Combination cancer therapy agents and methods

Combining CXCL9/10 chemokines with immune checkpoint inhibitors through in situ vaccination with CXCL9/10-secreting DCs addresses resistance to PD-1/PD-L1 therapy in NSCLC by enhancing tumor antigen presentation and angiogenesis inhibition, improving treatment efficacy.

JP2025166001APending Publication Date: 2025-11-05RGT UNIV OF CALIFORNIA +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025125676
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-07-17
Filing Date
2025-07-28
Publication Date
2025-11-05

AI Technical Summary

Technical Problem

Current treatments for non-small cell lung cancer (NSCLC) using PD-1/PD-L1 inhibitors face challenges with resistance and limited efficacy, particularly in patients with oncogenic driver mutations and immunosuppressive tumor microenvironments, necessitating improved methods to enhance tumor antigen presentation and overcome immunosuppression.

Method used

Administering CXCL9 or CXCL10 polypeptides, polynucleotides, or cells expressing these chemokines in combination with immune checkpoint inhibitors like PD-1 or PD-L1 blockers to enhance tumor antigen presentation and inhibit angiogenesis, using in situ vaccination with CXCL9/10-secreting dendritic cells (DCs) to sensitize tumors to immunotherapy.

Benefits of technology

Enhances the efficacy of PD-1/PD-L1 blockade by improving tumor-specific T cell activation and reducing angiogenesis, demonstrating effectiveness in both high and low mutation burden tumors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025166001000001_ABST
    Figure 2025166001000001_ABST
Patent Text Reader

Abstract

To provide a method for treating cancer or solid tumors in combination with an immune checkpoint inhibitor therapy.SOLUTION: A method for treating cancer or a solid tumor in a subject, the method comprising: a. administering to the subject (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, (iii) cells comprising the polynucleotide encoding the CXCL9 polypeptide, cells comprising the polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, or (iv) any combination thereof; and b. administering an immune checkpoint inhibitor to the subject.SELECTED DRAWING: Figure 5C
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Government Interest Statement This work was supported by the US Department of Veterans Affairs, and the federal government has certain rights in this invention. [Background technology]

[0002] Lung cancer is the most common cause of cancer death worldwide, with approximately 85% of patients presenting with non-small cell lung cancer (NSCLC). The recent approval of chemo-immunotherapy combinations has transformed the treatment landscape for advanced NSCLC, allowing all eligible patients to receive anti-PD-1 / PD-L1 immunotherapy in the frontline setting, either in combination with chemotherapy regardless of tumor PD-L1 levels, or as monotherapy in selected patients with tumor PD-L1 levels >50%. This shift has resulted in improved patient outcomes in the frontline setting (objective response rates (ORR) are approximately 55%), but it has also created an area of ​​unmet need: effective treatment options for patients who have progressed while receiving PD-1 and / or PD-L1 inhibitors. Second-line chemotherapy is an option for these patients but is associated with significant toxicity and limited efficacy. Alternatively, treatment with PD-1 or PD-L1 inhibitors after progression has been evaluated with minimal observed clinical benefit (ORR is approximately 8%).

[0003] Studies reveal that response to PD-1 / PD-L1 blockade is associated with high tumor mutation burden (TMB), increased CD8+ T cell tumor infiltration, and high baseline tumor PD-L1 expression. In contrast, oncogenic driver mutations may contribute to resistance to anti-PD-1 / PD-L1 immunotherapy. For example, LKB1 inactivating mutations are involved in driving primary resistance to anti-PD-1 therapy in KRAS mutant lung adenocarcinoma (LUAC), likely by promoting an immunosuppressive and angiogenic environment that facilitates tumor growth. In addition, patients with epidermal growth factor receptor (EGFR) mutations and / or anaplastic lymphoma kinase (ALK) rearrangements do not benefit from PD-1 / PD-L1 blockade after failure of tyrosine kinase inhibitor (TKI) therapy. EGFR and / or ALK mutant tumors often have a non-inflammatory and immunosuppressive TME, which may contribute to resistance to immunotherapy. Therefore, approaches that enhance tumor antigen presentation, overcome the immunosuppressive TME, and inhibit tumor angiogenesis are expected to improve the efficacy of PD-1 / PD-L1 blockade.

[0004] The present invention is directed to improving the efficacy of PD-1 / PD-L1 blockade and resistance to common immune checkpoint inhibitor therapy. Summary of the Invention

[0005] In one aspect, provided is a method of treating cancer or a solid tumor in a subject, the method comprising: (a) administering to the subject (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof; (ii) a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof; (iii) a cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof; or (iv) any combination thereof; and (b) administering to the subject an immune checkpoint inhibitor.

[0006] In one embodiment, the immune checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a CTLA-4 receptor inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a Pall inhibitor, a PD1-L2 inhibitor, a 4-1BB inhibitor, an OX40 inhibitor, a LAG-3 inhibitor, a TIM-3 inhibitor, or a combination thereof. In one embodiment, the immune checkpoint inhibitor is an antibody, optionally a monoclonal antibody. In one embodiment, the immune checkpoint inhibitor is a CTLA-4 inhibitor, optionally ipilimumab or tremilimumab.

[0007] In one embodiment, the immune checkpoint inhibitor is a PD1 inhibitor selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, lambrolizumab, BMS-936559, atezolizumab, and AMP-224, AMP224, AUNP12, BGB108, MCLA134, MEDI0680, PDR001, REGN2810, SHR1210, STIAI10X, STIA1110, and TSR042.

[0008] In one embodiment, the immune checkpoint inhibitor is a PD1-L1 inhibitor selected from the group consisting of BMS-936559, MPDL3280A, MEDI-4736, MSB0010718C, ALN-PDL, BGBA317, KD033, KY1003, STIA100X, STIA1010, STIA1011, STIA1012, and STIA1014.

[0009] In one embodiment, CXCL9 / 10 refers to and includes CXCL9, CXCL10, or a combination thereof. In one embodiment of the combination, CXCL9 and CXCL10 are each independently administered in different forms, such as a polypeptide, a polynucleotide, a cell comprising a polynucleotide, or any combination thereof. In one embodiment, CXCL9 is administered as a polypeptide. In one embodiment, CXCL10 is administered as a polypeptide. In one embodiment, the combination of CXCL9 and CXCL10 is each administered as a polypeptide. In one embodiment, CXCL9 is administered as a polynucleotide encoding CXCL9. In one embodiment, CXCL10 is administered as a polynucleotide encoding CXCL10. In one embodiment, the combination of CXCL9 and CXCL10 is each administered as a polynucleotide encoding CXCL9 and CXCL10, respectively. In one embodiment, CXCL9 is administered as a cell comprising a polynucleotide encoding CXCL9. In one embodiment, CXCL10 is administered as a cell comprising a polynucleotide encoding CXCL10. In one embodiment, the combination of CXCL9 and CXCL10 is administered as cells comprising a polynucleotide encoding CXCL9 and cells encoding a polynucleotide encoding CXCL10.

[0010] In one embodiment, a combination of CXCL9 and CXCL10 is administered, wherein CXCL9 is administered as a polypeptide and CXCL10 is administered as a polynucleotide encoding CXCL10. In one embodiment, a combination of CXCL9 and CXCL10 is administered, wherein CXCL10 is administered as a polypeptide and CXCL9 is administered as a polynucleotide encoding CXCL9. In one embodiment, a combination of CXCL9 and CXCL10 is administered, wherein CXCL9 is administered as a polypeptide and CXCL10 is administered as cells comprising a polynucleotide encoding CXCL10. In one embodiment, a combination of CXCL9 and CXCL10 is administered, wherein CXCL9 is administered as a polypeptide and CXCL9 is administered as cells comprising a polynucleotide encoding CXCL9. In one embodiment, a combination of CXCL9 and CXCL10 is administered, wherein CXCL9 is administered as a polynucleotide encoding CXCL9 and CXCL10 is administered as cells comprising a polynucleotide encoding CXCL10. In one embodiment, a combination of CXCL9 and CXCL10 is administered, wherein CXCL10 is administered as a polynucleotide encoding CXCL10 and CXCL9 is administered as cells comprising a polynucleotide encoding CXCL9.

[0011] In one embodiment, the CXCL9 polypeptide comprises the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In one embodiment, the CXCL9 polypeptide consists of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In one embodiment, the polynucleotide encoding the CXCL9 polypeptide comprises the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the polynucleotide encoding the CXCL9 polypeptide consists of the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the CXCL10 polypeptide comprises the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the CXCL10 polypeptide consists of the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the polynucleotide encoding the CXCL10 polypeptide comprises the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the polynucleotide encoding the CXCL10 polypeptide consists of the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, a cell comprising a polynucleotide encoding a CXCL9 polypeptide comprises the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, a cell comprising a polynucleotide encoding a CXCL10 polypeptide comprises the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the cell comprising a polynucleotide encoding a CXCL9 polypeptide and a CXCL10 polypeptide comprises the sequences of SEQ ID NO:5 or SEQ ID NO:6 and SEQ ID NO:7 or SEQ ID NO:8.

[0012] In one embodiment, CXCL9 / 10 in any form described herein and the immune checkpoint inhibitor are independently administered by a route selected from intratumoral, intravenous, intraarterial, intraperitoneal, intranasal, intramuscular, intradermal, or subcutaneous, or via IT injection via CT guidance or bronchoscopically. In one embodiment, CXCL9 / 10 is administered intratumorally and the immune checkpoint inhibitor is administered intravenously.

[0013] In one embodiment, a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof is inserted into a vector, and the vector is administered to a subject, or the vector is introduced into an antigen-presenting cell (APC) or dendritic cell (DC), which is then administered to a subject or to a tumor site. In one embodiment, the vector is an adenovirus vector, a lentivirus vector, a CMV vector, a vaccinia virus vector, a Sindbis virus vector, or a herpesvirus vector. In one embodiment, the adenovirus vector is a replication-deficient adenovirus vector. In one embodiment, the cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof is an antigen-presenting cell (APC) or a dendritic cell (DC). In one embodiment, the APC is a dendritic cell. In one embodiment, the dendritic cell is autologous to the subject. In one embodiment, the dendritic cell is derived from a donor. In one embodiment, the dendritic cell is derived from a cell line.

[0014] In one embodiment, at least or about 1x10^6 cells comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or about 1x10^6 cells of each in the case of a combination thereof are administered to a subject. In one embodiment, the cells produce at least or about 10 ng of each of CXCL9 and CXCL10 per 1x10^6 cells over a 24-hour period. In one embodiment, at least or about 1x10^6 cells comprising a polynucleotide encoding a CXCL9 polypeptide and about 1x10^6 cells comprising a polynucleotide encoding a CXCL10 polypeptide are administered to a subject. In one embodiment, the CXCL9-expressing cells produce at least or about 10 ng of CXCL9 per 1x10^6 cells over a 24-hour period, and the CXCL10-expressing cells produce at least or about 10 ng of CXCL10 per 1x10^6 cells over a 24-hour period.

[0015] In one embodiment, the subject has a solid tumor, and the polypeptide, polynucleotide, or cell, or any combination thereof, is administered to the subject intratumorally. In one embodiment, the solid tumor is a non-small cell lung cancer (NSCLC) solid tumor.

