329results about "Bacteriophages" patented technology

The invention discloses a lytic bacteriophage vBVpaSR40Z and application of the lytic bacteriophage vBVpaSR40Z to prevention and control of vibrio parahaemolyticus in an aquaculture environment. The preservation number of the vibrio parahaemolyticus phage vBVpaSR40Z is as follows: GDMCC No: 67440-B1, and the vibrio parahaemolyticus phage vBVpaSR40Z is The R40Z can be used for cracking multiple strains of vibrio parahaemolyticus and vibrio alginolyticus, has the capability of adapting to an aquaculture environment, and keeps relatively high activity within the range of 4-25 DEG C and pH of 4-10; no virulence gene or drug-resistant gene is detected through genome analysis, and phylogenetic and whole genome comparison shows that the similarity between R40Z and a related phage is lower than a species level threshold value, so that R40Z is a new phage species; the R40Z can obviously inhibit the growth of a host under various infection complex numbers. The R40Z has the advantages of strong splitting capacity, good environmental stability, high genome safety, unique evolutionary characteristics and the like, and is an aquatic vibriosis biological prevention and control bacteriophage with application potential.

The invention discloses a lytic bacteriophage for preventing and controlling vibrio in an aquaculture environment. The bacteriophage vBValMR42H belongs to a muscle tail bacteriophage and is insensitive to chloroform, the capsid of the bacteriophage vBValMR42H is free of lipid substances, and the preservation number is GDMCC No: 67434-B1. The bacteriophage has the characteristics of high adsorption speed, short incubation period and high cracking amount, keeps high activity in a wide range of temperature (4-55 DEG C) and pH (2-11), and has strong environmental adaptability. Genome analysis shows that the bacteriophage does not contain virulence factors, antibiotic resistance genes and lyogen related genes, and is high in biological safety. Physical development analysis shows that the method can be divided into a new genus. The bacteriophage R42H has the advantages of high splitting efficiency, good environmental stability, strong specificity, gene safety and the like, and can be used as an ideal biological prevention and control agent for preventing and controlling vibrio alginolyticus diseases in aquaculture.

A bacteriophage for specifically lysing high-virulence capsular Klebsiella pneumoniae, pertaining to the field of microorganisms. The deposit number of the Klebsiella pneumoniae bacteriophage vB_kpnP_D39 is CCTCC NO: M 2024690. In the bacteriophage liquid formulation prepared on the basis of the bacteriophage, the working titer of the bacteriophage is greater than 1 × 109 PFU / mL. The bacteriophage has high specificity and can kill all high-virulence multidrug-resistant Klebsiella pneumoniae of K1, K2, and K57 capsular serotypes, with an adsorption efficiency of 99.60%. The bacteriophage exhibits a biofilm clearance rate of 47.4%-63.2% and a capsule clearance rate of 42.1%-60.6% against the high-virulence Klebsiella pneumoniae. The bacteriophage is expected to become a safe, non-toxic agent for the prevention, control, and treatment of high-virulence multidrug-resistant Klebsiella pneumoniae infections, or an antibiotic adjuvant.

The present invention relates to the technical field of phages. Provided are a KL2-type Acinetobacter baumannii phage and a screening method therefor, a phage composition and the use, and a drug. The KL2-type Acinetobacter baumannii phage is named AB_SZL2, and is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M20241522; or the KL2-type Acinetobacter baumannii phage is named AB_SZL3, and is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M20241523. The KL2-type Acinetobacter baumannii phage can accurately target KL2-type Acinetobacter baumannii, and has an efficient bactericidal effect, thereby reducing the harm of KL2-type Acinetobacter baumannii and effectively addressing the problem of the antibiotic resistance of KL2-type Acinetobacter baumannii.

The invention discloses a mycobacteriophage and application thereof, and relates to the technical field of bacteriophages. The mycobacteriophage is named as Mycobacter phage BZNK001, is preserved in Guangdong Microbial Culture Collection Center, has a preservation number of GDMCC No: 67907-B1, does not contain antibiotic drug-resistant genes and integrase genes, has excellent biological safety and good environmental tolerance, can maintain high biological activity in a temperature range of 37-50 DEG C under an acid-base condition of pH 5-9, and can be used for preparing the antibiotic drug-resistant gene and integrase gene-containing mycobacteriophage for preventing and treating the antibiotic drug-resistant gene and integrase gene-containing mycobacteriophage for preventing and treating the antibiotic drug-resistant gene and integrase gene-containing mycobacteriophage. The bacillus subtilis has broad-spectrum and high-efficiency non-tuberculous mycobacterium cracking activity, and can effectively crack four clinical key mycobacteria such as mycobacterium abscessus, mycobacterium avium, mycobacterium intracellularis and mycobacterium smegmatis. According to the invention, a mycobacteriophage resource library is enriched, a novel and stable biological prevention and control means is provided for efficient prevention and control of mycobacteria, and the mycobacteriophage has good clinical application and industrialization values.

