Benzene ring compound

Benzene ring compounds targeting the mitochondrial oxidative phosphorylation pathway and NNMT gene expression provide a precise tumor treatment by modulating the mitochondrial permeability transition pore, addressing the challenges of tumor heterogeneity and individual patient differences.

JP2025172953APending Publication Date: 2025-11-26SHANGHAI SHIJIANG BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025149728
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-12-18
Filing Date
2025-09-10
Publication Date
2025-11-26

AI Technical Summary

Technical Problem

Current tumor treatments lack precision, leading to inappropriate drug applications due to tumor heterogeneity and individual patient differences, which can delay effective treatment and result in adverse effects.

Method used

Development of benzene ring compounds that target the mitochondrial oxidative phosphorylation pathway, modulate the mitochondrial permeability transition pore, and regulate NNMT gene expression to provide markers for personalized tumor treatment.

Benefits of technology

The compounds effectively suppress tumors by upregulating the mitochondrial oxidative phosphorylation pathway and downregulating NNMT, offering a targeted and safer treatment approach.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025172953000419
    Figure 2025172953000419
  • Figure 2025172953000420
    Figure 2025172953000420
  • Figure 2025172953000421
    Figure 2025172953000421
Patent Text Reader

Abstract

To provide a compound and a use thereof which can safely and effectively inhibit tumors.SOLUTION: Provided is a compound represented by formula I, or an optical isomer thereof or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof. (In formula I, ring A represents substituted / unsubstituted C6-C16 aryl ring, substituted / unsubstituted C3-C16 cycloalkyl ring, substituted / unsubstituted 3-16-membered heterocycloalkyl ring, or substituted / unsubstituted 3-16-membered heteroaryl ring; ring B represents absence, substituted / unsubstituted C6-C16 aryl ring, substituted / unsubstituted C3-C16 cycloalkyl ring, substituted / unsubstituted 3-16-membered heterocycloalkyl ring, or substituted / unsubstituted 3-16-membered heteroaryl ring).SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the technical field of medicine, and relates to benzene ring compounds and their uses. [Background technology]

[0002] Tumors are a common disease that seriously endangers human health, and the mortality rate due to malignant tumors is still high. The heterogeneity of tumors and individual patient differences make it difficult to determine their origin and pathology. Simply using the same treatment or the same drug depending on the clinical characteristics will prevent the occurrence of diseases resulting from inappropriate treatment. This can lead to problems occurring more easily, delaying important treatment times and opportunities for patients. There seems to be a great need to adopt individualized treatments for such situations. As a result, tumor treatment has entered an era of precision therapy, and tumor-related gene expression Changes in these genes have been discovered one after another, and the transformation of related genes plays an important role in the development of malignant tumors. The discovery and application of biomarkers will provide precise guidance for the application of relevant drugs and contribute to the development of tumor This enables personalized treatment, achieving targeted dosing and significantly improving therapeutic efficacy.

[0003] Therefore, there is an urgent need in the art to develop drugs that can precisely treat tumors. Summary of the Invention [Problem to be solved by the invention]

[0004] The present invention aims to provide a compound capable of safely and effectively suppressing tumors and its use. The target.

[0005] Furthermore, the present invention relates to the mitochondrial oxidative phosphorylation pathway, the mitochondrial permeability transition pore, NNMT, The methylation level of DNA CpG sites in the gene and / or NNMT gene region is used to Providing markers to determine whether a compound is suitable for the prevention and / or treatment of tumor patients The compounds of the present invention are intended to upregulate the mitochondrial oxidative phosphorylation pathway, Low activity of the membrane permeability transition pore in the granule, low or no expression of the NNMT gene and / or NNMT Significantly better treatment for tumors with hypermethylation of DNA CpG sites in gene regions It has an effect. [Means for solving the problem]

[0006] A first aspect of the present invention is a compound of formula I, or an optical isomer or racemate thereof, or a solvent thereof or a pharmaceutically acceptable salt thereof. [ka] where: Ring A is a substituted or unsubstituted C6-C16 aryl ring, a substituted or unsubstituted C3-C16 cyclohexyl ring, a substituted or unsubstituted 3- to 16-membered heterocycloalkyl ring, a substituted or unsubstituted 3- to 16-membered heterocycloalkyl ring, or a substituted or unsubstituted represents a substituted 3-16 membered heteroaryl ring; Ring B is an unsubstituted or substituted C6-C16 aryl ring, a substituted or unsubstituted C3-C1 6-membered cycloalkyl ring, substituted or unsubstituted 3- to 16-membered heterocycloalkyl ring, or substituted or represents an unsubstituted 3- to 16-membered heteroaryl ring; R1 is [ka] represents; R2 is a hydrogen atom, [ka] represents; R3 is an integer of 0 to 10, and is selected from the group consisting of: no group, hydrogen atom, halogen atom, -CN, hydroxyl group, mercapto group, nitrite, a group, an amino group, F3C-, F3C-O-, a substituted or unsubstituted C1-C10 alkyl group, substituted or unsubstituted C3-C12 cycloalkyl group, substituted or unsubstituted C1-C8 alkoxy group silyl group, substituted or unsubstituted C1-C8 alkylthiol group, substituted or unsubstituted C6-C1 6 aryl group, substituted or unsubstituted 5- to 12-membered heteroaryl group, substituted or unsubstituted C6- C16 aryl group-substituted or unsubstituted C1-C10 alkyl group-, or substituted or unsubstituted 5-12 membered heteroaryl group - represents a substituted or unsubstituted C1-C10 alkyl group; R4 and R5 each independently represent a hydrogen atom, a halogen atom, -CN, or a hydroxyl group. group, mercapto group, nitro group, amino group, substituted or unsubstituted C1-C10 alkyl group, substituted or unsubstituted C3-C12 cycloalkyl group, substituted or unsubstituted C1-C8 alkoxy group thiol group, substituted or unsubstituted C1-C8 alkylthiol group, substituted or unsubstituted C6-C16 alkylthiol group represents an aryl group or a substituted or unsubstituted 5-12 membered heteroaryl group; R6 is a substituted or unsubstituted C6-C16 aryl group, a substituted or unsubstituted 5-12 membered heterocyclic group, a substituted or unsubstituted 3- to 16-membered cycloalkyl group, or a substituted or unsubstituted 3 -represents a 16-membered heterocycloalkyl group; n represents 0, 1, 2, 3, 4, 5 or 6; Ring C is an unsubstituted or substituted C6-C16 aryl ring, a substituted or unsubstituted C3-C1 6-membered cycloalkyl ring, substituted or unsubstituted 3- to 16-membered heterocycloalkyl ring, or substituted or represents an unsubstituted 3- to 16-membered heteroaryl ring; R7 is a hydrogen atom, a halogen atom, -CN, a hydroxyl group, a mercapto group, or a nitro group. , an amino group, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C12 Cycloalkyl groups, substituted or unsubstituted C1-C8 alkoxy groups, substituted or unsubstituted C1 -C8 alkylthiol group, substituted or unsubstituted C6-C16 aryl group, or substituted or unsubstituted represents a substituted 5-12 membered heteroaryl group; R8 and R9 may be joined to form a substituted or unsubstituted 3- to 16-membered cycloalkyl ring, or a substituted or unsubstituted 3- to 16-membered cycloalkyl ring. forms an unsubstituted 3- to 16-membered heterocycloalkyl ring; R 10 and R 11 are each independently a hydrogen atom, a halogen atom, -CN, a hydroxyl Cyl group, mercapto group, nitro group, amino group, F3C-O-, F3C-, substituted or unsubstituted C1-C10 alkyl groups, substituted or unsubstituted C3-C12 cycloalkyl groups, substituted or unsubstituted an unsubstituted C1-C8 alkoxyl group, a substituted or unsubstituted C1-C8 alkylthiol group, Substituted or unsubstituted C6-C16 aryl group, substituted or unsubstituted 5-12 membered heteroaryl group, substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C10 alkyl group, substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C10 alkyl represents an alkyl group, or a substituted or unsubstituted C1-C6 alkyl group -C(O)-; or R 10 and R 11 is attached to a substituted or unsubstituted 3- to 16-membered heterocycloalkyl ring, or forming a substituted or unsubstituted 3- to 16-membered heteroaryl ring; R 12 and R 13 are each independently a hydrogen atom, a halogen atom, -CN, a hydroxyl Cyl group, mercapto group, nitro group, amino group, F3C-, F3C-O-, substituted or unsubstituted C1-C10 alkyl groups, substituted or unsubstituted C3-C12 cycloalkyl groups, substituted or unsubstituted an unsubstituted C1-C8 alkoxyl group, a substituted or unsubstituted C1-C8 alkylthiol group, Substituted or unsubstituted C6-C16 aryl group, substituted or unsubstituted 5-12 membered heteroaryl group, substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C1 0 represents an alkyl group; The optional "substitution" may be one or more (preferably one, two, 3, 4, 5, 6, 7 or 8) hydrogen atoms are C1-C8 alkyl groups, C3-C 8 Cycloalkyl groups, C1-C8 halogenated alkyl groups, C3-C8 halogenated cycloalkyl groups alkyl group, halogen atom, nitro group, -CN, hydroxyl group, mercapto group, amino group , F3C-, F3C-O-, C1-C4 carboxyl group, C2-4 ester group, C2-C 4 acylamino group, C1-C8 alkoxyl group, C1-C8 alkylthiol group, C1- C8 halogenated alkoxyl group, C1-C8 halogenated alkylthiol group, C6-C1 2 aryl groups, 5- to 10-membered heteroaryl groups, and 5- to 10-membered heterocycloalkyl groups is substituted by a substituent selected from the group consisting of: The heterocycloalkyl group, heteroaryl group, heterocycloalkyl ring, and hetero On the heterocyclic ring of the aryl ring, there are independently 1 to 4 atoms selected from N, O and S. (preferably 1, 2, 3 or 4) heteroatoms.

[0007] In another preferred embodiment, the optional "substitution" is one or more (preferably) groups on the ring or on the atomic group. or 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms are C1-C6 Alkyl groups, C3-C8 cycloalkyl groups, C1-C6 halogenated alkyl groups, C3-C 8 Halogenated cycloalkyl groups, halogen atoms, nitro groups, -CN, hydroxyl groups, methyl groups Amino group, F3C-O-, F3C-, C1-C4 carboxyl group, C2-4 Ester group, C2-C4 acylamino group, C1-C6 alkoxyl group, C1-C6 alkyl thiol group, C1-C6 halogenated alkoxyl group, C1-C6 halogenated alkylthiol group aryl groups, C6-C12 aryl groups, 5-10 membered heteroaryl groups, and 5-10 membered heteroaryl groups. It refers to being substituted by a substituent selected from the group consisting of cycloalkyl groups.

[0008] In another preferred embodiment, the optional "substitution" is one or more (preferably) groups on the ring or on the atomic group. or 1, 2, 3, 4, 5, 6, 7 or 8) hydrogen atoms in the C1-C4 Alkyl groups, C3-C8 cycloalkyl groups, C1-C4 halogenated alkyl groups, C3-C 8 Halogenated cycloalkyl groups, halogen atoms, nitro groups, -CN, hydroxyl groups, methyl groups Amino group, F3C-O-, F3C-, C1-C4 carboxyl group, C2-4 Ester group, C2-C4 acylamino group, C1-C4 alkoxyl group, C1-C4 alkyl thiol group, C1-C4 halogenated alkoxyl group, C1-C4 halogenated alkylthiol group aryl groups, C6-C12 aryl groups, 5-10 membered heteroaryl groups, and 5-10 membered heteroaryl groups. It refers to being substituted by a substituent selected from the group consisting of cycloalkyl groups.

[0009] In another preferred embodiment, the heterocycloalkyl group, heteroaryl group, On the heterocyclic ring of the alkyl ring and the heteroaryl ring, there are independently selected from N, O and S. There are 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms selected.

[0010] In another preferred embodiment, the halogen atom is F, Cl, Br, or I.

[0011] In another preferred embodiment, the cycloalkyl ring contains one, two, or three C=C cyclic double bonds. There is a match.

[0012] In another preferred embodiment, the heterocycloalkyl ring contains one, two, or three C=C rings. In another preferred embodiment, the heterocycloalkyl group, heteroaryl group, On the heterocyclic ring of the heterocycloalkyl ring and the heteroaryl ring, each independently, N, 1 to 4 (preferably 1, 2, 3 or 4) hetero atoms selected from O and S There are atoms.

[0013] In another preferred embodiment, ring A is a substituted or unsubstituted C6-C12 aryl ring, ... Substituted C3-C12 cycloalkyl ring, substituted or unsubstituted 3-12 membered heterocycloalkyl ring, or a substituted or unsubstituted 3- to 12-membered heteroaryl ring.

[0014] In another preferred embodiment, ring A is a substituted or unsubstituted C6-C10 aryl ring, ... Substituted C3-C10 cycloalkyl ring, substituted or unsubstituted 3-10 membered heterocycloalkyl ring, or a substituted or unsubstituted 3- to 10-membered heteroaryl ring.

[0015] In another preferred embodiment, ring A is a substituted or unsubstituted C6-C8 aryl ring, substituted or unsubstituted a C3-C8 cycloalkyl ring, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl ring, or represents a substituted or unsubstituted 5-8 membered heteroaryl ring.

[0016] In another preferred embodiment, ring A is an unsubstituted or substituted 5-membered heterocycloalkyl ring, a substituted or an unsubstituted 6-membered heterocycloalkyl ring, a substituted or unsubstituted 7-membered heterocycloalkyl ring, substituted or unsubstituted 8-membered heterocycloalkyl ring, substituted or unsubstituted 5-membered heteroaryl a substituted or unsubstituted 6-membered heteroaryl ring, a substituted or unsubstituted 7-membered heteroaryl ring or a substituted or unsubstituted 8-membered heteroaryl ring.

[0017] In another preferred embodiment, ring A is a substituted or unsubstituted 5-membered heteroaryl ring, substituted or unsubstituted a 6-membered heteroaryl ring, a substituted or unsubstituted 7-membered heteroaryl ring, or a substituted or unsubstituted represents an 8-membered heteroaryl ring of the formula:

[0018] In another preferred embodiment, ring A is a substituted or unsubstituted pyridine ring, a substituted or unsubstituted pyrimidinyl ring, a substituted or unsubstituted benzene ring, a substituted or unsubstituted naphthoyl ring, a substituted or unsubstituted a thiazole ring, a substituted or unsubstituted imidazole ring, or a substituted or unsubstituted pyrrolyl ring; vinegar.

[0019] In another preferred example, ring A is a pyridine ring, a pyrimidine ring, a benzene ring, a naphthoyl ring, It represents a thiazole ring or an imidazole ring.

[0020] In another preferred embodiment, R1 is bonded to a heteroatom on ring A.

[0021] In another preferred embodiment, R 1 is bonded to an N, O, or S atom on ring A.

[0022] In another preferred example, R1 is bonded to the N atom on ring A.

[0023] In another preferred embodiment, R2 is bonded to a carbon atom on ring A.

[0024] In another preferred embodiment, ring B is an unsubstituted or substituted C6-C12 aryl ring, a substituted or Unsubstituted C3-C12 cycloalkyl ring, substituted or unsubstituted 3-12 membered heterocycloalkyl It represents a substituted or unsubstituted 3- to 12-membered heteroaryl ring.

[0025] In another preferred embodiment, ring B is an unsubstituted or substituted C6-C10 aryl ring, a substituted or Unsubstituted C3-C10 cycloalkyl ring, substituted or unsubstituted 3-10 membered heterocycloalkyl It represents a substituted or unsubstituted 3- to 10-membered heteroaryl ring.

[0026] In another preferred embodiment, ring B is an unsubstituted or substituted C6-C8 aryl ring, a substituted or unsubstituted C6-C8 aryl ring, Substituted C5-C8 cycloalkyl ring, substituted or unsubstituted 5-8 membered heterocycloalkyl ring or a substituted or unsubstituted 5-8 membered heteroaryl ring.

[0027] In another preferred embodiment, ring B is an unsubstituted or substituted 5-membered heterocycloalkyl ring, or an unsubstituted 6-membered heterocycloalkyl ring, a substituted or unsubstituted 7-membered heterocycloalkyl ring, substituted or unsubstituted 8-membered heterocycloalkyl ring, substituted or unsubstituted 5-membered heteroaryl a substituted or unsubstituted 6-membered heteroaryl ring, a substituted or unsubstituted 7-membered heteroaryl ring or a substituted or unsubstituted 8-membered heteroaryl ring.

[0028] In another preferred embodiment, the cycloalkyl ring contains one, two, or three C=C cyclic double bonds. There is a match.

[0029] In another preferred embodiment, ring B is an unsubstituted or substituted tetrahydropyridine ring, a substituted or Unsubstituted pyrrolyl ring, substituted or unsubstituted dihydropyrrole ring, substituted or unsubstituted imidazo It represents a pyrazole ring, or a substituted or unsubstituted pyrazole ring.

[0030] In another preferred example, ring B is a ring selected from the group consisting of: nothing, a tetrahydropyridine ring, a piperidine ring, and a pyrrolyl ring. , dihydropyrrole ring, tetrahydropyrrole ring, imidazole ring, pyrazole ring, pyrazole ring Lysine ring, [ka] Represents.

[0031] In another preferred embodiment, R3 is bonded to a carbon atom on ring B.

[0032] In another preferred embodiment, R3 is bonded to a heteroatom on ring B.

[0033] In another preferred embodiment, R3 is bonded to an N, O, or S atom on ring B.

[0034] In another preferred example, R3 is bonded to the N atom on ring B.

[0035] Another preferred example is [ka] The bonding state between and ring A is [ka] is.

[0036] In another preferred example, [ka] The bonding state between and ring A is [ka] is.

[0037] In another preferred embodiment, the tetrahydropyridine ring is 1,2,3,4-tetrahydropyridine. It is a lysine ring.

[0038] In another preferred example, the pyrrolyl ring is a 1-hydropyrrole ring.

[0039] In another preferred embodiment, the dihydropyrrole ring is a 2,3-dihydropyrrole ring.

[0040] In another preferred embodiment, ring B is absent. The present invention relates to a compound of formula I, wherein when ring B is absent, the structure of the compound is as shown in structure I-1. It should be understood that: [ka]

[0041] In another preferred embodiment, the compound of formula I is as follows: I-1. [ka]

[0042] In another preferred embodiment, ring B is absent and R2 is [ka] Represents.

[0043] In another preferred embodiment, ring B is a substituted or unsubstituted C6-C16 aryl ring, ... Substituted C3-C16 cycloalkyl ring, substituted or unsubstituted 3-16 membered heterocycloalkyl ring, or a substituted or unsubstituted 3- to 16-membered heteroaryl ring; R2 represents a hydrogen atom.

[0044] In another preferred example, R1 is [ka] Represents.

[0045] In another preferred example, R1 is [ka] Represents.

[0046] In another preferred embodiment, R2 is a hydrogen atom, or [ka] Represents.

[0047] In another preferred embodiment, R2 is a hydrogen atom, or [ka] Represents.

[0048] In another preferred example, R3 is a hydrogen atom, a halogen atom, -CN, a hydroxyl group, a methyl group, Capryl group, nitro group, amino group, F3C-, F3C-O-, substituted or unsubstituted C1-C8 alkyl groups, substituted or unsubstituted C3-C10 cycloalkyl groups, substituted or unsubstituted C1- C8 alkoxyl group, substituted or unsubstituted C1-C8 alkylthiol group, substituted or unsubstituted a C6-C12 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted a substituted C6-C12 aryl group, a substituted or unsubstituted C1-C8 alkyl group, or a substituted or represents an unsubstituted 5-10 membered heteroaryl group - a substituted or unsubstituted C1-C8 alkyl group vinegar.

[0049] In another preferred example, R3 is a hydrogen atom, a halogen atom, -CN, a hydroxyl group, a methyl group, Capto group, nitro group, amino group, F3C-, F3C-O-, substituted or unsubstituted C1-C6 alkyl groups, substituted or unsubstituted C3-C8 cycloalkyl groups, substituted or unsubstituted C1-C 6 alkoxyl groups, substituted or unsubstituted C1-C6 alkylthiol groups, substituted or unsubstituted C6-C10 aryl group, substituted or unsubstituted 5-10 membered heteroaryl group, substituted or unsubstituted a substituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted 5-10 membered heteroaryl group -substituted or unsubstituted C1-C4 alkyl group- .

[0050] In another preferred example, R3 is a hydrogen atom, a halogen atom, -CN, a hydroxyl group, a methyl group, Capto group, nitro group, amino group, F3C-, F3C-O-, substituted or unsubstituted C1-C4 alkyl groups, substituted or unsubstituted C3-C8 cycloalkyl groups, substituted or unsubstituted C1-C 4 alkoxyl groups, substituted or unsubstituted C1-C4 alkylthiol groups, substituted or unsubstituted C6-C8 aryl group, substituted or unsubstituted 5-8 membered heteroaryl group, substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, or substituted or unsubstituted represents a 5-8 membered heteroaryl group - a substituted or unsubstituted C1-C2 alkyl group -.

[0051] In another preferred embodiment, R3 is a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C6 cycloalkyl group, substituted or unsubstituted phenyl group, substituted or unsubstituted substituted phenyl group-methyl group-, substituted or unsubstituted pyridine group, substituted or unsubstituted pyridine group-methyl group-, substituted or unsubstituted phenyl group-ethyl group-, or substituted or unsubstituted pyridinium group- It represents a vinyl group - an ethyl group.

[0052] In another preferred embodiment, R3 is a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C3-C6 cycloalkyl group, substituted or unsubstituted phenyl group, substituted or unsubstituted substituted phenyl group-methyl group-, substituted or unsubstituted pyridine group, substituted or unsubstituted pyridine group-methyl group-, substituted or unsubstituted phenyl group-ethyl group-, or substituted or unsubstituted pyridinium group- It represents a vinyl group - an ethyl group.

[0053] In another preferred example, R3 is a hydrogen atom, a substituted or unsubstituted methyl group, a substituted or unsubstituted an ethyl group, a substituted or unsubstituted propyl group, a substituted or unsubstituted cyclopropyl group, a substituted or unsubstituted cyclopropyl group, Unsubstituted phenyl group, substituted or unsubstituted phenyl group-methyl group, substituted or unsubstituted pyridinium phenyl group, substituted or unsubstituted pyridine group-methyl group, substituted or unsubstituted phenyl group-ethyl group It represents a substituted or unsubstituted pyridine group-ethyl group-.

[0054] In another preferred embodiment, the substituted or unsubstituted phenyl group Phenyl refers to monosubstituted or unsubstituted phenyl groups.

[0055] In another preferred embodiment, the substituted or unsubstituted phenyl group The phenyl group refers to a monosubstituted or unsubstituted phenyl group, and the substitution refers to ortho-substitution of the phenyl group; Refers to para or meta substitution.

[0056] In another preferred embodiment, the substituted or unsubstituted phenyl group The phenyl group refers to a monosubstituted or unsubstituted phenyl group, and the substitution refers to ortho-substitution of the phenyl group; The substituents may be halogen atoms (e.g., chlorine atoms), nitrites, or the like. group, amino group, C1-C4 alkyl group (methyl group), C1-C4 alkoxyl group, C1 -C4 alkylthiol group, F3C- or F3C-O-.

[0057] In another preferred embodiment, the substituted or unsubstituted phenyl group-methyl group The term "unsubstituted phenyl group" refers to a monosubstituted or unsubstituted phenyl group.

[0058] In another preferred embodiment, the substituted or unsubstituted phenyl group-methyl group The unsubstituted phenyl group refers to a monosubstituted or unsubstituted phenyl group, and the substituted phenyl group Refers to ortho, para or meta substitution.

[0059] In another preferred embodiment, the substituted or unsubstituted phenyl group-methyl group The unsubstituted phenyl group refers to a monosubstituted or unsubstituted phenyl group, and the substituted phenyl group The substituents may be ortho, para, or meta. The substituents may be halogen atoms (e.g., chlorine, atom), nitro group, amino group, C1-C4 alkyl group (methyl group), C1-C4 alkoxy It refers to a sil group, a C1-C4 alkylthiol group, F3C- or F3C-O-.

[0060] In another preferred example, the substituted phenyl group refers to a monosubstituted phenyl group.

[0061] In another preferred example, R4 and R5 are each independently a hydrogen atom, a halogen atom, - CN, hydroxyl group, mercapto group, nitro group, amino group, substituted or unsubstituted C1-C 8 alkyl groups, substituted or unsubstituted C3-C10 cycloalkyl groups, substituted or unsubstituted C1 -C8 alkoxyl group, substituted or unsubstituted C1-C8 alkylthiol group, substituted or unsubstituted a substituted C6-C12 aryl group or a substituted or unsubstituted 5-10 membered heteroaryl group .

[0062] In another preferred example, R4 and R5 are each independently a hydrogen atom, a halogen atom, - CN, hydroxyl group, mercapto group, nitro group, amino group, substituted or unsubstituted C1-C 6 alkyl groups, substituted or unsubstituted C3-C10 cycloalkyl groups, substituted or unsubstituted C1 -C8 alkoxyl group, substituted or unsubstituted C1-C8 alkylthiol group, substituted or unsubstituted a substituted C6-C12 aryl group or a substituted or unsubstituted 5-10 membered heteroaryl group .

[0063] In another preferred example, R4 and R5 are each independently a hydrogen atom, a halogen atom, - CN, hydroxyl group, mercapto group, nitro group, amino group, substituted or unsubstituted C1-C 4 alkyl groups, substituted or unsubstituted C3-C10 cycloalkyl groups, substituted or unsubstituted C1 -C4 alkoxyl group, substituted or unsubstituted C1-C4 alkylthiol group, substituted or unsubstituted It represents a substituted C6-C8 aryl group, or a substituted or unsubstituted 5-8 membered heteroaryl group.

[0064] In another preferred example, R4 and R5 each independently represent a hydrogen atom, a methyl group, or an ethyl group. represents a group, a propyl group, or a butyl group.

[0065] In another preferred embodiment, n represents 0, 1, 2, 3, 4, 5, or 6. In the present invention, when n is 0, [ka] but [ka] It should be understood that this refers to:

[0066] In another preferred embodiment, R6 is a substituted or unsubstituted C6-C12 aryl group, ... a substituted 5-12 membered heteroaryl group, a substituted or unsubstituted 3-12 membered cycloalkyl group, or It represents a substituted or unsubstituted 3- to 12-membered heterocycloalkyl group.

[0067] In another preferred embodiment, R6 is a substituted or unsubstituted C6-C10 aryl group, or a substituted or an unsubstituted 5- to 10-membered heteroaryl group, a substituted or unsubstituted 3- to 8-membered cycloalkyl group, or represents a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group.

[0068] In another preferred embodiment, R6 is a substituted or unsubstituted C6-C8 aryl group, or a substituted or unsubstituted a substituted 5-8 membered heteroaryl group, a substituted or unsubstituted 3-8 membered cycloalkyl group, or and represents a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group.

[0069] In another preferred example, R6 is a substituted or unsubstituted phenyl group, a substituted or unsubstituted pyridine group. group, or a substituted or unsubstituted pyrazine group.

[0070] In another preferred embodiment, the substituted or unsubstituted phenyl group is a monosubstituted or unsubstituted phenyl group. Refers to...

[0071] In another preferred embodiment, the substituted or unsubstituted phenyl group is a monosubstituted or unsubstituted phenyl group. and substitution refers to ortho, para or meta substitution of the phenyl group.

[0072] In another preferred embodiment, the substituted or unsubstituted phenyl group is a monosubstituted or unsubstituted phenyl group. and the substitution refers to ortho-, para- or meta-substitution of the phenyl group. is a halogen atom, a nitro group, an amino group, a C1-C4 alkyl group, a C1-C4 alkoxy group. thiol group, C1-C4 alkylthiol group, F3C-, F3C-O-, C6-C12 aryl It refers to a group, or a 5-10 membered heteroaryl group.

[0073] In another preferred embodiment, the substituted or unsubstituted phenyl group is a monosubstituted or unsubstituted phenyl group. and the substitution refers to ortho-, para- or meta-substitution of the phenyl group. is a halogen atom, a nitro group, an amino group, a C1-C4 alkyl group, a C1-C4 alkoxy group. It refers to a C1-C4 alkylthiol group, F3C-, F3C-O-, or phenyl group. .

[0074] In another preferred example, the substituted phenyl group refers to a monosubstituted phenyl group.

[0075] In another preferred embodiment, R6 is a meta-nitrophenyl group, an ortho-nitrophenyl group, or a pa para-nitrophenyl group, phenyl group, para-methylphenyl group, ortho-methylphenyl group group, meta-methylphenyl group, para-aminophenyl group, ortho-aminophenyl group, ter-aminophenyl group, para-methoxyphenyl group, ortho-methoxyphenyl group, meta -methoxyphenyl group, para-trifluoromethoxyphenyl group, ortho-trifluoro Methoxyphenyl group, meta-trifluoromethoxyphenyl group, para-halogenated phenyl group ortho-halogenated phenyl group, meta-halogenated phenyl group, para-trifluoromethyl ortho-trifluoromethylphenyl group, ortho-trifluoromethylphenyl group, meta-trifluoromethyl phenyl group, para-phenylphenyl group, ortho-phenylphenyl group, meta-phenylphenyl group a phenyl group, a pyridine group, [ka] , a pyrazine group, or a monomethyl-substituted pyrazine group.

[0076] In another preferred example, R7 is a hydrogen atom, a halogen atom, -CN, a hydroxyl group, or a methyl group. a capryl group, a nitro group, an amino group, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted a substituted C3-C8 cycloalkyl group, a substituted or unsubstituted C1-C8 alkoxy group, a substituted or unsubstituted C1-C8 alkoxy group, represents an unsubstituted C1-C8 alkylthiol group, a substituted or unsubstituted C6-C12 aryl group, or a substituted or unsubstituted 5- to 10-membered heteroaryl group.

[0077] In another preferred example, R7 is a hydrogen atom, a halogen atom, -CN, a hydroxyl group, or a methyl group. a capryl group, a nitro group, an amino group, a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted a substituted C3-C6 cycloalkyl group, a substituted or unsubstituted C1-C6 alkoxy group, a substituted or unsubstituted C1-C6 alkoxy group, is an unsubstituted C1-C4 alkylthiol group, a substituted or unsubstituted C6-C8 aryl group, or represents a substituted or unsubstituted 5- to 8-membered heteroaryl group.

[0078] In another preferred example, R7 is a hydrogen atom, a halogen atom, -CN, a hydroxyl group, or a methyl group. a capryl group, a nitro group, an amino group, a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted a substituted C3-C6 cycloalkyl group, a substituted or unsubstituted C1-C6 alkoxy group, a substituted or unsubstituted C1-C6 alkoxy group, is an unsubstituted C1-C4 alkylthiol group, a substituted or unsubstituted C6-C8 aryl group, or represents a substituted or unsubstituted 5- to 8-membered heteroaryl group.

[0079] In another preferred example, R7 represents a hydrogen atom.

[0080] In another preferred embodiment, R8 and R9 are joined to form a substituted or unsubstituted 3- to 12-membered cycloalkane. The aryl group forms a heterocycloalkyl ring, or a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring.

[0081] In another preferred embodiment, R8 and R9 are joined to form a substituted or unsubstituted 3- to 10-membered cycloalkane. The aryl group forms a heterocycloalkyl ring, or a substituted or unsubstituted 3- to 10-membered heterocycloalkyl ring.

[0082] In another preferred example, R8 and R9 are joined to form a substituted or unsubstituted 3-8 membered cycloalkyl. The cycloalkyl group forms a 3- to 8-membered heterocycloalkyl ring or a substituted or unsubstituted 3- to 8-membered heterocycloalkyl ring.

[0083] In another preferred example, R8 and R9 are joined to form a substituted or unsubstituted 5-8 membered cycloalkyl. The cycloalkyl group forms a 5- to 8-membered heterocycloalkyl ring or a substituted or unsubstituted 5- to 8-membered heterocycloalkyl ring.

[0084] In another preferred example, R8 and R9 are joined to form a substituted or unsubstituted 5- or 6-membered cycloalkyl. The cycloalkyl group forms a 5- or 6-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- or 6-membered heterocycloalkyl ring.

[0085] In another preferred example, R8 and R9 are joined to form a substituted or unsubstituted 5-membered cycloalkyl ring. or a substituted or unsubstituted 6-membered heterocycloalkyl ring.

[0086] In another preferred embodiment, the cycloalkyl ring contains one, two, or three C=C cyclic double bonds. There is a match.

[0087] In another preferred example, R8 and R9 are bonded to form a substituted or unsubstituted cyclopentene ring or Forms a cyclohexene ring.

[0088] In another preferred embodiment, ring C is an unsubstituted or substituted C6-C12 aryl ring, a substituted or Unsubstituted C3-C12 cycloalkyl ring, substituted or unsubstituted 3-12 membered heterocycloalkyl It represents a substituted or unsubstituted 3- to 12-membered heteroaryl ring.

[0089] In another preferred embodiment, ring C is an unsubstituted or substituted C6-C10 aryl ring, a substituted or Unsubstituted C3-C10 cycloalkyl ring, substituted or unsubstituted 3-10 membered heterocycloalkyl It represents a substituted or unsubstituted 3- to 10-membered heteroaryl ring.

[0090] In another preferred embodiment, ring C is an unsubstituted or substituted C6-C8 aryl ring, a substituted or unsubstituted C6-C8 aryl ring, Substituted C5-C10 cycloalkyl ring, substituted or unsubstituted 5-10 membered heterocycloalkyl It represents a 5- to 8-membered heteroaryl ring or a substituted or unsubstituted 5- to 8-membered heteroaryl ring.

[0091] In another preferred embodiment, ring C is a substituted or unsubstituted benzene ring or a substituted or unsubstituted pyridine ring. represents the cyclic ring.

[0092] In another preferred embodiment, ring C is a substituted or unsubstituted benzene ring or a substituted or unsubstituted pyridine ring. said optional "substitution" means that one, two or three hydrogen atoms on the atomic group are replaced by a methyl group; aryl group, halogen atom, nitro group, -CN, hydroxyl group, mercapto group, amino group, F substituted by a substituent selected from 3C-O-, F3C-, and a methoxy group; Refers to...

[0093] Another good example is R 10 and R 11 are each independently a hydrogen atom or a halogen atom , -CN, hydroxyl group, mercapto group, nitro group, amino group, F3C-O-, F3C -, substituted or unsubstituted C1-C10 alkyl group, substituted or unsubstituted C3-C10 cycloalkyl alkyl groups, substituted or unsubstituted C1-C8 alkoxy groups, substituted or unsubstituted C1-C8 alkyl groups, alkylthiol group, substituted or unsubstituted C6-C12 aryl group, substituted or unsubstituted 5-1 2-membered heteroaryl group, substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C 1-C8 alkyl group, substituted or unsubstituted 5-12 membered heteroaryl group, substituted or unsubstituted or a substituted or unsubstituted C1-C4 alkyl group -C(O)-. or R 10 and R 11 is bonded to a substituted or unsubstituted 3- to 12-membered heterocyclo The rings form an alkyl ring or a substituted or unsubstituted 3- to 12-membered heteroaryl ring.

