Methods for modulating level of expression from gene therapy expression cassette

Abstract

To provide gene therapy expression cassettes that contain 'switches' that allow expression to be turned on or off by the delivery of exogenous small non-coding RNAs.SOLUTION: The invention provides a gene therapy vector comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame (ORF) encoding a gene product and a 3' untranslated region. If the vector further comprises a first transcriptional regulatory region at 3' to the ORF in the transcribed RNA, then it is capable of (i) inhibiting translation of the transcribed RNA with a short interfering RNA sequence or (ii) enhancing degradation of the transcribed RNA, thereby inhibiting the expression of the gene product, and / or if the vector further comprises a second transcriptional regulatory region at 5' to the ORF in the transcribed RNA, it is capable of allowing translation of the transcribed RNA with a short activating RNA sequence, thereby allowing expression of the gene product.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the filing date of U.S. Patent Application No. 62 / 915,342, filed October 15, 2019, the disclosure of which is incorporated herein by reference. [Background technology]

[0002] background A current challenge in gene therapy is controlling the expression level from a transgene expression cassette after the vector is delivered. Currently, once a gene transfer vector is administered to a recipient, expression from the transgene cannot be regulated, blocked, or turned on. Controlling transgene expression from an administered vector is important for safety and better efficacy. Expression of some types of transgenes only needs to be expressed intermittently. Other transgenes may need to be blocked due to adverse reactions in individual patients. Summary of the Invention

[0003] overview The present disclosure provides gene therapy expression cassettes containing a "switch" that allows expression to be turned on or off by delivery of an exogenous small non-coding RNA. The gene therapy vector transgene expression construct incorporates a sequence for specific targeting, e.g., highly specific targeting, in one embodiment, a small non-coding RNA. In one embodiment, the targeting sequence in the 3' UTR of the cassette acts as a switch to turn off gene expression, e.g., intermittently in the presence of an exogenous small interfering RNA (siRNA) directed to the highly specific sequence. In one embodiment, the targeting sequence in the 3' UTR of the cassette in a vector, such as a viral vector, acts as a switch to turn off gene expression, e.g., permanently in the presence of an exogenous microRNA (miRNA) directed to the highly specific sequence. In one embodiment, the targeting sequence incorporated into a hairpin in the 5' UTR acts as a switch to turn on gene expression in the presence of an exogenous small RNA directed to the specific sequence.

[0004] In one embodiment, small non-coding RNAs, including siRNA sequences, e.g., shRNA sequences, can reduce gene expression by binding to specific complementary sequences, e.g., 21-25 nucleotides, in mRNA transcripts, thereby targeting the mRNA for destruction and reducing or eliminating protein production of the corresponding gene. By incorporating highly specific siRNA targeting sequences into the 3' untranslated region (UTR) of a transgene expression cassette, transgene expression can be blocked by delivery of exogenous siRNA specific to the target sequence. Transgene expression remains off as long as these siRNAs are present, and expression can be resumed by ceasing siRNA delivery. Because the highly specific siRNA targeting sequences are encoded in the 3' UTR of the transgene cassette, this strategy can be used universally with any promoter and transgene combination.

[0005] In one embodiment, small non-coding RNAs, including miRNA sequences, can reduce gene expression by binding to specific complementary nucleotide sequences in mRNA transcripts, thereby targeting the mRNA for destruction and reducing or eliminating the protein production of the corresponding gene. By incorporating highly specific miRNA targeting sequences into the 3' untranslated region (UTR) of a transgene expression cassette, transgene expression can be blocked by delivery of exogenous miRNAs specific to the target sequence, for example, encoded by a viral vector. Transgene expression remains off as long as these miRNAs are present; for example, when expressed from a constitutive promoter, transgene expression is permanently silenced. Because the highly specific miRNA targeting sequences are encoded in the 3' UTR of the transgene cassette, this strategy can be used universally with any promoter and transgene combination.

[0006] In one embodiment, small non-coding RNAs can also increase gene expression by acting as triggers to activate protein translation from target mRNAs, for example, using a toehold-like switch. A hairpin in the 5' UTR of an mRNA upstream of the AUG start codon includes a small RNA target site, a linker, and a sequence complementary to the small RNA target site, which acts to block ribosome scanning and protein translation by forming a hairpin and effectively eliminating transgene expression. Delivery of a small RNA that binds to the target site opens the hairpin, allowing ribosome scanning and protein translation. Transgene expression remains on only in the presence of an exogenous small trigger RNA. By incorporating a hairpin into the 5' UTR of a transgene cassette, this strategy can be applied to any promoter and transgene combination used in gene therapy.

[0007] In one embodiment, the present disclosure provides a gene therapy vector having one or more regions for controlling the expression of a linked therapeutic or prophylactic gene, wherein the controlling region has one or more sequences flanking the gene, and the sequences in the region can interact with a small RNA sequence that enables translation of the corresponding transcribed RNA, inhibition of translation of the corresponding transcribed RNA and / or degradation of the corresponding transcribed RNA, or enhancement of expression of the transcribed RNA. In one embodiment, the present disclosure provides methods of using the vector and the small RNA sequence.

[0008] In one embodiment, a gene therapy vector is provided, comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding a prophylactic or therapeutic gene product and a 3' untranslated region (3'UTR), wherein the vector further comprises a first transcriptional regulatory region 3' to the open reading frame, which, when present in the transcribed RNA, can i) interact with a small interfering RNA (siRNA) sequence, thereby inhibiting translation of the transcribed RNA, or ii) enhance degradation of the transcribed RNA, thereby inhibiting expression of the gene product; and / or the vector further comprises a second transcriptional regulatory region 5' to the open reading frame, which, when present in the transcribed RNA, can interact with a small activating RNA (saRNA; trigger RNA) sequence, thereby enabling translation of the transcribed RNA, thereby expressing the gene product. In one embodiment, the vector has the first transcriptional regulatory region but does not have the second transcriptional regulatory region. In one embodiment, the vector has a second transcriptional regulatory region but not a first transcriptional regulatory region. In one embodiment, the vector has a first transcriptional regulatory region and a second transcriptional regulatory region. In one embodiment, the vector is a viral vector. In one embodiment, the viral vector is an AAV vector, an adenoviral vector, a lentiviral vector, a herpesvirus vector, or a retroviral vector. In one embodiment, the transcribed RNA having the second transcriptional regulatory region forms at least one hairpin structure. In one embodiment, interaction between the saRNA and the transcribed RNA having the second transcriptional regulatory region exposes a ribosome binding site. In one embodiment, the transcribed RNA having the second transcriptional regulatory region forms one to three or two to five different hairpins. In one embodiment, the transcribed RNA having the second transcriptional regulatory region forms at least one hairpin that overlaps with the ribosome binding site and / or the first AUG in the transcribed RNA.In one embodiment, the second transcriptional regulatory region includes a toehold sequence, e.g., a sequence including a recognition site for RNA (activator RNA; saRNA) and a site for a ribosome binding site (RBS), and / or a sequence including the first AUG in the open reading frame, a sequence that forms a hairpin and one or more loops (single-stranded regions) in the transcribed RNA, a sequence that includes an RBS and / or the first AUG in the absence of saRNA, thereby inhibiting translation, but allowing translation when present in the transcribed RNA and in the presence of saRNA. In one embodiment, the first transcriptional regulatory region includes more than one nucleotide sequence that can bind to more than one different siRNA upon transcription into RNA. In one embodiment, the first transcriptional regulatory region includes a nucleotide sequence that can bind to multiple siRNAs upon transcription into RNA. In one embodiment, the nucleotide sequence has multiple siRNA binding sites for the same siRNA. In one embodiment, the open reading frame encodes a therapeutic RNA, a therapeutic antibody, an anti-cancer gene product, a complement factor, an interleukin, a cytokine, or a hormone. In one embodiment, the gene product comprises an anti-EGFR antibody, an anti-VEGF antibody, an anti-VEGFR antibody, alpha 1-antitrypsin, catalase, superoxide dismutase, factor 9, IL-2R, adenosine deaminase (ADA), WAS, beta-globin, ABCD1, an anti-CD19 antibody, or an FK506 binding protein. In one embodiment, the first transcriptional regulatory region comprises a sequence that binds to an siRNA having at least 80% nucleotide sequence identity to one of SEQ ID NOs: 1 or 2.

[0009] In one embodiment, a system is provided, comprising: a gene therapy vector comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding a prophylactic or therapeutic gene product and a 3' untranslated region (3'UTR), the vector further comprising a first transcriptional regulatory region 3' to the nucleic acid sequence, wherein the first transcriptional regulatory region, when present in the transcribed RNA, can interact with a small interfering RNA (siRNA) sequence, thereby inhibiting translation of the transcribed RNA or, through this interaction, enhancing degradation of the transcribed RNA, thereby inhibiting expression of the gene product; and an siRNA. In one embodiment, the siRNA is expressed from a vector. In one embodiment, the siRNA is expressed from a viral vector. In one embodiment, the siRNA comprises an isolated siRNA. In one embodiment, the first transcriptional regulatory region comprises a sequence that binds to an siRNA having at least 80% nucleotide sequence identity to one of SEQ ID NOs: 1 or 2.

[0010] In one embodiment, a system is provided, comprising: a gene therapy vector comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding a prophylactic or therapeutic gene product and a 3' untranslated region (3'UTR), wherein the vector further comprises a second transcriptional regulatory region 5' to the nucleic acid sequence, wherein the second transcriptional regulatory region, when present in the transcribed RNA, can interact with a small activating RNA (saRNA) sequence, allowing translation of the transcribed RNA and thereby expressing the gene product; and a vector comprising a sequence corresponding to the saRNA. In one embodiment, the second transcriptional regulatory region comprises a toehold sequence.

[0011] In one embodiment, a method for controlling expression, e.g., regulating or readjusting expression, by increasing or decreasing expression of a gene therapy vector in a mammal is provided. The method includes providing a mammal having a gene therapy vector and administering to the mammal an amount of a composition comprising a nucleic acid comprising a sequence for an siRNA and / or saRNA effective to modify expression of a gene product encoded by the vector. In one embodiment, the open reading frame encodes a protein. In one embodiment, the open reading frame encodes a therapeutic RNA. In one embodiment, the gene product is a therapeutic antibody, hormone, cytokine, interleukin, or ribozyme. In one embodiment, the composition comprises an siRNA, optionally with one or more nucleotide analogs. In one embodiment, the composition comprises a DNA vector having a sequence corresponding to an siRNA or saRNA sequence. In one embodiment, the composition comprises a plurality of different siRNAs. In one embodiment, the composition comprises an isolated saRNA. In one embodiment, the composition comprises a plurality of different saRNAs. In one embodiment, the composition comprises a nucleic acid vector comprising a nucleic acid comprising a sequence for an siRNA or saRNA. In one embodiment, the composition comprises a liposome comprising the nucleic acid. In one embodiment, the composition comprises a nanoparticle comprising the nucleic acid. In one embodiment, the composition comprises a protein complex comprising a nucleic acid. In one embodiment, the composition is administered systemically. In one embodiment, the composition is administered orally. In one embodiment, the composition is administered intravenously. In one embodiment, the composition is administered locally. In one embodiment, the composition is injected. In one embodiment, the composition is a sustained release composition. In one embodiment, the method further comprises administering a gene therapy vector to the mammal. In one embodiment, the liposome comprises the gene therapy vector. In one embodiment, the nanoparticle comprises the gene therapy vector. In one embodiment, the protein complex comprises the gene therapy vector. In one embodiment, the virus comprises the gene therapy vector. In one embodiment, the vector is administered intravenously. In one embodiment, the vector is administered locally. In one embodiment, the mammal is a human.

[0012] Also provided are vectors having homology arms flanking a second transcriptional regulatory region capable of interacting with a small activating RNA (saRNA) sequence when present in the transcribed RNA, the homology arms having sequences corresponding to gene therapy vector sequences adjacent to a site for insertion of the second transcriptional regulatory region. In one embodiment, the site for insertion is 3' to the promoter and 5' to the open reading frame of a prophylactic or therapeutic gene product.