[0016] In one embodiment, (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, or (iv) any combination thereof is administered to a subject prior to, about two weeks before, or simultaneously with, an immune checkpoint inhibitor. In one embodiment, (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, or (iv) a combination thereof is administered to a subject about two or more times, once every two weeks, once every three weeks, or once a month. In one embodiment, the immune checkpoint inhibitor is administered to a subject two or more times, once every two weeks, once every three weeks, or once a month. In some embodiments, the administration of each of the CXCL9 / 10 and immune checkpoint inhibitors comprises multiple administrations over a period of 2, 3, or 4 weeks, a rest period, and then a repeat of the same regimen. In other embodiments, two or more such cycles may be administered.

[0017] In one embodiment, (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, or (iv) a combination thereof, are administered intratumorally to a subject on days 7, 11, and 15, and a checkpoint inhibitor is administered on days 7, 9, 11, 13, and 15. In one embodiment, (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, or (iv) a combination thereof, are administered intratumorally to a subject on days 7, 10, and 13, and a checkpoint inhibitor is administered on days 7, 10, 13, and 15. In one embodiment, the dosing regimen is repeated for one or more cycles, with a break between cycles. In one embodiment, the regimen is repeated every two weeks. In one embodiment, the cycle is repeated every three weeks. In one embodiment, the cycle is repeated monthly.

[0018] In one embodiment, a method is provided for treating a cancer or solid tumor with a high mutational burden in a subject, the method comprising: a. administering to the subject: (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, or (iv) any combination thereof; and b. administering to the subject an immune checkpoint inhibitor.

[0019] In one embodiment, provided is a method for treating cancer or reducing the recurrence of a high mutational burden cancer in a subject in need thereof, comprising administering an effective amount of a combination therapy comprising: a) on days 0, 21, and 42, dendritic cells comprising a CXCL9 / 10 vector construct; and b) an effective amount of an anti-PD-1 antibody every 3 weeks starting on day 0, wherein optionally, the vector is a lentiviral vector.

[0020] In one embodiment, a method is provided for treating a cancer or solid tumor with a low mutational burden in a subject, the method comprising: a. administering to the subject: (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, or (iv) any combination thereof; and b. administering to the subject an immune checkpoint inhibitor.

[0021] In one embodiment, provided is a method for treating cancer or reducing the recurrence of a low mutational burden cancer in a subject in need thereof, comprising administering an effective amount of combination therapy comprising: a) on days 0, 21, and 42, dendritic cells comprising a CXCL9 / 10 vector construct; and b) an effective amount of an anti-PD-1 antibody every 3 weeks starting on day 0, wherein optionally, the vector is a lentiviral vector.

[0022] In one embodiment, a kit is provided comprising (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, or (iv) a combination thereof, and an immune checkpoint inhibitor. In one embodiment, the immune checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a CTLA-4 receptor inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD1-L2 inhibitor, a 4-1BB inhibitor, an OX40 inhibitor, a LAG-3 inhibitor, a TIM-3 inhibitor, or a combination thereof. In one embodiment, the immune checkpoint inhibitor is an antibody, optionally a monoclonal antibody. In one embodiment, the immune checkpoint inhibitor is a CTLA-4 inhibitor, optionally ipilimumab or tremilimumab. In one embodiment, the immune checkpoint inhibitor is a PD1 inhibitor selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, lambrolizumab, BMS-936559, atezolizumab, AMP-224, AMP224, AUNP12, BGB108, MCLA134, MEDI0680, PDR001, REGN2810, SHR1210, STIA110X, STIAl110, and TSR042. In one embodiment, the immune checkpoint inhibitor is a PD1-LI inhibitor selected from the group consisting of BMS-936559, MPDL3280A, MEDI-4736, MSB0010718C, ALN-PDL, BGBA317, KD033, KY1003, STIA100X, STIA1010, STIA1011, STIA1012, and STIA1014.

[0023] In one embodiment of the kit, the CXCL9 / 10 comprises CXCL9, CXCL10, or a combination thereof. In one embodiment, the CXCL9 polypeptide comprises the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and the CXCL10 polypeptide comprises the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the CXCL9 polypeptide consists of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and the CXCL10 polypeptide consists of the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the polynucleotide encoding the CXCL9 polypeptide comprises the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the polynucleotide encoding the CXCL9 polypeptide consists of the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the polynucleotide encoding the CXCL10 polypeptide comprises the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the polynucleotide encoding the CXCL10 polypeptide consists of the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the cell comprising the polynucleotide encoding the CXCL9 polypeptide comprises the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the cell comprising the polynucleotide encoding the CXCL10 polypeptide comprises the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the cell comprising a polynucleotide encoding a CXCL9 polypeptide and a CXCL10 polypeptide comprises the sequences of SEQ ID NO:5 or SEQ ID NO:6 and SEQ ID NO:7 or SEQ ID NO:8.

[0024] In one embodiment, a dendritic cell is provided comprising a vector comprising a polynucleotide encoding CXCL9 / 10. In one embodiment, the CXCL9 / 10 comprises CXCL9, CXCL10, or a combination thereof. In one embodiment, the CXCL9 polypeptide comprises the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and the CXCL10 polypeptide comprises the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the CXCL9 polypeptide consists of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and the CXCL10 polypeptide consists of the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the polynucleotide encoding the CXCL9 polypeptide comprises the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the polynucleotide encoding the CXCL9 polypeptide consists of the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the polynucleotide encoding the CXCL10 polypeptide comprises the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the polynucleotide encoding the CXCL10 polypeptide consists of the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the cell comprising a polynucleotide encoding a CXCL9 polypeptide comprises the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the cell comprising a polynucleotide encoding a CXCL10 polypeptide comprises the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the cell comprising polynucleotides encoding a CXCL9 polypeptide and a CXCL10 polypeptide comprises the sequences of SEQ ID NO: 5 or SEQ ID NO: 6 and SEQ ID NO: 7 or SEQ ID NO: 8. [Brief explanation of the drawings]

[0025] [Figures 1A-1C] We show that genetically engineered mouse models (GEMMs) of lung cancer with varying mutational burden recapitulate clinical responses. [Figures 2A-2C] Figure 1 shows the distinct tumor microenvironment (TME) immunophenotypes of the three genetic subtypes of GEMM. [Figure 3A-3B] We demonstrate that the combination of CXCL9 / 10-DC and anti-PD-1 is superior to monotherapy. [Figure 4A-4B] Correlation of CXCL9 / 10 gene expression with CD8+ T cells and dendritic cells in The Cancer Genome Atlas (TCGA) data. [Figures 5A-5C] 1 shows the experimental design and results of a study demonstrating that the combination of intratumoral CXCL9 / 10-DC and anti-PD-1 is superior to monotherapy. [Figure 6] 1 shows that intratumoral CXCL9 / 10-DCs enhance anti-PD-1 efficacy in the KPL-3M model. [Figure 7A-7C] Based on tumor volume, we show that CXCL9-DCs and CXCL10-DCs are functionally equivalent in enhancing the antitumor efficacy of anti-PD-1. [Figures 8A-8C] Based on tumor weight, we show that CXCL9-DCs and CXCL10-DCs are functionally equivalent in enhancing the antitumor efficacy of anti-PD-1. DETAILED DESCRIPTION OF THE INVENTION

[0026] The present subject matter may be more readily understood by reference to the following detailed description, which forms a part of this disclosure: The present invention is not limited to the specific products, methods, conditions, or parameters described and / or illustrated herein, and the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to limit the claimed invention.

[0027] Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meanings commonly understood by those skilled in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0028] As used above, and throughout this disclosure, the following terms and abbreviations, unless otherwise indicated, shall be understood to have the following meanings:

[0029] In this disclosure, the singular forms "a," "an," and "the" include plural references, and a reference to a particular numerical value includes at least that particular value unless the context clearly dictates otherwise. Thus, for example, a reference to a "compound" is a reference to one or more of such compounds and equivalents thereof known to those of skill in the art, and the like. As used herein, the term "plurality" means two or more. When a range of values ​​is expressed, another embodiment includes from the one particular value and / or to the other particular value.

[0030] Similarly, when values ​​are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. All ranges are inclusive and combinable. In the context of this disclosure, "about" a particular amount means that the amount is within ±20% of the stated amount, preferably within ±10% of the stated amount, or more preferably within ±5% of the stated amount.

[0031] As used herein, the terms "treat," "treatment," or "therapy" (and their different forms) refer to therapeutic treatment, including prophylactic or preventative measures, the purpose of which is to prevent or alleviate (reduce) undesirable physiological changes associated with a disease or condition. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, whether detectable or undetectable, reduction in the severity of the disease or condition, stabilization of the disease or condition (i.e., when the disease or condition does not worsen), delay or slowing of the progression of the disease or condition, improvement or palliation of the disease or condition, and remission (whether partial or total) of the disease or condition. Those in need of treatment include those already with the disease or condition, as well as those prone to have the disease or condition or those in which the disease or condition is to be inhibited.

[0032] As used herein, the terms "ingredient," "composition," "formulation," "composition of compound," "compound," "drug," "pharmacologically active agent," "active agent," "therapeutic agent," "therapy," "therapeutic agent," or "medicament," as the context dictates, are used interchangeably herein and refer to a compound(s) or composition of matter that, when administered to a subject (human or animal), induces a desired pharmacological and / or physiological effect through local and / or systemic action. A personalized composition or method refers to a product or use of a product in a regimen tailored or individualized to meet a specific need identified or intended in a subject.

[0033] The terms "subject," "individual," and "patient" are used interchangeably herein and refer to an animal, e.g., a human, to which treatment with a composition or formulation according to the present invention is provided. As used herein, the term "subject" refers to a human and a non-human animal. The terms "non-human animal" and "non-human mammal" are used interchangeably herein and include all vertebrates, e.g., mammals such as non-human primates (especially higher primates), sheep, dogs, rodents (e.g., mice or rats), guinea pigs, goats, pigs, cats, rabbits, cows, and horses, and non-mammals such as reptiles, amphibians, chickens, and turkeys. The compositions described herein can be used to treat any suitable mammal, including primates such as monkeys and humans, horses, cows, cats, dogs, rabbits, and rodents such as rats and mice. In one embodiment, the mammal being treated is a human. For non-human use, species-appropriate sequences (polypeptides, polynucleotides) of CXCL9 and / or CXCL10 are used, and for antibodies to immune checkpoint inhibitors, antibodies to species-appropriate immune checkpoints are used. For cell-based delivery, species-appropriate cells are used. The human can be any human of any age. In one embodiment, the human is an adult. In another embodiment, the human is a child. The human can be male, female, pregnant, middle-aged, adolescent, or elderly. According to any of the methods of the present invention, in one embodiment, the subject is a human. In another embodiment, the subject is a non-human primate. In another embodiment, the subject is a murine, which in one embodiment is a mouse and in another embodiment is a rat. In another embodiment, the subject is a canine, feline, bovine, equine, laprine, or porcine. In another embodiment, the subject is a mammal.

[0034] The conditions and disorders for which a particular drug, compound, composition, formulation (or combination thereof) is said to be "indicated" herein are not limited to those conditions and disorders for which the drug or compound or composition or formulation has been expressly approved by a regulatory agency, but also include other conditions and disorders known or reasonably believed by a physician or other health or nutritional professional to be suitable for treatment with that drug or compound or composition or formulation or combination thereof.