[0094] Another good example is R 10 and R 11 are each independently a hydrogen atom or a halogen atom , -CN, hydroxyl group, mercapto group, nitro group, amino group, F3C-, F3C-O -, substituted or unsubstituted C1-C6 alkyl group, substituted or unsubstituted C3-C8 cycloalkyl a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C1-C6 alkoxy group, a substituted or unsubstituted C1-C6 alkyl group a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-10 membered hydroxyl group, aryl group, substituted or unsubstituted C6-C10 aryl group, substituted or unsubstituted C1-C 4 alkyl group, substituted or unsubstituted 5-10 membered heteroaryl group, substituted or unsubstituted C1 represents a -C4 alkyl group, or a substituted or unsubstituted C1-C4 alkyl group -C(O)-; or Iwa, R 10 and R 11 is bonded to a substituted or unsubstituted 5-12 membered heterocycloalkyl The ring forms a substituted or unsubstituted 5- to 12-membered heteroaryl ring.

[0095] Another good example is R 10 and R 11are each independently a hydrogen atom or a halogen atom , -CN, hydroxyl group, mercapto group, nitro group, amino group, F3C-O-, F3C -, substituted or unsubstituted C1-C4 alkyl group, substituted or unsubstituted C3-C8 cycloalkyl group a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C1-C4 alkoxy group, a substituted or unsubstituted C1-C4 alkyl group a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-8 membered heterocyclic group, aryl group, substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 aryl group alkyl group, substituted or unsubstituted 5-8 membered heteroaryl group, substituted or unsubstituted C1-C2 represents an alkyl group - or a substituted or unsubstituted C1-C4 alkyl group -C(O)-; or , R 10 and R 11 is attached to a substituted or unsubstituted 5- to 12-membered heterocycloalkyl ring, or forms a substituted or unsubstituted 5-12 membered heteroaryl ring.

[0096] In another preferred embodiment, the substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring is or unsubstituted C6-C8 aryl ring and a fused heterocyclic ring of a substituted or unsubstituted C5-C8 monocyclic ring It is a chloroalkyl ring.

[0097] In another preferred embodiment, the substituted or unsubstituted 5- to 12-membered heterocycloalkyl ring is or unsubstituted C6-C8 aryl ring and a fused heterocyclic ring of a substituted or unsubstituted C5-C8 monocyclic ring It is a chloroalkyl ring.

[0098] Another good example is R 10 and R 11 are each independently a methyl group, a substituted or unsubstituted substituted or unsubstituted phenyl group, substituted or unsubstituted phenyl group-C1-C2 alkyl group-, substituted or unsubstituted substituted or unsubstituted pyridine group, substituted or unsubstituted pyridine group-C1-C2 alkyl group-, substituted or unsubstituted represents a substituted C1-C3 alkyl group -C(O)-; or R 10 and R 11 is combined with Substituted or unsubstituted isoquinoline ring, substituted or unsubstituted quinoline ring, substituted or unsubstituted tetrahydrofuran ring, a substituted or unsubstituted tetrahydroisoquinoline ring, a substituted or unsubstituted tetrahydroquinoline ring, or a substituted or unsubstituted tetrahydroisoquinoline ring The resulting dihydroisoquinoline-1 ketone ring is formed.

[0099] In another preferred embodiment, the tetrahydroquinoline ring is 1,2,3,4-tetrahydroquinoline. Refers to the phosphorus ring.

[0100] In another preferred embodiment, the dihydroisoquinoline-1 ketone ring is 3,4-dihydroisoquinoline. It refers to the ketone ring.

[0101] In another preferred embodiment, the substituted or unsubstituted phenyl group -C1-C2 alkyl group- is indicates an unsubstituted phenyl group-methyl group, or a substituted or unsubstituted phenyl group-ethyl group. vinegar.

[0102] In another preferred embodiment, the substituted or unsubstituted phenyl group-C1-C2 alkyl group The substituted or unsubstituted phenyl group refers to a monosubstituted or unsubstituted phenyl group.

[0103] In another preferred embodiment, the substituted or unsubstituted phenyl group-C1-C2 alkyl group The substituted or unsubstituted phenyl group refers to a monosubstituted or unsubstituted phenyl group, and the substitution is It refers to ortho, para or meta substitution of the phenyl group.

[0104] In another preferred embodiment, the substituted or unsubstituted phenyl group-C1-C2 alkyl group The substituted or unsubstituted phenyl group refers to a monosubstituted or unsubstituted phenyl group, and the substitution is It refers to ortho-, para- or meta-substitution of a phenyl group. The substituents are halogen atoms, Nitro group, amino group, C1-C4 alkyl group, C1-C4 alkoxy group, C1-C4 alkyl group It refers to the alkylthiol group, F3C-, or F3C-O-.

[0105] In another preferred example, the substituted phenyl group refers to a monosubstituted phenyl group.

[0106] In another preferred embodiment, the substituted or unsubstituted phenyl group -C1-C2 alkyl group- is substituted or unsubstituted phenyl group-methyl group-, or substituted or unsubstituted phenyl group-ethyl group- Refers to...

[0107] Another good example is R 12 and R 13 are each independently a hydrogen atom or a halogen atom , -CN, hydroxyl group, mercapto group, nitro group, amino group, F3C-, F3C-O -, substituted or unsubstituted C1-C8 alkyl group, substituted or unsubstituted C3-C8 cycloalkyl group a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C1-C6 alkoxy group, a substituted or unsubstituted C1-C6 alkyl group a substituted or unsubstituted C6-C12 aryl group; a substituted or unsubstituted 5-12 membered alkyl group; Heteroaryl group, substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1- C6 alkyl group- or substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted represents a C1-C6 alkyl group.

[0108] Another good example is R 12 and R 13 are each independently a hydrogen atom or a halogen atom , -CN, hydroxyl group, mercapto group, nitro group, amino group, F3C-, F3C-O -, substituted or unsubstituted C1-C4 alkyl group, substituted or unsubstituted C3-C6 cycloalkyl a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C1-C4 alkoxy group, a substituted or unsubstituted C1-C4 alkyl group a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-10 membered hydroxyl group, aryl group, substituted or unsubstituted C6-C8 aryl group, substituted or unsubstituted C1-C2 alkyl group, or a substituted or unsubstituted 5-8 membered heteroaryl group, substituted or unsubstituted C1 - represents a C2 alkyl group.

[0109] Another good example is R 12 and R 13 are each independently a hydrogen atom or a halogen atom or a phenyl group.

[0110] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-2. [ka] where R4, R5, R6 and n are as defined above.

[0111] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-3. [ka] where R4, R5, R6 and n are as defined above.

[0112] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-4. [ka] where R4, R5, R6, R 10 , R 11and n is as defined above.

[0113] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-5. [ka] where R4, R5, R6, R 10 , R 11 and n is as defined above.

[0114] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-6. [ka] where R3, R4, R5, R6 and n are as defined above.

[0115] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-7. [ka] where R3 is as defined above; R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom (e.g., Cl, F), methyl group, nitro group, phenyl group, -OCF3, or -CF3.

[0116] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-8. [ka] where R3 is as defined above; R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom (e.g., Cl), a methyl group, a nitro group, or a phenyl group.

[0117] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-9. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1 or 2; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0118] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-10. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1 or 2; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0119] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-11. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1 or 2; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0120] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-12. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1, 2 or 3; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0121] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-13. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1, 2, 3 or 4; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0122] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-14. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1, 2 or 3; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0123] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-15. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1 or 2; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0124] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-16. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1 or 2;

[0125] Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0126] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-17. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1 or 2; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0127] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-18. [ka] where R3, R4, R5, R6 and n are as defined above.

[0128] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-19. [ka] where R3 is as defined above.

[0129] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-20. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1, 2, 3, 4 or 5; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0130] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-21. [ka] where R3 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; a represents 0, 1, 2, 3, 4 or 5; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0131] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-22. [ka] where R3 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; a represents 1, 2, 3, 4 or 5; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0132] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-23. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 1, 2, 3, 4 or 5;

[0133] Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0134] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-24. [ka] where R3 is as defined above; a represents 0, 1, 2, 3, 4 or 5; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0135] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-25. [ka] where R3 is as defined above; a represents 0, 1, 2, 3, 4 or 5; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0136] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-26. [ka] where R 10 , R 11 and ring C is as defined above.

[0137] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-27. [ka] where R 10 , R 11 and ring C is as defined above.

[0138] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-28. [ka] where R 10 and R 11 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. vinegar.

[0139] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-29. [ka] where R 10 and R 11 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. vinegar.

[0140] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-30. [ka] where R 10 and R 11 is as defined above; R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom (e.g., Cl, F), methyl group, nitro group, phenyl group, -OCF3, or -CF3.

[0141] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-31. [ka] where R 10 and R 11 is as defined above; R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom (e.g., Cl, F), methyl group, nitro group, phenyl group, -OCF3, or -CF3.

[0142] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-32. [ka] where R3 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; a represents 0, 1, 2 or 3; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0143] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-33. [ka] where R3 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; a represents 0, 1, 2 or 3; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0144] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-34. [ka] where R3 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; a represents 0, 1, 2 or 3; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0145] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-35. [ka] where R3 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; a represents 0, 1, 2 or 3; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0146] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-36. [ka] where R3 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; a represents 0, 1, 2 or 3; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0147] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-37. [ka] where R3 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; a represents 0, 1, 2 or 3; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0148] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-38. [ka] wherein R3, R4, R5, R6 and n are as defined above; a represents 0, 1, 2 or 3; Each R 18 are independently a hydrogen atom, a halogen atom, a substituted or unsubstituted C-C 4. Alkyl groups, substituted or unsubstituted C6-C12 aryl groups, substituted or unsubstituted C3-C8 a cycloalkyl group, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl group, or a substituted or unsubstituted It represents a substituted 5-8 membered heteroaryl group.

[0149] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-39. [ka] where R 10 and R 11 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. vinegar.

[0150] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-40. [ka] where R4, R5, R6, R 10 , R 11 and n is as defined above; R 19 represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group.

[0151] Another good example is R 19 represents a hydrogen atom or a substituted or unsubstituted C1-C4 alkyl group (e.g., a methyl group).

[0152] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-41. [ka] where R4, R5, R6, R 10 , R 11 and n is as defined above; R 20 represents a hydrogen atom or a halogen atom.

[0153] Another good example is R 19 represents a hydrogen atom or a substituted or unsubstituted C1-C4 alkyl group (e.g., a methyl group).

[0154] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-42. [ka] where R4, R5, R6 and n are as defined above.

[0155] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-43. [ka] where R3 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, a halogen atom ( For example, Cl, F), a methyl group, a nitro group, a phenyl group, -OCF3, or -CF3. death; R 19 represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group.

[0156] Another good example is R 19 represents a hydrogen atom or a substituted or unsubstituted C1-C4 alkyl group (e.g., a methyl group).

[0157] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-44. [ka] where R3 is as defined above; R 14 , R 15 , R 16 and R 17 are each independently a hydrogen atom, -CF3, halo represents a fluorine atom (e.g., Cl, F), a methyl group, a nitro group, a phenyl group, or -OCF3 death; R 19 represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group.

[0158] Another good example is R 19 represents a hydrogen atom or a substituted or unsubstituted C1-C4 alkyl group (e.g., a methyl group).

[0159] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-45. [ka] where R4, R5, R6, R 10 , R 11 and n is as defined above.

[0160] In another preferred embodiment, the structure of the compound of formula I is as shown in structure I-46. [ka] where R4, R5, R6, R 10 , R 11 and n is as defined above.

[0161] In another preferred embodiment, the pharmaceutically acceptable salt of the compound of formula I is a hydrochloride, a galactaic acid salt. , D-glucuronic acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, Tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenesulfonic acid, benzenesulfonic acid an acid selected from any one of acetic acid, aspartic acid, and glutamic acid, or a combination thereof; is a salt formed with a compound of formula I.

[0162] In another preferred embodiment, the compound of formula I has the following structure: [ka] JPEG2025172953000065.jpg189147JPEG2025172953000066.jpg217147JPEG2025172953000067.jpg242147JPEG202 5172953000068.jpg228147JPEG2025172953000069.jpg226147JPEG2025172953000070.jpg217147JPEG20251729530 00071.jpg222147JPEG2025172953000072.jpg238147JPEG2025172953000073.jpg206147JPEG2025172953000074.j pg205147JPEG2025172953000075.jpg209147JPEG2025172953000076.jpg218147JPEG2025172953000077.jpg233147 JPEG2025172953000078.jpg237147JPEG2025172953000079.jpg238147JPEG2025172953000080.jpg232147JPEG202 5172953000081.jpg227147JPEG2025172953000082.jpg228147JPEG2025172953000083.jpg225147JPEG20251729530 00084.jpg240147JPEG2025172953000085.jpg226147JPEG2025172953000086.jpg220147JPEG2025172953000087.j pg239147JPEG2025172953000088.jpg227147JPEG2025172953000089.jpg233147JPEG2025172953000090.jpg115147

[0163] A second aspect of the present invention provides: (a) a compound of formula I according to the first aspect of the present invention, or an optical isomer thereof; (b) a monoisomeric or racemic form thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof; and A composition of the drug comprising a pharmaceutically acceptable carrier is provided.

[0164] A third aspect of the present invention is a method for preparing a composition or formulation for use in the prevention and / or treatment of tumors. a compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, provides for the use of a solvate thereof, or a pharmaceutically acceptable salt thereof.

[0165] In another preferred embodiment, the tumor is lung cancer, pancreatic cancer, breast cancer, lymphoma, prostate cancer, brain tumor, The cancer is selected from leukemia, liver cancer, melanoma, intestinal cancer, kidney cancer, colon cancer, or a combination thereof.

[0166] In another preferred embodiment, the tumor is of human origin.

[0167] In another preferred embodiment, the tumor is a human tumor.

[0168] In another preferred embodiment, the colon cancer comprises colon adenocarcinoma.

[0169] In another preferred embodiment, the permeability transition pore of mitochondria in the cancer cells is made less active.

[0170] In another preferred embodiment, the cancer comprises a cancer in which the mitochondrial permeability transition pore is hypoactive.

[0171] In another preferred embodiment, the low activity of the mitochondrial permeability transition pore is a function of a specific cell (e.g., tumor cell) The activity or expression level of the membrane permeability transition pore A1 in the mitochondrion of the mitochondrion of the mitochondrion cells (cells) and that in normal cells (similar cells) The ratio of the activity or expression level of the mitochondrial permeability transition pore (A1) to the expression level (A0) of the mitochondrial permeability transition pore (A1 / A0) is <1. 0, preferably ≦0.8, and then more preferably ≦0.7, ≦0.6, ≦0 This means that the value is ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1 or ≦0.05.

[0172] In another preferred embodiment, the same cells are those in which the activity of the mitochondrial permeability transition pore is normally expressed. This refers to cells that are similar to tumor cells.

[0173] In another preferred embodiment, the same cells are similar cells, but still have the same permeability transition pore of the mitochondrion. Refers to cells in which the activity is normally expressed.

[0174] In another preferred embodiment, the normal cells are those in which the activity of the mitochondrial permeability transition pore is normally expressed. Normal tissue cells (e.g., tumor-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells) vinegar.

[0175] In another preferred embodiment, the breast cancer comprises triple-negative breast cancer.

[0176] In another preferred embodiment, the liver cancer is undifferentiated or poorly differentiated liver cancer.

[0177] In another preferred embodiment, the leukemia comprises acute myeloid leukemia.

[0178] In another preferred embodiment, the leukemia comprises M4 acute myeloid leukemia.

[0179] In another preferred embodiment, the lung cancer is selected from non-small cell lung cancer, small cell lung cancer, or a combination thereof. It is selected.

[0180] In another preferred embodiment, the lymphoma comprises a B-cell lymphoma.

[0181] In another preferred embodiment, the intestinal cancer comprises rectal adenocarcinoma.

[0182] In another preferred embodiment, the rectal adenocarcinoma is Dukes' type C, grade IV rectal adenocarcinoma. Includes intestinal adenocarcinoma.

[0183] In another preferred embodiment, the brain tumor is glioblastoma, medulloblastoma, or a combination thereof. be selected.

[0184] In another preferred embodiment, the kidney cancer comprises renal clear cell adenocarcinoma.

[0185] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway is upregulated in cancer cells of said cancer. and / or the permeability transition pore of the mitochondrion is rendered less active.

[0186] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway is upregulated in cancer cells of said cancer. will be done.

[0187] In another preferred embodiment, the cancer comprises a cancer in which the mitochondrial oxidative phosphorylation pathway is upregulated.

[0188] In another preferred embodiment, the mitochondrial permeability transition pore is hypoactive in cancer cells of the cancer. do.

[0189] In another preferred embodiment, the upregulation of the mitochondrial oxidative phosphorylation pathway is achieved by upregulating the mitochondrial oxidative phosphorylation pathway in a cell (e.g., The level or expression level of oxidative phosphorylation pathway E1 in mitochondrial cells (tumor cells) and normal cells (similar cells) The ratio between the level or expression level of the oxidative phosphorylation pathway in the mitochondrion (E1 / E0) and that in the mitochondrion (E0) is >1.0, preferably ≥1.2, then more preferably ≥1.5, ≥2, ≧3 or ≧5.

[0190] In another preferred embodiment, the same cells are cultured in a manner that allows normal expression of the mitochondrial oxidative phosphorylation pathway. It refers to cells that are expressed in the tumor (similar tumor cells).

[0191] In another preferred embodiment, the same cells are similar cells, yet the mitochondrial oxidative phosphorylation pathway is Refers to cells in which the level of the tract is normally expressed.

[0192] In another preferred embodiment, the normal cells express normal levels of the mitochondrial oxidative phosphorylation pathway. Normal tissue cells (e.g., tumor-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells) ) refers to

[0193] In another preferred embodiment, the normal cells (or similar tumor cells) are treated with a compound of formula I or an optically active agent thereof. Insensitive to isomers or racemates, or solvates thereof, or pharmaceutically acceptable salts thereof Contains cells.

[0194] In another preferred embodiment, the low activity of the mitochondrial permeability transition pore is a function of a specific cell (e.g., tumor cell) The activity or expression level of the membrane permeability transition pore A1 in the mitochondrion of the mitochondrion of the mitochondrion cells (cells) and that in normal cells (similar cells) The ratio of the activity or expression level of the mitochondrial permeability transition pore (A1) to the expression level (A0) of the mitochondrial permeability transition pore (A1 / A0) is <1. 0, preferably ≦0.8, and then more preferably ≦0.7, ≦0.6, ≦0 This means that the value is ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1 or ≦0.05.

[0195] In another preferred embodiment, the cancer patient is administered an inhibitor of the mitochondrial permeability transition pore to inhibit the growth of cancer cells. It reduces the activity of the permeability transition pore in the mitochondria in the vesicle.

[0196] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore is used to inactivate the mitochondrial permeability transition pore. To make something sexual.

[0197] In another preferred embodiment, the level refers to the protein level and / or the mRNA level. .

[0198] In another preferred embodiment, the expression refers to protein expression and / or mRNA expression.

[0199] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore is Cyclosporin A, a CyP-D protein inhibitor, a peroxide scavenger, or a combination thereof. .

[0200] In another preferred embodiment, the tumor (cancer) is a tumor in which the NNMT gene is underexpressed or not expressed. include.

[0201] In another preferred embodiment, the tumor (cancer) is characterized by hypermethylation of the nucleotide site of the NNMT gene. and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region.

[0202] In another preferred embodiment, the tumor is hypermethylated at the nucleotide site in the NNMT gene. Including tumors.

[0203] In another preferred embodiment, the tumor (cancer) has a high DNA CpG site in the NNMT gene region. Including tumors that are chilled.

[0204] In another preferred embodiment, the NNMT gene is a human-derived NNMT gene.

[0205] In another preferred embodiment, the NNMT gene is a human NNMT gene.

[0206] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed is 1 μg of protein extracted from the sample, then more preferably 5 μg, 10 μg, 100 μg, NNMT protein cannot be detected with NNMT antibody in μg or 1000 μg of protein Refers to a tumor.

[0207] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed is a tumor cell The expression level of the NNMT gene is higher in the same cells or normal cells (e.g., cancerous bladder tissue cells). This refers to a tumor that is smaller than the expression level of the MT gene.

[0208] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed is a tumor cell The expression level of the NNMT gene in the same cells as E1 or in normal cells (e.g., cancerous bladder tissue cells) This refers to a tumor in which the ratio of NNMT gene expression to E0 (E1 / E0) is less than 1.0.

[0209] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed is a tumor in which a certain cell (e.g., The expression level E1 of the NNMT gene in tumor cells is the same as that in normal cells (e.g., cancer cells). The ratio of NNMT gene expression in bladder tissue cells to E0 (E1 / E0) is <1.0 and preferably ≦0.7, and then more preferably ≦0.6, ≦0.5, ≦0. 4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.0 01, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.000000 This refers to a tumor that is 1.

[0210] In another preferred embodiment, the same cells are cells in which the NNMT gene is normally expressed (analogous cells). refers to tumor cells.

[0211] In another preferred embodiment, the identical cells are similar cells, but the NNMT gene is normally expressed. This refers to cells in which the nucleus is expressed.

[0212] In another preferred embodiment, the normal cells are normal tissue cells in which the NNMT gene is normally expressed. (e.g., tumor-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0213] In another preferred embodiment, E0 is a nucleotide sequence of the NNMT gene in a cell in which the NNMT gene is normally expressed. The expression level.

[0214] In another preferred embodiment, the cells in which the NNMT gene is normally expressed are treated with a compound of formula I, or is not an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof Contains cells that are sensitive.

[0215] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated is , the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) Nucleotides of the NNMT gene in the same cell or in normal cells (e.g., cancerous bladder tissue cells) This refers to a tumor that has a higher methylation level than the site.

[0216] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated is , the methylation level L of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) Nucleotide sequences of the NNMT gene in the same cells as in 1 or normal cells (e.g., cancerous bladder tissue cells) The ratio of the methylation level of the methylated site L1 to L0 (L1 / L0) is preferably >1.0. ≧1.2 or ≧1.5, and then more preferably ≧2, ≧3, ≧5, ≧8, ≧10 , ≥ 15, ≥ 20, ≥ 30, or ≥ 50.

[0217] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated is , the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) ≧1%, preferably ≧3%, ≧5%, ≧10%, ≧15% or ≧20%, More preferably, it refers to a tumor with a CR of ≥ 25%, ≥ 30%, ≥ 40% or ≥ 50%.

[0218] In another preferred embodiment, the same cells have a nucleotide site in the NNMT gene that is normally methylated. This refers to cells that are mutated (similar tumor cells).

[0219] In another preferred embodiment, the same cells are similar cells, but still contain nucleotides of the NNMT gene. This refers to cells in which the methylation site is normally methylated.

[0220] In another preferred embodiment, the normal cell has a nucleotide site in the NNMT gene that is normally methylated. Normal tissue cells (e.g., tumor-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells) that are transformed refers to the cell).

[0221] In another preferred embodiment, the nucleotide site of the NNMT gene is normally methylated. The cell is a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutical This includes cells that are insensitive to physiologically acceptable salts.

[0222] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated is , the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., tumor cell) ( M%) is ≧3% and M1% or less, where M1 is any positive integer between 3 and 100. Refers to a tumor.

[0223] In another preferred example, M1 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 5 0, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0224] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene is The number of methylated nucleotides in the MT gene region and all nucleotides in the NNMT gene region were It refers to the ratio between the number of punches.

[0225] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene is Contains the methylation level of nucleotide sites in the MT gene promoter region.

[0226] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is SEQ ID NO: 1 Shown in D NO:1.

[0227] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene is The region from 1050 bp before the transcription start site of the MT gene to 499 bp after the transcription start site It includes the methylation level of the nucleotide site within the region.

[0228] In another preferred embodiment, the sequence from 1050 bp before the transcription start site of the NNMT gene to the transcription start site The region up to 499 bp following the nucleotide sequence shown in SEQ ID NO:1 It is ranked 951st to 2500th.

[0229] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene is The region from 1050 bp before the transcription start site of the MT gene to 193 bp before the transcription start site The methylation level of the nucleotide site within the sequence.

[0230] In another preferred embodiment, the sequence from 1050 bp before the transcription start site of the NNMT gene to the transcription start site The region up to 193 bp before the nucleotide sequence shown in SEQ ID NO:1 is It is ranked 51st to 1808th.

[0231] In another preferred embodiment, the DNA CpG sites in the NNMT gene region are hypermethylated. Tumors are characterized by the methylation of DNA CpG sites in the NNMT gene region of certain cells (e.g., tumor cells). The level of transcription of the NNMT gene region in the same cell or in normal cells (e.g., cancerous bladder tissue cells) This refers to a tumor that has a higher level of methylation of DNA CpG sites in the region.

[0232] In another preferred embodiment, the DNA CpG sites in the NNMT gene region are hypermethylated. Tumors are characterized by the methylation of DNA CpG sites in the NNMT gene region of certain cells (e.g., tumor cells). The NNMT gene expression level in the same cells as those at W1 or in normal cells (e.g., cancerous bladder tissue cells) The ratio of the methylation level of the DNA CpG sites in the chromosome region to W0 (W1 / W0) is >1. 0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30, or ≧50.

[0233] In another preferred embodiment, the DNA CpG sites in the NNMT gene region are hypermethylated. Tumors are characterized by the methylation of DNA CpG sites in the NNMT gene region of certain cells (e.g., tumor cells). The level of ionization is ≧1%, preferably ≧3%, ≧5%, ≧10%, ≧15% or ≧20%. and more preferably ≥ 25%, ≥ 30%, ≥ 40% or ≥ 50%. Refers to...

[0234] In another preferred embodiment, the same cells have normal DNA CpG sites in the NNMT gene region. This refers to cells that are methylated (similar tumor cells).

[0235] In another preferred embodiment, the same cells are similar cells, but still contain the DNA of the NNMT gene region. A refers to cells in which CpG sites are normally methylated.

[0236] In another preferred embodiment, the normal cells have normal DNA CpG sites in the NNMT gene region. Normal tissue cells (e.g., tumor-derived cells, tumor-adjacent cells, or cancerous bladder) that are methylated bladder tissue cells).

[0237] In another preferred embodiment, the DNA CpG sites in the NNMT gene region are normally methylated. The cells are treated with a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or This includes cells that are insensitive to its pharmaceutically acceptable salts.

[0238] In another preferred embodiment, the DNA CpG sites in the NNMT gene region are hypermethylated. Tumors are characterized by the methylation of DNA CpG sites in the NNMT gene region of certain cells (e.g., tumor cells). The molten level (M%) is ≥ 3% and M2% or less, where M2 is any positive value between 3 and 100. refers to a tumor that is an integer.

[0239] In another preferred example, M2 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 5 0, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0240] In another preferred embodiment, the methylation level of the CpG site is determined by measuring the methylation level of a certain gene region. The ratio between the number of CpG nucleotides and the total number of nucleotides in the gene region is vinegar.

[0241] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is The number of methylated CpG nucleotides in the NNMT gene region and the NNMT gene region It refers to the ratio between the number of all nucleotides in a sequence.

[0242] In another preferred embodiment, the methylation level of the CpG site is determined by measuring the methylation level of a certain gene region. The ratio between the number of CpG nucleotides in the gene region and the total number of CpG nucleotides in the gene region. Refers to the rate.

[0243] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is The number of methylated CpG nucleotides in the NNMT gene region and the NNMT gene region This refers to the ratio between the number of all CpG nucleotides in a sequence.

[0244] In another preferred embodiment, the methylation level of the DNA CpG site is determined by measuring the methylation level of the DNA in a certain region. It refers to the ratio between the number of CpG sites identified and the total number of CpG sites in the DNA of the region. vinegar.

[0245] In another preferred embodiment, the methylation level of the DNA CpG site is determined by measuring the methylation level of the DNA in a certain region. Between the number of CpG nucleotides bound to the region and the total number of nucleotides in the DNA This refers to the ratio of

[0246] In another preferred embodiment, the methylation level of the DNA CpG site is determined by measuring the methylation level of the DNA in a certain region. The number of CpG nucleotides bound to the region and the total number of CpG nucleotides in the DNA It refers to the ratio between

[0247] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , the number of methylated CpG sites in the DNA of the NNMT gene region and the It refers to the ratio between the number of all CpG sites in DNA.

[0248] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , the number of methylated CpG nucleotides in the DNA of the NNMT gene region and the NNMT gene It refers to the ratio between the number of all CpG nucleotides in the DNA of a given region.

[0249] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , including the methylation level of DNA CpG sites in the NNMT gene promoter region.

[0250] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is SEQ ID NO: 1 Shown in D NO:1.

[0251] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site. The methylation level of DNA CpG sites within the region is included.

[0252] In another preferred embodiment, the sequence from 1050 bp before the transcription start site of the NNMT gene to the transcription start site The region up to 499 bp following the nucleotide sequence shown in SEQ ID NO:1 It is ranked 951st to 2500th.

[0253] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site The methylation level of DNA CpG sites within the region is included.

[0254] In another preferred embodiment, the sequence from 1050 bp before the transcription start site of the NNMT gene to the transcription start site The region up to 193 bp before the nucleotide sequence shown in SEQ ID NO:1 is It is ranked 51st to 1808th.

[0255] In another preferred embodiment, the tumor is selected from the group consisting of lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, and pancreatic cancer. The cancer is selected from pancreatic cancer, liver cancer, prostate cancer, or a combination thereof.

[0256] In another preferred embodiment, the expression comprises protein expression and / or mRNA expression.

[0257] In another preferred embodiment, the composition is a pharmaceutical composition.

[0258] In another preferred embodiment, the composition or formulation further comprises a pharmaceutically acceptable carrier.

[0259] In another preferred embodiment, the expression is mRNA expression or protein expression.

[0260] In another preferred embodiment, the composition or preparation is in the form of a solid, liquid or semi-solid.

[0261] In another preferred embodiment, the composition or preparation is an oral preparation, an external preparation, or an injectable preparation. .

[0262] In another preferred embodiment, the composition or preparation is in the form of a tablet, an injection, an infusion, an ointment, or a gel. The formulation is a tablet, solution, pill or film.

[0263] In another preferred embodiment, the composition is a pharmaceutical composition.

[0264] In another preferred embodiment, the composition or formulation further comprises a pharmaceutically acceptable carrier.

[0265] The fourth aspect of the present invention is applied to the preparation of a composition or formulation for enhancing the anticancer effect of an anticancer agent. The present invention provides the use of inhibitors of the mitochondrial permeability transition pore.

[0266] In another preferred embodiment, the anti-cancer agent is a compound of formula I according to the first aspect of the invention, or The compound may be an optical isomer or a racemate, or a solvate thereof, or a pharmaceutically acceptable salt thereof. do.

[0267] In another preferred embodiment, the cancer is as described in the first aspect of the invention.

[0268] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore is Cyclosporin A, a CyP-D protein inhibitor, a peroxide scavenger, or a combination thereof. .

[0269] In another preferred embodiment, the CyP-D protein inhibitor is selected from the group consisting of SfA, BKA, and ADP(A Small molecules that regulate the activity of NT proteins.

[0270] In another preferred embodiment, the peroxide scavenger is propofol, pyruvate, M CI-186 or a combination thereof.

[0271] A fifth aspect of the present invention provides an active ingredient combination comprising: (1) a first active ingredient as an anticancer agent; and (2) A second active ingredient that acts as an inhibitor of the mitochondrial membrane permeability transition pore.

[0272] In another preferred embodiment, the molar ratio between the first active ingredient and the second active ingredient is 0.01- 600:1, preferably 0.05-500:1, and then even more preferably 0. 1-400:1, 0.2-200:1, 0.5-100:1, 0.5-80:1 or 1- The ratio is 50:1.

[0273] In another preferred embodiment, the active ingredient combination has at least one independent active ingredient. .

[0274] In another preferred embodiment, the combination of active ingredients includes a first active ingredient and a second active ingredient. It is independent of other companies.

[0275] A sixth aspect of the present invention provides a composition comprising the following components: (1) a first active ingredient as an anticancer agent; and (2) A second active ingredient that acts as an inhibitor of the mitochondrial membrane permeability transition pore.

[0276] In another preferred embodiment, the composition is a pharmaceutical composition.

[0277] In another preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0278] In another preferred embodiment, the content of the first active ingredient relative to the total weight of the active ingredients in the composition is: 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and More preferably, it is 1-99 wt%, 10-99 wt%, or 20-99 wt%.

[0279] In another preferred embodiment, the content of the second active ingredient relative to the total weight of the active ingredients in the composition is: 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and More preferably, it is 1-99 wt%, 10-99 wt%, or 20-99 wt%.

[0280] A seventh aspect of the present invention provides a medical kit comprising the following formulation: (A) a first formulation containing a first active ingredient as an anticancer agent; and (B) A second formulation comprising a second active ingredient that is an inhibitor of the mitochondrial permeability transition pore.

[0281] In another preferred embodiment, the medical kit further comprises an instruction manual.

[0282] In another preferred embodiment, the first formulation and the second formulation are independent of each other.

[0283] In another preferred embodiment, the first and second formulations are combined with each other.

[0284] In another preferred embodiment, the instruction manual includes a step of administering the first formulation and the second formulation in combination to an anti-cancer agent. It is pointed out that this enhances the antitumor activity of the agent.

[0285] In another preferred embodiment, the combination method comprises first administering to a subject a second agent containing an inhibitor of the mitochondrial permeability transition pore. The formulation is administered first, followed by the anti-cancer drug.

[0286] An eighth aspect of the present invention provides an in vitro non-therapeutic and non-diagnostic method for inhibiting cancer cells. The method comprises treating the cancer cells with a compound of formula I according to the first aspect of the invention, or an optical isomer thereof. and contacting cancer cells with the compound or racemate, or a solvate thereof, or a pharmaceutically acceptable salt thereof. The method includes the step of inhibiting the

[0287] In another preferred embodiment, the contacting is an in vitro culture contacting.

[0288] A ninth aspect of the present invention provides a method for preventing and / or treating cancer, said method comprising the steps of: a compound of formula I according to the first aspect, or an optical isomer or racemate thereof, or a solvate thereof; or a pharmaceutically acceptable salt thereof, or a combination of active ingredients according to the fifth aspect of the invention, or The composition according to the sixth aspect of the present invention or the medical kit according to the seventh aspect of the present invention may be and administering the composition to a subject in need thereof to prevent and / or treat cancer.

[0289] In another preferred embodiment, the subject is a mammal, including humans and non-humans (e.g., rodents, rabbits, monkeys, livestock, dogs, and cats).

[0290] A tenth aspect of the present invention is a compound of formula I according to the first aspect of the present invention, or an optical isomer thereof. or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof is used for the prevention and treatment of tumor patients. and / or providing a marker for determining whether the subject is suitable for treatment; the marker may be a marker for determining whether the subject is suitable for treatment; The metabolic phosphorylation pathway, the mitochondrial permeability transition pore, the NNMT gene, and the nucleotide sequence of the NNMT gene. Methylation levels of nucleotide sites and / or DNA CpG sites in the NNMT gene region It has a level of customization.