[0013] Also provided are vectors having homology arms flanking a first transcriptional regulatory region capable of interacting with a small interfering RNA (siRNA) sequence when present in the transcribed RNA, the homology arms having sequences corresponding to gene therapy vector sequences adjacent to a site for insertion of the first transcriptional regulatory region. In one embodiment, the site for insertion is 3' to the open reading frame of the prophylactic or therapeutic gene product and 5' to the 3' end of the 3'UTR. [The present invention 1001] 1. A gene therapy vector comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding a prophylactic or therapeutic gene product and a 3' untranslated region (3'UTR), the vector further comprises a first transcriptional regulatory region 3' to the open reading frame; When the first transcriptional regulatory region is present in the transcribed RNA, (i) capable of interacting with a small interfering RNA (siRNA) sequence, and said interaction inhibits translation of said transcribed RNA; or (ii) enhancing degradation of the transcribed RNA; thereby inhibiting the expression of said gene product; and / or the vector further comprises a second transcriptional regulatory region 5' to the open reading frame; the second transcriptional regulatory region, when present in the transcribed RNA, is capable of interacting with a small activating RNA (saRNA) sequence, said interaction enabling translation of the transcribed RNA and thereby expression of the gene product; Gene therapy vectors. [The present invention 1002] 1001. The vector of the present invention, which has the first transcriptional regulatory region but does not have the second transcriptional regulatory region. [The present invention 1003] 1001. The vector of the present invention, which has the second transcriptional regulatory region but does not have the first transcriptional regulatory region. [The present invention 1004] 1001. The vector of the present invention, comprising the first transcriptional regulatory region and the second transcriptional regulatory region. [The present invention 1005] The vector of any one of 1001 to 1004 of the present invention, which is a viral vector. [The present invention 1006] 1005. The vector of the present invention, wherein the viral vector is an AAV vector, an adenoviral vector, a lentiviral vector, a herpesvirus vector, or a retroviral vector. [The present invention 1007] The vector of any one of 1001 and 1003 to 1006, wherein the transcribed RNA having the second transcriptional regulatory region forms at least one hairpin structure. [The present invention 1008] The vector of any one of claims 1001 and 1003 to 1007, wherein a ribosome binding site is exposed by the interaction between the saRNA and the transcribed RNA having the second transcriptional regulatory region. [The present invention 1009] The vector of any one of 1001 and 1003 to 1008, wherein the transcribed RNA having the second transcriptional regulatory region forms 1 to 3 or 2 to 5 different hairpins. [The present invention 1010] The vector of any one of 1001 or 1003 to 1009, wherein the transcribed RNA having the second transcriptional regulatory region forms at least one hairpin that overlaps with the ribosome binding site and / or the first AUG in the transcribed RNA. [The present invention 1011] The vector of any one of 1001 and 1003 to 1010 of the present invention, wherein the second transcriptional regulatory region comprises a toehold sequence. [The present invention 1012] The vector of any of claims 1001 to 1002 or 1004 to 1011, wherein the first transcriptional regulatory region comprises more than one nucleotide sequence capable of binding to more than one different siRNA upon transcription into RNA. [The present invention 1013] The vector of any one of the vectors of the present inventions 1001 to 1002 or 1004 to 1011, wherein the first transcriptional regulatory region comprises a nucleotide sequence capable of binding to a plurality of siRNAs upon transcription into RNA. [The present invention 1014] 1013. The vector of the present invention, wherein the nucleotide sequence has multiple siRNA binding sites for the same siRNA. [The present invention 1015] The vector of any one of claims 1001 to 1014, wherein the open reading frame encodes a therapeutic RNA, a therapeutic antibody, an anti-cancer gene product, a complement factor, an interleukin, a cytokine, or a hormone. [The present invention 1016] The vector of any of claims 1001 to 1015, wherein the gene product comprises an anti-EGFR antibody, an anti-VEGF antibody, an anti-VEGFR antibody, alpha 1-antitrypsin, catalase, superoxide dismutase, factor 9, IL-2R, adenosine deaminase (ADA), WAS, beta-globin, ABCD1, an anti-CD19 antibody, an anti-IgG antibody, an anti-Siglec antibody, or an FK506 binding protein. [The present invention 1017] The vector of any one of claims 1001 to 1002 or 1004 to 1016, wherein the first transcriptional regulatory region comprises a sequence that binds to an siRNA having at least 80% nucleotide sequence identity with one of SEQ ID NOs: 4 to 6. [The present invention 1018] The system includes: (a) a gene therapy vector comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding a prophylactic or therapeutic gene product and a 3' untranslated region (3' UTR), the vector further comprises a first transcriptional regulatory region 3' to the nucleic acid sequence; the first transcriptional regulatory region, when present in a transcribed RNA, is capable of interacting with a small interfering RNA (siRNA) sequence, and said interaction can (i) inhibit translation of the transcribed RNA or (ii) enhance degradation of the transcribed RNA, thereby inhibiting expression of the gene product; gene therapy vectors, and (b) siRNA. [The present invention 1019] The system of claim 1018, wherein the siRNA is expressed from a vector. [The present invention 1020] The system of the present invention, wherein the siRNA is expressed from a viral vector. [The present invention 1021] The system of claim 1018, wherein the siRNA comprises an isolated siRNA. [The present invention 1022] 1022. The system of any of claims 1018 to 1021, wherein the first transcriptional regulatory region comprises a sequence having at least 80% nucleotide sequence identity with one of SEQ ID NOs: 1, 2, or 3. [The present invention 1023] The system includes: (i) a gene therapy vector comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding a prophylactic or therapeutic gene product and a 3' untranslated region (3' UTR), the vector further comprises a second transcriptional regulatory region 5' to the nucleic acid sequence; the second transcriptional regulatory region, when present in the transcribed RNA, is capable of interacting with a small activating RNA (saRNA) sequence, said interaction enabling translation of the transcribed RNA and thereby expression of the gene product; gene therapy vectors, and (ii) A vector containing a sequence corresponding to the saRNA. [The present invention 1024] The system of the present invention 1023, wherein the second transcriptional regulatory region comprises a toehold sequence. [The present invention 1025] A method for regulating expression of a gene therapy vector in a mammal, comprising the steps of: Providing a mammal having a gene therapy vector according to any one of claims 1001 to 1017; Administering to the mammal an amount of a composition comprising a nucleic acid containing a sequence for the siRNA and / or saRNA effective to alter the expression of the gene product encoded by the vector. [The present invention 1026] 1025. The method of claim 1025, wherein the open reading frame encodes a protein. [The present invention 1027] 1026. The method of claim 1025, wherein said open reading frame encodes a therapeutic RNA, a therapeutic antibody, a hormone, a cytokine, an interleukin, or a ribozyme. [The present invention 1028] 1028. The method of any of claims 1025 to 1027, wherein said composition comprises an siRNA optionally having one or more nucleotide analogues. [The present invention 1029] The method of any one of claims 1025 to 1027, wherein the composition comprises a DNA vector having a sequence corresponding to the siRNA sequence or the saRNA sequence. [The present invention 1030] 1029. The method of any of claims 1025 to 1029, wherein said composition comprises a plurality of different siRNAs. [The present invention 1031] The method of any of claims 1025 to 1030, wherein the composition comprises isolated saRNA. [The present invention 1032] The method of any one of claims 1025 to 1030, wherein the composition comprises a nucleic acid vector comprising the nucleic acid comprising the sequence of the siRNA or saRNA. [The present invention 1033] The method of any one of claims 1025 to 1032, wherein the composition comprises a liposome containing the nucleic acid. [The present invention 1034] The method of any one of claims 1025 to 1032, wherein the composition comprises nanoparticles containing the nucleic acid. [This invention 1035] The method of any one of claims 1025 to 1032, wherein the composition comprises a protein complex containing the nucleic acid. [The present invention 1036] 1036. The method of any one of claims 1025 to 1035, wherein the composition is administered systemically. [This invention 1037] 1036. The method of any one of claims 1025 to 1035, wherein the composition is administered orally. [The present invention 1038] 1036. The method of any one of claims 1025 to 1035, wherein the composition is administered intravenously. [This invention 1039] 1036. The method of any one of claims 1025 to 1035, wherein the composition is administered topically. [The present invention 1040] 1036. The method of any one of claims 1025 to 1035, wherein the composition is injected. [This invention 1041] The method of any one of claims 1025 to 1040, wherein the composition is a sustained-release composition. [The present invention 1042] The method of any one of claims 1025 to 1041, further comprising the step of administering said gene therapy vector to said mammal. [This invention 1043] 1042. The method of claim 1042, wherein the liposome comprises the gene therapy vector. [This invention 1044] 1042. The method of claim 1042, wherein the nanoparticle comprises said gene therapy vector. [This invention 1045] 1042. The method of claim 1042, wherein the protein complex comprises the gene therapy vector. [The present invention 1046] 1042. The method of claim 1042, wherein the virus comprises the gene therapy vector. [This invention 1047] The method of any one of claims 1042 to 1046, wherein the vector is administered intravenously. [This invention 1048] 1047. The method of any one of claims 1042 to 1046, wherein the vector is administered locally. [This invention 1049] The method of any one of claims 1025 to 1048, wherein the mammal is a human. [The present invention 1050] A vector having homology arms flanking a second transcriptional regulatory region that can interact with a small activating RNA (saRNA) sequence when present in transcribed RNA, the homology arms having sequences corresponding to gene therapy vector sequences flanking a site for insertion of the second transcriptional regulatory region. [This invention 1051] The vector of the present invention 1050, wherein the site for insertion is 3' to the promoter and 5' to the open reading frame of the prophylactic or therapeutic gene product. [This invention 1052] A vector having homology arms flanking a first transcriptional regulatory region that can interact with a small interfering RNA (siRNA) sequence when present in transcribed RNA, the homology arms having sequences corresponding to gene therapy vector sequences adjacent to a site for insertion of the first transcriptional regulatory region. [This invention 1053] The vector of the present invention 1052, wherein the site for insertion is 3' to the open reading frame of the prophylactic or therapeutic gene product and 5' to the 3' end of the 3'UTR. [Brief explanation of the drawings]

[0014] [Figure 1] Exemplary universal AAV vector inhibition using inhibitory siRNA. [Figure 2] The RNA triggers the hairpin switch, turning on expression. The stable hairpin, overlapping ribosome binding sites, and AUG start codon block protein expression. In one embodiment, multiple hairpins can be used to avoid leaky expression without the trigger RNA. Binding of the trigger RNA (e.g., approximately 23-30 nt in length) releases the hairpin, which then allows ribosome binding and expression. [Figure 3] Exemplary universal AAV vector for intermittent inhibition of expression using inhibitory siRNA. [Figure 4] An exemplary universal AAV vector for permanent inhibition of expression using a second vector, e.g., an AAV vector. [Figure 5] Exemplary vectors for regulatable Epo expression. [Figure 6] A) Measurement of EPO levels. B) Dose-dependent inhibition of expression. [Figure 7] Mouse studies. [Figure 8] When an allergic individual is exposed to an allergen to which they have been sensitized, allergen-specific IgE-allergen immune complexes bind to mast cells, mediating anaphylactic reactions. In one embodiment, gene therapy uses an AAV serotype rh.10 gene transfer vector encoding the heavy and light chains of omalizumab (Pagovich et al., 2016). After IV administration, the vector modifies hepatocytes to persistently express omalizumab, providing a sustained therapy that blocks anti-IgE allergen activation of mast cells. [Figure 9A]Figures 9A-9D. Treatment of established peanut allergen-induced systemic anaphylaxis with Vector 07. A) Sustained expression after a single dose of Vector 07. B-D) Efficacy data in a humanized peanut allergy mouse model (Pagovich et al., 2016). [Figure 9B] See legend to Figure 9A. [Figure 9C] See legend to Figure 9A. [Figure 9D] See legend to Figure 9A. [Figure 10] Gene transfer vectors. Vector 07A (AAVrh.10 anti-IgE-T) is a therapeutic vector expressing anti-IgE. Vector 07 and Vector 07A use a CAG highly active constitutive promoter driving a secretion signal followed by the heavy and light chains of anti-IgE omalizumab, separated by a furin 2A site; upon expression, the furin 2A site is cleaved, and the heavy and light chains combine to produce and secrete functional anti-IgE (Pagovich et al., 2016). Vector 07A is identical to Vector 07, except that it contains five 21-bp tandem target sequences 3' to the anti-IgE heavy and light chains for the cognate miRNAs expressed by Vector 09A and Vector 09B. Vector 09A (AdC7miRNA-E) is a serotype E1-E3- AdC7 vector encoding eight tandem miRNA sequences cognate to the Vector 07A target sequences. Vector 09B (AAV5miRNA-E) is a serotype 5 AAV vector that encodes the same tandem miRNA sequence as Vector 09A. Vectors 09A and 09B also express reporter genes (mCherry and EGFP, respectively), allowing transfected hepatocytes to be identified. [Figure 11] Function of unique miRNA targeting sequences. Plasmids encoding 21-bp miRNA targeting sequences (33 ng / well) were transfected into 293T cells ± cognate siRNA (5 pmol). After 24 hours, CAG-driven reporter expression was quantified by Western blot analysis. DETAILED DESCRIPTION OF THE INVENTION

[0015] Detailed Description definition "Vector" refers to a macromolecule or association of macromolecules that contains or is associated with a polynucleotide and can be used to mediate delivery of the polynucleotide to a cell, either in vitro or in vivo. Exemplary vectors include, for example, plasmids, viral vectors, liposomes, and other gene delivery vehicles. The polynucleotide to be delivered, sometimes referred to as a "target polynucleotide" or "transgene," may contain a coding sequence of interest in gene therapy (such as a gene encoding a protein of therapeutic interest), a coding sequence of interest in vaccine development (such as a polynucleotide that expresses a protein, polypeptide, or peptide suitable for eliciting an immune response in a mammal), and / or a selectable or detectable marker.

[0016] As used herein, "transduction," "transfection," "transformation," or "transducing" refers to a process for introducing an exogenous polynucleotide into a host cell, resulting in expression of the polynucleotide, e.g., a transgene, in the cell, including the use of recombinant viruses to introduce the exogenous polynucleotide into the host cell. Transduction, transfection, or transformation of a polynucleotide in a cell can be determined by methods well known in the art, including, but not limited to, measuring protein expression (including steady-state levels) by ELISA, flow cytometry, and Western blot, DNA and RNA by hybridization assays, e.g., Northern blot, Southern blot, and gel shift mobility assay. Methods used for introducing an exogenous polynucleotide include well-known techniques such as viral infection or transfection, lipofection, transformation, and electroporation, as well as other non-viral gene delivery techniques. The introduced polynucleotide can be maintained stably or transiently in the host cell.

[0017] "Gene delivery" refers to the introduction of an exogenous polynucleotide into a cell for gene transfer and can encompass targeting, binding, uptake, transport, localization, replicon integration, and expression.

[0018] "Gene transfer" refers to the introduction of an exogenous polynucleotide into a cell, which can include targeting, binding, uptake, transport, localization, and replicon integration, but is distinct from and does not imply subsequent expression of a gene.

[0019] "Gene expression" or "expression" refers to the processes of transcription, translation, and post-translational modification of a gene.

[0020] An "infectious" virus or viral particle is one that contains a polynucleotide component that can be delivered into a cell for which the viral species is trophic. This term does not necessarily imply any replicative capacity of the virus.

[0021] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or their analogs. Polynucleotides can contain modified nucleotides, such as methylated or capped nucleotides and nucleotide analogs, and can be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure can be added before or after the polymer is assembled. As used herein, the term polynucleotide refers interchangeably to double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment described herein that is a polynucleotide encompasses both the double-stranded form and each of the two complementary single-stranded forms that are known or expected to form the double-stranded form.

[0022] An "isolated" polynucleotide, such as a plasmid, virus, polypeptide, or other substance, refers to a preparation of the substance that lacks at least some of the other components that may also be present in the location in which the substance or similar substance naturally occurs or from which it was originally prepared. Thus, for example, an isolated substance can be prepared by concentrating it from a source mixture using purification techniques. An isolated nucleic acid, peptide, or polypeptide exists in a form or context that is different from that in which it is found in nature. For example, a given DNA sequence (e.g., a gene) is found on a host cell chromosome in close proximity to neighboring genes, and an RNA sequence, such as a particular mRNA sequence encoding a particular protein, is found in the cell as a mixture with many other mRNAs that encode many other proteins. Isolated nucleic acid molecules can exist in single-stranded or double-stranded form. When an isolated nucleic acid molecule is used to express a protein, the molecule contains at least the sense or coding strand (i.e., the molecule can be single-stranded), but can contain both the sense and antisense strands (i.e., the molecule can be double-stranded). Concentration can be measured in absolute terms, such as weight per volume of solution, or relative to a second potential interfering substance present in the source mixture. Incremental concentrations of embodiments of the present invention are contemplated. Thus, for example, 2-fold concentration, 10-fold concentration, 100-fold concentration, or 1000-fold concentration.

[0023] "Transcriptional regulatory sequence" refers to a genomic region that controls the transcription of a gene or coding sequence to which it is operably linked. Transcriptional regulatory sequences for use in the present invention generally include at least one transcriptional promoter and may also include one or more transcriptional enhancers and / or terminators.

[0024] "Operably linked" refers to an arrangement of two or more components wherein the components so described are in a relationship permitting them to function cooperatively. Illustratively, a transcriptional regulatory sequence or promoter is operably linked to a coding sequence if the TRS or promoter promotes transcription of the coding sequence. An operably linked TRS is generally linked in cis with the coding sequence, but is not necessarily directly adjacent to it.

[0025] "Heterologous" means derived from a genotypically different entity from the entity to which it is being compared. For example, a polynucleotide introduced into a different cell type by genetic engineering techniques is a heterologous polynucleotide (and, when expressed, may encode a heterologous polypeptide). Similarly, a transcriptional regulatory element, such as a promoter, that is removed from its native coding sequence and operably linked to a different coding sequence is a heterologous transcriptional regulatory element.

[0026] "Terminator" refers to a polynucleotide sequence that tends to reduce or prevent read-through transcription (i.e., reduces or prevents transcription originating on one side of the terminator from continuing to the other side of the terminator). The degree to which transcription is interrupted typically depends on the base sequence and / or the length of the terminator sequence. In particular, as is well known in many molecular biological systems, certain DNA sequences commonly referred to as "transcription termination sequences" are specific sequences that tend to interrupt read-through transcription by RNA polymerase, presumably by terminating the RNA polymerase molecule and / or disengaging it from the DNA being transcribed. Typical examples of such sequence-specific terminators include polyadenylation ("polyA") sequences, such as SV40 polyA. In addition to or instead of such sequence-specific terminators, the insertion of a relatively long DNA sequence between the promoter and the coding region also generally tends to interrupt transcription of the coding region in proportion to the length of the intervening sequence. This effect probably arises because there is always some tendency for RNA polymerase molecules to break away from the DNA being transcribed, and increasing the length of the sequence traversed before reaching the coding region generally increases the likelihood that breakaway will occur before transcription of the coding region is completed, or perhaps even initiated. Thus, terminators can prevent transcription from only one direction ("unidirectional" terminators) or from both directions ("bidirectional" terminators), and can be composed of sequence-specific termination sequences or sequence-nonspecific terminators, or both. A variety of such terminator sequences are known in the art, and exemplary uses of such sequences within the context of the present invention are provided below.

[0027] "Host cell," "cell line," "cell culture," "packaging cell line," and other such terms refer to higher eukaryotic cells, such as mammalian cells, including human cells, that are useful in the present invention, for example, to produce recombinant viruses or recombinant fusion polypeptides. These cells include the progeny of the original transduced cell. It is understood that the progeny of a single cell may not necessarily be completely identical (in morphology or genomic complement) to the original parent cell.

[0028] "Recombinant" as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction, and / or ligation steps, and other procedures that result in a construct that differs from polynucleotides found in nature. A recombinant virus is a viral particle that contains a recombinant polynucleotide. The term includes copies of the original polynucleotide construct and progeny of the original viral construct, respectively.

[0029] A "control element" or "control sequence" is a nucleotide sequence involved in molecular interactions that contribute to the functional regulation of a polynucleotide, including polynucleotide replication, duplication, transcription, splicing, translation, or degradation. Regulation can affect the frequency, speed, or specificity of the process and can be enhancing or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region that can bind to RNA polymerase under certain conditions and initiate transcription of a coding region typically located downstream (3' direction) of the promoter. Promoters include AAV promoters, such as P5, P19, P40, and AAV ITR promoters, as well as heterologous promoters.

