Breeding method of all-female new germplasm of takifugu obscurus with cold resistance

Abstract

To provide a breeding method of all-female new germplasm of takifugu obscurus with cold resistance.SOLUTION: In the breeding method of the present invention, sex reversal in Takifugu obscurus is induced by hormones and combined with sex-determining molecular markers to obtain pseudo-male Takifugu obscurus. The pseudo-male fish is then mated with normal female Takifugu obscurus to obtain all-female Takifugu obscurus. Finally, individuals with low-temperature tolerance are selected from the all-female Takifugu obscurus using low-temperature tolerance molecular markers to obtain a new all-female variety with low-temperature tolerance. In this invention, SNP molecular markers for Takifugu obscurus sex and low-temperature tolerance have been discovered, and by using these two important factors in combination for comprehensive selective breeding, it is possible to mass-produce new all-female varieties in a short period of time. Furthermore, the all-female Takifugu obscurus with low-temperature tolerance obtained in this invention provide an excellent maternal resource for breeding new varieties and has broad application prospects.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] The present invention relates to the field of aquatic animal breeding, and more specifically to a method for breeding a new all-female Takifugu obscurus species with low-temperature tolerance. [Background technology]

[0002] As a traditional and precious edible fish in China and one of the three major aquatic products of the Yangtze River, the pufferfish (Takifugu fasciatus) has captivated many foodies with its delicious, tender, mild, and smooth texture. This fish has a long history of consumption, particularly in China's Yangtze River Delta, as well as in Japan and Korea. With the maturation of Takifugu obscurus cultivation and toxicity control technology, the Ministry of Agriculture and Rural Affairs and the State Food and Drug Administration jointly issued the "Notice on Conditionally Lifting the Processing Operations of Farmed Tiger Pufferfish and Farmed Takifugu obscurus" in 2016. The farming area of ​​Takifugu obscurus has gradually expanded in provinces such as Guangdong, Fujian, and Jiangsu, making it an important farmed fish in China's economic aquaculture industry. In recent years, the demand for Takifugu obscurus seedlings has been increasing as the scale of farming has expanded in China. However, companies involved in Takifugu Obscurus broodstock farming and fry propagation have neglected parent fish renewal and selective breeding, resulting in broodstock aging, inbreeding, and a decline in quality. This has resulted in slow growth of fry, low survival rates, and reduced feed utilization efficiency after multiple generations of breeding. Furthermore, the optimal temperature range for Takifugu Obscurus growth is 23–32°C; feeding rhythms decline at 19°C, and frostbite death occurs at 13°C. Currently, the new Takifugu Obscurus cultivar, Takifugu Obscurus "Zhongyang No. 1" (certified by China Variety Review and Appraisal GS-01-003-2018), can tolerate temperatures as low as 7–8°C. However, further improvements to its cold tolerance are needed to expand the range of Takifugu Obscurus farming areas, reduce winter exposure, and increase economic benefits. Therefore, it is particularly important to develop new Takifugu Obscurus cultivars with faster growth and better cold tolerance.

[0003] Among the pufferfish species, Takifugu obscurus exhibits significant sexual dimorphism, meaning that females grow faster than males. Sexually mature females are larger, exceeding males in both weight and length, and have a higher feed conversion rate. However, the sex of Takifugu obscurus cannot be distinguished visually before sexual maturity. Sex can only be identified after sexual maturity by pressing the abdomen and examining sperm and eggs. This method is time-consuming and expensive for fish farming. Another method involves dissecting the fish's gonads and examining sections of the gonadal tissue to complete sex identification at the juvenile stage. However, this method inflicts irreversible damage on the fish and is generally only used in laboratory research. Neither method meets actual production needs. Therefore, developing a molecular sexing marker to identify Takifugu obscurus and cultivating all-female Takifugu obscurus could address the slow growth rate of Takifugu obscurus. Summary of the Invention [Problem to be solved by the invention]