[0291] In another preferred embodiment, the marker is an expression level of the mitochondrial oxidative phosphorylation pathway, The activity of the membrane permeability transition pore, the expression level of the NNMT gene, and the nucleotide site of the NNMT gene Methylation level and / or DNA CpG site methylation level of the NNMT gene region Prepare.

[0292] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , refers to the methylation level of DNA CpG sites in the NNMT gene promoter region.

[0293] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site. It refers to the methylation level of DNA CpG sites in the region.

[0294] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site In another preferred example, the methylation level of the DNA CpG sites in the region of a tumor in a tumor patient is In tumor cells, the mitochondrial oxidative phosphorylation pathway is upregulated, which is a first aspect of the present invention. A compound of formula I as defined above, or an optical isomer or racemate thereof, or a solvate thereof, or a drug thereof The physiologically acceptable salts are suitable for the prevention and / or treatment of tumor patients.

[0295] In another preferred example, the permeability transition pore of mitochondria is hypoactive in tumor cells of tumor patients. and then producing a compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof for the prevention and / or treatment of a tumor patient. It becomes suitable for.

[0296] In another preferred embodiment, the NNMT gene is underexpressed or not expressed in tumor cells of a tumor patient. and the nucleotide site of the NNMT gene is hypermethylated, and / or the NNMT gene When the DNA CpG sites in the region are hypermethylated, the compound of formula I according to the first aspect of the invention or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof The salts become suitable for the prevention and / or treatment of patients with the tumor.

[0297] In another preferred embodiment, the NNMT gene is highly expressed in tumor cells of a tumor patient, and NNMT gene is expressed in tumor cells of a tumor patient. The nucleotide site of the MT gene is hypomethylated and / or the DNA of the NNMT gene region is A CpG site is hypomethylated, and the compound of formula I according to the first aspect of the invention, or The optical isomer or racemate of the compound, or a solvate thereof, or a pharmaceutically acceptable salt thereof is This makes them unsuitable for the prevention and / or treatment of cancer patients.

[0298] An eleventh aspect of the present invention provides a detection kit, comprising: (i) At the level of the mitochondrial oxidative phosphorylation pathway, at the level of the mitochondrial permeability transition pore, and at the level of NN Expression level of MT gene and / or methylation level of DNA CpG site in NNMT gene region The device is provided with a detection reagent used to detect the antibody.

[0299] In another preferred embodiment, the level refers to the protein level and / or the mRNA level. .

[0300] In another preferred embodiment, the detection sample of the detection kit contains tumor cells.

[0301] In another preferred embodiment, NNMT gene expression is determined by mRNA expression or protein expression of the gene. Refers to the present.

[0302] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , including the methylation level of DNA CpG sites in the NNMT gene promoter region.

[0303] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site. This refers to the methylation level of DNA CpG sites within a region.

[0304] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region is , from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site It refers to the methylation level of DNA CpG sites in the region.

[0305] A twelfth aspect of the present invention relates to a method for producing a companion detection kit according to the eleventh aspect of the present invention. The accompanying detection kit comprises a compound of formula I according to the first aspect of the present invention. The compound, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof This is used to determine whether the salt is suitable for the prevention and / or treatment of tumor patients.

[0306] In another preferred embodiment, the companion detection kit further comprises an instruction manual or label.

[0307] In another preferred embodiment, the instructions or label include: The mitochondrial oxidative phosphorylation pathway is upregulated in tumor cells from tumor patients, and this study A compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof. The compound or a pharmaceutically acceptable salt thereof is suitable for the prevention and / or treatment of tumor patients. Please state what will happen.

[0308] In another preferred embodiment, the instructions or label include: In tumor cells of tumor patients, the permeability transition pore of mitochondria is made less active, and the present invention a compound of formula I according to the first aspect, or an optical isomer or racemate thereof, or a solvate thereof; or a pharmaceutically acceptable salt thereof, which is suitable for the prevention and / or treatment of tumor patients. Describe the contents.

[0309] In another preferred embodiment, the instructions or label include: In tumor cells of tumor patients, the NNMT gene is underexpressed or not expressed, and The nucleotide site is hypermethylated and / or the DNA Cp of the NNMT gene region When the G site is hypermethylated, the compound of formula I according to the first aspect of the present invention, or an optically isomeric The mono or racemic form, or a solvate thereof, or a pharmaceutically acceptable salt thereof is administered to the tumor patient. Describe what makes it suitable for prevention and / or treatment.

[0310] In another preferred embodiment, the instructions or label include: The NNMT gene is highly expressed in tumor cells of tumor patients, and NNMT gene nucleotides are The nucleotide sites are hypomethylated and / or the DNA CpG sites in the NNMT gene region are hypomethylated. Upon methylation, the compound of formula I according to the first aspect of the invention, or an optical isomer or lasing thereof, The semiconjugate, or a solvate thereof, or a pharmaceutically acceptable salt thereof is used for the prevention and / or treatment of tumor patients. Or describe the content that makes the patient unsuitable for treatment.

[0311] A thirteenth aspect of the present invention provides a medical kit, comprising: (i) At the level of the mitochondrial oxidative phosphorylation pathway, at the level of the mitochondrial permeability transition pore, and at the level of NN The expression level of the MT gene, the methylation level of the nucleotide site of the NNMT gene, and / or A test used to detect the methylation level of DNA CpG sites in the NMT gene region. Extraction reagent and (ii) a compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof; or a solvate thereof, or a pharmaceutically acceptable salt thereof.

[0312] In another preferred embodiment, the medical kit further comprises an instruction manual or label.

[0313] In another preferred embodiment, the instructions or label include: The mitochondrial oxidative phosphorylation pathway is upregulated in tumor cells from tumor patients, and this study A compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof. The compound or a pharmaceutically acceptable salt thereof is suitable for the prevention and / or treatment of tumor patients. Please state what will happen.

[0314] In another preferred embodiment, the instructions or label include: In tumor cells of tumor patients, the permeability transition pore of mitochondria is made less active, and the present invention a compound of formula I according to the first aspect, or an optical isomer or racemate thereof, or a solvate thereof; or a pharmaceutically acceptable salt thereof, which is suitable for the prevention and / or treatment of tumor patients. Describe the contents.

[0315] In another preferred embodiment, the instructions or label include: In tumor cells of tumor patients, the NNMT gene is underexpressed or not expressed, and The nucleotide site is hypermethylated and / or the DNA Cp of the NNMT gene region When the G site is hypermethylated, the compound of formula I according to the first aspect of the present invention, or an optically isomeric The mono or racemic form, or a solvate thereof, or a pharmaceutically acceptable salt thereof is administered to the tumor patient. Describe what makes it suitable for prevention and / or treatment.

[0316] In another preferred embodiment, the instructions or label include: The NNMT gene is highly expressed in tumor cells of tumor patients, and NNMT gene nucleotides are The nucleotide sites are hypomethylated and / or the DNA CpG sites in the NNMT gene region are hypomethylated. Upon methylation, the compound of formula I according to the first aspect of the invention, or an optical isomer or lasing thereof, The semiconjugate, or a solvate thereof, or a pharmaceutically acceptable salt thereof is used for the prevention and / or treatment of tumor patients. Or describe the content that makes the patient unsuitable for treatment.

[0317] A fourteenth aspect of the present invention is a compound of formula I according to the first aspect of the present invention, or an optical isomer thereof. The isomer or racemate, or a solvate thereof, or a pharmaceutically acceptable salt thereof, is used when necessary. Methods for preventing and / or treating tumors are provided for application to a subject.

[0318] In another preferred embodiment, the tumor is as described in the first aspect of the invention.

[0319] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway is upregulated in cancer cells of said cancer. and / or the permeability transition pore of the mitochondrion is rendered less active.

[0320] In another preferred embodiment, the subject's tumor is a tumor in which the NNMT gene is underexpressed or not expressed. include.

[0321] In another preferred embodiment, the subject's tumor is hypermethylated at a nucleotide site in the NNMT gene. This includes tumors that are

[0322] In another preferred embodiment, the subject's tumor has a high DNA CpG site in the NNMT gene region. Including tumors that are chilled.

[0323] In another preferred embodiment, the subject is a mammal, including humans and non-humans (e.g., rodents, rabbits, monkeys, livestock, dogs, and cats).

[0324] A fifteenth aspect of the present invention provides an apparatus or system, the apparatus or system comprising: (i) At the level of the mitochondrial oxidative phosphorylation pathway, at the level of the mitochondrial permeability transition pore, and at the level of NN Expression level of MT gene and / or methylation level of DNA CpG site in NNMT gene region a detection module used to detect the (ii) an output module. The output module includes: The mitochondrial oxidative phosphorylation pathway is upregulated in tumor cells from tumor patients, and this study A compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof. The compound or a pharmaceutically acceptable salt thereof is suitable for the prevention and / or treatment of tumor patients. Information that will become; In another preferred example, the permeability transition pore of mitochondria is hypoactive in tumor cells of tumor patients. and then producing a compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof for the prevention and / or treatment of a tumor patient. Information that will be suitable for; In tumor cells of tumor patients, the NNMT gene is underexpressed or not expressed, and The nucleotide site is hypermethylated and / or the DNA Cp of the NNMT gene region When the G site is hypermethylated, the compound of formula I according to the first aspect of the present invention, or an optically isomeric The mono or racemic form, or a solvate thereof, or a pharmaceutically acceptable salt thereof is administered to the tumor patient. information that makes it suitable for prevention and / or treatment; and / or The NNMT gene is highly expressed in tumor cells of tumor patients, and NNMT gene nucleotides are The nucleotide sites are hypomethylated and / or the DNA CpG sites in the NNMT gene region are hypomethylated. Upon methylation, the compound of formula I according to the first aspect of the invention, or an optical isomer or lasing thereof, The semiconjugate, or a solvate thereof, or a pharmaceutically acceptable salt thereof is used for the prevention and / or treatment of tumor patients. Or, information that the patient will become unsuitable for treatment is output.

[0325] In another preferred embodiment, the device comprises a gene detector or a protein detector.

[0326] In another preferred embodiment, the device or system further comprises a sample supply module.

[0327] In another preferred embodiment, the sample supply module is used to supply a tumor cell extract. can be.

[0328] In another preferred embodiment, the device or system further comprises a data processing module.

[0329] In another preferred embodiment, the data processing module is Methylation levels of DNA CpG sites in the NNMT gene region and their numerical range get.

[0330] In another preferred embodiment, the data processing module is The methylation level of DNA CpG sites in the NNMT gene promoter region was analyzed. Obtain the numerical range of these.

[0331] In another preferred embodiment, the data processing module is From 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site The methylation levels of DNA CpG sites within the region are processed to obtain their numerical ranges.

[0332] In another preferred embodiment, the data processing module is From 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site The methylation levels of DNA CpG sites within a region are processed to obtain their numerical ranges.

[0333] Within the scope of the present invention, the above technical features of the present invention may be further modified to include the following specific technical features (e.g. , Examples) constitute a new or preferred technical solution. Due to the limited size of the full text, it will not be repeated here. [Brief explanation of the drawings]

[0334] [Figure 1]FIG. 1 shows the expression of the NNMT gene in sensitive and insensitive tumor cells. [Figure 2] FIG. 2 shows the methylation levels of DNA CpG sites in the NNMT gene promoter region in sensitive and insensitive tumor cells. [Figure 3] FIG. 3 shows the methylation levels of DNA CpG sites in the region from 1050 bp before the transcription start site to 499 bp after the transcription start site of the NNMT gene in sensitive and insensitive tumor cells. [Figure 4] FIG. 4 shows the methylation levels of DNA CpG sites in the region from 1050 bp before to 193 bp before the transcription start site in sensitive and insensitive tumor cells. DETAILED DESCRIPTION OF THE INVENTION

[0335] As a result of long-term and in-depth research and numerous selections, the present inventors have found a specific compound ( A compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof It has been unexpectedly discovered that the compounds of the present invention (including their acceptable salts) effectively inhibit tumor growth. The substance inhibits the activity of tumor cells with inactivation of the mitochondrial oxidative phosphorylation pathway (mPTP) at low concentrations (IC 50), which is unexpectedly found to be a significant inhibitor of mPTP. It has a strong inhibitory effect on tumor cells with low or inactive mPTP activity, but They pointed out that mPTP has a weak inhibitory effect on certain tumor cells. The compounds of the present invention have a weak effect on normal somatic cells, so they are not suitable for sale. Maintains good drug safety.

[0336] The present inventors have investigated the low (or non-expression) of the NNMT gene, the nucleotide sequence of the NNMT gene, and Hypermethylation of CpG sites in the NNMT gene region and / or DNA It was unexpectedly discovered for the first time that the compounds of the present invention have a clear inhibitory effect on tumor cells. NNMT gene expression level, methylation level of nucleotide site of NNMT gene and / or the methylation level of DNA CpG sites in the NNMT gene promoter region, A marker for determining whether the compound of the present invention is suitable for the prevention and / or treatment of tumor patients. The present inventor has accomplished the present invention based on this.

[0337] (term) As used herein, the terms "including," "comprising," and "having" are used interchangeably. In addition to the closed definition, there are also semi-closed and open definitions that may be used in practice. In other words, the term "consists of" or "essentially consists of" It includes the meaning of "composed of."

[0338] The terms "anti-cancer agent" and "anti-tumor agent" may be used interchangeably.

[0339] The terms "cancer," "carcinosis," and "tumor" may be used interchangeably.

[0340] As used herein, the term "a cell" refers to a single cell (e.g., a single cancer cell). It refers to a group of cells (such as a single cell) or a group of similar cells (e.g., tumor tissue).

[0341] "I C 50 The term "50% inhibiting concentration" refers to It stands for "inhibition", i.e., the concentration of inhibitor at which 50% inhibitory effect is achieved. do.

[0342] As used herein, "IC50" and "IC 50 The terms " and " are used interchangeably. It may be used at a 50% inhibiting concentration. ation), that is, the concentration of inhibitor at which 50% inhibitory effect is achieved.

[0343] The term "mitochondrial permeability transition pore" is used to refer to mPTP (mitochondrial permeability transition pore). It is abbreviated as rheological transition pore.

[0344] The term "mitochondrial oxidative phosphorylation pathway" is now used to refer to OXPHOS (Oxidative Phosphorylation Pathway). It is also called oxidative phosphorylation.

[0345] As used herein, "DNA CpG sites are hypermethylated" and "DNA "High methylation of CpG sites" and "high DNA CpG site methylation levels" are mutually exclusive. May be used interchangeably.

[0346] As used herein, "DNA CpG sites are hypomethylated" and "DNA "CpG site hypomethylation" and "DNA CpG site low methylation level" are used interchangeably It may be used.

[0347] As used herein, the term "methylation level of a DNA CpG site" means Between the number of methylated CpG sites in a DNA region and the number of all CpG sites in that region This refers to the ratio of

[0348] As used herein, "methylation of DNA CpG sites" and "CpG nucleotide The terms "CpG methylation" and "CpG methylation" may be used interchangeably.

[0349] As used herein, "the compounds of the present invention are suitable for tumor patients" means that the compounds of the present invention are suitable for tumor patients. This means that the tumor is sensitive to the compounds of the present invention.

[0350] As used herein, "the compounds of the present invention are not suitable for tumor patients" means that the compounds of the present invention are not suitable for tumor patients. This means that the tumor is insensitive to the compounds of the present invention.

[0351] As used herein, the English name for the term "NNMT" is Nicotinamide de N-Methyltransferase.

[0352] As used herein, the term "bp" refers to a base pair. means.

[0353] As used herein, the term "SST" refers to the transcription start site.

[0354] Those skilled in the art will readily recognize the substituents and substitution patterns on the compounds of this invention to prepare chemically stable compounds. The compound can be synthesized by techniques known in the art and the methods described below. It should be understood that when substituted with one or more substituents, These substituents can be located on the same carbon or on different carbons as long as they produce a stable structure. It should be understood that:

[0355] As used herein, the term "substituted" or "substituted" refers to a hydrogen atom on a group of atoms. The atoms are replaced with non-hydrogen groups, but their valences must be satisfied and the substitution A more chemically stable compound, i.e., a compound that does not spontaneously undergo transformations such as cyclization or elimination, is selected. It means to generate.

[0356] As used herein, "R1", "R1" and "R 1 " have the same meaning and are interchangeable. may be used interchangeably and other similar definitions have the same meaning.

[0357] As used herein, [ka] represents the bonding site of the atomic group.

[0358] As used herein, the term "alkyl group" refers to a straight-chain ( i.e., unbranched), or branched saturated hydrocarbon groups, or a combination of straight and branched chain groups The presence of a carbon number restriction before the alkyl group (e.g., a C1-C6 alkyl group) indicates that The alkyl group has 1 to 6 carbon atoms, for example, C1-C4 alkyl. The alkyl group refers to an alkyl group containing 1 to 4 carbon atoms. Representative examples of these alkyl groups are: , methyl group, ethyl group, propyl group, isopropyl group, butyl group, isobutyl group, s-butyl group Examples of suitable alkyl groups include, but are not limited to, ethyl, t-butyl, or similar groups.

[0359] As used herein, the term "C2-C4 alkenyl group" refers to one or more From a linear or branched alkene molecule of 2 to 4 carbon atoms with a double bond, These are hydrocarbyl groups formed by the loss of one hydrogen atom from a bond. Contains a vinyl group (CH2=CH-), (C(CH3)2=CH-), or a similar group of atoms.

[0360] As used herein, the term "C2-C4 alkynyl group" refers to one or more From a linear or branched alkene molecule of 2 to 4 carbon atoms with a triple bond, These are hydrocarbyl groups formed by the loss of one hydrogen atom from a bond. Contains an ethynyl group (CH≡CH—), (H3C—C≡CH—), or a similar group.

[0361] In the present invention, the term "halogen atom" refers to F, Cl, Br or I.

[0362] In the present invention, "halogenated" refers to being replaced with a halogen atom.

[0363] As used herein, the term "halogenated alkyl group" refers to a group having one or more alkyl groups. One or more (preferably one, two, three or four) hydrogen atoms are replaced by halogen atoms. The alkyl group and halogen atom are as defined above. The halogenated alkyl group must be specified by the number of carbon atoms (e.g., C1-C8 halogenated alkyl group). The halogenated alkyl group has 1 to 8 carbon atoms, for example, , C1-C6 halogenated alkyl group is a halogenated alkyl group containing 1 to 6 carbon atoms Representative examples of these halogenated alkyl groups are -CF3, -CHF2, monofluoro Examples of suitable fluorinated groups include, but are not limited to, isopropyl difluoride, butyl difluoride, or similar groups. .

[0364] As used herein, the term "cycloalkyl ring" refers to a ring that is fully saturated or partially saturated. It refers to a monocyclic, bicyclic or polycyclic (fused, bridged or spiro) ring system. The restriction of the number of carbon atoms (e.g., C3-C12) before the cycloalkyl ring is intended to In some preferred embodiments, "C The term "3-C8 cycloalkyl ring" refers to a fully saturated ring containing from 3 to 8 ring carbon atoms. or a partially saturated monocycloalkyl ring or dicycloalkyl ring, a cyclopropyl ring cyclobutyl ring, cycloamyl ring, cycloheptyl ring or similar ring. A "chloroalkyl ring" is a bicyclic ring that shares one carbon atom (called a spiro atom) between the monocyclic rings. or polycyclic rings, which may contain one or more double bonds, The rings also do not have a completely conjugated π-electron system. "Fused cycloalkyl rings" are rings in which each ring in the system is conjugated to another ring in the system. refers to an all-carbon bicyclic or polycyclic ring of an adjacent pair of carbon atoms shared with the ring of The rings may contain one or more double bonds, but the adjacent pair of double bonds that connect the main chains are shared. The carbon atoms in the carbon atom are adjacent pairs of carbon atoms on an all-carbon bicyclic or polycyclic ring having a non-conjugated π-electron system. A "bridged cycloalkyl ring" is a ring in which any two rings are joined by two carbon atoms that are not directly connected. Refers to all-carbon polycyclic rings that share carbon atoms, and such rings may contain one or more double bonds. However, none of the rings has a completely conjugated π-electron system. Representatives of these cycloalkyl rings are Examples are a cyclopropyl ring, a cyclobutyl ring, a cycloamyl ring, a cycloheptyl ring or similar. rings, but are not limited to these.

[0365] As used herein, the term "cycloalkyl group" refers to a group that is fully saturated or partially saturated. It refers to a monocyclic, bicyclic or polycyclic (fused, bridged or spiro) ring group of atoms. The carbon number specified before the alkyl group (e.g., C3-C12) is used to In some preferred embodiments, the alkyl group has 3 to 12 ring carbon atoms. The term "C3-C8 cycloalkyl group" refers to a complete group having from 3 to 8 ring carbon atoms. It refers to a fully saturated or partially saturated monocycloalkyl or dicycloalkyl group, The alkyl group includes a cyclopropyl group, a cyclobutyl group, a cycloamyl group, a cycloheptyl group, or a similar group. "Spirocycloalkyl groups" are groups that share one carbon atom (called a spiro atom) between two rings. refers to a bicyclic or polycyclic group of atoms used in the Although there is a possibility that the cycloalkyl group may have a conjugated π-electron system, none of the groups have a completely conjugated π-electron system. is an all-carbon bicyclic or polycyclic ring in which each ring in the system shares an adjacent pair of carbon atoms with other rings in the system. refers to a ring group in which one or more rings may contain one or more double bonds. The point of attachment to the main chain must be located at a carbon atom on a ring with a non-conjugated π electron system. A "bridged cycloalkyl group" is a group in which any two rings share two carbon atoms that are not directly connected. refers to an all-carbon polycyclic group of atoms, which may contain one or more double bonds. However, none of the rings has a completely conjugated π-electron system. teeth, [ka] Including, but not limited to:

[0366] As used herein, the term "halogenated cycloalkyl group" refers to a cycloalkyl group. One or more (preferably one, two, three or four) hydrogen atoms of the alkyl group are halogenated. The cycloalkyl group and the halogen atom are as defined above. The cycloalkyl group must be specified by the number of carbon atoms (e.g., C3-C8 halo). The cycloalkyl group (a substituted cycloalkyl group) is a group in which the cycloalkyl group has 3 to 8 ring carbon atoms. For example, a C3-C8 halogenated cycloalkyl group has 3 to 8 ring carbon atoms. These halogenated cycloalkyl groups refer to halogenated cycloalkyl groups containing hydrogen atoms. Representative examples of the cyclopropyl monofluoride group, the cyclobutyl monochloride group, the cyclobutyl monofluoride group, These include, but are not limited to, fluoroamyl, difluorocycloheptyl, or similar groups. stomach.

[0367] The term "alkoxyl group" refers to the group R—O—, where R is an alkyl group. The alkyl group is as defined above. The alkoxy group may be specified by the number of carbon atoms before the alkoxy group. and (for example, a C1-C8 alkoxyl group) means that the alkoxyl group has one alkyl group. A typical example of such an alkoxy group is a methoxy group. , ethoxyl group, N-propoxy group, isopropoxy group, t-butoxy group or similar atoms Including, but not limited to, groups.

[0368] As used herein, the term "alkylthiol group" refers to an R—O group. where R is an alkyl group. The alkyl group is as defined above. The restriction of the number of carbon atoms before the ol group (e.g., C1-C8 alkoxyl group) is This means that the alkyl group in the alkylthiol group has 1 to 8 carbon atoms. Representative examples of the alkylthiol group include a methylthio group, an ethylthio group, an N-propylthio group, This includes, but is not limited to, isopropylthio, t-butylthiol, or similar groups. I can't.

[0369] As used herein, the term "halogenated alkoxyl group" means a halogenated The halogenated alkyl group is defined as above. For example, A C1-C6 halogenated alkoxy group is a halogenated alkoxy group having 1 to 6 carbon atoms. Representative examples of these halogenated alkoxyl groups include monofluoromethoxy groups and The group includes, but is not limited to, a silyl group, a monofluoroethoxy group, a difluorobutoxy group, or a similar atomic group. Not limited to.

[0370] As used herein, the term "halogenated alkylthiol group" means a halogenated alkylthiol group. The halogenated alkyl group -S- is defined as above. For example, a C1-C6 halogenated alkylthiol group is a halogenated alkylthiol having 1 to 6 carbon atoms. These halogenated alkyl thiol groups are exemplified by: Monofluorinated methylthio group, monofluorinated ethylthio group, difluorinated butylthio group or similar These include, but are not limited to, the following groups:

[0371] The term "heterocycloalkyl ring" is also referred to as a "heterocycle" and may be fully saturated or partially saturated. unsaturated rings (including, but not limited to, 3- to 7-membered monocyclic rings, 7- to 11-membered bicyclic rings, or 8- to 16-membered tricyclic rings) (not specified) where at least one heteroatom surrounds at least one carbon atom. The number of members in the heterocycle is determined by the number of ring atoms in the heterocycloalkyl ring. For example, a 3-16 membered heterocycle refers to a heterocycle having 3 to 16 ring atoms. Each heterocycle having a heteroatom may have one or more (e.g., 1, 2, 3) or four) heteroatoms may be present, and each heteroatom may be independently and the nitrogen atom or the sulfur atom is selected from the group consisting of a nitrogen atom, an oxygen atom, and a sulfur atom. The nitrogen atom may be quaternized. A heterocycle is a ring or ring system. It may be attached to any heteroatom or carbon atom residue of the molecule. Representative examples of the cycloalkyl ring include an azetidinyl ring, an oxetane ring, an imidazoline ring, and an imidazoline ring. Dazolidone ring, tetrahydrofuranyl ring, piperidinyl ring, piperazinyl ring, 2-hydroxy Piperazinyl ring, 2-oxypiperidinyl ring, 4-piperidinone ring, tetrahydropyranyl ring a methyl ring, a morpholine ring, a thiomorpholine ring, a thiomorpholine sulfoxide ring, a thiomorpholine ... sulfone ring, 1,3-dioxane ring, tetrahydro-1,1-dioxythiophene ring, etc. Multicyclic heterocycloalkyl rings include, but are not limited to, spiro rings, fused rings, and Related spiro, fused and bridged heterocycles are optionally It is connected to another ring by a single bond or to another cycloalkyl group via any two or more atoms on the ring. The main chain is further condensed with a ring, a hetero ring, an aryl ring, and a heteroaryl ring, but the point of connection is not It must be on a carbon atom or heteroatom on a ring having a conjugated pi electron system.

[0372] The term "heterocycloalkyl group" refers to a fully saturated or partially unsaturated cyclic group of atoms (3 (including, but not limited to, 7- to 11-membered monocyclic rings, 7- to 11-membered bicyclic rings, and 8- to 16-membered tricyclic rings) wherein at least one heteroatom is present in a ring having at least one carbon atom. The number of members limiting the heterocycloalkyl group is the number of ring atoms of the heterocycloalkyl group. For example, a 3-16 membered heterocycloalkyl group has from 3 to 16 ring atoms. Each heterocycle containing a heteroatom may have one or more (e.g., 1, 2, 3, or 4) heteroatoms may be present, and each heteroatom is independently selected from a nitrogen atom, an oxygen atom, or a sulfur atom; The nitrogen or sulfur atoms may be oxidized, and the nitrogen atoms may be quaternized. A heterocycloalkyl group is a radical of any heteroatom or carbon atom of a ring or ring system molecule. Representative examples of these monocyclic heterocycloalkyl groups are azetidine. a pyridine group, an oxetane group, an imidazoline group, an imidazolidone group, a tetrahydrofuranyl group, a pyridine group, Peridinyl group, piperazinyl group, 2-oxypiperazinyl group, and 2-oxypiperidinyl group 4-piperidinone group, tetrahydropyranyl group, morpholine group, thiomorpholine group, thiazolinone group, morpholine sulfoxide group, thiomorpholine sulfone group, 1,3-dioxane group, tetramethyl Polycyclic heterocyclic groups include, but are not limited to, tetrahydro-1,1-dioxythiophene groups, etc. The heterocycloalkyl groups include spirocyclic, fused and bridged heterocyclic groups. The heterocycloalkyl groups of rings, fused rings, and bridged rings are optionally connected to other atomic groups by single bonds. or further fused to other cycloalkyl rings and heterocycles via any two or more atoms on the ring. Polycyclic heterocycloalkyl groups may have fused aromatic rings, but the main chain is The bond must be on a carbon atom or heteroatom on a ring having a non-conjugated π electron system.

[0373] The term "aryl ring" refers to an all-carbon monocyclic or fused polycyclic ring (adjacent rings) having a conjugated π-electron system. Aryl rings refer to rings that share a pair of carbon atoms and are aromatic cyclic hydrocarbon compounds. The restriction of the number of carbon atoms before the group (e.g., C6-C12 aryl group) means that the aryl ring These aryl rings have 6 to 12 carbon atoms. The aryl ring includes other carbon rings (saturated or unsaturated rings). However, it does not contain heteroatoms such as nitrogen, oxygen, or sulfur atoms, and The points of attachment of the main chain must be on carbon atoms on rings with conjugated π electron systems. Representative examples of aryl rings include phenyl rings, naphthoyl rings, and similar rings.

[0374] The term "aryl group" refers to an all-carbon monocyclic or fused polycyclic (neighboring) ring system having a conjugated π electron system. A ring that shares a pair of adjacent carbon atoms (a ring) is an atom of an aromatic cyclic hydrocarbon compound. The aryl group is specified by the number of carbon atoms (e.g., C6-C12 aryl group). ) indicates that the aryl group has 6 to 12 ring carbon atoms. Representative examples of aryl groups include phenyl and naphthoyl groups. It can be condensed to a ring (including a saturated or unsaturated ring), but it can be condensed to a hetero atom such as a nitrogen atom, an oxygen atom, or a sulfur atom. The main chain is connected to a carbon atom on a ring that has a conjugated π electron system. Representative examples of these aryl groups are: [ka] Including, but not limited to:

[0375] The term "heteroaryl ring" refers to one or more (preferably 1, 2, 3 or The term "aromatic heterocycle" refers to an aromatic heterocycle having one or four heteroatoms. The ring may be monocyclic (monocyclic) or fused. A ring system that is bonded or covalently linked to a heterocycle (bicyclic, tricyclic or polycyclic) and does not contain a heteroatom. Each heterocycle containing one or more atoms independently selected from an oxygen atom, a sulfur atom, and a nitrogen atom may have multiple (e.g., 1, 2, 3, or 4) heteroatoms. The number of members in the definition of a heteroaryl ring refers to the number of ring atoms in the heteroaryl ring. A 5-12 membered heteroaryl ring refers to a heteroaryl ring having from 5 to 12 ring atoms. Representative examples of these heteroaryl rings are pyrrolyl rings, pyrazole rings, imidazole rings, and Oxazole ring, isoxazole ring, thiazole ring, thiadiazole ring, isothiazole ring a furan ring, a pyridine ring, a pyrazine ring, a pyrimidine ring, a pyrazine ring, a triazine ring, These include, but are not limited to, triazole rings and tetrazolyl rings.

[0376] The term "heteroaryl group" refers to one or more (preferably 1, 2, 3 or refers to the atomic group of an aromatic heterocyclic ring system having four heteroatoms. cyclic), or fused or covalently linked polycyclic (bicyclic, tricyclic or polycyclic), and each heterocycle containing a heteroatom is independently selected from an oxygen atom, a sulfur atom, and a nitrogen atom; The heteroatom may have one or more (e.g., one, two, three, or four) selected heteroatoms. The number of members in front of the heteroaryl group refers to the number of ring atoms in the heteroaryl group. For example, a 5-12 membered heteroaryl group is a heteroaryl group having from 5 to 12 ring atoms. Representative examples of these heteroaryl groups include pyrrolyl, pyrazole, and imino groups. a thiazole group, an oxazole group, an isoxazole group, a thiadiazole group, or Isothiazole group, furan group, pyridine group, pyrazine group, pyrimidine group, pyrazine group, thiazolinone group, Examples include, but are not limited to, riazine groups, triazole groups, and tetrazolyl groups.

[0377] As used herein, the term "carboxyl group" refers to a group of atoms of -COOH or -Alkyl group refers to the radical -COOH, where alkyl is as defined above. For example, a "C2-C4 carboxyl group" is a group of atoms of the -C1-C3 alkyl group -COOH. Representative examples of these carboxyl groups are -COOH, -CH2COOH, -C2H4 This includes, but is not limited to, COOH or similar groups.

[0378] As used herein, the term "ester group" refers to an ester group having an atom of the formula RC(O)-O-. or the group -C(O)-OR, where the alkyl group (R) is as defined above. For example, a "C2-C4 ester group" is a -C1-C3 alkyl group -C(O)-O- These ester groups refer to the atomic group or the atomic group of -C(O)-O-C1-C3 alkyl group. Representative examples are CH3COO-, C2H5COO-, C3H8COO-, (CH3)2CH COO-, -COOCH3, -COOC2H5, -COOC3H8, -COOC(CH3 )3 or similar atomic groups, but are not limited to these.

[0379] As used herein, the term "acylamino group" refers to an acylamino group of the formula RC(O)-N-. refers to the group of atoms or the group of atoms -C(O)-NR, where alkyl group (R) is as defined above. For example, a "C2-C4 acylamino group" is a -C1-C3 alkyl group -C(O) These refer to the atomic group of -N- or the atomic group of -C(O)-N-C1-C3 alkyl group. Representative examples of acylamino groups are CH3CO-N-, C2H5CO-N-, and C3H8CO-N -, (CH3)2CHCO-N-, -CO-N-CH3, -CO-N-C2H5, -CO This includes, but is not limited to, -N-C3H8 or similar groups.

[0380] As used herein, an "amino group" refers to an -NH2 group, either alone or as part of another substituent. Represents.

[0381] As used herein, a "nitro group" alone or as part of another substituent is -NO2 Represents.

[0382] As used herein, a "cyano group" refers to a -CN group, either alone or as part of another substituent. represent.

[0383] As used herein, a "hydroxyl group," alone or as part of another substituent, means - Represents OH.

[0384] As used herein, a "mercapto group" refers to a group defined as -S, alone or as part of another substituent. Represents H.

[0385] All substituents herein are substituted unless expressly stated as "substituted." The term "substituted" means that a particular substituent is present on a particular group of atoms. Specific substituents are those described above. The "substituted" group is preferably a ring or an atomic group. One or more of the above (preferably 1, 2, 3, 4, 5, 6, 7 or 8) The hydrogen atoms of the alkyl group are C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 halogen. halogenated alkyl groups, C3-C8 halogenated cycloalkyl groups, halogen atoms, nitro groups, - CN, hydroxyl group, mercapto group, amino group, C1-C4 carboxyl group, C2-C 4 ester group, C2-C4 acylamino group, C1-C8 alkoxyl group, C1-C8 alkoxyl group Kirchiol group, C1-C8 halogenated alkoxy group, C1-C8 halogenated alkyl group Thiol groups, C6-C12 aryl groups, 5-10 membered heteroaryl groups and 5-10 membered heteroaryl groups It refers to being substituted by a substituent selected from the group consisting of cycloalkyl groups. Unless otherwise specified, an optionally substituted group shall have a specific substituent at any substitutable position of the group. may have substituents selected from the group, and the substituents may be the same for each position. There is a possibility that it may differ.