[0030] An "expression vector" is a vector containing a region encoding a gene product of interest and is used to effect expression of the gene product in an intended target cell. Expression vectors also contain control elements operably linked to the coding region to promote expression of the protein in the target. The combination of control elements and one or more genes to which they are operably linked for expression is sometimes referred to as an "expression cassette," many of which are known and available in the art or can be readily constructed from components available in the art.

[0031] The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The term also encompasses amino acid polymers that have been modified (e.g., by disulfide bond formation, glycosylation, acetylation, phosphonylation, lipid addition, or conjugation with a labeling component).

[0032] The term "exogenous," when used in reference to a protein, gene, nucleic acid, or polynucleotide in a cell or organism, refers to a protein, gene, nucleic acid, or polynucleotide that has been introduced into the cell or organism by artificial or natural means. An exogenous nucleic acid can be from a different organism or cell, or can be one or more additional copies of a nucleic acid that naturally occurs in the organism or cell. As a non-limiting example, an exogenous nucleic acid is at a different chromosomal location than that of the native cell, or is otherwise flanked by different nucleic acid sequences than those found in nature (e.g., an expression cassette linking a promoter from one gene to the open reading frame of a gene product from a different gene).

[0033] "Transformed" or "transgenic" are used herein to include any host cell or cell line that has been altered or augmented by the presence of at least one recombinant DNA sequence. The host cells of the present invention are typically produced by transfection with a DNA sequence in a plasmid expression vector, as an isolated linear DNA sequence, or by infection with a recombinant viral vector.

[0034] The term "sequence homology" refers to the percentage of base matches between two nucleic acid sequences, or the percentage of amino acid matches between two amino acid sequences. When sequence homology is expressed as a percentage (e.g., 50%), the percentage indicates the percentage of matches over the length of the selected sequence compared to some other sequence. Gaps (in either of the two sequences) are allowed to maximize matching, and gap lengths of 15 bases or less are usually used (6 bases or less, e.g., 2 bases or less). When oligonucleotides are used as probes or therapeutics, the sequence homology between the target nucleic acid and the oligonucleotide sequence is generally 17 or more target base pair matches (85%) out of 20 possible oligonucleotide base pair matches, 9 or more matches (90%) out of 10 possible base pair matches, or 19 or more matches (95%) out of 20 possible base pair matches.

[0035] Two amino acid sequences are homologous if there is partial or complete identity between them. For example, 85% homology means that 85% of the amino acids are identical when the two sequences are aligned for maximum matching. Gaps (in either of the two sequences being matched) are allowed to maximize matching (gap length of 5 or less or 2 or less). Alternatively, two protein sequences (or polypeptide sequences derived from them that are at least 30 amino acids long) are homologous, as this term is used herein, if they have an alignment score of more than 5 (standard deviation units) using the program ALIGN with a mutation data matrix and a gap penalty of 6 or more. Two sequences or portions thereof are more homologous if their amino acids are 50% or more identical when optimally aligned using the ALIGN program.

[0036] The term "corresponding" is used herein to mean that a polynucleotide sequence is structurally related to all or a portion of a reference polynucleotide sequence, or that a polypeptide sequence is structurally related to all or a portion of a reference polypeptide sequence, e.g., they have at least 80%, 85%, 90%, 95%, or more, e.g., 99% or 100%, sequence identity. In contrast, the term "complementary" is used herein to mean that a complementary sequence is homologous to all or a portion of a reference polynucleotide sequence. By way of example, the nucleotide sequence "TATAC" corresponds to the reference sequence "TATAC" and is complementary to the reference sequence "GTATA."

[0037] The term "sequence identity" means that two polynucleotide sequences are identical (i.e., nucleotide-by-nucleotide) over a comparison window. The term "sequence identity percentage" means that two polynucleotide sequences are identical (i.e., nucleotide-by-nucleotide) over a comparison window. The term "sequence identity percentage" is calculated by comparing two optimally aligned sequences over a comparison window, determining the number of positions where the same nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to obtain the sequence identity percentage. As used herein, the term "substantial identity" refers to a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence having at least 85 percent sequence identity, e.g., at least 90-95 percent sequence identity, or at least 99 percent sequence identity, relative to a reference sequence over a comparison window of at least 20 nucleotide positions, frequently over a window of at least 20-50 nucleotides, where the percentage of sequence identity is calculated by comparing the reference sequence to a polynucleotide sequence that may contain deletions or additions totaling no more than 20 percent of the reference sequence over the comparison window.

[0038] "Conservative" amino acid substitutions include, for example, aspartic acid-glutamic acid as polar acidic amino acids, lysine / arginine / histidine as polar basic amino acids, leucine / isoleucine / methionine / valine / alanine / glycine / proline as nonpolar or hydrophobic amino acids, and serine / threonine as polar or uncharged hydrophilic amino acids. Conservative amino acid substitutions also include groupings based on side chains. For example, the group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; the group of amino acids with aliphatic-hydroxyl side chains is serine and threonine; the group of amino acids with amide-containing side chains is asparagine and glutamine; the group of amino acids with aromatic side chains is phenylalanine, tyrosine, and tryptophan; the group of amino acids with basic side chains is lysine, arginine, and histidine; and the group of amino acids with sulfur-containing side chains is cysteine ​​and methionine. For example, it is reasonable to expect that substitution of leucine with isoleucine or valine, aspartic acid with glutamic acid, threonine with serine, or similar substitutions of amino acids with structurally related amino acids will not have a significant effect on the properties of the resulting polypeptide. Whether an amino acid change results in a functional polypeptide can be readily determined by assaying the specific activity of the polypeptide. Naturally occurring residues are divided into groups based on common side chain properties: (1) hydrophobic: norleucine, met, ala, val, leu, ile; (2) neutral hydrophilic: cys, ser, thr; (3) acidic: asp, glu; (4) basic: asn, gln, his, lys, arg; (5) residues that affect chain orientation: gly, pro; and (6) aromatic: trp, tyr, phe.

[0039] The present disclosure also contemplates polypeptides with non-conservative substitutions, which entail exchanging a member of one of the above classes for another.

[0040] Vectors and methods In conventional use, once a gene transfer vector is administered to a recipient, expression from the transgene cannot be regulated, blocked, or turned on. Control of previously administered vectors is important for safety in case turning on the vector when needed results in too strong expression or efficacy.

[0041] The expression of some types of transgenes (e.g., therapeutic antibodies, hormones, anti-tumor therapies, etc.) is not always required. Small non-coding RNAs can be used to increase or decrease gene expression. A wide range of technologies have been developed for the in vivo administration of non-coding RNAs to regulate gene expression, and small non-coding RNAs are incorporated into gene transfer vectors to actively suppress genes. The present disclosure provides the use of small non-coding RNAs delivered independently after vector-mediated gene transfer to control (turn on or off) the expression of the transferred gene. The incorporation of a target site for small interfering RNA (siRNA) or small activating RNA (saRNA) into a vector expression cassette allows for the control of transgene expression of the previously administered vector / expression cassette as needed by administering exogenous siRNA or saRNA.

[0042] Exemplary Gene Therapy Vectors The present disclosure provides a gene therapy vector, which comprises a nucleic acid sequence having an open reading frame encoding a therapeutic or preventive gene product, and a first transcriptional regulatory region 3' to the open reading frame, which, when present in the transcribed RNA, can interact with a small interfering RNA (siRNA) sequence, thereby inhibiting the translation of the transcribed RNA, or 2) promoting the degradation of the transcribed RNA, thereby inhibiting the expression of the gene product; and / or a second transcriptional regulatory region 5' to the open reading frame, which, when present in the transcribed RNA, can interact with a small activating RNA (saRNA) sequence, thereby enabling the translation of the transcribed RNA and allowing the expression of the gene product. Also provided is a composition comprising siRNA or a vector for siRNA expression, or saRNA or a vector for saRNA expression.

[0043] Various embodiments of gene therapy vectors, transcriptional regulatory regions, siRNA and / or saRNA, and methods are discussed below. Although each parameter is discussed separately, the gene therapy vectors, transcriptional regulatory regions, siRNA and / or saRNA, and methods include combinations of the parameters described below to induce regulation of therapeutic or preventive gene products. Thus, any combination of parameters can be used according to the gene therapy vectors, transcriptional regulatory regions, siRNA and / or saRNA, and methods.

[0044] Thus, a "gene therapy vector" is any molecule or composition capable of carrying a heterologous nucleic acid sequence into a suitable host cell, where synthesis of the encoded protein occurs. Typically, a gene therapy vector is a nucleic acid molecule engineered using recombinant DNA techniques known in the art to incorporate a heterologous nucleic acid sequence. Desirably, the gene therapy vector is composed of DNA. Examples of suitable DNA-based gene therapy vectors include plasmids and viral vectors. However, non-nucleic acid-based gene therapy vectors, such as liposomes or nanoparticles containing a gene therapy vector and one or more transcriptional regulatory regions, can also be used. Gene therapy vectors can be based on a single type of nucleic acid (e.g., a plasmid) or on a non-nucleic acid molecule (e.g., a lipid or polymer). Gene therapy vectors can be integrated into the host cell genome or present in the host cell in the form of an episome.

[0045] Gene delivery vectors within the scope of the present disclosure include, but are not limited to, isolated nucleic acids, e.g., plasmid-based vectors that can be maintained extrachromosomally, and viral vectors, e.g., recombinant adenoviruses, retroviruses, lentiviruses, herpesviruses, poxviruses, papillomaviruses, or adeno-associated viruses, including viral and non-viral vectors present in liposomes, e.g., neutral or cationic liposomes such as DOSPA / DOPE, DOGS / DOPE, or DMRIE / DOPE liposomes, and / or associated with other molecules, such as DNA-anti-DNA antibody-cationic lipid (DOTMA / DOPE) complexes or natural or synthetic polymers. Exemplary viral gene delivery vectors are described below. Gene delivery vectors can be administered via any route, including, but not limited to, intracranial, intrathecal, intramuscular, buccal, rectal, intravenous, or intracoronary administration, and cellular transfer can be enhanced using electroporation and / or iontophoresis, and / or scaffolds such as extracellular matrices or hydrogels, e.g., hydrogel patches.

[0046] In one embodiment, the gene therapy vector or other vector for siRNA or saRNA expression is a viral vector.Suitable viral vectors include, for example, retroviral vector, lentiviral vector, herpes simplex virus (HSV)-based vector, parvovirus-based vector, for example, adeno-associated virus (AAV)-based vector, AAV-adenovirus chimeric vector, and adenovirus-based vector.These viral vectors can be prepared using standard recombinant DNA technology, for example, as described in Sambrook et al., Molecular Cloning, a Laboratory Manual, 3rd edition, Cold Spring Harbor Press, Cold Spring Harbor, NY (2001), and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, New York, NY (1994).

[0047] Retroviral vectors Retroviral vectors exhibit several unique characteristics, including their ability to stably and precisely integrate into the host genome and provide long-term transgene expression. These vectors can be engineered ex vivo to remove infectious gene particles to minimize the risk of systemic infection and patient-to-patient transmission. Pseudotyped retroviral vectors can change the tropism of host cells.

[0048] Lentivirus Lentivirus is derived from the retrovirus family, which includes human immunodeficiency virus and feline immunodeficiency virus.However, unlike retroviruses that only infect dividing cells, lentiviruses can infect both dividing and non-dividing cells.Although lentiviruses have specific tropism, pseudotyping of viral envelope with vesicular stomatitis virus results in a virus with a broader spectrum (Schnepp et al.Meth.Mol.Med.,69:427(2002)).

[0049] Adenovirus vectors Adenoviral vectors can be made replication-defective by deleting the early (E1A and E1B) genes responsible for viral gene expression from the genome, and can be stably maintained in host cells in an extrachromosomal form. These vectors have the ability to transfect both replicating and non-replicating cells. Adenoviral vectors have been shown to produce transient expression of therapeutic genes in vivo, peaking at 7 days and lasting for approximately 4 weeks. In addition, adenoviral vectors can be produced at very high titers, allowing for efficient gene therapy using small amounts of virus.

[0050] Adeno-associated virus vector Recombinant adeno-associated viruses (rAAVs) are derived from nonpathogenic parvoviruses, elicit essentially no cellular immune responses, and result in transgene expression that persists for months in most systems. Furthermore, like adenoviruses, adeno-associated virus vectors are capable of infecting replicating and non-replicating cells and are considered nonpathogenic to humans.

[0051] AAV vectors include, but are not limited to, AAV1, AAV2, AAV5, AAV7, AAV8, AAV9, or AAVrhlO (including chimeric viruses in which the AAV genome is from a different source than the capsid).

[0052] Plasmid DNA vectors Plasmid DNA is often referred to as "naked DNA" to indicate the absence of more elaborate packaging systems. Direct injection of plasmid DNA into cardiomyocytes in vivo has been achieved. Plasmid-based vectors are relatively non-immunogenic and non-pathogenic, and have the potential to stably integrate into the cellular genome, resulting in long-term gene expression in postmitotic cells in vivo. Furthermore, plasmid DNA is rapidly degraded in the bloodstream, thus negligible potential for transgene expression in distant organ systems. Plasmid DNA can be delivered to cells as part of macromolecular complexes, such as liposomes or DNA-protein complexes, and delivery can be enhanced using techniques including electroporation.

[0053] Exemplary AAV Vectors In embodiments, the disclosure provides an adeno-associated virus (AAV) vector comprising, consisting essentially of, or consisting of a nucleic acid sequence comprising: a nucleic acid sequence having an open reading frame encoding a therapeutic or prophylactic gene product; and a nucleic acid sequence having a first transcriptional regulatory region 3' to the open reading frame that, when present in the transcribed RNA, is capable of: i) interacting with a small interfering RNA (siRNA) sequence, thereby inhibiting translation of the transcribed RNA; or 2) enhancing degradation of the transcribed RNA, thereby inhibiting expression of the gene product; and / or the vector comprises a second transcriptional regulatory region 5' to the open reading frame that, when present in the transcribed RNA, is capable of interacting with a small activating RNA (saRNA) sequence, thereby allowing translation of the transcribed RNA to express the gene product. When an AAV vector consists essentially of a nucleic acid encoding a gene product and one or both transcriptional regulatory regions, additional components that do not substantially affect the AAV vector (e.g., genetic elements such as a poly(A) sequence or a restriction enzyme site that facilitates in vitro manipulation of the vector) may be included. When an AAV vector consists of a nucleic acid sequence encoding a gene product and one or both transcriptional regulatory regions, the AAV vector does not include any additional components (i.e., components that are not endogenous to AAV and are not required to effect expression of the nucleic acid sequence).

[0054] Adeno-associated viruses are members of the Parvoviridae family and contain a linear, single-stranded DNA genome of less than approximately 5,000 nucleotides. For efficient replication, AAV requires co-infection with a helper virus (i.e., adenovirus or herpesvirus) or the expression of helper genes. AAV vectors used for administering therapeutic nucleic acids typically lack approximately 96% of the parent genome, leaving only the terminal repeats (ITRs), which contain recognition signals for DNA replication and packaging. This eliminates immunological or toxic side effects caused by viral gene expression. Additionally, delivery of specific AAV proteins to producer cells allows for the integration of AAV vectors containing AAV ITRs into specific regions of the cellular genome, if desired (see, e.g., U.S. Patent Nos. 6,342,390 and 6,821,511). Host cells containing the integrated AAV genome do not exhibit changes in cell growth or morphology (see, e.g., U.S. Patent No. 4,797,368).

[0055] The AAV ITRs are flanked by unique coding nucleotide sequences for the nonstructural replication (Rep) proteins and the structural capsid (Cap) proteins (also known as virion proteins (VPs)). The terminal 145 nucleotides are self-complementary and organized to allow the formation of energetically stable intramolecular duplexes that form T-shaped hairpins. These hairpin structures serve as origins for viral DNA replication by acting as primers for cellular DNA polymerase complexes. The Rep genes encode the Rep proteins Rep78, Rep68, Rep52, and Rep40. Rep78 and Rep68 are transcribed from the p5 promoter, while Rep52 and Rep40 are transcribed from the p19 promoter. The Rep78 and Rep68 proteins are multifunctional DNA-binding proteins that perform helicase and nickase functions during productive replication, allowing for AAV terminus resolution (see, e.g., Im et al., Cell, 61:447 (1990)). These proteins also regulate transcription from the endogenous AAV promoter and promoters in the helper virus (see, e.g., Pereira et al., J. Virol., 71:1079 (1997)). Other Rep proteins modify the function of Rep78 and Rep68. The cap gene encodes the capsid proteins VP1, VP2, and VP3. The cap gene is transcribed from the p40 promoter.