[0035] One approach to overcoming the immunosuppressive tumor microenvironment (TME) is to utilize in situ vaccination with chemokine gene-modified functional antigen-presenting cells (APCs) to enhance tumor antigen presentation and promote tumor-specific T cell activation. The chemokines CXCL9 and CXCL10 have been shown to be important signaling molecules secreted by CD103+ dendritic cells (DCs) to recruit effector T cells and orchestrate effective antitumor immunity. Furthermore, CXCL9 / 10 (i.e., one or a combination of CXCL9 and CXCL10) possess antiangiogenic properties that can shift the balance of angiogenesis from tumor-induced angiogenesis to angiogenesis suppression. Thus, in one embodiment, a therapeutic method using IT injection of CXCL9 / 10-secreting DCs (CXCL9 / 10-DCs) to enhance response to anti-PD-1 therapy is described herein. In one embodiment, an immune checkpoint inhibitor, such as, but not limited to, anti-PD-1 therapy, is co-administered. Using genetically engineered mouse models (GEMMs) of lung cancer with increased tumor mutation burden (TMB), which recapitulates the mutational landscape of clinical NSCLC, we demonstrate the efficacy of cell-based and combination therapies. In situ vaccination with CXCL9 / 10-DCs may be an effective approach to sensitize non-responsive NSCLC to anti-PD-1 / PD-L1 immunotherapy. Efficacy is demonstrated in both low- and high-mutation burden tumors.

[0036] CXCL9 / 10 CXCL9 and CXCL10 useful in the methods of the present invention include both naturally occurring polypeptides and variant and modified forms thereof.

[0037] As used herein, CXCL9 / 10 refers to the chemokines CXCL9 or CXCL10, or a combination thereof, and may refer to them individually or in combination in the form of polypeptides, polynucleotides, or cells containing one or both polynucleotides and / or expressing one or both polypeptides. CXCL9 / 10 also refers to any combination of the foregoing, such as a combination of CXCL9 and CXCL10 polypeptides, a combination of CXCL9 and CXCL10 polynucleotides, a combination of cells, those containing CXCL9 polynucleotides, and those containing CXCL10 polynucleotides, as well as other combinations, such as cells expressing CXCL9 polypeptides and CXCL10, and cells containing CXCL10 polypeptides and CXCL9 polynucleotides. Furthermore, each of CXCL9 or CXCL10, whether in the form of a polypeptide, polynucleotide, or cell, can be used individually or in combination in the practice of the present invention.

[0038] Chemokine (C-X-C motif) ligand 9 (CXCL9) is a small cytokine (11.7 kDa) belonging to the C-X-C chemokine family, also known as the monokine induced by gamma interferon (MIG). CXCL9 is one of the chemokines that plays a role in inducing chemotaxis, promoting leukocyte differentiation and proliferation, and causing tissue extravasation. The amino acid sequence of human CXCL9 chemokine is shown in SEQ ID NO: 1. The amino acid sequence of mouse CXCL9 chemokine is shown in SEQ ID NO: 2.

[0039] The amino acid sequence of human CXCL9 is: MKKSGVLFLL GIILLVLIGV QGTPVVRKGR CSCISTNQGT IHLQSLKDLK QFAPSPSCEK IEIIATLKNG VQTCLNPDSA DVKELIKKWE KQVSQKKKQK NGKKHQKKKV LKVRKSQRSR QKKTT (SEQ ID NO: 1).

[0040] The amino acid sequence of mouse CXCL9 is: MKSAVLFLLG IIFLEQCGVR GTLVIRNARC SCISTSRGTI HYKSLKDLKQ FAPSPNCNKT EIIATLKNGD QTCLDPDSAN VKKLMKEWEK KISQKKKQKR GKKHQKNMKN RKPKTPQSRR RSRKTT (SEQ ID NO: 2).

[0041] In one non-limiting example, a polynucleotide encoding human CXCL9 has the following sequence: ATGAAGAAAAGTGGTGTTCTTTTCCTCTTGGGCATCATCTTGCTGGTTCTGATTGGAGTGCAAGGAACCC CAGTAGTGAGAAAGGGTCGCTGTTCTGCATCAGCACCAACCAAGGGACTATCCACCTACAATCCTTGAA AGACCTTAAAACAATTTGCCCCCAAGCCCTTCCTGCGAGAAAATTGAAATCATTGCTACACTGAAGAATGGA GTTCAAACATGTCTAAACCCAGATTCAGCAGATGTGAAGGAACTGATTAAAAAAGTGGGAGAAACAGGTCA GCCAAAAGAAAAAAGCAAAAGAATGGGAAAAAACATCAAAAAAAGAAAGTTCTGAAAGTTCGAAAATCTCA ACGTTCTCGTCAAAAGAAGACTACATAA (SEQ ID NO: 5).

[0042] In one non-limiting example, a polynucleotide encoding mouse CXCL9 has the following sequence: ATGAAGTCCGCTGTTCTTTTCCTCTTGGGCATCATCTTCCTGGAGCAGTGTGGAGTTCGAGGAACCCTAG TGATAAGGAATGCACGATGCTCCTGCATCAGCACCAGCCGAGGCACGATCCACTACAAATCCCTCAAAGA CCTCAAACAGTTTGCCCCAAGCCCCAATGCAAACAAAACTGAAATCATTGCTACACTGAAGAACGGAGAT CAAACCTGCCTAGATCCGGACTCGGCAAATGTGAAGAAGCTGATGAAAGAATGGGAAAAGAAGATCAGCC AAAAGAAAAAGCAAAAGAGGGGGAAAAAACATCAAAAGAACATGAAAAACAGAAAACCCAAAACACCCCA AAGTCGTCGTCGTTCAAGGAAGACTACATAA (SEQ ID NO: 6).

[0043] C-X-C motif chemokine 10 (CXCL10), also known as interferon gamma-inducible protein 10 (IP-10) or small inducible cytokine B10, is an 8.7 kDa protein encoded by the CXCL10 gene in humans. The human CXCL10 chemokine amino acid sequence is shown in SEQ ID NO: 3. The mouse CXCL10 chemokine amino acid sequence is shown in SEQ ID NO: 4.

[0044] The amino acid sequence of human CXCL10 is as follows: MNQTAILICC LIFLTLSGIQ GVPLSRTVRC TCISISNQPV NPRSLEKLEI IPASQFCPRV EIIATMKKKG EKRCLNPESK AIKNLLKAVS KERSKRSP (SEQ ID NO: 3)

[0045] The amino acid sequence of mouse CXCL10 is as follows: MNPSAAVIFC LILLGLSGTQ GIPLARTVRC NCIHIDDGPV RMRAIGKLEI IPASLSCPRV EIIATMKKND EQRCLNPESK TIKNLMKAFS QKRSKRAP (SEQ ID NO: 4)

[0046] In one non-limiting example, a polynucleotide encoding human CXCL10 has the following sequence: ATGAATCAAACTGCCATTCTGATTTGCTGCCTTATCTTTCTGACTCTAAGTGGCATTCAAGGAGTACCTC TCTCTAGAACTGTACGCTGTACCTGCATCAGCATTAGTAATCAACCTGTTAATCCAAGGTCTTTAGAAAA ACTTGAAATTATTCCTGCAAGCCAATTTTGTCCACGTGTTGAGATCATTGCTACAATGAAAAAGAAGGGT GAGAAGAGATGTCTGAATCCAGAATCGAAGGCCATCAAGAATTTACTGAAAGCAGTTAGCAAGGAAAGGT CTAAAAGATCTCCTTAA (SEQ ID NO: 7).

[0047] In one non-limiting example, a polynucleotide encoding mouse CXCL10 has the following sequence: ATGAACCCAAGTGCTGCCGTCATTTTCTGCCTCATCCTGCTGGGTCTGAGTGGGACTCAAGGGATCCCTC TCGCAAGGACGGTCCGCTGCAACTGCATCCATATCGATGACGGGCCAGTGAGAATGAGGGCCATAGGGAA GCTTGAAATCATCCCTGCGAGCCTATCCTGCCCACGTGTTGAGATCATTGCCACGATGAAAAAGAATGAT GAGCAGAGATGTCTGAATCCGGAATCTAAGACCATCAAGAATTTAATGAAAGCGTTTAGCCAAAAAAGGT CTAAAAGGGCTCCTTAA (SEQ ID NO: 8)

[0048] CXCL9 and CXCL10 include naturally occurring mammalian CXCL9 and CXCL10, and their variants and fragments.Preferably, CXCL9 and CXCL10 are of human or mouse origin.Most preferably, CXCL9 and CXCL10 are human CXCL9 and CXCL10.

[0049] CXCL9 and CXCL10 polypeptides for use in the methods disclosed herein can be CXCL9 or CXCL10 variants, CXCL9 or CXCL10 fragments, analogs, and derivatives.

[0050] As described elsewhere, each of these chemokines in the form of a polypeptide, a polynucleotide, or cells containing either or both of CXCL9 and CXCL10 polynucleotides can be administered to a subject together with a checkpoint inhibitor.For example, CXCL9 can be the only chemokine used in the methods described herein, and can be administered as a polypeptide, a polynucleotide, or cells containing a polynucleotide, or any combination thereof.In another example, CXCL10 can be the only chemokine used in the methods described herein, and can be administered as a polypeptide, a polynucleotide, or cells containing a polynucleotide, or any combination thereof.In another example, both CXCL9 and CXCL10 are used in the methods described herein, but they can be administered independently as a polypeptide, a polynucleotide, or cells containing a polynucleotide, or any combination thereof.In one example, CXCL9 is administered intratumorally as a polypeptide, and CXCL10 is administered intratumorally as cells containing a polynucleotide encoding CXCL10. In one embodiment, two or three delivery means may be used for one or both chemokines, e.g., polypeptide and polynucleotide, or polypeptide and cells, or polynucleotide and cells. In other embodiments, any combination of delivery means, delivery routes, and dosing schedules for either or both chemokines (in any form) is encompassed herein.

[0051] In one embodiment, the CXCL9 polypeptide comprises the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In one embodiment, the CXCL9 polypeptide consists of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In one embodiment, the polynucleotide encoding the CXCL9 polypeptide comprises the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the polynucleotide encoding the CXCL9 polypeptide consists of the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the CXCL10 polypeptide comprises the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the CXCL10 polypeptide consists of the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the polynucleotide encoding the CXCL10 polypeptide comprises the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the polynucleotide encoding the CXCL10 polypeptide consists of the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, a cell comprising a polynucleotide encoding a CXCL9 polypeptide comprises the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, a cell comprising a polynucleotide encoding a CXCL10 polypeptide comprises the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the cell comprising a polynucleotide encoding a CXCL9 polypeptide and a CXCL10 polypeptide comprises the sequences of SEQ ID NO:5 or SEQ ID NO:6 and SEQ ID NO:7 or SEQ ID NO:8.

[0052] Immune checkpoint inhibition Immune checkpoint inhibition, checkpoint blockade, immune checkpoint inhibitor, or checkpoint inhibitor refers equally to a therapeutic agent that inhibits one or more immune checkpoints that suppress T cell engagement. Non-limiting examples of checkpoints include CTLA-4, PD-1, and PD-L1, with additional examples provided below. Non-limiting examples of immune checkpoint inhibitors include antibodies such as anti-CTLA-4, anti-PD-1, anti-PD-L1, and those described in further detail below. As described herein in the practice of the present invention, any one or more checkpoint inhibitors can be used in conjunction with CXCL9 / 10.

[0053] In one non-limiting example, PD-1 is an immunoglobulin of the CD28 family. PD-1 is a type I transmembrane glycoprotein containing an extracellular Ig variable (V) domain involved in ligand binding and a cytoplasmic tail involved in intracellular signal transduction. Binding of PD-1 to PD-L1 (or its other ligand, PD1-L2) induces the recruitment of SHP-1 and SHP-2 to PD-1, resulting in the dephosphorylation of CD3ζ, PKCθ, and ZAP70, which are essential for T cell receptor (TCR) signaling and downregulation of T lymphocyte activation. Under healthy conditions, PD-L1 attenuates unwanted immune responses, such as autoimmunity.

