolamine POPE, lysophosphatidylethanolamine, and combinations thereof In one embodiment, the neutral phospholipid includes, but is not limited to, distearoyl Phosphatidylcholine (DSPC) and dimyristoylphosphatidylethanolamine In another embodiment, the neutral phospholipid may be selected from the group consisting of dimethicone (DMPE). It may also be stearoylphosphatidylcholine (DSPC).

[0462] "Helper lipids" include steroids, sterols, and alkylresorcinols Suitable helper lipids for use in the present disclosure include cholesterol. These include cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate. In one embodiment, the helper lipid is cholesterol. In one embodiment, the helper lipid may be cholesterol hemisuccinate. good.

[0463] "Stealth lipids" are nanoparticles that can survive in vivo (e.g., in the blood). Stealth lipids are lipids that, for example, reduce particle aggregation and increase particle size. Controlling the size can aid in formulation processing. The terpenes lipid may modulate the pharmacokinetic properties of the LNP. Stealth lipids suitable for use in the present invention include those having a hydrophilic head group linked to the lipid moiety. In the lipid composition of the present disclosure, stealth lipids having the formula: Information regarding suitable stealth lipids for use and the biochemistry of such lipids can be found in Ro mberg et al.,Pharmaceutical Research,Vol. .25, No.1,2008,pp.55-71 and Hoekstra et al. , Biochimica et Biophysica Acta 1660(2004 ) 41-52. Additional suitable PEG lipids can be found, for example, in WO2006 / 007712.

[0464] In one embodiment, the hydrophilic head group of the stealth lipid is selected from a PEG-based polymer. In some embodiments, the stealth lipid comprises a polymer moiety. , the stealth lipid is a PEG lipid.

[0465] In one embodiment, the stealth lipid is referred to as PEG (poly(ethylene oxide)). (Some examples include poly(oxazoline), poly(vinyl alcohol), poly(glycerol), Poly(N-vinylpyrrolidone), polyamino acids and poly[N-(2-hydroxypropyl The polymer moiety is selected from polymers based on [methylmethacrylamide].

[0466] In one embodiment, the PEG lipid is PEG (also referred to as poly(ethylene oxide)). The polymer moiety is based on

[0467] The PEG-lipid further comprises a lipid moiety. In some embodiments, the lipid moiety is a diacylglycerol. It may be derived from cerol or diacylglycamide, and may be derived from diacylglycerol or diacylglycerol. The sylglycamides are those containing independently saturated or unsaturated carbon atoms of about C4 to about C40. Dialkylglycerol or dialkylglycamide groups with alkyl chain lengths The chain may include one or more functional groups, such as amides or esters. In some embodiments, the alkyl chain length h) contains about C10 to C20 dialkylglycerol or dialkylglycamide groups may further include one or more substituted alkyl groups. The chain length may be symmetrical or It may be asymmetric.

[0468] Unless otherwise indicated, the term "PEG" as used herein means The term refers to any polyethylene glycol or other polyalkylene ether polymer. In one embodiment, PEG is optionally ethylene glycol or ethylene oxide. In one embodiment, PEG is an optionally substituted linear or branched polymer. In one embodiment, the PEG is unsubstituted, e.g., one or more alkyl, alkoxy, In one embodiment, the aryl group is substituted with an oxy, acyl, hydroxy, or aryl group. The term refers to PEG copolymers, e.g., PEG-polyurethane or PEG-polypropylene. Len (e.g., J. Milton Harris, Poly(ethylene glycol) col)chemistry:biotechnical and biomedica In another embodiment, the term does not include a PEG copolymer. In one embodiment, the PEG is from about 130 to about 50,000 In a secondary embodiment, about 150 to about 30,000, and in a secondary embodiment, about 150 to about 20 ,000, and in a secondary embodiment, about 150 to about 15,000, and in a secondary embodiment, about 150 In a subembodiment, about 150 to about 6,000; in a subembodiment, about 150 to about 5,000, in a subembodiment about 150 to about 4,000, in a subembodiment is about 150 to about 3,000, in a secondary embodiment, about 300 to about 3,000, In one embodiment, about 1,000 to about 3,000, and in a secondary embodiment, about 1,500 to about 2,500. It has a molecular weight.

[0469] In certain embodiments, PEG (e.g., a lipid moiety or lipid, e.g., a stealth lipid) PEG-2K, also known as PEG 2000, is a PEG-2K has an average molecular weight of about 2,000 daltons. PEG-2K has the following formula: ), where n is 45, i.e., the number average degree of polymerization is about 45 subunits. However, other PEG embodiments known in the art may be used. In one embodiment, for example, a polymer having a number average degree of polymerization of about 23 subunits may be used. (n=23), and / or those containing 68 subunits (n=68). In some embodiments, n may be in the range of about 30 to about 60. In some embodiments, n may range from about 35 to about 55. In some embodiments, n may range from about 40 to about 55. In some embodiments, n is in the range of about 42 to about 48. In some embodiments, n may be 45. In some embodiments, R may be , H, substituted alkyl, and unsubstituted alkyl. , R may be unsubstituted alkyl. In some embodiments, R may be methyl. .

[0470] In any embodiment described herein, the PEG lipid may be PEG-dilauroylglycerol. Cerol, PEG-dimyristoylglycerol (PEG-DMG) (Cat. # GM -020; NOF, Tokyo, Japan), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE) (Cat. # DSPE-0 20CN; NOF, Tokyo, Japan), PEG-dilaurylglycamide, PEG -Dimyristylglycamide, PEG-dipalmitoylglycamide, and PEG-distearate Aroylglycamide, PEG-cholesterol (1-[8'-(cholest-5-ene-3 [beta]-oxy)carboxamido-3',6'-dioxaoctanyl]carbamoyl -[omega]-methyl-poly(ethylene glycol), PEG-DMB (3,4-diethyl ether) Ditetradecoxylbenzyl-[omega]-methyl 1,2-dimyristoyl-sn-glyceroyl-poly(ethylene glycol) ether), -3-Phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000 ](PEG2k-DMG)(cat. #880150P;Avanti Polar Lipids, Alabaster, Alabama, USA), 1,2-distearoyl 1-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)] Cole)-2000](PEG2k-DSPE)(cat. #880120C;Ava nti Polar Lipids, Alabaster, Alabama, USA), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PE G2k-DSG; GS-020, NOF Tokyo, Japan), poly(ethylene glycol PEG-2k-DMA, and 1,2-disulfide Tearyloxypropyl-3-amine-N-[methoxy(polyethylene glycol)-2 000] (PEG2k-DSA). In one embodiment, the PEG lipid is In some embodiments, the PEG lipid may be PEG2k-DMG. In one embodiment, the PEG lipid may be PEG2k-DSPE. In one embodiment, the PEG lipid may be PEG2k-DMA. In one embodiment, the PEG lipid is PEG2k-C-DMA. , compounds disclosed in WO2016 / 010840 (paragraphs

[0240] to

[0244] ) In one embodiment, the PEG lipid is PEG2k-DSA. In one embodiment, the PEG lipid may be PEG2k-C11. In some embodiments, the PEG lipid may be PEG2k-C14. The PEG lipid may be PEG2k-C16. In some embodiments, the PEG lipid may be PE It may also be G2k-C18.

[0471] LNP formulation

[0472] LNPs contain (i) amine lipids for encapsulation and endosomal escape, (ii) stabilizers, and (iii) stabilizers. (iii) neutral lipids for stabilization, (iv) helper lipids, also for stabilization, and (v) iv) It may contain stealth lipids, such as PEG lipids.

[0473] In some embodiments, the LNP composition comprises an RNA-guided DNA binding agent, a Cas nuclear ase mRNA, class 2 Cas nuclease mRNA, Cas9 mRNA, and gR In some embodiments, the LNP composition may include an RNA component comprising one or more of the following: The composition may comprise a Class 2 Cas nuclease and a gRNA as the RNA component. In certain embodiments, the LNP composition comprises an RNA component, an amine lipid, a helper lipid, In certain LNP compositions, the helper lipid may comprise a neutral lipid, and a stealth lipid. The lipid is cholesterol. In other compositions, the neutral lipid is DSPC. In some embodiments, the stealth lipid is PEG2k-DMG or PEG2k-C11. In certain embodiments, the LNP composition comprises lipid A or an equivalent of lipid A, a helper lipid, The composition comprises a neutral lipid, a stealth lipid, and a guide RNA. In certain compositions, the composition comprises an amine lipid. The amine lipid is lipid A. In certain compositions, the amine lipid is lipid A or its acetal. The helper lipid is cholesterol, and the neutral lipid is DSPC. And the stealth lipid is PEG2k-DMG.

[0474] In certain embodiments, the lipid composition is based on the molar ratio of each of the component lipids in the formulation. Embodiments of the present disclosure are described as follows: The lipid composition described herein is provided. In one embodiment, the mole percent of the amine lipid is about 30 mole percent. In one embodiment, the mole % of the amine lipid may be about 40 mole % to about 60 mole %. In one embodiment, the mole % of the amine lipid may be from about 45 mole % to about 60 mole %. In one embodiment, the mole % of the amine lipid may be from about 50 mole % to about 60 mole %. In one embodiment, the mole % of the amine lipid is from about 55 mole % to about 60 mole %. In one embodiment, the mole % of the amine lipid may be from about 50 mole % to about 55 mole %. In one embodiment, the mole % of the amine lipid may be about 50 mole %. In one embodiment, the mole percent of the amine lipid may be about 55 mole percent. In this state, the amine lipid mole % of the LNP batch was within ±30%, ±25%, ±20% of the target mole %. %, ±15%, ±10%, ±5%, or ±2.5%. In some embodiments, the LN The amine lipid mol% of the P batch was ±4 mol%, ±3 mol%, ±2 mol%, ± 1.5 mol%, ±1 mol%, ±0.5 mol%, or ±0.25 mol%. The lipid % numbers are given as a percentage of the lipid component of the LNP composition. LNP lot-to-lot variation in amine lipid mole % was less than 15%, less than 10%, or less than 5%. is less than.

[0475] In one embodiment, the mole percent of neutral lipids may be from about 5 mole percent to about 15 mole percent. In an embodiment, the mole percent of neutral lipids may be from about 7 mole percent to about 12 mole percent. In some embodiments, the mole percent of neutral lipids may be about 9 mole percent. The neutral lipid mole % of each sample was ±30%, ±25%, ±20%, or ±15% of the target neutral lipid mole %. , ±10%, ±5%, or ±2.5%. In certain embodiments, the LNP lot The variation between is less than 15%, less than 10%, or less than 5%.

[0476] In one embodiment, the mole percent of the helper lipid may be from about 20 mole percent to about 60 mole percent. In one embodiment, the mole percent of helper lipid may be from about 25 mole percent to about 55 mole percent. In one embodiment, the mole percent of the helper lipid may be from about 25 mole percent to about 50 mole percent. In one embodiment, the mole percent of the helper lipid may be from about 25 mole percent to about 40 mole percent. In one embodiment, the mole percent of the helper lipid may be from about 30 mole percent to about 50 mole percent. In one embodiment, the mole percent of the helper lipid may be about 30 mole percent to about 40 mole percent. In one embodiment, the mole percent of the helper lipid is 100 mole percent of the lipid component. In some embodiments, the concentration of the lipids is adjusted based on the lipid, neutral lipid, and PEG lipid concentrations. The helper mole % of the LNP batches was ±30%, ±25%, ±20%, and ±15% of the target mole %. %, ±10%, ±5%, or ±2.5%. In certain embodiments, the LNP lock The sample-to-sample variability is less than 15%, less than 10%, or less than 5%.

[0477] In one embodiment, the mole percent of PEG lipid may be from about 1 mole percent to about 10 mole percent. In embodiments, the mole percent of PEG lipid may be from about 2 mole percent to about 10 mole percent. In one embodiment, the mole percent of PEG lipid may be from about 2 mole percent to about 8 mole percent. In one embodiment, the mole percent of PEG lipid may be about 2 mole percent to about 4 mole percent. The mole percent of EG lipids may be about 2.5 mole percent to about 4 mole percent. The mole % of G lipids may be about 3 mole %. In one embodiment, the mole % of PEG lipids is about In some embodiments, the PEG lipid mole % of the LNP batch may be 2.5 mole %. , ±30%, ±25%, ±20%, ±15%, ±10%, ±5% of target PEG lipid mol% In certain embodiments, the LNP lot-to-lot variation is 1 less than 5%, less than 10%, or less than 5%.

[0478] In certain embodiments, the cargo is an RNA-guided DNA-binding agent (e.g., a Cas nucleic acid). mRNA encoding the Cas nuclease, class 2 Cas nuclease, or Cas9, and and gRNA or a nucleic acid encoding gRNA, or a combination of mRNA and gRNA In one embodiment, the LNP composition may include lipid A or an equivalent thereof. In some embodiments, the amine lipid is lipid A. In some embodiments, the amine lipid is a lipid A equivalent. In certain embodiments, the amine lipid is an analog of lipid A. In various embodiments, the LNP composition comprises an amine lipid, a neutral lipid, and an acetal analog. In certain embodiments, the helper lipid comprises a PEG-lipid. In certain embodiments, the neutral lipid is DSPC. In some embodiments, the PEG lipid is PEG2k-DMG. The product may include lipid A, a helper lipid, a neutral lipid, and a PEG lipid. In embodiments, the LNP composition comprises an amine lipid, DSPC, cholesterol, and PEG lipid. In some embodiments, the LNP composition comprises a PEG lipid that includes DMG. In certain embodiments, the amine lipids include lipid A and acetal analogs of lipid A. In additional embodiments, the LNP composition is selected from lipid A equivalents. , cholesterol, DSPC, and PEG2k-DMG.

