Packaging oligonucleotides into virus-like particles

A controlled denaturation and aggregation process for oligonucleotides in VLPs addresses size and conformation inconsistencies, enabling stable and high-yield production of virus-like particles for pharmaceutical applications.

JP2025186230APending Publication Date: 2025-12-23CHECKMATE PHARM INC
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2025134628
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2018-04-09
Filing Date
2025-08-13
Publication Date
2025-12-23

AI Technical Summary

Technical Problem

Existing processes for producing virus-like particles (VLPs) with guanine-rich oligonucleotides suffer from inconsistency in size and conformation, leading to impurities, instability, and high production costs due to the reliance on initial oligonucleotide purity and a narrow time window for aggregation, making them unsuitable for large-scale manufacturing.

Method used

A process involving denaturation and controlled aggregation of oligonucleotides using chaotropic agents like urea, followed by precise temperature control, to achieve consistent spherical VLPs with oligonucleotides of defined size (6-16 nm) and conformation, independent of initial oligonucleotide purity, allowing for stable and high-yield production.

Benefits of technology

The process ensures consistent formation of pure, stable, and well-formed VLPs with controlled size and conformation, suitable for large-scale GMP manufacturing, reducing the need for additional purification steps and increasing yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025186230000005
    Figure 2025186230000005
  • Figure 2025186230000006
    Figure 2025186230000006
  • Figure 2025186230000007
    Figure 2025186230000007
Patent Text Reader

Abstract

To provide a process for producing a nucleotide composition comprising aggregated oligonucleotides, and a process for producing a composition comprising virus-like particles of an RNA bacteriophage and aggregated oligonucleotides packaged into the virus-like particles.SOLUTION: Provided is a process for producing a nucleotide composition comprising aggregated oligonucleotides, the process comprising the steps of: (a) providing oligonucleotides, wherein the oligonucleotides comprise 3 to 15 guanosine moieties at the 5' end and 3 to 15 guanosine moieties at the 3' end, and comprise phosphodiester-linked deoxynucleotides; (b) denaturing the oligonucleotides by incubating an aqueous solution I comprising the oligonucleotides at 75°C to 99°C until an average diameter of the oligonucleotides becomes 1 nm or less; and (c) aggregating the oligonucleotides.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for producing a composition comprising (i) a virus-like particle of an RNA bacteriophage and (ii) aggregated oligonucleotides, the aggregated oligonucleotides being packaged within the virus-like particle. The present invention further provides a process for producing a nucleotide composition comprising aggregated oligonucleotides suitable for use in the aforementioned process. Additionally, the present invention further provides a nucleotide composition comprising the aggregated oligonucleotides. Additionally, the present invention further provides a composition comprising (i) a virus-like particle of an RNA bacteriophage and (ii) aggregated oligonucleotides, the aggregated oligonucleotides being packaged within the virus-like particle. [Background technology]

[0002] The virus-like particles of RNA bacteriophage that are packaged with oligonucleotide, particularly guanine (G)-rich oligonucleotide, have been proposed as a powerful stimulator of immune system.Such virus-like particles and the oligonucleotides packaged therein, as well as the process for their production, are described in, for example, WO2003 / 024481, WO2004 / 000351, WO2004 / 084940, WO2004 / 007538, WO2007 / 068747 and WO2007 / 144150, the entire disclosures of which are incorporated herein by reference.Typically, this process is based on disassembling the recombinant virus-like particles of RNA bacteriophage, purifying the coat protein of said virus-like particles, and reassembling said coat protein in the presence of oligonucleotide, which produces virus-like particles that are packaged with oligonucleotide. Efficient and scalable processes for the production of recombinant virus-like particles of RNA bacteriophage are further disclosed, for example, in WO2005 / 117963, WO2006 / 125821, and WO2007 / 039552, which are incorporated herein by reference in their entireties.

[0003] Methods for oligonucleotide synthesis have been available for over 30 years, with phosphoramidite chemistry being the most commonly used method (Beaucage et al., Curr Protoc Nucleic Acid Chem 3.3.1-3.3.20 (2000)), the entire disclosure of which is incorporated herein by reference). There have been many significant improvements in phosphoramidite synthesis to reduce synthesis time and produce higher product yields. The synthesis of guanine (G)-rich oligonucleotides, particularly those with consecutive guanine residues, has always been more difficult to achieve on a large production scale, particularly with high purity and yield, likely due to the inaccessibility of the 5'-hydroxyl group to activated phosphoramidites during the coupling step. Specifically, support-bound protected G-rich oligomers can have problems forming secondary structures, leading to impurities and synthesis failure after a certain length, most predominantly resulting in oligonucleotide sequences with fewer or even more G residues. As a result, the purity of commercially available guanine (G)-rich oligonucleotides has significantly benefited from the improvements made to phosphoramidite synthesis. Thus, while 10 to 20 years ago, a purity of 60 to 80% for the guanine (G)-rich oligonucleotide was sometimes acceptable, purities as high as 93%, 95%, or even 97 or 99%, similar to non-guanine (G)-rich oligonucleotides, are now commonly achievable. Furthermore, when the (G)-rich oligonucleotide is part of a pharmaceutical product, the use of such higher purity (G)-rich oligonucleotides is required and required for regulatory approval.

[0004] G-rich oligonucleotides, specifically those with poly(G)s at the 5' and 3' ends and containing unmethylated CG dinucleotide motifs and central palindromes, tend to self-assemble into higher-order secondary and tertiary structures through G-tetrad formation of their poly(G) motifs (Kerkmann, M. et al., J. Biol. Chem., (2005) 280(9), 8086-93; Bochman, M. L. et al. Nat Rev Genet., (2012) 13(11):770-780, the entire disclosures of which are incorporated herein by reference). These G-quadruplexes can form via intermolecular or intramolecular pathways and are highly stable secondary structures. As a result, the size, shape, and conformation of these quadruplexes can be highly variable depending on the reaction pathway.

[0005] WO 2007 / 144150 describes a process for producing compositions containing guanine (G)-rich oligonucleotides packaged in virus-like particles of RNA bacteriophages, in which self-assembly of RNA bacteriophage coat proteins is carried out in the presence of oligonucleotide aggregates obtained by a disaggregation / aggregation process. The aggregation state of the oligonucleotides is characterized by relative peak onset times (PSTs) in size-exclusion HPLC using the RNA bacteriophage capsid as a standard. A PST of 50-110%, preferably 80-95%, has been found to be optimal. Such PSTs have been shown to correspond to oligonucleotide aggregates with apparent molecular weights within or slightly lower than the apparent molecular weight range of the RNA bacteriophage capsid. Despite its improvements over known processes for producing compositions comprising guanine (G)-rich oligonucleotides packaged in virus-like particles of RNA bacteriophage, the present inventors have identified substantial disadvantages of this prior art process of WO2007 / 144150. Summary of the Invention

[0006] Specifically, aggregated oligonucleotides prepared according to the prior art process of WO2007 / 144150 and with the size distribution defined in WO2007 / 144150 showed substantial inconsistency and large variation in the specific size and conformation of the formed aggregated oligonucleotides, as determined by dynamic light scattering (DLS).In addition, the inconsistency in the specific size and conformation of the formed aggregated oligonucleotides further resulted in substantial inconsistency in the virus-like particles into which the aggregated oligonucleotides were packaged, causing not only the formation of the desired spherical packaged VLPs, but also the formation of malformed rod-shaped aggregates or higher-order aggregates.Furthermore, the resulting VLPs into which the highly polydispersed aggregated oligonucleotides were packaged not only showed lower purity, but also increased instability.

[0007] Importantly, it has been found that the disaggregation / aggregation process of the prior art of WO2007 / 144150 is highly dependent on the initial purity of the oligonucleotides used in the disaggregation / aggregation step. Specifically, it has been found that the initial purity of the oligonucleotides used in the disaggregation / aggregation process of WO2007 / 144150 has an effect on the formation of aggregated oligonucleotides of a defined desired size and conformation due to the rate of oligonucleotide aggregation, i.e., aggregation and thus G-quadruplex formation. Typically, the higher the purity of the oligonucleotides used in the disaggregation / aggregation process of WO2007 / 144150, the faster and more uncontrolled and chaotic aggregation occurs, resulting in an increase in the amount of aggregated oligonucleotides that are typically very large outside the desired size window. As a result, the resulting aggregated oligonucleotides cannot be properly packaged, and the final oligonucleotide-packaged VLPs have reduced purity, requiring extensive and expensive purification, and reduced stability, as evidenced by changes in SEC chromatograms over time. Notably, an increase in the low molecular weight peak was observed over time, suggesting that some of the VLPs were not stable and released the originally packaged DNA and oligonucleotides, respectively.

[0008] Based on the findings of the present inventors, and particularly based on the high reliance on the purity of the oligonucleotides initially used in the disaggregation / aggregation process of WO2007 / 144150, the process of WO2007 / 144150, specifically the disaggregation / aggregation process of WO2007 / 144150, has been developed and optimized for low-purity G-rich oligonucleotides.As shown, not only are highly purified G-rich oligonucleotides widely available today, but their use as pharmaceuticals is also a prerequisite for regulatory approval.In addition to the inconsistency and large variation in the specific size and conformation of the formed aggregated oligonucleotides depending on the purity of the oligonucleotides initially used, another substantial disadvantage of the prior art process of WO2007 / 144150 is the associated very narrow time window for achieving the preparation of aggregated oligonucleotides within a defined size range due to uncontrolled, random aggregation.

[0009] As a result, and due to these resulting inconsistencies and variations, as well as the strong dependency on the purity of the oligonucleotides initially used, the process of WO2007 / 144150 is not suitable for large scale manufacturing, and in particular for GMP manufacturing (especially for clinical trial material where batch-to-batch consistency is important).

[0010] Thus, the present invention provides processes for producing nucleotide compositions comprising aggregated oligonucleotides, as well as processes for producing compositions comprising virus-like particles of RNA bacteriophages and aggregated oligonucleotides packaged within the virus-like particles, thus avoiding or reducing the disadvantages of the prior art processes.

[0011] Thus, in a first aspect, the present invention provides a process for producing a nucleotide composition comprising aggregated oligonucleotides, comprising: (a) providing an oligonucleotide, wherein the oligonucleotide comprises at least one poly-G stretch; (b) denaturing the oligonucleotide, the denaturing comprising: (i) incubating an aqueous solution I containing the oligonucleotides and a chaotropic agent at a temperature I until the average diameter of the oligonucleotides is 1 nm or less, as determined by dynamic light scattering (DLS), the temperature I being 75°C to 99°C, and preferably the chaotropic agent being urea; (c) aggregating the oligonucleotides, the aggregating comprising: (i) incubating the aqueous solution II containing the oligonucleotides having an average diameter of 1 nm or less obtained in step (b), a chaotropic agent, and cations at a temperature II to form the aggregated oligonucleotides, wherein the incubation is carried out until the average diameter of the formed aggregated oligonucleotides is 6 to 16 nm, and the average diameter is determined by dynamic light scattering (DLS), the temperature II is 75°C to 99°C, and preferably the chaotropic agent is urea; (ii) adjusting the temperature of solution II to a temperature III, wherein the temperature III is less than 40°C, preferably less than 30°C; A process is provided in which the steps are preferably performed in a given order.

[0012] Advantageously, the process of the present invention allows for control over the size, and thereby the conformation, of the aggregated oligonucleotides formed, resulting in the consistent formation of highly pure, stable, and well-formed, i.e., typically exclusively spherical, oligonucleotide-packaged VLPs.

[0013] Thus, the process of the present invention allows for control of the size of aggregated oligonucleotides by their diameter of 6 to 16 nm, preferably 7 to 14 nm, more preferably 8 to 14 nm, again more preferably 9 to 14 nm, again more preferably 10 to 14 nm, again more preferably 11 to 13 nm, thus 11, 12, or 13 nm, and most preferably 12 nm, as determined by dynamic light scattering (DLS).

[0014] Importantly, the process of the present invention not only allows for control of the size, and therefore the conformation, of the aggregated oligonucleotides formed, but also does so regardless of the purity of the oligonucleotides used in the denaturation step. Moreover, because the process of the present invention allows for control of aggregation, it also allows for and provides a wider operating window for carrying out the aggregation step. Such control, as well as the additional time and wider operating window, respectively, along with greater precision in process control, make the process of the present invention highly beneficial for expensive production at GMP quality, particularly at large-scale GMP quality. Furthermore, the yield of the final oligonucleotide-packaged VLPs obtained is additionally much higher and purer, particularly without the need for additional, costly purification steps.

[0015] As shown, the prior art process of WO 2007 / 144150 resulted in the formation of aggregated oligonucleotides that, in contrast to the aggregated oligonucleotides formed by the process of the present invention, exhibited substantial inconsistencies and large variations in the specific size and conformation of the formed aggregated oligonucleotides, as determined by dynamic light scattering (DLS). However, all of the aggregated oligonucleotides formed by the process of the present invention met the specification criteria for relative peak start time (PST) in size-exclusion HPLC using the capsid of the RNA bacteriophage as a standard, as defined in WO 2007 / 144150, although the corresponding optimal ranges were slightly shifted. Therefore, preferred aggregated oligonucleotides formed by the process of the present invention have a PST of 90-105%, preferably 92-102%, as determined accordingly.

[0016] Another advantage of the process of the present invention is that, compared with the prior art process of WO2007 / 144150, the denaturation step does not require the use of salts, particularly chaotropic agents, preferably urea.As a result, the resulting solution of the process of the present invention, which contains denatured, typically monomeric, oligonucleotides, is stable without the threat of re-aggregation, and can therefore be stored for further use.Therefore, these solutions can be heated or cooled multiple times without forming aggregates, and can advantageously be frozen for future use.The latter is not possible in the prior art process, probably due to the presence of salts generated during the neutralization step, which is required to stop the denaturation step before oligonucleotide degradation, as shown.Therefore, the prepared prior art solution has no possibility of storage and must be used afterwards.