[0054] Pembrolizumab is a humanized anti-PD-1 antibody used in cancer immunotherapy. It is a highly selective humanized mAb designed to block the interaction between PD-1 and its ligands, programmed death-ligand 1 (PD-L1) and programmed death-ligand 2 (PD-L2). Pembrolizumab is an IgG4 / kappa isotype with stabilizing sequence alterations in the Fc region. The theoretical molecular weights of the heavy and light chains, derived from their amino acid sequences and excluding glycosylation, are 49.4 kilodaltons (KDa) and 23.7 KDa, respectively.

[0055] Clinical trials testing the safety and efficacy of pembrolizumab in treating patients with NSCLC led to the drug's approval for this disease. The KEYNOTE-001 trial demonstrated responses in approximately 20% of patients with a moderate side effect profile. Importantly, patients with baseline PD-L1 tumor staining greater than 50% benefited more from anti-PD-1 therapy than patients with tumor PD-L1 expression less than 50%. The ORR, as defined by Response Evaluation Criteria in Solid Tumors (RECIST) criteria, was 45.2% in patients with PD-L1 staining greater than 50%, compared with 16.5% in patients with PD-L1 staining between 1% and 49%, and 10.7% in patients with PD-L1 staining less than 1%. In the KEYNOTE-010 phase II / III trial, pembrolizumab at 2 mg / kg and 10 mg / kg q3w demonstrated significant benefit over docetaxel at 75 mg / m2 q3w in randomized, previously treated patients with stage IV disease and PD-L1 staining >1%. In the KEYNOTE-024 trial, pembrolizumab at 200 mg demonstrated significant benefit over physician-selected standard-of-care chemotherapy in previously untreated patients with PD-L1 staining >50%. Despite robust and durable responses to anti-PD-1 therapy in a subgroup of NSCLC patients, most patients do not respond to PD-1 checkpoint inhibitors as single agents (12). Therefore, rational and effective combination strategies with PD-1 inhibitors are needed to enhance the efficacy of anti-PD-1 therapy in patients with advanced NSCLC.

[0056] Antibodies to PD-1 are described in U.S. Patent Nos. 8,735,553, 8,617,546, 8,008,449, 8,741,295, 8,552,154, 8,354,509, 8,779,105, 7,563,869, 8,287,856, 8,927,697, 8,088,905, 7,595,048, 8,168,179, 6,808,710, 7,943,743, 8,246,955, and 8,217,149.

[0057] It is contemplated that any known anti-PD-1 antibody can be used in the present methods. In various embodiments, the anti-PD-1 antibody inhibits or blocks the binding of the PD-1 receptor to one or both of its ligands, PD-L1 and PD-L2. In exemplary embodiments, the monoclonal antibody that specifically binds to PD-1 is nivolumab (BMS936558, Bristol Meyers Squibb), pembrolizumab (MK-3475, Merck), pidilizumab (CT-011, CureTech), lambrolizumab, BMS-936559, atezolizumab, or AMP-224 (GSK / Amplimmune), AMP224 (MedImmune), AUNP12 (Dr. Reddy's Laboratories Ltd.), BGB108 (BeiGene), MCLA134 (Merus BV), MEDI0680 (MedImmune), PDR001 (Novartis), REGN2810 (Regeneron / Sanofi), SHR1210 (Jiangsu Hengrui Medicine / Incyte), STIA110X (Sorrento), STIA1110 (Sorrento), and TSR042 (AnaptysBio / Tesaro).

[0058] In exemplary embodiments, the monoclonal antibody that specifically binds to PD-L1 is BMS-936559 (BMS / Ono), MPDL3280A (Roche / Genentech), or MEDI-4736 (MedImmune), MSB0010718C (Merck / Serono), ALN-PDL (Alnylam), BGBA317 (BeiGene), KD033 (Kadmon Corp.), KY1003 (Kymab Ltd.), STIA100X (Sorrento), STIA1010 (Sorrento), STIA1011 (Sorrento), STIA1012 (Sorrento), and STIA1014 (Sorrento).

[0059] For studies using anti-PD-1 in mice, a mouse PD-1 specific antibody, such as, but not limited to, monoclonal antibody clone RMP-1-14, catalog number BP0146, from Bio X Cell, Lebanon NH, is used. Studies in other animal models can use appropriate species-specific antibodies.

[0060] Other immune checkpoint inhibitors are encompassed herein, and the invention is not limited to any particular immune checkpoint inhibitor co-administered with CXCL9 / 10 as described herein.

[0061] As used herein, "programmed cell death protein 1," or "PD-1," refers to a cell surface receptor involved in immune checkpoint blockade mediated by binding to two ligands, PD-L1 and PD-L2. Binding of PD-1 to its ligands has been shown to reduce T-cell proliferation, cytokine production, and cytotoxic activity.

[0062] Cytotoxic T lymphocyte antigen 4 (CTLA-4) (CD152) is a well-known costimulatory molecule involved in the B7-1 / B7-2 costimulatory pathway of T cell activation. CTLA-4 is expressed on the surface of helper T cells and transmits inhibitory signals to T cells (see, for example, Krummel et al., J. Exp. Med. 182(2):459-65, 1995). Antibodies that bind to CTLA-4 include ipilimumab and tremilimumab.

[0063] "Antigen-presenting cells" (APCs) are cells capable of activating T cells, including, but not limited to, monocytes / macrophages, B cells, and dendritic cells (DCs). The terms "dendritic cell" or "DC" refer to any member of a diverse population of morphologically similar cell types found in lymphoid and non-lymphoid tissues. These cells are characterized by their unique morphology and high levels of surface MHC class II expression. DCs can be isolated from many tissue sources. DCs have a high capacity to sensitize MHC-restricted T cells and are highly effective at presenting antigens to T cells in situ. Antigens can be self-antigens expressed during T cell development and tolerance, or foreign antigens present during normal immune processes.

[0064] The term "therapeutically effective amount" is used herein to indicate an amount of a target-specific composition of the present disclosure that is effective in ameliorating or alleviating the symptoms or signs of the disease being treated.

[0065] The terms "treat," "treated," "treating," and "treatment" as used with respect to the methods herein refer to the elimination, reduction, suppression, or amelioration, temporarily or permanently, partially or completely, of clinical symptoms, the onset or progression of an event, disease, or condition. Such treatment need not be absolute to be useful.

[0066] The terms "cancer," "cancerous," or "malignant" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Exemplary cancers contemplated herein are described in more detail in the Detailed Description.

[0067] "Treatment of cancer" may refer to one or more of the following effects: (1) inhibition to some extent of tumor growth, including (i) slowing, and (ii) complete cessation of growth; (2) reduction in tumor cell number; (3) maintenance of tumor size; (4) reduction in tumor size; (5) inhibition to some extent of tumor cell invasion into peripheral organs, including (i) reduction, (ii) slowing, or (iii) complete prevention; (6) inhibition to some extent of metastasis, including (i) reduction, (ii) slowing, or (iii) complete prevention; (7) enhancement of an anti-tumor immune response, which may result in (i) maintenance of tumor size, (ii) reduction in tumor size, (iii) delay in tumor growth, (iv) reduction, delay, or prevention of invasion; and / or (8) reduction to some extent in the severity or number of one or more symptoms associated with the disorder.

[0068] As used herein, "pharmaceutical composition" refers to a composition suitable for administration to a subject animal, including humans and mammals. A pharmaceutical composition comprises a pharmacologically effective amount of a virus or antigen composition of the present invention and also comprises a pharmaceutically acceptable carrier. A pharmaceutical composition encompasses compositions containing an active ingredient and an inactive ingredient that constitutes a pharmaceutically acceptable carrier, as well as any product derived directly or indirectly from the combination, complexation, or aggregation of any two or more components. Thus, a pharmaceutical composition of the present invention encompasses any composition prepared by mixing a compound or conjugate of the present invention with a pharmaceutically acceptable carrier.

[0069] CXCL9 / 10-modified dendritic cells vector Methods for delivery of CXCL9 / 10 expression constructs include the use of expression vectors. In one embodiment, for the studies described herein, DCs were transduced with a lentiviral construct expressing mouse CXCL9, and separately, other DCs were transduced with a lentiviral construct expressing mouse CXCL10. In one embodiment, vectors encoding both CXCL9 and CXCL10 can be provided on the same vector, or separate vectors encoding each CXCL can be introduced into the same cells. However, the present invention is not so limited.

[0070] In one embodiment, lentiviral vectors can be used for improved stability and better expression. Alternatively, other vectors can be used to express CXCL9 or CXCL10, or both.

[0071] The nucleotide sequence of CXCL9 can be obtained based on the sequence provided in SEQ ID NO: 2. A PCR product of CXCL9 can be generated, and "sticky ends" can be generated by restriction digestion. These products are then ligated into a lentiviral vector. This vector is then transfected into 293T cells with a helper vector to generate lentivirus containing CXCL9 protein expression, which is then used to infect dendritic cells for delivery to tumors. CXCL10-DCs can be generated using a similar process. Alternatively, other viral vectors can be used.

[0072] Exemplary vectors include viral vectors, liposome or plasmid vectors, and other gene delivery vectors. Viral vectors include adenovirus, adeno-associated virus, lentivirus, retrovirus, vaccinia virus, modified Ankara virus, and vesicular stomatitis virus.

[0073] Adenoviral vectors are known to have a low ability to integrate into genomic DNA, but this characteristic is offset by the high efficiency of gene transfer afforded by these vectors. "Adenoviral expression vector" is meant to include those constructs that (a) support packaging of the construct in a host cell having complementary packaging functions, and (b) contain sufficient adenoviral sequences to ultimately express a heterologous gene of interest cloned therein.

[0074] Expression vectors include genetically engineered forms of adenovirus. Knowledge of the genetic organization of adenovirus, a 36 kb linear, double-stranded DNA virus, allows for the replacement of large segments of adenoviral DNA with foreign sequences (Grunhaus and Horwitz, 1992). In contrast to retroviruses, wild-type adenoviral DNA can replicate episomalally without potential genotoxicity, so adenoviral infection of host cells does not result in chromosomal integration. Furthermore, adenoviruses are structurally stable, and no genome rearrangements have been detected after extensive amplification.

[0075] Adenoviruses are particularly suitable for use as gene transfer vectors because of their medium-sized genome, ease of manipulation, high titer, wide target cell range, and high infectivity.

[0076] In various embodiments, the vector is a replication-defective adenoviral vector.

[0077] In various embodiments, the adeno-associated virus (AAV) is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or a combination thereof.

[0078] In one example, described in detail below, DCs were transduced with lentiviral constructs expressing murine CXCL9 and CXCL10.