The invention belongs to the field of veterinary biological products, and particularly relates to a chicken infectious laryngotracheitis recombinant subunit vaccine as well as a preparation method and application thereof. A core antigen of the vaccine is a recombinant gB trimer glycoprotein (gB-Trimer) modified by genetic engineering, and the protein successfully locks a prefusion conformation with the strongest immunogenicity of the gB protein through strategies of truncation, trimerization motif splicing, dual-stability mutation and the like. The vaccine prepared by the invention can stimulate rapid and lasting neutralizing antibody response, provide 100% clinical protection and effectively block replication and detoxification of the ILTV, has extremely high biological safety compared with a traditional live vaccine, completely eliminates risks of poison dispersion and enhancement, and provides a safe and efficient novel solution for prevention and control of the ILTV.

The application provides a preparation method of a functionalized phage probe and application of the functionalized phage probe in detection of escherichia coli. The functionalized phage is a recombinant phage (M13KO7@SaBP) in which streptavidin binding peptide (SaBP) is fused and expressed at the N terminal of the main capsid protein P8 protein of M13K07 phage. In the application, the gene encoding SaBP (MDVEAWLGAR) is inserted into the N terminal of the P8 protein gene of M13K07 phage by site-directed mutagenesis to prepare M13K07@SaBP. The stable signal amplification is realized by using the abundant P8 protein (about 2700) of M13 phage and the super strong binding force of biotin-streptavidin, the interference of food sample matrix is reduced by combining the magnetic separation technology, and a detection method of escherichia coli with high sensitivity and small sample matrix interference is constructed.

The present invention provides a bacteriophage having a bacteriolytic activity against Mycobacterium avium and / or Mycobacterium intracellularis, the bacteriophage having a genome containing a nucleic acid sequence represented by the genome of the bacteriophage specified by the preservation number NITE BP-03513 or NITE BP-03514 or the preservation number NITE BP-03918, the bacteriophage having a bacteriolytic activity against Mycobacterium avium and / or Mycobacterium intracellularis, and the bacteriophage having a bacteriolytic activity against Mycobacterium avium and / or Mycobacterium intracellularis. The capsid of the phage is connected with the cell-penetrating peptide through a tag.

Agricultural compositions are disclosed which comprise at least one isolated bacteriophage capable of infecting the plant pathogen Pseudomonas syringae pv. tomato, the at least one bacteriophage having a genomic nucleic acid sequence at least 85% identical to one of the nucleic acid sequence as set forth in SEQ ID NOs: 1-23. The composition comprises no more than 10 different strains of bacteriophage. Uses thereof for treating bacterial speck disease are also disclosed.

The invention relates to the technical field of bacteriophages, and particularly discloses a genetically engineered bacteriophage hydrogel for fat ablation therapy and a preparation method and application of the genetically engineered bacteriophage hydrogel for fat ablation therapy, and the genetically engineered M13 bacteriophage is formed by inserting an adipocyte targeting sequence ATS into a gene VIII of the M13 bacteriophage, a coding gene of pro-apoptotic protein Bax is integrated in a genome of the M13 bacteriophage; the nucleotide sequence of the adipocyte targeting sequence ATS is TGTAAAGGTGGCCGTGCTAAAGACTGT, the expression level of pro-apoptotic protein Bax in adipocytes of a treatment group is remarkably improved through hydrogel constructed through the M13-ATS-Bax bacteriophage, experiments prove that the constructed M13-ATS-Bax bacteriophage can be combined with the adipocytes in a targeting mode and efficiently express the Bax protein, and the expression level of the pro-apoptotic protein Bax is remarkably improved. The compound formed by the hydrogel has a remarkable effect of killing fat cells.