[0479] Embodiments of the present disclosure also provide a method for encapsulating a nucleic acid by combining the positively charged amine group (N) of an amine lipid with an encapsulated nucleic acid. The lipid composition is described according to the molar ratio between the negatively charged phosphate group (P) and the This can be expressed mathematically by the formula N / P. In some embodiments, LNP The composition comprises a lipid component including an amine lipid, a helper lipid, a neutral lipid, and a helper lipid; and a nucleic acid component, with an N / P ratio of about 3 to 10. The NP composition comprises a lipid component comprising an amine lipid, a helper lipid, a neutral lipid, and a helper lipid. and an RNA component, with an N / P ratio of about 3 to 10. The N / P ratio may be about 5 to 7. In one embodiment, the N / P ratio is about 4.5 to 8. In one embodiment, the N / P ratio may be about 6. In one embodiment, the N / P ratio is In one embodiment, the N / P ratio may be about 6±0.5. In some embodiments, the N / P ratio is 30%, ±25%, ±20%, ±15%, or ±10%, ±5%, or ±2.5%. In certain embodiments, the LNP lot-to-lot variation is The variation is less than 15%, less than 10%, or less than 5%.

[0480] In some embodiments, the RNA component is an mRNA, such as an mRNA disclosed herein. In one embodiment, the nucleic acid sequence may include an mRNA encoding a nuclease, such as a Cas nuclease. Alternatively, the RNA component may comprise a Cas9 mRNA encoding a Cas nuclease. In some compositions that include mRNA, the LNP further includes a gRNA nucleic acid, such as a gRNA. In some embodiments, the RNA components include a Cas nuclease mRNA and a gRNA. In some embodiments, the RNA component comprises a Class 2 Cas nuclease mRNA and a gR Contains NA.

[0481] In certain embodiments, the LNP compositions comprise mRNAs disclosed herein, e.g., For example, mRNA encoding a Cas nuclease, such as a class 2 Cas nuclease, Class 2 C may include amine lipids, helper lipids, neutral lipids, and PEG lipids. Certain LNs contain mRNAs encoding Cas nucleases, such as Cas nuclease. In the P composition, the helper lipid is cholesterol. In other compositions containing mRNA encoding any Cas nuclease, the neutral lipid is DSP. C. mRNAs encoding Cas nucleases, such as class 2 Cas nucleases In additional embodiments containing A, the PEG lipid is PEG2k-DMG or PEG2k-C1 1. mRNAs encoding Cas nucleases, such as class 2 Cas nucleases In certain compositions that include A, the amine lipid is lipid A and its equivalents, e.g., lipid Acetal analogs of A are selected.

[0482] In some embodiments, the LNP composition may comprise a gRNA. The LNP composition includes amine lipids, gRNA, helper lipids, neutral lipids, and PEG lipids. In certain LNP compositions containing gRNA, the helper lipid may comprise a cholesterol. In some compositions containing gRNA, the neutral lipid is DSPC. In additional embodiments containing A, the PEG lipid is PEG2k-DMG or PEG2k-C1 1. In certain embodiments, the amine lipid is lipid A and its equivalents, e.g. , acetal analogs of lipid A.

[0483] In one embodiment, the LNP composition may comprise an sgRNA. The composition may comprise a Cas9 sgRNA. In one embodiment, the LNP composition comprises a Cpf In some compositions containing an sgRNA, the LNP may comprise an amine lipids, helper lipids, neutral lipids, and PEG-lipids. In some compositions, the helper lipid is cholesterol. In other compositions that include an sgRNA, The neutral lipid is DSPC. In additional embodiments comprising an sgRNA, the PEG lipid is PEG In certain embodiments, the amine lipid is 2k-DMG or PEG2k-C11. , lipid A and its equivalents, such as acetal analogs of lipid A.

[0484] In certain embodiments, the LNP composition comprises an mRNA encoding a Cas nuclease. and a gRNA, which may be an sgRNA. The composition includes an amine lipid, an mRNA encoding a Cas nuclease, a gRNA, a helper The lipids may include a lipid, a neutral lipid, and a PEG-lipid. In certain compositions comprising RNA and gRNA, the helper lipid is cholesterol. In some compositions comprising mRNA and gRNA encoding a Cas nuclease, The neutral lipid is DSPC. In additional embodiments, the PEG lipid is PEG2k-DMG or PEG2k-C11. In certain embodiments, the amine lipid is lipid A and its equivalents, e.g., lipid A. It is selected from acetal analogs of Pido A.

[0485] In certain embodiments, the LNP composition comprises a Cas mRNA, such as a Class 2 Cas mRNA. In certain embodiments, the nucleic acid sequence comprises a nuclease mRNA and at least one gRNA. The LNP composition may comprise about 25:1 to about 1:25 Class 2 Cas nuclease mRNA. In certain embodiments, the ratio of gRNA to Cas nuclease mRNA is The LNP formulation comprises about 10:1 to about 1:10 of Class 2 Cas nuclease mRNP. A. In certain embodiments, the ratio of gRNA to Cas nuclease mRNA is In the LNP formulation, the ratio of Class 2 Cas nuclease mRNA to Class 2 Cas nuclease mRNA is about 8:1 to about 1:8. The ratio of gRNA to Cas nuclease mRNA measured herein includes the ratio of gRNA to Cas nuclease mRNA measured herein. In some embodiments, the LNP formulation is from about 5:1 to about 1: 5. gRNAs against Cas nuclease mRNAs, such as class 2 Cas mRNAs In some embodiments, the ratio ranges include ratios of about 3:1 to 1:3, about 2:1 to 1:2, Approximately 5:1 to 1:2, approximately 5:1 to 1:1, approximately 3:1 to 1:2, approximately 3:1 to 1:1, approximately 3:1 In some embodiments, the gRNA to mRNA ratio is about 2:1 to 1:1. In some embodiments, the ratio of Cas nucleases, such as Class 2 Cas nucleases, to the total number of Cas nucleases is about 2:1. The ratio of gRNA to nuclease mRNA is approximately 1:1. The ratios are approximately 25:1, 10: It can be 1, 5:1, 3:1, 1:1, 1:3, 1:5, 1:10, or 1:25 stomach.

[0486] The LNP compositions disclosed herein may comprise a template nucleic acid. mRNAs encoding Cas nucleases, such as the Ras2 Cas nuclease mRNA, In some embodiments, the template nucleic acid is formulated with a guide RNA. In some embodiments, the template nucleic acid is an mRNA encoding a Cas nuclease. In some embodiments, the template nucleic acid may be formulated with both a nucleic acid sequence and a guide RNA. It may be formulated separately from the mRNA or guide RNA encoding the Cas nuclease. The template nucleic acid may be delivered together with the LNP composition or separately from the LNP composition. In some embodiments, the template nucleic acid is single-stranded or double-stranded, depending on the desired repair mechanism. The template may contain regions of homology to the target DNA or to sequences flanking the target DNA. It may have a region.

[0487] In some embodiments, LNPs are prepared by dissolving an aqueous RNA solution in an organic solvent-based lipid solution, e.g., 10 0% ethanol. Suitable solutions or solvents include water, , PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, ethyl ether, cyclohexane, tetrahydrofuran, methanol, and isopropanol For example, for in vivo administration of LNPs, In certain embodiments, a pharmaceutically acceptable buffer may be used. By using a pH adjusting agent, the pH of the composition containing the LNP is maintained at or above pH 6.5. In certain embodiments, a buffer is used to adjust the pH of the composition comprising the LNPs to pH 7.0 or In certain embodiments, the composition is maintained at a pH of about 7.2 to about 7.7. In additional embodiments, the composition has a pH within the range of about 7.3 to about 7.7. In a further embodiment, the composition has a pH in the range of about 7.4 to about 7.6. The pH of the composition is 7.2, 7.3, 7.4, 7.5, 7.6, or 7.7. The pH may be measured using a micro pH probe. A cryoprotectant is included in the composition. Non-limiting examples of cryoprotectants include sucrose, trehalose, Exemplary compositions include glycerol, DMSO, and ethylene glycol. may contain up to 10% cryoprotectant, such as sucrose. In some embodiments, the LNP composition may contain about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% freezing. In certain embodiments, the LNP composition may comprise about 1, 2, 3, 4 In some embodiments, the sucrose content may be 5, 6, 7, 8, 9, or 10%. In some embodiments, the LNP composition may comprise a buffer. In some embodiments, the buffer is a phosphate buffer. (PBS), Tris buffer, citrate buffer, and mixtures thereof. In certain exemplary embodiments, the buffer comprises NaCl. In some formulations, NaCl is omitted. An exemplary amount of NaCl is about 20 mM to 100 mM. Exemplary amounts of NaCl may range from about 40 mM to about 50 mM. In some embodiments, the amount of NaCl is about 45 mM. In embodiments, the buffer is a Tris buffer. Exemplary amounts of Tris are from about 20 mM to about 60 mM. Exemplary amounts of Tris range from about 40 mM to about 60 mM. In some embodiments, the amount of Tris is about 50 mM. In certain exemplary embodiments of the LNP composition, the buffer comprises NaCl and Tris. contains 5% sucrose and 45 mM NaCl in Tris buffer. In a typical embodiment, the composition comprises sucrose in an amount of about 5% w / v, about 45 mM NaCl, and about 50 mM Tris at pH 7.5. Amounts of salts, buffers, and cryoprotectants may be varied to maintain the overall formulation osmolality. For example, Final osmolality may be maintained below 450 mOsm / L. In certain embodiments, the osmolality is 350-250 mOsm / L. , with a final osmolality of 300+ / -20 mOsm / L.

[0488] In some embodiments, microfluidic mixing, T-mixing, or cross-mixing is used. In certain embodiments, the flow rate, junction size, junction geometry, junction The tube shape, tube diameter, solution, and / or RNA and lipid concentrations may be varied. LNPs or LNP compositions can be prepared by, for example, dialysis, tangential flow filtration, or chromatography. LNPs may be concentrated or purified, for example, via a suspension, In some embodiments, the LNP may be stored as a solution, a solution containing the LNP, or a lyophilized powder. The compositions are stored at 2-8°C, and in certain embodiments, the LNP compositions are stored at room temperature. In additional embodiments, the LNP compositions are frozen, e.g., at -20°C or -80°C. In other embodiments, the LNP compositions are frozen and stored at temperatures within the range of about 0°C to about -80°C. Frozen LNP compositions can be stored, for example, on ice, at 4°C, at room temperature, or at temperatures below 4°C. or 25°C and may be thawed prior to use. Frozen LNP compositions can be stored at various temperatures, e.g. For example, it may be kept on ice, at 4°C, room temperature, 25°C, or 37°C.

[0489] In some embodiments, the LNP compositions have greater than about 80% encapsulation. In some embodiments, the LNP composition has a particle size of less than about 120 nm. In some embodiments, the LNP composition has a pdi of less than about 0.2. In some embodiments, each of these three characteristics is present. Analytical methods for determining these parameters are provided in the General Reagents and Methods section. This is discussed below in the paper.

[0490] In some embodiments, microfluidic mixing, T-mixing, or cross-mixing is used. In certain embodiments, the flow rate, junction size, junction geometry, junction The tube shape, tube diameter, solution, and / or RNA and lipid concentrations may be varied. The LNPs or LNP compositions may be concentrated or purified, for example, via dialysis or chromatography. LNPs may be, for example, suspensions, emulsions, or lyophilized powders. In some embodiments, the LNP compositions may be stored at 2-8°C. In certain embodiments, the LNP compositions are stored at room temperature. The P composition is stored frozen, for example at -20°C or -80°C. In this state, the LNP composition is stored at a temperature ranging from about 0°C to about -80°C. The LNP composition may be thawed prior to use, e.g., on ice, at room temperature, or at 25°C. stomach.

[0491] Dynamic photometric analysis was performed to characterize the polydispersity index ("pdi") and size of the LNPs of the present disclosure. DLS can be used to measure the amount of light emitted by a sample by subjecting the sample to a light source. The resulting light scattering is measured. The PDI determined from DLS measurements is the population It represents the distribution of particle sizes (around the average particle size) in a sample, with a PDI of 0 for a completely uniform population. In some embodiments, the pdi may be in the range of 0.005 to 0.75. In some embodiments, pdi may be in the range of 0.01 to 0.5. In some embodiments, pdi may be in the range of 0.02 to 0.4. The pdi may be in the range of 0.03 to 0.35. In some embodiments, the pdi is 0. It may be in the range of 1 to 0.35.

[0492] In some embodiments, the LNPs disclosed herein have a size of 1-250 nm. In some embodiments, the LNPs have a size of 10-200 nm. In some embodiments, the LNPs have a size of 20 to 150 nm. In some embodiments, the LNPs have a size of 50-150 nm. In some embodiments, the LNPs have a size of 50-120 nm. In some embodiments, the LNPs have a size of 75-150 nm. In general, LNPs have a size of 30-200 nm. All sizes mentioned in the specification are based on measurements made on a Malvern Zetasizer. is the average size (diameter) of fully formed nanoparticles as measured by differential light scattering. The nanoparticle sample was diluted in phosphate-buffered saline (PBS) and the counting rate was approximately 200- 400 kcts. Data are presented as a weighted average of the intensity measurements. In some embodiments, LNPs are formed with an average encapsulation efficiency in the range of 50% to 100%. In embodiments, LNPs are formed with an average encapsulation efficiency in the range of 50% to 70%. In embodiments, LNPs are formed with an average encapsulation efficiency in the range of 70% to 90%. In embodiments, LNPs are formed with an average encapsulation efficiency in the range of 90% to 100%. In embodiments, LNPs are formed with an average encapsulation efficiency in the range of 75% to 95%.