[0079] For use herein, DCs can be obtained from patients by leukapheresis or other methods of collecting dendritic cells from the patient's blood. The DCs will then be cultured and transduced with a vector containing a polynucleotide encoding CXCL9 or CXCL10. In other embodiments, DCs are derived from a donor or cell line. In one embodiment, donor or cell line DCs are HLA-matched to the recipient. In one embodiment, DCs are partially HPA-matched. How to use

[0080] Exemplary conditions or disorders that may be treated with the proposed combination therapy include esophageal cancer, pancreatic cancer, metastatic pancreatic cancer, metastatic adenocarcinoma of the pancreas, bladder cancer, gastric cancer, fibrous carcinoma, glioma, malignant glioma, diffuse intrinsic pontine glioma, recurrent pediatric brain neoplasm renal cell carcinoma, clear cell metastatic renal cell carcinoma, kidney cancer, prostate cancer, metastatic castration-resistant prostate cancer, stage IV prostate cancer, metastatic melanoma, melanoma, malignant melanoma, recurrent cutaneous melanoma, melanoma brain metastasis, stage IIIA cutaneous melanoma, stage IIIB cutaneous melanoma, stage III C cutaneous melanoma, stage IV cutaneous melanoma, malignant melanoma of the head and neck, lung cancer, non-small cell lung cancer (NSCLC), squamous cell non-small cell lung cancer, breast cancer, recurrent and metastatic breast cancer, hepatocellular carcinoma, Hodgkin lymphoma, follicular lymphoma, non-Hodgkin lymphoma, aggressive B-cell NHL, HL including diffuse large B-cell lymphoma (DLBCL), multiple myeloma, chronic myeloid leukemia, adult acute myeloid leukemia in remission, adult acute myeloid leukemia with Inv(16)(p13.1q22), CBFB-MYH11, t(16,16)(p13.1q22).Adult acute myeloid leukemia with t(8,21)(q22,q22), CBFB-MYH11, adult acute myeloid leukemia with t(8,21)(q22,q22), RUNX1-RUNX1T1, adult acute myeloid leukemia with t(9,11)(p22,q23), MLLT3-MLL, adult acute promyelocytic leukemia with t(15,17)(q22,q12), PML-RARA, alkylating agent-associated acute myeloid leukemia, chronic lymphocytic leukemia, Richter's syndrome, Waldenström's macroglobulinemia, adult glioblastoma, adult gliosarcoma, recurrent glioblastoma, recurrent childhood rhabdomyosarcoma, recurrent Ewing's sarcoma / peripheral primitive neuroectodermal tumor, recurrent neuroblastoma, recurrent osteosarcoma, colorectal cancer, MSI-positive colorectal cancer, MS These cancers include type I-negative colorectal cancer, nasopharyngeal nonkeratinizing carcinoma, recurrent nasopharyngeal undifferentiated carcinoma, cervical adenocarcinoma, cervical adenosquamous carcinoma, cervical squamous cell carcinoma, recurrent cervical cancer, stage IVA cervical cancer, stage IVB cervical cancer, anal canal squamous cell carcinoma, metastatic anal canal cancer, recurrent anal canal cancer, recurrent head and neck cancer, carcinoma, head and neck squamous cell carcinoma, head and neck squamous cell carcinoma (HNSCC), ovarian cancer, colon cancer, gastric cancer, advanced GI cancer, gastric adenocarcinoma, gastroesophageal junction adenocarcinoma, bone neoplasms, soft tissue sarcoma, osteosarcoma, thymic carcinoma, urothelial carcinoma, recurrent Merkel cell carcinoma, stage III Merkel cell carcinoma, stage IV Merkel cell carcinoma, myelodysplastic syndrome, and recurrent mycosis fungoides and Sézary syndrome.

[0081] In some embodiments, the cancer is lung cancer. In various embodiments, the lung cancer is non-small cell lung cancer (NSCLC). In various embodiments, the lung cancer is stage IV NSCLC, in which less than 50% of cells express PD-L1.

[0082] In various embodiments, the NSCLC or other solid tumor is a squamous cell or non-squamous cell tumor. In various embodiments, the subject has a low tumor mutational burden. In various embodiments, the subject has a high tumor mutational burden. Tumor mutational burden can be monitored, for example, by a diagnostic assay from FoundationOne (Cambridge, Massachusetts), such as FoundationOne CDx™, FoundationOne®, FoundationAct®, or FoundationOne® Heme.

[0083] In various embodiments, the patient has an NSCLC tumor accessible by CT-guided intervention or bronchoscopy, and the patient has not received systemic treatment for the NSCLC. In various embodiments, the CXCL9 / 10-DCs are administered via IT injection via CT-guided or bronchoscopy.

[0084] As described herein, certain cancers are characterized by having a high mutational burden. In various embodiments, methods are provided for treating a cancer or solid tumor with a high mutational burden in a subject, the methods comprising: a. administering to the subject (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, or (iv) any combination thereof; and (b) administering to the subject an immune checkpoint inhibitor.

[0085] In various embodiments, methods are provided for treating cancer or solid tumors in a subject, the methods comprising: a. identifying the presence of high mutational burden in the subject's tumor; and b. administering to the subject having the high mutational burden tumor (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof; (ii) a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof; (iii) a cell comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof; or (iv) any combination thereof; and (b) administering to the subject an immune checkpoint inhibitor.

[0086] In one embodiment of the foregoing method, high mutational burden is determined by tumor biopsy. In one embodiment, tumor-associated neoantigens are determined. In one embodiment, the neoantigen landscape of the tumor is elucidated following the efficacy of combination therapy. In one embodiment, the tumor contains mutations selected from KRAS, TP53(KP), or STK11 / LKB1, or any combination thereof. In one embodiment, the tumor has intratumoral heterogeneity. In one embodiment, tumor mutational burden is determined by a diagnostic assay selected from FoundationOne CDx™, FoundationOne®, FoundationAct®, and FoundationOne® Heme.

[0087] In one embodiment, high mutational burden tumors do not have activating mutations in epidermal growth factor receptor or anaplastic lymphoma kinase gene (ALK) fusions. In one embodiment, pre-, during, and post-treatment somatic mutational burden and tumor-associated neoantigens are used to initiate, prescribe, and monitor therapy.

[0088] In one embodiment, a method for treating cancer or reducing the recurrence of a high mutational burden cancer in a subject in need thereof comprises administering an effective amount of a combination therapy comprising: a) dendritic cells comprising a CXCL9 / 10 vector construct on days 0, 21, and 42; and b) an effective amount of an anti-PD-1 antibody every 3 weeks starting on day 0.

[0089] In various embodiments thereof, the tumor does not have an activating mutation in the epidermal growth factor receptor or an anaplastic lymphoma kinase gene (ALK) fusion.

[0090] In various embodiments thereof, pre-, during, and post-treatment somatic mutational load and tumor-associated neoantigens are used to initiate, prescribe, and monitor treatment.

[0091] In some embodiments, cancers treated by the methods have fewer than 50% of tumor cells expressing PD-L1 protein on their surface, hi various embodiments, cancers have greater than 50% PD-L1 staining on their cell surface, and thus greater than 50% of tumor cells express PD-L1 protein on their surface.

[0092] It is further contemplated that the method is useful in subjects who have been treated with first-line pembrolizumab and chemotherapy, or who have failed initial therapy with this combination.

[0093] In some embodiments, cancers that can be treated with this method include metastatic NSCLC and other solid tumors described herein.

[0094] In various embodiments, the methods of the invention can be used to treat patients with low mutational burden tumors.

[0095] The methods herein are contemplated to reduce tumor size or tumor burden in a subject and / or reduce metastasis in a subject. In various embodiments, the subject's tumor size or tumor volume is reduced by about 25-50%, about 40-70%, or about 50-90% or more. In various embodiments, the methods reduce tumor size or tumor volume by 10%, 20%, 30%, or more. In various embodiments, the methods reduce tumor size or tumor volume by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0096] The methods herein are contemplated to reduce tumor burden and also reduce or prevent tumor recurrence once the cancer has gone into remission.

[0097] It is also contemplated that administration of CXCL9 / 10-DCs increases the infiltration of CD8 T cells into tumors. In various embodiments, CD8 cells are increased by more than two-fold in treated subjects compared to subjects not receiving the combination therapy. It is provided that CXCL9 / 10-DCs increase PD-L1 expression in tumors.

[0098] In various embodiments, one or both of the CXCL9 and CXCL10 polypeptides, one or both of the CXCL9 and CXCL10 polynucleotides, or antigen-presenting cells such as dendritic cells expressing CXCL9, CXCL10, or both, are administered intratumorally, intravenously, intraarterially, intraperitoneally, intranasally, intramuscularly, intradermally, or subcutaneously, or via IT injection via CT guidance or bronchoscopically. In various embodiments, the checkpoint inhibitor is administered intravenously.

[0099] The route of administration of CXCL9 polypeptide, CXCL10 polypeptide, or their combination, polynucleotide or APC, e.g., dendritic cell, and checkpoint inhibitor will vary depending on the desired result.Generally, to initiate an immune response, injection of the agent at or near the desired site of inflammation or response is utilized.Alternatively, other routes of administration may be justified depending on the pathology.That is, to suppress the growth of neoplasm or tumor, it is preferable to inject the pharmaceutical composition at or near the tumor site.

[0100] As described herein, CXCL9 / 10 can include CXCL9, CXCL10, or both. The form of administration of either or both can be in the form of a polypeptide, a polynucleotide, or cells containing the polypeptide. Both the CXCL and the form of administration are independently selected for each CXCL. Thus, in some embodiments, CXCL9 can be delivered as a CXCL9 polypeptide, a polynucleotide encoding CXCL9, or cells containing a polynucleotide encoding CXCL9, or any combination thereof. Thus, in some embodiments, CXCL10 can be delivered as a CXCL10 polypeptide, a polynucleotide encoding CXCL10, or cells containing a polynucleotide encoding CXCL10, or any combination thereof. In some embodiments, both CXCL9 and CXCL10 can be administered, and CXCL9 can be delivered as a CXCL9 polypeptide, and CXCL10 can be delivered as a CXCL10 polypeptide, or as cells containing a polynucleotide encoding CXCL9 and a polynucleotide encoding CXCL10, or a polynucleotide encoding CXCL9 and a polynucleotide encoding CXCL10, or any combination thereof. In other embodiments in which both CXCL9 and CXCL10 are delivered, each can be delivered independently as a polypeptide, a polynucleotide, or cells encoding the polynucleotide, or any combination thereof. As a non-limiting example, CXCL9 can be delivered as a polypeptide and CXCL10 as a polynucleotide. In another example, CXCL9 can be delivered as a polypeptide and CXCL10 can be delivered in cells comprising a CXCL10 polynucleotide. In another example, CXCL9 can be delivered by cells comprising a CXCL9 polynucleotide and CXCL10 can be delivered as a polypeptide. In another example, CXCL9 can be delivered as a polynucleotide and CXCL10 can be delivered in cells comprising a CXCL10 polynucleotide. Thus, any combination of one or both CXCLs and one or more delivery methods is embodied herein. Of course, immune checkpoint inhibitors can also be delivered.Provided herein are dosing regimens, such as dose levels, frequency and duration of dosing, for CXCL9 / 10 and immune checkpoint inhibitors (including one or more immune checkpoint inhibitors), as described herein.

[0101] As described herein, a polynucleotide encoding human CXCL9 may comprise or consist of SEQ ID NO: 5. As described herein, a polynucleotide encoding mouse CXCL9 may comprise or consist of SEQ ID NO: 6. As described herein, a polynucleotide encoding human CXCL10 may comprise or consist of SEQ ID NO: 7. As described herein, a polynucleotide encoding mouse CXCL10 may comprise or consist of SEQ ID NO: 8.

[0102] As described herein, cells comprising a polynucleotide encoding a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof may comprise a polynucleotide encoding human CXCL9 that comprises or consists of SEQ ID NO:5. As described herein, cells comprising a polynucleotide encoding mouse CXCL9 may comprise or consist of SEQ ID NO:6. As described herein, cells comprising a polynucleotide encoding human CXCL10 may comprise or consist of SEQ ID NO:7. As described herein, cells comprising a polynucleotide encoding mouse CXCL10 may comprise or consist of SEQ ID NO:8. As described herein, cells comprising a polynucleotide encoding human CXCL9 and human CXCL10 may comprise or consist of SEQ ID NO:5, or may comprise or consist of SEQ ID NO:7. As described herein, cells comprising a polynucleotide encoding mouse CXCL9 and mouse CXCL10 may comprise or consist of SEQ ID NO:6, or may comprise or consist of SEQ ID NO:8. In some embodiments, the cells may contain both human and mouse chemokines.