[0386] In the present invention, "prevention" means preventing the onset of a disease and / or symptoms associated therewith, or "Prevention" as used herein refers to a method of protecting a subject from contracting a disease. and / or delay the onset of symptoms associated therewith, as well as reduce the risk of morbidity in a subject. It also refers to.

[0387] "Treatment" according to the present invention means slowing or terminating the progression of the disease or eliminating the disease. It means, but does not require 100% inhibition, elimination, or reversal. , the composition, medical kit, food kit, health product kit or combination of active ingredients according to the present invention under the influence of a compound or composition of the present invention compared to the level observed in the absence of the compound or composition. Reduce, inhibit, and / or reverse tumors by at least about 10%, 30%, 50%, or 80%, etc. You will start to do this.

[0388] In the present invention, "prevention" means preventing the onset of a disease and / or symptoms associated therewith, or Refers to a method of protecting an object and preventing disease.

[0389] "Treatment" according to the present invention means slowing or terminating the progression of the disease or eliminating the disease. It means, but does not require 100% inhibition, elimination, or reversal. the effect of the compounds of the present invention compared to the level observed in the absence of the compounds of the present invention Reduce the risk of developing related diseases (tumors) and their complications by at least about 10%, 30%, 50%, 80%, or %, or 100%, etc., to reduce, inhibit, and / or reverse the effect.

[0390] (Mitochondrial oxidative phosphorylation pathway and mitochondrial permeability transition pore) Mitochondrial Oxidative Phosphorylation Pathway OXPHOS is one of the most important pathways in the mitochondrion, and is involved in the tricarboxylic acid cycle and lipid metabolism. ATP is synthesized from NADH and FADH derived from oxidation pathways. The oxidative pathway involves five protein complexes, complexes I, II, III, IV, and V. There are over 90 proteins that make up the body.

[0391] The mitochondrial oxidative phosphorylation pathway is mediated by the mitochondrial permeability transition pore (mPTP). ndria permeability transition pore) It has been shown that compounds of the present invention are better able to inhibit cells in which mPTP is inactive.

[0392] As used herein, "the mitochondrial oxidative phosphorylation pathway is upregulated" and " The terms "mitochondrial oxidative phosphorylation pathway positive" may be used interchangeably. The level or expression level of the mitochondrial oxidative phosphorylation pathway in a certain cell (e.g., tumor cell) The level or expression of the oxidative phosphorylation pathway in mitochondria is greater than that of normal cells (similar cells). Preferably, "the mitochondrial oxidative phosphorylation pathway is upregulated" and "mitochondrial The term "oxidative phosphorylation pathway positive" refers to the expression of mitochondrial globulin in certain cells (e.g., tumor cells). The level or expression level of the oxidative phosphorylation pathway in the body E1 and the mitochondrial acid in normal cells (similar cells) The ratio between the level or expression of the metabolic phosphorylation pathway E1 and E0 (E1 / E0) is >1.0. , preferably ≧1.2, and more preferably ≧1.5, ≧2, ≧3 or ≧5. This refers to the following:

[0393] In the present invention, the terms "mitochondrial oxidative phosphorylation pathway is upregulated" and "mitochondrial acid The metabolic phosphorylation pathway is characterized by mPTP activation. The activation of mitochondrial oxidative phosphorylation pathway is upregulated and mitochondrial acid For example, the mPT of certain cells (e.g., tumor cells) The activity level or expression level of mPTP in A1 and normal cells (similar cells) The ratio (A1 / A0) between the expression level A1 and the expression level A0 is <1.0, preferably ≦0.8, Then, more preferably ≦0.7, ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2 , ≦0.1 or ≦0.05, the cells have upregulated mitochondrial oxidative phosphorylation pathway Cells that are positive or negative are considered to be positive.

[0394] In a preferred embodiment of the present invention, the level is determined by measuring the protein level and / or the mRNA level. Point.

[0395] In a preferred embodiment of the present invention, said expression refers to protein expression and / or mRNA expression.

[0396] In the present invention, the level or expression amount of the mitochondrial oxidative phosphorylation pathway and mPTP The level of activity or expression of mPTP is measured using a conventional method. For example, the activity of mPTP is measured using a conventional method. or measure the expression level of mPTP at the protein level or mRNA level.

[0397] (NNMT gene) In the present invention, the English name of NNMT is Nicotinamide N-Methylt Different databases have different identification numbers for the NNMT gene. For example, HGNC:7861; Entrez Gene:4837; Ense mbl:ENSG00000166741; OMIM:600008; UniPro tKB:P40261.

[0398] Human genome archive GCF_000001405.25 (GRCh37.p13) According to the study, the NNMT gene region is located at position 114,128,528 on human chromosome 11. It is located from bp to bp 114,184,258, and has a total length of 55,731 bp. The region is a DNA sequence consisting of the NNMT gene promoter region, the NNMT gene enzyme The transcription start site of the NNMT gene is included in the intron region and the NNMT gene intron region. The ranking is 114,166,535th bp.

[0399] The NNMT gene promoter region is located at position 114,164,535 on human chromosome 11. The nucleotide sequence from bp 1 to bp 114,167,034, i.e., the NNMT gene From 2000 bp (the part inside []) before the transcription start site of the gene to the transcription start site itself and 4 bp after The sequence is up to 99 bp (lowercase part). The NNMT gene promoter region has a total length of It is 2500 bp and its nucleotide sequence is shown in the following SEQ ID NO:1.

[0400] [TATCCAAGAGCTATCAGCACTCCCATGTTTATTGTAGCA CTGTTCACAATAGCCAAGATTTGGAAGTACTCTAAGTGTC CATTAGCAGATGAATGGATAAAGACAATGTGGTAATACAC ATAATGGAGTACTATTCAGTCATAAAGAAGAATTAGATCC TGTCATTTGCAAATAACATGGATGGAACTGGAGGTCATAAT GTTGAGTGAAAATAAACCAGGCACAGAAAGACAAACTTTGC ATGTTCTCACTTATTTATGGGAGCTAAAAACTAAAATAAC TGAACTCACAGAGATAGAGAGTAGAAGGATGGTTACGAGA GGATGGGAAGGGTAGCGAGGTGGGTAGGGGGGATGTGGGG ATCATTAATGGGTATAAAAAATAGTTAGAGGCCAGGCGCA GTGGCTCAGCCTGTAATCCCAGCACTTTGGGAGGCCGAG GTAGGCGGAACACCTGAGGAGTTCAAGACCAGCCTGGCCA ATATGATGAAACCCCGTCTCTACTAAAAATACAAAAATTA GCTGGGCGTGATGGTGTGCACCTGTAGTCCCAGCTGCTTG GGAGGCTGAGGCAGGAGAATCGCTGGAACCCAAGAGGTGA AGGTTGCAGTGAGCTGAGATCGCGTCACTGCACTCCAGCC TGGGTGACAGAGTGAGACTCCACATCAAAAAAAAAAAAAA AAAGTGAAATTGAATGACCTAATTTGCTAAGCA WINDGGTTAGTAGTAAAAAATTTATTTGTACCT TCAAAAATAACTAGACAAGTATTGGGTTGTTTGTAAC ACAAAAAAATAGTACTTGAGTGGTGGATACCCCATTT ACCCTGATGTGATTATTTTGTATTGCAGGCCTCTATCAGA ATATCTCATGTAACCCATAAATATACACCTACTCTGTA CCCACAAAAAGTTTTTAAAAAAAAAAAATAGCAACCG AAAAAAAAAAAGAGGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.... CAAGTGCCTGGCTGGGTAGAATAAATTCTAAGGCCACAAT GTTACTGACCATGGGTTTTTTGGCTCTCAGTGTATAGAAA TTGACACAAGGCCATAGTCTTCCCAAACATGCTTTACTG GAACTTACGCCCTGGCATAAGGGCCACAAAAAGAGAGA GCGAATTCTCTGGCTTGCTGACTCCTTGGAAAAAACCGGT AGGGATTTTTTTATTAGGCAAAGCAGGAATTTGACGTCA GAGGCAGGATGTGCTGCTGGGCAAAGCATACGAGAAGTGG GGTATGCAGGTCAGCATTACTTGGTTGCAATGGTTATCTT RESULTGGGCCAACTGGTGGTCTGGCCAGTGGCAACAAG GCTGTAAATCAATTATTCAGCATTCCTTCCCAAGGTGGGA CACCCGGCAACATTGTTTATCTCCTAAGGCCAGTTCCTGG AATTAAGTGAAAGGATGACTAATGGACATGTTGTCAGTGA GGTAGTGGTGTGGGTTTTGTGACCAGTGGGAATGCACGAA AGAATGCTTTAGCGGGGAGTGAGCTGAAGCCAAGCCCCAT CCCTACTCTGTCTCAAAGTGAGTTCAGAAAAGGGGATTTA AAGAATTCTTTTTTTTTTTTTTTTTTTTTGAGACAGAG TCTTGCTCTGTCGCCCAGGCTGGAGTGCAGTGGCGCCATC TTGGCTCACTGCAAGCTCCGCCCCCCGGGTTCATGCCATT CTCCTGCCTCAGCCTCCCAAGTAGCTGGGACTGCAGGTGC CTACCACCAAGCCCAGCTAATTTTTTGTATTTTTTTTTTA GTAGAGACGGGGTTTCACCATGTTAGCCAGGATGGTCTCG ATCTCCTGACCTCGTGATCTGCCCGCCTTAGCCTCCCAAA GTGCTGGGATTACAGGCATGAGCCTCCGCCCCCGGCCTTA AATAATTCTTAAAGGAAGTAAAGTTAACTTTGAAAGAACT ATCAGGATTTGGATTGACTGAAAGGAGTGGGGAAGCTTAG G]gaggaggtgcttgccagacactgggtcatggcagtggt cggtgaagctgcagttgcctagggcagggatggagagaga gtctgggcatgaggagggtctcgggatgtttggctgga ctagattttacagaaagccttatccaggctttaaaatta ctctttccagacttcatctgagactccttcttcagccaac attccttagccctgaatacatttcctatcctcatctttcc cttcttttttttcctttcttttacatgtttaaatttaaac cattcttcgtgaccccttttcttgggagattcatggcaag aacgagaagaatgatggtgcttgttaggggatgtcctgtc tctctgaactttggggtcctatgcattaaataattttcct gacgagctcaagtgctccctctggtctacaatccctggcg gctggccttcatcccttgggcaagcattgcatacagctca tggccctccctctaccataccc(SEQ ID NO: 1).

[0401] In the present invention, the region from 1050 bp before the transcription start site of the NNMT gene to The last 499 bp region is the 9th nucleotide sequence shown in SEQ ID NO:1. It is ranked 51-2500th.

[0402] In the present invention, the region from 1050 bp before the transcription start site of the NNMT gene to The region up to 193 bp before is 95% of the nucleotide sequence shown in SEQ ID NO:1. It is ranked 1-1808th.

[0403] (DNA methylation) DNA methylation is a genetic modification that does not change the DNA sequence. DNA methylation is a form of chemical modification of DNA that alters gene expression. The fifth carbon atom on cytosine in genomic CpG dinucleotides is transferred under the action of transferases. It refers to the covalent attachment of one methyl group to a DNA site. Many studies have shown that DNA methylation The study focuses on chromatin structure, DNA morphology, DNA stability, and DNA-protein interactions. It may alter expression and regulate gene expression.

[0404] DNA methylation is one of the first and most extensively studied regulators of epigenetic inheritance. In a broad sense, DNA methylation is the process by which specific bases in the DNA sequence are methylated. S under the catalysis of DNA methyltransferase 1 -Adenosylmethionine (S-adenosyl methionine) as a methyl donor This refers to a chemical modification process in which a molecule acquires a single methyl group via a covalent bond. DNA methylation modifications occur at the C-5 position of cytosine, the N-6 position of adenine, and the N- DNA methylation in general studies is mainly observed at Cp It refers to the process by which the carbon atom at position 5 on the cytosine in a G dinucleotide is methylated. The product is called 5-methylcytosine (5-mC), and is found in eukaryotic organisms such as plants and animals. DNA methylation is the predominant form of DNA methylation. DNA methylation is a relatively stable modification state. New generation DNA is generated during the DNA replication process under the action of NA methyltransferase It can be inherited independently, making it an important regulator of epigenetic inheritance.

[0405] DNA methylation reactions are divided into two types. The first type has two unmethylated strands. The DNA that is present is methylated, a process known as de novo methylation. The second type is a double-stranded DNA with one methylated strand and the other unmethylated strand methylated. This is called maintenance methylation.

[0406] Typically, DNA methylation is the methylation of DNA CpG sites. CpGs are distributed very unevenly in the human genome, and some segments of the genome contain Mainly the promoter and exon of the gene The enriched regions of CpG sites (also called CpG islands) located in the seq region are CpG Dinucleotide-enriched regions, including over 60% of gene promoters The top contains CpG islands, where CpG stands for cytosine (C)-phosphate (p)-guanine. It is an abbreviation for G.

[0407] Intracellular gene expression is regulated by various signal transduction pathways, transcription factors, and epigenetic modifications. DNA methylation is an important epigenetic modification that regulates gene expression. The DNA methylation level in a specific gene region is always DNA methylation, an epigenetic modification, affects expression levels. Compared to the regulation of gene expression by transcription factors, the effects on gene expression are more stable. DNA methylation modification is easy to achieve with existing technologies and is less susceptible to the extracellular environment. It is easily detectable, making it an ideal biomarker.

[0408] (Compound of Formula I) As used herein, "a compound of the invention," "a compound of Formula I of the invention," and "a compound of Formula I" refer to "Compound of Formula I" may be used interchangeably and refers to a compound having the structure of Formula I, or or a solvate thereof, or a pharmaceutically acceptable salt thereof. It should be understood that the term also includes mixtures of the above components. [ka]

[0409] Specifically, the compound of formula I is as described in the first aspect of the present invention.

[0410] Typically, the compounds of formula I of the present invention can be prepared according to Examples 1 to 105 of the present invention. The compounds are defined as follows (including their salts or free states without base ions).

[0411] In the present invention, when ring B is absent, R3 is also absent. That is, when ring B is absent, It should be understood that compounds of formula I have the following structure: [ka]

[0412] Compounds of formula I according to this embodiment can be prepared by organic synthesis methods known in the art. It is possible.

[0413] The compounds of the present invention have excellent inhibitory effects on tumor cells and inhibit mitochondrial oxidative phosphorylation. The pathway is upregulated or mPTP is underactivated, resulting in better suppression of tumor cells, especially mPTP. Furthermore, tumor cells in which mPTP is normally activated are better able to suppress tumors. For normal somatic cells that have a high level of activity, the compounds of the present invention have a weak inhibitory effect on normal somatic cells. Since the compound of the present invention has almost no toxic side effects, it is possible to develop a safe and effective anticancer drug. Cut.

[0414] The term "pharmaceutically acceptable salt" refers to a compound of the present invention formed with an acid or base. Pharmaceutically acceptable salts include inorganic salts and organic salts. One type of preferred salt is a salt formed by a compound of the present invention with an acid. Acids suitable for the formation of HCl include hydrochloric acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid. Inorganic acids such as phosphoric acid, formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, and fumaric acid Maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, and Organic acids such as benzenesulfonic acid and benzenesulfonic acid, as well as aspartic acid and glutamic acid Other species of preferred salts include, but are not limited to, acidic amino acids such as benzophenone, ... A suitable base for forming this type of salt is sodium hydroxide. Thorium, potassium hydroxide, sodium carbonate, sodium bicarbonate, sodium phosphate, etc. These include inorganic bases and organic bases such as ammonia, triethylamine, and diethylamine. Not limited to these.

[0415] The present invention provides a method for converting compounds such as those shown in Formula I into their pharmaceutically acceptable salts in a conventional manner. For example, adding a solution of the corresponding acid to a solution of the above compound may result in the removal of all salts. After conversion, the solvent is removed to obtain the corresponding salt of the compound of the invention.

[0416] Preferably, the compounds according to the present invention are prepared as per the examples of the present invention. do.

[0417] (cancer disease) The present invention relates to a compound of the present invention that has an excellent inhibitory effect on tumor cells and inhibits mitochondrial oxidation. Upregulation of the selective phosphorylation pathway, low activity of mPTP, low or no expression of the NNMT gene, Hypermethylation of nucleotide sites in the NMT gene and / or DNA in the NNMT gene region It better suppresses tumor cells with hypermethylation of CpG sites.

[0418] In particular, the tumor of the present invention is as described in the first aspect of the present invention.

[0419] (Anticancer drug) In the present invention, the anticancer agent is a compound of formula I, or an optical isomer or racemate thereof, or may be a solvate thereof, or a pharmaceutically acceptable salt thereof.

[0420] (Inhibitors of the mitochondrial permeability transition pore and their use) In the present invention, the inhibitor of the mitochondrial permeability transition pore is Cyclosporin A, CyP-D protein inhibitor, peroxide scavenger or a combination thereof, Not limited to.

[0421] Typically, the CyP-D protein inhibitors include SfA, BKA, and ADP (ANT protein). These include small molecules that regulate the activity of proteins.

[0422] Typically, the peroxide scavenger is propofol, pyruvate, MCI-1 86 or any combination thereof.

[0423] (marker) The present invention further provides a method for determining whether the compounds of the present invention are suitable for the prevention and / or treatment of tumor patients. The markers are used to identify proteins involved in the mitochondrial oxidative phosphorylation pathway, the mitochondrial membrane The permeability transition pore, the NNMT gene, the methylation level of the nucleotide site of the NNMT gene, and and / or the methylation level of DNA CpG sites in the NNMT gene region.

[0424] Compositions or Formulations, Active Ingredient Combinations and Dosage Methods The present invention further provides compositions or formulations, active ingredient combinations and medical kits, The product or preparation, the combination of active ingredients and the medical kit are used for the prevention and / or treatment of cancer .

[0425] Preferably, the composition of the present invention is a pharmaceutical composition. The present invention further comprises a carrier on which the

[0426] As used herein, a "pharmaceutically acceptable carrier" refers to a substance suitable for human or animal use. and one or more compatible solids, semi-solids, etc., which must be sufficiently pure and have sufficiently low toxicity. "Compatibility" refers to the compatibility of each component in a drug composition with the drug. When the active ingredients are mixed, and when they are mixed with each other, the efficacy does not decrease significantly. It refers to becoming.

[0427] In the present invention, the pharmaceutically acceptable carrier is not particularly limited, and may be any material commonly used in the art. It should be understood that these may be selected from a wide range of sources, prepared by conventional methods, or purchased commercially. Some pharmaceutically acceptable carriers include cellulose and its derivatives (e.g., methylcellulose). , ethyl cellulose, hydroxypropyl methyl cellulose, carboxymethyl cellulose sodium cellulose, etc.), gelatin, talc, solid lubricants (e.g., stearic acid, and magnesium stearate), calcium sulfate, and vegetable oils (e.g., soybean oil, sesame oil, Flower oil, olive oil, etc.) and polyhydric alcohols (e.g., propylene glycol, glycerin mannitol, sorbitol, etc.), emulsifiers (e.g., Tween), and wetting agents (e.g., , sodium lauryl sulfate), buffers, chelating agents, thickeners, pH adjusters, penetration enhancers, Contains coloring agents, fragrances, stabilizers, antioxidants, preservatives, bacteriostatic agents, heat-free raw water, etc.

[0428] In vitro studies and in vivo administration (e.g., intratumoral administration), inhibitors of the mitochondrial permeability transition pore It acts as an anti-tumor agent by reducing mPTP activity in tumor cells and upregulating the mitochondrial oxidative phosphorylation pathway. To enhance the therapeutic effect of tumor drugs, we aim to exert a synergistic antitumor effect between an antitumor drug and an mPTP inhibitor. Can be performed.

[0429] The present invention provides a combination of active ingredients comprising an antitumor drug and an mPTP inhibitor for synergistic antitumor activity. The present invention provides compositions and medical kits.

[0430] The present invention provides a combination of active ingredients comprising: (1) a first active ingredient as an anticancer agent; and (2) A second active ingredient that acts as an inhibitor of the mitochondrial membrane permeability transition pore.

[0431] In another preferred embodiment, the active ingredient combination has at least one independent active ingredient. .

[0432] In another preferred embodiment, the combination of active ingredients includes a first active ingredient and a second active ingredient. It is independent of other companies.

[0433] The present invention further provides a composition comprising the following components: (1) a first active ingredient as an anticancer agent; and (2) A second active ingredient that acts as an inhibitor of the mitochondrial membrane permeability transition pore.

[0434] In another preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0435] In another preferred embodiment, the content of the first active ingredient relative to the total weight of the active ingredients in the composition is: 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and More preferably, it is 1-99 wt%, 10-99 wt%, or 20-99 wt%.

[0436] In another preferred embodiment, the content of the second active ingredient relative to the total weight of the active ingredients in the composition is: 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and More preferably, it is 1-99 wt%, 10-99 wt%, or 20-99 wt%.

[0437] The present invention further provides a medical kit comprising the following formulation: (A) a first formulation containing a first active ingredient as an anticancer agent; and (B) A second formulation comprising a second active ingredient that is an inhibitor of the mitochondrial permeability transition pore.

[0438] In another preferred embodiment, the medical kit further comprises an instruction manual.

[0439] In another preferred embodiment, the first formulation and the second formulation are independent of each other.

[0440] In another preferred embodiment, the first and second formulations are combined with each other.

[0441] In another preferred embodiment, the instruction manual includes a step of administering the first formulation and the second formulation in combination to an anti-cancer agent. It is pointed out that this enhances the antitumor activity of the agent.

[0442] In another preferred embodiment, the combination method comprises first administering to a subject a second agent containing an inhibitor of the mitochondrial permeability transition pore. The formulation is administered first, followed by the anti-cancer drug.

[0443] Preferably, in the active ingredient combination, composition and / or medical kit of the present invention, The molar ratio between the first active ingredient and the second active ingredient is 0.01-600:1, and is preferably Typically 0.05-500:1, then more preferably 0.1-400:1, 0.2 -200:1, 0.5-100:1, 0.5-80:1 or 1-50:1.

[0444] In the present invention, the types of the composition or preparation include oral preparations, topical preparations, and injection preparations. , but not limited to these.

[0445] Typical examples of the composition or formulation include tablets, injections, infusions, ointments, Including, but not limited to, gels, solutions, pills or films.

[0446] Typically, the injection is an intratumoral injection.

[0447] The drug formulation should be consistent with the dosage regimen. Preferred dosage regimens are oral and injectable. When using a drug composition or formulation, an effective therapeutic amount of the drug is administered. The substance is administered to a subject (e.g., a human or non-human mammal). Thus, the term "therapeutically effective amount" refers to a quantity that provides a function or activity in humans and / or animals. For those skilled in the art, the term "effective therapeutic dose" refers to an amount acceptable to humans and / or animals. The amount of "drug composition" depends on the form of drug composition, the route of administration, the auxiliary materials of the drug used, the severity of the disease and other drugs. It should be understood that the results will vary depending on the combination of

[0448] In a dosage regimen, a safe and effective daily dosage of the first active ingredient is typically at least The amount is about 0.1 mg and in most cases does not exceed about 2500 mg. The dosage is 1 mg to 500 mg; a safe and effective daily dosage of the second active ingredient is usually Preferably, the amount is at least about 0.01 mg and in most cases is no more than 2500 mg. The dosage range is 0.1 mg to 2500 mg. Of course, the specific dosage depends on the dosage history. It is necessary to consider the path of the patient and the patient's health condition, but these conditions should be considered by an experienced doctor. It can be put into.

[0449] The present invention has the following main beneficial effects: The present invention suppresses tumor cells efficiently and safely, and in particular, upregulates the mitochondrial oxidative phosphorylation pathway. We have developed novel compounds that can significantly inhibit tumor cells with low mPTP activity. Furthermore, the novel compound is particularly effective against low or no expression of the NNMT gene and / or significantly inhibit tumor cells with hypermethylation of DNA CpG sites in the NNMT gene region Can harm.

[0450] The present invention will now be further described in conjunction with specific examples. These embodiments are intended to illustrate the invention. It should be understood that the following is for illustrative purposes only and does not limit the scope of the invention. For example, experimental methods that do not specify specific conditions usually follow general conditions or are recommended by the manufacturer. Percentages and ratios are calculated by weight unless otherwise specified.

[0451] Example 1 Preparation of compound AB24831A Step 1): [ka] Compound 1 (440 mg, 2 mmol) was dissolved in anhydrous N,N-dimethylformamide (DMF) 20 mL), and then compound 2 (428.4 mg, 4.2 mmol), bistrif Phenylphosphine palladium dichloride (42 mg, 0.06 mmol), N,N-diisopropyl propylethylamine (825 mg, 6.4 mmol) and cuprous iodide (19 mg, 0. 1 mmol) was added, and the mixture was then purged with nitrogen three times and stirred at room temperature overnight. When a new compound was detected by chromatography, the product was diluted with water (50 mL) and ethyl acetate was added. Extract the product by adding ethanol (30 mL x 3). After the organic phases were combined, add saturated saline (50 mL The product was washed with HCl, dried over anhydrous sodium sulfate, filtered, and the solution was concentrated under reduced pressure. Finally, the product is purified by column chromatography (ethyl acetate:silane). Compound 3 (weight 130 mg, yield 33%) was obtained by purifying with diethyl ether (0-50%). obtain.

[0452] Step 2): [ka] Compound 3 (130 mg, 0.47 mmol) was dissolved in dioxane (6 mL), and then Potassium t-butoxide (336.6 mg, 3 mmol) was added, and then the mixture was purged with nitrogen three times. After this, the temperature is raised to 110°C and the mixture is stirred for 16 hours. When new compounds were detected, the product was diluted with water (20 mL) and ethyl acetate (10 mL x 3). The product was extracted by adding the above, and after the organic phases were combined, the product was washed with saturated saline (30 mL), Dry with anhydrous sodium sulfate, filter, and concentrate the solution under reduced pressure to remove the organic solvent. Finally, the product was purified by thin layer chromatography (methanol:dichloromethane = 0-1 0%) to give compound 4 (weight 50 mg, yield 50%).

[0453] Step 3): [ka] Compound 4 (100 mg, 0.67 mmol) was dissolved in acetonitrile (10 mL). Compound 5 (312 mg, 1.34 mmol) was then added, followed by three nitrogen substitutions. After stirring, the temperature is raised to 80°C and the mixture is stirred overnight. Once detected, dilute the product with water (50 mL) and add ethyl acetate (30 mL x 3) to remove the product. After the organic phases were combined, the product was washed with saturated saline (50 mL) and added with anhydrous sodium sulfate. The solution is dried over sodium and filtered, and then concentrated under reduced pressure to remove the organic solvent. The product was prepared and purified to give compound AB24831A (weight 25.2 mg, yield earns 8.1%).

[0454] Compound AB24831A: 1H NMR(400MHz,DMSO-d6)δ 13.53(s,1H),9.0 6(s,1H),8.24(d,J=7.1Hz,1H),8.14(d,J=6.5H z,1H),8.08(d,J=7.4Hz,4H),7.74(d,J=7.6Hz, 2H),7.64-7.55(m,3H),7.48(s,1H),6.36(s,2H ). ESI-MS: Theoretical value [M-CF3COO] + 347.82, Observed: 347.25.

[0455] Example 2 Preparation of compound AB24828A Step 1): [ka] Compound 1 (140 mg, 0.66 mmol) was dissolved in anhydrous N,N-dimethylformamide D MF (10 mL), and then compound 2 (161.4 mg, 1.39 mmol), Triphenylphosphine palladium dichloride (14 mg, 0.02 mmol), N,N- Diisopropylethylamine (272 mg, 2.11 mmol) and cuprous iodide (5. After adding 7 mg (0.03 mmol), the mixture was purged with nitrogen three times and stirred at room temperature overnight. If a new compound is detected by thin layer chromatography, the product is diluted with water (50 mL). The product was extracted by adding ethyl acetate (30 mL x 3). After the organic phases were combined, the mixture was diluted with saturated sodium hydroxide. The product was washed with brine (50 mL), dried over anhydrous sodium sulfate, filtered, and evaporated under reduced pressure. The solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product is purified by column chromatography ( Compound 3 (100 mg, yield) was purified with ethyl acetate:petroleum ether (0-50%). The rate is 75.7%.

[0456] Step 2): [ka] Compound 3 (100 mg, 0.47 mmol) was dissolved in dioxane (30 mL), and then potassium t-butoxide (160 mg, 1.43 mmol) was added, followed by three flushes with nitrogen. After the substitution, the temperature is raised to 110°C and the mixture is stirred for 1 hour. When a new compound was detected, the product was diluted with water (20 mL) and ethyl acetate (10 mL x 3 The product was extracted by adding 20 mL of saturated sodium chloride solution. After the organic phases were combined, the product was washed with saturated sodium chloride solution (30 mL). The solution was concentrated under reduced pressure to remove the organic solvent. Finally, the product was purified by thin layer chromatography (methanol:dichloromethane = 0- 10%) to give compound 4 (weight 50 mg, yield 50%).

[0457] Step 3): [ka] Compound 4 (50 mg, 0.67 mmol) was dissolved in acetonitrile (10 mL), and then Compound 5 (312 mg, 1.34 mmol) was added immediately, and the mixture was then purged with nitrogen three times. After that, the temperature is raised to 80°C and the mixture is stirred overnight. Once the solution is evaporated, it is concentrated under reduced pressure to remove the organic solvent. After purification, compound AB24828A (weight 34.7 mg, yield 10.9%) was obtained. do.

[0458] Compound AB24828A 1 H NMR(400MHz,DMSO-d6)δ 13.15(s,1H),9.0 2(s,1H),8.21(d,J=6.1Hz,1H),8.07(d,J=8.4H z,3H),7.74(d,J=7.0Hz,2H),7.31(d,J=29.2Hz ,5H),6.74(s,1H),6.33(s,2H),4.33(s,2H). ESI-MS: Theoretical value [M-CF3COO] + 361.84, Observed: 361.25.

[0459] Example 3 Preparation of compound AB24861 Steps): [ka] Compound 1 (100 mg, 0.48 mmol) and compound 2 (123 g, 0.577 mmol) ol) was dissolved in acetonitrile (10 mL) and stirred at room temperature for 4 hours. When a new compound was detected in the filtration, the reaction solution was immediately filtered and the acetonitrile filtrate was removed. Compound AB24861 (weight 110.0 mg, yield 67.2%) was obtained via the filter cake. get.

[0460] Compound AB24861 1 H NMR(400MHz, DMSO-d6)δ 12.96(s,1H),9. 15(s,1H),8.27(s,1H),8.22(s,1H),8.11(s,1H ),8.04(d,J=7.4Hz,1H),7.56(d,J=7.1Hz,1H), 7.47(d,J=7.8Hz,1H),7.39(d,J=6.5Hz,1H),7. 29(d,J=12.7Hz,4H),7.17(s,1H),6.27(s,2H), 4.18(s,2H),2.43(s,3H). ESI-MS: Theoretical value [M-Br] + 341.43, Observed: 341.30.

[0461] Example 4 Preparation of compound AB24859 Step 1): [ka] Compound 1 (2.0g, 15.5mmol), Compound 2 (5.6g, 46.6mmol) , bis(dibenzylideneacetone)palladium (771.0 mg, 0.5 mmol), Tri-tert-butylphosphine tetrafluoroborate (451.0 mg, 1 mmol) and triethylenediamine (5.24 g, 30 mmol) in N,N-dimethylformamide The mixture was dissolved in DMF (50 mL), purged with nitrogen three times, and stirred at 120°C for 16 hours. After that, new compounds were detected by thin layer chromatography. The mixture was cooled to room temperature and then mixed with water. Ethyl acetate (100 mL x 3) was added to extract the product, and after the organic phases were combined, saturated brine was added. (100 mL), dried over anhydrous sodium sulfate, and concentrated the solution under reduced pressure. Finally, the product is purified by column chromatography (ethyl acetate:silane). Compound 3 (weight 70 mg, yield 2.16%) was purified with diethyl ether (66.6%). get.

[0462] Step 2): [ka] Compound 3 (97 mg, 0.5 mmol) and compound 4 (244 g, 1 mmol) were acetone- The mixture was dissolved in 10 mL of nitrile and stirred at room temperature for 16 hours. When a new compound was detected, the reaction solution was immediately filtered and the filter cake was washed with acetonitrile. Washing gives compound AB24859 (weight 89 mg, yield 52.1%).

[0463] Compound AB24859: 1 H NMR(400MHz,DMSO-d6)δ 12.98(s,1H),9.1 7(s,1H),8.28-8.21(m,2H),8.09(d,J=6.6Hz,1 H),7.94(d,J=7.7Hz,2H),7.43(d,J=7.8Hz,2H) ,7.34-7.24(m,4H),7.18(d,J=7.2Hz,1H),6.36 (s,2H),2.41(s,3H). ESI-MS: Theoretical value [M-Br] + 341.43, Observed: 341.30.

[0464] Example 5 Preparation of compound AB24835A Step 1): [ka] Compound 1 (1.28 g, 10 mmol), Compound 2 (4.02 g, 30 mmol), (dibenzylideneacetone)palladium (457.5 mg, 0.5 mmol), tetrachloroethylene Tri-tert-butylphosphine fluoroborate (290.13 mg, 1 mmol) and and triethylenediamine (3.36 g, 30 mmol) in N,N-dimethylformamide The mixture was dissolved in DMF (50 mL), purged with nitrogen three times, and stirred at 120°C for 16 hours. Afterwards, new compounds were detected by thin layer chromatography, and the mixture was cooled to room temperature and diluted with water and vinegar. Ethyl acetate (100 mL x 3) was added to extract the product, and after the organic phases were combined, saturated saline ( The product was washed with 100 mL of HCl, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The organic solvent is then removed. Finally, the product is purified by column chromatography (ethyl acetate:petroleum Compound 3 (weight 1.1 g, yield 2.16%) was obtained by filtration with ether (66.6%). obtain. ESI-MS: Theoretical value [M+1]+208.26, Observed value: 209.30.

[0465] Step 2): [ka] Compound 3 (208 mg, 1 mmol) and compound 4 (233.5 mg, 1 mmol) Dissolve in acetonitrile (10 mL) and stir at 80°C for 16 hours. When a new compound was detected by the filtration, the reaction solution was immediately filtered and the filter cake was washed with ethyl acetate. The mixture is washed to give compound AB24835A (weight 150 mg, yield 41.55%).

[0466] Compound AB24835A: 1 H NMR(400MHz,DMSO-d6)δ 12.98(s,1H),9.1 4(s,1H),8.30-8.19(m,2H),8.08(dd,J=22.2,7 .3Hz,3H),7.72(d,J=7.9Hz,2H),7.29(dt,J=14 .9,7.5Hz,4H),7.18(d,J=7.0Hz,1H),6.35(s,2 H), 4.18(s,2H). ESI-MS: Theoretical value [M+1]+361.84, Observed value: 361.30.