[0493] In some embodiments, the LNP associated with the gRNA disclosed herein is an AT For use in the preparation of a medicament for treating TR. The gRNA-associated LNPs disclosed herein can be used to target ATTR-bearing subjects. or reducing the accumulation and aggregation of TTR in amyloid or amyloid fibrils in In some embodiments, the present invention is for use in the preparation of a medicament for preventing The LNPs associated with the gRNAs disclosed herein can be used to reduce serum TTR concentrations. In some embodiments, the compounds described herein are for use in the preparation of a medicament for The LNPs associated with the gRNAs disclosed herein can be used in a subject, e.g., a mammal, e.g., a human. For use in treating ATTR in a primate. The gRNA-associated LNPs disclosed herein are useful in subjects with ATTR, For example, amyloid or amyloid fibrils in mammals, e.g., primates such as humans. The present invention is for use in reducing or preventing the accumulation and aggregation of TTR in some In some embodiments, the LNPs associated with the gRNAs disclosed herein are used to target a target gene, e.g., a target gene. for use in reducing serum TTR concentrations in mammals, e.g., primates such as humans. This is for the purpose.

[0494] Electroporation is also a well-known means for delivery of cargo, and any electroporation The microporation methodology can be used to deliver any one of the gRNAs disclosed herein. In some embodiments, electroporation may be used to deliver the any one of the gRNAs disclosed in the document and an RNA guide DNA such as Cas9. mRNA encoding a nuclease or an RNA-guided DNA nuclease such as Cas9 It may be used to deliver A.

[0495] In some embodiments, the present invention provides a method for the production of a medicament comprising administering to a subject ... into cells ex vivo, wherein the gRNA is associated with a LNP or In some embodiments, the gRNA / LNP or LNP is not associated with the gRNA / LNP. or gRNAs can also be used to guide RNA-guided DNA nucleases such as Cas9 or It associates with the mRNA that encodes the RNA-guided DNA nuclease.

[0496] In certain embodiments, the present invention provides a method for the preparation of a medicament comprising administering to a subject a subject the ability to administer a medicament comprising administering to a subject ... or a DNA or RNA vector encoding one or more guide RNAs. In some embodiments, in addition to the guide RNA sequence, the vector may encode a guide RNA. Nucleic acids that do not encode a guide RNA include promoters, RNA guided DNA, which can be an enhancer, regulatory sequence, and a nuclease such as Cas9 Examples of nucleic acids include, but are not limited to, nucleic acids encoding NA nucleases. In this state, the vector encodes crRNA, trRNA, or crRNA and trRNA. In some embodiments, the vector comprises one or more nucleotide sequences that encode One or more nucleotide sequences encoding the sgRNA and the RNA guide DNA sequence The RNA-guided DNA nuclease is Cas9. or a Cas nuclease such as Cpf1. In some embodiments, the vector , crRNA, trRNA, and one or more nucleotide sequences encoding the RNA The RNA-guided DNA nuclease contains mRNA encoding the guided DNA nuclease. The enzyme can be a Cas protein, such as Cas9. In one embodiment, Cas9 is a from Streptococcus pyogenes (i.e., Spy In some embodiments, the crRNA, trRNA, or crRNA is and a nucleotide sequence encoding a trRNA (which may be an sgRNA) flanked by all or part of the repeat sequences from the CRISPR / Cas system present in Containing or consisting of a guide sequence containing crRNA, trRNA, or crRNA and The nucleic acid comprising or consisting of a trRNA and a crRNA is referred to as a crRNA, a trRNA, or a crRNA. and trRNA together with a nucleic acid not found in nature. It may also be included in the above.

[0497] In some embodiments, the crRNA and trRNA are non-contiguous nuclei within one vector. In another embodiment, the crRNA and trRNA are encoded by contiguous nuclei. In some embodiments, the crRNA and trRNA may be encoded by a single In another embodiment, the crRNA and trRN are encoded by opposite strands of a single nucleic acid. A are encoded by the same strand of a single nucleic acid.

[0498] In some embodiments, the vector may be circular. In other embodiments, the vector may be In some embodiments, the vector is a lipid nanoparticle, a liposome, It may be entrapped in a non-lipid nanoparticle or a viral capsid. Exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, and the like. These include chromosomes, transposons, viral vectors, and expression vectors.

[0499] In some embodiments, the vector may be a viral vector. Alternatively, the viral vector may be genetically modified from its wild-type counterpart. For example, Viral vectors contain one or more nucleotide insertions, deletions, or substitutions. may be used to facilitate cloning or to facilitate the insertion of one or more of the vectors. The properties of the vector may be altered, such as packaging ability, transduction ability, etc. These include efficiency, immunogenicity, genomic integration, replication, transcription, and translation. In this case, the portion of the viral genome is the portion where the virus packages the exogenous sequence with a larger size. In some embodiments, the viral vector may be deleted to allow for casing. In some embodiments, the vector may have enhanced transduction efficiency. In some embodiments, the immune response induced by the virus may be reduced. Viral genes that facilitate the integration of viral sequences (e.g., integrase) The virus may be mutated to be non-integrating. In some embodiments, the viral vector may be replication-defective. exogenous transcriptional or translational control sequences to drive expression of the coding sequence on the vector In some embodiments, the virus may be helper-dependent. For example, , the virus is used to amplify the vector and package it into viral particles. One or more to provide the required viral components (e.g., viral proteins, etc.) In such cases, the viral components may be coated with helper viruses. One or more helper components, such as one or more vectors for transporting the vectors, may be used as described herein. In another embodiment, the virus may be introduced into a host cell along with a vector system carrying the virus. The virus may be helper-free. For example, the virus may be free of any helper virus. In some embodiments, the vector can be amplified and packaged without the need for a nucleic acid sequence. The vector systems described herein also provide for viral amplification and packaging. The vector may also encode viral components required for replication.

[0500] Non-limiting exemplary viral vectors include adeno-associated viral (AAV) vectors. -, lentiviral vector, adenoviral vector, helper-dependent adenovirus Vector (HDAd), herpes simplex virus (HSV-1) vector, bacteriophage Examples of vectors include plasmid T4, baculovirus vectors, and retrovirus vectors. In some embodiments, the viral vector may be an AAV vector. So, viral vectors are AAV2, AAV3, AAV3B, AAV5, AAV6, A AV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, A with AVrh.32.33, AAV8, AAV9, AAVrh10, or AAVLK03 In other embodiments, the viral vector may be a lentiviral vector.

[0501] In some embodiments, the lentivirus may be non-integrating. In some embodiments, the viral vector may be an adenoviral vector. Adenoviruses, even high cloning capacity or "gutless" adenoviruses, The adenovirus often contains 5' and 3' inverted terminal repeats (ITRs) and packaging sequences. All coding viral regions except the coding signal ("I") were deleted from the virus. In yet another embodiment, the viral vector is The vector may be an HSV-1 vector. In some embodiments, the vector is an HSV-1 based vector. In some embodiments, the package is helper-dependent, and in other embodiments, it is helper-independent. Amplicon vectors carrying only the nucleotide sequence are structural components for packaging. Requires a helper virus with a 30 kb deletion that eliminates non-essential viral functions HSV-1 vectors do not require a helper virus. The vector may be bacteriophage T4. Phage T4 can assemble any linear or circular DNA or R DNA into the empty viral head. In a further embodiment, the virus may be capable of packaging an NA molecule. The vector may be a baculovirus vector. The viral vector may be a retroviral vector. In embodiments using AAV or lentiviral vectors with the ability to More than one vector may be used to deliver all components of the vector system as disclosed herein. For example, one AAV vector contains a Cas gene. and may contain a sequence encoding an RNA-guided DNA nuclease, such as a nuclease, The second AAV vector may contain one or more guide sequences.

[0502] In some embodiments, the vector directs expression of one or more coding sequences in a cell. In some embodiments, the cell is a prokaryotic cell, e.g., In some embodiments, the cell may be a eukaryotic cell, such as a yeast cell, a bacterial cell, or the like. In some embodiments, the eukaryotic cell may be a plant, insect, or mammalian cell. The eukaryotic cell may be a mammalian cell. In some embodiments, the eukaryotic cell may be a rodent cell. In some embodiments, the eukaryotic cell may be a human cell. Suitable promoters for driving expression of some In embodiments, the promoter may be wild-type. In other embodiments, the promoter The vector may be modified for more efficient or effective expression. The promoter may be truncated but still retain its function. For example, the promoter may be of a normal size or suitable for insertion into the vector into the virus. It may have a reduced size suitable for packaging.

[0503] In some embodiments, the vectors may be modified with an RNA guide, such as a nuclease, as described herein. In some embodiments, the nucleic acid sequence may comprise a nucleotide sequence encoding a nucleotide DNA nuclease. In this case, the nuclease encoded by the vector may be a Cas protein. In some embodiments, the vector system comprises a nucleotide sequence encoding a nuclease. In other embodiments, the vector system may contain one copy of the nuclease. In some embodiments, the nucleic acid sequence may contain more than one copy of the encoding nucleotide sequence. In some cases, the nucleotide sequence encoding the nuclease is involved in at least one transcriptional or translational regulation. In some embodiments, the nucleic acid encoding the nuclease may be operably linked to a regulatory sequence. The nucleotide sequence may be operably linked to at least one promoter. good.

[0504] In some embodiments, the promoter is constitutive, inducible, or tissue-specific. In some embodiments, the promoter may be a constitutive promoter. Non-limiting exemplary constitutive promoters include the cytomegalovirus immediate early promoter. CMV promoter, Simian virus (SV40) promoter, adenovirus major late promoter (MLP) promoter, Rous sarcoma virus (RSV) promoter, mouse mammary tumor Virus (MMTV) promoter, phosphoglycerate kinase (PGK) promoter -, elongation factor-alpha (EF1a) promoter, ubiquitin promoter, actin Promoters, tubulin promoters, immunoglobulin promoters, and their functions In some embodiments, the promoter may be a target fragment, a target gene fragment, or any combination thereof. In some embodiments, the promoter may be a CMV promoter. In another embodiment, the promoter is the EF1a promoter. In some embodiments, the promoter is an inducible promoter. Non-limiting exemplary inducible promoters include those induced by heat shock, light, chemical Inducible by substances, peptides, metals, steroids, antibiotics, or alcohol In some embodiments, an inducible promoter provides a low basal (uninduced) expression level. those with a promoter such as the Tet-On® promoter (Clontech ) etc.

[0505] In some embodiments, the promoter is a tissue-specific promoter, e.g., a promoter specific for the liver. The promoter may be a promoter specific for the expression of a gene.

[0506] The vector may further comprise a nucleotide sequence encoding a guide RNA as described herein. In some embodiments, the vector comprises one copy of the guide RNA. In other embodiments, the vector contains more than one copy of the guide RNA. In embodiments with more guide RNAs, the guide RNAs target different target sequences. They may be non-identical so as to target the same target sequence, or identical so as to target the same target sequence. In some embodiments where the vector comprises more than one guide RNA, each guide RNA has other distinct properties, such as RNA-guided DNA nucleic acids (RNAs) such as Cas RNP complexes. In some embodiments, the activity or stability of the enzyme may be in a complex with the enzyme. The nucleotide sequence encoding the id RNA is expressed by at least one transcriptional or translational control sequence. , e.g., operably linked to a promoter, 3'UTR, or 5'UTR In one embodiment, the promoter is a tRNA promoter, e.g., a tRNA Ly s3 , or tRNA chimeras. Mefferd et al., RNA. 2015 21:1683-9;Scherer et al., Nucleic Ac See ids Res. 2007 35:2620-2628. The promoter may be recognized by RNA polymerase III (Pol III). Non-limiting examples of Pol III promoters include the U6 and H1 promoters. In some embodiments, the nucleotide sequence encoding the guide RNA is Alternatively, the gene may be operably linked to a human U6 promoter. The nucleotide sequence encoding the id RNA is driven by the mouse or human H1 promoter. In embodiments with more than one guide RNA, the expression The promoters used to drive the two may be the same or different. In some embodiments, the nucleotides encoding the crRNA of the guide RNA and the guide R Nucleotides encoding the trRNA of the NA may be provided on the same vector. In some embodiments, the nucleotides encoding the crRNA and the nucleotides encoding the trRNA are The nucleotides may be driven by the same promoter. The RNA and trRNA may be transcribed into a single transcript. For example, the crRNA and The trRNA and trRNA are processed from a single transcript to form a dual-molecule guide RNA. Alternatively, the crRNA and trRNA may be combined into a single guide RNA (sgRNA). In other embodiments, the crRNA and trRNA may be transcribed into the same vector. In yet another embodiment, the promoters may be driven by their corresponding promoters on the target. Alternatively, the crRNA and trRNA may be encoded by different vectors.

[0507] In some embodiments, the nucleotide sequence encoding the guide RNA is a Cas nuclease. The same vector containing a nucleotide sequence encoding an RNA-guided DNA nuclease, such as a In some embodiments, the guide RNA and the Cas protein may be located on a vector. The expression of RNA-guided DNA nucleases such as In some embodiments, expression of the guide RNA may be driven by a Cas protein. Driven by the same promoter that drives the expression of RNA-guided DNA nucleases such as In some embodiments, RNA guides, such as guide RNAs and Cas proteins, may be used. The guide DNA nuclease transcripts may be contained within a single transcript. RNA is encoded by the untranslated region of RNA-guided DNA nuclease transcripts, such as Cas proteins. In some embodiments, the guide RNA may be within the 5'UTR of the transcript. In other embodiments, the guide RNA may be in the 3' UTR of the transcript. In some embodiments, the intracellular half-life of a transcript may be increased by the inclusion of a guide R sequence within its 3'UTR. It contains NA, which may be reduced by shortening the length of its 3'UTR. In additional embodiments, the guide RNA may be within an intron of the transcript. In embodiments, a suitable sequence is used to ensure that the guide RNA is properly spliced ​​from the transcript. A splice site may be added in the intron where the guide RNA is located. In embodiments, RNA guides such as Cas proteins from the same vector in close temporal proximity are used. Expression of the DNA nuclease and guide RNA is more efficient in CRISPR RNP complexes. Efficient formation may be promoted.