[0056] AAV vectors can be produced using any AAV serotype known in the art. Several AAV serotypes and over 100 AAV variants have been isolated from adenovirus stocks or from human or non-human primate tissues (e.g., as reviewed in Wu et al., Molecular Therapy, 14(3):316 (2006)). Generally, AAV serotypes share significant genomic sequence homology at the nucleic acid and amino acid sequence levels, so that different serotypes share the same set of gene functions, produce essentially physically and functionally equivalent virions, and replicate and assemble by essentially the same mechanisms. AAV serotypes 1-5 and 7-9 are defined as "true" serotypes in that they do not cross-react efficiently with neutralizing sera specific for any other existing characterized serotypes. In contrast, AAV serotypes 6, 10 (also referred to as Rh10), and 11 are considered "variant" serotypes because they do not adhere to the definition of a "true" serotype. AAV serotype 2 (AAV2) is widely used for gene therapy applications due to its lack of pathogenicity, broad range of infectivity, and ability to establish long-term transgene expression (see, e.g., Carter, Hum. Gene Ther., 16:541 (2005), and Wu et al., supra). The genomic sequences of various AAV serotypes and comparisons thereof are disclosed, for example, in GenBank accession numbers U89790, J01901, AF043303, and AF085716, Chiorini et al., J. Virol., 71:6823 (1997), Srivastava et al., J. Virol., 45:555 (1983), Chiorini et al., J. Virol., 73:1309 (1999), Rutledge et al., J. Virol., 72:309 (1998), and Wu et al., J. Virol., 74:8635 (2000)).

[0057] AAV rep and ITR sequences are particularly conserved across most AAV serotypes. For example, the Rep78 proteins of AAV2, AAV3A, AAV3B, AAV4, and AAV6 are reportedly approximately 89–93% identical (see Bantel-Schaal et al., J. Virol., 73(2):939 (1999)). AAV serotypes 2, 3A, 3B, and 6 are reported to share approximately 82% overall nucleotide sequence identity at the genomic level (Bantel-Schaal et al., supra). Furthermore, the rep sequences and ITRs of many AAV serotypes are known to efficiently cross-complement (e.g., functionally substitute for) corresponding sequences from other serotypes during AAV particle production in mammalian cells.

[0058] Generally, the cap protein, which determines the cell tropism of AAV particles, and the associated cap protein coding sequence are significantly less conserved across different AAV serotypes than the Rep gene. Considering the ability of Rep and ITR sequences to cross-complement the corresponding sequences of other serotypes, AAV vectors can contain a mixture of serotypes, thereby becoming "chimeric" or "pseudotyped" AAV vectors. Chimeric AAV vectors typically contain AAV capsid proteins from two or more (e.g., two, three, four, etc.) different AAV serotypes. In contrast, pseudotyped AAV vectors contain one or more ITRs from one AAV serotype packaged in the capsid of another AAV serotype. Chimeric and pseudotyped AAV vectors are further described in, for example, U.S. Patent No. 6,723,551, Flotte, Mol. Ther., 13(1):1 (2006), Gao et al., J. Virol., 78:6381 (2004), Gao et al., Proc. Natl. Acad. Sci. USA, 99:11854 (2002), De et al., Mol. Ther., 13:67 (2006), and Gao et al., Mol. Ther., 13:77 (2006).

[0059] In one embodiment, the AAV vector is generated using an AAV that infects humans (e.g., AAV2). Alternatively, the AAV vector is generated using an AAV that infects non-human primates, such as great apes (e.g., chimpanzees), Old World monkeys (e.g., macaques), and New World monkeys (e.g., marmosets). In one embodiment, the AAV vector is generated using an AAV that infects non-human primates and is pseudotyped with an AAV that infects humans. Examples of such pseudotyped AAV vectors are disclosed, for example, in Cearley et al., Molecular Therapy, 13:528 (2006). In one embodiment, an AAV vector containing a capsid protein from an AAV that infects rhesus monkeys and is pseudotyped with AAV2 inverted terminal repeats (ITRs) can be generated. In certain embodiments, the AAV vector comprises capsid proteins from AAV10 (also referred to as "AAVrh.10") that infect rhesus macaques pseudotyped with AAV2 ITRs (see, e.g., Watanabe et al., Gene Ther., 17(8):1042 (2010), and Mao et al., Hum. Gene Therapy, 22:1525 (2011)).

[0060] In addition to the nucleic acid sequence encoding the gene product and one or more transcriptional regulatory regions, the AAV vector may contain expression control sequences, such as promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), etc., that provide for expression of the nucleic acid sequence in a host cell. Exemplary expression control sequences are known in the art and are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, CA. (1990).

[0061] Numerous promoters, including constitutive, inducible, and repressible promoters, from a variety of different sources are well known in the art. Typical promoter sources include, for example, viruses, mammals, insects, plants, yeast, and bacteria, and suitable promoters from these sources are readily available or can be synthetically produced based on publicly available sequences from, for example, repositories such as ATCC, as well as other commercial or individual sources. Promoters can be unidirectional (i.e., initiate transcription in one direction) or bidirectional (i.e., initiate transcription in either the 3' or 5' direction). Non-limiting examples of promoters include, for example, the T7 bacterial expression system, the pBAD (araA) bacterial expression system, the cytomegalovirus (CMV) promoter, the SV40 promoter, and the RSV promoter. Inducible promoters include, for example, the Tet system (U.S. Pat. Nos. 5,464,758 and 5,814,618), the ecdysone-inducible system (No et al. Proc. Natl. Acad. Sci., 93:3346 (1996)), the T-REXTM system (Invitrogen, Carlsbad, CA), the LACSWITCH™ system (Stratagene, San Diego, CA), and the Cre-ERT tamoxifen-inducible recombinase system (Indra et al., Nuc. Acid. Res., 27:4324 (1999), Nuc. Acid. Res., 28:e99 (2000), U.S. Pat. No. 7,112,715, and Kramer & Fussenegger, Methods Mol. Biol., 308:123 (2005)).

[0062] The term "enhancer" as used herein refers to a DNA sequence that increases the transcription of, for example, a nucleic acid sequence to which it is operably linked. Enhancers can be located many kilobases away from the coding region of a nucleic acid sequence and can mediate the binding of regulatory factors, DNA methylation patterns, or changes in DNA structure. Numerous enhancers from a variety of different sources are well known in the art and are available as or within cloned polynucleotides (e.g., from repositories such as ATCC, as well as other commercial or individual sources). Some polynucleotides containing promoters (such as the commonly used CMV promoter) also contain enhancer sequences. Enhancers can be located upstream of, within, or downstream of the coding sequence. In one embodiment, the nucleic acid sequence encoding the EPO or antibody is operably linked to a CMV enhancer / chicken beta actin promoter (also referred to as the "CAG promoter") (see, e.g., Niwa et al., Gene, 108:193 (1991); Daly et al., Proc. Natl. Acad. Sci. USA, 96:2296 (1999); and Sondhi et al., Mol. Ther., 15:481 (2007)).

[0063] Typically, AAV vectors are produced using well-characterized plasmids. For example, human embryonic kidney 293T cells are transfected with one of the transgene-specific plasmids and another plasmid containing an adenovirus helper and the AAV rep and cap genes (specific for AAVrh.10, 8, or 9, as needed). After 72 hours, the cells are harvested, and the vector is liberated from the cells by five freeze / thaw cycles. Subsequent centrifugation and benzonase treatment removes cell debris and unencapsidated DNA. An iodixanol gradient and ion exchange column can be used to further purify each AAV vector. The purified vector is then concentrated to the required concentration using a size-exclusion centrifugal spin column. Finally, the buffer is exchanged to produce the final vector product, formulated (for example) in 1x phosphate-buffered saline. Viral titer can be measured by TaqMan® real-time PCR, and viral purity can be assessed by SDS-PAGE.

[0064] Pharmaceutical Compositions and Delivery The present disclosure provides compositions comprising, consisting essentially of, or consisting of the above-described gene therapy vector and a pharmaceutically acceptable (e.g., physiologically acceptable) carrier, and / or comprising siRNA, saRNA, or a vector for expression of siRNA and / or saRNA. For example, when a composition consists essentially of a gene therapy vector and a pharmaceutically acceptable carrier, additional components (e.g., adjuvants, buffers, stabilizers, anti-inflammatory agents, solubilizers, preservatives, etc.) that do not substantially affect the composition may be included. For example, when a composition consists of a gene therapy vector and a pharmaceutically acceptable carrier, the composition does not contain any additional components. Any suitable carrier may be used within the context of the present disclosure, and such carriers are well known in the art. The choice of carrier is determined, in part, by the particular site to which the composition will be administered and the particular method used to administer the composition. The composition may optionally be sterile, with the exception of the gene therapy vectors described herein. The composition may be frozen or lyophilized for storage and reconstituted in a suitable sterile carrier prior to use. The compositions may be produced according to conventional techniques, for example, as described in Remington: The Science and Practice of Pharmacy, 21st Edition, Lippincott Williams & Wilkins, Philadelphia, PA (2001).

[0065] Suitable formulations for the composition include aqueous and non-aqueous solutions, isotonic sterile solutions (which may contain antioxidants, buffers, and bacteriostatic agents), and aqueous and non-aqueous sterile suspensions that may contain suspending agents, solubilizers, thickeners, stabilizers, and preservatives. The formulations may be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and may be stored in a freeze-dried (lyophilized) state, requiring only the addition of a sterile liquid carrier, such as water, immediately before use. Extemporaneous solutions and suspensions may be prepared from the types of sterile powders, granules, and tablets previously described. In one embodiment, the carrier is a buffered saline solution. In one embodiment, the gene therapy vector, siRNA, or saRNA is administered in a composition formulated to protect the gene therapy vector, siRNA, or saRNA from damage before and after administration. For example, the composition may be formulated to reduce loss of the gene therapy vector on devices used to prepare, store, or administer the gene therapy vector, such as glassware, syringes, or needles. The composition can be formulated to reduce the light and / or temperature sensitivity of the gene therapy vector. To this end, the composition can contain, for example, a pharmaceutically acceptable liquid carrier, such as those described above, and a stabilizer selected from the group consisting of polysorbate 80, L-arginine, polyvinylpyrrolidone, trehalose, and combinations thereof. The use of such a composition can extend the shelf life of the gene therapy vector, facilitate administration, and increase the efficiency of the method. Formulations for gene therapy vector-containing compositions are further described, for example, in Wright et al., Curr. Opin. Drug Discov. Devel., 6(2):174-178 (2003) and Wright et al., Molecular Therapy, 12:171-178 (2005).

[0066] The composition may also be formulated to enhance transduction efficiency. Additionally, those skilled in the art will appreciate that the gene therapy vector may be present in the composition with other therapeutic or bioactive agents. For example, factors that control inflammation, such as ibuprofen or steroids, may be part of the composition to reduce swelling and inflammation associated with in vivo administration of the gene therapy vector. Immune system stimulants or adjuvants, such as interleukins, lipopolysaccharides, and double-stranded RNA, may be administered to enhance or modify the immune response. Antibiotics, i.e., bactericides and fungicides, may be present to treat existing infections and / or reduce the risk of future infections, such as those associated with gene therapy procedures.

[0067] Injectable depot forms are prepared by forming microencapsule matrices of the target compound in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer and the properties of the specific polymer used, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations can also be prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.

[0068] In certain embodiments, the formulation comprises a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polymers of acrylic and methacrylic acid esters, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes and copolymers thereof, cellulose, polypropylene, polyethylene, polystyrene, polymers of lactic and glycolic acid, polyanhydrides, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acid, polycyanoacrylates, and blends, mixtures, or copolymers thereof.

[0069] The composition can be administered in or on a device that allows controlled or sustained release, such as a sponge, a biocompatible meshwork, a mechanical reservoir, or a mechanical implant. Implants (see, e.g., U.S. Pat. No. 5,443,505), devices (see, e.g., U.S. Pat. No. 4,863,457), for example, implantable devices, such as mechanical reservoirs, or implants or devices composed of polymeric compositions, are particularly useful for administering gene therapy vectors. The composition can also be administered in the form of sustained-release formulations, including, for example, gel foam, hyaluronic acid, gelatin, chondroitin sulfate, polyphosphoesters, such as bis-2-hydroxyethyl-terephthalate (BHET), and / or polylactic-glycolic acid (see, e.g., U.S. Pat. No. 5,378,475).

[0070] Delivery of a composition containing a gene therapy vector, or siRNA and / or saRNA, or a vector for its expression, can be intracerebral (including, but not limited to, intraparenchymal, intraventricular, or intracisternal), intrathecal (including, but not limited to, lumbar or cisterna magna), or systemic (including, but not limited to, intravenous), or any combination thereof, using devices known in the art. Delivery can also be via surgical implantation of an implanted device.

[0071] The dose of the gene therapy vector, siRNA, or saRNA, or vector for its expression in the composition administered to the mammal depends on several factors, including the size (mass) of the mammal, the extent of any side effects, the particular route of administration, etc. In one embodiment, the method involves administering a "therapeutically effective amount" of a composition containing a gene therapy vector described herein. A "therapeutically effective amount" refers to an amount effective, for the duration and dosage necessary, to achieve the desired therapeutic result. A therapeutically effective amount may vary depending on factors such as the extent of the condition, the age, sex, and weight of the individual, and the ability of the gene therapy vector to elicit the desired response in the individual. The dose of the gene therapy vector in the composition required to achieve a particular therapeutic effect is typically administered in units of vector genome copies per cell (gc / cell) or vector genome copies per kilogram body weight (gc / kg). Those skilled in the art can easily determine the appropriate gene therapy vector dosage range for treating a patient with a particular disease or disorder based on these and other factors well known in the art. A therapeutically effective amount is defined as 1×10 10 Genome copies ~1 x 10 13 A therapeutically effective dose may be 1×10 genome copies. 11 Genome copies ~1 x 10 14 A therapeutically effective dose may be 1×10 genome copies. 12 Genome copies ~1 x 10 15 The therapeutically effective amount may be 0.5 to 2 × 10 genome copies. 13 Genome copies (gc) ~0.5~2×10 16 gc, e.g., total dose in humans, e.g., 1×10 13 gc~1×10 14 gc, 1×10 14 gc~1×10 15 gc, or 1 × 10 15 gc~1×10 14 In one embodiment, the total dose in a human is about 1 x 10 8 gc / kg ~ approx. 2×10 10 gc / kg, e.g., 1.5 x 10 9 gc / kg ~ approx. 1.5×10 11gc / kg, 1.5 × 10 10 gc / kg ~ approx. 1.5×10 12 gc / kg, or 1.5 × 10 12 gc / kg ~ approx. 1.5×10 13 gc / kg. Assuming a 70 kg human, the dose range is 1.4 x 10 8 gc / kg~1.4×10 11 gc / kg, 1.4 × 10 9 gc / kg~1.4×10 12 gc / kg, 1.4 × 10 10 gc / kg~1.4×10 13 gc / kg, or 1.4 × 10 11 gc / kg~1.4×10 14 It may be gc / kg.

[0072] In one embodiment, the composition comprising gene therapy vector, siRNA or saRNA, or the vector for its expression is administered to mammal once.However, in certain cases, to ensure sufficient exposure of cell to composition, it may be appropriate to administer composition multiple times during treatment period.For example, composition can be administered to mammal more than once (for example, 2, 3, 4, 5, 6, 6, 8, 9 or 10 times or more) during treatment period.

[0073] subject The subject can be any animal, including human and non-human animals.Non-human animals include all vertebrates, for example, mammals and non-mammals, for example, non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles, but mammals such as non-human primates, sheep, dogs, cats, cows, and horses are considered as subjects.The subject can also be livestock, for example, cows, pigs, sheep, poultry, and horses, or pets, for example, dogs and cats.

[0074] In one embodiment, the subject includes a human subject suffering from or at risk for the medical diseases and disorders described herein. The subject will generally be diagnosed with the condition by one skilled in the art, e.g., a physician.