[0004] Purpose of the invention: The purpose of the present invention is to provide a method for cultivating a new all-female species of Takifugu obscurus that has a fast growth rate and can tolerate temperatures 2 to 3 degrees higher than the cold-tolerant Takifugu obscurus "Zhongyang No. 1," a new variety certified by the Chinese breeding review. [Means for solving the problem]

[0005] Technical solution: A method for cultivating a new all-female species of Takifugu obscurus with low-temperature tolerance according to the present invention, An operation step (1) of selecting sex-reversed Takifugu obscurus larvae using sex-determining molecular markers, obtaining pseudo-male Takifugu obscurus, and mating them with normal female Takifugu obscurus to obtain all-female Takifugu obscurus; and (2) selecting individuals with cold-tolerant traits from the all-female Takifugu obscurus obtained in step (1) using a cold-tolerant molecular marker whose base sequence at the SNP site is shown in SEQ ID NO. 2, amplifying a 150 bp strip by PCR, and if the genotype is detected as GG, the individuals are all-female cold-tolerant Takifugu obscurus.

[0006] The sex reversal in step (1) is achieved by a hormone-induced method.

[0007] The hormone induction method is the addition of 17α-methyltestosterone to the feed.

[0008] To feed Takifugu obscurus from hatching before 15 days of age up to 3.33 cm in length, rotifers are soaked in 17α-methyltestosterone at a dose of 30-60 mg / L. To feed Takifugu obscurus seedlings aged 15-40 days, Artemia are soaked in 17α-methyltestosterone at a dose of 30-60 mg / L. To feed Takifugu obscurus seedlings aged 40-100 days, add 17α-methyltestosterone to the feed at a dose of 30-60 μg / g.

[0009] The base sequence of the SNP site of the sex-determining molecular marker in step (1) is shown in SEQ ID NO. 1. If the PCR amplification result is two strips of 250 bp and 330 bp, the individual is a normal female fish or a pseudo-male fish, and if the PCR amplification result is one 330 bp strip, the individual is a normal male fish.

[0010] The primer sequences used for PCR amplification are shown in SEQ ID NOs. 3-4.

[0011] The program used for PCR amplification is as follows: step 1: pre-denaturation at 95°C for 3 minutes, step 2: denaturation at 95°C for 30 seconds, step 3: annealing at 51.5°C for 30 seconds, step 4: extension at 72°C for 30 seconds, steps 2 to 4 repeated 35 times, and step 5: extension at 72°C for 5 minutes.

[0012] In step (1), when mating the sham male fish with a normal female Takifugu obscurus, spawning was manually promoted. Specifically, the female fish were injected with 180 U / kg of HCG and 0.8 μg / kg of ovulation-inducing LRH-A2 the first time, with the dose halved for the sham male fish. A second injection was administered 24 hours later, with the dose for the female fish being 360 U / kg of HCG and 1.6 μg / kg of ovulation-inducing LRH-A2, with the dose halved for the sham male fish.

[0013] The primer sequences used for PCR amplification in step (2) are shown in SEQ ID NOs. 5-6.

[0014] The program used for PCR amplification in step (2) is as follows: Step 1: Pre-denaturation at 94°C for 4 minutes, step 2: Denaturation at 94°C for 30 seconds, step 3: Annealing at 51.5°C for 1 minute, step 4: Extension at 72°C for 40 seconds, steps 2 to 4 are repeated 30 times, and step 5: Extension at 72°C for 10 minutes. [Effects of the Invention]

[0015] Beneficial Effects: Compared with the prior art, the present invention has the following significant advantages: The sexing marker and cold-tolerance trait marker for Takifugu obscurus developed by the present invention can accurately determine genetic sex and cold-tolerance, and are characterized by speed, simplicity of operation, and low cost. In actual operation, genetic sex and cold-tolerance of fish can be identified in large quantities by simply cutting out a small amount of tail fin tissue and extracting DNA. This allows for the efficient selection of individuals with excellent traits and accelerates the breeding process of new fast-growing and cold-tolerant Takifugu obscurus varieties, improving breeding efficiency and speeding up the trait improvement process, thereby increasing the coverage of superior Takifugu obscurus cultivated varieties, enhancing industrial competitiveness, and promoting the stable and sustainable development of the industry. [Brief explanation of the drawings]