[0508] In some embodiments, the composition comprises a vector system. The vector system may comprise one single vector. In an additional embodiment, the vector system may comprise three vectors. If different guide RNAs are used for multiplexing, or If multiple copies of the id RNA are used, the vector system may contain more than three vectors. It may also include.

[0509] In some embodiments, the vector system initiates expression only after delivery to the target cell. Non-limiting exemplary inducible promoters include: These include heat shock, light, chemicals, peptides, metals, steroids, antibiotics, and In some embodiments, the inducible promoter is The control vectors are those with low basal (uninduced) expression levels, e.g., Tet-On™ The promoter may be a target promoter (Clontech), or the like.

[0510] In additional embodiments, the vector system is capable of expression only after delivery to a specific tissue. A tissue-specific promoter for initiation may be included.

[0511] The vector may be delivered by liposomes, nanoparticles, exosomes, or microvesicles. The vector may also be delivered by lipid nanoparticles (LNP). The LIPID NANOPARTICLE FORMULA was filed on December 12, 2016. LATIONS FOR CRISPR / CAS COMPONENTS" USSN 62 / 433,228 (the contents of which are incorporated herein in their entirety by reference). Any LNP and LNP formulation described herein may be used alone. alone or in association with the Cas nuclease or the mRNA encoding the Cas nuclease In some embodiments, the RNA component and the lipid component are suitable for delivery of the guide together. The lipid components include an amine lipid, a neutral lipid, a helper lipid, and an LNP composition comprising the lipid components. and stealth lipids, and the N / P ratio is about 1-10.

[0512] In some cases, the lipid component is lipid A or its acetal analog, cholesterol The polymer contains PEG-DMG, DSPC, and PEG-DMG, and has an N / P ratio of about 1 to 10. In this embodiment, the lipid component comprises about 40-60 mol % amine lipids, about 5-15 mol % methyl amine lipids, and about 5-15 mol % methyl amine lipids. The remainder of the lipid component is composed of a hydrophobic lipid and about 1.5-10 mol % PEG lipid. In some embodiments, the LNP composition is per lipid, and the N / P ratio is about 3-10. The lipid components are approximately 50-60 mol % amine lipids, approximately 8-10 mol % neutral lipids, and and about 2.5-4 mol % PEG lipid, with the remainder of the lipid component being helper lipid. and the N / P ratio of the LNP composition is about 3 to 8. In some cases, the lipid component is about 5 0-60 mol% amine lipid, about 5-15 mol% DSPC, and about 2.5-4 mol% The remainder of the lipid component is cholesterol, and the LNP composition The N / P ratio of the product is about 3-8. In some cases, the lipid component is 48-53 mole % lipid. % PEG lipid, about 8-10 mol % DSPC, and 1.5-10 mol % PEG lipid. The remaining part of the matrix component is cholesterol, and the N / P ratio of the LNP composition is 3 to 8 ± It is 0.2.

[0513] In some embodiments, the vector may be delivered systemically. The drug may be delivered to the hepatic circulation.

[0514] This description and the exemplary embodiments should not be construed as limiting. For purposes of the specification and the appended claims, unless otherwise indicated, Any amounts, percentages, or proportions used in this specification and claims are All numbers and other numerical values ​​represented are indicative of all things unless already so qualified. In the examples, it should be understood as being modified by the term "about." Accordingly, unless indicated to the contrary, the following specification and appended claims The numerical parameters set forth in the ranges may be varied depending upon the desired properties sought to be obtained. At the very least, and to limit the application of the doctrine of equivalents to the scope of the claims. Notwithstanding any attempt, each numerical parameter should be rounded to at least the nearest reported significant digits. These figures should be construed in light of the numbers and by applying ordinary rounding techniques.

[0515] As used in this specification and the appended claims, the singular forms "a," "an," "an" and "an" are used interchangeably. " and "the," and any use of the singular form of any word clearly refers to one referent. It is noted that unless explicitly and explicitly limited, plural referents are included. When used in this document, the term "includes" and its grammatical variations are non-exclusive. is intended, and the enumeration of an item in a list does not replace or add to the listed item. This does not exclude other similar items. [Example]

[0516] The following examples are provided to illustrate certain disclosed embodiments. , should not be construed as limiting the scope of the present disclosure in any way.

[0517] Example 1. Materials and Methods In vitro transcription ("IVT") of nuclease mRNA In vitro amplification using linearized plasmid DNA template and T7 RNA polymerase ro transcription results in capping and polyadenylation containing N1-methyl pseudo-U Streptococcus pyogenes ("Spy") Cas9 mRNA was produced using a T7 promoter, a sequence for transcription by SEQ ID NO: 1 or 2, and Plasmid DNA containing 100 nt of poly(A / T) region was prepared under the following conditions: 0 ng / µL plasmid, 2 U / µL XbaI (NEB), and 1x reaction buffer The DNA was linearized by incubating with XbaI at 37°C for 2 hours. The XbaI was inactivated by heating the reaction for 20 minutes. Linearization from enzymes and buffer salts using a PBS (Epoch Life Sciences) The plasmid was purified and analyzed by agarose gel to confirm linearization. The IVT reaction mixture for generating RNA was prepared under the following conditions: 50 ng / µL of linearized plasmid 2 mM each of GTP, ATP, CTP, and N1-methylpseudo-UTP (Tril ink); 10 mM ARCA (Trilink); 5 U / μL T7 RNA polymerase 1U / µL mouse ribonuclease inhibitor (NEB); 0.004U / µL inorganic E. coli pyrophosphatase (NEB); and 1x reaction buffer After 4 hours of incubation, the TURBO DNase (ThermoFisher) was added to a final concentration of 0.01 U / μL. The reaction was incubated for an additional 30 minutes to remove the DNA template. MegaClear Transcriptome according to the ThermoFisher protocol Use the nucleotide clean-up kit to clean the Cas9 mRNA with enzymes and nucleases. Alternatively, mRNA was purified through a precipitation protocol, and in some cases In some cases, this was followed by HPLC-based purification. After ATP digestion, the mixture was purified by adding 0.21x volume of 7.5 M LiCl solution and mixing. The RNA was precipitated and the precipitated mRNA was pelleted by centrifugation. The supernatant was removed. Afterwards, the mRNA was reconstituted in water. Ammonium acetate and ethanol were used to prepare the mRNA. A was precipitated again with 100% of 2x the volume of 5M ammonium acetate to a final concentration of 2M. The solution was mixed with EtOH and then incubated at -20°C for 15 minutes. The precipitated mRNA was pelleted again by centrifugation, and the supernatant was removed. The RNA was reconstituted in water. As a final step, sodium acetate and ethanol were used. The mRNA was precipitated using 1 / 10 volume of 3 M sodium acetate (pH 5.5) in 2 mL of PBS. The solution was mixed with x volume of 100% EtOH and incubated at -20°C for 15 minutes. The precipitated mRNA was pelleted again by centrifugation, and the supernatant was removed. The pellet was washed with 70% cold ethanol and air-dried. For HPLC-purified mRNA, after LiCl precipitation and reconstitution, the mRNA was P-IP was purified by HPLC (see, e.g., Kariko, et al. Nuclei c Acids Research,2011,Vol.39,No.21 e142 The fractions selected for pooling were combined and purified by sodium acetate / ethanol as above. The absorbance at 260 nm was measured (Nanodrop). The transcript concentration was determined by the method described above, and the transcript concentration was analyzed by capillary analysis using a Bioanlayzer (Agilent). -Transcripts were analyzed by electrophoresis.

[0518] When referring to SEQ ID NOs: 1 and 2 below with respect to RNA, T is replaced by U (as above). It is understood that the uridine derivative should be replaced with N1-methylpseudouridine (as in Example 1). The Cas9 mRNA used in It contains a 3' poly A tail and is identified by SEQ ID NO:

[0519] SEQ ID NO: 1: Cas9 sequence 1 for transcription GGGTCCCGCAGTCGGCGTCCAGCGGCTCTGCTTGTTCGTG TGTGTGTCGTTGCAGGCCTTATTCGGATCCGCCACCATGG ACAAGAAGTACAGCATCGGACTGGACATCGGAACAAACAG CGTCGGATGGGCAGTCATCACAGACGAATACAAGGTCCCG AGCAAGAAGTTCAAGGTCCTGGGAAACACAGACAGACACA GCATCAAGAAGAACCTGATCGGAGCACTGCTGTTCGACAG CGGAGAAACAGCAGAAGCAACAAGACTGAAGAGAACAGCA AGAAGAAGATACACAAGAAGAAAGAACAGAATCTGCTACC TGCAGGAAATCTTCAGCAACGAAATGGCAAAGGTCGACGA CAGCTTCTTCCACAGACTGGAAGAAAGCTTCCTGGTCGAA GAAGACAAGAAGCACGAAAGACACCCGATCTTCGGAAACA TCGTCGACGAAGTCGCATACCACGAAAAGTACCCGACAAT CTACCACCTGAGAAAGAAGCTGGTCGACAGCACAGACAAG GCAGACCTGAGACTGATCTACCTGGCACTGGCACACATGA TCAAGTTCAGAGGACACTTCCTGATCGAAGGAGACCTGAA CCCGGACAACAGCGACGTCGACAAGCTGTTCATCCAGCTG GTCCAGACATACAACCAGCTGTTCGAAGAAAACCCGATCA ACGCAAGCGGAGTCGACGCAAAGGCAATCCTGAGCGCAAG ACTGAGCAAGAGCAGAAGACTGGAAAACCTGATCGCACAG CTGCCGGGAGAAAAAAAACGGACTGTTCGGAAACCTGA TCGCACTGAGCCTGGGACTGACACCGAACTTCAAGAGCAA CTTCGACCTGGCAGAAGACGCAAAGCTGCAGCTGAGCAAG GACACATACGACGACGACCTGGACAACCTGCTGGCACAGA TCGGAGACCAGTACGCAGACCTGTTCCTGGCAGCAAAGAA CCTGAGCGACGCAATCCTGCTGAGCGACATCCTGAGAGTC AACACAGAAATCACAAAGGCACCGCTGAGCGCAAGCATGA TCAAGAGATACGACGAACACCACCAGGACCTGACACTGCT GAAGGCACTGGTCAGACAGCAGCTGCCGGAAAGTACAAG GAAATCTTCTTCGACCAGAGCAAGAACGGATACGCAGGAT ACATCGACGGAGGAGGAGCAAGCCAGGAAGAAGATTCTACAAGTT CATCAAGCCGATCCTGGAAAGATGGACGGAACAGAAGAA CTGCTGGTCAAGCTGAACAGAGAGACCTGCTGAGAAAGC AGAGAACATTCGACAACGGAAGCATCCCGCACCAGATCCA CCTGGGGAGAACTGCACGCAATCCTGAGAAGACAGGAAGAC TTCTACCCGTTCCTGAAGGACAACAGAGAAAGATCGAAA AGATCCTGACATTCAGAATCCCGTACTACGTCGGACCGCT GGCAAGAGGAAACAGCAGATTCGCATGGATGACAAGAAAG AGCGAAAAAACAATCACACCGTGGAACTTCGAAAGAAGTCG TCGACAAGGGAGCAAGCGCACAGAGCTTCATCGAAAGAAT GACAAACTTCGACAAGAACCTGCCGAACGAAAGGTCCTG CCGAAGCACAGCCTGCTGTACGAATACTTCACAGTCTACA ACGAACTGACAAAGGTCAAGTACGTCACAGAAGGAATGAG AAAGCCGGCATTCCTGAGCGGAGAACAGAGAGCAATC GTCGACCTGCTGTTCAAGACAAACAGAAAGGTCACAGTCA AGCAGCTGAAGGAAGACTACTTCAAGAAGATCGAATGCTT CGACAGCGTCGAAATCAGCGGAGTCGAAGACAGATTCAAC GCAAGCCTGGGAACATACCACGACCTGCTGAAGATCATCA AGGACAAGGACTTCCTGGACAACGAAGAAAACGAAGACAT CCTGGAAGACATCGTCCTGACACTGACACTGTTCGAAGAC AGAGAAATGATCGAAGAAAGACTGAAGACATACGCACACC TGTTCGACGACAAGGTCATGAAGCAGCTGAAGAGAGAGAG ATACACAGGATGGGGAAGACTGAGCAGAAGCTGATCAAC GGAATCAGAGACAAGCAGAGCGGAAAGACAATCCTGGACT TCCTGAAGAGCGACGGATTCGCAAACAGAAACTTCCATGCA GCTGATCCACGACGACAGCCTGACATTCAAGGAAGACATC CAGAAGGCACAGGTCAGCGGACAGGGAGACAGCCTGCACG AACACATCGCAAACCTGGCAGGAAGCCCGGCAATCAAGA GGGAATCCTGCAGACAGTCAAGGTCGTCGACGAACTGGTC AAGGTCATGGGAAGACACAAGCCGGAAAACATCGTCATCG AAATGGAGAAAACCAGACAACACAGAAGGGACAGAA GAACAGCAGAGAAAGAATGAAGAGAATCGAAGAGAATC AAGGAACTGGGAAGCCAGATCCTGAAGGAACACCCGGTCG AAAACACACAGCTGCAGAAACGAAAAGCTGTACCTGTACTA CCTGCAGAACGGAAGAGACATGTACGTCGACCAGGAACTG GACATCAACAGACTGAGCACTACGACGTCGACCACATCG TCCCGCAGAGCTTCCTGAAGGACGACAGCATCGACAACAA GGTCCTGACAAGAAGCGCACAAGAACAGGAAGGAGCGAC AACGTCCCGAGCGAAAGAAGTCGTCAAGAAGATGAAACT ACTGGAGACAGCTGCTGAACGCAAAGCTGATCACACAGAG AAAGTTCGACAACCTGGACAAAGGCAGAGAGGAGGACTG AGCGAACTGGACAAGGCAGGATTCATCAAGAGACAGCTGG TCGAAACAAGACAGATCCAAAGCACGTCGCCACAGATCCT GGACAGCAGAATGAACACAAAGTACGACGAAAACGACAAG CTGATCAGAGAAGTCAAGGTCATCACACTGAAGAGCAAGC TGGTCAGCGACTTCAGAAGGACTTCCAGTTCTACAAGGT CAGAGAAATCAACAACTACCACCACGCACACGACGCATAC CTGAACGCAGTCGTCGGAACAGCACTGATCAAGAAGTACC CGAAGCTGGAAAGCGAATTCGTCTACGGAGACTACAAGGT CTACGACGTCAGAAAGATGATCGCAAAGCGAAACAGGA ATCGGAAAGGCAACAGCAAAGTACTTCTTCTACAGCAACA TCATGAACTTCTTCAAGACAGAAATCACACTGGCAAACGG AGAAATCAGAAAGAGACCGCTGATCGAACAAACGGAGAA ACAGGAGAAATCGTCTGGGACAAGGGAAGAGACTTCGCAA CAGTCAGAAAGGTCCTGAGCATGCCGCAGGTCAACATCGT CAAGAGACAGAAGTCCAGACAGGAGGATTCAGCAAGGAA AGCATCCTGCCGAAGAGAACAGCGACAAGCTGATCGCAA GAAAGAAGGACTGGGACCCGAAGAAGTACGGAGGATTCGA CAGCCCGACAGTCGCATACAGCGTCCTGGTCGTCGCAAAG GTCGAAAAGGGAAGAGCAAGAAGCTGAAGAGCGTCAAGG AACTGCTGGGAATCACAATCATGGAAGAAGCAGCTTCGA AAAGAACCCGATCGACTTCCTGGAAAGCAAAGGGATACAAG GAAGTCAAGAAGGACCTGATCATCAAGCTGCCGAAGTACA GCCTGTTCGAACTGGAAAACGGAAAGAAAGGAATGCTGGC AAGCGCAGGAGAACTGCAGAAGGGAAACGAACTGGCACTG CCGAGCAAGTACGTCAACTTCCTGTACCTGGCAAGCCACT ACGAAAAGCTGAAGGGAAGCCCGGAAGACAACGAACAGAA GCAGCTGTTCGTCGAACAGCACAAGCACTACCTGGACGAA ATCATCGAACAGATCAGCGAATTCAGCAAGAGAGTCATCC TGGCAGACGCAAACCTGGACAAGGTCCTGAGCGCATACAA CAAGCACAGAGACAAGCCGATCAGAGAACAGGCAGAAAAC ATCATCCACCTGTTCACACTGACAAACCTGGGAGCACCGG CAGCATTCAAGTACTTCGACACAACAATCGACAGAAAAGAG ATACACAAGCACAAAGGAAGTCCTGGACGCAACACTGATC CACCAGAGCATCACAGGACTGTACGAAACAAGAATCGACC TGAGCCAGCTGGGAGGAGACGGAGGAGGAAGCCCGAAGAA GAAGAGAAGGTCTAGCTAGCCATCACATTTAAAAGCATC TCAGCCTACCATGAGAATAAGAGAAAAAAATGAAGATCA ATAGCTTATTCATCTCTTTTTCTTTTTCGTTGGTGTAAAG CCAACACCCTGTCTAAAAAACATAAATTTCTTTAATCATT TTGCCTCTTTTCTCTGTGCTTCAATTAATAAAAAATGGAA AGAACCTCGAG

