Cell penetrating peptide phage-de and its application in antibiosis

Abstract

The application belongs to the field of medicine, and particularly relates to a cell penetrating peptide Phage-Dec and application thereof in antibiosis. The cell penetrating peptide Phage-Dec has excellent cell penetration ability and antibacterial activity, can effectively penetrate the cell membrane, target and inhibit bacterial growth, and thus achieves the purpose of antibiosis. Research shows that Phage-Dec has a significant inhibitory effect on various pathogenic bacteria, and can effectively reduce the reproduction speed of bacteria. The use of the cell penetrating peptide provides a new idea for antibacterial treatment, has a good clinical application prospect, and lays a solid foundation for developing a new antibacterial drug based on a bacteriophage source.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to a phage-derived cell-penetrating peptide Phage-Dec and its application in antibacterial treatment. Background Art

[0002] Cell-penetrating peptides (CPPs) are a class of short peptides that can effectively penetrate cell membranes and transport bioactive molecules such as endogenous macromolecules (such as proteins, DNA, and RNA). These peptides are typically composed of 10 to 30 amino acids and have strong cationic and hydrophilic properties, enabling them to interact with cell membranes. However, existing CPPs still have certain limitations in terms of selectivity and efficiency, which has promoted the development of new cell-penetrating peptides.

[0003] In recent years, bacteriophages have attracted widespread attention as excellent natural delivery vehicles. Phages can infect bacteria and proliferate within their cells. Different phages possess diverse surface proteins that facilitate their binding to and entry into bacterial membranes. These properties make phages an excellent source for the development of novel cell-penetrating peptides. Phage display technology allows researchers to screen for peptides with excellent penetrating properties. For example, high-throughput screening methods can be used to screen a series of small peptides and evaluate their differences in cell membrane penetration. Leveraging these unique properties, scientists can design systems for the effective delivery of drugs, genetic material, or other bioactive molecules, overcoming many of the drawbacks of traditional drug delivery systems, such as poor biocompatibility and inadequate targeting. Furthermore, phage-derived cell-penetrating peptides exhibit selectivity and targeting, and their affinity for specific cell types can be enhanced by modifying their sequence or structure. This property holds potential for applications in precision medicine, gene therapy, and the development of anti-infective drugs. Phages not only serve as therapeutic delivery vehicles but also, through their high affinity and specificity, increase the flexibility of targeted drug delivery strategies.

[0004] Because Gram-negative bacteria have an outer cell membrane, phage lytic enzymes have difficulty penetrating the outer cell membrane and contacting the peptidoglycan layer, and therefore cannot perform their lytic function. Therefore, there are currently few studies on phage lytic enzymes targeting Gram-negative bacteria, and most phage lytic enzymes are derived from land. The ocean, as the largest living organism on Earth, has a much larger bacterial population than land. Therefore, the development and application of new cell-penetrating peptides derived from marine phages provides new ideas and technical means for research in multiple fields such as drug delivery, gene therapy, and cell engineering. Currently, in-depth research on these peptides is still ongoing, in order to achieve more efficient and targeted biotherapy strategies and promote the development of biomedicine. Summary of the Invention

[0005] This invention addresses the shortcomings of existing technologies by providing a marine phage-derived cell-penetrating peptide, Phage-Dec, and its application in antibacterial applications. This approach overcomes the shortcomings of existing cell-penetrating peptides in terms of efficiency, selectivity, and stability. It also lays a technical foundation for the development and application of this peptide in pharmaceuticals, food, health products, and functional supplements for the prevention or treatment of Gram-negative bacterial infections.

[0006] In view of the deficiencies in the prior art, the present invention provides a marine phage-derived cell-penetrating peptide Phage-Dec.

[0007] Another object of the present invention is to provide a method for preparing the cell-penetrating peptide.

[0008] Another object of the present invention is to provide uses of the cell-penetrating peptide.

[0009] The object of the present invention is achieved by the following technical solution: a marine-derived phage cell-penetrating peptide named Phage-Dec, whose amino acid sequence is shown in SEQ ID NO. 1. Its amino acid sequence is only 77.78% similar to the reported amino acid sequence, and is a novel peptide with a novel sequence.

[0010] SEQ ID NO.1: KAKKRRQRRRPPFSSSSNNNNLQK.