[0017] In the present invention, the aggregation state of oligonucleotides is characterized by dynamic light scattering (DLS), which measures the time-dependent fluctuations in scattered light. The hydrodynamic radius and diameter of the aggregated oligonucleotides are then calculated by relating the diffusion rate of the aggregates through the solvent. Aggregated oligonucleotides with average hydrodynamic diameters of 6-16 nm, preferably 7-14 nm, more preferably 8-14 nm, again more preferably 9-14 nm, again more preferably 10-14 nm, again more preferably 11-13 nm, thus 11, 12, or 13 nm, and most preferably 12 nm, have been found to be optimal.

[0018] Thus, in a further aspect, the present invention provides a process for producing a composition comprising: (i) a virus-like particle, wherein the virus-like particle is a virus-like particle of an RNA bacteriophage; and (ii) an aggregated oligonucleotide, wherein the aggregated oligonucleotide is packaged within the virus, the process comprising: (a) forming a mixture, the mixture comprising: (i) a coat protein of the RNA bacteriophage; and (ii) an agent capable of preventing self-assembly of the coat protein; and (iii) aggregating oligonucleotides, the aggregated oligonucleotides comprising oligonucleotides comprising at least one poly-G stretch, and having an average diameter of 6 to 16 nm, the average diameter being determined by dynamic light scattering (DLS); (b) removing the agent from the mixture; (c) allowing the coat proteins to self-assemble into virus-like particles and package the aggregated oligonucleotides.

[0019] In yet a further aspect, the present invention provides a process for producing a composition comprising: (i) a virus-like particle, wherein the virus-like particle is a virus-like particle of an RNA bacteriophage; and (ii) an aggregated oligonucleotide, wherein the aggregated oligonucleotide is packaged within the virus, the process comprising: (a) forming a mixture, the mixture comprising: (i) a coat protein of the RNA bacteriophage; and (ii) an agent capable of preventing self-assembly of the coat protein; and (iii) aggregated oligonucleotides, the aggregated oligonucleotides comprising oligonucleotides comprising at least one poly-G stretch, obtainable by the process according to the first aspect of the present invention, and having an average diameter of between 6 and 16 nm, the average diameter being determined by dynamic light scattering (DLS); (b) removing the agent from the mixture; (c) allowing the coat proteins to self-assemble into virus-like particles and package the aggregated oligonucleotides.

[0020] In yet a further aspect, the present invention provides a process for producing a composition comprising: (i) a virus-like particle, wherein the virus-like particle is a virus-like particle of an RNA bacteriophage; and (ii) an aggregated oligonucleotide, wherein the aggregated oligonucleotide is packaged within the virus, the process comprising: (a) forming a mixture, the mixture comprising: (i) a coat protein of the RNA bacteriophage; and (ii) an agent capable of preventing self-assembly of the coat protein; and (iii) a nucleotide composition comprising the aggregated oligonucleotides, the nucleotide composition being obtainable by the method for producing a nucleotide composition comprising aggregated oligonucleotides according to the present invention, the aggregated oligonucleotides comprising oligonucleotides comprising at least one poly-G stretch, the aggregated oligonucleotides having an average diameter of 6 to 16 nm, the average diameter being determined by dynamic light scattering (DLS); (b) removing the agent from the mixture; (c) allowing the coat proteins to self-assemble into virus-like particles and package the aggregated oligonucleotides.

[0021] During the process, the virus-like particle is formed by self-assembly of the coat proteins of the RNA bacteriophage in the presence of the aggregating oligonucleotides.

[0022] In again a further aspect, the present invention provides a nucleotide composition comprising aggregated oligonucleotides, obtainable by a process for producing a nucleotide composition comprising aggregated oligonucleotides according to the invention, preferably wherein the aggregated oligonucleotides have an average diameter of 6 to 16 nm, preferably 7 to 14 nm, the average diameter being determined by dynamic light scattering (DLS).

[0023] In yet a further aspect, the present invention provides a nucleotide composition comprising aggregated oligonucleotides, wherein the aggregated oligonucleotides have an average diameter of 7 to 14 nm, the average diameter being determined by dynamic light scattering (DLS).

[0024] In yet a further aspect, the present invention provides a composition comprising (i) a virus-like particle of an RNA bacteriophage and (ii) an aggregated oligonucleotide, wherein the aggregated oligonucleotide is packaged in the virus-like particle, the composition being obtainable by a process for producing a composition comprising (i) a virus-like particle, the virus-like particle being a virus-like particle of an RNA bacteriophage, and (ii) the aggregated oligonucleotide according to the present invention.

[0025] In yet a further aspect, the present invention provides a composition comprising: (i) virus-like particles of an RNA bacteriophage; and (ii) aggregated oligonucleotides packaged in the virus-like particles and having an average diameter of 6 to 16, preferably 7 to 14 nm, wherein the average diameter is determined by dynamic light scattering (DLS).

[0026] Further aspects and embodiments of the present invention will become apparent as this description continues. [Brief explanation of the drawings]

[0027] [Figure 1A] Dynamic light scattering (DLS) of denatured and aggregated oligonucleotide G10 obtained by the process of the present invention. DLS was performed as described in Example 3. Figure 1A shows denatured, highly purified G10 oligonucleotide with an average particle diameter of 0.90 nm, indicating that the secondary structure of G10 oligonucleotide was disrupted, denaturation was complete, and monomeric form was achieved. Multiple scans were performed, as indicated by the overlapping curves. The average diameter (Dhyd) and the percentage of primary peaks (average) of these scans are reported in the inset of the data box in the graph. [Figure 1B]Dynamic light scattering (DLS) of denatured and aggregated oligonucleotide G10 obtained by the process of the present invention. DLS was performed as described in Example 3. Figure 1B shows the G10 oligonucleotide obtained with proper aggregation and a diameter of 12 nm, and subsequently aggregated. Multiple scans were performed, as indicated by the overlapping curves. The average diameter (Dhyd) and the percentage of primary peaks (average) of these scans are reported in the inset of the data box in the graph. [Figure 2A] DLS of modified oligonucleotide G10. DLS was performed as described in Example 3. The low-purity oligonucleotide G10 of SEQ ID NO: 1 (approximately 79%, as determined by reverse-phase HPLC and anion-exchange HPLC) was used for disaggregation (denaturation) as described in the prior art (WO2007 / 144150). DLS showed particles with an average diameter of 2.2 nm, indicating that not all of the secondary structure of oligonucleotide G10 was disrupted and denatured to monomers. Multiple scans were performed, as indicated by overlapping curves. The average diameter (Dhyd) and the percentage of primary peaks (average) of these scans are reported in the inset of the data box in the graph. [Figure 2B] DLS of modified oligonucleotide G10. DLS was performed as described in Example 3. High-purity oligonucleotide G10 of SEQ ID NO: 1 (approximately 94%, as determined by reverse-phase HPLC and anion-exchange HPLC) was used for disaggregation (denaturation) as described in the prior art (WO2007 / 144150). DLS showed particles with an average diameter of 2.8 nm, indicating that not all of the secondary structure of oligonucleotide G10 was disrupted and denatured to monomers. Multiple scans were performed, as indicated by overlapping curves. The average diameter (Dhyd) and the percentage of primary peaks (average) of these scans are reported in the inset of the data box in the graph. [Figure 2C]DLS of modified oligonucleotide G10. DLS was performed as described in Example 3. Highly pure oligonucleotide G10 of SEQ ID NO: 1 (approximately 94%, as determined by reverse-phase HPLC and anion-exchange HPLC) was used for the disaggregation process of the present invention. DLS showed particles with an average diameter of 0.9 nm, indicating that oligonucleotide G10 was completely or substantially completely denatured to a monomer. Multiple scans were performed, as indicated by overlapping curves. The average diameter (Dhyd) and the percentage of primary peaks (average) of these scans are reported in the inset of the data box in the graph. [Figure 3A] DLS of aggregated oligonucleotide G10. DLS was performed as described in Example 3. The modified oligonucleotide from Example 5 (Figures 2A-2C) was used. Aggregation of low-purity G10, as described in the prior art (WO 2007 / 144150), modified by a prior art process. The low-purity oligonucleotide G10 of SEQ ID NO: 1 corresponds to a purity of approximately 79%, as determined by reverse-phase HPLC and anion-exchange HPLC. DLS shows the aggregated oligonucleotide not only at the high end of the desired particle range (15 nm), but also with 10% of the material being significantly larger (30-50 nm). Multiple scans were performed, as indicated by overlapping curves. The mean diameter (Dhyd) and percent primary peak (mean) of these scans are reported in the inset of the data box within the graph. [Figure 3B]DLS of aggregated oligonucleotide G10. DLS was performed as described in Example 3. The modified oligonucleotide obtained from Example 5 (Figures 2A-2C) was used. Aggregation of high-purity G10, as described in the prior art (WO 2007 / 144150), modified by a prior art process. The high-purity oligonucleotide G10 of SEQ ID NO: XX corresponds to a purity of approximately 94% as determined by reverse-phase HPLC and anion-exchange HPLC. DLS shows aggregated oligonucleotides whose average diameter is completely (100%) outside the desired diameter range of 6-16 nm, as illustrated by the shaded boxes. Multiple scans were performed, as indicated by overlapping curves. The average diameter (Dhyd) and the percentage of primary peaks (average) of these scans are reported in the insets of the data boxes in the graphs. [Figure 3C] DLS of aggregated oligonucleotide G10. DLS was performed as described in Example 3. The modified oligonucleotides obtained from Example 5 (Figures 2A-2C) were used. Aggregation of high-purity G10 by the process of the present invention. The high-purity oligonucleotide G10 of SEQ ID NO: 1 corresponds to a purity of approximately 94% as determined by reverse-phase HPLC and anion-exchange HPLC. DLS shows aggregated oligonucleotides whose average diameter is entirely (100%) within the desired diameter range of 6-16 nm, as illustrated by the shaded boxes. Multiple scans were performed, as indicated by overlapping curves. The average diameter (Dhyd) and the percentage of primary peaks (average) of these scans are reported in the insets of the data boxes in the graphs. [Figure 4A] Characterization of purified Qβ coat protein by analytical size exclusion chromatography. Sample of purified Qβ VLP. The absorption coefficient of RNA at 260 nm is approximately 100-fold higher than that of the coat protein, so the observed peak (ratio A260 / A280 = 2) is dominated by the RNA core of the VLP. [Figure 4B]Characterization of purified Qβ coat protein by analytical size-exclusion chromatography. Sample of the supernatant from the degradation reaction. Released coat protein is indicated by the presence of a protein-like peak at approximately 12 minutes. Additionally, several species of unprecipitated RNA molecules are present in the 6.8-11 minute range. [Figure 4C] Characterization of purified Qβ coat protein by analytical size exclusion chromatography. Sample of purified Qβ coat protein. Analysis was performed in PBS on a column TSK G5000PWxl (Tosoh Bioscience). [Figure 5A] DLS and electron micrographs (EM) of virus-like particles (VLPs) of RNA bacteriophage Qβ packaged with aggregated oligonucleotide G10, obtained by the prior art disaggregation-aggregation method and by the denaturation and aggregation method of the present invention. DLS was performed as described in Example 3, and EM was obtained as described in Example 8. DLS of Qβ VLPs packaged with aggregated oligonucleotide G10, obtained by the prior art disaggregation-aggregation method. Multiple scans were performed, as indicated by the overlapping curves. The mean diameter (Dhyd) and percent primary peak (mean) of these scans are reported in the insets of the data boxes in the graphs. [Figure 5B] DLS and electron micrographs (EM) of virus-like particles (VLPs) of RNA bacteriophage Qβ packaged with aggregated oligonucleotide G10 obtained by the prior art disaggregation-aggregation method and by the denaturation and aggregation of the present invention. DLS was performed as described in Example 3, and EM was obtained as described in Example 8. EM of Qβ VLPs packaged with aggregated oligonucleotide G10 obtained by the prior art disaggregation-aggregation method. Arrows are included to identify rod-shaped structures. [Figure 5C]DLS and electron micrographs (EM) of virus-like particles (VLPs) of RNA bacteriophage Qβ packaged with aggregated oligonucleotide G10, obtained by the prior art disaggregation-aggregation method and by the denaturation and aggregation method of the present invention. DLS was performed as described in Example 3, and EM was obtained as described in Example 8. DLS of Qβ VLPs packaged with aggregated oligonucleotide G10, obtained by the process of the present invention. Multiple scans were performed, as indicated by the overlapping curves. The mean diameter (Dhyd) and percent primary peak (mean) of these scans are reported in the insets of the data boxes in the graphs. [Figure 5D] DLS and electron micrographs (EM) of virus-like particles (VLPs) of RNA bacteriophage Qβ packaged with aggregated oligonucleotide G10 obtained by the prior art disaggregation-aggregation method and by the denaturation and aggregation of the present invention. DLS was performed as described in Example 3, and EM was obtained as described in Example 8. EM of Qβ VLPs packaged with aggregated oligonucleotide G10 obtained by the process of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0029] Average diameter: As used herein, the term "average diameter" determined by dynamic light scattering (DLS) typically and preferably refers to a diameter measured by DLS using the method described in Example 3, and a given average diameter value of the measured particles refers to particles having that diameter as the average in a normal (Gaussian) distribution. Thus, as used herein, typically and preferably applied to oligonucleotides, aggregated oligonucleotides, and VLPs in which the aggregated oligonucleotides according to the present invention are packaged, the term "average diameter" determined by dynamic light scattering (DLS) typically and preferably refers to a diameter measured by DLS using the method described in Example 3, and a given average diameter value of the measured particles refers to particles in which at least 90%, preferably at least 95%, of the particles have a diameter of the given value or a diameter within ±10% of the given value. For clarity, for example, an average diameter value of 12 nm for aggregated oligonucleotides of the present invention refers to aggregated oligonucleotides of the present invention in which at least 90%, preferably at least 95%, of the aggregated oligonucleotides of the present invention have a diameter of 10.8 nm to 13.2 nm. Furthermore, as used herein, the term "average diameter" as determined by dynamic light scattering (DLS), typically and preferably as applied to oligonucleotides, aggregated oligonucleotides, and VLPs in which aggregated oligonucleotides according to the present invention are packaged, typically and preferably refers to a diameter measured by DLS, typically and preferably as described in Example 3, and a given average diameter value for measured particles refers to particles in which at least 65%, preferably at least 70%, of the particles have a diameter of the given value or a diameter within ±5% of the given value. For clarity, for example, an average diameter value of 12 nm for aggregated oligonucleotides of the present invention refers to aggregated oligonucleotides of the present invention in which at least 65%, preferably at least 70%, of the aggregated oligonucleotides of the present invention have a diameter between 11.4 nm and 12.6 nm.