[0520] sequence number:2: transcriptional Cas9 sequence2 GGGTCCCGCAGTCGGCGTCCAGCGGCTCTGCTTGTTCGTG TGTGTGTCGTTGCAGGCCTTATTCGGATCCATGGATAAGA AGTACTCAATCGGGCTGGATATCGGAACTAATTCCGTGGG TTGGGCAGTGATCACGGATGAATACAAAGTGCCGTCCAAG AAGTTCAAGGTCCTGGGGAACACCGATAGACACAGCATCA AGAAAAATCTCATCGGAGCCCTGCTGTTTGACTCCGGCGA AACCGCAGAAGCGACCCGGCTCAAACGTACCGCGAGGCGA CGCTACACCCGGCGGAAGAATCGCATCTGCTATCTGCAAG AGATCTTTTCGAACGAAATGGCAAAGGTCGACGACAGCTT CTTCCACCGCCTGGAAGAATCTTTCCTGGTGGAGGAGGAC AAGAAGCATGAACGGCATCCTATCTTTGGAAACATCGTCG ACGAAGTGGCGTACCACGAAAAGTACCCGACCATCTACCA TCTGCGGAAGAAGTTGGTTGACTCAACTGACAAGGCCGAC CTCAGATTGATCTACTTGGCCCTCGCCCATATGATCAAAT TCCGCGGACACTTCCTGATCGAAGGCGATCTGAACCCTGA TAACTCCGACGTGGATAAGCTTTTCATTCAACTGGTGCAG ACCTACAACCAACTGTTCGAAGAAAACCCAATCAATGCTA GCGGCGTCGATGCCAAGGCCATCCTGTCCGCCCGGCTGTC GAAGTCGCGGCGCCTCGAAAACCTGATCGCACAGCTGCCG GGAGAGAAAAAGAACGGACTTTTCGGCAACTTGATCGCTC TCTCACTGGGACTCACTCCCAATTTCAAGTCCAATTTTGA CCTGGCCGAGGACGCGAAGCTGCAACTCTCAAAGGACACC TACGACGACGACTTGGACAATTTGCTGGCACAAATTGGCG ATCAGTACGCGGATCTGTTCCTTGCCGCTAAGAACCTTTC GGACGCAATCTTGCTGTCCGATATCCTGCGCGTGAACACC GAAATAACCAAAGCGCCGCTTAGCGCCTCGATGATTAAGC GGTACGACGAGCATCACCAGGATCTCACGCTGCTCAAAGC GCTCGTGAGACAGCAACTGCCTGAAAAGTACAAGGAGATC TTCTTCGACCAGTCCAAGAATGGGTACGCAGGGTACATCG ATGGAGGCGCTAGCCAGGAAGAGTTCTATAAGTTCATCAA GCCAATCCTGGAAAAGATGGACGGAACCGAAGAACTGCTG GTCAAGCTGAACAGGGAGGATCTGCTCCGGAAACAGAGAA CCTTTGACAACGGATCCATTCCCCACCAGATCCATCTGGG TGAGCTGCACGCCATCTTGCGGCGCCAGGAGGACTTTTAC CCATTCCTCAAGGACAACCGGGAAAAGATCGAGAAAATTC TGACGTTCCGCATCCCGTATTACGTGGGCCCACTGGCGCG CGGCAATTCGCGCTTCGCGTGGATGACTAGAAAATCAGAG GAAACCATCACTCCTTGGAATTTCGAGGAAGTTGTGGATA AGGGAGCTTCGGCACAAAGCTTCATCGAACGAATGACCAA CTTCGACAAGAATCTCCCAAACGAGAAGGTGCTTCCTAAG CACAGCCTCCTTTACGAATACTTCACTGTCTACAACGAAC TGACTAAAGTGAAATACGTTACTGAAGGAATGAGGAAGCC GGCCTTTCTGTCCGGAGAACAGAAGAAAGCAATTGTCGAT CTGCTGTTCAAGACCAACCGCAAGGTGACCGTCAAGCAGC TTAAAGAGGACTACTTCAAGAAGATCGAGTGTTTCGACTC AGTGGAAATCAGCGGGGTGGAGGACAGATTCAACGCTTCG CTGGGAACCTATCATGATCTCCTGAAGATCATCAAGGACA AGGACTTCCTTGACAACGAGGAGAACGAGGACATCCTGGA AGATATCGTCCTGACCTTGACCCTTTTCGAGGATCGCGAG ATGATCGAGGAGAGGCTTAAGACCTACGCTCATCTCTTCG ACGATAAGGTCATGAAACAACTCAAGCGCCGCCGGTACAC TGGTTGGGGCCGCCTCTCCCGCAAGCTGATCAACGGTATT CGCGATAAACAGAGCGGTAAAACTATCCTGGATTTCCTCA AATCGGATGGCTTCGCTAATCGTAACTTCATGCAATTGAT CCACGACGACAGCCTGACCTTTAAGGAGGACATCCAAAAA GCACAAGTGTCCGGACAGGGAGACTCACTCCATGAACACA TCGCGAATCTGGCCGGTTCGCCGGCGATTAAGAAGGGAAT TCTGCAAACTGTGAAGGTGGTCGACGAGCTGGTGAAGGTC ATGGGACGGCACAAACCGGAGAATATCGTGATTGAAATGG CCCGAGAAAACCAGACTACCCAGAAGGGCCAGAAAAACTC CCGCGAAAGGATGAAGCGGATCGAAGAAGGAATCAAGGAG CTGGGCAGCCAGATCCTGAAAGAGCACCCGGTGGAAAACA CGCAGCTGCAGAACGAGAAGCTCTACCTGTACTATTTGCA AAATGGACGGGACATGTACGTGGACCAAGAGCTGGACATC AATCGGTTGTCTGATTACGACGTGGACCACATCGTTCCAC AGTCCTTTCTGAAGGATGACTCGATCGATAACAAGGTGTT GACTCGCAGCGACAAGAACAGAGGGAAGTCAGATAATGTG CCATCGGAGGAGGTCGTGAAGAAGATGAAGAATTACTGGC GGCAGCTCCTGAATGCGAAGCTGATTACCCAGAGAAAGTT TGACAATCTCACTAAAGCCGAGCGCGGCGGACTCTCAGAG CTGGATAAGGCTGGATTCATCAAACGGCAGCTGGTCGAGA CTCGGCAGATTACCAAGCACGTGGCGCAGATCTTGGACTC CCGCATGAACACTAAATACGACGAGAACGATAAGCTCATC CGGGAAGTGAAGGTGATTACCCTGAAAAGCAAACTTGTGT CGGACTTTCGGAAGGACTTTCAGTTTTACAAAGTGAGAGA AATCAACAACTACCATCACGCGCATGACGCATACCTCAAC GCTGTGGTCGGTACCGCCCTGATCAAAAAGTACCCTAAAC TTGAATCGGAGTTTGTGTACGGAGACTACAAGGTCTACGA CGTGAGGAAGATGATAGCCAAGTCCGAACAGGAAATCGGG AAAGCAACTGCGAAATACTTCTTTTACTCAAACATCATGA ACTTTTTCAAGACTGAAATTACGCTGGCCAATGGAGAAAT CAGGAAGAGGCCACTGATCGAAACTAACGGAGAAACGGGC GAAATCGTGTGGGACAAGGGCAGGGACTTCGCAACTGTTC GCAAAGTGCTCTCTATGCCGCAAGTCAATATTGTGAAGAA AACCGAAGTGCAAACCGGCGGATTTTCAAAGGAATCGATC CTCCCAAAGAGAAATAGCGACAAGCTCATTGCACGCAAGA AAGACTGGGACCCGAAGAAGTACGGAGGATTCGATTCGCC GACTGTCGCATACTCCGTCCTCGTGGTGGCCAAGGTGGAG AAGGGAAAGAGCAAAAAGCTCAAATCCGTCAAAGAGCTGC TGGGGATTACCATCATGGAACGATCCTCGTTCGAGAAGAA CCCGATTGATTTCCTCGAGGCGAAGGGTTACAAGGAGGTG AAGAAGGATCTGATCATCAAACTCCCCAAGTACTCACTGT TCGAACTGGAAAATGGTCGGAAGCGCATGCTGGCTTCGGC CGGAGAACTCCAAAAAGGAAATGAGCTGGCCTTGCCTAGC AAGTACGTCAACTTCCTCTATCTTGCTTCGCACTACGAAA AACTCAAAGGGTCACCGGAAGATAACGAACAGAAGCAGCT TTTCGTGGAGCAGCACAAGCATTATCTGGATGAAATCATC GAACAAATCTCCGAGTTTTCAAAGCGCGTGATCCTCGCCG ACGCCAACCTCGACAAAGTCCTGTCGGCCTACAATAAGCA TAGAGATAAGCCGATCAGAGAACAGGCCGAGAACATTATC CACTTGTTCACCCTGACTAACCTGGGAGCCCCAGCCGCCT TCAAGTACTTCGATACTACTATCGATCGCAAAAGATACAC GTCCACCAAGGAAGTTCTGGACGCGACCCTGATCCACCAA AGCATCACTGGACTCTACGAAACTAGGATCGATCTGTCGC AGCTGGGTGGCGATGGCGGTGGATCTCCGAAAAAAGAAGAG AAAGGTGTAATGAGCTAGCCATCACATTTAAAAGCATCTC AGCCTACCATGAGAATAAGAGAAAGAAAATGAAGATCAAT AGCTTATTCATCTCTTTTTTCTTTTTCGTTGGTGTAAAGCC AACACCCTGTCTAAAAAACATAAATTTCTTTAATCATTTT GCCTCTTTTCTCTGTGCTTCAATTAATAAAAAATGGAAAG AACCTCGAG

[0521] Cynomolgus monkey homology guide design along with human TTR guide design and human TTR Human reference genome (e.g., hg38) and user-defined genomic regions of interest (e.g., , TTR protein-coding exons) to identify PAMs in the region of interest. For each identified PAM, we performed an initial guide selection in silico. Analyze and report statistics based on a number of criteria (e.g., GC content, predicted on-target gRNA molecules were further selected and analyzed based on their target activity (target activity, and potential off-target activity). The results were ranked. A total of 68 guide RNAs for TTR (ENSG00000118271) A total of 68 genes were designed targeting the protein coding regions within 1, 2, 3, and 4. Of these, 33 are 100% in cynomolgus monkeys (cynomolgus monkeys) In addition, 10 human TTR genes that are not completely homologous in cynomolgus monkeys were identified. For the id, a "surrogate" was created to perfectly match the corresponding cynomolgus target sequence. These "surrogate" or "tool" guides were designed and fabricated in parallel. are screened in cynomolgus monkeys to assess, for example, the activity and Functions can be approximated. Provide guide sequences and corresponding genomic coordinates (Table 1). All guide RNAs were generated as dual guide RNAs, with a subset of guide sequences They were produced as modified single-guide RNAs (Table 2). Dual-guide RNAs (dgRNAs) ) ID, modified single guide RNA (sgRNA) ID, and mutations against the cynomolgus monkey genome In addition to the number of matches, the guide ID alignment across the exact match IDs of cynomolgus monkeys was also performed. The dgRNAs used in the experiments detailed throughout the Examples are provided in Table 3. Where appropriate, SEQ ID NO:270 was used.