[0467] Example 6 Preparation of compound AB24863 Step 1): [ka] Compound 1 (3.86 g, 30 mmol) was dissolved in N,N-dimethylformamide (DMF) (25 0 mL), and then compound 2 (12.1 g, 90 mmol), triethylenediamine (10.1 g, 90 mmol), tri-tert-butylphosphine tetrafluoroborate phenylalanine (870 mg, 3 mmol) and bis(dibenzylideneacetone)palladium (1. After successively adding 37 g (1.5 mmol) of ethanol, the mixture was purged with nitrogen three times, and then the temperature was raised to 120 The temperature was raised to ℃ and stirred for 2 hours overnight. A new compound was detected by thin layer chromatography. Dilute the product with water (200 mL) and add ethyl acetate (100 mL x 3) to extract the product. After the organic phases were combined, the product was washed with saturated saline (100 mL) and added to anhydrous sodium sulfate. The solution is dried over ice and filtered, and then concentrated under reduced pressure to remove the organic solvent. The product was purified by column chromatography (methanol:dichloromethane = 10:1). Compound 3 (weight 2.0 g, yield 32%) was obtained.

[0468] Step 2): [ka] Compound 3 (100 mg, 0.5 mmol) was dissolved in acetonitrile (10 mL), and then Compound 4 (244 mg, 1 mmol) was added at 20°C, and the mixture was purged with nitrogen three times. The temperature is raised to 80°C and stirred overnight. New compounds are detected by thin layer chromatography. The solution is then immediately concentrated under reduced pressure to remove the organic solvent. Finally, the product is purified by thin layer chromatography. The compound AB24863 was purified by filtration (methanol:dichloromethane = 10:1). (Weight 140 mg, yield 59.8%)

[0469] Compound AB24863 1 H NMR(400MHz,DMSO-d6)δ 13.01(s,1H),9.1 6(s,1H),8.46(d,J=7.9Hz,2H),8.26(dd,J=16. 4,8.2Hz,4H),8.14(d,J=6.9Hz,1H),7.31(dd,J =20.1,7.4Hz,4H),7.20(d,J=7.3Hz,1H),6.43( s,2H),4.20(s,2H). ESI-MS: Theoretical value [M-Br]+ 388.40, Observed value: 388.25.

[0470] Example 7 Preparation of compound AB24878 Step 1): [ka] Compound 1 (2.7 g, 23 mmol) and compound 2 (2.5 g, 19 mmol) were dissolved in N, N-dimethylformamide (DMF) (30 mL) and then triethylenediamine ( 6.5g, 58mmol), bis(dibenzylideneacetone)palladium (890mg, 0.97 mmol) and tri-tert-butylphosphine tetrafluoroborate (56 1 mg, 1.94 mmol) is added successively, and the mixture is stirred in a sealed tube at 120°C for 16 hours. A new compound was detected by thin layer chromatography and was synthesized in water and ethyl acetate (60 mL). The product is extracted and the organic phase is concentrated under reduced pressure to give a residue. Compound 3 (weight: 80%) was purified by HPLC (methanol:dichloromethane = 5%). 0 mg, yield 17.9%).

[0471] Step 2): [ka] Compound 3 (92 mg, 0.5 mmol) and compound 4 (244 g, 1 mmol) were acetone- The mixture was dissolved in 10 mL of nitrile and stirred at room temperature for 16 hours. When a new compound was detected, the reaction solution was immediately filtered and the filter cake was washed with acetonitrile. Washing gives compound AB24878 (weight 116.2 mg, yield 53.02%).

[0472] Compound AB24878 1 H NMR(400MHz,DMSO-d6)δ 9.28(s,1H),8.77 (d,J=11.6Hz,2H),8.59(d,J=8.2Hz,1H),8.48( s,2H),8.37(d,J=6.3Hz,1H),7.96(t,J=7.8Hz, 1H),7.80(d,J=7.2Hz,2H),7.52(t,J=7.2Hz,2H ),7.38(d,J=7.1Hz,1H),6.53(s,2H). ESI-MS: Theoretical value [M-Br] + 358.37, Observed: 358.30.

[0473] Example 8 Preparation of compound AB24872 Step 1): [ka] Compound 1 (500 mg, 3.6 mmol) was dissolved in dichloromethane (20 mL), and then Add Dess-Martin oxidant (2.02 g, 4.7 mmol) in an ice bath, then add 2 When a new compound was detected by thin layer chromatography, the filtrate was concentrated under reduced pressure. The organic solvent was removed under reduced pressure, and the mixture was purified by column chromatography (ethyl acetate: petroleum ether Purification with HCl (0-10%) gave compound 2 (weight 340 mg, yield 69.1%). .

[0474] Step 2): [ka] Compound 2 (340mg, 2.67mmol), Compound 3 (286mg, 2.22mmol) l), bis(dibenzylideneacetone)palladium (102 mg, 0.11 mmol), Tri-tert-butylphosphine tetrafluoroborate (64 mg, 0.22 mmol) ) and triethylenediamine (750 mg, 6.68 mmol) in N,N-dimethylformamide The amide was dissolved in DMF (50 mL), then purged with nitrogen three times and heated at 120°C for 16 hours. After stirring, new compounds were detected by thin layer chromatography and the mixture was cooled to room temperature. Add water and ethyl acetate (100 mL x 3) to extract the product. After the organic phases were combined, the mixture was saturated. The product was washed with brine (100 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The mixture is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (ethyl acetate). The compound 4 (weight 200 mg, yield 37%) was purified with petroleum ether (66.6%). 0.9%).

[0475] Step 3): [ka] Compound 4 (200 mg, 0.96 mmol) and compound 5 (245 mg, 1.15 mmol) ol) was dissolved in acetonitrile (10 mL), and then purged with nitrogen three times and stirred at room temperature for 5 hours. If a new compound is detected by thin layer chromatography, the solution is concentrated under reduced pressure. Finally, the product is purified by column chromatography (methanol:dimethicone). The compound AB24872 (weight 92.6 mg, A yield of 28.3% is obtained.

[0476] Compound AB24872: 1 H NMR(400MHz,CD3OD)δ 10.11(s,1H),9.54( s,1H),9.20(dd,J=39.1,6.4Hz,2H),8.78(d,J= 7.5Hz,2H),8.46-8.36(m,2H),8.22(dd,J=29.1 ,7.7Hz,3H),7.98(d,J=6.7Hz,1H),7.24(s,2H) ,3.22(d,J=11.7Hz,6H). ESI-MS: Theoretical value [M-Br]+ 341.43, Observed value: 341.25.

[0477] Example 9 Preparation of compound AB24854 Step 1): [ka] Compound 1 (8 g, 47.1 mmol) was dissolved in tetrahydrofuran (80 mL), and then 2.5 N lithium aluminum hydride solution in tetrahydrofuran (56 ml) was heated in an ice bath. The mixture was stirred at room temperature for 30 minutes, and then the temperature was raised to 75°C. If a new compound is detected by thin layer chromatography, the mixture is cooled to room temperature. Add water (56 mL) dropwise in an ice bath, then add 15% aqueous sodium hydroxide solution (56 mL) ) and water (158 mL) were added successively, and the aluminum salts were filtered off with diatomaceous earth. The product was extracted by adding 100 mL of saturated sodium chloride solution (100 mL) and the organic phases were combined. The product was washed with water, dried over anhydrous sodium sulfate, and the solution was concentrated under reduced pressure to remove the organic solvent. After removal, compound 2 was obtained (weight: 5.6 g, yield: 75.76%).

[0478] Step 2): [ka] Compound 2 (3 g, 17.64 mmol) was dissolved in dichloromethane (50 mL), and then Add Dess-Martin oxidant (8.97 g, 21.18 mmol) in an ice bath, then add at room temperature. Stir for 1 hour. A new compound was detected by thin layer chromatography. (50 mL) was added, and the aluminum salt was filtered through diatomaceous earth. The filtrate was concentrated under reduced pressure and the extract was purified by The organic solvent was removed, and the mixture was purified by column chromatography (ethyl acetate: petroleum ether = 0-10 %) to give compound 3 (weight 2.4 g, yield 80.9%).

[0479] Step 3): [ka] Compound 3-1 (1.67g, 12.99mmol), Compound 3 (2.4g, 14.29 (mmol) was dissolved in N,N-dimethylformamide (DMF) (30 mL), and then bis( Dibenzylideneacetone)palladium (595 mg, 0.65 mmol), tetrafluoroethylene Tri-tert-butylphosphine borate (377 mg, 1.31 mmol) and tri Ethylenediamine (4.37 g, 38.97 mmol) was added and the mixture was stirred at 120°C for 16 hours. A new compound was detected by thin layer chromatography, and the resulting solution was dissolved in water and ethyl acetate (10 mL). The product is extracted with HCl, and the organic phase is concentrated under reduced pressure to give a residue. Finally, the residue is The compound was purified by chromatography (methanol:dichloromethane = 10%) and compound 4 (heavy The amount obtained was 1.2 g, yield 50%, crude product.

[0480] Step 4): [ka] Compound 4 (500 mg, 2.06 mmol) was dissolved in acetonitrile (5 mL), and then Compound 5 (660 mg, 3.09 mmol) was added, and the mixture was then purged with nitrogen three times. The reaction mixture was stirred overnight at room temperature. If a new compound was detected by thin layer chromatography, the reaction mixture was centrifuged. The liquid was removed and the crude product was prepared to give compound AB24854 (weight 20 mg, yield 2.59%). ) is obtained.

[0481] Compound AB24854: 1 H NMR(400MHz,CD3OD)δ 9.02(s,1H),8.09(s ,2H),7.97(dd,J=13.7,7.1Hz,3H),7.42(d,J=8 .0Hz,2H),7.32-7.19(m,4H),6.27(s,2H),4.25 (s,2H),2.45(s,3H). ESI-MS: Theoretical value [M-CF3COO] + 375.12, Observed: 375.20.

[0482] Example 10 Preparation of compound AB24945 Step 1): [ka] Compound 1 (200 mg, 1.69 mmol) was dissolved in anhydrous N,N-dimethylformamide D Dissolve in MF (20 mL), add NaH (203 mg, 5.07 mmol) in an ice bath, and The mixture was stirred in an ice bath for 30 minutes, and then compound 2 (289 mg, 1.86 mmol) was added thereto. Stir for 3 hours. A new compound was detected by thin layer chromatography. The product was extracted with ethyl acetate (10 mL) and then extracted three times with ethyl acetate. The phases are combined. The organic phase is washed with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. Finally, the product was purified by column chromatography (ethyl acetate:petroleum ether). Compound 3 (weight 260 mg, yield 73.8%) was obtained by purification using HCl (0-10%). do.

[0483] Step 2): [ka] Compound 3 (130 mg, 0.625 mmol) was dissolved in acetonitrile (10 mL). Then, compound 4 (200 mg, 0.94 mmol) was added, and the mixture was then purged with nitrogen three times. The mixture was stirred at room temperature overnight. A new compound was detected by thin layer chromatography. The solid was filtered to obtain compound AB24945 (weight 70 mg, yield 32.8%). .

[0484] Compound AB24945: 1 H NMR(400MHz,CDCl3)δ 10.96(s,1H),8.05( d,J=7.4Hz,2H),7.87(s,2H),7.78(s,1H),7.42 (s,2H),7.36-7.28(m,5H),6.81(d,J=11.9Hz,3 H), 5.70(s,2H), 2.41(s,3H). ESI-MS: Theoretical value [M-Br] + 341.43, Observed: 341.10.

[0485] Example 11 Preparation of compound AB24837 Step 1): [ka] Compound 1 (440 mg, 2 mmol) was dissolved in anhydrous N,N-dimethylformamide (DMF) 20 mL), and then compound 2 (428.4 mg, 4.2 mmol), bistrif Phenylphosphine palladium dichloride (42 mg, 0.06 mmol), N,N-diisopropyl propylethylamine (825 mg, 6.4 mmol) and cuprous iodide (19 mg, 0. 1 mmol) was added, and the mixture was then purged with nitrogen three times and stirred at room temperature overnight. When a new compound was detected by chromatography, the product was diluted with water (50 mL) and ethyl acetate was added. Extract the product by adding ethanol (30 mL x 3). After the organic phases were combined, add saturated saline (50 mL The product was washed with HCl, dried over anhydrous sodium sulfate, filtered, and the solution was concentrated under reduced pressure. Finally, the product is purified by column chromatography (ethyl acetate:silane). Compound 3 (weight 130 mg, yield 33%) was obtained by purifying with diethyl ether (0-50%). obtain.

[0486] Step 2): [ka] Compound 3 (130 mg, 0.47 mmol) was dissolved in dioxane (6 mL), and then Potassium t-butoxide (336.6 mg, 3 mmol) was added, and then the mixture was purged with nitrogen three times. After this, the temperature is raised to 110°C and the mixture is stirred for 16 hours. When new compounds were detected, the product was diluted with water (20 mL) and ethyl acetate (10 mL x 3). The product was extracted by adding the above, and after the organic phases were combined, the product was washed with saturated saline (30 mL), Dry with anhydrous sodium sulfate, filter, and concentrate the solution under reduced pressure to remove the organic solvent. Finally, the product was purified by thin layer chromatography (methanol:dichloromethane = 0-1 0%) to give compound 4 (weight 50 mg, yield 50%).

[0487] Step 3): [ka] Compound 4 (340 mg, 1.75 mmol) was dissolved in acetic acid (5 mL) and then para-di After adding 100 mg of ammonium carbonate (3 mmol), the mixture was substituted with hydrogen three times and then heated at room temperature. Stir for 12 hours. If a new compound is detected by thin layer chromatography, it is filtered and centrifuged. After dewatering, compound 5 (weight 50 mg, yield 50%) is obtained by preparation.

[0488] Step 4): [ka] Compound 6 (50 mg, 0.26 mmol) was dissolved in acetonitrile (10 mL), and then Compound 7 (182 mg, 0.78 mmol) was added immediately, and the mixture was then purged with nitrogen three times. After that, the temperature is raised to 80°C and the mixture is stirred overnight. Once the product is dissolved, dilute it with water (50 mL) and add ethyl acetate (30 mL x 3) to dissolve the product. After extraction and combining the organic phases, the product was washed with saturated saline (50 mL) and added to anhydrous sodium sulfate. The solution is dried over an aqueous solution of 100 ml of ethanol and filtered, and the solution is concentrated under reduced pressure to remove the organic solvent. The product was prepared and purified to give compound AB24837 (weight 30 mg, yield 33. 71%).

[0489] Compound AB24837 1 H NMR(400MHz,DMSO-d6)δ 9.40(s,1H),8.05 (d,J=6.6Hz,1H),8.00(d,J=8.0Hz,2H),7.93(s ,1H),7.69(d,J=7.9Hz,2H),7.38(d,J=6.5Hz,2 H),7.32(d,J=6.5Hz,3H),6.82(d,J=6.5Hz,1H) ,5.87(s,2H),5.36(d,J=8.9Hz,1H),3.74-3.65 (m,1H), 2.99(s,1H). ESI-MS: Theoretical value [M-CF3COO] + 349.84, Observed: 349.00.

[0490] Example 12 Preparation of compound AB24827A Step 1): [ka] Compound 1 (440 mg, 2 mmol) was dissolved in N,N-dimethylformamide (DMF) (20 m L, and then compound 2 (486 mg, 4.2 mmol), cuprous iodide (19 m g, 0.1 mmol), N,N-diisopropylethylamine (824 mg, 6.4 mm ol) and bistriphenylphosphine palladium dichloride (42 mg, 0.06 mmol ) was added successively, and the mixture was then purged with nitrogen three times, followed by stirring at room temperature for 16 hours. When a new compound was detected by chromatography, the product was diluted with water (50 mL) and ethyl acetate was added. (30mLx3) was added to extract the product, and after the organic phases were combined, saturated brine (50mL) was added. The product was washed with HCl, dried over anhydrous sodium sulfate, and filtered, and the solution was concentrated under reduced pressure. Finally, the product is purified by thin layer chromatography (methanol:dichloromethane). Compound 3 (weight 332 mg, yield 79.8%) was obtained by filtration with hexane (10:1). obtain.

[0491] Step 2): [ka] Compound 3 (332 mg, 1.6 mmol) was dissolved in 1,4-dioxane (10 mL). Then potassium t-butoxide (538 mg, 4.8 mmol) was added, and then the mixture was heated under nitrogen. After three replacements, the temperature is raised to 100°C and the mixture is stirred overnight. If a new compound is detected, the solution is immediately concentrated under reduced pressure to remove the organic solvent. The product was purified by thin layer chromatography (methanol:dichloromethane=10:1). Compound 4 (weight: 189 mg, yield: 56.7%) was obtained.

[0492] Step 3): [ka] Compound 4 (189 mg, 0.9 mmol) was dissolved in acetonitrile (10 mL), and then Compound 5 (233 mg, 1.1 mmol) was added immediately, and the mixture was then purged with nitrogen three times. The temperature is raised to 80°C and the mixture is stirred overnight. A new compound is detected by thin layer chromatography. The solution is then immediately concentrated under reduced pressure to remove the organic solvent. The compound AB248 was purified by chromatographic analysis (methanol:dichloromethane = 10:1). 27A (yield 9.3%) was obtained.

[0493] Compound AB24827A: 1 H NMR(400MHz,DMSO-d6)δ 13.00(s,1H),9.0 8(s,1H),8.33(d,J=6.5Hz,1H),8.05(d,J=8.5H z,2H),7.93(d,J=6.8Hz,1H),7.72(d,J=8.3Hz, 2H),7.28(d,J=28.2Hz,5H),6.80(s,1H),6.32( s,2H),4.23(s,2H). ESI-MS: Theoretical value [M-CF3COO] + 361.84, Observed: 361.25.

[0494] Example 13 Preparation of compound AB24887 Step 1): [ka] Compound 1 (200 mg, 1.69 mmol) was dissolved in N,N-dimethylformamide (DMF) 20 mL), and NaH (203 mg, 5.07 mmol) was added in an ice bath. The mixture was stirred for 30 minutes, and then Compound 2 (318 mg, 1.86 mmol) was added, and the mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography, and the resulting solution was diluted with water (30 mL) and acetic acid. Ethyl acetate (30 mL x 3) was added to extract the product, and the organic phases were combined. The organic phase was washed with HCl, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The solvent is removed. Finally, the product is purified by column chromatography (methanol:dichloromethane). The compound was purified by ethanol (0-10%) to give compound 3 (weight 280 mg, yield 79.5%). do.

[0495] Step 2): [ka] Compound 3 (280 mg, 1.3 mmol) was dissolved in acetonitrile (5 mL), and then Compound 4 (430 mg, 2.0 mmol) was added, and the mixture was then purged with nitrogen three times at room temperature. Stir overnight. If a new compound is detected by thin layer chromatography, the reaction mixture is centrifuged. Finally, the product was purified by column chromatography (methanol:dichloromethane = 0- 10%) to obtain compound AB24887 (weight 220 mg, yield 47.9%). obtain.

[0496] Compound AB24887 1 H NMR(400MHz,DMSO,d6)δ 9.28(s,1H),8.47 (s,1H),8.32(s,1H),8.15(s,1H),7.95(d,J=7. 6Hz,2H),7.44(d,J=7.7Hz,2H),7.34(s,5H),7. 17(s,1H),6.37(s,2H),5.66(s,2H),2.41(s,3H ). ESI-MS: Theoretical value [M-Br] + 341.43, Observed: 341.25.

[0497] Example 14 Preparation of compound AB24888 Step 1): [ka] Compound 1 (200 mg, 1.69 mmol) was dissolved in N,N-dimethylformamide (DMF) 20 mL), and NaH (203 mg, 5.07 mmol) was added in an ice bath. The mixture was stirred for 30 minutes, and then Compound 2 (318 mg, 1.86 mmol) was added, and the mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography, and the resulting solution was diluted with water (30 mL) and acetic acid. Ethyl acetate (30 mL x 3) was added to extract the product, and the organic phases were combined. The organic phase was washed with HCl, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The solvent is removed. Finally, the product is purified by column chromatography (methanol:dichloromethane). The compound was purified by ethanol (0-10%) to give compound 3 (weight 280 mg, yield 79.5%). do.

[0498] Step 2): [ka] Compound 3 (250 mg, 1.2 mmol) was dissolved in acetonitrile (5 mL), and then Compound 4 (440 mg, 1.8 mmol) was added, and the mixture was then purged with nitrogen three times at room temperature. Stir overnight. Thin layer chromatography detects a new compound, and the precipitated solid The mixture was filtered, the filter cake was washed three times with acetonitrile (3 mL), and the solution was centrifuged to remove the liquid. Compound AB24888 (weight 300 mg, yield 67.1%) was obtained.

[0499] Compound AB24888 1 H NMR(400MHz,DMSO,d6)δ 9.26(s,1H),8.73 (s,1H),8.58(d,J=8.1Hz,1H),8.46(t,J=7.4Hz ,2H),8.35(d,J=6.8Hz,1H),8.16(s,1H),7.94( t,J=7.9Hz,1H),7.33(s,5H),7.19(s,1H),6.47 (s,2H),5.66(s,2H). ESI-MS: Theoretical value [M-Br] + 372.40, Observed: 372.25.

[0500] Example 15 Preparation of compound AB24895 Step 1): [ka] Compound 1 (500 mg, 4.23 mmol), iodobenzene (963 mg, 4.23 mmol), mmol), cuprous iodide (16.2 mg, 0.085 mmol), tripotassium phosphate ( 1.79 g, 8.46 mmol) and cyclohexanediamine (99 mg, 0.87 mmol) Dissolve the mol) in N,N-dimethylformamide (DMF) (20 mL). Then, purify with nitrogen three times. After the substitution, the temperature is raised to 110°C and the mixture is stirred for 16 hours. If a new compound is detected, the solution is concentrated under reduced pressure to remove the organic solvent. The product was purified by column chromatography (methanol:dichloromethane = 0-10%). Compound 3 (weight: 580 mg) was obtained.

[0501] Step 2): [ka] Compound 3 (290 mg, 1.49 mmol) and compound 4 (477 mg, 2.24 mmol) ol) was dissolved in acetonitrile (10 mL), and then purged with nitrogen three times and stirred at room temperature for 3 hours. If a new compound is detected by thin layer chromatography, the solution is concentrated under reduced pressure. Finally, the product is purified by column chromatography (methanol:dimethicone). The compound AB24895 (weight 377 mg, yield 10%) was purified with chloromethane (0-10%). The rate is 77.3%.

[0502] Compound AB24895: 1 H NMR(400MHz,DMSO-d6)δ 9.45(s,1H),8.56 (d,J=5.9Hz,1H),8.31(s,1H),8.14(d,J=6.5Hz ,1H),7.96(d,J=7.3Hz,2H),7.70(dd,J=22.8,7 .0Hz,4H),7.57(d,J=6.7Hz,1H),7.43(d,J=7.3 Hz,2H),7.36(s,1H),6.50(s,2H),2.40(s,3H). ESI-MS: Theoretical value [M-Br] + 327.41, Observed: 327.20.

[0503] Example 16 Preparation of compound AB24833A Step 1): [ka] Compound 1 (2.0g, 15.5mmol), Compound 2 (5.6g, 46.6mmol) , bis(dibenzylideneacetone)palladium (771.0 mg, 0.5 mmol), Tri-tert-butylphosphine tetrafluoroborate (451.0 mg, 1 mmol) and triethylenediamine (5.24 g, 30 mmol) in N,N-dimethylformamide The mixture was dissolved in DMF (50 mL), purged with nitrogen three times, and stirred at 120°C for 16 hours. After that, new compounds were detected by thin layer chromatography. The mixture was cooled to room temperature and then mixed with water. Ethyl acetate (100 mL x 3) was added to extract the product, and after the organic phases were combined, saturated brine was added. (100 mL), dried over anhydrous sodium sulfate, and concentrated the solution under reduced pressure. Finally, the product is purified by column chromatography (ethyl acetate:silane). Compound 3 (weight 70 mg, yield 2.16%) was purified with diethyl ether (66.6%). get.

[0504] Step 2): [ka] Compound 3 (70 mg, 0.336 mmol) and compound 4 (157 mg, 0.673 mmol) mol) in acetonitrile (10 mL) and o Stir for 3 hours. When a new compound was detected by HPLC, the reaction solution was cooled to room temperature and immediately filtered. The filter cake was washed with ethyl acetate to obtain compound AB24833A (weight 40 mg, yield The rate is 32.8%.

[0505] Compound AB24833A 1 H NMR(399MHz,DMSO-d6)δ 12.76(s,1H),9.2 6(s,1H),8.36(d,J=7.0Hz,1H),8.06(s,2H),8. 02(d,J=7.2Hz,1H),7.82(s,1H),7.75(s,2H),7 .29(d,J=7.8Hz,4H),7.18(s,1H),6.33(s,2H), 4.14(s,2H). ESI-MS: Theoretical value [M-CF3COO] + 361.85, Observed: 361.25.

[0506] Example 17 Preparation of compound AB24916 Step 1): [ka] Compound 1 (480 mg, 3.0 mmol) was dissolved in acetic acid (7 mL), and then the mixture was Liquid bromine (480 mg, 3.0 mmol) was added, followed by the addition of two drops of aqueous hydrobromic acid. The mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography. 0 mL) was added, and ethyl acetate (30 mL x 3) was added to extract the product, and the organic phases were combined. After that, the product was washed with saturated saline (30 mL), dried over anhydrous sodium sulfate, and then evaporated under reduced pressure. The solution was concentrated to remove the organic solvent, and compound 2 (weight: 400 mg, yield: 55.8%) was obtained. get.

[0507] Step 2): [ka] Compound 2 (150 mg, 0.63 mmol) was dissolved in acetonitrile (10 mL). Compound 3 (150 mg, 0.82 mmol) was then added, and the mixture was then purged with nitrogen three times. After that, the mixture was stirred at room temperature overnight. A new compound was detected by thin layer chromatography. The solid was filtered off, washed three times with acetonitrile (2 mL), and centrifuged. Compound AB24916 (weight 50 mg, yield 23.1%) was obtained via

[0508] Compound AB24916: 1 H NMR(400MHz, DMSO-d6)δ 9.55(s,1H),8.2 6(d,J=7.0Hz,1H),8.15(d,J=7.1Hz,1H),7.69( s,1H),7.47(d,J=7.6Hz,1H),7.35(dd,J=20.0, 5.6Hz,6H),7.07(d,J=7.0Hz,1H),6.98(d,J=6. 7Hz,1H),5.69(d,J=10.6Hz,1H),4.57(d,J=5.5 Hz,2H),3.21(d,J=12.6Hz,1H),3.11(d,J=16.3 Hz,1H),2.75(d,J=10.4Hz,1H),2.46-2.41(m,1 H), 2.32(s,3H). ESI-MS: Theoretical value [M-Br] + 343.44, Observed: 343.10.

[0509] Example 18 Preparation of compound AB24913 Step 1): [ka] Compound 1 (500 mg, 2.77 mmol) was dissolved in acetic acid (7 mL), and the mixture was then Liquid bromine (443 mg, 2.77 mmol) was added to the solution, and two drops of aqueous hydrobromic acid were added. The mixture was then stirred at room temperature for 3 hours. (30 mL) was added, and ethyl acetate (30 mL x 3) was added to extract the product. The organic phases were combined. After that, the product was washed with saturated saline (30 mL), dried over anhydrous sodium sulfate, and The solution was concentrated under reduced pressure to remove the organic solvent, and compound 2 (weight 200 mg, yield 27.8%) was obtained. %).

[0510] Step 2): [ka] Compound 3 (5.6 g, 53.13 mmol) was dissolved in ethanol (10 mL), and then Compound 4 (5 g, 53.13 mmol) was added at 100°C, and the mixture was purged with nitrogen three times. The temperature is raised to 90°C and stirred for 2 hours. New compounds are detected by thin layer chromatography. The reaction temperature was then lowered to 0°C, and sodium borohydride (4.01 g, 106.2 mmHg) was added. The reaction mixture was allowed to warm to room temperature and stirred for 1 hour. If a new compound was detected by the filter, the product was diluted with water (200 mL) and ethyl acetate (2 Extract the product by adding 200 mL of saturated sodium chloride solution (200 mL) and combining the organic phases. The product was washed with HCl, dried over anhydrous sodium sulfate, and filtered, and the solution was concentrated under reduced pressure. Finally, the product is purified by column chromatography (methanol:dic Compound 5 (weight 2.6 g, yield 26.8%) was obtained by purifying with chloromethane (10:1). obtain.

[0511] Step 3): [ka] Compound 2 (200 mg, 0.77 mmol) was dissolved in acetonitrile (10 mL). Compound 5 (212 mg, 1.12 mmol) was then added, followed by three nitrogen substitutions. After that, the mixture was stirred at room temperature overnight. A new compound was detected by thin layer chromatography. The solid was filtered off, washed three times with acetonitrile (2 mL), and centrifuged. Compound AB24913 (weight 50 mg, yield 17.5%) was obtained via

[0512] Compound AB24913: 1 H NMR(400MHz,DMSO,d6)δ 9.34(s,1H),8.22 (s,1H),8.12(d,J=6.5Hz,1H),7.82(s,1H),7.7 2(d,J=8.0Hz,1H),7.50(d,J=7.9Hz,1H),7.34( d,J=25.3Hz,5H),7.01(d,J=6.4Hz,2H),5.68(d ,J=14.0Hz,1H),4.57(d,J=5.3Hz,2H),3.19(t, J=17.3Hz,3H),2.77(d,J=9.0Hz,1H). ESI-MS: Theoretical value [M-Br-]+363.86, Observed value: 363.30.

[0513] Example 19 Preparation of compound AB24841A Step 1): [ka] Compound 1 (5.6 g, 53.13 mmol) was dissolved in ethanol (10 mL), and then Compound 2 (5 g, 53.13 mmol) was added at 100°C, and the mixture was purged with nitrogen three times. The temperature is raised to 90°C and stirred for 2 hours. New compounds are detected by thin layer chromatography. The reaction temperature was then lowered to 0°C, and sodium borohydride (4.01 g, 106.2 mmHg) was added. The reaction mixture was allowed to warm to room temperature and stirred for 1 hour. If a new compound was detected by the filter, the product was diluted with water (200 mL) and ethyl acetate (2 Extract the product by adding 200 mL of saturated sodium chloride solution (200 mL) and combining the organic phases. The product was washed with HCl, dried over anhydrous sodium sulfate, and filtered, and the solution was concentrated under reduced pressure. Finally, the product is purified by column chromatography (methanol:dic Compound 3 (weight 2.6 g, yield 26.8%) was obtained by purifying with methyl methyl ether (10:1). obtain.

[0514] Step 2): [ka] Compound 4 (500 mg, 2.7 mmol) was dissolved in acetic acid (50 mL), and the mixture was then Add liquid bromine (442 mg, 2.7 mmol) to the mixture, add two drops of aqueous hydrobromic acid, and then The mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography. 30 mL) was added, and ethyl acetate (30 mL x 3) was added to extract the product. The organic phases were combined. After that, the product was washed with saturated saline (30 mL), dried over anhydrous sodium sulfate, and The solution was concentrated under reduced pressure to remove the organic solvent, and compound 5 (weight 700 mg, yield 97.3%) was obtained. ) is obtained.

[0515] Step 3): [ka] Compound 5 (400 mg, 1.5 mmol) and compound 3 (200 mg, 1.1 mmol) ) was dissolved in acetonitrile (10 mL), and the mixture was then purged with nitrogen three times and stirred at room temperature for 5 hours. If a new compound is detected by thin layer chromatography, the solution is concentrated under reduced pressure. The organic solvent is removed. Finally, the product is purified by column chromatography (methanol:dichloromethane). The compound AB24841A (weight 37 mg, yield 100%) was purified with 20% methyl ether (0-10%). 9.3%).

[0516] Compound AB24841A: 1H NMR(400MHz,CDCl3)δ 9.96(s,1H),7.90-7 .52(m,3H),7.25(s,8H),6.50(s,1H),5.50(s,1 H),4.43(s,2H),3.34(s,1H),3.05(s,1H),2.50 (d, J = 38.1 Hz, 2 H). ESI-MS: Theoretical value [M-CF3COO] + 363.86, Observed: 363.25.

[0517] Example 20 Preparation of compound AB24920 Step 1): [ka] Compound 1 (500 mg, 2.6 mmol) was dissolved in tetrahydrofuran (10 mL). Then, liquid bromine (418 mg, 2.6 mmol) was added at 0°C, and the mixture was stirred at 0°C for 2 hours. When a new compound was detected by thin layer chromatography, it was resolved by eluting it with 2M aqueous sodium bicarbonate ( The product was diluted with ethyl acetate (40 mL) and ethyl acetate (40 mL), and the organic phase was centrifuged to obtain compound 2 ( The weight is 400 mg (Crude).

[0518] Step 2): [ka] Compound 2 (200 mg, 0.70 mmol) and Compound 3 (130 mg, 0.70 mmol) ol) is dissolved in acetonitrile (10 mL) and then stirred at room temperature for 4 hours. When a new compound is detected by chromatography, the reaction mixture is centrifuged and the compound is then analyzed by column chromatography. The compound AB24920 (weight 41 m g, yield 14.8%).

[0519] Compound AB24920: 1 H NMR(400MHz,DMSO,d6)δ=9.44(s,1H),8.54 (s,1H),8.46(d,J=8.1,1H),8.26(d,J=6.5,1H) ,8.14(d,J=6.0,1H),7.76(d,J=8.3,1H),7.37( s,4H),7.31(s,1H),7.04(s,2H),5.79(d,J=12. 9,1H),5.73(s,1H),4.58(d,J=4.9,2H),2.83(s ,1H),2.51(s,1H). ESI-MS: Theoretical value [M-Br] + 374.41, Observed: 374.30.

[0520] Example 21 Preparation of compound AB24923 Step 1): [ka] Compound 1 (5.6 g, 53.13 mmol) was dissolved in ethanol (10 mL), and then Compound 2 (5 g, 53.13 mmol) was added at 100°C, and the mixture was purged with nitrogen three times. The temperature is raised to 90°C and stirred for 2 hours. New compounds are detected by thin layer chromatography. The reaction temperature was then lowered to 0°C, and sodium borohydride (4.01 g, 106.2 mmHg) was added. The reaction mixture was allowed to warm to room temperature and stirred for 1 hour. Upon detecting a new compound in the feed, the product was diluted with water (200 mL) and then diluted with ethyl acetate. Extract the product by adding ethanol (200 mL x 3). After the organic phases were combined, add saturated saline (200 mL) The product was washed with 1 mL of HCl, dried over anhydrous sodium sulfate, and filtered. The solution was then concentrated under reduced pressure. The product is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol Compound 3 (weight 2.6 g, yield 26.8%) was purified with hexane (methylene chloride = 10:1). %).

[0521] Step 2): [ka] Compound 4 (300 mg, 2.03 mmol) was dissolved in acetic acid (10 mL) and then mixed. Liquid bromine (326 mg, 2.03 mmol) was added to the solution, and two drops of aqueous hydrobromic acid were added. The mixture was then stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography. Add water (30 mL) and ethyl acetate (30 mL x 3) to extract the product. After combining, the product was washed with saturated saline (30 mL) and dried over anhydrous sodium sulfate. The solution was concentrated under reduced pressure to remove the organic solvent and give compound 5 (weight 400 mg, yield 86. 7%).