The invention discloses a bacteriophage capable of efficiently splitting Pseudomonas ongdamura and a composition and application thereof, the bacteriophage is Pseudomonas ongdamura bacteriophage PL1P1, the preservation number is CCTCCM20251191, the Pseudomonas ongdamura bacteriophage PL1P1 is a virulent bacteriophage separated from the nature, and the Pseudomonas ongdamura bacteriophage PL1P1 has relatively high tolerance to ultraviolet rays and pH, and can be used for efficiently splitting Pseudomonas ongdamura and Pseudomonas ongdamura and Pseudomonas ongdamura. The bacteriophage is suitable for different prevention and treatment environments and can achieve a good fresh-keeping effect on chilled meat, DNA of the bacteriophage cannot encode protein possibly causing potential health risks, the possibility of carrying lysogenic genes does not exist, the bacteriophage has high affinity and splitting capacity, the titer of 10 < 10 > PFU / mL or above can be achieved within 24 h of culture, and the bacteriophage has good application prospects. The Pseudomonas longdamura phage PL1P1 can specifically partially or completely inactivate Pseudomonas longdamura, can complete mass proliferation only by using a small amount of initial phage, and provides a high-quality phage strain source for industrial production of phage bactericides.

The application discloses a freeze-drying protective agent of Vibrio harveyi phage V-YDF132 and a preservation method thereof. The freeze-drying protective agent contains inulin, skimmed milk powder, gelatin, L-glutamic acid sodium and water. The freeze-drying protective agent is mixed with a phage V-YDF132 solution, and then the mixture is frozen to a solid state, and after being subjected to freeze-drying, a phage V-YDF132 freeze-drying powder preparation is obtained. There are various preservation methods for phages, and the best preservation method is different for different phages. The application screens and prepares different phage freeze-drying protective agents and explores the protection effect of the freeze-drying protective agents on phages after freeze-drying, so as to lay a foundation for phage preservation. The phage powder preparation prepared from the freeze-drying protective agent formula P9 and the phage V-YDF132 has low requirements on the preservation conditions and can be long-term preserved without losing biological activity.

The invention discloses a vibrio canetinii bacteriophage capable of being split across species and application, the bacteriophage is a vibrio canetinii bacteriophage CP2 which is preserved in the China Center for Type Culture Collection with the preservation number of CCTCCM20251108, and the vibrio canetinii bacteriophage CP2 is preserved in the China Center for Type Culture Collection. The vibrio cantoniensis bacteriophage CP2 is a virulent bacteriophage separated from the nature, is free of genetic modification, has high safety and strong application potential, has an optimal infection complex number of 1: 10000, has a fermentation titer of 3.5 * 10 < pfu > / mL after 12 h, can rapidly split vibrio cantoniensis, has a recognition rate of 96.7% to 180 vibrio cantoniensis strains and a splitting rate of over 96%, and can be used for preparing the vibrio cantoniensis bacteriophage CP2. The genome does not contain toxicity and bad genes, the biological safety is high, the bacteriophage is excellent in environmental adaptability, stable in activity when the pH value is 6-8, high in storage stability at 4-25 DEG C, capable of being stored for 12 months at 4 DEG C, capable of stably surviving at room temperature, tolerant to a common chemical agent povidone-iodine for aquatic products, and suitable for various breeding scenes. Meanwhile, the cracking spectrum is wide, and the cross-species capability is realized.

The present invention is directed to the field of phage therapy for the treatment and control of bacterial infections, particularly respiratory bacterial infections such as bacterial pneumonia. More specifically, the present invention is directed to novel bacteriophage strains and cocktails thereof, as well as variants thereof, and methods of using the same in the treatment and prevention of bacterial infections, including, by way of example, respiratory infections caused by Pseudomonas aeruginosa and / or Klebsiella pneumoniae. The cocktails are used as pharmaceutical compositions, alone or in further combination with other therapies, by way of example, antibiotics or other standard and non-standard therapies for respiratory infections.

It is an object of the present invention to provide a bacteriophage having lytic activity against Mycobacterium avium and / or Mycobacterium intracellulare. The present invention provides a bacteriophage having lytic activity against Mycobacterium avium and / or Mycobacterium intracellulare, wherein the genome of the bacteriophage contains the nucleic acid sequence of the genome of a bacteriophage identified by any of Accession Nos. NITE BP-03513 to NITE BP-03521.

To provide lentiviral-based vectors and related systems and methods for eukaryotic gene editing.SOLUTION: Provided are compositions, systems, and methods useful for effecting gene editing in eukaryotic cells. Compositions include plasmids that encode one or more viral fusion proteins in which one or more viral proteins are fused with an aptamer-binding protein. Compositions also include plasmids that encode a non-viral nucleic acid sequence, in which the non-viral nucleic acid sequence encodes a CRISPR system component. In some instances, the non-viral nucleic acid sequence also includes an aptamer sequence. The plasmids can be used to generate viral particles, including lentivirus-like particles that contain a viral fusion protein and a non-viral RNA sequence. Systems of producing such viral particles are provided.SELECTED DRAWING: None

Disclosed herein are nanorod productions systems (NPS) useful for the production of biological scalable functionalization-ready nanorods (BSFnano). The nanorods produced are derived from filamentous phage Ff (f1, M13 or fd). The NPS disclosed herein permits efficient biological production of non-infectious, heat-stable isomorphic proteinaceous nanorods comprising modifications allowing site-specific recombinant, chemical and enzymatic attachment of peptide and non-peptide functionalities in an orthogonal manner. Also disclosed are methods of making and using these nanorods, such as in methods of detecting target molecules.