[0030] All ranges of values, particularly mean diameters or diameter ranges disclosed herein, are intended to refer to all values ​​within that range, inclusive of the values ​​defining that range. For clarity, for example, a diameter value of 12 nm to 13 nm is intended to refer to a diameter of 12 nm or 13 nm, or any diameter within the range of 12 nm to 13 nm.

[0031] Chaotropic Agent: As used herein, the term "chaotropic agent" refers to a molecule or substance that disrupts the ordered structure of proteins, oligonucleotides, or other macromolecules. This loss of stability is typically caused by disruption of the hydrogen bond network. Examples include urea, phenol, isopropyl alcohol (IPA), ethanol, and guanidinium chloride, among others.

[0032] Oligonucleotide: As used herein, the term oligonucleotide refers to a single-stranded deoxyribonucleotide. Preferred oligonucleotides contain at least one poly-G stretch as defined below. More preferred oligonucleotides contain 2, 3, 4, 5, or 6 of the poly-G stretches. Highly preferred oligonucleotides contain exactly two poly-G stretches, preferably one of the two poly-G stretches located at the 5'-end or 3'-end of the oligonucleotide. Even more preferred oligonucleotides contain exactly two poly-G stretches, one of the two poly-G stretches located at the 5'-end and one of the two poly-G stretches located at the 3'-end of the oligonucleotide. Typically and preferably, as used herein, an oligonucleotide consists of 6 to 1,000 nucleotides, preferably 10 to 1,000 nucleotides, more preferably 10 to 200 nucleotides, even more preferably 10 to 100 nucleotides, even more preferably 20 to 40 nucleotides, and most preferably 30 nucleotides. More preferred oligonucleotides consist of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. Even more preferred oligonucleotides consist of 24 to 32 nucleotides, more preferably about 30 nucleotides.

[0033] The term oligonucleotide also refers to a molecule that contains at least one modified nucleotide, and preferably the modified nucleotide is selected from (a) a nucleotide analog or (b) a nucleotide that contains a backbone modification.In one embodiment, the oligonucleotide contains at least one modified nucleotide selected from the group consisting of (a) peptide nucleic acid, (b) inosine, (c) a tritylated base, (d) phosphorothioate, (e) alkylphosphorothioate, (f) 5-nitroindole desoxyribofuranosyl, (g) 5-methyldeoxycytosine, and (h) 5,6-dihydro-5,6-dihydroxydeoxythymidine.In a further embodiment, the oligonucleotide comprises or consists of phosphorothioated nucleotides.Phosphorothioated nucleotides are protected against degradation in cells or organisms, and are therefore preferred nucleotide modifications.More preferred are polynucleotides that are typically found in nature and are chemically, enzymatically, or metabolically modified. However, preferred oligonucleotides are composed exclusively of unmodified nucleotides, i.e., adenosine, thymidine, guanosine, and / or cytidine. Even more preferred oligonucleotides are composed exclusively of phosphodiester-linked nucleotides.

[0034] Highly preferred oligonucleotides are unmethylated CpG-containing oligonucleotides containing at least one, preferably one, two, three, or four CpG motifs. Even more preferred oligonucleotides contain a palindromic sequence, preferably the palindromic sequence contains at least one, preferably one, two, three, or four CpG motifs. Even more preferred oligonucleotides contain a palindromic sequence, preferably the palindromic sequence comprises or preferably consists of the sequence GACGATCGTC (SEQ ID NO: 2). Even more preferred oligonucleotides contain a palindromic sequence, the palindromic sequence is flanked at its 5' end by a poly-G stretch, and the palindromic sequence is flanked at its 3' end by a poly-G stretch, preferably the palindromic sequence is GACGATCGTC (SEQ ID NO: 2). Highly preferred oligonucleotides comprise a palindromic sequence flanked at its 5' end by at least 3 to 15, preferably 6 to 10, guanosine entities and at its 3' end by at least 3 to 15, preferably 6 to 10, guanosine entities, preferably the palindromic sequence is GACGATCGTC (SEQ ID NO: 2).

[0035] Poly-G stretch: The term poly-G stretch relates to a segment of an oligonucleotide, said segment consisting of at least three consecutive guanosine residues. Preferred poly-G stretches consist of 3 to 25, preferably 4 to 20, more preferably 4 to 15, and most preferably 4 to 10 consecutive guanosine entities. Even more preferred poly-G stretches consist of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive guanosine entities.

[0036] CpG motif: As used herein, the term CpG motif refers to a short, preferably single-stranded, DNA sequence containing a cytosine (C)-guanosine (G) dinucleotide, where C is unmethylated, and preferably the CG dinucleotide is a phosphodiester bond. Preferably, the CpG motif contains at least one, preferably one, two, or three, additional nucleotides 5' and / or 3' of the CG dinucleotide, and more preferably, the additional nucleotides do not contain the CG dinucleotide.

[0037] Relative Peak Onset Time: The term "relative peak onset time" is a parameter indicative of the aggregation state of an oligonucleotide, as essentially analyzed by analytical size exclusion HPLC using the conditions described in Example 4, as described in WO2007 / 144150.

[0038] Packaged: As used herein, the term "packaged" refers to the state of oligonucleotides associated with virus-like particles, typically and preferably the state of aggregated oligonucleotides. The use of the terms "aggregated oligonucleotides packaged in a VLP" or "VLPs in which aggregated oligonucleotides are packaged" are equivalent. As used herein, the term "packaged" typically and preferably refers to non-covalent binding, preferably ionic interactions, hydrophobic interactions, or hydrogen bonds. Typically and very preferably, as used herein, the term "packaged" refers to the encapsulation of the aggregated oligonucleotides within a VLP. Typically and preferably, VLPs in which aggregated oligonucleotides are packaged protect the aggregated oligonucleotides from degradation, preferably from DNase hydrolysis. Thus, in a preferred sense, the term "packaged" indicates that the packaged aggregated oligonucleotides are inaccessible to DNase hydrolysis. More preferably, the term "packaged" indicates that the aggregated oligonucleotides are inaccessible to DNase hydrolysis, and even more preferably, the DNase is DNase I or benzonase. Even more preferably, the term "packaged" indicates that the aggregated oligonucleotides are not available to benzonase hydrolysis.

[0039] The accessibility of an oligonucleotide to a deoxyribonuclease (e.g., deoxyribonuclease I or benzonase) is preferably assayed as described in Examples 11-17 of WO 2003 / 024481 A2 (see page 111 therein). In a preferred sense, a VLP is considered to have packaged oligonucleotides if at least 90%, preferably at least 95%, and most preferably at least 98% of the oligonucleotide can be recovered from the VLP after treatment with benzonase (190 U of benzonase per mg of coat protein in a buffer containing 2 mM MgCl, pH 7.2, 20-25°C, 18 hours). It will be clear to those skilled in the art that such assays may require appropriate controls and adaptation to the particular combination of VLP and oligonucleotide. In a highly preferred sense, oligonucleotide G10 (SEQ ID NO: 1) is considered to be packaged in a VLP of RNA bacteriophage Qβ if at least 90%, preferably at least 95%, and most preferably at least 98% of the G10 can be recovered from the VLP of RNA bacteriophage Qβ after treatment with benzonase (190 U benzonase per mg coat protein in a buffer containing 2 mM MgCl2, pH 7.2, 20-25°C, 18 hours).

[0040] Coat protein: As used herein, the term "coat protein" refers to a protein or proteins of an RNA bacteriophage that can be incorporated into the capsid assembly of the bacteriophage or RNA bacteriophage. Thus, the term coat protein refers to a protein that forms the capsid of an RNA bacteriophage or the VLP of an RNA bacteriophage. Typically, and preferably, the coat protein of an RNA bacteriophage has a dimeric structure.

[0041] Fragment of recombinant coat protein: As used herein, a fragment of a recombinant coat protein is defined as a polypeptide that is at least 70%, preferably at least 80%, more preferably at least 90%, and even more preferably at least 95% of the length of the wild-type coat protein or wild-type recombinant protein, respectively, where the wild-type coat protein or wild-type recombinant protein preferably retains the ability to form VLPs. Preferably, the fragment is obtained by at least one internal deletion, at least one truncation, or at least one combination thereof. The term "fragment of recombinant coat protein" or "fragment of coat protein" further encompasses polypeptides having at least 80%, preferably 90%, and even more preferably 95% amino acid sequence identity with the wild-type coat protein, respectively, where the wild-type coat protein is preferably capable of assembly into virus-like particles. The term "mutant coat protein" refers to a polypeptide having an amino acid sequence derived from the wild-type recombinant protein or coat protein, respectively, where the amino acid sequence is at least 80%, preferably at least 85%, 90%, 95%, 97%, or 99% identical to the wild-type sequence, and preferably retains the ability to assemble into VLPs.

[0042] Virus-like particle (VLP): As used herein, VLP refers to a non-replicating or non-infectious, preferably non-replicating and non-infectious, virus particle, or a non-replicating or non-infectious, preferably non-replicating and non-infectious structure resembling a virus particle, preferably a viral capsid. As used herein, the term "non-replicating" refers to the inability to replicate the genome contained in the VLP. As used herein, the term "non-infectious" refers to the inability to enter a host cell. Preferably, virus-like particles according to the present invention are non-replicating and / or non-infectious because they lack all or part of the viral genome or genome function. In one embodiment, virus-like particles are virus particles from which the viral genome has been physically or chemically inactivated, disassembled and reassembled, or assembled with purified proteins into VLPs. Typically, and more preferably, virus-like particles lack all or part of the replicative and infectious components of the viral genome. Virus-like particles according to the present invention may contain nucleic acids distinct from their genomes. A typical and preferred embodiment of the virus-like particle according to the present invention is a viral capsid, such as the viral capsid of a corresponding virus, bacteriophage, preferably an RNA bacteriophage.The term "capsid" refers to a macromolecular assembly composed of viral protein subunits.Typically, there are 60, 120, 180, 240, 300, 360, and more than 360 viral protein subunits.Typically and preferably, the interaction of these subunits results in the formation of a viral capsid with a unique repetitive structure, and this structure is typically and preferably spherical.For example, the capsid of an RNA bacteriophage has a spherical shape with icosahedral symmetry.

[0043] RNA bacteriophage virus-like particle: As used herein, the term "RNA bacteriophage virus-like particle" refers to a virus-like particle that comprises, or preferably consists essentially of, or consists of, the coat protein, variants, or fragments of an RNA bacteriophage. In addition, the RNA bacteriophage virus-like particle resembles the structure of an RNA bacteriophage, is non-replicative, non-infectious, lacks at least one gene(s) encoding the replication mechanism of the RNA bacteriophage, and typically also lacks the gene(s) encoding the protein(s) involved in the attachment or invasion of the virus into the host. A preferred VLP derived from an RNA bacteriophage exhibits icosahedral symmetry and consists of 180 subunits. In the context of the present invention, the term RNA bacteriophage virus-like particle preferably relates to a macromolecular structure obtained by the self-assembly of recombinant coat proteins of an RNA bacteriophage, or its fragments or variants, and preferably the self-assembly occurs in the presence of an oligonucleotide and an aggregation oligonucleotide, respectively.

[0044] Agents capable of preventing coat protein self-assembly: Agents capable of preventing coat protein self-assembly are agents that prevent the spontaneous formation of virus-like particles in the mixture.Those skilled in the art can experimentally determine the chemical nature and appropriate concentration of the agent by analyzing the mixture, for example, by size exclusion chromatography, as disclosed in Example 9 of WO2007 / 144150.After incubating the mixture at room temperature, preferably 22°C, for 1 hour, if the agent can prevent coat protein self-assembly if virus-like particles can no longer be detected by size exclusion chromatography, as disclosed in Example 9 of WO2007 / 144150.However, agents capable of preventing coat protein self-assembly do not irreversibly modify the coat protein, and removing the agent from the mixture leads to the spontaneous formation of virus-like particles.Preferred agents capable of preventing coat protein self-assembly include detergent, guanidinium hydrochloride, and urea, most preferably urea. Preferred detergents are sodium dodecyl sulfate, Tween 20, Triton X 100, etc. Typically and preferably, the agent capable of preventing self-assembly of coat proteins typically and preferably further comprises a reducing agent such as DDT, which keeps the intermolecular disulfide bonds formed by cysteine ​​residues of the coat proteins in a reduced state.