[0522] Step 3): [ka] Compound 5 (200 mg, 0.88 mmol) was dissolved in acetonitrile (10 mL). Compound 3 (109 mg, 0.59 mmol) is then added, followed by three nitrogen substitutions. When a new compound was detected by thin layer chromatography, compound AB2 was extracted via centrifugal dehydration. 4923 (weight 25 mg, yield 8.6%) is obtained.

[0523] Compound AB24923: 1 H NMR(400MHz,CD3OD)δ 8.68(s,1H),8.14(d ,J=6.6Hz,1H),8.06(t,J=6.7Hz,3H),7.71(s,1 H),7.37(s,7H),7.31(d,J=3.5Hz,1H),6.97(dd ,J=26.9,6.0Hz,3H),4.93-4.91(m,2H),4.60(s ,2H),3.44(d,J=13.3Hz,1H),2.85(t,J=9.2Hz, 1H), 2.64 (d, J = 10.5 Hz, 1H). ESI-MS: Theoretical value [M-CF3COO-] + 330.40, Observed: 330.30 .

[0524] Example 22 Preparation of compound AB24840A Step 1): [ka] Compound 1 (5.6 g, 53.13 mmol) was dissolved in ethanol (10 mL), and then Compound 2 (5 g, 53.13 mmol) was added at 100°C, and the mixture was purged with nitrogen three times. The temperature is raised to 90°C and stirred for 2 hours. New compounds are detected by thin layer chromatography. The reaction temperature was then lowered to 0°C, and sodium borohydride (4.01 g, 106.2 mmHg) was added. The reaction mixture was allowed to warm to room temperature and stirred for 1 hour. Upon detecting a new compound in the feed, the product was diluted with water (200 mL) and then diluted with ethyl acetate. Extract the product by adding ethanol (200 mL x 3). After the organic phases were combined, add saturated saline (200 mL) The product was washed with 1 mL of HCl, dried over anhydrous sodium sulfate, and filtered. The solution was then concentrated under reduced pressure. The product is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol Compound 3 (weight 2.6 g, yield 26.8%) was purified with hexane (methylene chloride = 10:1). %).

[0525] Step 2): [ka] Compound 4 (500 mg, 3.0 mmol) was dissolved in acetic acid (50 mL), and the mixture was then Add liquid bromine (480 mg, 3.0 mmol) to the mixture, add two drops of hydrobromic acid solution, and then The mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography. 30 mL) was added, and ethyl acetate (30 mL x 3) was added to extract the product. The organic phases were combined. After that, the product was washed with saturated saline (30 mL), dried over anhydrous sodium sulfate, and The solution was concentrated under reduced pressure to remove the organic solvent, and compound 5 (weight: 600 mg, yield: 38.46%) was obtained. %).

[0526] Step 3): [ka] Compound 5 (300 mg, 1.2 mmol) and Compound 3 (200 mg, 1.1 mmol) ) was dissolved in acetonitrile (10 mL), and the mixture was then purged with nitrogen three times and stirred at room temperature for 5 hours. If a new compound is detected by thin layer chromatography, the solution is concentrated under reduced pressure. The organic solvent is removed. Finally, the product is purified by column chromatography (methanol:dichloromethane). Compound AB24840A (weight 27.6 mg, yield 10%) was purified with methyl hexane (0-10%). The rate is 7.2%.

[0527] Compound AB24840A: 1 H NMR(400MHz,DMSO,d6)δ 9.38(s,1H),8.31 (d,J=7.1Hz,1H),8.16(d,J=7.0Hz,1H),7.84-7 .75(m,2H),7.60(d,J=8.1Hz,1H),7.34(dd,J=2 3.4,6.5Hz,5H),6.99(d,J=6.6Hz,2H),5.62(t, J=6.7Hz,1H),4.58(d,J=5.4Hz,2H),3.85(dd,J =17.3,8.2Hz,1H),3.45(s,1H). ESI-MS: Theoretical value [M-CF3COO] + 349.84, Observed: 349.20.

[0528] Example 23 Preparation of compound AB24904 Step 1): [ka] Compound 1 (146 mg, 1.0 mmol) was dissolved in acetic acid (5 mL), and then the mixture was Liquid bromine (160 mg, 1.0 mmol) was added, and two drops of aqueous hydrobromic acid were added. The mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography. 0 mL) was added, and ethyl acetate (30 mL x 3) was added to extract the product, and the organic phases were combined. After that, the product was washed with saturated saline (30 mL), dried over anhydrous sodium sulfate, and then evaporated under reduced pressure. The solution was concentrated to remove the organic solvent, and compound 2 (weight: 180 mg, yield: 97.3%) was obtained. get.

[0529] Step 2): [ka] Compound 2 (180 mg, 0.79 mmol) was dissolved in acetonitrile (10 mL). Compound 3 (161 mg, 0.87 mmol) was then added, and the mixture was then purged with nitrogen three times. After that, the mixture was stirred at room temperature overnight. A new compound was detected by thin layer chromatography. The solid was filtered off, washed three times with acetonitrile (2 mL), and centrifuged. Compound AB24904 (weight 40 mg, yield 15.4%) was obtained via

[0530] Compound AB24904: 1 H NMR(400MHz, DMSO-d6)δ 9.76(s,1H),8.3 4(d,J=6.1Hz,1H),8.20(d,J=6.0Hz,1H),7.64( d,J=6.7Hz,1H),7.45(d,J=6.7Hz,1H),7.37(s, 4H),7.30(d,J=5.3Hz,2H),7.11(s,1H),6.97(s ,1H),5.67(s,1H),4.57(s,2H),3.77(dd,J=16. 2,8.1Hz,1H),2.53(s,3H),2.48(s,1H). ESI-MS: Theoretical value [M-Br] + 329.42, Observed: 329.50.

[0531] Example 24 Preparation of compound AB24905 Step 1): [ka] Compound 1 (5.6 g, 53.13 mmol) was dissolved in ethanol (10 mL), and then Compound 2 (5 g, 53.13 mmol) was added at 100°C, and the mixture was purged with nitrogen three times. The temperature is raised to 90°C and stirred for 2 hours. New compounds are detected by thin layer chromatography. The reaction temperature was then lowered to 0°C, and sodium borohydride (4.01 g, 106.2 mmHg) was added. The reaction mixture was allowed to warm to room temperature and stirred for 1 hour. Upon detecting a new compound in the feed, the product was diluted with water (200 mL) and then diluted with ethyl acetate. Extract the product by adding ethanol (200 mL x 3). After the organic phases were combined, add saturated saline (200 mL) The product was washed with 1 mL of HCl, dried over anhydrous sodium sulfate, and filtered. The solution was then concentrated under reduced pressure. The product is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol Compound 3 (weight 2.6 g, yield 26.8%) was purified with hexane (methylene chloride = 10:1). %).

[0532] Step 2): [ka] Compound 4 (300 mg, 2.05 mmol) was dissolved in acetic acid (10 mL) and then mixed. Liquid bromine (328 mg, 2.05 mmol) was added to the solution, and two drops of aqueous hydrobromic acid were added. The mixture was then stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography. Add water (30 mL) and ethyl acetate (30 mL x 3) to extract the product. After combining, the product was washed with saturated saline (30 mL) and dried over anhydrous sodium sulfate. The solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product is purified by column chromatography. - (ethyl acetate: petroleum ether = 0-20%), and compound 5 (weighing 300 mg) , yield 65%).

[0533] Step 3): [ka] Compound 5 (200 mg, 0.89 mmol) was dissolved in acetonitrile (10 mL). Compound 3 (110 mg, 0.60 mmol) was then added, followed by three nitrogen substitutions. Stir overnight at room temperature. If a new compound is detected by thin layer chromatography, The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol). The compound AB24905 (weight 110 mg, yield 56%).

[0534] Compound AB24905: 1 H NMR(400MHz,DMSO-d6)δ 9.43(s,1H),8.30 (d,J=6.9Hz,1H),8.15(d,J=6.8Hz,1H),7.63(d ,J=7.6Hz,1H),7.55(d,J=8.9Hz,2H),7.36(s,4 H),7.30(d,J=5.6Hz,1H),6.99(t,J=8.0Hz,2H) ,5.62(s,1H),4.57(d,J=5.5Hz,2H),3.78(dd,J =16.7,8.4Hz,1H),3.37(s,1H),2.38(s,3H). ESI-MS: Theoretical value [M-Br] + 329.41, Observed: 329.25.

[0535] Example 25 Preparation of compound AB24883 Step 1): [ka] Compound 1 (1.06 g, 10 mmol) was dissolved in ethanol (50 mL), and then Compound 2 (1.37 g, 10 mmol) was added, and the mixture was then purged with nitrogen three times. The temperature was raised to 90°C and the mixture was stirred for 2 hours. A new compound was detected by thin layer chromatography. The reaction temperature was lowered to 0°C, and sodium borohydride (1.13 g, 30 mmol) was slowly added. The reaction mixture is allowed to warm to room temperature and stirred for 1 hour. Upon detecting new compounds, the product was diluted with water (20 mL) and then ethyl acetate (20 mL). The product was extracted by adding 20 mL of saturated saline solution (2 x 3). After the organic phases were combined, the product was washed with saturated saline solution (20 mL). The solution was concentrated under reduced pressure, and the organic solvent was removed. Finally, the product is purified by column chromatography (methanol:dichloromethane =10:1) to give compound 3 (weight 600 mg, yield 26.4%).

[0536] Step 2): [ka] Compound 3 (50 mg, 0.22 mmol) was dissolved in N,N-dimethylformamide (DMF) mL) and then 2-(7-azinebenzotriazole)-N,N,N',N'- Tetramethylurea hexafluorophosphate (125.55 mg, 0.33 mmol), N,N-di Isopropylethylamine (85.2 mg, 0.66 mmol) and compound 4 (25.9 mg, 0.24 mmol) was added, and the mixture was then purged with nitrogen three times and stirred at room temperature overnight. A new compound was detected by thin layer chromatography, and the resulting solution was dissolved in water (10 mL) and ethyl acetate. The product was extracted with 10 mL of ethyl acetate, and then extracted three times with ethyl acetate. The organic phases were combined and then saturated. The product was washed with saturated saline, dried over anhydrous sodium sulfate, filtered, and the solution was evaporated under reduced pressure. The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol). The compound AB24883 (weight 27.9%) was purified in dichloromethane (0-10%). mg, yield 36.7%).

[0537] Compound AB24883 1 H NMR(400MHz,DMSO,d6)δ 8.79(s,1H),8.70 (d,J=8.2Hz,1H),7.94(d,J=8.4Hz,2H),7.77(s ,1H),7.62(s,1H),7.36(s,4H),7.26(s,1H),6. 78(d,J=8.1Hz,2H),4.43(d,J=5.0Hz,2H). ESI-MS: Theoretical value [M+1] + 348.30, Observed: 348.20.

[0538] Example 26 Preparation of compound AB24851 Step 1): [ka] Compound 1 (3.0 g, 18.3 mmol) was dissolved in methylbenzene (50 mL), and then Compound 2 (5.8 g, 54.8 mmol), cesium carbonate (12.0 g, 36.5 mmol), mol), tri-(diphenylene-BASEacetone)dipalladium (334 mg, 0. 36mmol) and 2-dicyclohexylhexylphosphonium-2,4,6-triisopropyl Biphenyl (262 mg, 0.54 mmol) was added, and the mixture was then purged with nitrogen three times. The temperature is raised to 110°C and stirred for 16 hours. A new compound is identified by thin layer chromatography. Upon detection, the reaction temperature was lowered to room temperature and the product was diluted with water (50 mL) followed by ethyl acetate. (50mLx3) was added to extract the product, and after the organic phases were combined, saturated brine (50mL) was added. The product was washed with HCl, dried over anhydrous sodium sulfate, and filtered, and the solution was concentrated under reduced pressure. Finally, the product is purified by column chromatography (methanol:dic Compound 3 (weight 150 mg, yield 4.4%) was obtained by purifying with hexane (10:1). obtain.

[0539] Step 2): [ka] Compound 3 (150 mg, 0.78 mmol) was dissolved in acetonitrile (5 mL), and then Compound 4 (151 mg, 0.71 mmol) was added at 20°C, and the mixture was purged with nitrogen three times. The temperature is raised to 80°C and stirred overnight. New compounds are detected by thin layer chromatography. The reaction mixture was cooled to room temperature, and the reaction mixture was centrifuged to remove the liquid, thereby obtaining compound AB24851 (by weight). 10 mg of the compound was obtained, with a yield of 3.9%.

[0540] Compound AB24851: 1 H NMR(400MHz,CD3OD)δ 7.93(d,J=7.8Hz,2H ),7.34(dd,J=47.3,19.8Hz,9H),4.58(s,2H),4 .37(s,2H),2.45(s,3H). ESI-MS: Theoretical value [M-CF3COO] + 323.43, Observed: 323.20.

[0541] Example 27 Preparation of compound AB24850 Step 1): [ka] Compound 1 (2g, 5.91mmol), compound 2 (2.51g, 7.09mmol) and and sodium methoxide (958 mg, 17.73 mmol) in absolute ethanol (30 The resulting solution was dissolved in 1 mL of HCl and stirred at room temperature for 16 hours. Once the solution is extracted, it is cooled to room temperature and water (50 mL) and ethyl acetate (50 mL x 3) are added. The product was extracted, and the organic phases were combined. The product was then washed with saturated saline (50 mL) and diluted with sulfuric acid anhydride. The solution is dried over sodium and concentrated under reduced pressure to remove the organic solvent. The product was purified by column chromatography (ethyl acetate: petroleum ether = 0-30%) and Compound 3 was obtained (weight 2.1 g, yield 86.24%).

[0542] Step 2): [ka] Compound 3 (1.2 g, 2.91 mmol) was dissolved in tetrahydrofuran (6 mL) and water (6 mL), then add concentrated hydrochloric acid (3 mL), then stir at 100°C for 3 hours. When a new compound was detected by chromatography, it was cooled to room temperature and saturated sodium bicarbonate was added. Add sodium solution to adjust the pH value, and add ethyl acetate (50 mL x 3) to extract the product. After the organic phases were combined, the product was washed with saturated saline (50 mL) and anhydrous sodium sulfate. The solution was dried at 77°C, concentrated under reduced pressure to remove the organic solvent, and compound 4 (weight 500 mg) was obtained. , and the yield is 83.21%.

[0543] Step 3): [ka] Compound 4 (200 mg, 1.17 mmol) and compound 5 (249 mg, 1.17 mmol) ol) was dissolved in acetonitrile (10 mL) and then triethylamine (356 mg, Add 3.51 mmol) and stir at 80°C for 16 hours. When a compound is detected, the reaction mixture is cooled to room temperature, centrifuged, and compound A is extracted. B24850 (weight 40 mg, yield 11.32%) is obtained.

[0544] Compound AB24850: 1 H NMR(400MHz,CD3OD)δ 8.83(s,0H),7.93(d ,J=7.4Hz,1H),7.43-7.27(m,2H),7.22(s,0H), 6.99(s,0H),6.48(s,0H),5.84(s,1H),2.44(s, 3H). ESI-MS: Theoretical value [M+1] + 303.14, Observed: 303.00.

[0545] Example 28 Preparation of compound AB24885 Step 1): [ka] Compound 1 (519 mg, 3 mmol) was dissolved in tetrahydrofuran (30 mL), and then Compound 2 (481 mg, 4.5 mmol) and methanesulfonic acid (2-dicyclohexyl Cylhexylrin)-3,6-dimethoxy-2',4',6'-triisopropyl-1, 1'-biphenyl)(2'-amino-1,1'-biphenyl-2-yl)palladium(II) ) (163 mg, 0.18 mmol) was added successively, the reaction temperature was lowered to 0°C, and then dichloromethane was added. After injecting methylsilylamine lithium and then replacing it with nitrogen three times, the temperature reached 40 ℃ The temperature was raised to 100°C and the mixture was stirred for 16 hours. A new compound was detected by thin layer chromatography. (50 mL) and add ethyl acetate (50 mL x 3) to extract the product. After the phases were combined, the product was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, and The solution is concentrated under reduced pressure to remove the organic solvent. The compound was purified by column chromatography (methanol:dichloromethane = 10:1) to give compound 3. (weight 80 mg, yield 13%)

[0546] Step 2): [ka] Compound 3 (160 mg, 0.8 mmol) was dissolved in N-tert-butanol (10 mL). The solution was then dissolved in triethyl formate (296 mg, 2 mmol) and formate (37 mg, 0. After successive addition of 8 mmol) and then purging with nitrogen three times, the temperature rose to 110°C. Stir for 18 hours. A new compound was detected by thin layer chromatography, and the mixture was immediately purified under reduced pressure. The solution is concentrated to remove the organic solvent. Finally, the product is purified by thin layer chromatography. Compound 4 was obtained (weight: 100 mg, yield: 63.8%).

[0547] Step 3): [ka] Compound 4 (100 mg, 0.5 mmol) was dissolved in acetonitrile (10 mL), and then Compound 5 (127 mg, 0.6 mmol) was added immediately, and the mixture was then purged with nitrogen three times. The mixture was stirred at room temperature overnight. When a new compound was detected by thin layer chromatography, the mixture was immediately The solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product is purified by thin layer chromatography. This gives compound AB24885 (weight 20 mg, yield 9.4%).

[0548] Compound AB24885: 1H NMR(400MHz,DMSO-d6)δ 9.39(s,1H),8.92 (s,1H),8.54(d,J=6.4Hz,1H),8.17(d,J=6.9Hz ,1H),7.99(d,J=7.7Hz,2H),7.42(d,J=10.2Hz, 7H),5.72(s,2H),4.85-4.84(m,2H),2.46(s,3H) ). ESI-MS: Theoretical value [M-Br] + 342.41, Observed: 342.30.

[0549] Example 29 Preparation of compound AB24898 Step 1): [ka] Compound 2 (53.5 mL, 150 mmol, 3N) was dissolved in tetrahydrofuran, and then Compound 1 (6.25 g, 50 mmol) was added at 0°C, and the mixture was stirred at 0°C to room temperature for 16 hours. When a new compound was detected by thin layer chromatography, it was found to be The product was filtered through diatomaceous earth, extracted with ethyl acetate, and the solution was concentrated under reduced pressure. The organic solvent is then removed. Finally, the product is purified by column chromatography (ethyl acetate:petroleum The compound was purified with ether (1:2) to give compound 3 (weight 4.2 g, yield 41.37%). do.

[0550] Step 2): [ka] Compound 3 (4.06 g, 20 mmol) was dissolved in tetrahydrofuran and then heated at 0°C. Add Dess-Martin oxidant (10.17 g, 24 mmol). Stir at 0°C for 2 hours. When new compounds are detected by thin layer chromatography, the products are The compound 4 (weight 4.0 g, yield 1.0 g) was purified with ethyl acetate:petroleum ether (1:3). The rate is 99.0%.

[0551] Step 3): [ka] Compound 4 (402 mg, 2 mmol) was dissolved in ethanol, and then hydrazine hydrate was added. (200 mg, 4 mmol) is added, followed by stirring at 90°C for 16 hours. When a new compound is detected in the column, the product is directly transferred to column chromatography via centrifugal deliquoring. Compound 5 (weight 60 ml) was purified by chromatography (ethyl acetate:petroleum ether = 1:1). g, yield 15.30%).

[0552] Step 4): [ka] Compound 5 (100 mg, 0.51 mmol) and compound 6 (123.93 mg, 0.5 (1 mmol) is dissolved in acetonitrile (5 mL) and then stirred at room temperature for 3 hours. When a new compound is detected by chromatography, the solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product was purified by column chromatography (methanol:dichloromethane = 0- 30%) and purified to compound AB24898 (weight 100 mg, yield 54.61%). get.

[0553] Compound AB24898: 1 H NMR(400MHz,DMSO-d6)δ 9.77(s,1H),8.89 (d,J=6.4Hz,1H),8.78(s,1H),8.65-8.47(m,3H ),8.11(d,J=7.4Hz,2H),7.97(t,J=7.9Hz,1H), 7.65-7.50(m,3H),6.65(s,2H). ESI-MS: Theoretical value [M-Br - ] + 359.36, Observed: 359.25.

[0554] Example 30 Preparation of compound AB24839B Step 1): [ka] Compound 1 (2.1 g, 20 mmol) was dissolved in ammonia and ethanol (40:40 mL). The mixture was stirred at -78°C to -10°C for 3 hours, and then compound 2 (6.72 g, 40 m mol) and stir at room temperature overnight. Then, the pH value was adjusted to 1 by adding concentrated hydrochloric acid solution, and the product was extracted with water and ethyl acetate (80 mL). The pH value of the aqueous phase was adjusted to 14 with 50% sodium hydroxide, and the solution was diluted with water and dichloromethane (2 The product was extracted with 10 mL of hexane (×80 mL), and the organic phase was centrifuged to obtain compound 3 (weight 1.6 g, yield 54.42%).

[0555] Step 2): [ka] Compound 3 (5g, 28.57mmol), Compound 4 (21g, 142.85mmol) and triethylamine (28.85 g, 285.7 mmol) in acetonitrile (60 m L) and then stirred at 80°C for 16 hours. Thin layer chromatography revealed a new compound When detected, extract the product with water and ethyl acetate (200 mL x 2). The solution was centrifuged and purified by column chromatography (PE:EA = 5:1) to obtain compound 5( A weight of 2.2 g is obtained, with a yield of 25.41%.

[0556] Step 3): [ka] Compound 5 (2.2g, 7.26mmol), Compound 6 (1.68g, 10.89mmol) l), sodium carbonate (2.1 g, 19.8 mmol) and [1,1'-di(diphenyl Phosphine)dicyclopentadienyliron]palladium dichloride (495.6mg, 0.6 6 mmol) was dissolved in dioxane and water (21:7 mL) and heated at 95°C for 16 minutes in a sealed tube. A new compound was detected by thin layer chromatography, and the resulting solution was dissolved in water and ethyl acetate ( The product is extracted with 200 mL of ethanol. The organic phase is centrifuged and then purified by column chromatography. The product was purified using a 3:1 ethanol / ethanol (PE:EA) mixture to give compound 7 (weight 200 mg, yield 11. 02%).

[0557] Step 4): [ka] Compound 7 (500 mg, 2 mmol), dimethylaminopyridine (48.8 mg, 0. 4 mmol), triethylamine (404 mg, 4 mmol) and trifluoroacetic anhydride (2.1 g, 10 mmol) was dissolved in dichloromethane (10 mL) and stirred at room temperature for 16 hours. A new compound was detected by thin layer chromatography, which was found to be a mixture of water and dichloromethane (50 The product is extracted with 2 mL of ethanol. The organic phase is centrifuged and then purified by column chromatography. (PE:EA=3:1) and compound 8 (weight 200 mg, yield 28.82%) ) is obtained.

[0558] Step 5): [ka] Compound 8 (300 mg, 0.86 mmol) and Grubbs Catalyst 2 ND (100 mg) was dissolved in dichloromethane (10 mL) and stirred at 40°C for 16 hours. Then, add an aqueous solution of potassium hydroxide (1N, 5 mL) and stir for 1 hour. When a new compound was detected in the filtration, the product was extracted with water and dichloromethane (50 mL x 2). The product was extracted by centrifuging the organic phase and then separating it by column chromatography (DCM:MeOH = 10:1) to give compound 9 (weight 120 mg, yield 62.57%).

[0559] Step 6): [ka] Compound 9 (60 mg, 0.25 mmol) was dissolved in acetonitrile (5 mL), and then Compound 10 (57 mg, 0.25 mmol) was added at 10°C, and the mixture was then purged with nitrogen three times at room temperature. The mixture was stirred overnight at RT. A new compound was detected by thin layer chromatography, indicating that the product was The solution was centrifuged and then subjected to column chromatography (methanol:dichloromethane = 0-10%). to obtain compound AB24839B (weight 6 mg, yield 9.94%).

[0560] Compound AB24839B: 1 H NMR(400MHz,CD3OD)δ 8.16(s,1H),8.05(d ,J=7.1Hz,2H),7.83(s,1H),7.62(d,J=7.3Hz,2 H),7.37(d,J=13.9Hz,6H),7.09(d,J=6.1Hz,1H ),6.40(d,J=11.0Hz,1H),6.20(s,1H),4.80-4. 74(m,2H),3.62(s,1H),3.03(s,1H),2.81(d,J= 10.6Hz, 1H). ESI-MS: Theoretical value [M-Br] + 375.87, Observed: 375.30.

[0561] Example 31 Preparation of compound AB24959 Step 1): [ka] Compound 1 (294 mg, 2 mmol) was dissolved in dimethyl sulfoxide (10 mL). , followed by cesium carbonate (1.64 g, 5 mmol) and cuprous iodide (76.2 mg, 0 0.4 mmol) was added, and 5 drops of N,N-2-methylethylenediamine were added dropwise. The mixture was stirred for 10 minutes. Compound 2 (650 mg, 3 mmol) was added, and the reaction mixture was heated. Stir for 2 hours at 20°C. A new compound was detected by thin layer chromatography. The product is extracted with ethyl acetate (10 mL) and the organic phase is concentrated under reduced pressure to give a residue. The residue was purified by thin layer chromatography (methanol:dichloromethane = 10%). Compound 3 was obtained (weight: 200 mg, yield: 47.62%).

[0562] Step 2): [ka] Compound 3 (200 mg, 0.89 mmol) was dissolved in acetonitrile (10 mL). Compound 4 (189.57 mg, 0.89 mmol) was then added, followed by three nitrogen substitutions. The mixture was stirred overnight at room temperature. A new compound was detected by thin layer chromatography. The solid was filtered and washed with acetonitrile (5 mL) to give compound AB24959 (heavy). The amount obtained is 70 mg, with a yield of 22.03%.

[0563] Compound AB24959: 1 H NMR(400MHz, DMSO-d6)δ 8.83(d,J=5.4Hz ,2H),8.27(d,J=5.5Hz,2H),8.04(d,J=7.2Hz,1 H),7.95(d,J=7.2Hz,2H),7.63(s,1H),7.45(d, J=5.7Hz,4H),6.31(s,2H),4.24(s,2H),3.21(s ,2H),2.42(s,3H). ESI-MS: Theoretical value [M-Br]+ 357.43, Observed value: 357.10.

[0564] Example 32 Preparation of compound AB24938 Step 1): [ka] Compound 1 (2 g, 23 mmol) and compound 2 (2.5 g, 19 mmol) were reacted with N,N- Dissolve in dimethylformamide (DMF) (30 mL) and then add triethylenediamine (6. 5g, 58mmol), bis(dibenzylideneacetone)palladium (890mg, 0. 97 mmol) and tri-tert-butylphosphine tetrafluoroborate (561 m g, 1.94 mmol) was added and the mixture was stirred in a sealed tube at 120°C for 16 hours. When a new compound was detected by chromatography, the product was extracted with water and ethyl acetate (10 mL). The organic phase is concentrated under reduced pressure to give a residue. Finally, the residue is purified by column chromatography. The compound 3 (weight 800 mg, yield 100%) was purified with HCl (methanol:dichloromethane = 5%). The rate is 26.1%.

[0565] Step 2): [ka] Compound 3 (100 mg, 0.625 mmol) was dissolved in acetonitrile (5 mL). Compound 4 (200 mg, 0.938 mmol) was then added, and the mixture was then purged with nitrogen three times. The mixture was stirred at room temperature overnight. A new compound was detected by thin layer chromatography, and the product was The reaction mixture was centrifuged and then purified by column chromatography (methanol:dichloromethane = 0-1 0%) to obtain compound AB24938 (weight 78 mg, yield 39.8%). .

[0566] Compound AB24938: 1 H NMR(400MHz,DMSO-d6)δ 9.14(s,1H),8.23 (d,J=9.1Hz,3H),8.08(s,1H),8.00(d,J=7.0Hz ,1H),7.84(d,J=7.3Hz,1H),7.68(t,J=7.1Hz,1 H),6.39(s,2H),3.14(s,1H),1.33(d,J=5.7Hz, 6H). ESI-MS: Theoretical value [M-Br] + 313.80, Observed: 313.25.

[0567] Example 33 Preparation of compound AB24821 Step 1): [ka] Compound 1 (2.7 g, 20 mmol) was dissolved in N,N-dimethylformamide (DMF) (50 ml L), and then compound 1-1 (5.3 g, 40 mmol), 2-(7-azinzibenone) 11.4g , 30 mmol) and N,N-diisopropylethylamine (9 g, 70 mmol) were added. Add 100 ml of water and stir at room temperature for 1 hour. A new compound was detected by thin layer chromatography. (50 mL) and ethyl acetate (50 mL x 3) were added to extract the product, and the organic phases were combined. The product was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (acetic acid The compound 2 (weight 3.6 g, yield 9%) was purified with ethyl acetate and petroleum ether (0-30%). 1.1%).

[0568] Step 2): [ka] Compound 2 (200 mg, 1 mmol) was dissolved in dry tetrahydrofuran (5 mL). Then, a 1N solution of methylmagnesium bromide in tetrahydrofuran (2 mL) was added at 0°C. Stir at 0°C for 3 hours. A new compound was detected by thin layer chromatography. Sodium bicarbonate aqueous solution (6 mL), water (20 mL), and ethyl acetate (20 mL x 3) The product was extracted by adding the above, and after the organic phases were combined, the product was washed with saturated saline (30 mL), The solution was dried over anhydrous sodium sulfate, concentrated under reduced pressure to remove the organic solvent, and compound 3 was obtained. (weight 67 mg, yield 37.4%)

[0569] Step 3): [ka] Compound 3 (363 mg, 3 mmol) was dissolved in acetic acid (5 mL), and then the mixture was added to the liquid Bromine (383 mg, 3.8 mmol) was added, and two drops of aqueous hydrobromic acid solution were added dropwise. The mixture was stirred for 3 hours at 47°C. A new compound was detected by thin layer chromatography. The mixture was then washed with ice water (30 ml). L) was added, and ethyl acetate (30 mL x 3) was added to extract the product. After the organic phases were combined, The product was washed with saturated brine (30 mL), dried over anhydrous sodium sulfate, and dissolved under reduced pressure. The solution was concentrated to remove the organic solvent, and compound 4 (weight: 100 mg, yield: 97.3%) was obtained. do.

[0570] Step 4): [ka] Compound 5 (5.6 g, 53.13 mmol) was dissolved in ethanol (10 mL), and then Compound 6 (5 g, 53.13 mmol) was added at 100°C, and the mixture was purged with nitrogen three times. The temperature is raised to 90°C and stirred for 2 hours. New compounds are detected by thin layer chromatography. The reaction temperature was then lowered to 0°C, and sodium borohydride (4.01 g, 106.2 mmHg) was added. The reaction mixture was allowed to warm to room temperature and stirred for 1 hour. Upon detecting a new compound in the feed, the product was diluted with water (200 mL) and then diluted with ethyl acetate. Extract the product by adding ethanol (200 mL x 3). After the organic phases were combined, add saturated saline (200 mL) The product was washed with 1 mL of HCl, dried over anhydrous sodium sulfate, and filtered. The solution was then concentrated under reduced pressure. The product is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol Compound 7 (weight 2.6 g, yield 26.8%) was purified with HCl (10:1) and dichloromethane (10:1). %).

[0571] Step 5): [ka] Compound 4 (100 mg, 0.46 mmol) and compound 7 (86 mg, 0.46 mmol) l) is dissolved in acetonitrile (10 mL) and then stirred at room temperature for 5 hours. If a new compound is detected by chromatography, the solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product was purified by column chromatography (methanol:dichloromethane = 0-10%). ) to obtain compound AB24821 (weight 15 mg, yield 10.1%).

[0572] Compound AB24821 1 H NMR(400MHz,DMSO-d6)δ 9.45(s,1H),9.03 (s,1H),8.77(s,1H),8.16(d,J=7.0Hz,1H),8.0 5(d,J=7.1Hz,1H),7.36(s,4H),7.30(s,1H),7. 05(d,J=8.3Hz,1H),7.01(d,J=7.3Hz,1H),5.92 (s,2H),4.56(d,J=5.4Hz,2H),2.63(s,3H). ESI-MS: Theoretical value [M-Br] + 319.38, Observed: 319.30.

[0573] Example 34 Preparation of compound AB24839 Step 1): [ka] Compound 1 (2.1 g, 20 mmol) was dissolved in ammonia and ethanol (40:40 mL). After stirring at -78°C to -10°C for 3 hours, compound 2 (6.72 g, 40 ml) was dissolved in mol) and stir at room temperature overnight. Then, the pH value was adjusted to 1 by adding concentrated hydrochloric acid solution, and the product was extracted with water and ethyl acetate (80 mL). The pH value of the aqueous phase was adjusted to 14 with 50% sodium hydroxide, and the solution was diluted with water and dichloromethane (2 The product was extracted with 10 mL of hexane (×80 mL), and the organic phase was centrifuged to obtain compound 3 (weight 1.6 g, yield 54.42%).

[0574] Step 2): [ka] Compound 3 (5g, 28.57mmol), Compound 4 (21g, 142.85mmol) and triethylamine (28.85 g, 285.7 mmol) in acetonitrile (60 m L) and then stirred at 80°C for 16 hours. Thin layer chromatography revealed a new compound When detected, extract the product with water and ethyl acetate (200 mL x 2). The solution was centrifuged and purified by column chromatography (PE:EA = 5:1) to obtain compound 5( A weight of 2.2 g is obtained, with a yield of 25.41%.

[0575] Step 3): [ka] Compound 5 (2.2g, 7.26mmol), Compound 6 (1.68g, 10.89mmol) l), sodium carbonate (2.1 g, 19.8 mmol) and [1,1'-di(diphenyl Phosphine)dicyclopentadienyliron]palladium dichloride (495.6mg, 0.6 6 mmol) was dissolved in dioxane and water (21:7 mL) and heated at 95°C for 16 minutes in a sealed tube. A new compound was detected by thin layer chromatography, and the resulting solution was dissolved in water and ethyl acetate ( The product is extracted with 200 mL of ethanol. The organic phase is centrifuged and then purified by column chromatography. The product was purified using a 3:1 ethanol / ethanol (PE:EA) mixture to give compound 7 (weight 200 mg, yield 11. 02%).

[0576] Step 4): [ka] Compound 7 (500 mg, 2 mmol), dimethylaminopyridine (48.8 mg, 0. 4 mmol), triethylamine (404 mg, 4 mmol) and trifluoroacetic anhydride (2.1 g, 10 mmol) was dissolved in dichloromethane (10 mL) and stirred at room temperature for 16 hours. A new compound was detected by thin layer chromatography, which was found to be a mixture of water and dichloromethane (50 The product is extracted with 2 mL of ethanol. The organic phase is centrifuged and then purified by column chromatography. (PE:EA=3:1) and compound 8 (weight 200 mg, yield 28.82%) ) is obtained.

[0577] Step 5): [ka] Compound 8 (300 mg, 0.86 mmol) and Grubbs Catalyst 2 ND (100 mg) was dissolved in dichloromethane (10 mL) and stirred at 40°C for 16 hours. Then, add an aqueous solution of potassium hydroxide (1N, 5 mL) and stir for 1 hour. When a new compound was detected in the filtration, the product was extracted with water and dichloromethane (50 mL x 2). The product was extracted by centrifuging the organic phase and then separating it by column chromatography (DCM:MeOH = 10:1) to give compound 9 (weight 120 mg, yield 62.57%).