[0075] The methods described herein can be used for subjects of any species, sex, age, ethnic group, or genotype. Thus, the term subject includes males and females, and includes elderly people, elderly-adult transition age subjects, adult-pre-adult transition age subjects, and pre-adults, including adolescents, children, and infants.

[0076] Examples of human ethnic groups include Caucasians, Asians, Hispanics, Africans, African Americans, Native Americans, Semitic peoples, and Pacific Islanders. The method may be more suitable for some ethnic groups, such as Caucasians, particularly Northern European populations, and Asian populations.

[0077] The term subject also includes subjects of any genotype or phenotype, as described above, as long as they require treatment.In addition, subjects may have any genotype or phenotype for any hair color, eye color, skin color, or any combination thereof.The term subject includes subjects of any height, weight, or size or shape of any organ or body part.

[0078] Exemplary Nanoparticle Formulations Biodegradable nanoparticles (e.g., containing gene therapy vectors or isolated siRNA or saRNA nucleic acids, or vectors for expression of siRNA or saRNA) can be prepared from a variety of nanoparticles, including polylactic acid (PLA), polyglycolic acid (PGA), copolymers of PLA and PGA (i.e., polylactic-co-glycolic acid (PLGA)), poly-ε-caprolactone (PCL), polyethylene glycol (PEG), poly(3-hydroxybutyrate), poly(p-dioxanone), polypropylene fumarate, poly(orthoesters), polyol / diketene acetal addition polymers, poly(alkyl-cyano)s, and poly(alkyl-cyano)s. The polymeric material may comprise or be formed from biodegradable polymer molecules, including, but not limited to, polyacrylate (PAC), poly(sebacic anhydride) (PSA), poly(carboxybiscarboxyphenoxyphenoxyhexone) (PCPP), poly[bis(p-carboxyphenoxy)methane (PCPM), copolymers of PSA, PCPP, and PCPM, poly(amino acids), poly(pseudoamino acids), polyphosphazenes, derivatives of poly[(dichloro)phosphazenes] and poly[(organo)phosphazenes], polyhydroxybutyric acid, or S-caproic acid, elastin, or gelatin (see, e.g., Kumari et al., Colloids and Surfaces B: Biointerfaces 75(2010)1-18, and U.S. Patent Nos. 6,913,767, 6,884,435, 6,565,777, 6,534,092, 6,528,087, 6,379,704, 6,309,569, 6,264,987, 6,210,707, 6,090,925, 6,022,564, 5,981,7 19, 5,871,747, 5,723,269, 5,603,960, and 5,578,709, as well as U.S. Application Publication No. 2007 / 0081972, and International Application Publication Nos. WO2012 / 115806 and WO2012 / 054425, the contents of which are incorporated herein by reference in their entireties.

[0079] Biodegradable nanoparticles can be prepared by methods known in the art. (See, for example, Nagavarma et al., Asian J. of Pharma. And Clin. Res., Vol. 5, Suppl. 3, 2012, pp. 16-23; Cismaru et al., Rev. Roum. Chim., 2010, 55(8), 433-442; and International Application Publication Nos. WO 2012 / 115806 and WO 2012 / 054425, the contents of which are incorporated herein by reference in their entirety.) Suitable methods for preparing nanoparticles can include methods utilizing preformed polymer dispersions, including, but not limited to, solvent evaporation, nanoprecipitation, emulsification / solvent diffusion, salting out, dialysis, and supercritical fluid techniques. In some embodiments, nanoparticles can be prepared by forming a double emulsion (e.g., water-in-oil-in-water) followed by solvent evaporation. The nanoparticles obtained by the disclosed methods can be optionally subjected to further processing steps, such as washing and lyophilization. Optionally, the nanoparticles can be combined with a preservative (e.g., trehalose).

[0080] Typically, the nanoparticles have an average effective diameter of less than 1 micron, e.g., the nanoparticles have an average effective diameter of about 25 nm to about 500 nm, e.g., about 50 nm to about 250 nm, about 100 nm to about 150 nm, or about 450 nm to 650 nm. Particle size (e.g., average effective diameter) can be assessed by methods known in the art, including, but not limited to, transmission electron microscopy (TEM), scanning electron microscopy (SEM), atomic force microscopy (AFM), photon correlation spectroscopy (PCS), nanoparticle surface area monitor (NSAM), condensation particle counter (CPC), differential mobility analyzer (DMA), scanning mobility particle sizer (SMPS), nanoparticle tracking analysis (NTA), X-ray diffraction (XRD), aerosol time-of-flight mass spectrometry (ATFMS), and aerosol particle mass spectrometry (APM).

[0081] Biodegradable nanoparticles can have a zeta potential that facilitates uptake by target cells. Typically, nanoparticles have a zeta potential greater than 0. In some embodiments, nanoparticles have a zeta potential of about 5 mV to about 45 mV, about 15 mV to about 35 mV, or about 20 mV to about 40 mV. Zeta potential can be determined by characteristics including electrophoretic mobility or dynamic electrophoretic mobility. Electrokinetic and electroacoustic phenomena can be used to calculate zeta potential.

[0082] In one embodiment, the non-viral delivery vehicle comprises poly(lactic-co-glycolic acid) (PLGA), polylactic acid (PLA), linear and / or branched PEI with different molecular weights (e.g., 2, 22, and 25 kDa), dendrimers such as polyamidoamine (PAMAM) and polymethacrylate, cationic liposomes, cationic emulsions, lipids including, but not limited to, DOTAP, DOTMA, DMRIE, DOSPA, distearoylphosphatidylcholine (DSPC), DOPE, or DC-cholesterol, peptide-based vectors including, but not limited to, poly-L-lysine or protamine, or polymers including, but not limited to, poly(β-amino ester), chitosan, PEI-polyethylene glycol, PEI-mannose-dextrose, DOTAP-cholesterol, or RNAiMAX.

[0083] In one embodiment, the delivery vehicle is poly(glycamidoamine) (PGAA), a glycopolymer-based delivery vehicle capable of complexing with various polynucleotide types and forming nanoparticles. These materials are prepared by polymerizing methyl ester or lactone derivatives of various carbohydrates (D-glucarate (D), meso-galactarate (G), D-mannarate (M), and L-tartrate (T)) with a series of oligoethyleneamine monomers (containing one to four ethyleneamines) (Liu and Reineke, 2006). A subset consisting of these carbohydrates and four ethyleneamines in the polymer repeat unit resulted in excellent delivery efficiency.

[0084] In one embodiment, the delivery vehicle comprises polyethyleneimine (PEI), polyamidoamine (PAMAM), PEI-PEG, PEI-PEG-mannose, dextran-PEI, OVA conjugate, PLGA microparticles, or PLGA microparticles coated with PAMAM, or any combination thereof. The disclosed cationic polymers may include, but are not limited to, polyamidoamine (PAMAM) dendrimers. Suitable polyamidoamine dendrimers for preparing the nanoparticles of the present disclosure may include third, fourth, fifth, or at least sixth generation dendrimers.

[0085] In one embodiment, the delivery vehicle comprises a lipid, such as N-[1-(2,3-dioleoyloxy)propan]-N,N,N-trimethylammonium (DOTMA), 2,3-dioleyloxy-N-[2-sperminecarboxamido]ethyl-N,N-dimethyl-1-propaneammonium trifluoracetate (DOSPA, Lipofectamine), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dimyristoloxy)propyl], N,N-dimethyl-N-(2-hydroxyethyl)ammonium bromide (DMRIE), 3-β-[N-(N,N'-dimethylaminoethane)carbamoyl]cholesterol (DC-Chol), dioctadecylamidoglyceryl spermine (DOGS, Transfectamine), or dimethyldioctadecylammonium bromide (DDAB). The positively charged hydrophilic head group of cationic lipids typically consists of monoamines such as tertiary and quaternary amines, polyamines, amidinium, or guanidinium groups. A series of pyridinium lipids have been developed (Zhu et al., 2008; van der Woude et al., 1997; Ilies et al., 2004). In addition to pyridinium cationic lipids, other types of heterocyclic head groups include imidazole, piperidine, and amino acids. The main function of the cationic head group is to condense negatively charged nucleic acids into slightly positively charged nanoparticles through electrostatic interactions, resulting in enhanced cellular uptake and endosomal escape.

[0086] Lipids with two linear fatty acid chains, such as DOTMA, DOTAP, and SAINT-2, or DODAC, can be used as delivery vehicles, as can tetraalkyl lipid chain surfactants, which are dimers of N,N-dioleyl-N,N-dimethylammonium chloride (DODAC). All trans-oriented lipids, regardless of their hydrophobic chain length (C 16:1 , C 18:1 , and C 20:1 ), which appear to enhance transfection efficiency compared to their cis-oriented counterparts.

[0087] The structures of cationic polymers useful as delivery vehicles include, but are not limited to, linear polymers such as chitosan and linear poly(ethyleneimine), branched polymers such as branched poly(ethyleneimine) (PEI), ring-like polymers such as cyclodextrin, network (cross-linked) polymers such as cross-linked poly(amino acids) (PAA), and dendrimers. Dendrimers consist of a central core molecule from which several highly branched arms "grow" to form a tree-like structure in a symmetric or asymmetric manner. Examples of dendrimers include polyamidoamine (PAMAM) and polypropyleneimine (PPI) dendrimers.

[0088] DOPE and cholesterol are neutral co-lipids commonly used to prepare cationic liposomes. Branched PEI-cholesterol water-soluble lipopolymer conjugates self-assemble into cationic micelles. Nonionic polymers such as Pluronic (poloxamer) and SP1017, a combination of Pluronic L61 and F127, can also be used.

[0089] In one embodiment, PLGA particles are used to increase encapsulation frequency, although complexation with PLL may also increase encapsulation efficiency. Other cationic materials, such as PEI, DOTMA, DC-Chol, or CTAB, can be used to create nanospheres.

[0090] In one embodiment, the complex is embedded in or applied to a material including, but not limited to, a hydrogel of poloxamer, polyacrylamide, poly(2-hydroxyethyl methacrylate), carboxyvinyl polymers (e.g., Carbopol 934, Goodrich Chemical Co.), cellulose derivatives such as methylcellulose, cellulose acetate, and hydroxypropylcellulose, polyvinylpyrrolidone or polyvinyl alcohol, or combinations thereof.

[0091] In some embodiments, the biocompatible polymeric material is derived from a biodegradable polymer such as collagen, e.g., hydroxylated collagen, fibrin, polylactic acid-polyglycolic acid, or a polyanhydride. Other examples include, but are not limited to, any biocompatible polymer (whether hydrophilic, hydrophobic, or amphiphilic), such as ethylene vinyl acetate copolymer (EVA), polymethyl methacrylate, polyamide, polycarbonate, polyester, polyethylene, polypropylene, polystyrene, polyvinyl chloride, polytetrafluoroethylene, N-isopropylacrylamide copolymer, poly(ethylene oxide) / poly(propylene oxide) block copolymer, poly(ethylene glycol) / poly(D,L-lactide-co-glycolide) block copolymer, polyglycolide, polylactide (PLLA or PDLA), poly(caprolactone) (PCL), or poly(dioxanone) (PPS).

[0092] In another embodiment, the biocompatible material includes polyethylene terephthalate, polytetrafluoroethylene, copolymers of polyethylene oxide and polypropylene oxide, combinations of polyglycolic acid and polyhydroxyalkanoate, gelatin, alginate, poly-3-hydroxybutyrate, poly-4-hydroxybutyrate, and polyhydroxyoctanoate, and polyacrylonitrile polyvinyl chloride.

[0093] In one embodiment, the following polymers may be used: natural polymers such as starch, chitin, glycosaminoglycans, e.g., hyaluronic acid, dermatan sulfate, and chlorotin sulfate; and microbial polyesters, e.g., hydroxyalkanoates, such as hydroxyvalerate and hydroxybutyrate copolymers; and synthetic polymers, including poly(orthoesters) and polyanhydrides, and homo- and copolymers of glycolide and lactide (e.g., poly(L-lactide), poly(L-lactide-co-D,L-lactide), poly(L-lactide-co-glycolide), polyglycolide and poly(D,L-lactide), poly(D,L-lactide-coglycolide), poly(collidine lactate), and polycaprolactone).

[0094] In one embodiment, the biocompatible material is derived from isolated extracellular matrix (ECM). ECM can be isolated from any organ or tissue source, including the endothelial layer of various cell populations, tissues, and / or organs, such as the skin, liver, digestive tract, respiratory tract, intestinal tract, urinary tract, or genital tract of warm-blooded vertebrates. The ECM used in the present invention can be from a combination of sources. The isolated ECM can be prepared as a sheet, in particulate form, gel form, etc.

[0095] Biocompatible scaffold polymers may include silk, elastin, chitin, chitosan, poly(d-hydroxy acid), poly(anhydride), or poly(orthoester). More specifically, biocompatible polymers include polyethylene glycol, poly(lactic acid), poly(glycolic acid), copolymers of lactic acid and glycolic acid, copolymers of lactic acid and glycolic acid with polyethylene glycol, poly(E-caprolactone), poly(3-hydroxybutyrate), poly(p-dioxanone), polypropylene fumarate, poly(orthoester), polyol / diketene acetal addition polymer, poly(sebacic anhydride) (PSA), poly(carboxybiscarboxyphenoxyphenoxy) The polymeric polymer may be formed from poly(amino acids), poly(pseudoamino acids), polyphosphazenes, derivatives of poly(dichloro)phosphazenes or poly(organo)phosphazenes, polyhydroxybutyric acid, or S-caproic acid, polylactide-co-glycolide, polylactic acid, polyethylene glycol, cellulose, oxidized cellulose, alginate, gelatin, or derivatives thereof.

[0096] Thus, the polymer may be formed from any of a wide range of materials, including polymers comprising naturally occurring polymers, synthetic polymers, or combinations thereof. In one embodiment, the scaffold comprises a biodegradable polymer. In one embodiment, a naturally occurring biodegradable polymer may be modified to provide a synthetic biodegradable polymer derived from a naturally occurring polymer. In one embodiment, the polymer is poly(lactic acid) ("PLA") or poly(lactic-co-glycolic acid) ("PLGA"). In one embodiment, scaffold polymers include, but are not limited to, alginate, chitosan, poly(2-hydroxyethyl methacrylate), xyloglucan, copolymers of 2-methacryloyloxyethyl phosphorylcholine, poly(vinyl alcohol), silicone, hydrophobic and hydrophilic polyesters, poly(lactide-co-glycolide), N-isopropylacrylamide copolymers, poly(ethylene oxide) / poly(propylene oxide), polylactic acid, poly(orthoesters), polyanhydrides, polyurethanes, copolymers of 2-hydroxyethyl methacrylate and sodium methacrylate, phosphorylcholine, cyclodextrin, polysulfone and polyvinylpyrrolidine, starch, poly-D,L-lactic acid-para-dioxanone-polyethylene glycol block copolymer, polypropylene, poly(ethylene terephthalate), poly(tetrafluoroethylene), poly-epsilon-caprolactone, or cross-linked chitosan hydrogels.

[0097] Alternatively, the nucleic acid or vector can be administered at a dosage of at least about 0.0001 mg / kg to about 1 mg / kg, at least about 0.001 mg / kg to about 0.5 mg / kg, at least about 0.01 mg / kg to about 0.25 mg / kg, or at least about 0.01 mg / kg to about 0.25 mg / kg body weight, although other dosages may provide beneficial results.

[0098] Alternatively, the nucleic acid or vector can be administered at a dosage of at least about 0.0001 mg / kg to about 1 mg / kg, at least about 0.001 mg / kg to about 0.5 mg / kg, at least about 0.01 mg / kg to about 0.25 mg / kg, or at least about 0.01 mg / kg to about 0.25 mg / kg body weight, although other dosages may provide beneficial results.