[0103] In one embodiment, a form of CXCL9 and independently a form of CXCL10 may be delivered intratumorally (IT).

[0104] It should be noted that, despite the use of the term "combination," CXCL9 / 10 and checkpoint inhibitors need not be administered at the same time, by the same route of administration, or in the same formulation. Each may have a different dosing schedule; in one embodiment, the dosing schedules overlap in time; in one embodiment, one begins before the other, in one embodiment, one ends before the other, and in one embodiment, a course of therapy for one agent ends before the other begins (the anti-tumor efficacy of both agents is greater than either alone, i.e., synergistic). Combination refers to the simultaneous use of both CXCL9 / 10 and a checkpoint inhibitor to achieve the anti-tumor activity described herein. In one embodiment, the anti-tumor effect of the combination of CXCL9 / 10 and an immune checkpoint inhibitor is greater than either agent individually; in one embodiment, the effect is greater than the combined effect of each agent individually; in one embodiment, the combination is synergistic.

[0105] Examples of other routes of systemic administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may include the following components: a sterile diluent such as water for injection or saline, fixed oils, polyethylene glycol, glycerin, propylene glycol or other synthetic solvents, antibacterial agents such as benzyl alcohol or methylparabens, antioxidants such as ascorbic acid or sodium bisulfite, chelating agents such as EDTA, buffers such as acetates, citrates, or phosphates, and tonicity adjusters such as sodium chloride or dextrose.

[0106] In one embodiment, the pharmaceutical composition can be delivered via a sustained release formulation or matrix containing a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, or a DNA construct suitable for expression of CXCL9 / 10 in or around a site in the body. In this way, a transient lymph node can be created at the desired transplant location to attract dendritic cells and T cells that initiate an immune response.

[0107] The selection of one or more immune checkpoint inhibitors to be administered with CXCL9 / 10 can be guided as described herein. Although the examples herein refer to anti-PD1 antibodies, the invention is not so limited and is generally directed to the combination of CXCL9 / 10 and any one or more immune checkpoint inhibitors.

[0108] In the example of anti-PD-1, it is contemplated that the anti-PD-1 antibody is administered every three weeks starting on day 0. In various embodiments, the anti-PD-1 antibody is pembrolizumab administered at a dose of 200 mg every three weeks.

[0109] In various embodiments, each of the CXCL9-DC and CXCL10-DC is 5x10 6 cells / injection~3x10 7 cells / injection, e.g., 5x10 6 , 1x10 7 , or 3x10 7 The dose is 100 mg / injection. Dendritic cells containing a vector-CXCL9 / 10, such as a lentiviral construct (CXCL9 / 10-DC), are contemplated to be administered at 3-week intervals, for example, on days 0, 21, and 42. As noted, these are merely exemplary dosing regimens, and one skilled in the art practicing the present invention will readily determine the optimal dosing regimen for a particular subject, tumor stage, etc.

[0110] It is further contemplated that other adjuvant therapies may be administered as needed, for example, the patient may also be administered surgical therapy, chemotherapy, cytotoxic agents, photodynamic therapy, or radiation therapy as needed.

[0111] A wide variety of chemotherapeutic agents can be used in combination with the combination therapy of the present invention. These may be, for example, agents that directly crosslink DNA, agents that intercalate into DNA, and agents that cause chromosomal and mitotic abnormalities by affecting nucleic acid synthesis. Various chemotherapeutic agents are intended to be used in the combination therapy disclosed herein. Exemplary chemotherapeutic agents include, for example, etoposide (VP-16), adriamycin, 5-fluorouracil (5FU), camptothecin, actinomycin-D, mitomycin C, cisplatin (CDDP), and even hydrogen peroxide.

[0112] As will be understood by those skilled in the art, appropriate doses of chemotherapeutic agents are generally those already used in clinical therapy, where the chemotherapeutic agent is administered alone or in combination with other chemotherapeutic agents. By way of example only, drugs such as cisplatin and other DNA alkylating agents can be used. Cisplatin is widely used in cancer treatment, and the effective dose used in clinical applications is 20 mg / in² for 5 days every 3 weeks for a total of 3 courses. Because cisplatin is not absorbed orally, it must be delivered via intravenous, subcutaneous, intratumoral, or intraperitoneal injection.

[0113] Agents that directly cross-link nucleic acids, particularly DNA, to result in DNA damage have been envisioned and are shown herein to provide synergistic antitumor combinations. Agents such as cisplatin and other DNA alkylating agents can be used.

[0114] Further useful drugs include compounds that interfere with DNA replication, mitosis, and chromosome segregation. These chemotherapeutic compounds include adriamycin, also known as doxorubicin, etoposide, verapamil, and podophyllotoxin. These compounds, widely used in clinical settings for the treatment of neoplasms, are administered intravenously at 21-day intervals at doses ranging from 25 to 75 mg / in² for adriamycin via bolus injection to 35 to 50 mg / in² for etoposide intravenously, or twice the intravenous dose orally.

[0115] Agents that disrupt the synthesis and fidelity of polynucleotide precursors can also be used. Particularly useful are agents that have undergone extensive testing and are readily available. Thus, agents such as 5-fluorouracil (5-FU) are preferentially used by neoplastic tissue, making this agent particularly useful for targeting neoplastic cells. Although highly toxic, 5-FU can be administered in a wide range of delivery vehicles, including topical, but intravenous administration at doses ranging from 3 to 15 mg / kg / day is commonly used.

[0116] Plant alkaloids, such as taxol, are also contemplated for use in certain embodiments of the present invention. Taxol is an experimental antimitotic agent isolated from the bark of the ash tree, Taxus brevifolia. It binds to tubulin (at a site distinct from that used by vinca alkaloids) and promotes microtubule assembly. Taxol is currently undergoing clinical evaluation and is active against malignant melanoma and ovarian cancer. The maximum dose is 30 mg / m² per day for five days, or 210-250 mg / m² once every three weeks. Of course, all of these dosages are exemplary, and any dosage between these points is also expected to be useful in the present invention.

[0117] The foregoing exemplary chemotherapeutic agents useful in combination therapy are not intended to be limiting, and the use of such agents or agents will be guided by those skilled in the art. Each of the agents listed therein is exemplary and in no way limiting. Those skilled in the art are directed to "Remington's Pharmaceutical Sciences," 15th Edition, Chapter 33, especially pages 624-652. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. In any event, the person responsible for administration will determine the appropriate dose for the individual subject. Furthermore, for human administration, preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by the FDA Office of Biologics Standards. [Example]

[0118] Example 1. Newly established genetically engineered mouse models (GEMMs) of lung cancer with different mutational burdens recapitulate clinical responses to anti-PD-1. Although conditional GEMMs of NSCLC harbor common driver mutations, recent studies reveal that these GEMMs have low tumor mutation burden (TMB). To recapitulate the mutational landscape of human NSCLC, we established novel GEMMs with increased TMB by in vitro exposure of KrasG12D (K), KrasG12DP53- / - (KP), and KrasG12DP53- / -Lkb1- / - (KPL) cells to the carcinogen methyl-nitrosourea (MNU) for 30 minutes each time (designated 3M, 5M, and 7M, respectively). MNU is a potent alkylating agent that targets the nitrogen and oxygen atoms of nucleotides, resulting in similar numbers of G>A and C>T substitutions. Whole-exome sequencing (WES) of these mutant cell lines revealed a significant increase in mutation burden (Figure 1A) and intratumor heterogeneity. Although tumors from all three parental cell lines were resistant to anti-PD-1 therapy (Figure 1B), PD-1 blockade induced strong efficacy in the K-3M and KP-3M models (Figure 1C). In contrast, limited anti-PD-1 efficacy was observed in KPL-3M tumors (Figure 1D). A recent study revealed that ORR to anti-PD-1 monotherapy significantly differed among the KL (7.4%), KP (35.7%), and K (28.6%) subgroups of human KRAS mutant LUAC tumors, identifying LKB1 loss of function mutations as a major driver of primary resistance to anti-PD-1 therapy. Our results recapitulate clinical responses to anti-PD-1 therapy in NSCLC and highlight the utility of these novel GEMMs in examining the molecular mechanisms of response to immunotherapy.

[0119] Detailed description of Figure 1A, Figure 1B, Figure 1C, and Figure 1D. Newly established GEMMs of lung cancers with different mutation burdens recapitulate clinical responses to anti-PD-1. Figure 1A) WES reveals KrasG12D(K), KrasG12DP53 - / - (KP), and KrasG12DP53- / - Lkb1 - / - Genomic DNA from parental (KPL) and mutant cells (3M, 5M, 7M) was used. DNA from mouse tails was included as a normal tissue control. Numbers represent mutation burden as single-nucleotide variants (SNVs) per Mb. Figure 1B) After tumor inoculation [K-parental (2 x 106) cells SC in 129 / E mice and KP-parental (8 x 106) cells SC in FVB mice]. 5 ) or KPL-Parent (7.5x10 4 ) cells SC]. Mice bearing tumors of <50 mm3 (approximately days 5-7) were treated with i) vehicle, ii) anti-PD-1 antibody (200 μg / dose IP, 4 doses every 3 days), and tumor growth was measured with a caliper. Figure 1C) Same as Figure 1B except 3M cells were utilized [K-3M (2x10) in 129 / E mice]. 6 ) cells in FVB mice, and KP-3M (2.2x10 6 ) or KPL-3M(1x10 5 ) cells. P values ​​were determined by unpaired t-test. ns, not significant; *, P<0.05; **P<0.005; ***, P<0.0005; ****, P<0.0001.

[0120] Example 2. Distinct TME immunophenotypes occur in GEMM subtypes. Response to anti-PD-1 therapy requires pre-existing tumor-specific T cell immunity, which is suppressed by PD-L1 / PD-1-mediated suppression. Consistent with the observation that KRAS-driven lung cancers harboring LKB1-inactivating mutations are resistant to anti-PD-1 therapy, our immune profiling of the tumor microenvironment (TME) of GEMMs by flow cytometry revealed prominent T lymphocyte infiltration in K-3M and KP-3M tumors and a lack of CD4+ and CD8+ T cell infiltration in KPL-P and KPL-3M tumors, indicating a suppressed T cell immune state (Figure 2A). In contrast, consistent with previous studies, we observed a predominance of myeloid-derived suppressor cells (MDSCs) within the TME of KPL-P and KPL-3M tumors (Figure 2B). As expected, the severe state of immune suppression in KPL-P and KPL-3M tumors with low T lymphocyte infiltration correlates with low PD-L1 expression, which is associated with primary resistance to anti-PD-1 monotherapy (Figure 2C). We found increased levels of chemoattractant cytokines in LKB1-null KPL-3M tumors, including CXCL1, 2, 3, 5, 7, and IL-6, which may contribute to the recruitment of MDSCs and a profound state of T-cell suppression within the TME.