[0016] [Figure 1]1 is a technical flowchart of the present invention. [Figure 2] FIG. 1 is a diagram showing cold-resistant SNP sequence measurement peaks. [Figure 3] Figure 1 shows the sex identification diagram of Takifugu obscurus genes. [Figure 4] This is a comparison of an all-female cold-tolerant Takifugu obscurus and a common Takifugu obscurus. [Figure 5] This is a diagram of the cold tolerance experiment of all-female cold-tolerant Takifugu obscurus. DETAILED DESCRIPTION OF THE INVENTION

[0017] The technical solution of the present invention will be further described below with reference to the drawings.

[0018] Example 1: A method for cultivating a new all-female species of Takifugu obscurus with low-temperature tolerance (1) Sex reversal in Takifugu obscurus larvae was hormonally induced. Hormone induction method: Rotifers were administered to Takifugu obscurus fish at 15 days of age, before opening, up to a body length of 3.33 cm after hatching. The rotifers were collected and transferred to 30 mg / L 17α-methyltestosterone for 1 hour before administration. From 15 to 40 days of age, specially prepared Artemia nauplii were administered. The method for preparing the specially prepared nauplii was as follows: 1.5% saltwater was prepared, Artemia eggs were introduced, and incubation was carried out at 25°C under light conditions. After hatching on the 1st or 2nd day, the nauplii were transferred to 30 mg / L 17α-methyltestosterone for 1 hour before administration. After 40 days of age, 17α-methyltestosterone was mixed with the fish's diet and administered. After 100 days of age, the addition was discontinued and the fish were reared in a conventional manner. The preparation method and dosage were as follows. A predetermined amount of powder was weighed out and dissolved in pure ethanol. When used, the feed was mixed with eel powder and water, then rolled into balls. The 17α-methyltestosterone concentration in the balls was 30 μg / g. The balls were placed in a shaded, ventilated area and administered after the ethanol had evaporated. The feed was administered twice daily, in the morning and afternoon. After 100 days of age, sex determination molecular markers were used to identify the sex of the fish, facilitating later statistical analysis of the incidence of sex reversal. Two years later, during the breeding season, individuals whose gonads had developed to the end of stage VI (i.e., reproductive fluids were able to leak from the brood hole) were captured and their abdomens gently squeezed using specialized methods to observe whether semen leaked from the brood hole. The genetic sex of the fish was determined as female using sex determination molecular markers, and pseudomale fish (individuals with a genetic sex of female but physiological expression of female) were selected.

[0019] Development of molecular markers for sex determination used above: To determine the genetic sex of the parent fish at later stages, genome analysis was performed on male and female individuals from the Takifugu obscurus population (GenBank accession number: PRJNA449558) to obtain the SNP site for identifying the genetic sex of Takifugu obscurus. The base sequence of the SNP site is shown in SEQ ID NO. 1 ( ). The Takifugu obscurus sexing marker PCR primer pair (SEQ ID NO. 3 F(5'-3'):TCCTGGAGACGCTTGTCG, SEQ ID NO. 4 R(5'-3'):AGTGTGTCGTGATGTAAGG) was designed to match the SNP site for the genetic sex of Takifugu obscurus. The DNA molecule shown in SEQ ID NO. 1 was base-paired with the Takifugu obscurus sexing marker PCR primer pair. The base sequences are SEQ ID NO. 3 F(5'-3'):TCCTGGAGACGCTTGTCG and SEQ ID NO. 4 R(5'-3'):AGTGTGTCGTGATGTAAGG. The specific detection steps were as follows.A small amount of fin tissue was cut and DNA was extracted. The PCR amplification reaction mixture consisted of 10 μL of 2× Rapid Taq Master Mix, 0.8 μL each of upstream and downstream primers, 7.4 μL of sterile water, and 1 μL of template DNA. The amplification program steps were as follows: step 1: pre-denaturation at 95°C for 3 minutes, step 2: denaturation at 95°C for 30 seconds, step 3: annealing at 51.5°C for 30 seconds, step 4: elongation at 72°C for 30 seconds, steps 2 to 4 were repeated 35 times, and step 5: elongation at 72°C for 5 minutes. After gel electrophoresis of the amplified products, individuals with two strips were normal females or genotypically female, i.e., pseudomale, fish; individuals with one strip were genotypically male, i.e., normal male, fish. The results are shown in Figure 3.