[0578] Step 6): [ka] Compound 9 (120 mg, 0.53 mmol) was dissolved in tetrahydrofuran (5 mL). Then palladium on carbon (12 mg) was added. The mixture was stirred under hydrogen for 4 hours. Thin layer chromatography If a new compound is detected in the filtration, the product is filtered through diatomaceous earth, and the filtrate is centrifuged to separate the compound. Product 10 was obtained (weight 20 mg, yield 16.77%).

[0579] Step 7): [ka] Compound 10 (20 mg, 0.08 mmol) was dissolved in acetonitrile (5 mL), and then Compound 11 (20.71 mg, 0.08 mmol) was added immediately, and then the mixture was purged with nitrogen three times. The mixture was stirred overnight at room temperature. A new compound was detected by thin layer chromatography. The reaction mixture was centrifuged and purified by column chromatography (methanol:dichloromethane = 0- 10%) to obtain compound AB24839 (weight 3.1 mg, yield 9.94%). obtain.

[0580] Compound AB24839: 1 H NMR(400MHz,CD3OD)δ 8.05(d,J=7.7Hz,2H ),7.92-7.82(m,2H),7.62(d,J=7.7Hz,2H),7.4 0(dd,J=30.0,8.5Hz,6H),6.92(d,J=6.7Hz,1H) ,5.80(s,2H),5.21(d,J=10.2Hz,1H),2.69-2.4 5(m,2H),2.13(s,2H),1.99(s,2H). ESI-MS: Theoretical value [M-Br]+ 377.89, Observed value: 377.25.

[0581] Example 35 Preparation of compound AB27130 Step 1): [ka] Compound 1 (200 mg, 1.01 mmol) and triphenylphosphine (400 mg , 3.54 mmol) was dissolved in tetrahydrofuran (10 mL) and then purged with nitrogen three times. After this, the temperature is raised to 80°C and the mixture is stirred for 16 hours. When a compound of interest was detected, the mixture was cooled to room temperature, the product was filtered, and the mixture was diluted with tetrahydrofuran three times. After washing, crude compound 2 was obtained (weight: 350 mg, yield: 91.1%).

[0582] Step 2): [ka] Compound 2 (200 mg, 0.52 mmol) and compound 3 (108 mg, 0.46 mmol) ol) was dissolved in tetrahydrofuran (10 mL) and then triethylamine (2 mL) was added. After the mixture is purged with nitrogen three times, the temperature is raised to 70°C and the mixture is stirred for 16 hours. When a new compound was detected by layer chromatography, the solution was cooled to room temperature and then purified under reduced pressure. Finally, the product is purified by column chromatography (methanol:dichloromethane =0-10%) to give compound 4 (weight 150 mg, yield 89%).

[0583] Step 3): [ka] Compound 4 (200 mg, 0.61 mmol) was dissolved in saturated hydrochloride ethyl acetate solution (5 mL). The solution was dissolved and stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography. Concentrate the solution under reduced pressure to give crude compound 5 (weight 210 mg).

[0584] Step 4): [ka] Compound 5 (200 mg, 0.97 mmol) was dissolved in ethanol (5 mL), and then Palladium carbon (20 mg) was added, and the mixture was then purged with hydrogen three times, followed by stirring at room temperature overnight. When a new compound is detected by thin layer chromatography, it is filtered and the solution is extracted under reduced pressure. Finally, the product is purified by column chromatography (methanol:dichloromethane =0-10%) to give compound 6 (weight 60 mg, yield 29.5%).

[0585] Step 5): [ka] Compound 7 (200 mg, 1.11 mmol) was dissolved in dichloromethane (10 mL). Next is C8H 18 Add N2O2HBr3 (456 mg, 1.11 mmol) and let stand at room temperature for 1 The reaction mixture was stirred for 1 hour. A new compound was detected by thin layer chromatography. The solution was centrifuged and subjected to thin layer chromatography to obtain compound 8 (weight 250 mg, yield 87%). 0.29%).

[0586] Step 6): [ka] Compound 6 (100 mg, 0.48 mmol) and compound 8 (148 mg, 0.57 mmol) ol) was dissolved in acetonitrile (10 mL) and then potassium carbonate (66 mg, 0.4 8mmol) and stirred at room temperature for 16 hours. Once the product is detected, the solution is concentrated under reduced pressure to remove the organic solvent. The compound AB was purified by chromatography (methanol:dichloromethane = 0-10%). 27130 (weight 55 mg, yield 29.4%) is obtained.

[0587] Compound AB27130: 1 H NMR(400MHz,DMSO-d6)δ 9.37(s,1H),8.18 (s,1H),8.09(s,1H),7.79(d,J=45.7Hz,2H),7. 53(s,1H),7.38(d,J=20.0Hz,5H),6.93(s,1H), 5.71(d,J=9.8Hz,1H),4.77(s,1H),3.22(s,2H) ,2.79(s,2H),2.52(s,2H),2.10(s,1H),1.89(s ,1H). ESI-MS: Theoretical value [M-Br] + 389.90, Observed: 389.10.

[0588] Example 36 Preparation of compound AB27141 Step 1): [ka] Compound 1 (240 mg, 2 mmol) was dissolved in anhydrous N,N-dimethylformamide (DMF) 10 mL), and then compound 2 (555 mg, 1.5 mmol) and triethylamine were added. After adding amine (606.0 mg, 6.0 mmol), the mixture was purged with nitrogen three times. The mixture was stirred overnight at room temperature. A new compound was detected by thin layer chromatography. ) and extract the product by adding ethyl acetate (30 mL x 3). The organic phases were combined and After that, the product was washed with saturated saline (50 mL), dried over anhydrous sodium sulfate, and filtered. The solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product is purified by thin layer chromatography. Compound 3 (weight 26%) was purified by filtration (ethyl acetate: petroleum ether = 0-50%). 0 mg, yield 58.47%).

[0589] Step 2): [ka] Compound 3 (111 mg, 0.50 mmol) was dissolved in acetonitrile (10 mL). Compound 4 (130 mg, 0.5 mmol) was then added, followed by three nitrogen substitutions. After that, the mixture was stirred at room temperature overnight. If a new compound was detected by thin layer chromatography, the mixture was filtered. The solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product is purified by thin layer chromatography. The compound AB27141 ( A weight of 40 mg is obtained, with a yield of 19.95%.

[0590] Compound AB27141 1H NMR(400MHz,DMSO-d6)δ 9.67(s,1H),8.75 (d,J=6.4Hz,1H),8.22(d,J=6.5Hz,1H),8.05(s ,1H),7.80(s,1H),7.73(d,J=7.8Hz,1H),7.57- 7.50(m,3H),7.40(dd,J=12.0,7.2Hz,4H),7.14 (s,1H),6.25-6.15(m,2H),3.43(d,J=43.7Hz,2 H),3.20(d,J=16.7Hz,1H),2.95(d,J=10.2Hz,1 H), 2.06 (d, J = 6.2 Hz, 3H). ESI-MS: Theoretical value [M-Br] + 401.91, Observed: 401.10.

[0591] Example 37 Preparation of compound AB24957 Step 1): [ka] Compound 1 (300 mg, 3.15 mmol) was dissolved in acetonitrile (10 mL). Compound 2 (671 mg, 2.35 mmol) was then added, and the mixture was then purged with nitrogen three times. After stirring overnight at room temperature, a new compound was detected by thin layer chromatography. The reaction mixture was centrifuged and subjected to thin layer chromatography to obtain compound 3 (weight: 600 mg). , and the yield is 83.54%.

[0592] Step 2): [ka] Compound 3 (200 mg, 0.87 mmol) was dissolved in phosphorus oxychloride (10 mL), Next, after replacing with nitrogen three times, the mixture is stirred at 90°C for 2 hours. When a new compound was detected, the reaction mixture was centrifuged to separate compound 4 (weight 215 mg, The crude product is then directly transferred to the next stage.

[0593] Step 3): [ka] Compound 4 (215 mg, 0.88 mmol) was dissolved in N,N-dimethylformamide (DMF) 10 mL), and then compound 5 (117 mg, 0.88 mmol) and triethyl ether were added. The amine (267 mg, 2.64 mmol) was added successively, and then the mixture was purged with nitrogen three times. The mixture was stirred at 80°C overnight. A new compound was detected by thin layer chromatography. AB24957 (weight 80 mg, yield 26.50%) is obtained.

[0594] Compound AB24957: 1 H NMR(400MHz,DMSO,d6)δ 8.30(s,2H),7.95 (d,J=8.2Hz,2H),7.45(d,J=8.1Hz,1H),7.38(s ,1H),7.32-7.27(m,2H),6.00(s,2H),4.85(s,2 H),3.86(t,J=6.0Hz,2H),3.04(t,J=5.9Hz,2H) ,2.44(s,2H). ESI-MS: Theoretical value [M-Br]+ 343.18, Observed value: 343.30.

[0595] Example 38 Preparation of compound AB24989 Step 1): [ka] Compound 1 (200 mg, 1.69 mmol) was dissolved in N,N-dimethylformamide (DMF) 20 mL), and add NaH (203 mg, 5.07 mmol) in an ice bath. The mixture was stirred for 30 minutes, and then Compound 2 (289 mg, 1.86 mmol) was added, and the mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography, and the resulting solution was diluted with water (10 mL) and acetic acid. Ethyl acetate (10 mL) was added to extract the product, followed by three extractions with ethyl acetate. The organic phases were combined. The organic phase was washed with saturated saline, dried over anhydrous sodium sulfate, and the solution was extracted under reduced pressure. Finally, the product is purified by column chromatography (ethyl acetate:petroleum ether = 0-10%) to give compound 3 (weight 260 mg, yield 73.8%).

[0596] Step 2): [ka] Compound 3 (300 mg, 1.44 mmol) was dissolved in acetonitrile (10 mL). Compound 4 (577 mg, 2.16 mmol) was then added, followed by three nitrogen substitutions. Stir overnight at room temperature. Thin layer chromatography reveals a new compound, which is precipitated. The solid obtained was filtered to give compound AB24989 (weight 30 mg, yield 5.3%).

[0597] Compound AB24989: 1 H NMR(400MHz,DMSO,d6)δ 9.25(s,1H),8.45 (s,1H),8.33(s,3H),8.16(s,2H),7.90(s,1H), 7.34(s,5H),7.20(s,1H),6.44(s,2H),5.67(s, 2H). ESI-MS: Theoretical value [M-Br] + 395.40, Observed: 395.30.

[0598] Example 39 Preparation of compound AB24906 Step 1): [ka] Compound 1 (438 mg, 3 mmol) was dissolved in acetic acid (5 mL) and 1 drop of hydrobromic acid was added. Then, liquid bromine (384 mg, 2.4 mmol) was added to acetic acid (2 mL) and the mixture was The mixture is then injected with nitrogen three times and stirred at room temperature for 3 hours. When a new compound was detected by chromatography, it was filtered, the solution was concentrated under reduced pressure, and the solution was analyzed by thin layer chromatography. Compound 2 (weight 400 mg, yield 59.51%) was obtained through chromatography.

[0599] Step 2): [ka] Compound 2 (200 mg, 0.9 mmol) was dissolved in acetonitrile (10 mL), and then Compound 3 (171 mg, 0.9 mmol) was added, and the mixture was then purged with nitrogen three times at room temperature. The mixture was stirred at RT for 3 hours. A new compound was detected by thin layer chromatography, and the mixture was filtered. The solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product is purified by thin layer chromatography. The compound AB24906 (weight: 1 00mg, yield 27.23%).

[0600] Compound AB24906: 1 H NMR(400MHz,DMSO-d6)δ 9.54(s,1H),8.30 (d,J=7.0Hz,1H),8.15(d,J=7.0Hz,1H),7.66(d ,J=7.6Hz,1H),7.48(s,1H),7.33(d,J=25.3Hz, 6H),7.00(dd,J=22.7,6.8Hz,2H),5.62(s,1H), 4.57(d,J=4.8Hz,2H),3.76(d,J=8.3Hz,1H),3. 39(s,1H),2.44(s,3H). ESI-MS: Theoretical value [M-Br] + 329.16, Observed: 329.16.

[0601] Example 40 Preparation of compound AB24949 Step 1): [ka] Compound 1 (200 mg, 1.22 mmol) was dissolved in acetic acid (5 mL), and hydrobromic acid was added. Add one drop of acetic acid (2 mL) and then add liquid bromine (193 mg, 1.22 mmol). The mixture is then purged with nitrogen three times and stirred at room temperature for 3 hours. When a new compound was detected by chromatography, it was filtered and the solution was concentrated under reduced pressure. Compound 2 (weight 300 mg, yield 101%) was obtained through thin layer chromatography. .

[0602] Step 2): [ka] Compound 3 (5.6 g, 53.13 mmol) was dissolved in ethanol (10 mL), and then Compound 4 (5 g, 53.13 mmol) was added at 100°C, and the mixture was purged with nitrogen three times. The temperature is raised to 90°C and stirred for 2 hours. New compounds are detected by thin layer chromatography. The reaction temperature was then lowered to 0°C, and sodium borohydride (4.01 g, 106.2 mmHg) was added. The reaction mixture was allowed to warm to room temperature and stirred for 1 hour. Upon detecting a new compound in the feed, the product was diluted with water (200 mL) and then diluted with ethyl acetate. Extract the product by adding ethanol (200 mL x 3). After the organic phases were combined, add saturated saline (200 mL) The product was washed with 1 mL of HCl, dried over anhydrous sodium sulfate, and filtered. The solution was then concentrated under reduced pressure. The product is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol Compound 5 (weight 2.6 g, yield 26.8%) was purified with hexane (methylene chloride = 10:1). %).

[0603] Step 3): [ka] Compound 6 (300 mg, 1.24 mmol) was dissolved in acetonitrile (10 mL). Compound 5 (228 mg, 1.24 mmol) was then added, followed by three nitrogen substitutions. Stir for 3 hours at room temperature. If a new compound is detected by thin layer chromatography, filter it. The solution is then concentrated under reduced pressure to remove the organic solvent. Finally, the product is purified by thin layer chromatography. The compound AB24949 (weight ratio) was purified with dichloromethane:ethanol = 10:1. 35 mg of the compound was obtained, with a yield of 12.5%).

[0604] Compound AB24949: 1 H NMR(400MHz,CD3OD)δ 8.16-7.98(m,3H),7 .35(d,J=21.1Hz,5H),7.16(s,2H),6.95(d,J=1 2.6Hz,2H),4.59(s,2H),3.39(s,1H),3.24-3.1 9(m,1H),2.76(s,1H),2.59(s,1H). ESI-MS: Theoretical value [M-Br] + 347.40, Observed: 347.10.

[0605] Example 41 Preparation of compound AB24954 Step 1): [ka] Compound 1 (176 mg, 1.0 mmol) was dissolved in acetic acid (7 mL), and then the mixture was Liquid bromine (160 mg, 1.0 mmol) was added, and two drops of aqueous hydrobromic acid were added. The mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography. 0 mL) was added, and ethyl acetate (30 mL x 3) was added to extract the product, and the organic phases were combined. After that, the product was washed with saturated saline (30 mL), dried over anhydrous sodium sulfate, and then evaporated under reduced pressure. The solution was concentrated to remove the organic solvent, and compound 2 (weight: 200 mg, yield: 78.43%) was obtained. ) is obtained.

[0606] Step 2): [ka] Compound 2 (200 mg, 0.78 mmol) was dissolved in acetonitrile (10 mL). Compound 3 (150 mg, 0.82 mmol) was then added, followed by three nitrogen substitutions. Stir overnight at room temperature. Thin layer chromatography reveals a new compound, which is precipitated. The solid was filtered, washed three times with acetonitrile (2 mL), and centrifuged. This gives compound AB24954 (weight 20 mg, yield 7.14%).

[0607] Compound AB24954: 1 H NMR(400MHz,CD3OD)δ 8.11(d,J=7.4Hz,1H ),8.03(d,J=7.3Hz,1H),7.58(d,J=8.0Hz,1H), 7.37(s,5H),7.32(s,1H),7.26(d,J=7.3Hz,1H) ,6.98(d,J=7.2Hz,1H),6.92(d,J=7.3Hz,1H),4 .86-4.84(m,1H),4.59(s,2H),3.90(s,3H),3.4 0(d,J=18.1Hz,1H),3.00(t,J=12.3Hz,1H),2.6 9(s,1H),2.60(s,1H). ESI-MS: Theoretical value [M-CF3COO] + 359.45, Observed: 359.10.

[0608] Example 42 Preparation of compound AB24963 Step 1): [ka] Compound 1 (8 g, 83.33 mmol) was dissolved in phosphorus oxychloride (40 mL), and then After flushing with nitrogen three times, the mixture was heated to 90°C and stirred overnight. When a new compound was detected, the phosphorus oxychloride was centrifuged and then soaked in dichloromethane (5 Add 50 mL of ice water, add 50 mL of dichloromethane, and The product was extracted by adding the extractant, and after the organic phases were combined, the product was washed with saturated saline (100 mL). Dry with anhydrous sodium sulfate and concentrate the solution under reduced pressure to remove the organic solvent. The product was purified by column chromatography (ethyl acetate: petroleum ether = 30-80%). Compound 2 (weight: 5 g, yield: 52.17%) was obtained.

[0609] Step 2): [ka] Compound 2 (2.5 g, 21.73 mmol) was dissolved in N,N-dimethylformamide (DMF) 50 mL), and then compound 3 (7.43 g, 65.22 mmol) and potassium carbonate were added. After adding ammonium (9.01 g, 65.22 mmol), the mixture was purged with nitrogen three times. Heat to 0°C and stir overnight. A new compound is detected by thin layer chromatography. Water (50 mL) and ethyl acetate (50 mL x 3) were added to extract the product, and the organic phases were combined. After that, the product was washed with saturated saline (50 mL), dried over anhydrous sodium sulfate, and then evaporated under reduced pressure. The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography ( The compound 4 (weight 2.1 g, yield 100%) was purified with ethyl acetate:petroleum ether (0-30%). 52.24%).

[0610] Step 3): [ka] Compound 4 (200 mg, 1.08 mmol) was dissolved in acetonitrile (10 mL). Compound 5 (371 mg, 1.62 mmol) was then added, followed by three nitrogen substitutions. Stir overnight at room temperature. If a new compound is detected by thin layer chromatography, The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol). The compound AB24963 (weight 20 ml) was purified in dichloromethane (0-30%). g, yield 5.54%).

[0611] Compound AB24963 1 H NMR(400MHz,DMSO,d6)δ 10.18(s,1H),8.7 7(s,1H),8.14(s,1H),7.98(d,J=8.2Hz,2H),7. 33(d,J=22.3Hz,5H),7.13(d,J=8.2Hz,2H),6.9 7(s,1H),5.83(s,2H),4.73(s,2H),3.86(s,3H) . ESI-MS: Theoretical value [M-Br] + 334.16, Observed: 334.25.

[0612] Example 43 Preparation of compound AB24964 Step 1): [ka] Compound 1 (8 g, 83.33 mmol) was dissolved in phosphorus oxychloride (40 mL), and then After flushing with nitrogen three times, the mixture was heated to 90°C and stirred overnight. When a new compound was detected, the phosphorus oxychloride was centrifuged and then soaked in dichloromethane (5 Add 50 mL of ice water, add 50 mL of dichloromethane, and The product was extracted by adding the extractant, and after the organic phases were combined, the product was washed with saturated saline (100 mL). Dry with anhydrous sodium sulfate and concentrate the solution under reduced pressure to remove the organic solvent. The product was purified by column chromatography (ethyl acetate: petroleum ether = 30-80%). Compound 2 (weight: 5 g, yield: 52.17%) was obtained.

[0613] Step 2): [ka] Compound 2 (2.5 g, 21.73 mmol) was dissolved in N,N-dimethylformamide (DMF) 50 mL), and then compound 3 (7.43 g, 65.22 mmol) and potassium carbonate were added. After adding ammonium (9.01 g, 65.22 mmol), the mixture was purged with nitrogen three times. Heat to 0°C and stir overnight. A new compound is detected by thin layer chromatography. Water (50 mL) and ethyl acetate (50 mL x 3) were added to extract the product, and the organic phases were combined. After that, the product was washed with saturated saline (50 mL), dried over anhydrous sodium sulfate, and then evaporated under reduced pressure. The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography ( The compound 4 (weight 2.1 g, yield 100%) was purified with ethyl acetate:petroleum ether (0-30%). 52.24%).

[0614] Step 3): [ka] Compound 4 (200 mg, 1.08 mmol) was dissolved in acetonitrile (10 mL). Compound 5 (446 mg, 1.62 mmol) was then added, followed by three nitrogen substitutions. Stir overnight at room temperature. Thin layer chromatography reveals new compounds, indicating that the product is a reaction product. The reaction solution was centrifuged and then subjected to column chromatography (methanol:dichloromethane = 10%). to obtain compound AB24964 (weight 30 mg, yield 7.3%).

[0615] Compound AB24964: 1 H NMR(400MHz,DMSO-d6)δ 10.13(s,1H),8.7 9(s,1H),8.12(d,J=25.9Hz,3H),7.94(d,J=6.7 Hz,2H),7.77(s,2H),7.51(s,1H),7.44(s,1H), 7.35(d,J=17.5Hz,3H),6.97(s,1H),5.92(s,2H ),4.74(s,1H). ESI-MS: Theoretical value [M-CF3COO] + 380.46, Observed: 380.30.

[0616] Example 44 Preparation of compound AB24967 Step 1): [ka] Compound 1 (8 g, 83.33 mmol) was dissolved in phosphorus oxychloride (40 mL), and then After flushing with nitrogen three times, the mixture was heated to 90°C and stirred overnight. When a new compound was detected, the phosphorus oxychloride was centrifuged and then soaked in dichloromethane (5 Add 50 mL of ice water, add 50 mL of dichloromethane, and The product was extracted by adding the extractant, and after the organic phases were combined, the product was washed with saturated saline (100 mL). Dry with anhydrous sodium sulfate and concentrate the solution under reduced pressure to remove the organic solvent. The product was purified by column chromatography (ethyl acetate: petroleum ether = 30-80%). Compound 2 (weight: 5 g, yield: 52.17%) was obtained.

[0617] Step 2): [ka] Compound 1 (2.5 g, 21.73 mmol) was dissolved in N,N-dimethylformamide (DMF) 50 mL), and then compound 3 (7.43 g, 65.22 mmol) and potassium carbonate were added. After adding ammonium (9.01 g, 65.22 mmol), the mixture was purged with nitrogen three times. Heat to 0°C and stir overnight. A new compound is detected by thin layer chromatography. Water (50 mL) and ethyl acetate (50 mL x 3) were added to extract the product, and the organic phases were combined. After that, the product was washed with saturated saline (50 mL), dried over anhydrous sodium sulfate, and then evaporated under reduced pressure. The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography ( The compound 4 (weight 2.1 g, yield 100%) was purified with ethyl acetate:petroleum ether (0-30%). 52.24%).

[0618] Step 3): [ka] Compound 4 (200 mg, 1.08 mmol) was dissolved in acetonitrile (15 mL). Compound 5 (367 mg, 1.29 mmol) was then added, followed by three nitrogen substitutions. Stir overnight at room temperature. If a new compound is detected by thin layer chromatography, The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol). The compound AB24967 (weight 30 ml) was purified in dichloromethane (0-30%). g, yield 7.16%).

[0619] Compound AB24967: 1 H NMR(400MHz,DMSO,d6)δ 10.29(s,1H),8.7 5(s,1H),8.14(s,1H),8.05(s,1H),7.92(s,1H) ,7.78(s,2H),7.33(d,J=23.1Hz,6H),6.99(d,J =6.7Hz,1H),5.90(s,2H),4.73(s,2H). ESI-MS: Theoretical value [M-Br] + 388.13, Observed: 388.25.

[0620] Example 45 Preparation of compound AB24991 Step 1): [ka] Compound 1 (200 mg, 1.69 mmol) was dissolved in N,N-dimethylformamide (DMF) 20 mL), and NaH (203 mg, 5.07 mmol) was added in an ice bath. The mixture was stirred for 30 minutes, and then Compound 2 (318 mg, 1.86 mmol) was added, and the mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography, and the resulting solution was diluted with water (30 mL) and acetic acid. Ethyl acetate (30 mL x 3) was added to extract the product, and the organic phases were combined. The organic phase was washed with HCl, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The solvent is removed. Finally, the product is purified by column chromatography (methanol:dichloromethane). The compound was purified by ethanol (0-10%) to give compound 3 (weight 200 mg, yield 56.9%). do.

[0621] Step 2): [ka] Compound 3 (200 mg, 0.96 mmol) was dissolved in acetonitrile (10 mL). Compound 4 (337 mg, 1.44 mmol) was then added, followed by three nitrogen substitutions. Stir overnight at room temperature. If a new compound is detected by thin layer chromatography, The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol). The compound AB24991 (weight 100 mg, yield 28.86%).

[0622] Compound AB24991: 1 H NMR(400MHz,DMSO,d6)δ 9.26(s,1H),8.41 (d,J=42.8Hz,2H),8.06(dd,J=48.7,20.6Hz,3H ),7.85(d,J=6.8Hz,1H),7.69(d,J=7.0Hz,1H), 7.27(d,J=60.4Hz,6H),6.40(s,2H),5.67(s,2H ). ESI-MS: Theoretical value [M-Br] + 361.11, Observed: 361.05.

[0623] Example 46 Preparation of compound AB27106 Step 1): [ka] Compound 1 (80 mg, 0.38 mmol) and compound 2 (103 mg, 0.385 mmol) ol) was dissolved in acetonitrile (5 mL) and stirred at room temperature for 3 hours. When a new compound was detected by the filter, the precipitated solid was filtered under reduced pressure and The filter cake was washed three times with 2 mL of ethanol and centrifuged to separate the compound AB27106 (by weight). 57 mg of the compound was obtained, with a yield of 37.97%.

[0624] Compound AB27106: 1H NMR(400MHz,DMSO-d6)δ 13.53(s,1H),9.2 9(s,1H),8.33-8.25(m,4H),8.14(d,J=6.7Hz,1 H),8.05(d,J=8.3Hz,2H),7.38-7.28(m,4H),7. 21(dd,J=7.2,4.0,1.4Hz,1H),6.53(s,2H),4.2 2(s,2H). ESI-MS: Theoretical value [M-Br] + 395.40, Observed: 395.05.

[0625] Example 47 Preparation of compound AB27107 Step 1): [ka] Compound 1 (100 mg, 0.50 mmol) and compound 2 (141 mg, 0.5 mmol) l) is dissolved in acetonitrile (5 mL) and stirred at room temperature for 3 hours. When a new compound was detected by the filtration, the precipitated solid was filtered under reduced pressure and then diluted with acetonitrile. The filter cake was washed three times with 2 mL of HCl (2 mL) and centrifuged to remove compound AB27107 (by weight). 65 mg, 31.55% yield, is obtained.

[0626] Compound AB27107: 1 H NMR(400MHz,DMSO-d6)δ 13.10(s,1H),9.2 4(s,1H),8.41-8.12(m,5H),7.67(d,J=8.3Hz,2 H),7.40-7.27(m,4H),7.21(t,J=7.1Hz,1H),6. 48(s,2H),4.22(s,2H). ESI-MS: Theoretical value [M-Br] + 411.40, Observed: 411.05.

[0627] Example 48 Preparation of compound AB27114 Step 1): [ka] Compound 1 (4.4 g, 20 mmol) was dissolved in N,N-dimethylformamide (DMF) (20 m L, and then compound 2 (4.28 g, 42 mmol), cuprous iodide (0.19 g, 1 mmol), N,N-diisopropylethylamine (8.24 g, 64 mmol) and bistriphenylphosphine palladium dichloride (190 mg, 0.6 mmol) successively. After the mixture was purged with nitrogen three times, the mixture was stirred at room temperature for 16 hours. When a new compound was detected by the filter, the product was diluted with water (100 mL) and ethyl acetate (1 The product was extracted by adding 100 mL of saturated sodium chloride solution (100 mL) and the organic phases were combined. The product was washed with HCl, dried over anhydrous sodium sulfate, and filtered, and the solution was concentrated under reduced pressure. The organic solvent is then removed. Finally, the product is purified by column chromatography (ethyl acetate:petroleum The compound 3 (weight 3.5 g, yield 84.13%) was obtained by purifying with ethyl ether (2:1). do.

[0628] Step 2): [ka] Compound 3 (1.5 g, 7.2 mmol) was dissolved in 1,4-dioxane (40 mL), Potassium t-butoxide (2.4 mg, 21.6 mmol) was then added, followed by nitrogen After three replacements, the temperature is raised to 100°C and the mixture is stirred overnight. If a new compound is detected, the solution is immediately concentrated under reduced pressure to remove the organic solvent. The product was purified by thin layer chromatography (methanol:dichloromethane=10:1). This gives compound 4 (weight: 1.1 g, yield: 73.45%).

[0629] Step 3): [ka] Compound 4 (104 mg, 0.5 mmol) was dissolved in acetonitrile (10 mL), and then Compound 5 (160 mg, 0.6 mmol) was added immediately, and the mixture was then purged with nitrogen three times. The mixture was stirred at room temperature overnight. When a new compound was detected by thin layer chromatography, the mixture was immediately The solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product is purified by thin layer chromatography ( The compound AB27114 (weight 14%) was purified with ethanol:dichloromethane = 10:1. 1 mg, yield 59.49%).

[0630] Compound AB27114: 1 H NMR(400MHz,DMSO-d6)δ 13.04(s,1H),9.1 1(s,1H),8.35(d,J=6.0Hz,1H),8.24(d,J=7.2H z,2H),8.03(d,J=7.2Hz,2H),7.96(d,J=6.2Hz, 1H),7.33(s,2H),7.26(s,1H),6.82(s,1H),6.4 1(s,2H),4.24(s,2H). ESI-MS: Theoretical value [M-Br] + 395.14, Observed: 395.14.

[0631] Example 49 Preparation of compound AB27124 Step 1): [ka] Compound 1 (200 mg, 1.69 mmol) was dissolved in N,N-dimethylformamide (DMF) 20 mL), and add NaH (203 mg, 5.07 mmol) in an ice bath. ℃ in The mixture was stirred for 30 minutes, and then Compound 2 (318 mg, 1.86 mmol) was added, and the mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography, and the resulting solution was diluted with water (30 mL) and acetic acid. Ethyl acetate (30 mL x 3) was added to extract the product, and the organic phases were combined. The organic phase was washed with HCl, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The solvent is removed. Finally, the product is purified by column chromatography (methanol:dichloromethane). The compound was purified by ethanol (0-10%) to give compound 3 (weight 200 mg, yield 56.9%). do.

[0632] Step 2): [ka] Compound 4 (200 mg, 1.11 mmol) was dissolved in dichloromethane (10 mL). Compound 5 (456 mg, 1.11 mmol) was then added and stirred at room temperature for 1 hour. When a new compound is detected by chromatography, the product is separated into a thin layer by centrifuging the reaction mixture. Compound 6 (weight 250 mg, yield 87.29%) was obtained through chromatography.

[0633] Step 3): [ka] Compound 3 (150 mg, 0.58 mmol) was dissolved in acetonitrile (10 mL). Compound 6 (100 mg, 0.48 mmol) was then added, and the mixture was then purged with nitrogen three times. After stirring overnight at room temperature, a new compound was detected by thin layer chromatography. The reaction mixture was centrifuged and subjected to thin layer chromatography to isolate compound AB27124 (weight 65 mg of the compound was obtained, with a yield of 34.99%.

[0634] Compound AB27124: 1 H NMR(400MHz,DMSO,d6)δ 9.45(s,1H),8.62 (s,1H),8.40(d,J=6.8Hz,1H),8.21(d,J=2.5Hz ,1H),7.88(d,J=2.0Hz,1H),7.79(dd,J=8.3,2. 3Hz,1H),7.58(d,J=8.3Hz,1H),7.42-7.31(m,5 H),7.19(d,J=3.3Hz,1H),5.71(s,2H),3.30(s, 3H),3.04(dd,J=13.2,4.6Hz,1H),2.69(d,J=8. 9Hz,1H). ESI-MS: Theoretical value [M-Br] + 387.13, Observed: 387.20.

[0635] Example 50 Preparation of compound AB27127 Steps): [ka] Compound 1 (100 mg, 0.42 mmol) was dissolved in acetonitrile (10 mL). Compound 2 (77.73 mg, 0.42 mmol) was then added, followed by three nitrogen substitutions. After that, the mixture was stirred at room temperature overnight. A new compound was detected by thin layer chromatography. The reaction mixture was centrifuged and subjected to thin layer chromatography to identify the compound AB27127( A weight of 15 mg is obtained, with a yield of 9.73%.

[0636] Compound AB27127: 1 H NMR(400MHz,DMSO-d6)δ 9.50(s,1H),8.65 (s,1H),8.40(d,J=6.5Hz,1H),8.20(s,1H),7.7 2(s,1H),7.49(s,1H),7.41-7.26(m,6H),7.14( s,1H),6.36(d,J=11.1Hz,1H),5.70(s,2H),3.3 1(s,1H),3.21-3.06(m,1H),2.95(t,J=30.6Hz, 1H), 2.65(s,1H), 2.33(s,3H). ESI-MS: Theoretical value [M-Br]+ 367.47, Observed value: 367.25.

[0637] Example 51 Preparation of compound AB24924 Step 1): [ka] Compound 1 (5.6 g, 53.13 mmol) was dissolved in ethanol (10 mL), and then Compound 2 (5 g, 53.13 mmol) was added at 100°C, and the mixture was purged with nitrogen three times. The temperature is raised to 90°C and stirred for 2 hours. New compounds are detected by thin layer chromatography. The reaction temperature was then lowered to 0°C, and sodium borohydride (4.01 g, 106.2 mmHg) was added. The reaction mixture was allowed to warm to room temperature and stirred for 1 hour. Upon detecting a new compound in the feed, the product was diluted with water (200 mL) and then diluted with ethyl acetate. Extract the product by adding ethanol (200 mL x 3). After the organic phases were combined, add saturated saline (200 mL) The product was washed with 1 mL of HCl, dried over anhydrous sodium sulfate, and filtered. The solution was then concentrated under reduced pressure. The product is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol Compound 3 (weight 2.6 g, yield 26.8%) was purified with hexane (methylene chloride = 10:1). %).

[0638] Step 2): [ka] Compound 4 (400 mg, 2.1 mmol) was dissolved in acetic acid (10 mL), and the mixture was then Liquid bromine (348 mg, 2.17 mmol) was added to the solution, and two drops of aqueous hydrobromic acid were added. The mixture was then stirred at room temperature for 3 hours. The solid that had precipitated below was filtered, and the filter cake was washed with dichloromethane (5 ml). The solvent is removed to give compound 5 (weight 400 mg, yield 81.3%).