[0522] Cas9 mRNA and guide RNA delivery in vitro HEK293_Cas9 cell line, a human embryonic kidney adenocarcinoma that constitutively expresses Spy Cas9 The cell line HEK293 ("HEK293_Cas9") was cultured in 5% CO2 medium containing 10% fetal bovine serum and 5% CO2. The cells were cultured in DMEM medium supplemented with 100 μg / ml of G418. 24 hours before incubation, cells were plated at a density of 10,000 cells / well in a 96-well plate. Cells were transfected with Lipofectamine according to the manufacturer's protocol. Transfer RNAiMAX (ThermoFisher, Cat. 13778150) The cells were transfected with individual crRNA (25 nM), trRNA (25 nM), and Lipo Contains fectamine RNAiMAX (0.3 μL / well) and OptiMem The cells were transfected with lipoplexes containing the vector.

[0523] HUH7 cell line. Human hepatocellular carcinoma cell line HUH7 (Japanese Collection) n of Research Bioresources Cell Bank, Cat The cells (JCRB0403) were cultured in DMEM medium supplemented with 10% fetal bovine serum. The cells were plated in 96-well plates at 15,000 cells / well 20 hours before transfection. Cells were plated at a density of 100 μg / ml. Cells were treated with Lipofol according to the manufacturer's protocol. ectamine MessengerMAX (ThermoFisher, Cat. The cells were transfected with Spy Cas9 mRNA (10 0 ng), MessengerMAX (0.3 μL / well) and OptiMem Lipoplexes containing the respective crRNAs (25 nM), tracer RNAs (2 5nM), MessengerMAX (0.3µL / well) and OptiMem Separate lipoplexes carrying the respective nucleotides were sequentially transfected.

[0524] HepG2 cell line. Human hepatocellular carcinoma cell line HepG2 (American Type Cu Culture Collection, Cat. HB-8065) ​​in 10% fetal bovine blood. The cells were cultured in DMEM medium supplemented with supernatant. The cells were counted and counted 24 hours after transfection. Before incubation, plate 96-well plates with Bio-coat Collier at a density of 10,000 cells / well. Gen I-coated 96-well plates (ThermoFisher, Cat. Cells were plated on a 1000-well plate (877272). Li was added to the cells according to the manufacturer's protocol. pofectamine 2000 (ThermoFisher, Cat. 11668 The cells were transfected with Spy Cas9 mRNA (100 ng), Lipofectamine 2000 (0.2 μL / well) and OptiMem Lipoplexes containing the individual crRNAs (25 nM), tracer RNAs ( 25 nM), Lipofectamine 2000 (0.2 μL / well) and Op Separate lipoplexes containing tiMem were transfected sequentially.

[0525] Primary human liver hepatocytes (PHH) and primary cynomolgus monkey liver hepatocytes (P CH) (Gibco) according to the manufacturer's protocol (Invitrogen, protocol Briefly, cells were thawed and cultured according to the method described in the Supplementary Material of ... After resuspending in hepatocyte thawing medium (Gibco, Cat. CM7000) containing The supernatant was centrifuged at 100 g for 10 minutes for the cynomolgus monkeys and at 80 g for 4 minutes for the cynomolgus monkeys. Discard the pelleted cells and resuspend them in Hepatocyte Plating Medium + Additive Pack (Invi The cells were resuspended in 100 mL of 10 ... Count at 33,000 cells / well for humans or 60,000 for cynomolgus monkeys. Cells / well (or, as further described below, assayed for effects on TTR protein) Bio-coat Collagen I was plated at a density of 65,000 cells / well for 30 min. A coated 96-well plate (ThermoFisher, Cat. 877272 The plated cells were incubated in a tissue culture incubator for 3 The cells were incubated at 7°C in a 5% CO atmosphere for 6 or 24 hours to allow adhesion. After incubation, the cells were checked for monolayer formation, and the medium was changed to hepatocyte culture medium containing serum-free additive pack. (Invitrogen, Cat. A1217601 and CM4000) I got it.

[0526] Lipofectamine RNAiMax (ThermoFisher, Cat. 13778150)-based transfection according to the manufacturer's protocol. The cells were injected with Spy Cas9 mRNA (100 ng), Lipofectamine, and Liposomes containing RNAiMax (0.4 μL / well) and OptiMem followed by crRNA (25 nM) and tracer RNA (25 nM) or s gRNA (25nM), Lipofectamine RNAiMax (0.4μL / u Separate lipoplexes containing OptiMem were sequentially transfected. I did.

[0527] After forming ribonucleotides, the Spy Cas9 protein carrying the guide RNA The proteins (RNP) were electroporated or transfected into cells. For each deoxyribonucleic acid (dgRNA), individual crRNA and trRNA were prepared using equivalent amounts of the sample. Pre-anneal the drugs by mixing and incubating at 95 °C for 2 min and cooling to room temperature. The single guide (sgRNA) was boiled at 95°C for 2 minutes and cooled to room temperature. Boiled dgRNA or sgRNA was incubated in Optimem for 10 minutes at room temperature in SpyCa. Incubation with s9 protein allowed the formation of ribonucleoprotein (RNP) complexes .

[0528] For electroporation of RNP into primary human and cynomolgus monkey hepatocytes, Thawing the cells and electroporating primary cells 2500 cells / µL for human hepatocytes and 2500 cells / µL for cynomolgus monkey hepatocytes in P3 buffer Resuspend cells at a concentration of 3,500 cells / µL in a volume of 20 µL per guide. and 5 μL of RNP. 20 μL of the mixture is electroporated in a Lonza electroporator. Place in a template. Cells were electroporated using a cleofector. After incubation, cells were transferred to Biocoat plates containing pre-warmed maintenance medium and incubated for 3 min. Place in a tissue culture incubator at 7°C and 5% CO2.

[0529] For transfection of RNP lipoplexes, follow the manufacturer's protocol. Therefore, cells were treated with Lipofectamine RNAiMAX (ThermoFisher) r, Cat. 13778150). 10 nM), individual guides (10 nM), tracer RNA (10 nM), Lipofe Containing ctamine RNAiMAX (1.0 μL / well) and OptiMem The RNPs were transfected as described above.

[0530] Precision Nanosystems according to the manufacturer's protocol Using the NanoAssemblr™ Benchtop Instrument By performing microfluidic mixing of lipid and RNA solutions through cross-flow mixing LNP was formed by the following.

[0531] LNP formulations - NanoAssemblr Generally, lipid nanoparticle components are dissolved in 100% ethanol at various molar ratios of lipid components. The RNA cargo was dissolved in 25 mM citrate, 100 mM NaCl (pH 5.0). Dissolution resulted in a concentration of approximately 0.45 mg / mL of RNA cargo. or a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6, and a 1:1 mRNA to g LNPs were formulated at a weight ratio of RNA.

[0532] Precision Nanosystems according to the manufacturer's protocol Using the NanoAssemblr™ Benchtop Instrument LNPs were formed by microfluidic mixing of lipid and RNA solutions. The difference in the ratio of aqueous to organic solvent was used to maintain a 2:1 ratio during mixing. After mixing, LN P was collected, diluted in water (approximately 1:1 v / v), kept at room temperature for 1 hour, and further diluted with water. After this, a final buffer exchange was performed with 50 mM Tris, 45 mM NaCl, and 1:1 v / v. A final buffer exchange into TSS, 5% (w / v) sucrose, pH 7.5 (TSS) was performed at PD The procedure was completed using a GE-10 desalting column. If necessary, an Amicon 100 kDa The formulation was concentrated by centrifugation using a centrifugal filter (Millipore). The resulting mixture was then filtered using a 0.2 μm sterile filter. The LNPs were stored at −80° C. until further use.

[0533] LNP Formulation - Crossflow For LNPs prepared using cross-flow technology, 2 volumes of RNA solution and 1 LNPs were formed by impinging jet mixing of lipids in ethanol with a volume of water. Mix the lipids in the tube with 2 volumes of RNA solution through a mixing cross. The mixture is mixed with the outlet stream of the cross through an in-line tee (WO2016010 (See Figure 2 in 840). The LNPs were kept at room temperature for 1 hour and further diluted with water (approximately 1:1 v / v). The diluted LNP was loaded onto a flat sheet cartridge (Sartorius, 100k After concentration using tangential flow filtration with a 0.2 mm diameter MWCO (0.2 mm), the buffer was diaphragmed. Filtration yielded 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose. Alternatively, the final buffer exchange to TSS was Desalting was completed using a PD-10 desalting column (GE). If necessary, Amicon 100k The formulation was concentrated by centrifugation using a Da centrifugal filter (Millipore). The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNP was stored at 4°C or -80°C until further use.

[0534] Analysis of formulations Dynamic photometric analysis was performed to characterize the polydispersity index ("pdi") and size of the LNPs of the present disclosure. DLS is used to measure the amount of light emitted by a sample as a result of subjecting the sample to a light source. The PDI determined from DLS measurements is the particle size in the population. PDI represents the distribution of particle sizes (around the mean particle size), with a completely uniform population having a PDI of 0. Dynamic light scattering (DLS) was performed using a Malvern Zetasizer DLS instrument. The mean particle size and polydispersity are measured by DLS. The LNP samples were then washed with PB The Z-average diameter, an intensity-based measure of the average particle size, was calculated using a few averages. The zeta potential of LNPs was also measured using Malve Before measurement, the sample was diluted with 0.1X PBS, pH 7. Dilute 1:17 (50uL to 800uL) with .4.

[0535] Fluorescence-based assay (Ribogreen®, ThermoFisher Determine total RNA concentration and free RNA using a ELISA kit (Scientific). The encapsulation efficiency is calculated as (total RNA - free RNA) / total RNA. Dilute the sample appropriately with 1x TE buffer containing 0.2% Triton-X 100. Determine total RNA by diluting with 1x TE buffer or determine free RNA by diluting with 1x TE buffer. . 1x TE buffer + / - 0.2% Triton- Prepare a standard curve by using a 100x diluted starting RNA solution. Diluted RiboGreen® dye (according to the manufacturer's instructions) was then added to the standard Add the mixture to the substrate and sample and incubate for approximately 10 minutes at room temperature in the absence of light. pectraMax M5 Microplate Reader (Molecular The samples were read using the NI 80260 Devices, and the excitation, automatic cutoff, and emission wavelengths were Set the wavelengths to 488 nm, 515 nm, and 525 nm, respectively. Total RNA and Free RNA is determined from an appropriate standard curve.

[0536] The encapsulation efficiency is calculated as (total RNA - free RNA) / total RNA. The same procedure may be used to determine the encapsulation efficiency of NA-based cargo components. For DNA, Oligreen Dye may be used, and for double-stranded DNA, P Icogreen Dye may also be used.

[0537] Typically, LNPs are prepared with encapsulation >80%, particle size <120 nm, and pd i was <0.2.

[0538] Delivery of LNPs in vivo Unless otherwise stated, 6- to 10-week-old CD-1 female mice were used in each experiment. Animals were weighed and grouped according to weight to prepare dosing solutions based on group mean weight. The LNP was administered in a volume of 0.2 mL per animal (approximately 10 per kilogram of body weight). The animals were observed for adverse effects approximately 6 hours after administration. Body weights were measured 24 hours after administration and the animals were treated with isoflurane. Mice were euthanized at various time points by exsanguination via cardiac puncture under anesthesia. Blood was collected for serum separation. Tubes or tubes containing buffered sod...

Claims

1. A method for inducing a double-strand break (DSB) in the TTR gene, comprising delivering a composition to a cell. wherein the composition comprises: a. a guide RNA comprising a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 18 of a sequence selected from SEQ ID NOs: 5 to 82 is a guide RNA comprising 20 consecutive nucleotides; or c. At least 99%, 98%, 97% of a sequence selected from SEQ ID NOs: 5-82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Guide RNA containing Including, method.

2. A method for modifying a TTR gene, comprising delivering a composition to a cell, said composition the product comprises (i) an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent; and (ii) a guide RNA, wherein the guide RNA comprises: a. a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 18 of a sequence selected from SEQ ID NOs: 5 to 82 is 20 consecutive nucleotides; or c. At least 99%, 98%, 97% of a sequence selected from SEQ ID NOs: 5-82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, method.

3. A method for treating amyloidosis associated with TTR (ATTR), comprising administering to a subject a composition comprising: administering the compound to a subject in need thereof, thereby treating ATTR; The composition comprises (i) an RNA-guided DNA-binding agent or a nucleic acid encoding the RNA-guided DNA-binding agent. and (ii) a guide RNA, wherein the guide RNA comprises: a. a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 18 of a sequence selected from SEQ ID NOs: 5 to 82 is 20 consecutive nucleotides; or c. At least 99%, 98%, 97% of a sequence selected from SEQ ID NOs: 5-82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, method.