[0020] (2) All-female Takifugu obscurus were obtained by mating pseudomale Takifugu obscurus (XX males) obtained by selection using sex-detecting molecular markers with normal female Takifugu obscurus (XX females).

[0021] Five suitable pseudomale fish (individuals with female genetic sex and physiological expression) selected in step (1) and five normal female fish were manually induced to spawn and inseminated. The fertilized eggs were supplied with water at a constant pressure and oxygenated with running water at a constant temperature of 25-28°C. After the larvae hatched, all female Takifugu obscurus seedlings were obtained, and a total of 143 larvae were used in subsequent experiments. The spawning-promoting agents and their amounts were as follows: The first injection of female fish was 180 U / kg of human chorionic gonadotropin (HCG) (Ningbo Second Glycogen Field) plus 0.8 μg / kg of ovulation-inducing LRH-A2 (Ningbo Second Glycogen Field). The dose was halved for the pseudo-male fish. 24 hours later, the parent fish received a second injection of 360 U / kg of HCG plus 1.6 μg / kg of LRH-A2 for the female fish. The dose for the pseudo-male fish was halved.

[0022] (3) Using cold-tolerance molecular markers, individuals with cold-tolerance traits were selected from all female Takifugu obscurus.

[0023] Development of cold tolerance markers:A temperature-reduction experiment was conducted on a population of Takifugu obscurus. The Takifugu obscurus used in the experiment were obtained from Zhongyang Group Co., Ltd., Nantong, Jiangsu Province, and cultured in ponds. The culture environment in the ponds was the same, and the fish were fed twice daily, at the same time in the morning and afternoon, with the same amount of food. Before the cold stress experiment, the fish were allowed to adapt to the temperature in a recirculating system for one week. The cold stress experiment was first controlled by the culture system, with the water temperature decreasing by 1°C per hour. When the water temperature reached 13°C, the rate of temperature reduction slowed, and the temperature reduction continued by adding ice to the recirculating system. It took 5.5 hours for the water temperature to decrease from 13°C to 6.8°C. The inability of Takifugu obscurus individuals to tolerate the low temperature was determined by their loss of balance on the bottom of the water. The time required for each fish to lose balance and the unbalance temperature were recorded. Approximately 1 cm of the tail fin of a Takifugu obscurus was cut, and genomic DNA was extracted from the tail fin tissue. Several general PCR primers, including primer base sequences SEQ ID NO. 5 F(5'-3'): AATCGCTCTGAAGGACAAT and SEQ ID NO. 6 R(5'-3'): CAGCCGTGTTTTACTTGAG, were designed and amplification was performed. The amplification program consisted of the following steps: Step 1: Pre-denaturation at 94°C for 4 minutes; Step 2: Denaturation at 94°C for 30 seconds; Step 3: Annealing at 51.5°C for 1 minute; Step 4: Elongation at 72°C for 40 seconds; Steps 2-4 were repeated 30 times; and Step 5: Elongation at 72°C for 10 minutes. Agarose gel electrophoresis was performed, and the brightest single strips were selected for bidirectional sequencing. Based on the peak map of the sequencing results (Figure 2), the genotype of the detected individuals could be determined by determining single or double peaks at a single base. A single peak was heterozygous and a double peak was homozygous.The double peaks were identified as potential target sites. The sites were verified by fluorescent quantitative PCR and polymorphism analysis. Based on the genotyping results of the sites, association analysis was performed by statistically analyzing the frequency of each genotype and gene. The SNP site for the cold tolerance trait of Takifugu obscurus was obtained. The base sequence was SEQ ID NO.2 (ACAAAAGTGACATTACGCTGCTTTTAAACCCTGACTGTTGGAAAATAAAGACATTTTGTTGCCTTTTATCTGGAAAATTCTGATAATCTTACTGCGGCTCAAAGTTAAAAATCCTGCAACACATATTTATAAAGGCTTTGAAACACTAGAAAGGAGCTCTTCGTCCCAGAACTGCCTTCTTAATCGCTCTGAAGGACAATTAACTCTTGACCTAAAATAATTGTATTATTACAAGGTTCAACTTGCCTT[G / C ]GCGGCCCTTAAATTTGGGCCCCGCGGCAGCAAAAGTCGCCCGTGAAAGACGACGCTGTAGCTTTTTCTGCAATCAGACTTTGTTTTTCTTGACACCTTTTTCTGTGTTGACACATTTTTGTATTTTATTTATTTTTTTCAAACGTCAGCTCAAGTAAAACACGGCTGCGCGTCAGCATTAAGGGGGAATATTTAGAAAGGGTATTAGTCTGCTGGTGCCAGATTACCCCTTACAGCTGGGGCAATTTGATA. SEQ ID NO. 5 and SEQ ID NO. 6 were used as a PCR primer pair for the cold tolerance marker of Takifugu obscurus, corresponding to the SNP site responsible for the cold tolerance trait of Takifugu obscurus, to select larval fish with cold tolerance traits.