The present invention relates to a bacteriophage composition for the treatment a plant of the Solanaceae family to protect the plants from infection caused by Clavibacter michiganensis, and more specifically Clavibacter michiganensis subsp. michiganensis, the causal agent of the disease called bacterial canker. The present invention further relates to methods for the treatment of a plant of the Solanaceae family to control Clavibacter michiganensis infection using said composition and use of the bacteriophage composition or bacteriophage for the treatment of a plant of the Solanaceae family against Clavibacter michiganensis.

The present invention provides a polypeptide as defined in one of (i) to (iii) below, as well as an antibacterial protein, an antibacterial agent, a disinfectant, a pharmaceutical composition, an antibacterial agent composition, and a disinfectant composition, each comprising the following polypeptide: (i) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1; (ii) a polypeptide comprising an amino acid sequence in which one or more amino acid residues are deleted, substituted, inserted, and / or added in the amino acid sequence represented by SEQ ID NO: 1; or (iii) a polypeptide comprising an amino acid sequence having sequence identity of 80% or higher with the amino acid sequence represented by SEQ ID NO: 1.

The invention discloses an enterococcus faecalis bacteriophage vBEfaPFA2, a bacteriophage composition and application of the enterococcus faecalis bacteriophage vBEfaPFA2, the enterococcus faecalis bacteriophage vBEfaPFA2 has a specific lysis effect on enterococcus faecalis and also has a cross-species lysis effect on salmonella, the acid-base adaptability of the bacteriophage is high, and the bacteriophage vBEfaPFA2 and the bacteriophage composition can be used for preparing the enterococcus faecalis bacteriophage The enterococcus faecalis bacteriophage can be used as an active component to be prepared into the bacteriophage composition or the bacteriophage pharmaceutical preparation, the bacteriophage composition or the bacteriophage pharmaceutical preparation is applied to preparation of a medicine or a bacteriostatic agent for preventing and treating enterococcus faecalis and salmonella infection, the enterococcus faecalis bacteriophage and the bacteriophage composition are safe to use, high in yield and easy to industrially produce, and due to the cross-species lysis performance, the bacteriophage can be The method has the advantages of wide splitting spectrum, wide application range and good application prospect.

The application discloses a lytic bacteriophage vB_VpaS_R40Z and application thereof in preventing and controlling Vibrio parahaemolyticus in aquaculture environment. The Vibrio parahaemolyticus bacteriophage vB_VpaS_R40Z has a preservation number of GDMCC No: 67440-B1. The R40Z can lyse multiple strains of Vibrio parahaemolyticus and Vibrio alginolyticus, and has the ability to adapt to the aquaculture environment, and remains high activity within the range of 4-25 DEG C and pH 4-10; genome analysis does not detect virulence genes or drug resistance genes; phylogenetic comparison with the whole genome shows that the similarity of R40Z with the related bacteriophage is lower than the species level threshold, and R40Z is a new bacteriophage species; R40Z can significantly inhibit the growth of the host under multiple infection multiplicities. R40Z has the advantages of strong lytic ability, good environmental stability, high genome safety and unique evolutionary characteristics, and is a water product vibrio disease biological prevention and control bacteriophage with application potential.

The invention discloses a salmonella virulent bacteriophage vBSalPNW15 and application thereof, the bacteriophage is separated from farm sewage, belongs to a long-tail bacteriophage family, has a regular icosahedron head and a long-tail structure, and keeps stable under the conditions that the pH is 4-13 and the temperature is 40-60 DEG C. Genomic analysis shows that the kit does not contain virulence genes and drug-resistant genes and is good in safety. The bacteriophage and cinnamyl aldehyde are combined to be used for preventing and treating salmonella infection, both the bacteriophage and cinnamyl aldehyde show a remarkable synergistic bacteriostatic effect (FICI = 0.5) in vitro and in vivo, and the bacteriophage and cinnamyl aldehyde can effectively inhibit growth of multi-drug-resistant salmonella, remove biological membranes, relieve tissue pathological damage and remarkably improve the survival rate of chicks. The invention provides a safe and efficient antibiotic replacement scheme for preventing and treating salmonella infection, and is suitable for the fields of livestock and poultry breeding and food safety.