[0099] Illustrative Embodiments In one embodiment, a gene therapy vector is provided, comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame for a gene product useful for prevention or treatment and a 3' untranslated region (3'UTR), wherein the vector further comprises a first transcriptional regulatory region 3' to the nucleic acid sequence, which, when present in the transcribed RNA, can interact with a small interfering RNA (siRNA) sequence, thereby inhibiting translation of the transcribed RNA or promoting degradation of the transcribed RNA, thereby inhibiting expression of the gene product; and / or the vector further comprises a second transcriptional regulatory region 5' to the nucleic acid sequence, which, when present in the transcribed RNA, can interact with a small activating RNA (saRNA) sequence, thereby enabling translation of the transcribed RNA, thereby allowing expression of the gene product. In one embodiment, the vector has the first transcriptional regulatory region but does not have the second transcriptional regulatory region. In one embodiment, the vector has the second transcriptional regulatory region but does not have the first transcriptional regulatory region. In one embodiment, the vector has a first and a second transcriptional regulatory region. In one embodiment, the vector is a viral vector. In one embodiment, the viral vector is an AAV vector, an adenoviral vector, a lentiviral vector, a herpesvirus vector, or a retroviral vector. In one embodiment, the second transcriptional regulatory region forms at least one hairpin structure. In one embodiment, interaction between the saRNA and the second transcriptional regulatory region exposes a ribosome binding site. In one embodiment, the second transcriptional regulatory region forms 1 to 3 or 2 to 5 different hairpins. In one embodiment, the second transcriptional regulatory region forms at least one hairpin that overlaps with the ribosome binding site and / or the first AUG in the transcribed RNA. In one embodiment, the second transcriptional regulatory region comprises a toehold sequence. In one embodiment, the first transcriptional regulatory region comprises more than one nucleotide sequence that can bind to more than one different siRNA upon transcription into RNA.In one embodiment, the first transcriptional regulatory region comprises a nucleotide sequence capable of binding to multiple siRNAs upon transcription into RNA. In one embodiment, the nucleotide sequence has multiple siRNA binding sites for the same siRNA. In one embodiment, the open reading frame encodes a therapeutic RNA, a therapeutic antibody, an anti-oncogene product, a complement factor, an interleukin, a cytokine, or a hormone. In one embodiment, the gene product comprises an anti-EGFR antibody, an anti-VEGF antibody, an anti-VEGFR antibody, alpha-1-antitrypsin, catalase, superoxide dismutase, factor 9, IL-2R, adenosine deaminase (ADA), WAS, beta-globin, ABCD1, an anti-CD19 antibody, or an FK506 binding protein. In one embodiment, the vector comprises at least one copy of SEQ ID NOs: 1-3, 7-9, or 17-20, or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 94%, 95%, 98%, or 99% nucleotide sequence identity thereto. In one embodiment, the siRNA or miRNA sequence for inhibiting or activating RNA expressed from the vector comprises at least one copy of SEQ ID NO: 4-6 or 12-16, or a nucleotide sequence having at least 80%, 85%, 90%, 92%, 94%, 95%, 98%, or 99% nucleotide sequence identity thereto.

[0100] Further provided is a host cell comprising the vector. In one embodiment, the cell is a mammalian cell. In one embodiment, the cell is a human cell. In one embodiment, the cell is a host organism. In one embodiment, the host organism is a mammal. In one embodiment, the mammal is a non-human primate. In one embodiment, the mammal is a human.

[0101] Further provided is a method for regulating expression of a gene therapy vector in a mammal. The method includes providing a mammal having a gene therapy vector and administering to the mammal an amount of a composition comprising a nucleic acid comprising a sequence for an siRNA and / or saRNA effective to modify expression of a gene product encoded by the vector. In one embodiment, the open reading frame encodes a protein. In one embodiment, the open reading frame encodes a therapeutic RNA. In one embodiment, the gene product is a therapeutic antibody, hormone, cytokine, interleukin, or ribozyme. In one embodiment, the composition comprises an RNA, optionally with one or more nucleotide analogs. In one embodiment, the composition comprises a DNA vector having a sequence corresponding to an siRNA sequence or saRNA sequence. In one embodiment, the composition comprises a plurality of different siRNAs. In one embodiment, the composition comprises a plurality of different saRNAs.

[0102] Also provided is a method for regulating expression of a gene therapy vector in a mammal, comprising: introducing the gene therapy vector into the mammal; and administering to the mammal an amount of a composition comprising a nucleic acid comprising a sequence for siRNA and / or saRNA effective to alter expression of a gene product encoded by the vector. In one embodiment, the composition comprises a liposome comprising the nucleic acid. In one embodiment, the composition comprises a nanoparticle comprising the nucleic acid. In one embodiment, the composition comprises a protein complex comprising the nucleic acid. In one embodiment, the composition is administered systemically. In one embodiment, the composition is administered orally. In one embodiment, the composition is administered intravenously. In one embodiment, the composition is administered topically. In one embodiment, the composition is injected. In one embodiment, the composition is a sustained-release composition. In one embodiment, the vector is administered intravenously. In one embodiment, the vector is administered topically.

[0103] In one embodiment, a vector is provided having homology arms flanking a second transcriptional regulatory region capable of interacting with a small activating RNA (saRNA) sequence when present in the transcribed RNA, the homology arms having a sequence corresponding to a gene therapy vector sequence flanking a site for insertion of the second transcriptional regulatory region. In one embodiment, the site for insertion is 3' to the promoter and 5' to the open reading frame of a prophylactic or therapeutic gene product.

[0104] In one embodiment, a vector is provided having homology arms flanking a first transcriptional regulatory region that can interact with a small interfering RNA (siRNA) sequence when present in the transcribed RNA, the homology arms having a sequence corresponding to a gene therapy vector sequence adjacent to a site for insertion of the first transcriptional regulatory region. In one embodiment, the site for insertion is 3' to the open reading frame of a prophylactic or therapeutic gene product and 5' to the 3' end of the 3'UTR.

[0105] The present invention is further illustrated by the following non-limiting examples. [Example]

[0106] Example 1 Figures 1 and 3 show vectors for turning off expression by inserting an siRNA recognition site into the 3'UTR of the vector construct. In one embodiment, the insertion into the 3'UTR is a sequence that is universal to all vector constructs, e.g., a highly specific sequence with no off-target sequences. Inhibition of mRNA degradation and protein expression depends on the presence of sufficient inhibitory siRNA. In one embodiment, inhibition can be increased by incorporating one or more siRNA target sequences, e.g., 2-10 copies. Expression is turned off only in the presence of the targeting siRNA.

[0107] Figure 2 illustrates a vector for turning on expression. For example, toehold switches are found in bacteria and used in synthetic biology (e.g., as sensors for viral mRNA or miRNA). A stable hairpin overlapping the ribosome binding site and / or AUG start codon blocks protein expression. The inclusion of, for example, one to three hairpins ensures that there is no leaky expression without a trigger RNA. Binding of the trigger RNA (e.g., approximately 23-30 nt in length) releases the hairpin, allowing ribosome binding and expression to proceed. Thus, expression is "on" in the presence of the trigger RNA.

[0108] This provides gene therapy vectors with transgene expression levels that can be adjusted by applying exogenous small RNA.The transgene expression from gene therapy vectors can be increased or decreased by applying exogenous small RNA.RNA recognition sequences can be constructed in the 5' and / or 3' UTR of the vector transgene product and can be universal for all transgenes.The advantages of adjustable transgene expression include, for example, turning on expression for a limited time only, or turning off expression for, for example, improving safety or reducing toxicity, and using a combination of on switch and off switch in the same vector.

[0109] Example 2 Figure 5 shows a vector for regulatable EPO expression. Vector-derived hEPO promotes red blood cell production, and the CAG promoter constitutively expresses EPO. The targeting site allows for exogenous siRNA knockdown of vector-derived EPO expression, allowing regulation of EPO and hematocrit levels.

[0110] Exemplary target sites include, but are not limited to, siRNAs that score better than 99.99% and 99.67% in the siSPOTR algorithm and have seed sequences that match only 12-13 / 21 nucleotides in either the human or mouse genome, for example.

[0111] Exemplary target sequences in vectors are shown below. Target 1: AAGATCGTCGTCGTAAGCGCGTAA (SEQ ID NO: 1) Target 2: AAGTTACGCGACTTACGCGAT (SEQ ID NO: 2) Target 3: ACGATCGTTCATATCGCGTAT (SEQ ID NO: 3)

[0112] Exemplary siRNAs delivered in trans, for example for targets 1-3, are as follows: siRNA1: GAUCGUCGUAAGCGCGUAAuu (sense) (SEQ ID NO: 4) siRNA2: GUUACGCGACUUACGCGAUuu (sense) (SEQ ID NO: 5) siRNA3: GAUCGUUCAUAUCGCGUAUuu (sense) (SEQ ID NO: 6)

[0113] Exemplary targets 4-6 may be used in systems using miRNA, for example, for miRNA expressed by AAV / Ad (see, e.g., Figures 4 and 10). Target 4: CTATTGACGTATGACGCGTAA (SEQ ID NO: 7) Target 5: CAATCCATCATTACGCGTTAA (SEQ ID NO: 8) Target 6: CAATCCATCAATTACGCGTTA (SEQ ID NO: 9)

[0114] For on-switch purposes (Figure 2), the exemplary sequence of triggering hairpin may be the same as the siRNA for inhibition (targets 1-3, siRNAs 1-3).

[0115] Using the same criteria, two potential negative control siRNAs were designed (excluding any with seed sequences similar to the targeting siRNA). Control siRNA1: AAGATCCCGATTGTCGATCGT (SEQ ID NO: 10) Control siRNA2: ACGTCGTACGTTACCGTACGA (SEQ ID NO: 11)

[0116] Example 3 The vector was formulated for therapeutic use to prevent severe reactions (anaphylaxis) mediated by type I hypersensitivity responses linked to allergen-specific immunoglobulin E (IgE) (Pate et al., 2010; Burton & Oettgen, 2011; Wu & Zarrin, 2014) (Figure 8). The IgE-allergen complex activates mast cells and basophils, releasing mediators responsible for the anaphylactic response to the allergen (Pate et al., 2010; Burton & Oettgen, 2011; Wu & Zarrin, 2014). The current therapy for preventing the induction of anaphylaxis by allergen-specific IgE is omalizumab (Xolair®), a recombinant DNA-derived humanized IgG1K monoclonal antibody that binds to human immunoglobulin E (IgE) (Babu et al., 2013). It inhibits IgE binding to IgE receptors (FcεRI) on the surface of mast cells and basophils, suppressing the release of mediators of the allergic response from FcεRI-bearing cells (Holgate et al., 2005). Circulating IgE antibodies, when bound to anti-IgE, are unable to bind to specific high-affinity Fc receptors, resulting in the removal of the IgE-bound anti-IgE complex from the circulation (Babu et al., 2013). Although omalizumab is effective (Babu et al., 2013, Leung et al., 2003, Schneider et al., 2013, Shikh & Burks, 2013), its use as a prophylactic agent is challenging because the protection provided by a single dose is short (2–4 weeks) and monthly parenteral administration is required to maintain sustained, effective therapy (Lowe et al., 2009, Lieberman & Chehade, 2013). As a strategy to avoid the requirement for repeated administration, a single dose of omalizumab-encoding serotype rh.10 adeno-associated virus (AAV) (AAVrh.10 anti-IgE) results in long-term expression of anti-IgE and protects against allergen-specific induced allergic responses. NOD-scid IL2Rgamma reconstituted in peanut-specific human blood mononuclear cells (HCMs) is a novel vector. nullWe used immunodeficient mice to create a humanized mouse model of human IgE-mediated anaphylaxis in response to peanut (Pagovich et al., 2016). In these mice, total and peanut-specific IgE levels were generated after engraftment of mononuclear cells from peanut-allergic individuals, and peanut-specific anaphylaxis was induced by mediator release after challenge with peanut extract. A single dose of Vector07 provided persistent protection against peanut-induced severe allergy, whether administered as a prophylactic agent before peanut sensitization or as a therapeutic agent after mice exhibited symptoms associated with peanut-induced anaphylaxis (Figure 9).

[0117] In one embodiment, the present disclosure provides a vector with an "off switch" that, for example, shuts down anti-IgE expression acutely (e.g., to address anaphylaxis) and chronically (e.g., to address parasitic infection). The "off switch" strategy is based on embedding in the therapeutic expression cassette a sequence that is responsive to a microRNA (miRNA) that shuts down anti-IgE expression directed by vector 07. To enable both rapid and sustained shutoff of anti-IgE expression, vector 07 was modified into vector 07A (vector 7A, AAVrh.10h anti-IgE-T; FIG. 10) to contain five tandem repeats of a 21-bp miRNA target sequence 3' to the anti-IgE coding sequence. The design of Vector 07A and its cognate miRNA delivery vectors (Vector 09A and Vector 09B (Figure 10)) was based on the identification of a unique 21-bp miRNA target site not present in the human or mouse genome using the algorithms of Boudreau et al. (2013) and Birmingham et al. (2007). This unique target has a greater than 99.99% probability of being free of off-target effects. In one embodiment, two gene transfer "off" vectors were designed to shut down Vector 07A-mediated expression of anti-IgE. Following IV administration, these vectors target the liver and express effector miRNAs that bind to their cognate targets in the mRNA produced by Vector 07A, thereby identifying the mRNA for destruction and blocking Vector 07A-mediated expression of anti-IgE. To rapidly shut down anti-IgE expression from vector 07A, we use vector 09A (AdC7miRNA-E), a serotype C7 adenovirus (AdC7) vector that encodes a miRNA that is cognate to the vector 07A miRNA target.AdC7 is effective despite the immunity induced by vector 07A because there is no cross-reactivity between Ad and AAV vectors due to the absence of homologous epitopes (Blacklow et al., 1967; McCaffrey et al., 2008; De et al., 2008). AdC7 is derived from chimpanzees, to which the human population has no pre-existing immunity (Zhi et al., 2006; Roy et al., 2004; Basnight et al., 1971; Reyes-Sandoval et al., 2004). Based on the known pharmacokinetics of Ad vectors, after IV administration, vector 09A rapidly shuts down vector 07A-mediated hepatocyte expression of anti-IgE, thereby expressing its cognate miRNA in the liver within 8 hours (McCaffrey et al., 2008; De et al., 2008; Wen et al., 2000). To permanently shut down anti-IgE expression from vector 07A (AAVrh.10 anti-IgE-T), we used vector 09B (AAVSmiRNA-E), a serotype 5 AAV vector that effectively expresses effector miRNAs despite prior anti-AAVrh.10 immunity induced by prior administration of vector 7A (AAVrh.10 vector) (De et al., 2006). The capsids of AAVrh.10 and AAV5 are derived from sufficiently distinct clades that prior immunity to AAVrh.10 does not interfere with normal expression from the AAV5-based vector (vector 09B) used to shut down anti-IgE expression from vector 07A (Sondhi et al., 2007; Gao et al., 2004; Piguet et al., 2012). Finally, the combination of Vector 09A and Vector 09B together shuts down Vector 07A acutely and chronically, for example, permanently shutting down anti-IgE expression starting 8 hours after administration and indefinitely.

[0118] In one embodiment, the rAAV comprises an rAAV genome encoding a gene of interest, such as an antibody, such as anti-IgE or anti-Siglec, containing an AAV8, AAV9, AAV5, AAV2, or AAVrhlO capsid. The rAAV genome may be of any AAV serotype, including, but not limited to, the AAV8, AAV9, AAV5, AAV2, or AAVrhlO genome. In one embodiment, the second viral vector expresses siRNA in the form of shRNA or saRNA (trigger RNA) as miRNA. In one embodiment, rAAV containing an AAV8, AAV9, AAV5, AAV2, or AAVrhlO capsid may be administered, followed by rAAV4 or rAAV5. In one embodiment, after administration of the rAAV, a non-AAV viral vector, such as an adenovirus, lentivirus, herpesvirus, or retrovirus vector, is administered.

[0119] In one embodiment, the recombinant adenovirus, lentivirus, herpesvirus or retrovirus is used to encode gene of interest.In one embodiment, the second viral vector expresses siRNA in the form of shRNA or saRNA as miRNA.In one embodiment, after administering recombinant adenovirus, lentivirus, herpesvirus or retrovirus vector, can be administered with a second heterologous viral vector, for example, rAAV8, rAAV9, rAAV5, rAAV2 or rAAVrh10 vector.