[0024] The specific procedure for selecting individuals with cold tolerance was as follows. DNA was extracted from a small amount of caudal fin tissue. The PCR amplification reaction mixture consisted of 10 μL of 2×Taq Plus Master Mix II, 1 μL each of upstream and downstream primers, 6 μL of sterile water, and 2 μL of template DNA. The amplification program steps were as follows: Step 1: Pre-denaturation at 94°C for 4 minutes; Step 2: Denaturation at 94°C for 30 seconds; Step 3: Annealing at 51.5°C for 1 minute; Step 4: Elongation at 72°C for 40 seconds; Steps 2–4 were repeated 30 times; Step 5: Elongation at 72°C for 10 minutes. After gel electrophoresis of the amplified products, bright, clear strips were excised and sequenced. If positions 250–251 of SEQ ID NO. 2 were GG, the fish were cold-tolerant females. All larvae were subjected to an association analysis between the SNP site and cold tolerance, and the results are shown in Table 1.

[0025] [Table 1]

[0026] Thirty cold-tolerant female fish of the GG genotype and the common Takifugu obscurus (Chuyo No. 1) were reared. The rearing conditions were that the fish were fed 4-5% of their body weight in powder twice a day. The body length and weight of each fish were measured on the 50th and 100th days, and the results are shown in Table 2.

[0027] [Table 2]

[0028] In winter, 200-day-old female cold-tolerant Takifugu obscurus were placed in an outdoor aquarium for one day, and the water temperature was measured at 5.2°C.

[0029] To summarize the above results, the all-female cold-tolerant Takifugu obscurus bred in this invention has a growth rate 15% to 30% faster than that of ordinary Takifugu obscurus, and a cold-tolerance of 5.2°C (Figure 5), which is 2 to 3 degrees higher than the temperature that the new cold-tolerant Takifugu obscurus "Zhongyang No. 1" (7 to 8°C), a new variety previously certified by the Chinese variety review and evaluation, can tolerate.

[0030] The above is merely a preferred embodiment of the present invention, and all equivalent changes and modifications within the scope of the present invention should fall within the scope of the present invention.