[0639] Step 3): [ka] Compound 5 (300 mg, 1.16 mmol) and compound 3 (107 mg, 0.58 mmol) ol) was dissolved in acetonitrile (10 mL) and stirred at room temperature for 3 hours. If a new compound is detected in the filter, the solution is concentrated under reduced pressure to remove the organic solvent. The product was subsequently purified by column chromatography (methanol:dichloromethane = 10%). This is converted to compound AB24924 (weight 15 mg, yield 3.9%).

[0640] Compound AB24924: 1 H NMR(400MHz,CD3OD)δ 8.96(s,1H),8.57(d ,J=5.3Hz,1H),8.05(dd,J=7.5,1.9Hz,1H),7.9 7(dd,J=7.4,1.9Hz,1H),7.41(d,J=5.3Hz,1H), 7.29(t,J=4.6Hz,4H),7.27-7.20(m,1H),6.92( dd,J=7.4,2.9Hz,1H),6.86(dd,J=7.5,2.9Hz,1 H),4.52(s,2H),3.35(s,1H),3.24-3.21(m,1H) ,3.20-3.17(m,1H),2.72(d,J=4.5Hz,1H),2.56- 2.48(m,1H). ESI-MS: Theoretical value [M-CF3COO] + 330.41, Observed: 330.30.

[0641] Example 52 Preparation of compound AB24996 Step 1): [ka] Compound 1 (22 g, 100 mmol) was dissolved in tetrahydrofuran (200 mL), Then, compound 2 (10.5 g, 150 mmol) was added, and the mixture was stirred at −78° C. with n-butyllithium (80 mL, 2.5 mol / L) was added and the mixture was stirred at room temperature for 16 hours. If a new compound is detected by the filter, the solution is concentrated under reduced pressure to remove the organic solvent. The product was purified by column chromatography (ethyl acetate: petroleum ether = 50:1). Compound 3 (weight: 12 g, yield: 55.2%) was obtained.

[0642] Step 2): [ka] Compound 3 (12 g, 55.6 mmol) was dissolved in dichloromethane (100 mL) and water (10 0 mL), and then silver nitrate (1.89 g, 11.12 mmol) and potassium persulfate were added. Add 37 g (139 mmol) of ethanol and stir at room temperature for 16 hours. If a new compound is detected, the solution is concentrated under reduced pressure to remove the organic solvent. The product was purified by column chromatography (petroleum ether: ethyl acetate = 0-10%). This gives compound 4 (weight: 3.1 g, yield: 26.05%).

[0643] Step 3): [ka] Compound 4 (1.5 mg, 6.9 mmol) was dissolved in dichloromethane (20 mL), and then C8H 18Add N2O2HBr3 (2.9 g, 6.9 mmol) and stir at room temperature for 1 hour. If a new compound is detected by thin layer chromatography, the product is removed by centrifugation. The solution was purified by thin layer chromatography to obtain compound 5 (weight 2.2 g, yield 85.48%). ) is obtained.

[0644] Step 4): [ka] Compound 5 (150 mg, 0.5 mmol) was dissolved in acetonitrile (5 mL), and then Compound 6 (104 mg, 0.5 mmol) was added, and the mixture was then purged with nitrogen three times at room temperature. Stir overnight. When a new compound was detected by thin layer chromatography, concentrate the solution under reduced pressure. Finally, the product is purified by column chromatography (methanol: The compound AB24996 (weight 40 mg, yield) was purified with dichloromethane (0-30%). The rate is 16.0%).

[0645] Compound AB24996: 1 H NMR(400MHz,DMSO-d6)δ 9.38(s,1H),8.56 (d,J=6.7Hz,1H),8.36(d,J=6.9Hz,1H),8.17(s ,1H),8.11(d,J=8.0Hz,1H),7.94(s,1H),7.80( d,J=8.1Hz,1H),7.35(s,5H),7.17(s,1H),6.20 (d,J=9.8Hz,1H),5.67(s,2H),3.40(s,3H),3.0 6(s,1H),2.68(s,1H). ESI-MS: Theoretical value [M-Br] + 421.15, Observed: 421.15.

[0646] Example 53 Preparation of compound AB27111 Step 1): [ka] Compound 1 (36.3 g, 150 mmol) was dissolved in tetrahydrofuran (120 mL). Compound 2 (12.6 g, 180 mmol) was then added, and the mixture was stirred at −78° C. with n-butyllithium. Add 120 mL of 2.5 mol / L ammonium hydroxide and stir at room temperature for 16 hours. If a new compound is detected by chromatography, the solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product was purified by column chromatography (petroleum ether: ethyl acetate = 0-10%). ) to give compound 3 (weight 6.72 g, yield 18.66%).

[0647] Step 2): [ka] Compound 3 (6.72 g, 28 mmol) was dissolved in dichloromethane (200 mL) and water (20 0 mL) and then added silver nitrate (952 mg, 5.6 mmol) and potassium persulfate ( Add 18.9 g (70 mmol) of methylcellulose and stir at room temperature for 16 hours. If a new compound is detected, the solution is concentrated under reduced pressure to remove the organic solvent. The product was purified by column chromatography (petroleum ether: ethyl acetate = 0-10%). Compound 4 (weight 2.35 g, yield 36.33%) is obtained.

[0648] Step 3): [ka] Compound 4 (2.0 g, 8.69 mmol) was dissolved in dichloromethane (50 mL), and then C8H 18 Add N2O2HBr3 (2.9 g, 6.9 mmol) and stir at room temperature for 1 hour. If a new compound is detected by thin layer chromatography, the product is removed by centrifugation. The compounds were separated by thin layer chromatography (petroleum ether: ethyl acetate = 0-10%). Product 5 (weight 2.5 g, yield 93.10%) is obtained.

[0649] Step 4): [ka] Compound 5 (240 mg, 0.78 mmol) was dissolved in acetonitrile (10 mL). Compound 6 (150 mg, 0.78 mmol) was then added, followed by three nitrogen substitutions. Stir overnight at room temperature. If a new compound is detected by thin layer chromatography, The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol). The compound AB27111 (weight 88 ml) was purified in dichloromethane (0-30%). g, yield 27.31%).

[0650] Compound AB27111: 1 H NMR(400MHz,DMSO-d6)δ 9.72(s,1H),8.27 (d,J=6.8Hz,1H),8.17(d,J=6.7Hz,1H),8.02(d ,J=8.5Hz,1H),7.48(s,1H),7.40(d,J=11.9Hz, 5H),7.29(s,1H),7.11(d,J=5.7Hz,1H),6.99(d ,J=5.6Hz,1H),5.81(d,J=10.7Hz,1H),4.57(d, J=4.9Hz,2H),3.25(s,2H),3.21(s,1H),2.81(d ,J=9.3Hz,1H). ESI-MS: Theoretical value [M-Br] + 413.42, Observed: 413.20.

[0651] Example 54 Preparation of compound AB27112 Step 1): [ka] Compound 1 (8 g, 83.33 mmol) was dissolved in phosphorus oxychloride (40 mL), and then After flushing with nitrogen three times, the mixture was heated to 90°C and stirred overnight. When a new compound was detected, the phosphorus oxychloride was centrifuged and then soaked in dichloromethane (5 Add 50 mL of ice water, add 50 mL of dichloromethane, and The product was extracted by adding the extractant, and after the organic phases were combined, the product was washed with saturated saline (100 mL). Dry with anhydrous sodium sulfate and concentrate the solution under reduced pressure to remove the organic solvent. The product was purified by column chromatography (ethyl acetate: petroleum ether = 30-80%). Compound 2 (weight: 5 g, yield: 52.17%) was obtained.

[0652] Step 2): [ka] Compound 1 (2.5 g, 21.73 mmol) was dissolved in N,N-dimethylformamide (DMF) 50 mL), and then compound 3 (7.43 g, 65.22 mmol) and potassium carbonate were added. After adding ammonium (9.01 g, 65.22 mmol), the mixture was purged with nitrogen three times. Heat at 0°C and stir overnight. A new compound was detected by thin layer chromatography. (50 mL) and ethyl acetate (50 mL x 3) were added to extract the product, and the organic phases were combined. The product was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (acetic acid The compound 4 (weight 2.1 g, yield 5%) was purified with ethyl acetate and petroleum ether (0-30%). 2.24%).

[0653] Step 3): [ka] Compound 4 (100 mg, 0.54 mmol) was dissolved in acetonitrile (10 mL). Compound 5 (173 mg, 0.65 mmol) was then added and stirred at room temperature for 16 hours. When a new compound is detected by chromatography, the solution is concentrated under reduced pressure to remove the organic solvent. Finally, the product was purified by column chromatography (methanol:dichloromethane = 0- 10%) to obtain compound AB27112 (weight 40 mg, yield 19.9%). do.

[0654] Compound AB27112: 1 H NMR(400MHz,DMSO-d6)δ 10.47(s,1H),8.7 9(s,1H),8.20(s,3H),8.01(d,J=6.7Hz,2H),7. 37(s,5H),7.06(d,J=6.5Hz,1H),5.97(s,2H),4 .73(s,2H). ESI-MS: Theoretical value [M-Br] + 372.36, Observed: 372.10.

[0655] Example 55 Preparation of compound AB27125 Step 1): [ka] Compound 1 (22 g, 100 mmol) was dissolved in tetrahydrofuran (200 mL), Then, compound 2 (10.5 g, 150 mmol) was added, and the mixture was stirred at −78° C. with n-butyllithium (80 mL, 2.5 mol / L) was added and the mixture was stirred at room temperature for 16 hours. If a new compound is detected by the filter, the solution is concentrated under reduced pressure to remove the organic solvent. The product was purified by column chromatography (petroleum ether: ethyl acetate = 50:1). Compound 3 (weight: 13 g, yield: 60.3%) was obtained.

[0656] Step 2): [ka] Compound 3 (6.48 g, 30 mmol) was dissolved in dichloromethane (100 mL) and water (10 0 mL), and then silver nitrate (1 g, 6 mmol) and potassium persulfate (20 g, 2 Add 70 mmol) and stir at room temperature for 16 hours. Once the product is detected, the solution is concentrated under reduced pressure to remove the organic solvent. The compound was purified by chromatography (petroleum ether: ethyl acetate = 0-10%) and obtained as compound 4( The weight is 584 mg, the yield is 9.0%.

[0657] Step 3): [ka] Compound 4 (584 mg, 1.98 mmol) was dissolved in dichloromethane (20 mL), Next is C8H 18 Add N2O2HBr3 (820 mg, 1.98 mmol) and let the mixture stand at room temperature for 1 The reaction mixture was stirred for 1 hour. A new compound was detected by thin layer chromatography. After centrifugation and thin layer chromatography, compound 5 (weight 670 mg, yield 94%) was isolated. 0.7%).

[0658] Step 4): [ka] Compound 5 (200 mg, 0.65 mmol) was dissolved in acetonitrile (5 mL), and then Compound 6 (100 mg, 0.65 mmol) was added, and the mixture was then purged with nitrogen three times. The mixture was stirred overnight at room temperature. A new compound was detected by thin layer chromatography, and the solution was then purified under reduced pressure. The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol). The compound AB27125 (weight 53 mg) was purified in dichloromethane (0-30%). , yield 16.3%).

[0659] Compound AB27125: 1 H NMR(400MHz,DMSO-d6)δ 9.40(s,1H),8.58 (d,J=6.0Hz,1H),8.37(d,J=6.2Hz,1H),8.15(d ,J=17.0Hz,2H),8.06(d,J=7.5Hz,1H),7.76(d, J=7.5Hz,1H),7.35(s,5H),7.17(s,1H),6.24(d ,J=12.0Hz,1H),5.68(s,2H),3.39(s,2H). ESI-MS: Theoretical value [M-Br] + 421.15, Observed: 421.15.

[0660] Example 56 Preparation of compound AB27126 Step 1): [ka] Compound 1 (200 mg, 1.69 mmol) was dissolved in N,N-dimethylformamide (DMF) 20 mL), and add NaH (203 mg, 5.07 mmol) in an ice bath. ℃ in The mixture was stirred for 30 minutes, and then Compound 2 (318 mg, 1.86 mmol) was added, and the mixture was stirred at room temperature for 3 hours. A new compound was detected by thin layer chromatography, and the resulting solution was diluted with water (30 mL) and acetic acid. Ethyl acetate (30 mL x 3) was added to extract the product, and the organic phases were combined. The organic phase was washed with HCl, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The solvent is removed. Finally, the product is purified by column chromatography (methanol:dichloromethane). The compound was purified by ethanol (0-10%) to give compound 3 (weight 200 mg, yield 56.9%). do.

[0661] Step 2): [ka] Compound 4 (30 g, 124 mmol) was dissolved in tetrahydrofuran (200 mL), Compound 5 (10.46 g, 149 mmol) was then added, followed by three nitrogen substitutions. n-Butyllithium (80 mL, 2.5 mol / L) was added at -78°C, and the mixture was stirred at room temperature for 16 hours. If a new compound is detected by thin layer chromatography, the solution is concentrated under reduced pressure. Finally, the product is purified by column chromatography (petroleum ether: The compound 6 (weight 11.2 g, yield 38.93%) was purified with ethyl acetate (0-10%). %).

[0662] Step 3): [ka] Compound 6 (11.2 g, 48 mmol) was dissolved in dichloromethane (100 mL) and water (10 0 mL) and then added silver nitrate (1.65 g, 9.7 mmol) and potassium persulfate ( Add 32.6 g (121 mmol) of methylcellulose and stir at room temperature for 16 hours. If a new compound is detected, the solution is concentrated under reduced pressure to remove the organic solvent. The product was purified by column chromatography (petroleum ether: ethyl acetate = 0-10%). This gives compound 7 (weight: 930 mg, yield: 8.42%).

[0663] Step 4): [ka] Compound 7 (930 mg, 4.04 mmol) was dissolved in dichloromethane (20 mL), Next is C8H 18 Add N2O2HBr3 (1.68 g, 4.04 mmol) and let the mixture stand at room temperature for 1 The reaction mixture was stirred for 1 hour. A new compound was detected by thin layer chromatography. The solution was centrifuged and purified by column chromatography (petroleum ether: ethyl acetate = 0-10%). Compound 8 (weight: 800 mg, yield: 64.50%) was obtained.

[0664] Step 5): [ka] Compound 8 (200 mg, 0.65 mmol) was dissolved in acetonitrile (5 mL), and then Compound 3 (100 mg, 0.65 mmol) was added, and the mixture was then purged with nitrogen three times. The mixture was stirred overnight at room temperature. A new compound was detected by thin layer chromatography, and the solution was then purified under reduced pressure. The solution is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol). Compound AB27126 (weight 20 mg) was purified in dichloromethane (0-30%). , yield 7.04%).

[0665] Compound AB27126: 1 H NMR(400MHz,DMSO-d6)δ 9.41(s,1H),8.58 (s,1H),8.37(d,J=5.9Hz,1H),8.18(s,1H),7.7 0(dd,J=33.1,12.2Hz,3H),7.35(s,5H),7.16(s ,1H),6.25(s,1H),5.68(s,2H),3.48(s,2H),3. 04(d,J=9.3Hz,1H),2.65(s,1H). ESI-MS: Theoretical value [M-Br] + 437.15, Observed: 437.20.

[0666] Example 57 Preparation of compound AB27131 Step 1): [ka] Compound 1 (22 g, 100 mmol) was dissolved in tetrahydrofuran (200 mL), Then, compound 2 (10.5 g, 150 mmol) was added, and the mixture was stirred at −78° C. with n-butyllithium (80 mL, 2.5 mol / L) was added and the mixture was stirred at room temperature for 16 hours. If a new compound is detected by the filter, the solution is concentrated under reduced pressure to remove the organic solvent. The product was purified by column chromatography (petroleum ether: ethyl acetate = 50:1). Compound 3 (weight: 13 g, yield: 60.1%) was obtained.

[0667] Step 2): [ka] Compound 3 (6.48 g, 30 mmol) was dissolved in dichloromethane (100 mL) and water (10 0 mL), and then silver nitrate (1 g, 6 mmol) and potassium persulfate (20 g, 2 Add 70 mmol) and stir at room temperature for 16 hours. Once the product is detected, the solution is concentrated under reduced pressure to remove the organic solvent. The compound was purified by chromatography (petroleum ether: ethyl acetate = 0-10%) and obtained as compound 4( The weight is 584 mg, the yield is 9.0%.

[0668] Step 3): [ka] Compound 4 (584 mg, 1.98 mmol) was dissolved in dichloromethane (20 mL), Next is C8H 18 Add N2O2HBr3 (820 mg, 1.98 mmol) and let the mixture stand at room temperature for 1 The reaction mixture was stirred for 1 hour. A new compound was detected by thin layer chromatography. After centrifugation and thin layer chromatography, compound 5 (weight 670 mg, yield 94%) was isolated. 0.7%).

[0669] Step 4): [ka] Compound 5 (150 mg, 0.5 mmol) and compound 6 (105 mg, 0.5 mmol) ) in acetonitrile (10 mL) and stir at room temperature for 3 hours. If a new compound is detected by the method, the solution is concentrated under reduced pressure to remove the organic solvent. The product was purified by thin layer chromatography (methanol:dichloromethane = 10%). The compound AB27131 is obtained (weight 30 mg, yield 11.9%).

[0670] Compound AB27131: 1 H NMR(400MHz,DMSO-d6)δ 9.29(s,1H),8.15 (d,J=14.3Hz,2H),8.05(dd,J=14.3,7.1Hz,2H) ,7.73(d,J=7.4Hz,1H),7.45-7.30(m,5H),6.90 (d,J=6.3Hz,1H),5.70(d,J=12.1Hz,1H),4.77( s,1H),2.81(s,2H),2.59(s,4H),2.10(s,1H),1 .88(s,1H). ESI-MS: Theoretical value [M-Br] + 423.17, Observed: 423.17.

[0671] Example 58 Preparation of compound AB27133 Step 1): [ka] Compound 1 (160 g, 1 mmol) was dissolved in dichloromethane (50 mL) and then C 8H 18 N2O2HBr3 (414 mg, 1 mmol) was added and the mixture was stirred at room temperature for 1 hour. When new compounds are detected by thin layer chromatography, the products are separated by centrifugation of the reaction mixture. Compound 2 was purified by layer chromatography (petroleum ether: ethyl acetate = 0-10%). (Weight 240 mg, yield 100%)

[0672] Step 2): [ka] Compound 2 (240 mg, 1.0 mmol) was dissolved in acetonitrile (10 mL), and then Compound 3 (210 mg, 1.0 mmol) was added, and the mixture was then purged with nitrogen three times at room temperature. The solution was stirred overnight at rt. A new compound was detected by thin layer chromatography. The product is concentrated to remove the organic solvent. Finally, the product is purified by column chromatography (methanol : Purified with dichloromethane = 0-30%, compound AB27133 (weight 70.0 ml g, yield 18.97%).

[0673] Compound AB27133: 1 H NMR(400MHz,DMSO-d6)δ 9.47(s,1H),8.20 (s,1H),8.12(d,J=6.4Hz,1H),7.71(s,1H),7.4 8(d,J=7.2Hz,1H),7.39(d,J=6.3Hz,2H),7.34( d,J=6.5Hz,4H),6.98(d,J=6.7Hz,1H),5.72(d, J=11.3Hz,1H),4.77(s,1H),3.33-3.27(m,1H), 3.23(d,J=12.8Hz,1H),3.12(d,J=15.4Hz,1H), 2.77(d,J=9.3Hz,2H),2.57(s,1H),2.33(s,3H) ,2.08(s,1H),1.88(s,1H). ESI-MS: Theoretical value [M-Br] + 369.49, Observed: 369.15.

[0674] Example 59 Preparation of compound AB27142 Step 1): [ka] Compound 1 (5.0 g, 22.72 mmol) was dissolved in anhydrous N,N-dimethylformamide D Compound 2 (7.65 g, 68.16 mmol), Methylferrocene, palladium dichloride (1.0 g, 1.2 mmol), lithium chloride (0. 96 mg, 22.72 mmol) and sodium carbonate (4.8 g, 45.44 mmol) Then flush with nitrogen three times and stir overnight at room temperature. Upon detecting a new compound, the product was diluted with water (50 mL) and ethyl acetate (50 mL). The product was extracted by adding 3 mL of saturated sodium chloride solution. After the organic phases were combined, the product was extracted with saturated sodium chloride solution (100 mL). The solution was washed, dried over anhydrous sodium sulfate, and filtered, and the solution was concentrated under reduced pressure to obtain an organic solvent. The solvent is removed. Finally, the product is purified by thin layer chromatography (ethyl acetate:petroleum ether = 0-50%) to give compound 3 (weight 2.65 g, yield 56.89%).

[0675] Step 2): [ka] Compound 3 (2.65 g, 12.99 mmol) was dissolved in ethanol (100 mL). Sodium hydroxide (15.59 g, 389.70 mmol) was then added, followed by nitrogen After three replacements, the temperature is raised to 90°C and the mixture is stirred overnight. Upon detection of a new compound, the product was diluted with water (20 mL) and then diluted with dichloromethane (3 The product was extracted by adding 50 mL of saturated saline (50 mL) and the organic phases were combined. The product was washed, dried over anhydrous sodium sulfate, and filtered, and the solution was concentrated under reduced pressure to obtain a soluble solid. The organic solvent is removed. Finally, the product is purified by thin layer chromatography (methanol:dichloromethane). Compound 4 (weight 1.1 g, yield 63.66%) was obtained by filtration (pH 0-10%). do.

[0676] Step 3): ...

Claims

1. A compound having formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof. 【Chemistry 1】 (In Formula I, ring A represents a substituted or unsubstituted C6-C16 aryl ring, a substituted or unsubstituted C3-C16 cycloalkyl ring, a substituted or unsubstituted 3- to 16-membered heterocycloalkyl ring, or a substituted or unsubstituted 3- to 16-membered heteroaryl ring; Ring B is an unsubstituted or substituted C6-C16 aryl ring, a substituted or unsubstituted C3-C16 cycloalkyl ring, a substituted or unsubstituted 3- to 16-membered heterocycloalkyl ring, or a substituted or unsubstituted 3- to 16-membered heteroaryl ring; R 1 teeth 【Chemistry 2】 【Transformation 3】 R 3 represents nothing, a hydrogen atom, a substituted or unsubstituted C6-C16 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C10 alkyl group-, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C10 alkyl group-; R 4 and R 5 each independently represents a hydrogen atom or a substituted or unsubstituted C1-C10 alkyl group; R 6 represents a substituted or unsubstituted C6-C16 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted 3-16 membered cycloalkyl group, or a substituted or unsubstituted 3-16 membered heterocycloalkyl group; R 7 represents a hydrogen atom or a substituted or unsubstituted C1-C10 alkyl group; R 8 and R 9 are joined to form a substituted or unsubstituted 3- to 16-membered cycloalkyl ring or a substituted or unsubstituted 3- to 16-membered heterocycloalkyl ring; R 10 and R 11 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C6-C16 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C10 alkyl group-, a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C10 alkyl group-, or a substituted or unsubstituted C1-C6 alkyl group -C(O)-; or R 10 and R 11 are joined to form a substituted or unsubstituted 3- to 16-membered heterocycloalkyl ring or a substituted or unsubstituted 3- to 16-membered heteroaryl ring; Ring C represents a substituted or unsubstituted C6-C16 aryl ring, a substituted or unsubstituted C3-C16 cycloalkyl ring, a substituted or unsubstituted 3-16 membered heterocycloalkyl ring, or a substituted or unsubstituted 3-16 membered heteroaryl ring; n represents 0, 1, 2 or 3; The optional "substitution" means that one, two, three or four hydrogen atoms on the ring or atomic group are replaced with a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a halogen atom, a nitro group, -CN, a hydroxyl group, a mercapto group, an amino group, F 3 C-O-, F 3 means substituted by a substituent selected from C—, a C1-C4 carboxyl group, a C2-4 ester group, a C2-C4 acylamino group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, a C6-C12 aryl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocycloalkyl group; The heterocyclic rings of the heterocycloalkyl group, heteroaryl group, heterocycloalkyl ring, and heteroaryl ring each independently have 1, 2, 3, or 4 heteroatoms selected from N, O, and S.

2. In Formula I, ring A represents a substituted or unsubstituted C6-C12 aryl ring, a substituted or unsubstituted C3-C12 cycloalkyl ring, a substituted or unsubstituted 3-12 membered heterocycloalkyl ring, or a substituted or unsubstituted 3-12 membered heteroaryl ring; Ring B is an unsubstituted or substituted C6-C10 aryl ring, a substituted or unsubstituted C3-C10 cycloalkyl ring, a substituted or unsubstituted 3-10 membered heterocycloalkyl ring, or a substituted or unsubstituted 3-10 membered heteroaryl ring; R 3 represents nothing, a hydrogen atom, a substituted or unsubstituted C6-C10 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-; R 4 and R 5 each independently represents a hydrogen atom or a substituted or unsubstituted C1-C6 alkyl group; R 6 represents a substituted or unsubstituted phenyl group, a substituted or unsubstituted thiol group, or a substituted or unsubstituted pyridine group, wherein the substituted or unsubstituted phenyl group is a mono-substituted or unsubstituted phenyl group, and the substitution refers to ortho-substitution, para-substitution, or meta-substitution of the phenyl group, and the substituent is a halogen atom, a nitro group, an amino group, a C1-C4 alkyl group, a C1-C4 alkoxyl group, a C1-C4 alkylthiol group, F 3 C-, F 3 CO—, a C6-C12 aryl group, or a 5-10 membered heteroaryl group; R 7 represents a hydrogen atom or a substituted or unsubstituted C1-C4 alkyl group; R 8 and R 9 are joined to form a substituted or unsubstituted 3- to 10-membered cycloalkyl ring or a substituted or unsubstituted 3- to 10-membered heterocycloalkyl ring; R 10 and R 11 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted C1-C4 alkyl group -C(O)-; or R 10 and R 11 are joined to form a substituted or unsubstituted 5-12 membered heterocycloalkyl ring or a substituted or unsubstituted 5-12 membered heteroaryl ring; Ring C represents a substituted or unsubstituted C6-C10 aryl ring, a substituted or unsubstituted C3-C10 cycloalkyl ring, a substituted or unsubstituted 3-10 membered heterocycloalkyl ring, or a substituted or unsubstituted 3-10 membered heteroaryl ring; 2. The compound according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof.

3. In formula I, ring A represents a substituted or unsubstituted hiricine ring, a substituted or unsubstituted hirimicine ring, or a substituted or unsubstituted thiazol ring, and the substitution refers to the replacement of one, two, three, or four hydrogen atoms on the ring or on the atomic group by a C1-C4 alkyl group; Ring B is selected from the group consisting of: nothing, a tetrahydropyridine ring, a dihydropyrrole ring, an imidazole ring, a pyrazole ring, 【Chemistry 4】 R 3 represents no group, a phenyl group, a phenyl group-methyl group, or a phenyl group-ethyl group; R 4 and R 5 each independently represents a hydrogen atom, a methyl group, an ethyl group, a propyl group, or a butyl group; R 6 is a meta-nitrophenyl group, an ortho-nitrophenyl group, a para-nitrophenyl group, a phenyl group, a para-methylphenyl group, an ortho-methylphenyl group, a meta-methylphenyl group, a para-aminophenyl group, an ortho-aminophenyl group, a meta-aminophenyl group, a para-methoxyphenyl group, an ortho-methoxyphenyl group, a meta-methoxyphenyl group, a para-trifluoromethoxyphenyl group, an ortho-trifluoromethoxyphenyl group, a meta-trifluoromethoxyphenyl group, a para-halogenated phenyl group, an ortho-halogenated phenyl group, a meta-halogenated phenyl group, a para-trifluoromethylphenyl group, an ortho-trifluoromethylphenyl group, a meta-trifluoromethylphenyl group, a para-phenylphenyl group, an ortho-phenylphenyl group, a meta-phenylphenyl group, a pyridine group, 【Transformation 5】 represents a pyrazine group or a monomethyl-substituted pyrazine group; R 7 represents a hydrogen atom; R 8 and R 9 are linked to form a cyclopentene or cyclohexene ring; R 10 and R 11 each independently represents a hydrogen atom, a methyl group, a phenyl group -C1-C2 alkyl group-, a pyridine group -C1-C2 alkyl group-, or a C1-C3 alkyl group -C(O)-; or R 10 and R 11 are bonded to form an isoquinoline ring, a quinoline ring, a tetrahydroisoquinoline ring, a tetrahydroquinoline ring, or a dihydroisoquinoline-1 ketone ring; Ring C represents a substituted or unsubstituted benzene ring or a substituted or unsubstituted pyridine ring; the optional "substitution" may be any of the following: one, two or three hydrogen atoms on the atomic group are replaced with a methyl group, a halogen atom, a nitro group, F 3 C-, F 3 C—O—, and methoxy group-; n is 1; 2. The compound according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof.

4. R 1 is bonded to the heteroatom on ring A, and R 2 is attached to a carbon atom on ring A; and / or R 3 is bonded to a carbon atom or heteroatom on ring B 2. The compound according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof.

5. 2. The compound of claim 1, wherein the compound has the following structure: 【Transformation 6】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】 【change】

6. (a) a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof; and (b) a pharmaceutically acceptable carrier thereof. A drug composition characterized by:

7. Use of the compound of formula I according to claim 1, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, wherein the compound of formula I, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, is used to prepare a composition or formulation; and the composition or formulation is used for the prevention and / or treatment of tumors.

10. The use characterized by:

8. 8. The use according to claim 7, characterized in that the tumor is a human tumor; and / or the tumor is selected from lung cancer, pancreatic cancer, breast cancer, lymphoma, prostate cancer, brain cancer, leukemia, liver cancer, melanoma, intestinal cancer, renal cancer, colon cancer or a combination thereof.

9. the colon cancer comprises colon adenocarcinoma; the breast cancer comprises triple-negative breast cancer; the liver cancer is undifferentiated or poorly differentiated liver cancer; the leukemia comprises acute myeloid leukemia; the lung cancer is selected from non-small cell lung cancer, small cell lung cancer, or a combination thereof; the lymphoma comprises a B-cell lymphoma; the intestinal cancer comprises rectal adenocarcinoma; the brain tumor is selected from glioblastoma, medulloblastoma, or a combination thereof; and / or the renal cancer comprises renal clear cell adenocarcinoma.

10. 10. The use according to claim 9, wherein the leukemia comprises M4 acute myeloid leukemia; and / or the rectal adenocarcinoma comprises Dukes' type C, grade IV rectal adenocarcinoma.

11. the tumor comprises a tumor in which the mitochondrial oxidative phosphorylation pathway is upregulated; the tumor comprises a tumor in which the mitochondrial permeability transition pore is hypoactive; The tumor comprises a tumor in which the NNMT gene is underexpressed or not expressed; the tumor comprises a tumor in which the nucleotide site of the NNMT gene is hypermethylated; and / or the cancer comprises a tumor in which DNA CpG sites in the NNMT gene region are hypermethylated.

12. the upregulation of the mitochondrial oxidative phosphorylation pathway refers to a ratio (E1 / E0) between the level or expression level (E1) of the mitochondrial oxidative phosphorylation pathway in tumor cells and the level or expression level (E0) of the mitochondrial oxidative phosphorylation pathway in normal cells or similar cells being >1.0; The tumor with low activity of the mitochondrial permeability transition pore refers to a tumor in which the ratio (A1 / A0) between the activity or expression level A1 of the mitochondrial permeability transition pore in tumor cells and the activity or expression level A0 of the mitochondrial permeability transition pore in normal cells or similar cells is <1.0; The tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in tumor cells and the expression level E0 of the NNMT gene in the same cells or normal cells is <1.0; The tumor having hypermethylation of the nucleotide site of the NNMT gene refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in tumor cells and the methylation level L0 of the nucleotide site of the NNMT gene in the same cells or normal cells is >1.0; and / or The use according to claim 11, characterized in that the tumor with hypermethylation of DNA CpG sites in the NNMT gene region refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of DNA CpG sites in the NMT gene region of tumor cells and the methylation level W0 of DNA CpG sites in the NMT gene region of the same cells or normal cells is >1.

0.

13. said expression comprising protein expression and / or mRNA expression; "identical cells" refers to similar tumor cells in which normal levels of the mitochondrial oxidative phosphorylation pathway are expressed; The identical cells refer to similar tumor cells in which the activity of the mitochondrial permeability transition pore is normally expressed; The term "identical cells" refers to similar cells, i.e., similar tumor cells in which the NNMT gene is normally expressed; The identical cells refer to similar tumor cells in which the nucleotide sites of the NNMT gene are normally methylated; and / or The use according to claim 12, characterized in that the identical cells refer to similar tumor cells in which the DNA CpG sites in the NNMT gene region are normally methylated.

14. The tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level M% of the nucleotide site of the NNMT gene in tumor cells is ≧3% and M1% or less, where M1 is any positive integer between 3 and 100; The methylation level of the nucleotide site of the NNMT gene refers to the ratio between the number of methylated nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region; The methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site of the NNMT gene promoter region; the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site within a region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site; the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide site within a region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site; The tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the methylation level M% of the DNA CpG site in the NNMT gene region in tumor cells is ≧3% and M2% or less, where M2 is any positive integer between 3 and 100; The methylation level of the DNA CpG site in the NNMT gene region refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region; The methylation level of the DNA CpG site in the NNMT gene region refers to the ratio between the number of methylated CpG nucleotides in the DNA of the NNMT gene region and the number of all CpG nucleotides in the DNA of the NNMT gene region; The methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the DNA CpG site in the NNMT gene promoter region; The methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the DNA CpG site in the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site; and / or The use described in claim 11, characterized in that the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites within the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site.

15. M1 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100; M2 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100; The nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1; The region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site is from positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO: 1; and / or The use according to claim 14, characterized in that the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:

1.

16. the composition is a drug composition; the composition or formulation further comprises a pharmaceutically acceptable carrier; The use according to claim 7, characterized in that the composition or preparation is in the form of a solid, liquid or semi-solid; and / or the type of the composition or preparation is an oral agent, an external agent or an injectable preparation.

17. (1) a first active ingredient serving as an anticancer agent, which is a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof; (2) A pharmaceutical composition characterized by comprising a second active ingredient that is an inhibitor of the mitochondrial membrane permeability transition pore.

18. Use of a detection kit for producing a concomitant detection kit, wherein the concomitant detection kit is used to determine whether the compound of formula I according to claim 1, or its optical isomer or racemate, or its solvate, or its pharmaceutically acceptable salt, is suitable for the prevention and / or treatment of tumor patients; The detection kit comprises: (i) a detection reagent for detecting the level of the mitochondrial oxidative phosphorylation pathway, the level of the mitochondrial permeability transition pore, the expression level of the NNMT gene, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region; the companion detection kit further comprising an instruction manual or label; The instructions or label shall: The present invention describes that when the mitochondrial oxidative phosphorylation pathway is upregulated, the mitochondrial membrane permeability transition pore is made less active, the NNMT gene is under-expressed or not expressed, the nucleotide site of the NNMT gene is hypermethylated, and / or the DNA CpG site of the NNMT gene region is hypermethylated in tumor cells of a tumor patient, the compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof becomes suitable for the prevention and / or treatment of the tumor patient. Use of a detection kit characterized by: