A polymyxin-resistant, extended-spectrum β-lactamase-producing Escherichia coli EC382-2-2 and its application
By providing Escherichia coli EC382-2-2 strain as a model strain, the problem of screening multidrug-resistant strains was solved, enabling efficient screening and identification of multiple antibiotics and providing new treatment methods.
Patent Information
- Application Number
- CN202211406804.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-10
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2042-11-10
AI Technical Summary
With the widespread use of antibiotics in animal husbandry and clinical practice, the drug resistance of Escherichia coli and Escherichia coli O157 has been increasing year by year. Multidrug-resistant strains are spreading in animals, food and the environment, which limits the therapeutic effect of existing antibiotics. In particular, the spread of plasmid-mediated mcr-1 gene and extended-spectrum β-lactamase ESBLs genes has increased the difficulty of disease treatment.
A strain of Escherichia coli EC382-2-2 is provided, which carries 18 drug resistance genes and 1 virulence gene. It is used as a model strain for screening novel antimicrobial drugs, functional microorganisms, drugs and preparations that inhibit multiple antibiotics, and is identified by PCR amplification using specific primers.
Escherichia coli EC382-2-2 strain can serve as a model strain for screening novel antimicrobial drugs. It can efficiently screen strains resistant to multiple antibiotics, providing new treatment options, especially for high-level resistance to polymyxins and third-generation cephalosporins, and has promising application prospects.
Smart Images

Figure CN115725462B_ABST
Abstract
Description
Technical fields:
[0001] This invention relates to the field of drug-resistant pathogens, and more particularly to a polymyxin-resistant, extended-spectrum β-lactamase-producing Escherichia coli EC382-2-2 and its applications. Background technology:
[0002] Escherichia coli O157 is an important zoonotic pathogen that can cause diarrhea, hemorrhagic enteritis, and hemolytic uremic syndrome in humans and animals, posing a serious threat to food safety and human health. E. coli O157 includes several H serotypes, among which O157:H7 is the most studied serotype both domestically and internationally, exhibiting a high mortality rate. Besides O157:H7, several other H serotypes have been reported in recent years to be associated with serious human infections, such as O157:H45, O157:H26, O157:H2, and O157:H16. Consuming meat and vegetables contaminated with E. coli O157 is a major cause of food poisoning. Currently, E. coli O157 remains a key pathogen that is being tracked and monitored worldwide.
[0003] Antibiotics play a certain auxiliary role in the treatment of Escherichia coli (including Escherichia coli O157) infections. However, with the widespread / overuse of antibiotics in livestock farming and clinical practice, drug resistance in E. coli and E. coli O157 is increasing year by year, and multidrug-resistant strains are constantly spreading in animals, food, and the environment. These pan-drug-resistant strains can be transmitted to humans through food, posing new challenges to the treatment of bacterial infections in clinical and livestock settings. Currently, the prevalence and spread of drug-resistant strains has become a significant public health issue. Literature shows that the resistance rate of E. coli to most quinolone antibiotics is as high as 50%, and the resistance rate to third-generation cephalosporins reaches over 20%, with pentadal, hexadal, and heptadal resistance being predominant. Polymyxin is considered a last resort for treating multidrug-resistant Gram-negative bacterial infections. However, since the first report in my country in 2015 of the plasmid-mediated colistin resistance gene mcr-1, reports of polymyxin-resistant E. coli have been gradually increasing globally. The Mcr-1 gene spreads horizontally among different bacteria via transferable plasmids, leading to the emergence of new multidrug-resistant and pan-drug-resistant bacteria. To date, plasmid-mediated mcr-1 gene transmission has been detected in various Enterobacteriaceae, including Escherichia coli, Salmonella, and Klebsiella pneumoniae. Some strains simultaneously carry both the extended-spectrum β-lactamase ESBL gene and the mcr-1 gene, resulting in resistance to third-generation cephalosporins and polymyxins, further limiting antibiotic selection and increasing the difficulty of disease treatment.
[0004] Continuously tracking and monitoring the emergence of new drug-resistant bacteria, promptly updating and reporting on the spread of drug-resistant bacteria, and gradually improving the data sharing service platform are of great significance for developing new drugs and protecting human health. Summary of the Invention:
[0005] To overcome the shortcomings of existing technologies, this invention provides a novel Escherichia coli O157 strain—Escherichia coli EC382-2-2—carrying both multiple drug resistance genes and virulence genes, and its applications. This strain is the first of its kind reported internationally and can be used as a model strain for screening novel antibacterial drugs, showing promising application prospects.
[0006] The first objective of this invention is to provide a pathogenic Escherichia coli (atypical enteropathogenic Escherichia coli, aEPEC) EC382-2-2, classified as Escherichia coli EC382-2-2, deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, China, postcode: 510070, deposited on October 27, 2022, with accession number GDMCC No: 62929.
[0007] The *Escherichia coli* EC382-2-2 provided by this invention belongs to serotype O157:H26 and carries 18 drug resistance genes and 1 virulence gene. The genes it carries are as follows:
[0008] Drug resistance genes: ant(2')-Ia, aph(3')-Ib, aph(3')-IIa, aph(3')-XV, aph(6')-Id, floR, catB3, CTX-M-55, OXA-4, TEM-214, mcr-1, dfrA1, fosA3, mdf(A), oqxA, oqxB, sul2, tet(A);
[0009] Virulence gene: Carrying a virulence gene (eae) that encodes the LEE adhesion site;
[0010] Quinolone resistance mutation sites on chromosomes:
[0011] The serine (S) at position 83 of the product encoded by the gyrA gene is mutated to leucine (L);
[0012] The aspartic acid (D) at position 87 of the gyrA gene encoding product is mutated to asparagine (N);
[0013] The serine (S) at position 80 of the parC gene encoding product is mutated to isoleucine (I).
[0014] The pathogenic *Escherichia coli* EC382-2-2 described is a Gram-negative, short bacillus. It was identified as *Escherichia coli* (5044552) by API 20E, with a concordance rate of 99.5%. Its biochemical characteristics are as follows: ONPG test (+), arginine dihydrolase (-), lysine decarboxylase (+), ornithine decarboxylase (-), citrate (-), hydrogen sulfide production (-), urease (-), phenylalanine deaminase (-), indole test (+), VP test (-), unable to liquefy gelatin, ferments glucose, mannitol, sorbitol, rhamnose, mesquite, and arabinose, but does not ferment inositol, sucrose, or amygdalin, exhibiting typical physiological and biochemical characteristics of *Escherichia coli*. Serotype molecular identification was serotype O157:H26.
[0015] A second objective of this invention is to provide the application of the above-mentioned Escherichia coli EC382-2-2 as a model strain for screening novel antimicrobial drugs.
[0016] Preferably, the use of Escherichia coli EC382-2-2 as a model strain in screening functional microorganisms, drugs, preparations or antimicrobial materials that are anti-Escherichia coli is preferred.
[0017] Preferably, the functional microorganism, drug, preparation, or antimicrobial material is a functional microorganism, drug, preparation, or antimicrobial material that inhibits Escherichia coli resistant to ampicillin, amoxicillin-clavulanic acid, cefotaxime, polymyxin E, gentamicin, ciprofloxacin, sulfamethoxazole-trimethoprim, tetracycline, and florfenicol.
[0018] Preferably, the Escherichia coli EC382-2-2 can be used as a control or model strain for antibiotic drugs, such as polymyxin or third-generation cephalosporins, to assist in screening targeted drugs for food microbial control and clinical treatment.
[0019] Preferably, the *Escherichia coli* EC382-2-2 is used as a reference strain for detecting the drug resistance gene mcr-1 / CTX-M-55 and the virulence gene eae.
[0020] A third objective of this invention is to be able to specifically identify the nucleotide sequence of Escherichia coli EC382-2-2, as shown in SEQ ID NO.1.
[0021] A fourth objective of this invention is to provide primers for the specific identification of Escherichia coli EC382-2-2, comprising: F: 5'-TAGAAGGCTCTTTGGAAGCA-3'; R: 5'-GACCGGACATCATCAGGAAG-3'.
[0022] The fifth objective of this invention is to provide a method for specifically identifying Escherichia coli EC382-2-2, which involves using the aforementioned primers to perform PCR or qPCR amplification on the Escherichia coli to be tested. If a band / signal is generated, the test bacterium is Escherichia coli EC382-2-2; if no band / signal is generated, the test bacterium is not Escherichia coli EC382-2-2.
[0023] Preferably, the PCR amplification system is 25 μL, comprising 12.5 μL PCR mixture, 1.0 μL each of 10 μmol / L upstream and downstream primers, 8.5 μL ddH2O, and 2.0 μL DNA template.
[0024] Preferably, the PCR amplification is performed under the following conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 45 s, 72℃ extension for 60 s, for 30 cycles, and finally 72℃ extension for 10 min.
[0025] The beneficial effects of this invention are:
[0026] This invention provides a novel multidrug-resistant pathogenic Escherichia coli strain, EC382-2-2, resistant to multiple antibiotics. This strain simultaneously carries the eae virulence gene (a pathogenic E. coli-specific virulence gene), the plasmid-mediated polymyxin resistance gene mcr-1, the extended-spectrum β-lactamase gene CTX-M-55, and other antibiotic resistance genes. This is the first time internationally that 18 drug resistance genes have been found coexisting in a single non-H7 type E. coli O157 strain, classifying it as a newly emerging highly pathogenic multidrug-resistant bacterium.
[0027] The Escherichia coli O157 of this invention carries 18 drug resistance genes [ant(2')-Ia, aph(3')-Ib, aph(3')-IIa, aph(3')-XV, aph(6')-Id, floR, catB3, CTX-M-55, OXA-4, TEM-214, mcr-1, dfrA1, fosA3, mdf(A), oqxA, oqxB, sul2, tet(A)] as well as a virulence gene (eae) encoding the LEE adhesion site. This is the first time, both domestically and internationally, that plasmid-mediated polymyxin resistance gene mcr-1, extended-spectrum β-lactamase (ESBL) resistance genes CTX-M-55, TEM-214, OXA-4, quinolone resistance gene (oqxAB), and other antibiotic genes have coexisted in the same non-H7 E. coli O157 strain. This strain has not been reported internationally. This pathogenic multidrug-resistant strain can lead to high resistance in E. coli O157 to multiple antibiotics, including third-generation cephalosporins, polymyxins, and quinolones, posing a new challenge to the treatment of infections. EC382-2-2 exhibits high levels of resistance to multiple antibiotics, including ampicillin (AMP), amoxicillin-clavulanic acid (AMC), cefotaxime (CTX), polymyxin E, gentamicin (GEN), ciprofloxacin (CIP), trimethoprim-sulfamethoxazole (SXT), tetracycline (TE), and florfenicol (FFC). The minimum inhibitory concentrations (MICs) of these antibiotics against *Escherichia coli* O157:H26 EC382-2-2 strain were >128 μg / mL, >128 / 64 μg / mL, >8 μg / mL, 4 μg / mL, >32 μg / mL, >8 μg / mL, >16 / 304 μg / mL, >64 μg / mL, and >128 μg / mL, respectively. The *Escherichia coli* O157 strain of this invention can serve as a model strain for screening novel antimicrobial drugs and has promising application prospects.
[0028] Escherichia coli EC382-2-2 is deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong, China, 510070, China. The deposit date is October 27, 2022, and the accession number is GDMCC No: 62929. Attached image description:
[0029] Figure 1 This is the colony morphology of Escherichia coli EC382-2-2. EC382-2-2 appears as purple-red colonies on Escherichia coli O157 staining plates.
[0030] Figure 2It is Escherichia coli EC382-2-2 Gram staining microscopic examination (100×).
[0031] Figure 3 This is the biochemical identification result of Escherichia coli EC382-2-2API 20E.
[0032] Figure 4 These are the results of serotype, drug resistance gene, and virulence gene identification for Escherichia coli EC382-2-2, including the serotype genes rfbE and filC. H26 ;
[0033] Virulence gene eae; drug resistance genes CTX-M and mcr-1.
[0034] Figure 5 These are the qPCR verification results of Escherichia coli EC382-2-2 and other non-target strains. From left to right, they are EC382-2-2, Cronobacter sakazakii 3414C1, Listeria monocytogenes CMCC54002, Salmonella typhimurium ATCC14028, Yersinia enterocolitica 256B1, Listeria monocytogenes CMCC54007, and Bacillus cereus CMCC63301. Detailed implementation method:
[0035] To make the objectives, technical solutions, and advantages of the present invention clearer, the following description is provided in conjunction with specific embodiments, but these should not be construed as limiting the present invention; they are merely some embodiments of the present invention.
[0036] Example 1: Strain strain isolation
[0037] Escherichia coli O157:H26 EC382-2-2 was isolated from chicken samples in Hohhot, Inner Mongolia, China. The detection method followed the national food safety standard GB 4789.36-2016, "Microbiological Examination of Food - Test for Escherichia coli O157:H7 / NM". 25g of the sample was aseptically added to a homogenizing bag containing 225mL of mEC+n broth. The mixture was homogenized continuously for 2 minutes using a tapping homogenizer and incubated at 36℃±1℃ for 18-24 hours. A loop was used to inoculate the mEC+n enrichment broth onto Escherichia coli O157 chromogenic agar plates, which were then incubated at 36℃±1℃ for 18-24 hours. Colony morphology was observed. Typical colonies on Escherichia coli O157 chromogenic agar plates are round, smooth, with regular edges, and a diameter of 1-1.5mm, appearing as purplish-red colonies. Figure 1The colonies were inoculated into LB broth and incubated overnight at 37°C. Glycerol was then added to a final concentration of 50% and stored at -40°C. Simultaneously, lyophilization was performed to obtain *Escherichia coli* O157 EC382-2-2, hereinafter referred to as *Escherichia coli* EC382-2-2. *Escherichia coli* EC382-2-2 is deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, China, 510070, China. The deposit date is October 27, 2022, and the accession number is GDMCC No. 62929.
[0038] Example 2: Biochemical and serotype identification of strain EC382-2-2
[0039] The purified strain EC382-2-2 was subjected to morphological characteristics, physiological and biochemical analysis, and serotype identification.
[0040] (1) Gram staining microscopy
[0041] Pick 1-2 single colonies on a glass slide, perform Gram staining, and observe their morphology under a microscope. *Escherichia coli* EC382-2-2 is a Gram-negative, short rod-shaped bacterium. Figure 2 ).
[0042] (2) API 20E identification
[0043] Single colonies were picked from NA plates and a bacterial suspension with 0.85% physiological saline was prepared to a McFarland turbidity of 0.5. The strains were then identified according to the instructions for bioMérieux API 20E reagent strip. Figure 3 ).
[0044] (3) Serological type identification
[0045] Bacterial DNA was extracted using a DNA extraction kit. Primer sequences from the references were used to identify the O157 antigen gene (rfbE) and the H antigen gene (flicH26). Primer sequences are shown in Table 1. The primers were synthesized by BGI Genomics. The amplification system was 25 μL, including 12.5 μL PCR mixture, 1.0 μL each of 10 μmol / L forward and reverse primers, 8.5 μL ddH2O, and 2.0 μL DNA template. PCR amplification conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 45 s, 72℃ extension for 60 s, for 30 cycles, with a final extension at 72℃ for 10 min. 6 μL of the PCR product was separated by 1.5% agarose gel electrophoresis (120V, 25 min).
[0046] (4) Identification of virulence factors of Escherichia coli EC382-2-2 strain
[0047] The virulence gene *eae* of the strain was identified by PCR using the method described in the references. Primers were synthesized by BGI Genomics Co., Ltd. (Table 1). The reaction system was the same as above. 6 μL of the PCR product was loaded onto a 1.5% agarose gel for electrophoresis separation (120V, 30 min). Figure 4 ).
[0048] (5) Specific molecular target sequence and qPCR verification of Escherichia coli EC382-2-2
[0049] By pan-genome analysis, a specific molecular target sequence (SEQ ID NO.1) for E. coli EC382-2-2 was screened, and specific amplification primers (F: TAGAAGGCTCTTTGGAAGCA; R: GACCGGACATCATCAGGAAG) were designed for both conventional PCR and qPCR amplification. PCR amplification conditions were the same as above. qPCR amplification used a commercial kit (SYBR qPCR SuperMixPlus). The reaction volume was 20 μL, including 10 μL of 2×SYBR qPCR Super Mix Plus, 1 μL each of forward and reverse primers (final concentration 1.0 μM), 2 μL of DNA template, and 6 μL of RNase-free water. Amplification conditions were 94℃ for 3 min, 94℃ for 15 s, 57℃ for 30 s, and 68℃ for 40 s, for a total of 40 cycles. Fluorescence signals were collected, and the results are shown below. Figure 5 As shown, no amplification or interference was observed in non-target bacteria, indicating that the target has good specificity.
[0050] The results showed that strain EC382-2-2 was a Gram-negative, short bacillus, identified as *Escherichia coli* by API 20E, with biochemical code 5044552, a concordance rate of 99.5%. Its biochemical characteristics were as follows: oxidase negative, ONPG test (+), arginine dihydrolase (-), lysine decarboxylase (+), ornithine decarboxylase positive (-), citrate (-), hydrogen sulfide production (-), urease (-), phenylalanine deaminase (-), indole test (+), VP test (-), unable to liquefy gelatin, ferments glucose, mannitol, sorbitol, rhamnose, mesiobiose, and arabinose, but does not ferment inositol, sucrose, or amygdalin, exhibiting typical physiological and biochemical characteristics of *Escherichia coli*. Figure 3 Serological PCR identification was O157:H26, see attached. Figure 4 .
[0051] Based on morphology, Gram staining, biochemical reactions, and serological identification, the strain was identified as *Escherichia coli* O157, and named *Escherichia coli* EC382-2-2. The nucleotide sequence of the specific virulence gene *eae* is shown in SEQ ID NO:2.
[0052] Table 1 Primer sequences and amplification fragments of Escherichia coli EC382-2-2 antigen and virulence genes.
[0053]
[0054]
[0055] Example 3: Drug resistance phenotype determination of strain EC382-2-2
[0056] Following the 2018 Clinical and Laboratory Standards Institute (CLSI) guidelines and interpretation criteria, the microbroth dilution method was used to determine the resistance levels of *Escherichia coli* strain EC382-2-2 to ampicillin (AMP), amoxicillin-clavulanic acid (AMC), cefotaxime (CTX), polymyxin E, gentamicin (GEN), ciprofloxacin (CIP), trimethoprim-sulfamethoxazole (SXT), tetracycline (TE), and florfenicol (FFC). EC382-2-2 was inoculated into 5 mL of LB broth, cultured to the logarithmic growth phase, adjusted to 0.5 McFarland turbidity, and diluted to 1.0 × 10⁻⁶. 5 CFU / mL. Following a two-fold serial dilution, a sterile 96-well flat-bottomed microplate was used. 50 μL of MH broth was added to the first well of each row, followed by 50 μL of the test drug in the first well of each row. The mixture was thoroughly combined, and 50 μL was transferred to the second well, and so on, until the 12th well. After mixing, 50 μL was discarded. Finally, 50 μL of diluted and mixed *E. coli* EC382-2-2 suspension was added to each well. 100 μL of MH broth was added as a negative control in a suitable well; 50 μL of EC382-2-2 bacterial suspension and 50 μL of MH broth were added as positive controls. The plate was incubated at 37°C for 18–24 h, and the OD value and MIC value were measured using a microplate reader.
[0057] The minimum inhibitory concentrations (MICs) of ampicillin (AMP), amoxicillin-clavulanic acid (AMC), cefotaxime (CTX), polymyxin E, gentamicin (GEN), ciprofloxacin (CIP), trimethoprim-sulfamethoxazole (SXT), tetracycline (TE), and florfenicol (FFC) against *Escherichia coli* strain EC382-2-2 were >128 μg / mL, >128 / 64 μg / mL, >8 μg / mL, 4 μg / mL, >32 μg / mL, >8 μg / mL, >16 / 304 μg / mL, >64 μg / mL, and >128 μg / mL, respectively. The drug susceptibility results for *Escherichia coli* strain EC382-2-2 are shown in Table 2.
[0058] Table 2. Antimicrobial susceptibility results of Escherichia coli EC382-2-2 strain
[0059]
[0060] Example 4: Detection of drug resistance genes in strain EC382-2-2
[0061] Since the pathogenic *Escherichia coli* EC382-2-2 was resistant to all selected β-lactam antibiotics, PCR was used to further confirm whether it was an ESBL-positive strain to detect whether EC382-2-2 carried the CTX-M gene, the presence of which causes the strain to be insensitive to β-lactam antibiotics. Simultaneously, the mcr-1 gene was detected, which can cause resistance to polymyxin E (colistin). The strain was inoculated into LB broth and cultured at 37°C for 18–24 h. Genomic DNA was extracted according to the instructions of the Genomic DNA Mini Kit (Invitrogen, USA). The resistance gene was amplified using singlet PCR, with primer sequences from the reference (Table 3). PCR amplification conditions: 95°C pre-denaturation for 5 min; 95°C denaturation for 45 s, 56°C annealing for 45 s, 72°C extension for 50 s, for 35 cycles; final extension at 72°C for 8 min. The reaction mixture (25 μL) contained: 12.5 μL 2×DreamTaqMaster mix, 8.5 μL ultrapure water, 2 μL template DNA, and 1.0 μL each of 10 μmol / L forward and reverse primers. 5 μL of the PCR amplification product was separated by electrophoresis on a 1.5% agarose gel (120V, 25 min). Figure 4 )
[0062] Upon identification, Escherichia coli strain EC382-2-2 was found to carry both of these important multidrug resistance genes. The nucleotide sequence of mcr-1 is shown in SEQ ID NO:3, and the nucleotide sequence of CTX-M-55 is shown in SEQ ID NO:4.
[0063] Table 3 Primer sequences and amplification fragments for the drug resistance genes mcr-1 and CTX-M.
[0064]
[0065] Example 5: Whole genome sequencing of Escherichia coli EC382-2-2
[0066] (1) Genomic DNA extraction
[0067] Escherichia coli EC382-2-2 was revived in LB broth at 37°C for 18 h. 1 ml of the bacterial culture was collected by centrifugation at 10,000 rpm for 10 min. Bacterial genomic DNA was extracted using the Genomic DNA Mini Kit (Invitrogen, USA). The obtained genomic DNA showed an OD280 / OD260 ratio of 1.86 and a DNA concentration of 312 ng / μL.
[0068] (2) Hiseq platform library building and document quality inspection
[0069] 100 ng of Escherichia coli EC382-2-2 DNA was randomly fragmented into fragments smaller than 400 bp using an ultrasonic disruptor (Covaris S220). End repair (including 5' end phosphorylation and 3' end A addition) was performed using End Prep Enzyme Mix, and sequencing adapters were added to both ends. The target fragment was then purified using magnetic beads and amplified using P5 and P7 primers. Library quality was assessed using an Agilent 2100 bioanalyzer (Agilent Technologies, Palo Alto, CA, USA), and library concentration was measured using Qubit 3.0. The qualified libraries were used for cluster preparation and sequencing.
[0070] (3) Library creation and quality control on the PacBio platform
[0071] Take 5-10 μg of high-quality genomic DNA and randomly fragment it into approximately 10 kb fragments using Covaris g-TUBE (select a 20 kb library based on genome size). Then, construct an SMRTbell library using the DNA Template Prep kit. Combine the constructed SMRTbell library with sequencing primers and polymerase, and add it to the sequencing chip of the PacBio Sequel platform via free diffusion, ready for sequencing. Finally, perform sequencing on the qualified libraries.
[0072] (4) Sequencing data quality control and genome assembly
[0073] For second-generation sequencing data obtained through the HiSeq platform, cutadapt (v1.9.1) was used to remove adapter sequences and low-quality sequences, resulting in clean second-generation sequencing data for subsequent analysis. Spades software was then used for assembly to obtain a draft genome map. For third-generation sequencing data obtained through the PacBio platform, HGAP4 / Falcon (v0.3) was used for assembly to obtain preliminary assembly results. Subsequently, the quality-filtered second-generation sequencing data was aligned with the assembly results, and Pilon software was used for further correction to obtain the final assembly result.
[0074] (5) Genome sequence alignment
[0075] The strain's genome draft was compared with the Resfinder, Plasmidfinder, and MLST databases using the local program Staramr (0.7.2). The command was "staramr search -o out / fna / 382-2-2.fna" (output folder is out). The results were viewed in the output file "result.xlsx". The results are shown in Table 4. In addition, three chromosomal mutation sites associated with quinolone resistance were identified: gyrA (S 83L), gyrA (D 87N), and parC (S 80I).
[0076] Table 4. Genome sequencing and alignment results of strain EC382-2-2
[0077]
[0078]
[0079] Example 6: Application of multidrug-resistant strain EC382-2-2
[0080] The specific applications of EC382-2-2 are mainly reflected in the following two aspects:
[0081] (1) It can be used as a control or model strain for the determination of MIC of antibiotic drugs (polymyxin and third-generation cephalosporins) to help screen new food microbial control and clinical treatment targeted drugs.
[0082] The screening method for antimicrobial drugs is as follows: The drug to be tested is dissolved in sterile ultrapure water to prepare a solution with an initial concentration of 2000 μg / mL. After two-fold serial dilution, the minimum inhibitory concentration (MIC) is determined. *Escherichia coli* EC382-2-2 from this invention is revived in LB broth at 37°C for 18-24 h, streaked into MH medium, and revived at 37°C for 24 h. One to two single colonies are picked, diluted with sterile physiological saline, adjusted to 0.5 McFarland turbidity, and further diluted to 1.0 × 10⁻⁶. 5 CFU / mL. The MIC values of the strains to the drug were determined according to the broth dilution method recommended by the Clinical and Laboratory Standards Institute (CLSI, 2018), with each group performed in triplicate. Using a 96-well microplate, following a two-fold serial dilution method, 100 μL of MH broth was added to the first well of each row, followed by 100 μL of the test drug in the first well of each row. The mixture was then pipetted and transferred to the second well, and so on, until the 12th well. After mixing, 100 μL was discarded. Finally, 1×10⁻⁶ CFU / mL was added to each well. 5 100 μL of CFU / mL *E. coli* EC382-2-2 bacterial suspension was used. 200 μL of MH broth was used as a negative control, and a mixture of 100 μL EC382-2-2 bacterial suspension and 100 μL MH broth was used as a positive control. The culture plates were incubated at 37℃ for 18–24 h, and the OD values were read using a microplate reader to determine the MIC values.
[0083] (2) As a reference strain for detecting the drug resistance gene mcr-1 / CTX-M-55 and the virulence gene eae
[0084] The test strain was cultured in a suitable resuscitation broth for 18-24 hours, and its DNA was extracted using a commercially available kit. PCR amplification was performed using the primers and amplification conditions of mcr-1 / CTX-M-55 / eae described in this invention, followed by electrophoresis to determine whether the strain was a mcr-1 / CTX-M-55 positive pathogenic strain.
[0085] The specific steps are as follows: The test strain was cultured in suitable resuscitation broth for 18-24 hours. 1 mL of the bacterial culture was then extracted, and genomic DNA was extracted using a commercially available kit. The mcr-1 / CTX-M-55 / eae gene was amplified using singlet PCR. Primer sequences are shown in Tables 1 and 3. The PCR amplification system consisted of 25 μL of PCR mixture, 1.0 μL each of 10 μmol / L forward and reverse primers, 8.5 μL of ddH2O, and 2.0 μL of DNA template. Amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 45 s, and 72℃ extension for 60 s, for 30 cycles, followed by a final extension at 72℃ for 10 min. 6 μL of the PCR product was separated by electrophoresis on a 1.5% agarose gel (120V, 25 min). If a single band appears, it indicates that the strain is positive for mcr-1 / CTX-M-55 / eae, meaning it is a pathogenic strain that is positive for mcr-1 / CTX-M-55; if only the mcr-1 / CTX-M-55 band appears, it indicates that it is a drug-resistant bacterium; if only the eae band appears, it indicates that it is a pathogenic bacterium.
[0086] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
[0087] SEQ ID NO.1: 382-2-2 Specific target sequence
[0088] ATGGATTTAAGTAAATTAGAAGGCTCTTTGGAAGCATCAGTAAAAAATTTTATATCAGTAATTGATGAAAAAAACTGAAGATATTAAGAAAGCAACTATTGCCGAACTTATTCAAACAAGAGCCAGTACATTTGATCATCTTCCTGATGAT GTCCGGTCAGCGGCAATTCACGTATATGTAACGGCAATAAGCAATATTGACCCCCCAATTGATGAAGAATCAAGAGATATTCAGAAAAAACGGTTTGAGATGTTAGCCAGCAACATTGTCGCTGGCTTTGCAAAGCTTACTTGTTGTTAG
[0089] SEQ ID NO.2: eae gene sequence
[0090]
[0091] SEQ ID NO.3: mcr-1.1 gene sequence
[0092]
[0093] SEQ ID NO.4: CTX-M-55 sequence
[0094] ATGGTTAAAAAATCACTGCGCCAGTTCACGCTGATGGCGACGGCAACCGTCACGCTGTTGTTAGGAAGTGTGCCGCTGTATGCGCAAACGGCGGACGTACAGCAAAAACTTGCCGAATTAGAGCGGCAGTCGGGAGGCAGACTGGGTGTGGCATTGATTAACACAGCAGATAATTCGCAAATACTTTATCGTGCTGATGAGCGCTTTGCGATGTGCAGCACCAGTAAAGTGATGGCCGTGGCCGCGGTGCTGAAGAAAAGTGAAAGCGAACCGAATCTGTTAAATCAGCGAGTTGAGATCAAAAAATCTGACCTTGTTAACTATAATCCGATTGCGGAAAAGCACGTCAATGGGACGATGTCACTGGCTGAGCTTAGCGCGGCCGCGCTACAGTACAGCGATAACGTGGCGATGAATAAGCTGATTGCTCACGTTGGCGGCCCGGCTAGCGTCACCGCGTTCGCCCGACAGCTGGGAGACGAAACGTTCCGTCTCGACCGTACCGAGCCGACGTTAAACACCGCCATTCCGGGCGATCCGCGTGATACCACTTCACCTCGGGCAATGGCGCAAACTCTGCGGAATCTGACGCTGGGTAAAGCATTGGGCGACAGCCAACGGGCGCAGCTGGTGACATGGATGAAAGGCAATACCACCGGTGCAGCGAGCATTCAGGCTGGACTGCCTGCTTCCTGGGTTGTGGGGGATAAAACCGGCAGCGGTGGCTATGGCACCACCAACGATATCGCGGTGATCTGGCCAAAAGATCGTGCGCCGCTGATTCTGGTCACTTACTTCACCCAGCCTCAACCTAAGGCAGAAAGCCGTCGCGATGTATTAGCGTCGGCGGCTAAAATCGTCACCGACGGTTTGTAA
Claims
1. Escherichia coli ( Escherichia coli EC382-2-2, accession number GDMCC No: 62929.
2. The *Escherichia coli* EC382-2-2 as described in claim 1 as a detection method for drug resistance genes. mcr-1、CTX-M-55 and virulence genes eae Applications of reference strains.
Citation Information
Patent Citations
Multi-antibiotic resistant e. coli strains with pathogenic genes
KR1020110107773A