[0121] Detailed description of Figure 2A, Figure 2B, and Figure 2C. Distinct TME immunophenotypes in the three genetic subtypes of GEMM. Figure 2A) On days 14–16 after tumor inoculation (SC-delivered 2 x 10 K-parental and K-3M cells in 129 / E mice, KP-parental (8 x 10) and KP-3M (2.2 x 10) cells in FVB mice, or KPL-parental (1 x 10) and KPL-3M (1.5 x 10) cells in FVB mice), tumors were harvested and analyzed by FACS using T cell markers. Tregs are defined as CD45+CD4+FoxP3+. Figure 2B) Same as Figure 2A, except MDSC markers were utilized. Polymorphonuclear (PMN)-MDSCs are defined as CD45+CD11b+Ly6G+Ly6Clo. Monocytes (M)-MDSCs are defined as CD45+CD11b+Ly6G-Ly6Chi. Figure 2C) Same as Figure 2A, except that mean fluorescence intensity (MFI) of PD-L1 is plotted. P values ​​were determined by unpaired t-test. *, P<0.05; **, P<0.005; ***, P<0.0005; ****, P<0.0001. ND, not determined.

[0122] Example 3. Enhancement of anti-PD-1 efficacy by IT administration of CXCL9 / 10-DC in a mouse lung cancer model. For the studies described herein, DCs were transduced with a lentiviral construct expressing murine CXCL9, and separately, other DCs were transduced with a lentiviral construct expressing murine CXCL10. The nucleotide sequence of CXCL9 (SEQ ID NO: 6) was obtained based on the sequence provided in SEQ ID NO: 2. PCR products of CXCL9 were generated, and "sticky ends" were generated by restriction digestion. These products were then ligated into lentiviral vectors. This vector was then transfected into 293T cells with a helper vector to generate lentivirus containing CXCL9 protein expression, which was then used to infect dendritic cells for delivery to tumors. CXCL10-DCs were generated using a similar process using a nucleotide sequence (SEQ ID NO: 8) based on SEQ ID NO: 4. These DCs are referred to herein as CXCL9 / 10-DCs (or vector-CXCL9 / 10-DCs). As described herein, for each DC population, approximately 1 x 10^6 cells produced 10 ng of each polypeptide in 24 hours. Approximately 1x10^6 cells expressing CXCL9 and approximately 1x10^6 cells expressing CXCL10 (i.e., a total of 2x10^6 cells) were administered to the animals.

[0123] We conducted a study to evaluate the efficacy of the combination of CXCL9 / 10-DC and anti-PD-1 (anti-mouse PD-1 (CD279), clone RMP-1-14, catalog number BP0146, Bio X Cell, Lebanon, NH) in lung cancer KPL-3M GEMM. Consistent with the observed immunosuppressive TME (Figures 2A-C), anti-PD-1 alone showed limited efficacy (Figure 3A). Importantly, CXCL9 / 10-DC significantly enhanced the antitumor effect of PD-1 blockade. Tumor weights on the day of euthanasia were consistent with tumor volume measurements (Figure 3B). These data indicate that CXCL9 / 10-DC in combination with PD-1 induces potent antitumor effects.

[0124] Brief description of Figures 3A and 3B. The combination of CXCL9 / 10-DC and anti-PD-1 is superior to monotherapy. Figure 3A) IT CXCL9 / 10-DC (DC transduced with a lentiviral construct expressing a combination of murine CXCL9 and CXCL10 and anti-PD-1 in the murine KPL-3M model). FVB mice were inoculated SC with 1 x 10 KPL-3M cells. On day 7, mice bearing tumors <25 mm were treated with a) vehicle control, b) IT CXCL9 / 10-DC (10 CXCL9 / 10-DC / dose on days 7, 11, and 15), c) IP anti-PD-1 (200 μg / dose on days 7, 9, 11, 13, and 15), or d) the combination of IT CXCL9 / 10 and IP anti-PD-1 at the same time points as above. Tumor volumes, measured by caliper, were recorded. Figure 3B) Same as Figure 3A, except tumor weights at the end of the study are shown. P values ​​were determined by unpaired t-test; *, P<0.05; **, P<0.005; ***, P<0.0005; ****, P<0.00005.

[0125] Example 4. CXCL9 / 10 gene expression levels correlate with DC and CD8+ T cell infiltration. To determine the association between CXCL9 / 10 expression and immune infiltration, we analyzed TCGA NSCLC data, including both lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC). TIMER was used to estimate immune cell populations based on gene expression levels. Gene expression levels of both CXCL9 (Figure 4A) and CXCL10 (Figure 4B) significantly correlated with estimated infiltrating CD8+ T cell and DC populations. CXCL9 / 10 expression did not correlate with tumor content.

[0126] Detailed description of Figures 4A and 4B. Correlation of CXCL9 / 10 gene expression with CD8+ T cells and DCs in TCGA data. CXCL9 (Figure 4A) and CXCL10 (Figure 4B) expression levels were plotted against purity (tumor content), and CD8+ T cell and DC populations were estimated for LUAD (top) and LUSC (bottom) NSCLC. Tumor content levels did not correlate with CXCL9 or CXCL10 levels, but CD8+ T cells and DCs showed significant correlation.

[0127] Example 5. Intratumoral (IT) administration of CXCL9 / 10-DC enhances anti-PD-1 efficacy in the KPL-3M model. The efficacy of CXCL9 / 10-DC and anti-PD-1 combination therapy was evaluated in a KPL-3M mouse model using a study design similar to that described in Example 3 (except for the dosing regimen). The study design is shown in Figure 5A. Tumors were implanted subcutaneously on day 0. On days 7, 10, 13, and 15, animals received intratumoral administration of CXCL9 / 10 and anti-PD-1. As shown in Figure 5B, anti-PD-1 or CXCL9 / 10 monotherapy showed limited efficacy. Importantly, CXCL9 / 10-DC significantly enhanced the antitumor effect of PD-1 blockade in terms of tumor growth and tumor volume, respectively (Figures 5B and 5C).

[0128] To evaluate the synergistic effect of the combination of CXCL9 / 10 and anti-PD-1, the doubling time of the tumor volume curve was calculated and compared with that of the control group, and the change and percent change in doubling time within the group were compared. A longer doubling time indicates reduced tumor growth. As shown in the table below, the reduction in doubling time of the combination treatment of CXCL9 / 10-DC and anti-PD-1 was 2.7-fold greater than the sum of the reductions in doubling time of the individual treatments. [Table 1]

[0129] In a similar analysis, the change in tumor weight data is shown in the table below. The reduction in tumor weight with combined treatment with CXCL9 / 10-DC and anti-PD-1 was 24% greater than the sum of the reductions in tumor weight with the individual treatments. [Table 2]

[0130] Detailed description of Figures 5A, 5B, and 5C. IT CXCL9 / 10-DC enhances anti-PD-1 efficacy in the KPL-3M model. Figure 5A) Schematic of the study. Figure 5B) FVB mice were inoculated SC with 1.5x10^5 KPL-3M cells. On day 7, mice bearing tumors <50 mm^3 were treated with a) vehicle, b) IP anti-PD-1 (200 μg / dose on days 7, 10, 13, and 15), c) IT CXCL9 / 10-DC (10^6 cells / dose each on days 7, 10, and 13), or d) a combination of b) and c). Tumor volume was recorded. Figure 5C) Tumor weight at necropsy. P values ​​were determined by unpaired t-test. *, P<0.05; **, P<0.005; ****, P<0.0001.

[0131] Example 6. Intratumoral (IT) CXCL9 / 10-DCs promote T cell infiltration and reduce immunosuppressive MDSCs of the TME in the KPL-3M model. To assess changes in the tumor microenvironment (TME) upon treatment, we performed the same mouse experiments as in Example 5 (Figure 5), except that tumors were harvested on days 16 and 19 after tumor inoculation and single-cell suspensions were prepared for immunophenotyping by flow cytometry (Figure 6). On day 16, we observed increased CD4+ T cell infiltration after IT CXCL9 / 10-DC monotherapy (Figure 6, top left) and combination treatment, along with an additional increase in CD8+ T cell infiltration and a concomitant reduction in MDSCs on day 19 (Figure 6, bottom left, center, and right). These data support the hypothesis that IT CXCL9 / 10-DC can enhance T cell infiltration and function and reprogram the immunosuppressive TME.

[0132] Detailed description of Figure 6. FVB mice were inoculated SC with 1.5x10^5 KPL-3M cells. On day 7, mice bearing tumors <50 mm^3 were treated with a) vehicle, b) IP anti-PD-1 (200 μg / dose on days 7, 10, 13, and 15), c) IT CXCL9 / 10-DC (10^6 cells / dose each on days 7, 10, and 13), or d) a combination of b) and c). On day 16 or 19 after tumor inoculation, tumors were harvested and analyzed by flow cytometry using surface markers: MDSC, myeloid-derived suppressor cells. P values ​​were determined by unpaired t-test. *, P<0.05; **, P<0.005; ***, P<0.0005; ****, P<0.0001.

[0133] Example 7. CXCL9-DC and CXCL10-DC are functionally equivalent in enhancing the anti-tumor efficacy of anti-PD-1. To assess whether CXCL9-DC and CXCL-10DC have different effects on enhancing the antitumor efficacy of PD-1 blockade, we performed experiments similar to those described in Example 5 (Figure 5), except that mice received IT injections of equal numbers of cells composed of CXCL9-DC alone (2x10^6), CXCL10-DC alone (2x10^6), or both (1:1 ratio, 10^6 each) (Figure 7, tumor volume; Figure 8, tumor weight). Similar antitumor effects mediated by CXCL9-DC and CXCL10-DC alone or in combination with anti-PD-1 were observed, indicating that CXCL9-DC and CXCL10-DC are functionally equivalent in enhancing the antitumor efficacy of anti-PD-1.

[0134] To evaluate the synergistic effect of combining CXCL9-DC, CXCL10-DC, or both with anti-PD-1, the doubling time of tumor volume curves was calculated and compared with that of the control group. The change in doubling time and percent change within the groups were compared. A longer doubling time indicates reduced tumor growth. As shown in the table below, the decrease in doubling time with combined treatment of CXCL9-DC and anti-PD-1 was 30% greater than the sum of the doubling time decreases of the individual treatments. The decrease in doubling time with combined treatment of CXCL10-DC and anti-PD-1 was 2.7-fold greater than the sum of the doubling time decreases of the individual treatments. The decrease in doubling time with combined treatment of both CXCL9 / 10-DC and anti-PD-1 was 55% greater than the sum of the doubling time decreases of the individual treatments. [Table 3] [Table 4] [Table 5]

[0135] In a similar analysis, the change in tumor weight data is shown in the table below. The tumor weight reduction with combined treatment of CXCL9-DC and anti-PD-1 was 9.3% greater than the sum of the tumor weight reductions of the individual treatments. The tumor weight reduction with combined treatment of CXCL10-DC and anti-PD-1 was 31% greater than the sum of the tumor weight reductions of the individual treatments. The tumor weight reduction with combined treatment of both CXCL9 / 10-DC and anti-PD-1 was 26% greater than the sum of the tumor weight reductions of the individual treatments. [Table 6] [Table 7] [Table 8]

[0136] Detailed description of Figures 7A, 7B, and 7C. CXCL9-DCs and CXCL10-DCs are functionally equivalent in enhancing the antitumor efficacy of anti-PD-1, as measured by tumor volume. Figure 7A) FVB mice were inoculated SC with 1.5x10^5 KPL-3M cells. On day 7, mice bearing tumors <50 mm3 were treated with a) vehicle, b) IP anti-PD-1 (200 μg / dose on days 7, 10, 13, and 15), c) IT CXCL9-DCs (2x10^6 cells / dose on days 7, 10, and 13), or d) a combination of b) and c). Tumor volume was recorded. Figure 7B) Same as Figure 7A, except CXCL10-DCs were utilized. Figure 7C) Same as Figure A, except CXCL9 / 10-DCs (10^6 cells / dose each) were utilized. P values ​​were determined by unpaired t-test. ****, P<0.0001.