The invention relates to an immune system humanized mouse biological system for preparing a fully humanized monoclonal antibody and a method for preparing the fully humanized monoclonal antibody. The method comprises the following steps: using a constructed immune system humanized mouse and a VLP chimeric antigen; the HSC immune system humanized mouse is an immunodeficient mouse transplanted with human immune cells, the human immune cells are reconstructed, and antigen-specific B cells and fully humanized antibodies can be generated in the immune system humanized mouse by using a VLP chimeric antigen without firstly activating DC and antigen-specific T cells. In addition, by coupling a VLP antigen and a target antigen, a specific B cell and a fully human antibody of any target can be generated.

Described in certain example embodiments herein are engineered phages comprising one or more heterologous genes that encode one or more heterologous gene products and methods of using the engineered phages to deliver one or more heterologous gene products to a subject.

Described herein are split recombinases having inducible recombinase activity and polynucleic acid molecules encoding the same. Also described herein are kits and host cells comprising the split recombinases, as well as methods of their use.

The invention relates to the technical field of biology, and aims to provide an M13 recombinant bacteriophage with PRRSV broad-spectrum neutralizing activity for displaying NPC and application of the M13 recombinant bacteriophage. A nano antibody-CD163 peptide fragment conjugate NPC shown as SEQ ID NO: 1 is displayed on the surface of the N end of capsid protein III of the M13 recombinant phage, 1-3 NPC molecules are contained on the surface of each phage particle, and the phage is used for neutralizing PRRSV (Porcine Reproductive and Respiratory Syndrome Virus). The recombinant bacteriophage provided by the invention is easy to prepare, extremely high in virus titer and excellent in thermal and pH stability; in Marc-145 and PAMs cells, the compound shows strong neutralizing activity on PRRSV II type 1, 3, 5 and 8 pedigree, so that the compound has broad-spectrum neutralizing capacity; the compound can be used as a PRRSV prevention and control preparation, and a new thought is provided for development of safe and efficient novel antiviral drugs or biological preparations.

Embodiments of the present disclosure provide novel compositions and methods for making and using thermostable agent-containing lipid-emulsion formulations. In certain embodiments, compositions and methods are disclosed for adapting lipid nanoemulsions of agent-containing formulations having improved stability and / or retaining or enhancing immunogenicity. In other embodiments, agent-containing lipid-nanoemulsion formulations can be spray-dried and further embedded within glassy matrices or microparticles to improve stability and compatibility with other agents by limiting molecular mobility. In other embodiments, these microparticles harboring essentially dried stabilized agent-containing lipid-emulsion formulations can be coated by one or more coating layer to produce stabilized lipid nanoemulsions of agent-containing formulations. In some embodiments, the coating layer is applied by atomic layer deposition (ALD) and the coating layers include a metalloorganic material.

A method for preparing a bacteriophage targeting extra-intestinal pathogenic Escherichia coli (ExPEC) comprising mixing pig (porcine) extraintestinal E. coli host cells at logarithmic phase with phage

The invention relates to the technical field of microorganisms, in particular to a riemerella anatipestifer bacteriophage as well as a composition and application thereof. The strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) on November 29, 2023, and the preservation number is CGMCC No.45785. The invention further discloses a preparation method of the strain. A composition comprises the bacteriophage and a riemerella anatipestifer inactivated vaccine. The invention discloses a method for quickly establishing immune protection on riemerella anatipestifer in a duck group. An effective amount of the composition is applied to the duck group in need. According to the invention, the specific bacteriophage RDP-RA-22010 and the inactivated vaccine are synergistically compounded, so that the conventional cognition of an immune blank period is broken through. The composition can provide the challenge protection rate up to 90% in the third day after inoculation, while the protection rate of a common vaccine group in the same period is only 40%. And the effective protection time is shortened to 3 days from the traditional 7-14 days. The pathogen inhibition effect and the animal protection rate of the vaccine are far better than the sum of the effects of a phage or a vaccine which are independently used, and reach 1 + 1gt; and 2, synergistic effect.

Compositions and methods of glycosylated virus-like particles (VLPs) displaying user-defined antigens and optionally encapsidating TLR ligands for targeting dendritic cell lectins have been developed. The VLPs employ ligands for a DC lectin e.g., DC-SIGN to activate dendritic cells (DC) and drive proliferation of antigen-specific CD8 and CD4-T cells specific for a user-defined antigen, such as a tumor antigens. In some forms, the compositions include aryl-mannose ligands to effectively generate DC-mediated TH-1 T cell responses to the user-defined antigen.