[0011] A gene encoding the above-mentioned marine phage-derived cell-penetrating peptide, whose nucleotide sequence is as SEQ ID NO.2.

[0012] SEQ ID NO.2:

[0013] AAAGCGAAAAAACGCCGCCAGCCGCCGCCGCCCGCCGTTTAGCAGCAGCAACAACAACAACCTGCAGAAA.

[0014] An expression vector containing the above-mentioned encoding gene. An engineered yeast expression system, the genome of which contains the above-mentioned encoding gene; preferably, the cells of which contain the above-mentioned expression vector.

[0015] Application of the above-mentioned marine phage-derived cell-penetrating peptide in inhibiting bacteria.

[0016] The bacteria include at least one of E. coli and S. typhi.

[0017] Application of the above cell-penetrating peptide in the preparation of antibacterial products.

[0018] An antimicrobial agent comprising the above-mentioned cell-penetrating peptide.

[0019] Beneficial effects:

[0020] The present invention has the following advantages and effects compared to the prior art:

[0021] (1) The present invention addresses the problem that there is currently little research on phage-derived cell-penetrating peptides for Gram-negative bacteria. The present invention successfully heterologously expresses a cell-penetrating peptide Phage-Dec derived from a marine phage and uses it to act on Gram-negative bacteria.

[0022] (2) The cell-penetrating peptide Phage-Dec in the present invention is less likely to induce bacterial resistance, has a lower effective concentration, can be applied in daily life scenarios, and has broad industrial application prospects.

[0023] (3) The cell-penetrating peptide Phage-Dec prepared by the present invention can be compounded with an outer membrane permeabilizer to enhance its antibacterial effect and effectively kill Escherichia coli on various surfaces, thus having wide application value in the preparation of antibacterial products. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0025] Figure 1 It is the cytotoxicity graph of Phage-Dec.

[0026] Figure 2 It is a graph of the cell penetration ability of Phage-Dec.

[0027] Figure 3 It is the antibacterial (S. typhimurium 14028) activity of Phage-Dec.

[0028] Figure 4 It is the antibacterial (S. aureus 29213) activity of Phage-Dec.

[0029] Figure 5 It is the secondary structure of Phage-Dec. DETAILED DESCRIPTION

[0030] The following is a detailed description of an embodiment of the present invention. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process. However, the protection scope of the present invention is not limited to the following embodiment.

[0031] Materials and reagents: Plasmid pPICZαA-Phage-Dec was synthesized by Sangon Biotech (Shanghai) Co., Ltd.; empty plasmid pPICZαA was stored in this laboratory; plasmid extraction kit was purchased from Sangon Biotech (Shanghai) Co., Ltd.; all chemical reagents used in the following examples were purchased from regular chemical reagent suppliers and were of analytical grade.

[0032] Example 1 Components of Phage-Dec Recombinant Expression Vector

[0033] The cell-penetrating peptide gene, Phage-Dec, is derived from the marine bacteriophage M-PHM1SY-11 and was obtained by PCR amplification of conserved fragments within the conserved region and reverse PCR amplification. The cell-penetrating peptide gene comprises a 69-base sequence encoding a 23-amino acid sequence. Using the Basic Local Alignment Search Tool (Blast) from the National Center for Biotechnology Information (NCBI), the amino acid sequence showed only 77.78% similarity to previously reported amino acid sequences, indicating a novel peptide with a novel sequence.

[0034] The nucleotides used for the subsequent recombinant expression of the cell-penetrating peptide Phage-Dec of the present invention are fully synthesized products from BGI. The sequence of Phage-Dec is modified with restriction endonuclease, EcoR I and Xba I sites, and the recombinant primers are designed as follows (underlined are restriction endonuclease sites, italics are restriction endonuclease protection bases):

[0035] Forward primer: SEQ ID NO.3: Phage-Dec-F:

[0036] 5'-GAATTCAAAGCGAAAAAACGCC-3'-3'(EcoR I)

[0037] Reverse primer: SEQ ID NO.4: Phage-Dec-R:

[0038] 5'-TCTAGATTCTGCAGAAAACCTG-3'(Xba I)

[0039] PCR amplification conditions were as follows: pre-denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 59°C for 30 s, and extension at 72°C for 1 min, followed by extension at 72°C for 5 min, and stabilization at 4°C for 15 min. Primerstar HS DNA polymerase was purchased from Dalian Takara Biotechnology Co., Ltd.

[0040] The PCR product was double-digested with the restriction endonucleases EcoR I and Xba I, and the digested PCR product was recovered by agarose gel electrophoresis. pPICZαA plasmid DNA (Invitrogen, USA) was also double-digested with the restriction endonucleases EcoR I and Xba I, and the digested product fragments were recovered by agarose gel electrophoresis. The enzymes used for the digestion and the substrate reaction system (temperature, time, DNA dosage, etc.) were all performed according to the product instructions provided by Dalian Takara Biotechnology.

[0041] The double-enzyme-digested PCR product and the pPICZαA plasmid vector were ligated according to the instructions for DNA ligase (Dalian Takara Biotechnology Co., Ltd.). The ligation product was then transformed into Pichia pastoris X33 (Invitrogen, USA). The resulting recombinant plasmid pPICZαA-phage-Dec was linearized with Sac I. >5 μg of the linearized recombinant plasmid was mixed with 80 μL of competent Pichia pastoris X33 and transferred to an electroporation cuvette with a 0.2 cm slit. The cells were electroporated on ice for 5 minutes at 2500 V, 25 μF, and 200 Ω. Immediately after electroporation, 1 mL of 1 M sorbitol solution was added, and the cells were transferred to a 1.5 mL centrifuge tube and incubated at 30°C for 2 hours. 400 μL of the transformation product was spread onto YPD solid medium (containing 100 μg / mL Zeocin) and incubated at 30°C for 2 days until single colonies appeared. Then, PCR identification of Pichia pastoris transformants was performed. A single transformant colony was picked and inoculated into 10 mL of YPD culture medium. The culture was cultured at 30°C until the culture medium was saturated. Yeast DNA was extracted using a yeast genomic DNA rapid extraction kit and then sequenced for identification.

[0042] Example 2 Expression and purification of Phage-Dec

[0043] The recombinant Pichia pastoris single colony was inoculated into 10 mL YPD (containing 100 μg / mL Zeocin) liquid medium, cultured at 30°C, 200 rpm for 24 h, and then inoculated into 200 mL BMGY medium, cultured at 30°C, 200 rpm for 24 h, and the OD 600 Reach 5.0. Centrifuge at 3000g for 10 minutes at room temperature, discard the supernatant, wash the cells three times with sterile water to remove excess glycerol, and resuspend the cells in 100 mL of BMMY medium. Transfer the cells to a sterile 500 mL Erlenmeyer flask and induce expression with 0.5% methanol at 28°C and 200 rpm for 72 hours. Collect the supernatant and pellet for subsequent determination of the expression site.

[0044] The supernatant fermentation broth was frozen at -80°C for 16 hours and then freeze-dried at -50°C for 4 days in a vacuum freeze dryer. The concentrate was reconstituted with 20 mL of the binding buffer from the nickel column purification kit and the cell-penetrating peptide protein was purified according to the nickel column purification kit instructions. The bacterial pellet was reconstituted with 15 mL of binding buffer and 200 μL of PMSF was added to prevent degradation and damage of the exogenous protein. The pellet was incubated on ice for 20 minutes and sonicated for 25 minutes at 450W with 10-second intervals. The pellet was centrifuged at 3000 g for 10 minutes at 4°C, and the supernatant was collected and purified on a nickel column. The expression of the obtained cell-penetrating peptide protein was verified by Tricine-SDS-PAGE. Due to the limited yield and low concentration of the periplasmic cell-penetrating peptide expressed in the bacterial pellet, considering that expression in the fermentation supernatant is more conducive to obtaining high-concentration cell-penetrating peptides for future practical applications, the pPICZαA-phage-Dec cell-penetrating peptide was expressed in the fermentation supernatant of Pichia pastoris X33 for subsequent development and utilization. After nickel column purification, the cell-penetrating peptide protein concentration was determined using the Bradford assay, yielding 2.58 mg / mL of pPICZαA-phage-Dec cell-penetrating peptide protein. The molecular weight was determined using LCMS before further purification. Finally, the peptide was separated and purified using HPLC, followed by lyophilization, yielding a peptide with a purity of >95%.

[0045] Purification conditions: stationary phase: C18; mobile phase configuration: Pump A: V(tfa) / V(water) = 1 / 1000; Pump B: V(TFA) / v(acetonitrile) = 1 / 1000; flow rate: 10 mL / min; retention time: between 20-30 min.

[0046] Example 3 Determination of antibacterial activity of cell-penetrating peptides

[0047] The minimum inhibitory concentration of the peptide was determined using the standard microbroth dilution method. The bacteria were cultured overnight in MHB medium at 37°C and 220 rpm, and then the bacterial solution was transferred to new MHB medium and cultured until the logarithmic growth phase of the bacteria. Finally, the bacteria were diluted to 2x10 5 CFU / mL. 50 μL of peptide and suspension at a final concentration of 1-64 μM was added to each well of a 96-well plate. In addition, only MHB medium was used as a negative control, and only bacteria and MHB medium were used as a positive control. The 96-well plate was placed in a 37°C constant temperature incubator for 18 hours, and the plate was read at 492 nm (OD 492 The absorbance was measured at 4°C (0.5°F) to determine the minimum inhibitory concentration (MIC). Three independent replicates were performed, each with two replicates. The results are shown in Table 1.

[0048] Table 1 Minimum inhibitory concentration (μM) of the cell-penetrating peptide Phage-Dec.

[0049]

[0050]

[0051] As can be seen from Table 1, the cell penetrating peptide Phage-Dec exhibited strong antibacterial activity against a variety of bacteria, including Salmonella typhimurium, Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus, with minimum inhibitory concentrations between 2.3 and 8.5 μM.

[0052] Example 4 Determination of cytotoxicity of cell-penetrating peptides

[0053] Mouse macrophage RAW 264.7 cells were diluted to 4 × 10 5 cells / mL, 50 μL / well cell suspension was added to the 96-well plate, and culture was continued overnight in a 37°C cell culture incubator containing 5% CO2 until the cells were completely attached and grew. 50 μL of a polypeptide with a concentration of 64-0.125 μM was added to a new 96-well plate, 50 μL of cell culture medium was used as a positive control, and 100 μL of cell culture medium alone was used as a negative control. The liquid in each well of the above 96-well plate was transferred to the corresponding well of the 96-well plate containing cells, and cultured in a 37°C cell culture incubator containing 5% CO2 for 4 hours. Subsequently, 25 μL of MTT with a concentration of 0.5 mg / mL was added to each well of the 96-well plate, and culture was continued for 3 hours in a 37°C cell culture incubator containing 5% CO2. Finally, the supernatant was discarded, 150 μL of DMSO was added to each well to dissolve the formazan crystals, and the plate was marked with a microplate reader at a wavelength of 570 nm (OD 570 ) was used to measure the absorbance. The experiment was repeated 3 times independently. The cell viability was calculated as follows: Cell viability (%) = [(sample OD 570 -Negative control OD 570 ) / (positive control OD 570 -Negative control OD 570 )]×100%.

[0054] Figure 1 The cytotoxicity of the cell penetrating peptide Phage-Dec on mouse macrophages RAW 264.7 was studied. In the concentration range of 0.125-16 μM, the cell penetrating peptide Phage-Dec had little effect on the survival rate of mouse macrophages and still remained above 80%, indicating that the cell penetrating peptide Phage-Dec has good biocompatibility.

[0055] Example 5 Determination of cell penetration ability of cell-penetrating peptides

[0056] Mouse macrophage RAW 264.7 cells were diluted to 2 × 10 5cells / mL, 1 mL of cell suspension was added to a 24-well plate and cultured overnight in a 37°C cell culture incubator containing 5% CO2 until the cells were fully attached. FITC-labeled cell-penetrating peptide Phage-Dec was added and the cells were cultured for another 2 h in a 37°C cell culture incubator containing 5% CO2. 0.4% trypan blue was added for 3 min to quench extracellular fluorescence. The cells were then washed 2-3 times with PBS, collected, and analyzed by flow cytometry.

[0057] Figure 2 The cell penetrating ability of the cell penetrating peptide is shown in Figure 3. At a concentration of 16 μM, the cell penetrating peptide Phage-Dec can penetrate into more than 79% of mouse macrophages, indicating that it has efficient cell penetrating ability.