[0045] Purity: The purity of a composition of the invention comprising (i) virus-like particles, which are virus-like particles of an RNA bacteriophage, and (ii) aggregated oligonucleotides according to the invention, wherein the aggregated oligonucleotides are packaged in the virus-like particles, is determined by analytical size-exclusion HPLC, which is carried out under conditions essentially, and preferably exactly, as disclosed in Example 4. The purity of the composition is determined as the percentage of the peak area of ​​the virus-like particles contained in the composition relative to the total peak area of ​​all peaks in the same chromatogram.

[0046] "One", "a / an": When the terms "one", "a", or "an" are used in this disclosure, unless otherwise specified, they mean "at least one" or "one or more."

[0047] About: Within the meaning of this application, the term about shall mean + / - 4%, typically and preferably + / - 2%, e.g., about 100 shall mean 96-104, typically and preferably 98-102.

[0048] The present invention provides a process for producing a nucleotide composition comprising aggregated oligonucleotides, the process comprising: (a) providing oligonucleotides, the oligonucleotides comprising at least one poly-G stretch; (b) denaturing the oligonucleotides, the denaturing comprising: (i) incubating an aqueous solution I comprising the oligonucleotides and a chaotropic agent at a temperature I until the average diameter of the oligonucleotides is 1 nm or less, preferably determined by dynamic light scattering (DLS), the temperature I being between 75°C and 99°C, and preferably the chaotropic agent being urea; and (c) aggregating the oligonucleotides, the aggregating comprising: (i) incubating aqueous solution II containing the oligonucleotides having an average diameter of 1 nm or less obtained in step (b), a chaotropic agent, and cations at temperature II to form aggregated oligonucleotides, wherein the incubation is carried out until the average diameter of the formed aggregated oligonucleotides is 6 to 16 nm, preferably the average diameter is determined by dynamic light scattering (DLS), the temperature II is 75°C to 99°C, and preferably the chaotropic agent is urea; and (ii) adjusting the temperature of solution II to temperature III, wherein temperature III is less than 40°C, preferably less than 30°C, wherein the steps are preferably performed in a given order.

[0049] The present invention provides a process for producing aggregated oligonucleotides, the process comprising: (a) providing oligonucleotides, the oligonucleotides comprising at least one poly-G stretch; (b) denaturing the oligonucleotides, the denaturing comprising: (i) incubating an aqueous solution I comprising the oligonucleotides and a chaotropic agent at a temperature I until the average diameter of the oligonucleotides is 1 nm or less, preferably determined by dynamic light scattering (DLS), the temperature I being between 75°C and 99°C, and preferably the chaotropic agent being urea; and (c) aggregating the oligonucleotides, the aggregating comprising: (i) incubating an aqueous solution I comprising the oligonucleotides and a chaotropic agent at a temperature I until the average diameter of the oligonucleotides is 1 nm or less, preferably determined by dynamic light scattering (DLS), the temperature I being between 75°C and 99°C, and preferably the chaotropic agent being urea. The present invention further provides a process comprising the steps of: (i) incubating aqueous solution II obtained in (b), comprising the oligonucleotides having an average diameter of 1 nm or less, a chaotropic agent, and cations, at temperature II to form aggregated oligonucleotides, wherein the incubation is carried out until the average diameter of the formed aggregated oligonucleotides is 6 to 16 nm, preferably the average diameter is determined by dynamic light scattering (DLS), the temperature II is 75°C to 99°C, and preferably the chaotropic agent is urea; and (ii) adjusting the temperature of solution II to temperature III, wherein temperature III is less than 40°C, preferably less than 30°C, wherein the steps are preferably performed in a given order.

[0050] In a preferred embodiment, the denaturing of the oligonucleotide comprises solubilizing the oligonucleotide in an aqueous solution comprising the chaotropic agent to form aqueous solution I, wherein the aqueous solution does not contain monovalent or divalent ions at a concentration greater than 1 mM, and the aqueous solution does not contain monovalent or divalent ions at a concentration greater than 500 μM, preferably greater than 250 μM, preferably greater than 100 μM, preferably greater than 50 μM, preferably greater than 10 μM.

[0051] In a further preferred embodiment, the denaturing of the oligonucleotide comprises solubilizing the oligonucleotide in an aqueous solution comprising the chaotropic agent to form aqueous solution I, wherein the aqueous solution does not contain monovalent or divalent ions at concentrations that would cause self-aggregation of the oligonucleotide after addition of the oligonucleotide.

[0052] In a further preferred embodiment, the aqueous solution I does not contain monovalent or divalent ions at concentrations such that the oligonucleotides self-aggregate.

[0053] In a further preferred embodiment, the denaturing of the oligonucleotide comprises solubilizing the oligonucleotide in an aqueous solution comprising the chaotropic agent to form aqueous solution I, wherein the aqueous solution does not contain monovalent or divalent ions at concentrations that would cause spontaneous self-aggregation of the oligonucleotide after addition of the oligonucleotide.

[0054] In a further preferred embodiment, the aqueous solution I does not contain monovalent or divalent ions at concentrations such that the oligonucleotides spontaneously self-aggregate.

[0055] In a further preferred embodiment, said denaturing said oligonucleotide comprises the steps of solubilizing said oligonucleotide and said chaotropic agent to form said aqueous solution I and adjusting the temperature of said solution I to temperature I.

[0056] In a further preferred embodiment, the chaotropic agent contained in solution I is selected from urea, phenol, isopropyl alcohol, ethanol, and guanidinium chloride.

[0057] In a further preferred embodiment, the chaotropic agent contained in Solution I is urea.

[0058] In a further preferred embodiment, said temperature I is between 75°C and 90°C, preferably between 80°C and 90°C, even more preferably between 83°C and 87°C, again even more preferably about 85°C, and most preferably 85°C.

[0059] In a further preferred embodiment, said incubating said oligonucleotide in said solution I at said temperature I is carried out for 10 to 120 minutes, preferably 20 to 60 minutes, even more preferably 20 to 30 minutes, and again even more preferably 15 to 18 minutes.

[0060] In a further preferred embodiment, the concentration of the chaotropic agent, preferably the urea, in solution I is between 200 nM and 5M, preferably between 500 mM and 2M, even more preferably between 500 mM and 1.5M, and again even more preferably 1M.

[0061] In a further preferred embodiment, the concentration of the oligonucleotide, preferably the oligonucleotide of SEQ ID NO: 1, in Solution I is from 100 μM to 1 mM, preferably from 100 μM to 750 μM, even more preferably from 200 μM to 600 μM, and again even more preferably from 350 μM to 500 μM.

[0062] In a further preferred embodiment, the incubation of the oligonucleotide in solution I at temperature I is carried out for 15 minutes to 120 minutes, preferably 15 minutes to 60 minutes, and even more preferably 15 minutes to 30 minutes, again even more preferably 15 minutes to 25 minutes.

[0063] In a further preferred embodiment, the oligonucleotide comprises at least 3 and at most 15 guanosine entities at its 5' end and at least 3 and at most 15 guanosine entities at its 3' end, preferably at least 6 and at most 13 guanosine entities at its 3' end, more preferably at least 8 and at most 11 guanosine entities at its 3' end.

[0064] In a further preferred embodiment, the oligonucleotide comprises a palindromic sequence, preferably the palindromic sequence is GACGATCGTC (SEQ ID NO: 2), even more preferably the palindromic sequence is flanked at its 5' end by at least 3 and at most 15 guanosine entities and the palindromic sequence is flanked at its 3' end by at least 3 and at most 15 guanosine entities, again even more preferably the palindromic sequence is flanked at its 5' end by at least 6 and at most 13 guanosine entities and the palindromic sequence is flanked at its 3' end by at least 6 and at most 13 guanosine entities, again even more preferably the palindromic sequence is flanked at its 5' end by at least 8 and at most 11 guanosine entities and the palindromic sequence is flanked at its 3' end by at least 8 and at most 11 guanosine entities.

[0065] In a more preferred embodiment, the oligonucleotide comprises 10 to 1000 nucleotides, preferably 10 to 200 nucleotides, even more preferably 10 to 100 nucleotides, even more preferably 20 to 40 nucleotides, and even more preferably 30 nucleotides.

[0066] In a further preferred embodiment, the oligonucleotide comprises: (a) G10:GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1), (b) G10-11: GGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 3), (c) G12-11: GGGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 4), (d) G6:GGGGGGGACGATCGTCGGGGGG (SEQ ID NO: 5); (e) G7:GGGGGGGGACGATCGTCGGGGGGG (SEQ ID NO: 6), (f) G8:GGGGGGGGGACGATCGTCGGGGGGGG (SEQ ID NO: 7), (g) G9:GGGGGGGGGGACGATCGTCGGGGGGGGG (SEQ ID NO: 8), (h) G11:GGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 9), (i) G6-10: GGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 24), (j) G7-10: GGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 25), (k) G8-10:GGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 26), and (l) G9-10: GGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 27).

[0067] In a further preferred embodiment, the oligonucleotide has the nucleic acid sequence G10 GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1).

[0068] In a more preferred embodiment, the oligonucleotide consists exclusively of phosphodiester-linked deoxynucleotides.

[0069] In a further preferred embodiment, the purity of the oligonucleotide, preferably the oligonucleotide of SEQ ID NO: 1, is greater than or equal to 90% as determined by HPLC, preferably by reverse phase HPLC or anion exchange HPLC, more preferably by reverse phase HPLC.

[0070] In a further preferred embodiment, the purity of the oligonucleotide, preferably the oligonucleotide of SEQ ID NO: 1, is 92% or more, preferably 94% or more, even more preferably 95% or more, again more preferably 97% or more, again more preferably 98% or more, again more preferably 99% or more, as determined by HPLC, preferably by reverse phase HPLC or anion exchange HPLC, more preferably by reverse phase HPLC.

[0071] In a further preferred embodiment, the oligonucleotide comprises the sequence of SEQ ID NO: 1, and the oligonucleotide consists exclusively of phosphodiester-linked deoxynucleotides.

[0072] In a further preferred embodiment, the oligonucleotide consists of the sequence SEQ ID NO:1.

[0073] In a further preferred embodiment, the oligonucleotide consists of the sequence of SEQ ID NO: 1, and the oligonucleotide consists exclusively of phosphodiester-linked deoxynucleotides.

[0074] In a further preferred embodiment, the chaotropic agent contained in Solution II is selected from urea, phenol, isopropyl alcohol, ethanol, and guanidinium chloride.

[0075] In a more preferred embodiment, the chaotropic agent contained in Solution II is urea.

[0076] Therefore, in a further preferred embodiment, the chaotropic agent contained in solution II, ie the solution for agglutination, is urea.

[0077] In a further preferred embodiment, said temperature II is between 75°C and 90°C, preferably between 80°C and 90°C, even more preferably between 83°C and 87°C, again even more preferably about 85°C, and most preferably 85°C.

[0078] In a further preferred embodiment, the concentration of the chaotropic agent, preferably the urea, in solution II is between 200 nM and 5M, preferably between 500 mM and 2M, more preferably between 500 mM and 1.5M, and again more preferably 1M.

[0079] In a more preferred embodiment, the cation is Na + , K. + , NH4 + , Li + , Ca 2+ , Mg 2+, and Zn 2+ is selected from.

[0080] The cation is typically and preferably provided by an inorganic salt, more preferably the inorganic salt is selected from chloride and sulfate. + , K. + , NH4 + , Li + , Ca 2+ , Mg 2+ , Zn 2+ is provided by its chloride salt. Alternatively, the Na as the cation + , K. + , NH4 + , Li + , Ca 2+ , Mg 2+ , Zn 2+ is provided by its sulfate salt. Again more preferably, the Na as the cation + , K. + , NH4 + , Li + , Ca 2+ , Mg 2+ is provided by its chloride salt, and the Zn as the cation 2+ is preferably provided as its sulfate salt.

[0081] In a further preferred embodiment, the concentration of the cation in solution II is between 20 mM and 2 M, preferably between 50 mM and 1 M, more preferably between 100 mM and 500 mM, and again more preferably 250 mM.

[0082] In a further preferred embodiment, the chaotropic agent contained in solution I and the chaotropic agent contained in solution II are the same.

[0083] In a more preferred embodiment, the concentrations of the chaotropic agent contained in solution I and the chaotropic agent contained in solution II are the same.

[0084] In a further preferred embodiment, the chaotropic agent contained in solution I and the chaotropic agent contained in solution II is urea.

[0085] In a further preferred embodiment, the aggregating of the oligonucleotides comprises the steps of: (i) solubilizing the chaotropic agent and the cations to form an aqueous solution IIa; (ii) mixing the aqueous solution IIa with the aqueous solution I containing the oligonucleotides having an average diameter of 1 nm or less obtained in step (b) to form the aqueous solution II; and (iii) adjusting the temperature of the solution II to temperature II.

[0086] In a further preferred embodiment, the temperature difference between said temperature I and said temperature II is 5°C or less, preferably 4°C or less, even more preferably 3°C or less, again more preferably 2°C or less, again more preferably 1°C or less, and most preferably said temperature I and said temperature II are equal.

[0087] In a further preferred embodiment, the incubating is carried out until the average diameter of the aggregated oligonucleotides is 7 to 14 nm, as determined by dynamic light scattering (DLS).

[0088] In a more preferred embodiment, the incubating is carried out until the average diameter of the aggregated oligonucleotides is 8 to 14 nm, as determined by dynamic light scattering (DLS).

[0089] In a more preferred embodiment, the incubating is carried out until the average diameter of the aggregated oligonucleotides is 9 to 14 nm, as determined by dynamic light scattering (DLS).

[0090] In a further preferred embodiment, the incubating is carried out until the average diameter of the aggregated oligonucleotides is 10 to 14 nm, as determined by dynamic light scattering (DLS).