[0120] Example 4 introduction Allergens are the primary cause of a significant number of fatal and near-fatal anaphylactic reactions in the United States (Sheikh & Burks, 2013; Liu et al., 2010). Individuals with severe allergies exhibit itching, hives, swelling, eczema, airway narrowing, abdominal pain, hypotension, and anaphylaxis upon exposure to sensitized allergens (Simons et al., 2011; Taylor et al., 2010). Allergen-induced anaphylaxis can include vomiting, diarrhea, abdominal pain, angioedema, laryngeal edema, bronchospasm, lower airway obstruction, hypotension, loss of consciousness, and sometimes death (Simons et al., 2011; Taylor et al., 2010). Most allergies begin in childhood, and many do not remit with age (Sheikh & Burks, 2013; Sampson, 2013). Affected individuals must strictly avoid allergens and have ready access to an epinephrine auto-injector (Schneider et al., 2013; Simons et al., 2011; Du et al., 2015; Sicherer et al., 2010). The only available therapies are epinephrine, desensitization, or acute use of anti-IgE monoclonal antibodies. Although the anti-IgE monoclonal omalizumab is effective, there are several reasons why Vector 7A is preferred, including: (1) anti-IgE monoclonals must be administered every 2–4 weeks (Lowe et al., 2009), whereas treatment with Vector 07A is a single dose; (2) systemic administration of anti-IgE monoclonals produces immediately high anti-IgE levels, but these subsequently decline and the protection offered diminishes over time; in contrast, serum anti-IgE levels produced by Vector 07A are constant and have more optimal pharmacokinetic properties; and (3) the requirement for repeated administration of anti-IgE monoclonals increases the cost of care, requires repeated parenteral administration by healthcare providers, and is inconvenient for the treated individual.

[0121] Exemplary Vectors and Methods One-time treatment with Vector 07A obviates the risk of repeated severe allergic reactions. To ensure the safety of Vector 07A, an "off switch" for AAV-mediated gene therapy was used. This strategy is useful not only for Vector 07A anti-IgE gene therapy, but also as a platform that can be used to shut down any gene therapy using miRNA targets engineered into expression cassettes.

[0122] Vector 07A (AAVrh.10 anti-IgE-T) is a non-human primate serotype rh.10 AAV vector that expresses omalizumab under the control of a CAG-highly active constitutive promoter. It is identical to vector 07 but contains five tandem repeats of a 21-bp sequence (3' of the omalizumab anti-IgE heavy and light chain coding sequences) that serve as targets for the miRNAs expressed by vectors 09A and 09B (Figure 11). The 21-bp target and its cognate miRNA are unique sequences not present in the mouse or human genome. After IV administration, over 90% of vector 07A is expressed in the liver, an organ highly efficient for the expression and secretion of AAV vector-mediated gene therapy products (Pagovich et al., 2016; Mingozzi & High, 2011; Sands, 2011; van der Laan et al., 2011). The safety of AAVrh.10 administration has been demonstrated in experimental animals (Piguet et al., Rosenberg et al., 2018; Sondhi et al., 2012; Chiuchiolo et al., 2013; Rosenberg et al., 2014; Zerah et al., 2015) and humans (BB-IND1539). Omalizumab is an FDA-approved anti-IgE IgG1k monoclonal antibody (trade name Xolair®, patent-expired US 2001 / 6329509) that specifically binds to free and membrane-bound IgE on the surface of lymphocytes (Chang et al., 2007; Schulman, 2001). Candidate patients for Vector 07A will first be tested with omalizumab to determine whether they are at risk for anaphylaxis, which occurs most frequently with the first dose (Lieberman & Chehade, 2013; Kim et al., 2010). As an additional safety strategy, two Vector 07A "off-switch" vectors will be prepared that mediate rapid and sustained shutdown of the therapeutic AAVrh.10 vector, which mediates sustained liver hepatocyte expression of anti-IgE. Vector 07A, based on its cognate miRNA, has an embedded miRNA target sequence that shuts down anti-IgE expression if necessary due to safety concerns (Figure 11).Vector 09A is a serotype C7 Ad that encodes a cognate miRNA that is expressed in liver hepatocytes upon IV administration and rapidly shuts down anti-IgE expression mediated by Vector 7A. Vector 09B is a serotype 5 MV that encodes the same cognate miRNA that is expressed in liver hepatocytes upon IV administration and persistently shuts down anti-IgE expression. Vectors 09A and 09B are not product-specific, and they can be used in any gene therapy-based treatment strategy where the ability to block expression is an important safety feature, as long as the miRNA target sequence is engineered into the treatment vector.

[0123] Fifteen million people in the United States have food allergies (Branum & Lukacs, 2010, Gupta, 2011, Liu et al., 2010). Allergies to peanuts, tree nuts, fish, and shellfish are generally lifelong (Skripak et al., 2007, Savage et al., 2010, Savage et al., 2007, Keet et al., 2009, Sicherer et al., 2004). In children, food allergies result in 300,000 outpatient care unit visits and 9,500 hospitalizations per year (Branum & Lukacs, 2010). There are 200,000 emergency department visits per year for food allergic reactions, and food allergies are a leading cause of anaphylaxis (Sampson, 2003; Clark et al., 2011). Insect sting allergies affect 5% of the US population, and 90-100 deaths per year are attributed to insect sting anaphylaxis. The advantage of Vector 07A is that it is a one-time treatment and significantly reduces the incidence of severe allergic reactions.

[0124] Therefore, vector 07A gene therapy requires only a single administration to provide sustained protection from anaphylaxis resulting from allergen challenge. This can be applied to any IgE-mediated allergy. The development of vector 07A with an off-switch targeting sequence, as well as vectors with rapid (vector 09A) and sustained (vector 09B) "off switches," is common in AAV drug discovery.

[0125] Preliminary research The efficacy of Vector 07 was demonstrated in a humanized model of peanut allergy. Vector 07A is identical to Vector 07 except for an additional miRNA off-target sequence 3' to the anti-IgE sequence. To demonstrate the function of this unique 21-bp miRNA target in Vector 07A, we designed a plasmid with the same promoter (CAG) as Vector 07A but containing a reporter gene followed 3' by an effector miRNA (miRNA-E) (Fowler et al., 2016) derived from a modified miR155-based backbone in which the guide strand was replaced by a sequence complementary to the unique kDa targeting site in Vector 07A. Transfection of the plasmid into 293T cells using siRNA (sequences identical to those of the miRNAs expressed by Vector 09A and Vector 09B) demonstrated greater than 99% suppression of reporter gene mRNA expression (Figure 11).

[0126] AdC7Vector 09A (AdC7miRNA-E, Figure 10) is based on the chimpanzee AdC7 vector (Roy et al., 2004, Krause et al., 2013, Zhi et al., 2005). AdC7 is not recognized by anti-AAV neutralizing antibodies. The construction and production of the AdC7 vector was as described in Zhi et al. (2005) and Worgall et al. (2005). AAV5. Vector 09B (AAVSmiRNA-E; Figure 10) was constructed and produced as described by De et al. (De et al., 2006). Efficacy of AAV5 in the context of anti-AAVrh.10 immunization. One challenge of in vivo gene therapy is that administration of an AAV vector induces neutralizing immunity to the AAV capsid, rendering repeated administration of the same or similar capsid ineffective. Neutralizing anti-capsid immunity prevents repeated administration of the capsid from reaching its cognate receptor. This can be circumvented by seroswitching, i.e., using a capsid from a different clade. This approach has been successful for Ad71 and AAV vectors (Gao et al., 2002; Davidoff et al., 2005), including the demonstration of efficient expression by AAV5 vectors in the context of AAVrh.10 neutralizing immunity (see Figure 6 in De et al. (2006)).

[0127] Coadministration of Ad and AAV vectors to mediate rapid and sustained expressionWhile AAV vectors provide sustained expression after a single administration, the onset of expression is approximately one week, insufficient to provide the acute treatment required to block vector 07A anti-IgE expression in the context of anti-anti-IgE-induced anaphylaxis. In contrast, the onset of expression for Ad-based vectors is 8 hours (McCaffrey et al., 2008; Wen et al., 2000; Chu et al., 2019; Greenberg et al., 2020). To provide rapid and sustained blockade of vector 07A, coadministration of vector 09A (AdC7) and vector 09B (AAV5) was used to provide rapid and sustained expression of miRNA-E. As discussed above, Ad vectors are not visible to AAV vector-induced immunity, and AAV5 vectors effectively express their transgenes in the context of anti-AAVrh.10 immunity (De et al., 2006). Co-administration of Ad and AAV vectors provides rapid and sustained expression of the same transgene ( De et al., 2008 ).

[0128] test Vector 07 was modified to contain a target miRNA that responds to an AdC7 (rapid) and / or AAV5 (persistent) "off switch" that shuts down vector 07 A-mediated liver hepatocyte expression of anti-IgE, resulting in vector 07A. A summary of the study is in Table I, followed by study details.

[0129] Inspection of Vector 07A Regarding the properties of Vector 07 A and Vector 07, after IV administration (2 doses each), mice will be evaluated at weeks 4 and 8 for equivalence (±20%) of liver anti-IgE mRNA and serum anti-IgE protein levels (see Pagovich et al. (2016) for details).

[0130] Testing Vector 09A and Vector 09BVector 09A and Vector 09B were tested for hepatic expression of the effector miRNA by TaqMan quantification of liver homogenates. Evaluations were performed 1 day, 1 week, 4 weeks, and 8 weeks after administration. Based on Ad and AAV vectors, Vector 09A (AdC7 mCherry-miRNA-E) was expressed on day 1 (8 hours), peaked on day 7, and was less than 5% of its peak at 4 weeks. Vector 09B (AAV5EGFP-miRNA-E) was 75% expressed by week 2, 100% expressed by weeks 3–4, and then sustained expression at the same level.

[0131] Vector Blockade (Shutdown of Vector 07 A-mediated expression of anti-IgE). Four weeks after Vector 07 A administration, when anti-IgE mRNA (liver) and protein (serum) levels have stabilized (Pagovich et al., 2016), a test to shut down Vector 07 A expression is performed by IV administration of either an acute off-vector (Vector 09A) or a sustained off-vector (Vector 09). Assessment of "off" success includes liver anti-IgE mRNA (TaqMan) and serum anti-IgE protein (ELISA) levels that are less than 10% of those of Vector 07 A alone. To verify that the Vector 09A miRNA product is expressed in the same liver cells as the Vector 07A anti-IgE product, livers at each time point are evaluated for Vector 07A mRNA (in situ hybridization) (Chu et al., 2019; Greenberg et al., 2020) and the marker genes (mCherry or EGFP) expressed by Vector 09A (mCherry) or Vector 09B (EGFP, both assessed by immunofluorescence) (Fe et al., 2017).

[0132] The "off" vectors, Vector 09A (AdC7-based) and Vector 09B (AAV9-based), were designed to function in the context of anti-AAVrh.10 immunity elicited by administration of Vector 07A, a therapeutic vector (based on AAVrh.10). To assess immunity elicited by all vectors, neutralizing antibodies against AAVrh.10, AdC7, and AAV5 were assessed at all time points (De et al., 2006; Rosenberg et al., 2018; Sondhi et al., 2012; Wang et al., 2014).

[0133] Detailed Method Vector 07, 7A, and 9A AAVrh.10 vectors and vector 09A AdC7 vectors were produced, purified, and tested as previously described (De et al., 2008, De et al., 2006, Sondhi et al., 2007, Rosenberg et al., 2018, Krause et al., 2011). For liver anti-IgE mRNA (TaqMan) and serum anti-IgE (ELISA), see Pagovich et al. (2016). Liver hepatocyte coexpression of the transgene is assessed by anti-IgE in situ hybridization, mCherry, and EGFP immunofluorescence (Fe et al., 2017). Serum neutralizing antibodies against AAVrh.10, AdC7, and AAV5 are assessed in vitro by capsid marker gene expression (De et al., 2006, Rosenberg et al., 2018).

[0134] Table I. Mouse studies for testing Vector 07A, Vector 09A, and Vector 09B 1 TIFF2025170347000001.tif221117

[0135] All studies were performed in 6- to 8-week-old CS7Bl / 6 mice; PBS (phosphate-buffered saline) control for all three objectives; 2See Figure 10 for vector description; vector or PBS was administered IV in 100 μl via the tail vein; 3 Doses for Vector 07, Vector 07A, and Vector 09B (all AAV vectors) are in genome copies; doses for Vector 09A (Ad vector) are in particles; for Objectives 1 and 2, two doses are tested; for Objective 3, the optimal dose for Objectives 1 and 2 is used; 4 For each time point, each dose and each vector (or PBS) has n = 5 males and 5 females. For Objective 1, evaluation time points are 4 and 8 weeks post-dose; for Objective 2, 1 day, 1 week, 4 weeks, and 8 weeks post-dose; for Objective 3, 4 weeks after Vector 07, then 1 day, 1 week, 4 weeks, and 8 weeks after the second vector; for PBS control, pre-dose; 4 weeks and 1 day after the first dose; and 4 and 8 weeks. The "Day 1" evaluation for Vector 09A "Off" is at 8 hours (AdC7 vector expression is at 8 hours and peaks at day 7); 5 Aim 1 - liver anti-IgE mRNA, serum anti-IgE protein, serum neutralizing antibodies: Aim 2 - liver miRNA-E, serum neutralizing antibodies: Aim 3 - all parameters; PBS - all parameters.

[0136] statisticsStatistical analysis is performed using repeated measures ANOVA (see Table I) applied to each assay separately, with factors for repeated measures of dose, sex, and time of assessment. Appropriate a priori contrasts are then considered to assess primary hypotheses. For example, a single contrast (for anti-IgE mRNA, protein, in situ anti-IgE, and antibody) within 4 and 8 weeks and for both combinations is used to identify any significant differences between Vector 07A and Vector 07 compared to PBS, as well as to predict any dose-related effects. Similar approaches are taken (e.g., for miRNA-E, hepatocyte mCherry, and EGFP assays) to assess differences in dose and to assess hypotheses about expected time courses (e.g., expected levels of Vector 09A are significantly higher than Vector 09B at day 1 and week 1, but the reverse is true for weeks 4 and 8). In a separate study, appropriate contrasts will be used to assess differences compared to PBS, comparing before and after second vector evaluation at different time points to assess significant changes in anti-IgE assays for Vector 09A (e.g., expected to be higher at day 1, week 1 with Vector 07A "off"), Vector 09B (elevated at weeks 4, 8 with Vector 07A "off"), and Vector 09A + Vector 09B (elevated at all time points with second vector / Vector 07A "off"). Considering the anti-IgE levels from administration of Vector 07 (e.g., see Figure 9), and assuming similar test vector expression, the sample size (e.g., 5 M / F mice per dose per time point) will make these contrasts sufficiently powered to detect significant effects of treatment.

[0137] The number of repeats may be reduced from 8 to 6, 4, or 2. If shutting down of Vector 07A is not complete, additional unique target and effector miRNA combinations can be added to Vector 07A and Vector 09A, Vector 09B, respectively.

[0138] Mice are treated as 8-week-old adults and evaluated at weeks 4 and 8, as well as at days 1, 1, 4, and 8, and at several time points after treatment with AAV and / or Ad. AAVrh.10, AAV5, and AdC7 are administered at two doses (1 x 10 10 and 1 × 10 11 gc), followed by one dose. For example, two vectors (Vector 07, Vector 07A) x 2 doses x 10 mice (5 M / 5 F) / dose x 2 time points are used, or two vectors (Vector 09A, Vector 09B) x 2 doses x 10 mice (5 M / 5 F) / dose x 4 time points are used, or four treatment groups x 1 dose x 5 time points x 10 mice (5 M / 5 F) / time point, plus a PBS control group.

[0139] Administration of AAV and Ad vectors involves a non-surgical intravenous delivery route via the tail vein into mice. Briefly, mice are warmed (using a heat lamp) to induce venous dilation and increase the ease of vascular access. The mouse is placed in a restrainer to allow access to the lateral tail vein. The tail is cleaned with sterile alcohol wipes prior to injection. An insulin 28G needle is aimed into the lateral tail vein and the injection solution (AA V, Ad, or PBS) is slowly administered, ensuring no swelling is detected cranial to the injection site. After withdrawing the needle from the vein, pressure is applied to the injection site with gauze (or similar material) for approximately 30 seconds to prevent hematoma formation and ensure hemostasis is achieved.