4. A method for reducing serum concentrations of TTR, comprising administering a composition to a subject in need thereof. thereby reducing the serum concentration of TTR, wherein the composition comprises: (i) RNA a nucleic acid encoding a guide DNA binding agent or an RNA-guided DNA binding agent; and (ii) a The guide RNA comprises: a. a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 18 of a sequence selected from SEQ ID NOs: 5 to 82 is 20 consecutive nucleotides; or c. At least 99%, 98%, 97% of a sequence selected from SEQ ID NOs: 5-82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, method.

5. reducing the accumulation of amyloid or amyloid fibrils containing TTR in a subject; or A method for preventing amyloidosis, comprising administering a composition to a subject in need thereof, thereby preventing amyloidosis. and reducing accumulation of amyloid or amyloid fibrils, wherein the composition comprises: (i) RNA; a nucleic acid encoding a guide DNA binding agent or an RNA-guided DNA binding agent; and (ii) a The guide RNA comprises: a. a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 18 of a sequence selected from SEQ ID NOs: 5 to 82 is 20 consecutive nucleotides; or c. At least 99%, 98%, 97% of a sequence selected from SEQ ID NOs: 5-82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, method.

6. A composition comprising a guide RNA, wherein the guide RNA is a. a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 18 of a sequence selected from SEQ ID NOs: 5 to 82 is 20 consecutive nucleotides; or c. At least 99%, 98%, 97% of a sequence selected from SEQ ID NOs: 5-82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, composition.

7. A composition comprising a vector encoding a guide RNA, wherein the guide RNA is a. a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 18 of a sequence selected from SEQ ID NOs: 5 to 82 is 20 consecutive nucleotides; or c. At least 99%, 98%, 97% of a sequence selected from SEQ ID NOs: 5-82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, composition.

8. For use in inducing a double-strand break (DSB) in the TTR gene in a cell or subject. The composition according to claim 6 or 7 for use in a method for treating a skin condition.

9. 6 or 7 for use in modifying the TTR gene in a cell or a subject.

7. The composition described in 7.

10. For use in treating amyloidosis associated with TTR (ATTR) in a subject.

8. The composition according to claim 6 or 7 for use in

11. A compound according to claim 6 or 7 for use in reducing the serum concentration of TTR in a subject. The composition described above.

12. Use in reducing or preventing amyloid or amyloid fibril accumulation in a subject The composition according to claim 6 or 7.

13. The method of any one of claims 1 to 5, wherein the composition reduces serum TTR levels. A method or composition for use according to any one of claims 8 to 12.

14. The serum TTR level is at least as high as the serum TTR level before administration of the composition.

14. The composition for the method or use of claim 13, wherein the amount of erythrocyte proliferation is also reduced by 50%.

15. the serum TTR level is increased by 50 to 60% compared to the serum TTR level before administration of the composition; ０％、６０～７０％、７０～８０％、８０～９０％、９０～９５％、９５～９８％、９８ 14. The method or use according to claim 13, wherein the amount of hydroxybenzoates in the blood is reduced by up to 99%, or by 99-100%. Composition of.

16. Claims 1-5 or 8-15, wherein the composition results in editing of the TTR gene.

10. A composition for the method or use according to any one of the preceding claims.

17. The editing is calculated as the percentage of the population that is edited (percent editing).

17. A composition for the method or use of claim 16.

18. 18. The method of claim 17, wherein the percent editing is between 30 and 99% of the population; or Composition for use.

19. The percentage of edited regions is 30-35%, 35-40%, 40-45%, 45% or 50% of the population. ～５０％、５０～５５％、５５～６０％、６０～６５％、６５～７０％、７０～７５％、 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% 18. A composition for the method or use of claim 17.

20. The composition of claim 1, wherein the composition reduces amyloid deposition in at least one tissue. 5 or the use according to any one of claims 8 to 19 Composition of.

21. The at least one tissue is one or more of the stomach, colon, sciatic nerve, or dorsal root ganglion.

21. A composition for the method or use of claim 20 comprising a number.

22. 22. The method of claim 20 or 21, wherein amyloid deposition is measured 8 weeks after administration of the composition. A composition for the described method or use.

23. Amyloid deposits are compared to a negative control or to levels measured before administration of the composition.

23. The method or composition for use according to any one of claims 20 to 22,

24. 2. Amyloid deposits are measured in biopsy samples and / or by immunostaining.

24. A composition for the method or use according to any one of claims 0 to 23.

25. Amyloid deposits were 30-35%, 35-40%, or 40% of those seen in negative controls. ４０％、４０～４５％、４５～５０％、５０～５５％、５５～６０％、６０～６５％、６ ５～７０％、７０～７５％、７５～８０％、８０～８５％、８５～９０％、９０～９５％ 25. The method according to any one of claims 20 to 24, wherein the amount of oxidized or oxidized cellulose is reduced by 95 to 99% or by 95 to 99%. or compositions for use.

26. amyloid deposits are 30-35% of the amyloid deposits seen prior to administration of the composition; ３５～４０％、４０～４５％、４５～５０％、５０～５５％、５５～６０％、６０～６５ ％、６５～７０％、７０～７５％、７５～８０％、８０～８５％、８５～９０％、９０～ 26. The method according to claim 20, wherein the amount of oxidative stress is reduced by 95%, or by 95-99%. Compositions for the methods or uses.

27. 27. The method of claim 1, wherein the composition is administered or delivered at least twice. A composition for the method or use according to any one of claims 1 to 4.

28. 28. The method or use of claim 27, wherein the composition is administered or delivered at least three times. Composition for use.

29. 28. The method or use of claim 27, wherein the composition is administered or delivered at least four times. Composition for use.

30. The composition is administered or delivered up to 5, 6, 7, 8, 9, or 10 times. Item 28. A composition for the method or use according to Item 27.

31. The administration or delivery is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 1 The method according to any one of claims 27 to 30, which is carried out at intervals of 3, 14 or 15 days. Method or composition for use.

32. The administration or delivery is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 1 The method according to any one of claims 27 to 30, which is carried out at intervals of 3, 14 or 15 weeks. Method or composition for use.

33. The administration or delivery is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 1 31. The method of claim 27, wherein the method is carried out at intervals of 3, 14, or 15 months. Compositions for the methods or uses.

34. Any one of claims 1 to 33, wherein the guide sequence is selected from SEQ ID NOs: 5 to 82 2. The method or composition according to claim 1 .

35. The guide RNA is at least partially identical to a target sequence present in the human TTR gene.

35. The method or composition of any one of claims 1 to 34, which is complementary.

36. 3. The target sequence is in exon 1, 2, 3, or 4 of the human TTR gene.

5. The method or composition according to claim 5.

37. 36. The method of claim 35, wherein the target sequence is in exon 1 of the human TTR gene; composition.

38. 36. The method of claim 35, wherein the target sequence is in exon 2 of the human TTR gene; composition.

39. 36. The method of claim 35, wherein the target sequence is in exon 3 of the human TTR gene; composition.

40. 36. The method of claim 35, wherein the target sequence is in exon 4 of the human TTR gene; composition.

41. 41. Any of claims 1 to 40, wherein the guide sequence is complementary to a target sequence in the positive strand of TTR.

1. The method or composition according to claim 1.

42. 41. Any of claims 1 to 40, wherein the guide sequence is complementary to a target sequence in the negative strand of TTR.

1. The method or composition according to claim 1.

43. The first guide sequence is complementary to the first target sequence in the positive strand of the TTR gene and The composition further comprises a second guide sequence complementary to a second target sequence in the negative strand of the FTR gene.

41. The method or composition of any one of claims 1 to 40, comprising:

44. The guide RNA comprises the guide sequence and has the nucleotide sequence of SEQ ID NO:

126. wherein said nucleotides of SEQ ID NO: 126 are said guide sequence 44. The method or composition of any one of claims 1 to 43, wherein at its 3' end Finished product.

45. Any of claims 1 to 44, wherein the guide RNA is a dual guide (dgRNA).

10. The method or composition according to claim 1.

46. the dual guide RNA comprises a crRNA and a trRNA, and the crRNA , comprising the nucleotide sequence of SEQ ID NO: 126, wherein said nucleotide of SEQ ID NO: 126 46. ​​The method or composition of claim 45, wherein the guide sequence is followed at its 3' end by 。

47. Any of claims 1 to 43, wherein the guide RNA is a single guide (sgRNA).

10. The method or composition according to claim 1.

48. 48. The method of claim 47, wherein the sgRNA comprises a guide sequence having the pattern of SEQ ID NO:

3. The method or composition described.

49. 48. The method or composition of Claim 47, wherein the sgRNA comprises the sequence of SEQ ID NO:

3.

50. Each N in SEQ ID NO:3 is any natural or non-natural nucleotide, The guide sequence is formed, and the guide sequence targets Cas9 to the TTR gene.

50. The method or composition of claim 48 or 49.

51. the sgRNA comprising any one of the guide sequences of SEQ ID NOs: 5-82 and SEQ ID NO:

51. The method or composition of any one of claims 47 to 50, comprising 126 nucleotides. thing.

52. the sgRNA has at least 99% identity with a sequence selected from SEQ ID NOs: 87-124; 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical 52. The method or composition of any one of claims 47 to 51, comprising a guide sequence of:

53. 48. The method of claim 47, wherein the sgRNA comprises a sequence selected from SEQ ID NOs: 87 to 124. The method or composition described.

54. 54. The method according to any one of claims 1 to 53, wherein the guide RNA comprises at least one modification. The method or composition described above.

55. The at least one modification is a 2'-O-methyl (2'-O-Me) modified nucleotide.

55. The method or composition of claim 54, comprising:

56. The at least one modification includes an internucleotide phosphorothioate (PS) bond.

56. The method or composition of claim 54 or 55.

57. wherein the at least one modification comprises a 2'-fluoro (2'-F) modified nucleotide.

57. The method or composition of any one of claims 54 to 56.

58. The at least one modification is one or more of the first five nucleotides at the 5' end.

58. The method or composition of any one of claims 54 to 57, wherein 。

59. The at least one modification is one or more of the last five nucleotides at the 3' end.

59. The method or composition of any one of claims 54 to 58, wherein 。

60. The at least one modification comprises a PS bond between the first four nucleotides.

60. The method or composition of any one of paragraphs 54 to 59.

61. The at least one modification comprises a PS bond between the last four nucleotides.

61. A method or composition according to any one of paragraphs 54 to 60.

62. The at least one modification is a 2-nucleotide sequence in the first three nucleotides at the 5' end.

62. The method of any one of claims 54 to 61, comprising '-O-Me modified nucleotides. Or composition.

63. The at least one modification is a 2-nucleotide sequence in the last three nucleotides at the 3' end.

63. The method of any one of claims 54 to 62, comprising '-O-Me modified nucleotides. Or composition.

64. Any of claims 54 to 63, wherein the guide RNA comprises modified nucleotides of SEQ ID NO:

3. The method or composition according to any one of claims 1 to 4.

65. 65. Any one of claims 1 to 64, wherein the composition further comprises a pharmaceutically acceptable excipient. Item 1. The method or composition according to item 1.

66. 66. Any of claims 1 to 65, wherein the guide RNA is associated with a lipid nanoparticle (LNP).

1. The method or composition according to claim 1.

67. 67. The method or composition of claim 66, wherein the LNP comprises a CCD lipid.

68. 68. The method or composition of claim 67, wherein the CCD lipid is lipid A or lipid B. thing.

69. 69. The method or composition of claims 66-68, wherein the LNP comprises a neutral lipid.

70. 70. The method or composition of claim 69, wherein the neutral lipid is DSPC.

71. The method according to any one of claims 66 to 70, wherein the LNP comprises a helper lipid. is a composition.

72. 72. The method or composition of claim 71, wherein the helper lipid is cholesterol.

73. 73. The method of any one of claims 66 to 72, wherein the LNP comprises a stealth lipid. is a composition.

74. 74. The method or composition of claim 73, wherein the stealth lipid is PEG2k-DMG. 。

75. 75. Any one of claims 1 to 74, wherein the composition further comprises an RNA-guided DNA binding agent.

2. The method or composition according to claim 1 .

76. 2. The method of claim 1 , wherein the composition further comprises an mRNA encoding an RNA-guided DNA-binding agent.

76. The method or composition of any one of 1 to 75.

77. 77. The method of claim 75 or 76, wherein the RNA-guided DNA binding agent is a Cas cleavase. The method or composition described above.

78. 78. The method or composition of Claim 77, wherein the RNA-guided DNA binding agent is Cas9. thing.

79. 79. The method according to any one of claims 75 to 78, wherein the RNA-guided DNA binding agent is modified. The method or composition described.

80. 80. Any one of claims 75 to 79, wherein the RNA-guided DNA binding agent is a nickase.

2. The method or composition according to claim 1 .

81. The modified RNA-guided DNA binding agent comprises a nuclear localization signal (NLS).

81. The method or composition of claim 79 or 80.

82. The RNA-guided DNA binder is a Cas from a type II CRISPR / Cas system.

82. The method or composition of any one of claims 75 to 81.

83. 10. The method of claim 1, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier.

83. The method or composition of any one of claims 1 to 82.

84. The composition reduces or prevents amyloid or amyloid fibrils containing TTR.

84. A method or composition for use according to any one of claims 1 to 5 or 8 to 83, thing.

85. The amyloid or amyloid fibrils are present in the nerves, heart, or gastrointestinal tract.

85. The method or use of claim 84, Composition of.

86. Non-homologous end joining (NHEJ) introduces mutations during repair of DSBs in the TTR gene. for the method or use according to any one of claims 1 to 5 or 8 to 83, composition.