[0091] In a further preferred embodiment, the incubating is carried out until the average diameter of the aggregated oligonucleotides is 11 to 13 nm, as determined by dynamic light scattering (DLS).

[0092] In a further preferred embodiment, the incubating is carried out until the average diameter of the aggregated oligonucleotides is 11, 12, or 13 nm, as determined by dynamic light scattering (DLS).

[0093] In a further preferred embodiment, the incubating is carried out until the average diameter of the aggregated oligonucleotides is 12 nm, as determined by dynamic light scattering (DLS).

[0094] The determination of the average diameter by dynamic light scattering (DLS) according to the present invention, whether it is of the oligonucleotide during the denaturation process or of the aggregated oligonucleotide during the aggregation process, is very beneficial because the determination can be easily performed during the process, which further ensures very high accuracy and very high control of the desired size of the oligonucleotide and the aggregated oligonucleotide, respectively.

[0095] In a further preferred embodiment, the incubating is carried out until the aggregated oligonucleotides contain 80-110% of the relative peak onset time, as determined by size exclusion HPLC using the capsid of an RNA bacteriophage as a standard.

[0096] In a further preferred embodiment, the process further comprises a step of purifying said aggregated oligonucleotides, preferably said purifying comprises filtering said aggregated oligonucleotides, preferably said Solution II containing said aggregated oligonucleotides, through a 50 nm filter.

[0097] In a more preferred embodiment, the 50 nm filter is a 50 nm PTFE filter.

[0098] In a further preferred embodiment, filtering the aggregated oligonucleotides, preferably the Solution II comprising the aggregated oligonucleotides, through the 50 nm filter, preferably the 50 nm PTFE filter, is carried out at 0°C to 20°C.

[0099] This further preferred step of purification, preferably filtration, allows for the removal of any large aggregates prior to the packaging step into VLPs and therefore typically further increases the purity of the final product, i.e., the VLPs of the invention into which the aggregated oligonucleotides have been packaged, typically by about 5%. Thus, the increase in purity is typically associated with a reduction in higher molecular weight material in the final product, as evidenced by SEC HLPC or DLS.

[0100] In a further preferred embodiment, the process does not include a step of purifying the aggregated oligonucleotides.

[0101] In a further preferred embodiment, the aggregated oligonucleotide comprises at least 3 and at most 15 guanosine entities at its 5' end and at least 3 and at most 15 guanosine entities at its 3' end, preferably at least 6 and at most 13 guanosine entities at its 3' end, more preferably at least 8 and at most 11 guanosine entities at its 3' end.

[0102] In a further preferred embodiment, the aggregating oligonucleotide comprises a palindromic sequence, preferably the palindromic sequence is GACGATCGTC (SEQ ID NO: 2), even more preferably the palindromic sequence is flanked at its 5' end by at least 3 and at most 15 guanosine entities and the palindromic sequence is flanked at its 3' end by at least 3 and at most 15 guanosine entities, again even more preferably the palindromic sequence is flanked at its 5' end by at least 6 and at most 13 guanosine entities and the palindromic sequence is flanked at its 3' end by at least 6 and at most 13 guanosine entities, again even more preferably the palindromic sequence is flanked at its 5' end by at least 8 and at most 11 guanosine entities and the palindromic sequence is flanked at its 3' end by at least 8 and at most 11 guanosine entities.

[0103] In a further preferred embodiment, the aggregated oligonucleotide comprises 10 to 1000 nucleotides, preferably 10 to 200 nucleotides, even more preferably 10 to 100 nucleotides, even more preferably 20 to 40 nucleotides, and even more preferably 30 nucleotides.

[0104] In a further preferred embodiment, the aggregated oligonucleotide comprises: (a) G10:GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1), (b) G10-11: GGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 3), (c) G12-11: GGGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 4), (d) G6:GGGGGGGACGATCGTCGGGGGG (SEQ ID NO: 5); (e) G7:GGGGGGGGACGATCGTCGGGGGGG (SEQ ID NO: 6), (f) G8:GGGGGGGGGACGATCGTCGGGGGGGG (SEQ ID NO: 7), (g) G9:GGGGGGGGGGACGATCGTCGGGGGGGGG (SEQ ID NO: 8), (h) G11:GGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 9), (i) G6-10: GGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 24), (j) G7-10: GGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 25), (k) G8-10:GGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 26), and (l) G9-10: GGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 27).

[0105] In a further preferred embodiment, the aggregating oligonucleotide has the nucleic acid sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1) (G10).

[0106] In a further preferred embodiment, the aggregated oligonucleotides consist exclusively of phosphodiester-linked deoxynucleotides.

[0107] In a further aspect, the present invention provides a nucleotide composition comprising aggregated oligonucleotides, obtainable by a process for producing a nucleotide composition comprising aggregated oligonucleotides according to the invention, preferably wherein the aggregated oligonucleotides have an average diameter of 6 to 16 nm, preferably 7 to 14 nm, wherein the average diameter is determined by dynamic light scattering (DLS).

[0108] In a preferred embodiment, the aggregated oligonucleotides have an average diameter of 8 to 14 nm, preferably 9 to 14 nm, and more preferably 10 to 14 nm, as determined by dynamic light scattering (DLS).

[0109] In a further preferred embodiment, the aggregated oligonucleotides have an average diameter of 11 to 13 nm, preferably 11, 12, or 13 nm, more preferably 12 nm, wherein the average diameter is determined by dynamic light scattering (DLS).

[0110] In a further preferred embodiment, at least 90%, preferably at least 95%, of the aggregated oligonucleotides have a diameter of between 10.8 nm and 13.2 nm, as determined by dynamic light scattering (DLS).

[0111] In a further preferred embodiment, at least 65%, preferably at least 70%, of the aggregated oligonucleotides have a diameter of between 11.4 nm and 12.6 nm, as determined by dynamic light scattering (DLS).

[0112] In a further preferred embodiment of the nucleotide composition, at least 90%, preferably at least 95%, of the aggregated oligonucleotides have a diameter of 12 nm ± 10%, i.e., 10.8 nm to 13.2 nm, as determined by dynamic light scattering (DLS).

[0113] In a further preferred embodiment of the nucleotide composition, at least 65%, preferably at least 70%, of the aggregated oligonucleotides have a diameter of 12 nm ± 5%, i.e., 11.4 nm to 12.6 nm, as determined by dynamic light scattering (DLS).

[0114] In a further preferred embodiment, the aggregating oligonucleotide has the nucleic acid sequence G10 GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1).

[0115] In a further preferred embodiment, the aggregated oligonucleotide has the nucleic acid sequence G10 GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1), and the aggregated oligonucleotide consists exclusively of phosphodiester-linked deoxynucleotides.

[0116] In yet a further aspect, the present invention provides a nucleotide composition comprising aggregated oligonucleotides, wherein the aggregated oligonucleotides have an average diameter of 7 to 14 nm, the average diameter being determined by dynamic light scattering (DLS).

[0117] In a preferred embodiment, the aggregated oligonucleotides have an average diameter of 8 to 14 nm, preferably 9 to 14 nm, and more preferably 10 to 14 nm, as determined by dynamic light scattering (DLS).

[0118] In a further preferred embodiment, the aggregated oligonucleotides have an average diameter of 11 to 13 nm, preferably 11, 12, or 13 nm, more preferably 12 nm, wherein the average diameter is determined by dynamic light scattering (DLS).

[0119] In a further preferred embodiment, at least 90%, preferably at least 95%, of the aggregated oligonucleotides have a diameter of between 10.8 nm and 13.2 nm, as determined by dynamic light scattering (DLS).

[0120] In a further preferred embodiment, at least 65%, preferably at least 70%, of the aggregated oligonucleotides have a diameter of between 11.4 nm and 12.6 nm, as determined by dynamic light scattering (DLS).

[0121] In a further preferred embodiment of the nucleotide composition, at least 90%, preferably at least 95%, of the aggregated oligonucleotides have a diameter of 12 nm ± 10%, i.e., 10.8 nm to 13.2 nm, as determined by dynamic light scattering (DLS).

[0122] In a further preferred embodiment of the nucleotide composition, at least 65%, preferably at least 70%, of the aggregated oligonucleotides have a diameter of 12 nm ± 5%, i.e., 11.4 nm to 12.6 nm, as determined by dynamic light scattering (DLS).

[0123] In a further preferred embodiment, the aggregating oligonucleotide has the nucleic acid sequence G10 GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1).

[0124] In a further preferred embodiment, the aggregated oligonucleotide has the nucleic acid sequence G10 GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1), and the aggregated oligonucleotide consists exclusively of phosphodiester-linked deoxynucleotides.

[0125] In a further aspect, the present invention provides a process for producing a composition comprising (i) virus-like particles, wherein the virus-like particles are virus-like particles of an RNA bacteriophage, and (ii) aggregated oligonucleotides, wherein the aggregated oligonucleotides are packaged within the virus, the process comprising: (a) producing a mixture comprising (i) coat proteins of the RNA bacteriophage, (ii) an agent capable of preventing self-assembly of the coat proteins, and (iii) aggregated oligonucleotides, wherein the aggregated oligonucleotides comprise oligonucleotides comprising at least one poly-G stretch and have an average diameter of 6 to 16 nm, wherein the average diameter is determined by dynamic light scattering (DLS); (b) removing the agent from the mixture; and (c) allowing the coat proteins to self-assemble into virus-like particles and package the aggregated oligonucleotides.

[0126] In yet a further aspect, the present invention provides a process for producing a composition comprising (i) virus-like particles, wherein the virus-like particles are virus-like particles of an RNA bacteriophage, and (ii) aggregated oligonucleotides, wherein the aggregated oligonucleotides are packaged within the virus, the process comprising: (a) producing a mixture comprising (i) coat proteins of the RNA bacteriophage, (ii) an agent capable of preventing self-assembly of the coat proteins, and (iii) aggregated oligonucleotides, wherein the aggregated oligonucleotides comprise oligonucleotides comprising at least one poly-G stretch, and are obtainable by the process described in the first aspect of the present invention, and have an average diameter of 6 to 16 nm, wherein the average diameter is determined by dynamic light scattering (DLS); (b) removing the agent from the mixture; and (c) allowing the coat proteins to self-assemble into virus-like particles and package the aggregated oligonucleotides.

[0127] In yet a further aspect, the present invention provides a process for producing a composition comprising (i) virus-like particles, wherein the virus-like particles are virus-like particles of an RNA bacteriophage, and (ii) aggregated oligonucleotides, wherein the aggregated oligonucleotides are packaged within the virus, the process comprising: (a) producing a mixture, the mixture comprising (i) coat proteins of the RNA bacteriophage, (ii) an agent capable of preventing self-assembly of the coat proteins, and (iii) a nucleotide composition, obtainable by a process for producing a nucleotide composition comprising aggregated oligonucleotides according to the present invention, the nucleotide composition comprising the aggregated oligonucleotides, the aggregated oligonucleotides comprising oligonucleotides comprising at least one poly-G stretch and having an average diameter of 6 to 16 nm, the average diameter being determined by dynamic light scattering (DLS); (b) removing the agent from the mixture; and (c) allowing the coat proteins to self-assemble into virus-like particles and package the aggregated oligonucleotides.

[0128] During the process, the virus-like particle is formed by self-assembly of the coat proteins of the RNA bacteriophage in the presence of the aggregating oligonucleotides.

[0129] In a preferred embodiment, the aggregated oligonucleotides have an average diameter of 8 to 14 nm, preferably 9 to 14 nm, and more preferably 10 to 14 nm, as determined by dynamic light scattering (DLS).

[0130] In a further preferred embodiment, the aggregated oligonucleotides have an average diameter of 11 to 13 nm, preferably 11, 12, or 13 nm, more preferably 12 nm, wherein the average diameter is determined by dynamic light scattering (DLS).

[0131] In a further preferred embodiment, the coat protein comprises a recombinant protein or fragment thereof of an RNA bacteriophage that is capable of self-assembly.

[0132] In a further preferred embodiment, the coat protein consists of a recombinant protein of an RNA bacteriophage or a fragment thereof, capable of self-assembly.

[0133] In a further preferred embodiment, the RNA bacteriophage (a) Bacteriophage Qβ, (b) bacteriophage R17, (c) bacteriophage fr, (d) bacteriophage GA, (d) bacteriophage SP, (e) bacteriophage MS2, (f) bacteriophage M11, (g) bacteriophage MX1, (h) bacteriophage NL95, (i) bacteriophage f2, (j) bacteriophage PP7, and (k) bacteriophage AP205.

[0134] In a further preferred embodiment, the RNA bacteriophage is Qβ.

[0135] In a further preferred embodiment, the coat protein is (a) SEQ ID NO: 10 (QβCP); (b) a mixture of SEQ ID NO: 10 and SEQ ID NO: 11 (QβA1 protein); (c) SEQ ID NO: 12 (R17 coat protein); (d) SEQ ID NO: 13 (fr coat protein); (e) SEQ ID NO: 14 (GA coat protein); (f) SEQ ID NO: 15 (SP coat protein); (g) a mixture of SEQ ID NO: 15 and SEQ ID NO: 16; (h) SEQ ID NO: 17 (MS2 coat protein); (i) SEQ ID NO: 18 (M11 coat protein); (j) SEQ ID NO: 19 (MXI coat protein); (k) SEQ ID NO: 20 (NL95 coat protein); (1) SEQ ID NO: 21 (f2 coat protein), (m) SEQ ID NO: 22 (PP7 coat protein), and (n) comprises a sequence selected from the group consisting of SEQ ID NO: 23 (AP205 coat protein).

[0136] In a further preferred embodiment, the coat protein comprises the sequence of SEQ ID NO: 10 (QβCP).