[0137] Detailed description of Figures 8A, 8B, and 8C. CXCL9-DC and CXCL10-DC are functionally equivalent in enhancing the anti-tumor efficacy of anti-PD-1, as measured by tumor weight. Same as Figure 7, except tumor weight at necropsy is shown. P values ​​were determined by unpaired t-test. *, P<0.05; **, P<0.005; ***, P<0.0005; ****, P<0.0001; ns, not significant.

[0138] While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those skilled in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit and scope of the invention.

Claims

1. 1. A method of treating cancer or solid tumor in a subject, comprising: a. (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof; (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or a combination thereof; (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or a combination thereof; or (iv) administering any combination thereof; and b. administering to said subject an immune checkpoint inhibitor.

2. 10. The method of claim 1, wherein the immune checkpoint inhibitor is an antibody, optionally a monoclonal antibody.

3. 3. The method of claim 1 or 2, wherein the immune checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a CTLA-4 receptor inhibitor, a PD-1 inhibitor, a PD1-L1 inhibitor, a PD1-L2 inhibitor, a 4-1BB inhibitor, an OX40 inhibitor, a LAG-3 inhibitor, a TIM-3 inhibitor, or a combination thereof.

4. 4. The method of claim 3, wherein the immune checkpoint inhibitor is a CTLA-4 inhibitor, optionally ipilimumab or tremilimumab.

5. 4. The method of claim 3, wherein the immune checkpoint inhibitor is a PD1 inhibitor selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, lambrolizumab, BMS-936559, atezolizumab, and AMP-224, AMP224, AUNP12, BGB108, MCLA134, MEDI0680, PDR001, REGN2810, SHR1210, STIA110X, STIA1110, and TSR042.

6. 4. The method of claim 3, wherein the immune checkpoint inhibitor is a PD1-L1 inhibitor selected from the group consisting of BMS-936559, MPDL3280A, MEDI-4736, MSB0010718C, ALN-PDL, BGBA317, KD033, KY1003, STIA100X, STIA1010, STIA1011, STIA1012, and STIA1014.

7. 10. The method of claim 1, wherein said administering comprises CXCL9, CXCL10, or a combination thereof.

8. The method of claim 1, wherein the CXCL9 polypeptide comprises the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and the CXCL10 polypeptide comprises the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO:

4.

9. The method of claim 1, wherein the polynucleotide encoding the CXCL9 polypeptide, the CXCL10 polypeptide, or a combination thereof is inserted into a vector and the vector is administered to the subject, or the vector is introduced into an antigen-presenting cell (APC) or a dendritic cell (DC) and then administered to the subject or to the site of the tumor.

10. 10. The method of claim 9, wherein the vector is an adenoviral vector, a lentiviral vector, a CMV vector, a vaccinia viral vector, a Sindbis viral vector, or a herpes viral vector.

11. The method of claim 10, wherein the adenoviral vector is a replication-deficient adenoviral vector.

12. The method of claim 1, wherein the cell comprising the polynucleotide encoding the CXCL9 polypeptide, the CXCL10 polypeptide, or a combination thereof is an antigen-presenting cell (APC) or a dendritic cell (DC).

13. The method of claim 12, wherein the APC is a dendritic cell.

14. 14. The method of claim 13, wherein the dendritic cells are autologous to the subject, derived from a donor, or derived from a cell line.

15. The method of claim 1, wherein at least or about 1x10^6 cells comprising the polynucleotide encoding the CXCL9 polypeptide, about 1x10^6 cells comprising the polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, are administered to the subject.

16. 16. The method of claim 15, wherein the cells produce at least or about 10 ng of CXCL9 or CXCL10 per 1x10^6 cells over a 24 hour period.

17. 10. The method of claim 1, wherein the subject comprises a solid tumor and the cells are administered intratumorally to the subject.

18. 18. The method of claim 17, wherein the solid tumor is a non-small cell lung cancer (NSCLC) solid tumor.

19. The method of claim 1, wherein (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, or (iv) any combination thereof is administered to the subject before, about two weeks before, or simultaneously with the immune checkpoint inhibitor.

20. The method of claim 1, wherein (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, or (iv) any combination thereof, is administered to the subject approximately twice or more, once every two weeks, once every three weeks, or once a month.

21. 10. The method of claim 1, wherein the immune checkpoint inhibitor is administered to the subject two or more times, once every two weeks, once every three weeks, or once a month.

22. 2. The method of claim 1, wherein (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, or (iv) any combination thereof, and the immune checkpoint inhibitor are independently administered by a route selected from intratumoral, intravenous, intraarterial, intraperitoneal, intranasal, intramuscular, or subcutaneous, or via IT injection via CT guidance or bronchoscopic.

23. The method of claim 1, wherein (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or a combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or a combination thereof, or (iv) any combination thereof, is administered intratumorally, and the immune checkpoint inhibitor is administered intravenously.

24. 24. The method of any one of claims 1 to 23, wherein the subject has a high mutational burden tumor.

25. 25. The method of claim 24, wherein the high mutational burden is determined by biopsy of the tumor.

26. 25. The method of claim 24, wherein tumor-associated neoantigens are determined.

27. 25. The method of claim 24, wherein the efficacy of the combination therapy is followed by elucidation of the neoantigenic landscape of the tumor.

28. 25. The method of claim 24, wherein the tumor comprises a mutation selected from KRAS, TP53 (KP), or STK11 / LKB1, or any combination thereof.

29. 25. The method of claim 24, wherein the tumor has intratumor heterogeneity.

30. 25. The method of claim 24, wherein the tumor mutation burden is determined by a diagnostic assay selected from FoundationOne CDx™, FoundationOne®, FoundationAct®, and FoundationOne® Heme.

31. 25. The method of claim 24, wherein the tumor does not have an activating mutation in epidermal growth factor receptor or anaplastic lymphoma kinase gene (ALK) fusion.

32. 25. The method of claim 24, wherein pre-treatment, during-treatment, and post-treatment somatic mutational burden and tumor-associated neoantigens are used to initiate, prescribe, and monitor therapy.

33. 24. The method of any one of claims 1 to 23, wherein the subject has a low mutational burden tumor.

34. 34. The method of claim 33, wherein the low mutational burden is determined by biopsy of the tumor.

35. 34. The method of claim 33, wherein tumor-associated neoantigens are determined.

36. 34. The method of claim 33, wherein the efficacy of the combination therapy is followed by elucidation of the neoantigenic landscape of the tumor.

37. 34. The method of claim 33, wherein the tumor comprises a mutation selected from KRAS, TP53 (KP), or STK11 / LKB1, or any combination thereof.

38. 34. The method of claim 33, wherein the tumor has intratumor heterogeneity.

39. 34. The method of claim 33, wherein the tumor mutation burden is determined by a diagnostic assay selected from FoundationOne CDx™, FoundationOne®, FoundationAct®, and FoundationOne® Heme.

40. 34. The method of claim 33, wherein the tumor does not have an activating mutation in epidermal growth factor receptor or anaplastic lymphoma kinase gene (ALK) fusion.

41. 34. The method of claim 33, wherein pre-treatment, during-treatment, and post-treatment somatic mutational burden and tumor-associated neoantigens are used to initiate, prescribe, and monitor therapy.

42. 1. A method for treating cancer or reducing the recurrence of high mutational burden cancer in a subject in need thereof, comprising administering an effective amount of a combination therapy comprising: a) dendritic cells comprising a CXCL9 vector and dendritic cells comprising a CXCL10 vector; and b) an effective amount of an anti-PD-1 antibody.

43. 43. The method of claim 42, wherein the dendritic cells comprising a CXCL9 vector and the dendritic cells comprising a CXCL10 vector are administered on days 0, 21, and 42, and an effective amount of an anti-PD-1 antibody is administered every three weeks starting on day 0, and optionally, the vector is a lentiviral vector.

44. 43. The method of claim 42, wherein the high mutational burden is determined by biopsy of the tumor.

45. 43. The method of claim 42, wherein tumor-associated neoantigens are determined.

46. 43. The method of claim 42, wherein the efficacy of the combination therapy is followed by elucidation of the neoantigenic landscape of the tumor.

47. 43. The method of claim 42, wherein the tumor comprises a mutation selected from KRAS, TP53 (KP), or STK11 / LKB1, or any combination thereof.

48. 43. The method of claim 42, wherein the tumor has intratumor heterogeneity.

49. 43. The method of claim 42, wherein the tumor mutation burden is determined by a diagnostic assay selected from FoundationOne CDx™, FoundationOne®, FoundationAct®, and FoundationOne® Heme.

50. 43. The method of claim 42, wherein the tumor does not have an activating mutation in epidermal growth factor receptor or anaplastic lymphoma kinase gene (ALK) fusion.

51. 43. The method of claim 42, wherein pre-treatment, during-treatment, and post-treatment somatic mutational burden and tumor-associated neoantigens are used to initiate, prescribe, and monitor therapy.

52. 1. A method for treating cancer or reducing the recurrence of low mutational burden cancer in a subject in need thereof, comprising administering an effective amount of a combination therapy comprising: a) dendritic cells comprising a CXCL9 vector and dendritic cells comprising a CXCL10 vector; and b) an effective amount of an anti-PD-1 antibody.

53. 53. The method of claim 52, wherein dendritic cells comprising a CXCL9 vector and dendritic cells comprising a CXCL10 vector are administered on days 0, 21, and 42, and an effective amount of an anti-PD-1 antibody is administered every three weeks starting on day 0, and optionally, the vectors are lentiviral vectors.

54. 53. The method of claim 52, wherein the low mutational burden is determined by biopsy of the tumor.

55. 53. The method of claim 52, wherein tumor-associated neoantigens are determined.

56. 53. The method of claim 52, wherein the efficacy of the combination therapy is followed by elucidation of the neoantigenic landscape of the tumor.

57. 53. The method of claim 52, wherein the tumor comprises a mutation selected from KRAS, TP53 (KP), or STK11 / LKB1, or any combination thereof.

58. 53. The method of claim 52, wherein the tumor has intratumor heterogeneity.

59. 53. The method of claim 52, wherein the tumor mutation burden is determined by a diagnostic assay selected from FoundationOne CDx™, FoundationOne®, FoundationAct®, and FoundationOne® Heme.

60. 53. The method of claim 52, wherein the tumor does not have an activating mutation in epidermal growth factor receptor or anaplastic lymphoma kinase gene (ALK) fusion.

61. 53. The method of claim 52, wherein pre-treatment, during-treatment, and post-treatment somatic mutational burden and tumor-associated neoantigens are used to initiate, prescribe, and monitor therapy.

62. An antigen-presenting cell comprising a vector comprising a polynucleotide encoding CXCL9, CXCL10, or a combination thereof.

63. 63. The antigen-presenting cell of claim 62, wherein the antigen-presenting cell is a dendritic cell.

64. The antigen-presenting cell of claim 62, wherein the CXCL9 polypeptide comprises the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO:

2.

65. The antigen-presenting cell of claim 62, wherein the CXCL9 polynucleotide sequence comprises SEQ ID NO:5 or SEQ ID NO:

6.

66. The antigen-presenting cell of claim 62, wherein the CXCL10 polypeptide comprises the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO:

4.

67. The antigen-presenting cell of claim 62, wherein the CXCL10 polynucleotide sequence comprises SEQ ID NO:7 or SEQ ID NO:8.