[0058] Example 6 Determination of intracellular bactericidal activity of cell-penetrating peptides

[0059] Mouse macrophage RAW 264.7 cells were diluted to 2 × 10 5 cells / mL, 1 mL of cell suspension was added to a 24-well plate and cultured overnight in a 37°C cell culture incubator with 5% CO2 until the cells were fully attached. S. typhimurium 14028 or S. aureus 29213 was cultured overnight in MHB medium at 37°C and 220 rpm. The culture suspension was then transferred to fresh MHB medium and cultured until the bacteria reached the logarithmic growth phase. S. typhimurium 14028 or S. aureus 29213 was added to the 24-well plate containing cells and infected at 37°C for 1 hour (cell:bacteria = 1:10). Gentamycin at 100 μg / mL was then added and cultured at 37°C for another hour to completely eliminate extracellular bacteria. After rinsing with PBS, various concentrations of cell-penetrating peptide were added, while a control was treated with PBS and cultured at 37°C for another 4 hours. After washing with PBS, the cells were lysed with 0.25% Triton X-100 for 15 min, spread on MHA plates after dilution, and counted after incubation at 37°C overnight.

[0060] Figure 3 and Figure 4 The intracellular antibacterial activity of the cell-penetrating peptide Phage-Dec was shown. The killing rate of 16 μM Phage-Dec against Salmonella typhimurium and Staphylococcus aureus in mouse macrophages was above 85%, indicating that it has excellent anti-intracellular bacterial activity.

[0061] Example 7 Bioinformatics Analysis

[0062] The primary amino acid structure of the Phage-Dec peptide was analyzed using specialized protein bioinformatics websites (such as http: / / expasy.org, https: / / predictprotein.org / , and https: / / swissmodel.expasy.org / ). Its lipophilicity index (Aliphatic Index) was 108.45, and its average hydrophilicity (GRAVY) was 0.67, indicating that Phage-Dec is a hydrophobic antimicrobial peptide. A high Aliphatic Index indicates that the peptide is able to interact with lipids to a certain extent, facilitating its binding to bacterial membranes.

[0063] According to the sequence characteristics, Phage-Dec contains more α-helical structures (such as Figure 5 ), a structure commonly found in antimicrobial peptides due to their ability to form pores on the cell membrane surface, disrupting bacterial membrane integrity. In addition, some random coil regions are present, and the diversity of these structures contributes to the peptide's broad-spectrum antimicrobial activity against diverse bacteria. Analysis using appropriate structure prediction tools revealed that the three-dimensional structure of Phage-Dec is primarily α-helical. This structure not only facilitates the interaction of its hydrophobic surface with the hydrophobic interactions of phospholipids, but also potentially allows for interactions with specific components of the bacterial membrane through a specific spatial conformation.

[0064] Furthermore, based on the amino acid composition of KPhage-Dec, analysis revealed that the total negative charge of its Asp+Glu group is 1, and the total positive charge of its Arg+Lys group is 5. Therefore, Phage-Dec is an antimicrobial peptide with a significant positive charge overall. The cationic nature of the peptide helps enhance its antimicrobial activity, as cationic antimicrobial peptides can bind to the negatively charged outer membrane of bacteria through electrostatic attraction, leading to cell membrane disruption. In summary, the cationic nature and hydrophobicity of Phage-Dec give it great potential for antimicrobial activity. This property allows it to effectively target bacterial surfaces, enhancing its bactericidal effect and thus exhibiting good antimicrobial activity.

[0065] In summary, the cell-penetrating peptide Phage-Dec has strong antibacterial activity against common intracellular bacteria such as Salmonella typhimurium, Listeria monocytogenes, and Staphylococcus aureus. It can efficiently penetrate macrophages and has excellent bactericidal effects on intracellular Salmonella and Staphylococcus aureus. It has low toxicity to macrophages and kills bacteria by destroying the bacterial membrane, and has extremely high application potential.

Claims

1. A cell-penetrating peptide, named Phage-Dec, whose amino acid sequence is shown in SEQ ID NO.

1.

2. Use of the cell-penetrating peptide Phage-Dec according to claim 1 in the preparation of antibacterial drugs.

3. The use according to claim 2, characterized in that: The bacteria include E. coli and S .typhi At least one of .

4. Use of the cell-penetrating peptide according to claim 1 in the preparation of antibacterial products.

Images