[0137] In a further preferred embodiment, the coat protein comprises a mixture of SEQ ID NO: 10 and SEQ ID NO: 11 (QβA1 protein).

[0138] In a further preferred embodiment, the coat protein consists of the sequence of SEQ ID NO: 10 (QβCP).

[0139] In a further preferred embodiment, the coat protein consists of a mixture of SEQ ID NO: 10 and SEQ ID NO: 11 (QβA1 protein).

[0140] In a more preferred embodiment, the concentration of the coat protein in the mixture is 1 to 4 mg / ml, preferably 2.5 mg / ml.

[0141] In a more preferred embodiment, the concentration of the aggregated oligonucleotide in the mixture is 25 to 100 μM, preferably 62.5 μM.

[0142] In a further preferred embodiment, the molar ratio of the aggregating oligonucleotide and the coat protein in the mixture is between 0.5 and 1.2, preferably 0.7.

[0143] In a further preferred embodiment, the agent comprises a denaturing compound selected from urea and guanidinium hydrochloride.

[0144] In a further preferred embodiment, the agent comprises a modified compound, the modified compound being urea, and preferably the concentration of urea in the mixture is 0.25-7.2M, preferably 1M.

[0145] In a further preferred embodiment, the medicament further comprises a reducing agent.

[0146] In a more preferred embodiment, the reducing agent is DTT, and preferably the concentration of DTT in the mixture is 1 to 25 mM, preferably 2.5 mM.

[0147] In a further preferred embodiment, the removal of the drug from the mixture is carried out by a first buffer exchange with a first buffer, wherein the first buffer comprises sodium chloride, and preferably the concentration of the sodium chloride in the first buffer is 50-350 mM, preferably 250 mM.

[0148] In a further preferred embodiment, the first buffer exchange is performed across a membrane, the membrane comprising a molecular weight cut-off of 1-50 kD, preferably 5-30 kD, most preferably 30 kD.

[0149] In a further preferred embodiment, the process further comprises the step of contacting said virus-like particles with an oxidizing agent, preferably said oxidizing agent comprising: (a) hydrogen peroxide, preferably having a concentration of 0.25 to 50 mM, preferably 2 mM; (b) oxygen, (c) glutathione, (d) Cu 2+ , and (e)Fe 3+ is selected from the group consisting of:

[0150] In a further preferred embodiment, the oxygen as an oxidizing agent may be sterile filtered air, typically and preferably sterile filtered ambient air.

[0151] In a further preferred embodiment, the process further comprises purifying the virus-like particles, wherein said purifying comprises a second buffer exchange with a second buffer, wherein said second buffer is a pharmaceutically acceptable buffer.

[0152] In a further preferred embodiment, the second buffer exchange is carried out using a membrane, the membrane comprising a molecular weight cutoff of 50-1000 kD.

[0153] In a further preferred embodiment, the second buffer exchange is carried out using a membrane, the membrane comprising a molecular weight cutoff of 100-300 kD.

[0154] In a further preferred embodiment, the purity of the composition is at least 99.5%, preferably at least 99.6%, more preferably at least 99.7%, even more preferably at least 99.8%, and most preferably at least 99.9%, as determined by size exclusion chromatography.

[0155] In yet a further aspect, the present invention provides a composition comprising (i) a virus-like particle of an RNA bacteriophage and (ii) an aggregated oligonucleotide, wherein the aggregated oligonucleotide is packaged in the virus-like particle, the composition being obtainable by a process for producing a composition comprising (i) a virus-like particle, the virus-like particle being a virus-like particle of an RNA bacteriophage, and (ii) the aggregated oligonucleotide according to the present invention.

[0156] In yet a further aspect, the present invention provides a composition comprising: (i) virus-like particles of an RNA bacteriophage; and (ii) aggregated oligonucleotides packaged in the virus-like particles and having an average diameter of 6 to 16, preferably 7 to 14 nm, wherein the average diameter is determined by dynamic light scattering (DLS).

[0157] In a further preferred embodiment, the RNA bacteriophage is bacteriophage Qβ.

[0158] In a further preferred embodiment, said virus-like particle of RNA bacteriophage Qβ consists of a coat protein (QβCP) comprising the sequence of SEQ ID NO: 10.

[0159] In a further preferred embodiment, said virus-like particle of RNA bacteriophage Qβ consists of a coat protein (QβA1 protein) comprising a mixture of SEQ ID NO: 10 and SEQ ID NO: 11.

[0160] In a further preferred embodiment, said virus-like particle of RNA bacteriophage Qβ consists of a coat protein (QβCP) consisting of the sequence of SEQ ID NO: 10.

[0161] In a further preferred embodiment, said virus-like particle of RNA bacteriophage Qβ consists of a coat protein (QβA1 protein) consisting of a mixture of SEQ ID NO: 10 and SEQ ID NO: 11.

[0162] In a further preferred embodiment, the aggregating oligonucleotide has the nucleic acid sequence G10 GGGGGGGGGG GACGATCGTC GGGGGGGGGG (SEQ ID NO: 1).

[0163] In a further preferred embodiment, the aggregated oligonucleotide has the nucleic acid sequence G10 GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1), and the aggregated oligonucleotide consists exclusively of phosphodiester-linked deoxynucleotides.

[0164] In a further preferred embodiment, the purity of the composition is at least 99.5%, preferably at least 99.6%, more preferably at least 99.7%, even more preferably at least 99.8%, and most preferably at least 99.9%, as determined by size exclusion chromatography.

[0165] In a further preferred embodiment, the aggregated oligonucleotides have an average diameter of 6 to 16, preferably 7 to 14 nm, as determined by dynamic light scattering (DLS).

[0166] In a more preferred embodiment, the aggregated oligonucleotides have an average diameter of 8 to 14 nm, preferably 9 to 14 nm, and more preferably 10 to 14 nm, the average diameter being determined by dynamic light scattering (DLS).

[0167] In a further preferred embodiment, the aggregated oligonucleotides have an average diameter of 11 to 13 nm, preferably 11, 12, or 13 nm, more preferably 12 nm, wherein the average diameter is determined by dynamic light scattering (DLS).

[0168] In a further preferred embodiment, at least 90%, preferably at least 95%, of the aggregated oligonucleotides have a diameter of between 10.8 nm and 13.2 nm, as determined by dynamic light scattering (DLS).

[0169] In a further preferred embodiment, at least 65%, preferably at least 70%, of the aggregated oligonucleotides have a diameter of between 11.4 nm and 12.6 nm, as determined by dynamic light scattering (DLS).

[0170] In a further preferred embodiment of the composition, at least 90%, preferably at least 95%, of the aggregated oligonucleotides have a diameter of 12 nm ± 10%, i.e., 10.8 nm to 13.2 nm, as determined by dynamic light scattering (DLS).

[0171] In a further preferred embodiment of the composition, at least 65%, preferably at least 70%, of the aggregated oligonucleotides have a diameter of 12 nm ± 5%, i.e., 11.4 nm to 12.6 nm, as determined by dynamic light scattering (DLS). [Example]

[0172] The examples are intended to illustrate the present invention without limiting it. In the examples described below, all temperatures are in degrees Celsius (°C) unless otherwise specified. Reagents were purchased from commercial suppliers such as Sigma Aldrich, Boston Bioproducts, Invitrogen, and Alfa Aesar and were used without further purification unless otherwise specified. Water used in the reactions described was purified or treated to remove all contaminants and salts. Removal of inorganic ionic impurities was confirmed by measuring the conductivity of the water. Water used in this application typically and preferably has a resistivity of at least 18 MΩ·cm at 25°C. This ensures that residual inorganic impurities, such as salts, are less than 1 ppb.

[0173] The purity of the oligonucleotides, specifically oligonucleotide G10 of SEQ ID NO: 1, was determined by ion-pair reversed-phase high performance liquid chromatography (IP-RP-HPLC) or by anion-exchange high performance liquid chromatography (IEX-HPLC).

[0174] IP-RP-HPLC was performed using a 4.6 x 75 mm Waters Xbridge BEH C18, 2.5 μm column with a column temperature of 70 ± 2°C, a flow rate of 0.4 mL / min, a wavelength of 260 nm, an injection volume of 5 μL, and a run time of 40 min.

[0175] IEX-HPLC was performed using a Dionex DNAPac PA200 column of 4.0×250 mm, a column temperature of 30±2 °C, a part number 063000 column, a flow rate of 1.0 mL / min, a wavelength of 260 nm, an injection volume of 20 μL, and a run time of 45 minutes.

[0176] IP-RP-HPL.C / / G10: The sample was injected onto an oligonucleotide ion pairing column, and elution was performed using a mixed water-acetonitrile gradient modified with TEA and HFIP as the pairing buffer and detected at 260 nm. The resulting oligonucleotide G10 peak was integrated separately from the remaining peaks consisting of oligonucleotide G10 subpopulations such as G10+1n, G10-1n, G10-2n, G10-3n, >G10+1n, and <G10-3n (whereby n = deoxynucleotide).

[0177] IEX-HPLC / / G10: The sample was injected onto a strong anion exchange column and analyzed under denaturing conditions (pH≧10). Elution was performed using a mixed salt and methanol gradient and detected at 260 nm. The resulting oligonucleotide G10 peak was integrated separately from the remaining peaks consisting of oligonucleotide G10 subpopulations such as G10+1n, G10-1n, G10-2n, G10-3n, >G10+1n, and <G10-3n (whereby n = deoxynucleotide).

[0178] Example 1 Denaturation and aggregation of oligonucleotide G10 (SEQ ID NO: 1) Quantification of G10: Oligonucleotide G10 (SEQ ID NO: 1) was quantified by UV absorption at 260 nm corrected by absorption at 340 nm, and 1 A 260-340 corresponds to a concentration of 27.8 μg / ml at a path length of 1 cm.

[0179] Denaturation: (10.0 ml scale, 500 μM G10 of approximately 94% purity, as determined by reverse-phase HPLC and anion-exchange HPLC (referred to in this Examples section as high-purity G10 oligonucleotide), 1 M urea, 85°C, 20 min): 70.6 mg of G10 was weighed into a 15 ml tube. The powder was dissolved in 10.0 ml of purified water (having a resistivity of 18.2 MΩ cm at 25°C) containing 1 M urea (c = 500 μM, content of bulk powder determined spectrophotometrically before dilution). The mixture was deaggregated in a water bath at 85°C for 20 min. An aliquot was taken, immediately cooled to 0°C in an ice / water bath, removed from the ice bath, and allowed to warm to room temperature. DLS and optional size-exclusion HPLC (SEC) measurements were performed as described in Examples 3 and 4. The remaining sample was kept at 85°C for the aggregation step.

[0180] Figure 1A shows the DLS of the modified, highly pure G10 oligonucleotide obtained by the process of the present invention as a single peak. The measured average diameter of the G10 oligonucleotide of 0.90 nm indicates that the modification is complete and the monomer has been achieved. This fully modified G10 oligonucleotide ensures and enables the formation of well-controlled and defined aggregated G10 oligonucleotides within the desired range according to the present invention, as outlined below.

[0181] Aggregation (20.0 ml scale, 250 μM G10 denatured as above, 250 mM Na + Cl - 20 mM sodium phosphate (pH = 7.2), 1 M urea, 85°C, 8-30 min: 10 ml of the denatured 500 μM G10 solution at 85°C mentioned above was mixed with 10 ml of a solution of 500 mM NaCl, 40 mM sodium phosphate, and 1 M urea at 85°C in a 25 ml tube. The mixture was incubated at 85°C in a water bath for 15 min. The solution was cooled to 0°C in an ice / water bath. An aliquot was taken from it, warmed to room temperature, and DLS and optional size-exclusion HPLC (SEC) measurements were performed. The aggregated oligonucleotide solution, if stored below 20°C, was typically, and preferably, used within 3 hours.

[0182] A final filtration step was used to remove the final traces (<1%) of large particles, performed by passing the previously cooled, room temperature solution of aggregated oligonucleotides through a 50 nm filter.

[0183] Figure 1B shows DLS of the subsequently aggregated G10 oligonucleotides obtained by the process of the present invention. The highly preferred aggregated G10 oligonucleotides obtained exhibit proper aggregation and an average diameter of 12 nm. These well-controlled and defined aggregated G10 oligonucleotides within the desired preferred range according to the present invention result in highly pure packaged and well-formed VLPs, as outlined below.

[0184] Denaturation and aggregation of the highly preferred oligonucleotide G10 (SEQ ID NO: 1) was further performed at different oligonucleotide concentrations, yielding DLS data essentially identical to those shown in Figures 1A and 1B. Thus, denaturation was performed using various concentrations of oligonucleotide G10, ranging from 100 µM to 1 mM. The subsequent aggregation step was then performed using exactly half the concentration used for denaturation, for convenience, since the two solutions were mixed 1:1 as described herein.

[0185] Example 2 Denaturation and aggregation of oligonucleotides G10-11, G12-11, G6, G7, G8, G9, G11, G6-10, G7-10, G8-10, and G9-10 (SEQ ID NOs: 3-9, 24-27) Denaturation: A 500 μM solution of oligonucleotide G10-11 (SEQ ID NO: 3), G12-11 (SEQ ID NO: 4), G6 (SEQ ID NO: 5), G7 (SEQ ID NO: 6), G8 (SEQ ID NO: 7), G9 (SEQ ID NO: 8), G11 (SEQ ID NO: 9), G6-10 (SEQ ID NO: 24), G7-10 (SEQ ID NO: 25), G8-10 (SEQ ID NO: 26), or G9-10 (SEQ ID NO: 27) in 1 M urea was disaggregated in a water bath at 85° C. for 20 minutes.