Claims

1. A method for cultivating a new all-female species of Takifugu obscurus with low-temperature tolerance, comprising: An operational step (1) of selecting sex-reversed Takifugu Obscurus larvae using a sex-discriminating molecular marker, obtaining pseudo-male Takifugu Obscurus, and mating them with normal female Takifugu Obscurus to obtain all-female Takifugu Obscurus; and (2) an operation step of selecting individuals with cold-tolerant traits from the all-female Takifugu Obscurus obtained in step (1) using a cold-tolerant molecular marker whose base sequence at the SNP site is shown in SEQ ID NO. 2, amplifying a 150 bp strip by PCR, and determining that if the genotype is detected as GG, the individual is an all-female cold-tolerant Takifugu Obscurus.

2. 2. The method for cultivating a new all-female species of Takifugu obscurus with low-temperature tolerance according to claim 1, wherein the sex change in step (1) is achieved by a hormone induction method.

3. 3. The method for cultivating a new all-female species of Takifugu obscurus with low-temperature tolerance according to claim 2, wherein the hormone induction method is to add 17α-methyltestosterone to feed.

4. To feed Takifugu obscurus from hatching before 15 days of age to a body length of 3.33 cm, the rotifers were immersed in the 17α-methyltestosterone at a dosage of 30-60 mg / L. Artemia was immersed at 30-60 mg / L to feed 15-40 day old Takifugu obscurus seedlings. The method for raising an all-female new species of Takifugu obscurus with low-temperature tolerance according to claim 3, characterized in that the compound is added to feed at 30-60 μg / g for feeding to 40-100 day-old Takifugu obscurus.

5. The base sequence of the SNP site of the sex-discriminating molecular marker in step (1) is shown in SEQ ID NO. 1, If the PCR amplification result is two strips of 250 bp and 330 bp, the individual is a normal female fish or a pseudomale fish; The method for cultivating a new all-female species of Takifugu obscurus with low-temperature tolerance as described in claim 1, characterized in that if the PCR amplification result is a single 330 bp strip, the individual is a normal male fish.

6. The method for cultivating a new all-female species of Takifugu obscurus with low-temperature tolerance according to claim 5, wherein the primer sequences used for PCR amplification are shown in SEQ ID NO. 3-4.

7. The program used for PCR amplification is as follows: Step 1: Pre-denaturation at 95°C for 3 minutes Step 2: Denaturation at 95°C for 30 seconds, Step 3: Anneal at 51.5°C for 30 seconds, Step 4: Extend at 72°C for 30 seconds, Repeat steps 2 to 4 35 times. The method for cultivating a new all-female species of Takifugu obscurus having low-temperature tolerance according to claim 5, characterized in that step 5 is extended at 72°C for 5 minutes.

8. In step (1), when mating the pseudomale fish with a normal female Takifugu obscurus, spawning is manually promoted; Specifically, female fish were injected with 180 U / kg of HCG and 0.8 μg / kg of ovulation-inducing LRH-A2 the first time, and the dose was halved in the case of pseudo-male fish. The method for cultivating a new all-female species of Takifugu obscurus with low-temperature tolerance according to claim 1, characterized in that the second injection is given 24 hours later, and the injection dose for female fish is 360 U / kg of HCG + 1.6 μg / kg of ovulation-inducing LRH-A2, and the dose for pseudo-male fish is halved.

9. The method for cultivating a new all-female species of Takifugu obscurus with low-temperature tolerance according to claim 1, characterized in that the primer sequences used for PCR amplification in step (2) are shown in SEQ ID NO. 5-6.

10. The program used for PCR amplification in step (2) is as follows: Step 1: Pre-denaturation at 94°C for 4 minutes Step 2: Denaturation at 94°C for 30 seconds, Step 3: Anneal at 51.5°C for 1 minute, Step 4: Extend at 72°C for 40 seconds, Repeat steps 2 to 4 30 times. The method for cultivating a new all-female species of Takifugu obscurus with low-temperature tolerance according to claim 1, characterized in that step 5 is extended at 72°C for 10 minutes.

Images