[0140] Exemplary sequences of the target sites and miRNAs for the vectors described in Figures 4 and 10 are as follows, where the miRNAs are derived from a modified mir155 scaffold described in Fowler et al. (2016): miRNA1: CTGGAGGCTTGCTTTGGGCTGTATGCTGTTACGCGTCATACGTCAATAGGTTTTGGCCACTGACTCGACTTATGATTATGACGCGTAACAGGACACAAGGCCCTTTATCAGCACTCACATGGAACAAATGGCCACCGTGGGAGGATGACAA(sequence number 12) miRNA2: CTGGAGGCTTGCTTTGGGCTGTATGCTGTTACGCGTCATACGTCAATAGGTTTTGGCCACTGACTCGACTTATTATGATGACGCGTAACAGGACACAAGGCCCTTTATCAGCACTCACATGGAACAAATGGCCACCGTGGGAGGATGACAA(sequence number 13) miRNA3: CTGGAGGCTTGCTTTGGGCTGTATGCTGTTTAACGCGTAATGATGGATTGGTTTTGGCCACTGACTCGACTAATTATATTACGCGTTAACAGGACACAAGGCCCTTTATCAGCACTCACATGGAACAAATGGCCACCGTGGGAGGATGACAA(sequence number 14) miRNA4: CTGGAGGCTTGCTTTGGGCTGTATGCTGTTTAACGCGTAATGATGGATTGGTTTTGGCCACTGACTCGACTAATCATTTTACGCGTTAACAGGACACAAGGCCCTTTATCAGCACTCACATGGAACAAATGGCCACCGTGGGAGGATGACAA(sequence number 15) miRNA5: CTGGAGGCTTGCTTTGGGCTGTATGCTGTAACGCGTAACGCGTAATTGATGGATTGGTTTTGGCCACTGACTGACTAATTATAATTACGCGTTACAGGACACAAGGCCCTTTATCAGCACTCACATGGAACAAATGGCCACCGTGGGAGGATGACAA(sequence number 15) miRNA6: CTGGAGGCTTGCTTTGGGCTGTATGCTGTAACGCGTAATTGATGGATTGGTTTTGGCCACTGACTCGACTAATCATTATTACGCGTTACAGGACACAAGGCCCTTTATCAGCACTCACATGGAACAAATGGCCACCGTGGGAGGATGACAA (SEQ ID NO: 16)

[0141] An exemplary sequence of the hairpin for the on switch shown in FIG. 2 is as follows: Hairpin 1A AAAAGATCGTCGTAAGCGCGTAATTTTCCATCAAGAACAGGCCACCATGGAAAATTACGCGAACCTGGCGGCAGCGCAAAAGATGGGGGTGCACGAATGTCCTGCC (SEQ ID NO: 17) Hairpin 1B AAAAGATCGTCGTAAGCGCGTAATTTTCCATCTAGAAGACGCCACCATGGAAAATTACGCGAACCTAGCCCCAGCCCAAAAGATGGGGGTGCACGAATGTCCTGCC (SEQ ID NO: 18) Hairpin 2A AAAAGTTACGCGACTTACGCGATTTTTCCATCAAGAACAGGCCACCATGGAAAAATCGCGTAACCTGGCGGCAGCGCAAAAGATGGGGGTGCACGAATGTCCTGCC (SEQ ID NO: 19) Hairpin 2B AAAAGTTACGCGACTTACGCGATTTTTCCATCAAGAAGACGCCACCATGGAAAAATCGCGTTACCTAGCCCCAGCCCAAAAGATGGGGGTGCACGAATGTCCTGCC (SEQ ID NO: 20)

[0142] The corresponding triggers are siRNA#1 and siRNA#2.

[0143] References TIFF2025170347000002.tif171128TIFF2025170347000003.tif22497TIFF2025170347000004.tif231117

[0144] All publications, patents, and patent applications are incorporated herein by reference. In the foregoing specification, the invention has been described in connection with specific embodiments thereof, and numerous details have been set forth for purposes of illustration, but it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that some of the details described herein may be varied considerably without departing from the basic principles of the invention.

[0145] Sequence information SEQUENCE LISTING <110> Cornell University <120> METHODS FOR MODULATING LEVEL OF EXPRESSION FROM GENE THERAPY EXPRESSION CASSETTE <150> US 62 / 915,342 <151> 2019-10-15 <160> twenty one <170> FastSEQ for Windows Version 4.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 1 aagatcgtcg taagcgcgta a 21 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 2 aagttacgcg acttacgcga t 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 3 acgatcgttc atatcgcgta t 21 <210> 4 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 4 gaucgucgua agcgcguaau u 21 <210> 5 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 5 guuacgcgac uuacgcgauu u 21 <210> 6 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 6 gaucguucau aucgcguauu u 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 7 ctattgacgt atgacgcgta a 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 8 caatccatca ttacgcgtta a 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 9 caatccatca attacgcgtt a 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 10 aagatcccga ttgtcgatcg t 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 11 acgtcgtacg ttaccgtacg a 21 <210> 12 <211> 151 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 12 ctggaggctt gctttgggct gtatgctgtt acgcgtcata cgtcaatagg ttttggccac 60 tgactcgact tatgattatg acgcgtaaca ggacacaagg ccctttatca gcactcacat 120 ggaacaaatg gccaccgtgg gaggatgaca a 151 <210> 13 <211> 151 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 13 ctggaggctt gctttgggct gtatgctgtt acgcgtcata cgtcaatagg ttttggccac 60 tgactcgact tattatgatg acgcgtaaca ggacacaagg ccctttatca gcactcacat 120 ggaacaaatg gccaccgtgg gaggatgaca a 151 <210> 14 <211> 151 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 14 ctggaggctt gctttgggct gtatgctgtt aacgcgtaat gatggattgg ttttggccac 60 tgactcgact aattatatta cgcgttaaca ggacacaagg ccctttatca gcactcacat 120 ggaacaaatg gccaccgtgg gaggatgaca a 151 <210> 15 <211> 151 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 15 ctggaggctt gctttgggct gtatgctgtt aacgcgtaat gatggattgg ttttggccac 60 tgactcgact aatcatttta cgcgttaaca ggacacaagg ccctttatca gcactcacat 120 ggaacaaatg gccaccgtgg gaggatgaca a 151 <210> 16 <211> 151 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 16 ctggaggctt gctttgggct gtatgctgta acgcgtaatt gatggattgg ttttggccac 60 tgactcgact aatcattatt acgcgttaca ggacacaagg ccctttatca gcactcacat 120 ggaacaaatg gccaccgtgg gaggatgaca a 151 <210> 17 <211> 106 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 17 aaaagatcgt cgtaagcgcg taattttcca tcaagaacag gccaccatgg aaaattacgc 60 gaacctggcg gcagcgcaaa agatgggggt gcacgaatgt cctgcc 106 <210> 18 <211> 106 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 18 aaaagatcgt cgtaagcgcg taattttcca tctagaagac gccaccatgg aaaattacgc 60 gaacctagcc ccagcccaaa agatgggggt gcacgaatgt cctgcc 106 <210> 19 <211> 106 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 19 aaaagttacg cgacttacgc gatttttcca tcaagaacag gccaccatgg aaaaatcgcg 60 taacctggcg gcagcgcaaa agatgggggt gcacgaatgt cctgcc 106 <210> 20 <211> 106 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 20 aaaagttacg cgacttacgc gatttttcca tcaagaagac gccaccatgg aaaaatcgcg 60 ttacctagcc ccagcccaaa agatgggggt gcacgaatgt cctgcc 106 <210> 21 <211> 151 <212> DNA <213> Artificial Sequence <220> <223> A synthetic oligonucleotide sequence <400> 21 ctggaggctt gctttgggct gtatgctgta acgcgtaatt gatggattgg ttttggccac 60 tgactcgact aattataatt acgcgttaca ggacacaagg ccctttatca gcactcacat 120 ggaacaaatg gccaccgtgg gaggatgaca a 151

Claims

1. 1. A gene therapy vector comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding a prophylactic or therapeutic gene product and a 3′ untranslated region (3′ UTR), the vector further comprises a first transcriptional regulatory region 3' to the open reading frame; When the first transcriptional regulatory region is present in the transcribed RNA, (i) capable of interacting with a small interfering RNA (siRNA) sequence, and by said interaction inhibiting translation of said transcribed RNA; or (ii) increasing the degradation of the transcribed RNA; thereby inhibiting the expression of said gene product; and / or the vector further comprises a second transcriptional regulatory region 5' to the open reading frame; the second transcriptional regulatory region, when present in the transcribed RNA, is capable of interacting with a small activating RNA (saRNA) sequence, said interaction enabling translation of the transcribed RNA and thereby expression of the gene product; Gene therapy vectors.

2. The vector of claim 1 , which has the first transcriptional regulatory region but does not have the second transcriptional regulatory region.

3. The vector of claim 1 , which has the second transcriptional regulatory region but does not have the first transcriptional regulatory region.

4. The vector of claim 1 , comprising the first transcriptional regulatory region and the second transcriptional regulatory region.

5. The vector according to any one of claims 1 to 4, which is a viral vector.

6. The vector of claim 5 , wherein the viral vector is an AAV vector, an adenoviral vector, a lentiviral vector, a herpesvirus vector, or a retroviral vector.

7. The vector of any one of claims 1 or 3 to 6, wherein the transcribed RNA having the second transcriptional regulatory region forms at least one hairpin structure.

8. 8. The vector of any one of claims 1 or 3-7, wherein the interaction of the saRNA with the transcribed RNA having the second transcriptional regulatory region exposes a ribosome binding site.

9. The vector of any one of claims 1 or 3 to 8, wherein the transcribed RNA having the second transcriptional regulatory region forms 1 to 3 or 2 to 5 different hairpins.

10. 10. The vector of any one of claims 1 or 3 to 9, wherein the transcribed RNA having the second transcriptional regulatory region forms at least one hairpin that overlaps with the ribosome binding site and / or the first AUG in the transcribed RNA.

11. The vector of any one of claims 1 or 3 to 10, wherein the second transcriptional regulatory region comprises a toehold sequence.

12. 12. The vector of any one of claims 1 to 2 or 4 to 11, wherein the first transcriptional regulatory region comprises more than one nucleotide sequence that can bind to more than one different siRNA upon transcription into RNA.

13. The vector of any one of claims 1 to 2 or 4 to 11, wherein the first transcriptional regulatory region comprises a nucleotide sequence capable of binding to multiple siRNAs upon transcription into RNA.

14. The vector of claim 13 , wherein the nucleotide sequence has multiple siRNA binding sites for the same siRNA.

15. The vector of any one of claims 1 to 14, wherein the open reading frame encodes a therapeutic RNA, a therapeutic antibody, an anti-cancer gene product, a complement factor, an interleukin, a cytokine, or a hormone.

16. 16. The vector of any one of claims 1 to 15, wherein the gene product comprises an anti-EGFR antibody, an anti-VEGF antibody, an anti-VEGFR antibody, alpha 1-antitrypsin, catalase, superoxide dismutase, factor 9, IL-2R, adenosine deaminase (ADA), WAS, beta-globin, ABCD1, an anti-CD19 antibody, an anti-IgG antibody, an anti-Siglec antibody, or an FK506 binding protein.

17. The vector of any one of claims 1 to 2 or 4 to 16, wherein the first transcriptional regulatory region comprises a sequence that binds to an siRNA having at least 80% nucleotide sequence identity to one of SEQ ID NOs: 4 to 6.

18. The system includes: (a) a gene therapy vector comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding a prophylactic or therapeutic gene product and a 3' untranslated region (3'UTR), the vector further comprises a first transcriptional regulatory region 3' to the nucleic acid sequence; the first transcriptional regulatory region, when present in the transcribed RNA, is capable of interacting with a small interfering RNA (siRNA) sequence, and said interaction can (i) inhibit translation of the transcribed RNA or (ii) enhance degradation of the transcribed RNA, thereby inhibiting expression of the gene product; gene therapy vectors, and (b) siRNA.

19. The system of claim 18 , wherein the siRNA is expressed from a vector.

20. The system of claim 19 , wherein the siRNA is expressed from a viral vector.

21. The system of claim 18 , wherein the siRNA comprises an isolated siRNA.

22. The system of any one of claims 18 to 21, wherein the first transcriptional regulatory region comprises a sequence having at least 80% nucleotide sequence identity with one of SEQ ID NOs: 1, 2, or 3.

23. The system includes: (i) a gene therapy vector comprising a promoter operably linked to a nucleic acid sequence comprising an open reading frame encoding a prophylactic or therapeutic gene product and a 3' untranslated region (3'UTR), the vector further comprises a second transcriptional regulatory region 5' to the nucleic acid sequence; the second transcriptional regulatory region, when present in the transcribed RNA, is capable of interacting with a small activating RNA (saRNA) sequence, said interaction enabling translation of the transcribed RNA and thereby expression of the gene product; gene therapy vectors, and (ii) A vector comprising a sequence corresponding to the saRNA.

24. The system of claim 23 , wherein the second transcriptional regulatory region comprises a toehold sequence.

25. A method for regulating expression of a gene therapy vector in a mammal, comprising the steps of: Providing a mammal with a gene therapy vector according to any one of claims 1 to 17; and Administering to the mammal an amount of a composition comprising a nucleic acid comprising a sequence for the siRNA and / or saRNA effective to alter expression of the gene product encoded by the vector.

26. 26. The method of claim 25, wherein the open reading frame encodes a protein.

27. 26. The method of claim 25, wherein the open reading frame encodes a therapeutic RNA, a therapeutic antibody, a hormone, a cytokine, an interleukin, or a ribozyme.

28. The method of any one of claims 25 to 27, wherein the composition comprises an siRNA, optionally with one or more nucleotide analogues.

29. The method of any one of claims 25 to 27, wherein the composition comprises a DNA vector having a sequence corresponding to the siRNA sequence or the saRNA sequence.

30. The method of any one of claims 25 to 29, wherein the composition comprises a plurality of different siRNAs.

31. The method of any one of claims 25 to 30, wherein the composition comprises isolated saRNA.

32. The method of any one of claims 25 to 30, wherein the composition comprises a nucleic acid vector comprising the nucleic acid comprising the sequence of the siRNA or saRNA.

33. The method of any one of claims 25 to 32, wherein the composition comprises a liposome containing the nucleic acid.

34. The method of any one of claims 25 to 32, wherein the composition comprises nanoparticles comprising the nucleic acid.

35. The method of any one of claims 25 to 32, wherein the composition comprises a protein complex comprising the nucleic acid.

36. The method of any one of claims 25 to 35, wherein the composition is administered systemically.

37. The method of any one of claims 25 to 35, wherein the composition is administered orally.

38. The method of any one of claims 25 to 35, wherein the composition is administered intravenously.

39. The method of any one of claims 25 to 35, wherein the composition is administered topically.

40. The method of any one of claims 25 to 35, wherein the composition is injected.

41. The method of any one of claims 25 to 40, wherein the composition is a sustained release composition.

42. 42. The method of any one of claims 25 to 41, further comprising administering the gene therapy vector to the mammal.

43. 43. The method of claim 42, wherein a liposome comprises the gene therapy vector.

44. 43. The method of claim 42, wherein a nanoparticle comprises the gene therapy vector.

45. 43. The method of claim 42, wherein a protein complex comprises the gene therapy vector.

46. 43. The method of claim 42, wherein a virus comprises the gene therapy vector.

47. 47. The method of any one of claims 42 to 46, wherein the vector is administered intravenously.

48. The method of any one of claims 42 to 46, wherein the vector is administered locally.

49. The method of any one of claims 25 to 48, wherein the mammal is a human.

50. A vector having homology arms flanking a second transcriptional regulatory region that can interact with a small activating RNA (saRNA) sequence when present in transcribed RNA, the homology arms having a sequence corresponding to a gene therapy vector sequence flanking a site for insertion of the second transcriptional regulatory region.

51. 51. The vector of claim 50, wherein the site for insertion is 3' to the promoter and 5' to the open reading frame of a prophylactic or therapeutic gene product.

52. A vector having homology arms flanking a first transcriptional regulatory region that can interact with a small interfering RNA (siRNA) sequence when present in transcribed RNA, the homology arms having sequences corresponding to gene therapy vector sequences flanking a site for insertion of the first transcriptional regulatory region.

53. 53. The vector of claim 52, wherein the site for insertion is 3' to the open reading frame of the prophylactic or therapeutic gene product and 5' to the 3' end of the 3'UTR.

Images