[0186] Aggregation: (10.0 ml scale, 250 μM G10, 250 mM Na + 5 ml of oligonucleotides G10-11 (SEQ ID NO:3), G12-11 (SEQ ID NO:4), G6 (SEQ ID NO:5), G7 (SEQ ID NO:6), G8 (SEQ ID NO:7), G9 (SEQ ID NO:8), G11 (SEQ ID NO:9), G6-10 (SEQ ID NO:24), G7-10 (SEQ ID NO:25), G8-10 (SEQ ID NO:26), or G9-10 (SEQ ID NO:27), 5 ml of 500 mM Na phosphate, 1 M urea, 85°C, 8-30 min + A denaturing solution (85°C) of 250 µM oligonucleotides, 1 M urea, 20 mM sodium phosphate, 250 mM NaCl, and 40 mM sodium phosphate was mixed in a 15 ml tube. + ). The mixture was incubated in a water bath at 85°C for 15 minutes. The solution was cooled to 0°C in an ice / water bath, from which an aliquot was taken, warmed to room temperature, and DLS and optional size-exclusion HPLC (SEC) measurements were performed. The aggregated oligonucleotide solution, if stored below 20°C, was typically and preferably used within 3 hours.

[0187] The products of the aggregation process were analyzed by dynamic light scattering (DLS) as described in Example 3 and by size-exclusion HPLC as described in Example 4. DLS of the aggregated oligonucleotides revealed that the average diameter of all aggregated oligonucleotides was 11-13 nm, as determined by dynamic light scattering (DLS), and all within 80-110% of the PST, as determined by size-exclusion HPLC.

[0188] Example 3 Analysis of the aggregation of oligonucleotide G10 by dynamic light scattering. The particle sizes of the oligonucleotides, aggregated oligonucleotides, and VLPs packaged with the aggregated oligonucleotides according to the present invention were determined using dynamic light scattering (DLS). The preferred instrument settings used in this example for determining the particle sizes of the oligonucleotides, aggregated oligonucleotides, and VLPs packaged with the aggregated oligonucleotides according to the present invention are shown below. Equipment:Malvern Zetasizer Nano ZS Light source: He-Ne laser (633 nm (max) at 4 nW)

[0189] The center column of Table 1 represents the settings applied to the reference standard (polystyrene microparticles) and the calibration settings used to ensure proper instrument function. The right column represents the settings applied to the method used to analyze and measure oligonucleotides, aggregated oligonucleotides, and VLPs packaged with aggregated oligonucleotides. JPEG2025186230000001.jpg101170

[0190] The DLS software calculates the mean hydrodynamic radius and, by basic multiplication, determines the mean diameter of the particles: 2 x mean radius of the particles = particle diameter. For consistency, particle size will hereafter be referred to as the mean diameter (D) measured in nanometers throughout this invention. Hyd ) and use it as a

[0191] Example 4 Analysis of aggregation of oligonucleotide G10 by size-exclusion HPLC. The aggregation state of the aggregated G10 oligonucleotide was analyzed by analytical size exclusion HPLC essentially as described in WO2007 / 144150 using the following conditions: JPEG2025186230000002.jpg77170

[0192] The peak start time X% of G10 relative to Qβ capsid (relative peak start time Qβ) was calculated as follows: X% = peak start time of oligonucleotide [min] divided by retention time of Qβ capsid standard [min] × 100% (where the peak start time of the oligonucleotide was determined as the time when the oligonucleotide became detectable, and the retention time of the Qβ capsid standard was determined as the time of occurrence of the maximum peak of the standard). An example of the elution profile of oligonucleotide G10 and the capsid of bacteriophage Qβ as a standard is shown in Figure 1 of WO2007 / 144150. Based on the chromatogram shown in Figure 1 of WO2007 / 144150, a relative peak start time of 88% was calculated for the aggregated oligonucleotide.

[0193] Example 5 Comparison of modified oligonucleotide G10 obtained by the process of the present invention with modified oligonucleotide G10 obtained by a prior art process The oligonucleotide G10 of SEQ ID NO: 1 has two different purities (79% and 94%, determined by reverse-phase HPLC and anion exchange HPLC, referred to as low-purity and high-purity G10 oligonucleotide in this example section), respectively, and is subjected to disaggregation (denaturation) as described in the prior art (WO2007 / 144150).As described in Example 1 herein, the oligonucleotide G10 with the same high purity (94%) is subjected to denaturation.The impurities of the oligonucleotide G10 used are mostly "failure sequences", which means the oligonucleotide sequences with fewer G residues, whether they are 26-mer, 27-mer, 28-mer, or 29-mer.

[0194] The resulting products were analyzed by DLS as described in Example 3 and are shown in Figure 2A (low purity G10, prior art process), Figure 2B (high purity G10, prior art process), and Figure 2C (high purity G10, inventive process). The fully denatured oligonucleotide G10 monomer has a mean hydrodynamic diameter of approximately 1 nm.

[0195] Low-purity G10 subjected to the prior art denaturation process resulted in particles with an average diameter of 2.2 nm, indicating the presence of secondary structure and that not all of the oligonucleotide G10 was completely denatured to monomers (FIG. 2A). High-purity G10 subjected to the prior art denaturation process resulted in particles with an average diameter of 2.8 nm, indicating the presence of secondary structure and that not all of the oligonucleotide G10 was completely denatured to monomers (FIG. 2B). As discussed in Example 6, this incomplete denaturation results in more variable aggregated oligonucleotides and even larger aggregated oligonucleotides.

[0196] High-purity G10 subjected to the denaturation process of the present invention yielded particles with an average diameter of 0.9 nm, indicating that the oligonucleotide G10 was completely or substantially completely denatured into monomers (FIG. 2C). As shown, this fully denatured G10 oligonucleotide ensures and enables the formation of well-controlled and defined aggregates of G10 oligonucleotides within the desired range according to the present invention.

[0197] Before the aggregation step begins, complete or at least near-complete denaturation and proper denaturation of the oligonucleotides, as shown for the highly preferred oligonucleotide G10, which results in monomers, dimers, trimers, or quadruplexes of the oligonucleotides, is highly preferred and important. If secondary structures are present, the aggregation step will be more variable, and the final aggregated oligonucleotides will be larger and have a broader size distribution.

[0198] Example 6 Comparison of aggregated oligonucleotide G10 obtained by the process of the present invention with that obtained by a prior art process The G10 material obtained from the denaturation experiment described in Example 5 was subjected to aggregation as described in the prior art (WO2007 / 144150) or as described by the process of the present invention and consequently as described in Example 1 above.

[0199] The resulting aggregated oligonucleotides were analyzed by DLS as described in Example 3 herein and are shown in Figure 3A (prior art aggregation of low purity G10 modified by a prior art process), Figure 3B (prior art aggregation of high purity G10 modified by a prior art process), and Figure 3C (inventive aggregation of high purity G10 modified by a process of the present invention).

[0200] The low-purity material denatured and aggregated in the prior art process not only fell on the high side of the desired average diameter range (6-16 nm), but also resulted in 10% of the material being aggregated oligonucleotides that were too large (30-40 nm) for subsequent proper packaging into RNA bacteriophage VLPs, preferably RNA bacteriophage Qβ VLPs (Figure 3A). As a result of this larger, broader particle distribution, the final packaged VLPs are less pure by SEC and DLS, and rod-like structures are observed in electron micrographs (see Example 8 below). Note that the rod-like structures typically cannot be separated by purification by filtration but require more expensive and intensive purification by chromatography, which is highly detrimental to large-scale manufacturing, and specifically to GMP manufacturing.

[0201] All of the high-purity materials that were denatured and aggregated in the prior art processes resulted in aggregated oligonucleotides that were too large to be packaged into RNA bacteriophage VLPs, preferably RNA bacteriophage Qβ VLPs, and therefore resulted in unstable VLPs (Figure 3B). In addition, a second peak was identified at approximately 100 nm. It is noteworthy that optimization of the prior art processes using high-purity materials by reducing the aggregation time was not performed due to the fact that the subsequent heating and cooling times required were shorter than could be easily controlled either at the laboratory or manufacturing scale. The process of the present invention was indeed able to overcome this disadvantage of the prior art processes.

[0202] Thus, in contrast, the highly pure material denatured and aggregated by the process of the present invention resulted in aggregated oligonucleotides with an average diameter of 12 nm, indicating proper aggregation (Figure 3B). This well-controlled and defined aggregation of G10 oligonucleotides within the highly preferred range desired according to the present invention results in very pure, well-formed packaged VLPs.

[0203] Proper aggregation of oligonucleotides, as shown for the highly preferred oligonucleotide G10, which results in a perfect, or at least near-perfect, narrowly defined diameter size distribution, is further highly preferred and important. Controlling aggregation to result in aggregated oligonucleotides of 11-13 nm mean diameter, preferably 12 nm mean diameter, as determined by DLS as described in Example 3, can ensure and enable the achievement of highly pure packaged VLPs.

[0204] If the aggregated oligonucleotides are too large, as shown in DLS, the resulting material after the packaging step will have large impurities as shown in DLS and malformed VLPs, such as rod-shaped structures as shown in electron micrographs. If the aggregated oligonucleotides are too large, greater than 50 nm, unstable VLPs may result.

[0205] Example 7 Packaging of Q.BETA. VLPs with the Aggregating Oligonucleotide G10 by Disassembly / Reassembly. Disassembly of Qβ VLPs: 45 mg of Qβ VLPs (2.5 mg / ml as determined by Bradford assay) in PBS (20 mM phosphate, 150 mM NaCl, pH 7.5) was reduced with 10 mM DTT for 15 min at room temperature under stirring. Magnesium chloride was then added to a final concentration of 0.7 M, and incubation was continued for 15 min at room temperature under stirring, resulting in precipitation of encapsulated host cell RNA and concomitant disintegration of the VLPs. To remove the precipitated RNA from the solution, the solution was centrifuged at 4000 rpm for 10 min at 4°C (Eppendorf 5810R, fixed-angle rotor A-4-62, used in all subsequent steps). The supernatant containing the released dimeric Qβ coat protein was used for the chromatographic purification step.

[0206] In an alternative and preferred method, Q beta capsids were broken down into Q beta dimers by adding 1 M DTT to a final concentration of 10 mM DTT. Nucleic acids and host cell proteins were precipitated by increasing the NaCl concentration to 600 mM by adding 1 M sodium phosphate, 0.75 M citric acid, and adjusting the pH to pH 2.6 using the following operating parameters (P フィード =0.9, P 残余分 = 0.4 bar, and P 透過分 = 0.2 bar, resulting in a TMP of 0.45 bar) was performed in a 2 x 0.5 m 2 Precipitated nucleic acids and HCPs were removed by TFF using a Sartoflow Beta Crossflow system equipped with a Millipore Biomax 300 membrane. The material was diafiltered against three DVs of 20 mM sodium phosphate, 20 mM citric acid, 300 mM sodium chloride, pH 3.3.

[0207] Purification of Qβ coat protein by cation exchange and size exclusion chromatography: The supernatant of the degradation reaction, containing dimeric coat protein, host cell proteins, and residual host cell RNA, was loaded onto an SP-Sepharose FF column (xk16 / 20, 6 ml, Amersham Bioscience). To achieve proper binding of the coat protein to the column, the column was equilibrated with 20 mM sodium phosphate buffer (pH 7), and the sample was diluted 1:15 with water to adjust the conductivity to less than 10 mS / cm. Elution of the bound coat protein was achieved with a step gradient to 20 mM sodium phosphate / 500 mM sodium chloride, and the protein was collected in fraction volumes of approximately 25 ml. Chromatography was performed at room temperature with a flow rate of 5 ml / min during all steps, and absorbance was monitored at 260 nm and 280 nm. In the second step, the isolated Qβ coat protein (eluted fraction from the cation exchange column) was loaded onto a Sephacryl S-100HR column (xk26 / 60, 320 ml, Amersham Bioscience) equilibrated with 20 mM sodium phosphate / 250 mM sodium chloride (pH 7.2). Chromatography was performed at room temperature with a flow rate of 2.5 ml / min, and absorbance was monitored at 260 nm and 280 nm. Five-ml fractions were collected.

[0208] Characterization of purified Qβ coat protein by analytical size-exclusion chromatography: Samples of purified Qβ coat protein were analyzed by analytical size-exclusion chromatography (Figure 4C) and compared with i) intact Qβ VLPs purified from E. coli lysate and used as raw material for the purification procedure (Figure 4A), and ii) the supernatant of the degradation reaction (Figure 4B). Efficient separation of RNA molecules from coat protein is demonstrated by the absence of an RNA-like peak (typical ratio of A280 / A260 = 0.5) and the presence of a distinctive protein-like peak (typical ratio of A280 / A260 = 1.7) in Figure 4C.

[0209] In an alternative and preferred method, purification of Qβ coat protein was achieved by cation exchange chromatography and Mustang Q membranes. CEX chromatography was performed as a capture step for Qβ dimers. SP Sepharose FF resin was packed into a BPG140 column using an AKTA Ready Chromatography system and 150 mM NaCl as the loading buffer. The bed height of the packed column was 14.0 cm, corresponding to a bed volume of 2.2 L. HETP analysis yielded an asymmetry factor of 1.55 and a theoretical plate count of 2560 plates per meter. The diafiltrate from the digestion step was filtered through a Millipore Opticap XL5 capsule before loading. Chromatography was performed using the method shown in Table 2. JPEG2025186230000003.jpg100170

[0210] Filtration through Mustang Q capsules was performed to reduce endotoxins and any residual nucleic acids. The CEX pool was first filtered using a 0.2 μm Millipak 60 filter (catalog number MPGL06GH2) before filtering through a Mustang Q filter at a flow rate of 200 ml / min at 47°C. The collected flow-through from the Mustang Q filter was then passed through a second 0.2 μm Millipak 60 filter.