87. NHEJ is a deletion or insertion of nucleotides during repair of a DSB in the TTR gene.

87. The composition for the method or use of claim 86, wherein

88. The deletion or insertion of nucleotides results in a frameshift or deletion of a nucleic acid sequence in the TTR gene.

88. The method or composition for use of claim 87, which induces a sense mutation.

89. A frameshift or nonsense mutation in the TTR gene in at least 50% of hepatocytes 88. The composition for the method or use of claim 87, which is induced in offspring.

90. Frameshift or nonsense mutations are present in 50% to 60%, 60% to 70%, and 70% of cases. % or 80%, 80% to 90%, 90 to 95%, 95% to 99%, or 99% to 10 90. The method or use of claim 89, wherein the TTR gene is induced in 0% of hepatocytes. Composition for.

91. Nucleotide deletions or insertions are at least 50 times greater than those at the off-target site.

91. The method of any one of claims 87 to 90, wherein the TTR gene is 2 or more times A composition for the method or use of.

92. The deletion or insertion of nucleotides is 50-100 times more frequent than at off-target sites. 50x, 150x to 500x, 500x to 1500x, 1500x to 5000x, 500x 0 to 15,000 times, 15,000 to 30,000 times, or 30,000 to 60,000 times 92. The method or composition for use of claim 91, wherein the gene occurs predominantly in the TTR gene.

93. The deletion or insertion of nucleotides is 3, 2, 1, or occurs at less than 0 or equal to 3, 2, 1, or 0 off-target sites, and any Optionally, the off-target site is a protein in the genome of the primary human hepatocyte.

93. The method or method according to any one of claims 87 to 92, wherein the method or method does not occur in a coding region. or compositions for use.

94. The deletion or insertion of nucleotides is performed in a Cas9-overexpressing cell. Off-target expression in primary human hepatocytes is less than the number of off-target sites where deletions or insertions occur. and optionally, the off-target site is present in the primary human 94. The method of claim 93, wherein the sequence does not occur in a protein coding region in the genome of a hepatocyte. A composition for the described method or use.

95. The Cas9-overexpressing cells are HEK293 cells that stably express Cas9.

95. A composition for the method or use of claim 94.

96. The number of off-target sites in primary human hepatocytes is in vitro determined by Cas9 mRNA and genome sequences from primary human hepatocytes transfected with the guide RNA. and optionally, the off-target site is determined by analyzing the genome DNA. The present invention relates to a method for producing a hepatocyte comprising the steps of:

96. A composition for the method or use according to any one of claims 93 to 95.

97. The number of off-target sites in primary human hepatocytes is in vitro determined by Cas9 mRNA, the guide RNA, and the donor oligonucleotide are transfected. and analyzing genomic DNA from primary human hepatocytes. and optionally, the off-target site is determined by assay in the primary human hepatocytes.

96. The method of claim 93, wherein the method does not occur in a protein coding region in the genome of A composition for the method or use according to any one of claims 1 to 4.

98. The sequence of the guide RNA is a) SEQ ID NO: 92 or 104; b) SEQ ID NO: 87, 89, 96, or 113; c) SEQ ID NO: 100, 102, 106, 111, or 112; or d) SEQ ID NOs: 88, 90, 91, 93, 94, 95, 97, 101, 103, 108 , or 109 and optionally, the guide RNA is a protein in the genome of the primary human hepatocyte. does not generate indels at off-target sites that occur in gene-coding regions; 98. The method or composition of any one of claims 1 to 43 or 47 to 97.

99. 2. The method of claim 1, wherein administering the composition reduces the level of TTR in the subject.

99. A composition for the method or use according to any one of claims 1-5 or 8-98.

100. 100. The method or use of claim 99, wherein the level of TTR is reduced by at least 50%. Composition for use.

101. The level of TTR is 50% to 60%, 60% to 70%, 70% or 80%, 80% or % to 90%, 90 to 95%, 95% to 99%, or 99% to 100% reduction in claims 101. A composition for the method or use according to paragraph 100.

102. The level of TTR is measured in serum, plasma, blood, cerebrospinal fluid, or sputum.

102. A composition for the method or use according to claim 100 or 101.

103. The level of TTR is measured in the liver, choroid plexus, and / or retina.

102. A composition for the method or use according to paragraph 100 or 101.

104. The level of TTR is measured via enzyme-linked immunosorbent assay (ELISA).

104. A composition for the method or use according to any one of claims 99 to 103.

105. The method of any one of claims 1 to 5 or 8 to 104, wherein the subject has ATTR. Compositions for the methods or uses.

106. The method or method according to any one of claims 1 to 5 or 8 to 105, wherein the subject is a human. or compositions for use.

107. 107. The method or use of claim 105 or 106, wherein the subject has ATTRwt. Composition for.

108. 107. The method or use of claim 105 or 106, wherein the subject has an inherited ATTR gene. Composition for use.

109. 109. The method of claim 1, wherein the subject has a family history of ATTR. A composition for the method or use according to any one of claims 1 to 4.

110. Claims 1 to 5, 8 to 106, wherein the subject has familial amyloid polyneuropathy 109. Or a composition for the method or use according to any one of claims 108-109.

111. The subject has only or primarily neurological symptoms of ATTR.

110. A method or a composition for use according to any one of claims 1 to 5 or 8 to 110, Finished product.

112. 110. The method of claim 1, wherein the subject has familial amyloidotic cardiomyopathy.

1. A composition for the method or use according to claim 1.

113. The subject has only or primarily cardiac symptoms of ATTR.

113. The method or use of any one of claims 1 to 5, 8 to 109 or 112. Composition for.

114. Claims 1 to 5 or 8 to 11, wherein the subject expresses a TTR having a V30 mutation.

4. A composition for the method or use according to any one of claims 3.

115. the V30 mutation is V30A, V30G, V30L, or V30M.

115. A composition for the method or use according to paragraph 114.

116. Claims 1 to 5 or 8 to 11, wherein the subject expresses a TTR having a T60 mutation.

4. A composition for the method or use of claim 3.

117. 117. The method or use of claim 116, wherein the T60 mutation is T60A. composition.

118. 10. The method of claim 1, wherein the subject expresses a TTR having a V122 mutation.

14. A composition for the method or use of claim 13.

119. wherein the V122 mutation is V122A, V122I, or V122(-).

119. A composition for the method or use of claim 118.

120. 120. The method of any one of claims 1-5 or 8-119, wherein the subject expresses wild-type FAP. A composition for the described method or use.

121. the subject does not express a TTR having a V30, T60, or V122 mutation; For the method or use of any one of claims 1 to 5, 8 to 107 or 120 Composition of.

122. Claims 1 to 5, 8 to 10, wherein the subject does not express a TTR having a pathological mutation. 7, or a composition for use according to any one of claims 120-121.

123. 122. The method or use of claim 121, wherein the subject is homozygous for wild-type TTR. Composition for use.

124. and (b) after administration, the subject experiences an improvement, stabilization, or improvement in symptoms of sensorimotor neuropathy. The method according to any one of claims 1 to 5 or 8 to 123, wherein the slowing of the change Composition for use.

125. The improvement, stabilization, or slowing of changes in sensory neuropathy is determined by electromyography, neurological findings, and 125. The method of claim 124, wherein the method is measured using a cardiac conduction test or a patient-reported outcome. Method or composition for use.

126. the subject has an improvement, stabilization, or slowed change in symptoms of congestive heart failure. A composition for the method or use according to any one of claims 1 to 5 or 8 to 125. 。

127. The improvement, stabilization, or slowing of change in congestive heart failure is determined by measuring cardiac biomarkers.

126. The method of claim 126, wherein the blood pressure is measured using a blood pressure test, a pulmonary function test, a chest x-ray, or an electrocardiogram. A composition for the method or use described above.

128. The composition or pharmaceutical formulation according to claims 1 to 5 is administered via a viral vector.

128. A composition for the method or use according to any one of claims 8 to 127.

129. 10. The composition or pharmaceutical formulation according to claim 1, wherein the composition or pharmaceutical formulation is administered via lipid nanoparticles. 8-127. A composition for the method or use according to any one of claims 8-127.

130. The subject has a specific mutation in the TTR gene prior to administration of the composition or formulation.

130. The method or method of any one of claims 1 to 5 or 8 to 129, wherein the or compositions for use.

131. Claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 5 10. The method or composition according to any one of claims 1 to 9.

132. Claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 6 10. The method or composition according to any one of claims 1 to 9.

133. Claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 7 10. The method or composition according to any one of claims 1 to 9.

134. Claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 8 10. The method or composition according to any one of claims 1 to 9.

135. Claims 1 to 130, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 9 10. The method or composition according to any one of claims 1 to 9.

136. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 10 10. The method or composition of any one of claims 1 to 5.

137. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 11 10. The method or composition of any one of claims 1 to 5.

138. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 12 10. The method or composition of any one of claims 1 to 5.

139. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 13 10. The method or composition of any one of claims 1 to 5.

140. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 14 10. The method or composition of any one of claims 1 to 5.

141. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 15 10. The method or composition of any one of claims 1 to 5.

142. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 16 10. The method or composition of any one of claims 1 to 5.

143. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 17 10. The method or composition of any one of claims 1 to 5.

144. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 18 10. The method or composition of any one of claims 1 to 5.

145. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 19 10. The method or composition of any one of claims 1 to 5.

146. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 20 10. The method or composition of any one of claims 1 to 5.

147. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 21 10. The method or composition of any one of claims 1 to 5.

148. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 22 10. The method or composition of any one of claims 1 to 5.

149. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 23 10. The method or composition of any one of claims 1 to 5.

150. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 24 10. The method or composition of any one of claims 1 to 5.

151. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 25 10. The method or composition of any one of claims 1 to 5.

152. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 26 10. The method or composition of any one of claims 1 to 5.

153. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 27 10. The method or composition of any one of claims 1 to 5.

154. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 28 10. The method or composition of any one of claims 1 to 5.

155. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 29 10. The method or composition of any one of claims 1 to 5.

156. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 30 10. The method or composition of any one of claims 1 to 5.

157. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 31 10. The method or composition of any one of claims 1 to 5.

158. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 32 10. The method or composition of any one of claims 1 to 5.

159. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 33 10. The method or composition of any one of claims 1 to 5.

160. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 34 10. The method or composition of any one of claims 1 to 5.

161. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 35 10. The method or composition of any one of claims 1 to 5.

162. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 36 10. The method or composition of any one of claims 1 to 5.

163. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 37 10. The method or composition of any one of claims 1 to 5.

164. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 38 10. The method or composition of any one of claims 1 to 5.

165. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 39 10. The method or composition of any one of claims 1 to 5.

166. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 40 10. The method or composition of any one of claims 1 to 5.

167. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 41 10. The method or composition of any one of claims 1 to 5.

168. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 42 10. The method or composition of any one of claims 1 to 5.

169. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 43 10. The method or composition of any one of claims 1 to 5.

170. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 44 10. The method or composition of any one of claims 1 to 5.

171. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 45 10. The method or composition of any one of claims 1 to 5.

172. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 46 10. The method or composition of any one of claims 1 to 5.

173. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 47 10. The method or composition of any one of claims 1 to 5.

174. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 48 10. The method or composition of any one of claims 1 to 5.

175. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 49 10. The method or composition of any one of claims 1 to 5.

176. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 50 10. The method or composition of any one of claims 1 to 5.

177. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 51 10. The method or composition of any one of claims 1 to 5.

178. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 52 10. The method or composition of any one of claims 1 to 5.

179. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 53 10. The method or composition of any one of claims 1 to 5.

180. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 54 10. The method or composition of any one of claims 1 to 5.

181. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 55 10. The method or composition of any one of claims 1 to 5.

182. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 56 10. The method or composition of any one of claims 1 to 5.

183. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 57 10. The method or composition of any one of claims 1 to 5.

184. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 58 10. The method or composition of any one of claims 1 to 5.

185. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 59 10. The method or composition of any one of claims 1 to 5.

186. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 60 10. The method or composition of any one of claims 1 to 5.

187. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 61 10. The method or composition of any one of claims 1 to 5.

188. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 62 10. The method or composition of any one of claims 1 to 5.

189. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 63 10. The method or composition of any one of claims 1 to 5.

190. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 64 10. The method or composition of any one of claims 1 to 5.

191. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 65 10. The method or composition of any one of claims 1 to 5.

192. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 66 10. The method or composition of any one of claims 1 to 5.

193. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 67 10. The method or composition of any one of claims 1 to 5.

194. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 68 10. The method or composition of any one of claims 1 to 5.

195. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 69 10. The method or composition of any one of claims 1 to 5.

196. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 70 10. The method or composition of any one of claims 1 to 5.

197. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 71 10. The method or composition of any one of claims 1 to 5.

198. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 72 10. The method or composition of any one of claims 1 to 5.

199. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 73 10. The method or composition of any one of claims 1 to 5.

200. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 74 10. The method or composition of any one of claims 1 to 5.

201. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 75 10. The method or composition of any one of claims 1 to 5.

202. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 76 10. The method or composition of any one of claims 1 to 5.

203. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 77 10. The method or composition of any one of claims 1 to 5.

204. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 78 10. The method or composition of any one of claims 1 to 5.

205. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 79 10. The method or composition of any one of claims 1 to 5.

206. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 80 10. The method or composition of any one of claims 1 to 5.

207. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 81 10. The method or composition of any one of claims 1 to 5.

208. Claims 1 to 13, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 82 10. The method or composition of any one of claims 1 to 5.

209. A method according to any one of claims 6 to 208 for the preparation of a medicament for treating a human subject having ATTR. Use of any of the compositions or formulations described herein.

Images