[0211] Assembly of QβG10 by diafiltration: Purified coat protein (in 20 mM sodium phosphate, pH 7.2, 250 mM NaCl) was mixed with water and a stock solution of urea, NaCl, DTT, and aggregated G10 oligonucleotide (prepared as described in Example 1). The volume of the mixture was 50 ml, and the final concentrations of the components were 1 mg / ml coat protein, 1.0 M urea, 250 mM NaCl, 2.5 mM DTT, and 0.24 mg / ml G10. The solution was then diafiltered at room temperature against 300 ml of 20 mM sodium phosphate, 250 mM NaCl, pH 7.2, using a 30 kDa cutoff cartridge (Pellicon XL, Millipore), an orthogonal flow rate of 10 mL / min, and a permeate flow rate of 2.5 mL / min. HO was added to a final concentration of 7 mM, and the solution was incubated at room temperature for 1 hour to induce disulfide bond formation. Next, to remove excess H2O2 and unpackaged G10 oligonucleotides from the assembled QβG10 product, the solution was diafiltered against 500 ml of 20 mM sodium phosphate, 150 mM NaCl (pH 7.2) using a 300 kDa cutoff cartridge (Pellicon XL, Millipore), an orthogonal flow rate of 10 ml / min, and a permeate flow rate of 2.5 ml / min.

[0212] Alternatively, packaging of QβVLPs with the aggregating oligonucleotide G10 obtained according to the invention can also be effected as described in Example 10 of WO2007 / 144150.

[0213] Example 8 Comparison of Qβ VLPs packaged with aggregated oligonucleotide G10 obtained by the process of the present invention and by a prior art process - DLS and EM QβVLPs were prepared as in Example 7 above, using aggregated G10 oligonucleotides prepared as described in Example 1, but also using aggregated G10 oligonucleotides prepared by the prior art process described in Example 6 above.

[0214] The aggregated oligonucleotides shown in Figure 3A, obtained by prior art aggregation of low-purity G10 denatured by a prior art process and having a broad size distribution with 10% too large for packaging when subjected to the packaging step, yielded VLPs with the DLS shown in Figure 5A and the EM shown in Figure 5B. DLS revealed a major peak (96%) with an average diameter of 28 nm, corresponding to properly formed VLPs (30 nm ± 2 nm), although an additional large particle peak was also observed. The corresponding EM shows spherical VLPs with that average diameter but also with rod-like structures much larger than the desired 30 nm VLPs.

[0215] In contrast, the highly purified material denatured and aggregated in the process of the present invention, when subjected to the packaging VLP step, resulted in packaged VLPs of one mean diameter and purely formed VLPs: DLS showed one single peak at 30 nm with no large particles (Figure 5C), and EM showed all spherical VLPs with no rod-shaped structures (Figure 5D).

[0216] Example 9 Modification steps of the process of the present invention resulting from different parameters The denaturation of oligonucleotide G10 (SEQ ID NO: 1) described in Example 1 was investigated by varying the urea concentration, denaturation time, and temperature applied for the denaturation. Bulk oligonucleotide G10 solution was obtained by dissolving G10 (94% pure) in water to a concentration of 1 mM. Urea solution was added to obtain a final denatured solution of 500 μM G10 with a urea concentration ranging from 0.1 M to 1 M. Aliquots of these samples were then incubated for 20 or 60 minutes at temperatures ranging from 25 °C to 85 °C. The samples were immediately cooled to 0 °C in an ice / water bath, removed from the ice bath, and allowed to warm to room temperature. DLS measurements were then performed as described in Example 3. Table 3 shows that successful denaturation, i.e., an average diameter of 1 nm or less, can be achieved regardless of the urea concentration, ranging from 0.2 M to 1.0 M. JPEG2025186230000004.jpg55170

Claims

1. 1. A process for producing a nucleotide composition comprising aggregated oligonucleotides, comprising: (a) providing an oligonucleotide, said oligonucleotide comprising at least one poly-G stretch; (b) denaturing the oligonucleotide, the denaturing comprising: (i) incubating an aqueous solution I comprising the oligonucleotides and a chaotropic agent at a temperature I until the average diameter of the oligonucleotides is 1 nm or less, as determined by dynamic light scattering (DLS), the temperature I being between 75°C and 99°C, and preferably the chaotropic agent being urea; (c) aggregating the oligonucleotides, wherein the aggregating comprises: (i) incubating the oligonucleotides having an average diameter of 1 nm or less obtained in step (b), aqueous solution II comprising a chaotropic agent and cations at a temperature II to form the aggregated oligonucleotides, wherein the incubation is carried out until the average diameter of the formed aggregated oligonucleotides is 6 to 16 nm, the average diameter being determined by dynamic light scattering (DLS), the temperature II being 75°C to 99°C, and preferably the chaotropic agent being urea; (ii) adjusting the temperature of the solution II to a temperature III, wherein the temperature III is less than 40°C, preferably less than 30°C; A process in which the steps are preferably performed in a given order.

2. 2. The process of claim 1, wherein aqueous solution I does not contain monovalent or divalent ions at concentrations such that the oligonucleotides spontaneously self-aggregate.

3. 3. The process according to claim 1 or 2, wherein the chaotropic agent contained in solution I is selected from urea, phenol, isopropyl alcohol, ethanol, and guanidinium chloride, preferably the chaotropic agent contained in solution I is urea.

4. 4. The process according to any one of claims 1 to 3, wherein the oligonucleotide comprises at least 3 and at most 15 guanosine entities at its 5' end and at least 3 and at most 15 guanosine entities at its 3' end, preferably at least 6 and at most 13 guanosine entities at its 3' end and at least 6 and at most 13 guanosine entities at its 3' end, more preferably at least 8 and at most 11 guanosine entities at its 3' end.

5. 5. The process according to any one of claims 1 to 4, wherein the oligonucleotide comprises 10 to 1000 nucleotides, preferably 10 to 200 nucleotides, more preferably 10 to 100 nucleotides, even more preferably 20 to 40 nucleotides, and even more preferably 30 nucleotides.

6. the oligonucleotide is (a) G10: GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1); (b) G10-11: GGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 3), (c) G12-11: GGGGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 4), (d) G6: GGGGGGGACGATCGTCGGGGGG (SEQ ID NO: 5); (e) G7: GGGGGGGGACGATCGTCGGGGGGG (SEQ ID NO: 6); (f) G8: GGGGGGGGGACGATCGTCGGGGGGGG (SEQ ID NO: 7); (g) G9: GGGGGGGGGGACGATCGTCGGGGGGGGG (SEQ ID NO: 8); (h) G11: GGGGGGGGGGGGGACGATCGTCGGGGGGGGGGGG (SEQ ID NO: 9), (i) G6-10: GGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 24), (j) G7-10: GGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 25), (k) G8-10: GGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 26), and (l) G9-10: GGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 27), 6. The process according to any one of claims 1 to 5, wherein preferably said oligonucleotide has the nucleic acid sequence G10 GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1), more preferably said oligonucleotide consists exclusively of phosphodiester linked deoxynucleotides.

7. 7. The process according to any one of claims 1 to 6, wherein the purity of the oligonucleotide, preferably the oligonucleotide of SEQ ID NO: 1, is greater than or equal to 90% as determined by HPLC, preferably by reverse phase HPLC or anion exchange HPLC, more preferably by reverse phase HPLC.

8. 8. The process according to any one of claims 1 to 7, wherein the chaotropic agent contained in solution II is selected from urea, phenol, isopropyl alcohol, ethanol, and guanidinium chloride, preferably the chaotropic agent contained in solution II is urea.

9. 9. The process of claim 1, wherein the chaotropic agent contained in Solution I and the chaotropic agent contained in Solution II are the same, and the chaotropic agent contained in Solution I and the chaotropic agent contained in Solution II are urea.

10. 10. The process of any one of claims 1 to 9, wherein the incubating is carried out until the average diameter of the aggregated oligonucleotides is between 9 and 14 nm, the average diameter being determined by dynamic light scattering (DLS).

11. 11. The process of any one of claims 1 to 10, wherein the aggregated oligonucleotides have the nucleic acid sequence GGGGGGGGGGGACGATCGTCGGGGGGGGGG (SEQ ID NO: 1) (G10), more preferably the aggregated oligonucleotides consist exclusively of phosphodiester linked deoxynucleotides.

12. 12. A nucleotide composition comprising aggregated oligonucleotides, obtainable by the process of any one of claims 1 to 11, wherein preferably said aggregated oligonucleotides have an average diameter of 6 to 16 nm, preferably 7 to 14 nm, said average diameter being determined by dynamic light scattering (DLS).

13. A nucleotide composition comprising aggregated oligonucleotides, wherein said aggregated oligonucleotides have an average diameter of 7 to 14 nm, said average diameter being determined by dynamic light scattering (DLS).

14. 14. The nucleotide composition of claim 12 or claim 13, wherein at least 90%, preferably at least 95%, of the aggregated oligonucleotides have a diameter of 10.8 nm to 13.2 nm, the diameter being determined by dynamic light scattering (DLS).

15. 15. The nucleotide composition of any one of claims 12 to 14, wherein at least 65%, preferably at least 70%, of the aggregated oligonucleotides have a diameter of 11.4 nm to 12.6 nm, the diameter being determined by dynamic light scattering (DLS).

16. 16. The nucleotide composition of any one of claims 12 to 15, wherein the aggregated oligonucleotides have the nucleic acid sequence G10 GGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 1), preferably wherein the aggregated oligonucleotides consist exclusively of phosphodiester-linked deoxynucleotides.

17. 1. A process for producing a composition comprising: (i) a virus-like particle, the virus-like particle being a virus-like particle of an RNA bacteriophage; and (ii) an aggregated oligonucleotide, the aggregated oligonucleotide packaged within the virus-like particle, the process comprising: (a) forming a mixture, said mixture comprising: (i) a coat protein of the RNA bacteriophage; (ii) an agent capable of preventing self-assembly of the coat protein; and (iii) aggregated oligonucleotides, the aggregated oligonucleotides comprising oligonucleotides comprising at least one poly-G stretch and having an average diameter of 6 to 16 nm, the average diameter being determined by dynamic light scattering (DLS); (b) removing the agent from the mixture; (c) allowing the coat proteins to self-assemble into virus-like particles and package the aggregated oligonucleotides.

18. 1. A process for producing a composition comprising: (i) a virus-like particle, the virus-like particle being a virus-like particle of an RNA bacteriophage; and (ii) an aggregated oligonucleotide, the aggregated oligonucleotide being packaged in the virus, the process comprising: (a) forming a mixture, said mixture comprising: (i) a coat protein of the RNA bacteriophage; (ii) an agent capable of preventing self-assembly of the coat protein; and (iii) aggregated oligonucleotides, comprising oligonucleotides comprising at least one poly-G stretch, obtainable by the process of any one of claims 1 to 11, and having an average diameter of 6 to 16 nm, said average diameter being determined by dynamic light scattering (DLS); (b) removing the agent from the mixture; (c) allowing the coat proteins to self-assemble into virus-like particles and package the aggregated oligonucleotides.

19. The RNA bacteriophage (a) bacteriophage Qβ, (b) bacteriophage R17, (c) bacteriophage fr, (d) bacteriophage GA; (d) bacteriophage SP, (e) bacteriophage MS2, (f) bacteriophage M11, (g) bacteriophage MX1, (h) bacteriophage NL95, (i) bacteriophage f2, (j) bacteriophage PP7, and (k) bacteriophage AP205; 19. A process according to claim 17 or claim 18, wherein preferably said RNA bacteriophage is Qβ.

20. 20. The process of any one of claims 17 to 19, wherein the purity of the composition is at least 99.5%, preferably at least 99.6%, more preferably at least 99.7%, even more preferably at least 99.8%, and most preferably at least 99.9%, as determined by size exclusion chromatography.

21. 21. A composition obtainable by the process of any one of claims 17 to 20, comprising: (i) virus-like particles of an RNA bacteriophage; and (ii) aggregated oligonucleotides, the aggregated oligonucleotides being packaged in said virus-like particles.

22. 1. A composition comprising: (i) virus-like particles of an RNA bacteriophage; and (ii) aggregated oligonucleotides packaged in said virus-like particles and having an average diameter of 6 to 16, preferably 7 to 14 nm, wherein said average diameter is determined by dynamic light scattering (DLS).

23. 23. The composition of claim 21 or claim 22, wherein the RNA bacteriophage is bacteriophage Qβ.

24. 24. The composition of any one of claims 21 to 23, wherein the aggregated oligonucleotides have the nucleic acid sequence G10 GGGGGGGGGGGGACGATCGTCGGGGGGGGGGG (SEQ ID NO: 1), and the aggregated oligonucleotides consist exclusively of phosphodiester-linked deoxynucleotides.

25. 25. The composition of any one of claims 21 to 24, wherein at least 90%, preferably at least 95%, of the aggregated oligonucleotides have a diameter of between 10.8 nm and 13.2 nm, the diameter being determined by dynamic light scattering (DLS).

26. 26. The composition of any one of claims 21 to 25, wherein at least 65%, preferably at least 70%, of the aggregated oligonucleotides have a diameter of between 11.4 nm and 12.6 nm, the diameter being determined by dynamic light scattering (DLS).

Citation Information

Patent Citations

  • Delivery to compacted nucleic acids and cells

    JP1998503469A

  • Immunostimulatory Nucleic Acid Package Particles for Treatment of Hypersensitivity

    JP2009519299A

  • A Method for Packaging Oligonucleotides into Virus-like Particles of RNA Bacteriophages

    JP2009539907A

  • Self-assembled 3D RNA cage nanoparticles

    WO2017197009A1