Polycistronic expression of gut peptides

Abstract

Provided herein are monocistronic, bicistronic, and polycistronic expression constructs for expressing gut peptides, as well as pharmaceutical compositions comprising such expression constructs. Also provided are methods of using such expression constructs, e.g., to induce satiety in a subject in need thereof or to treat obesity in a subject in need thereof.

Description

[Technical field]

[0001] The present disclosure relates to compositions and methods in the field of molecular biology. In particular, the disclosure relates to polycistronic expression constructs for expressing peptides, as well as methods of using these polycistronic expression constructs. [Background technology]

[0002] Current treatments for obesity involve stimulant medications, which are weakly effective and may have adverse side effects, especially when used over a long period of time.Other current treatment methods involve invasive bariatric surgery, which may be effective in some cases, but may be associated with a variety of serious complications.More recently, saturated gastrointestinal peptides (also called saturated peptides or gastrointestinal peptides) have been investigated as a potential treatment for obesity.

[0003] Satiety gut peptides are chemical messengers that control gastrointestinal (GI) functions such as secretion, motility, absorption, digestion, and cell proliferation. These polypeptides are produced by endocrine cells in the stomach, pancreas, or intestine and act locally by autocrine or paracrine mechanisms or at distant sites in a classical endocrine manner. Upon crossing the blood-brain barrier in plasma, they act by activating specific receptors in the satiety center of the hypothalamus, thereby inducing a feeling of satiety.

[0004] Acute replacement therapy with satiety gut peptides reduces food intake and body weight in animal models of obesity as well as in lean and obese human subjects.

[0005] It is widely recognized that oral administration of satiety gut peptides is ineffective because enzymes and acids in the gut digest them before they reach the blood, and therefore novel mechanisms for expression of satiety gut peptides are urgently needed. Summary of the Invention

[0006] Provided herein are expression constructs for expressing gut peptides, and methods of using such expression constructs.

[0007] In one aspect, a bicistronic expression construct encoding a polyprotein comprising: a. the polyprotein comprises a signal peptide, a first gut peptide, and a second gut peptide; b. The polyprotein coding sequence is i. a sequence encoding the signal peptide; ii. a sequence encoding the first gastrointestinal peptide; and iii. comprising a sequence encoding the second gastrointestinal peptide; The above expression constructs are provided.

[0008] In some embodiments, the first gut peptide and / or the second gut peptide comprises a sequence selected from human glucagon-like peptide 1 (hGLP-1) peptide, human glucose-dependent insulinotropic (hGIP) peptide, human oxyntomodulin (hOXM) peptide, peptide YY (PYY), human glucagon peptide, and amylin peptide. In embodiments, the hGLP-1 peptide is hGLP-1 7-37 In an embodiment, the hGIP peptide is 1-42 In some embodiments, the first gut peptide and / or the second gut peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 1-5. In some embodiments, the first gut peptide and / or the second gut peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 1-5. In some embodiments, the first gut peptide and / or the second gut peptide comprises a sequence selected from SEQ ID NOs: 1-5.

[0009] In some embodiments, the sequence encoding the first gut peptide and / or the second gut peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 6-12. In some embodiments, the sequence encoding the first gut peptide gut peptide and / or the second gut peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 6-12. In some embodiments, the sequence encoding the first gut peptide gut peptide and / or the second gut peptide comprises a sequence selected from SEQ ID NOs: 6-12.

[0010] In some embodiments, the first gut peptide and the second gut peptide are the same gut peptide. In some embodiments, the sequence encoding the first gut peptide and the sequence encoding the second gut peptide are different. In some embodiments, at least one of the sequence encoding the first gut peptide and the sequence encoding the second gut peptide is codon optimized. In some embodiments, the sequence encoding the first gut peptide and the sequence encoding the second gut peptide are codon optimized. In some embodiments, the first gut peptide and the second gut peptide are hGLP-1. In some embodiments, the first gut peptide and the second gut peptide each comprise a sequence at least 80% identical to SEQ ID NO:1. In some embodiments, the first gut peptide and the second gut peptide each comprise a sequence at least 90% identical to SEQ ID NO:1. In some embodiments, the first gut peptide and the second gut peptide each comprise SEQ ID NO:1.

[0011] In some embodiments, the sequence encoding the first gastrointestinal peptide and the sequence encoding the second gastrointestinal peptide each comprise a sequence that is at least 80% identical to a sequence selected from SEQ ID NOs: 6-8. In some embodiments, the sequence encoding the first gastrointestinal peptide and the sequence encoding the second gastrointestinal peptide each comprise a sequence that is at least 90% identical to a sequence selected from SEQ ID NOs: 6-8. In some embodiments, the sequences encoding the first and second gastrointestinal peptides are selected from SEQ ID NOs: 6-8.

[0012] In some embodiments, the bicistronic expression construct comprises a sequence encoding a polypeptide that is at least 80% identical to SEQ ID NO: 45 or SEQ ID NO: 55. In some embodiments, the bicistronic expression construct comprises a sequence encoding a polypeptide that is at least 90% identical to SEQ ID NO: 45 or SEQ ID NO: 55. In some embodiments, the bicistronic expression construct encodes a polypeptide comprising SEQ ID NO: 45 or SEQ ID NO: 55.

[0013] In some embodiments, the bicistronic expression construct comprises a sequence that is at least 80% identical to SEQ ID NO:50 or SEQ ID NO:57. In some embodiments, the bicistronic expression construct comprises a sequence that is at least 90% identical to SEQ ID NO:50 or SEQ ID NO:57. In some embodiments, the bicistronic expression construct comprises SEQ ID NO:50 or SEQ ID NO:57.

[0014] In some embodiments, the first gut peptide and the second gut peptide are different gut peptides. In some embodiments, the first gut peptide and the second gut peptide are selected from the group consisting of hGLP-1 and hGIP. In embodiments, the hGLP-1 peptide is hGLP-1 7-37 In an embodiment, the hGIP peptide is 1-42 It is a peptide.

[0015] In some embodiments, the bicistronic expression construct encodes a sequence comprising a sequence that is at least 80% identical to any one of SEQ ID NOs: 46-49, or SEQ ID NO: 56. In some embodiments, the bicistronic expression construct encodes a sequence comprising a sequence that is at least 90% identical to any one of SEQ ID NOs: 46-49, or SEQ ID NO: 56. In some embodiments, the bicistronic expression construct encodes a sequence comprising any one of SEQ ID NOs: 46-49, or SEQ ID NO: 56.

[0016] In some embodiments, the bicistronic expression construct comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 51-54, or SEQ ID NO: 58. In some embodiments, the bicistronic expression construct comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 51-54, or SEQ ID NO: 58. In some embodiments, the bicistronic expression construct comprises a sequence selected from SEQ ID NOs: 51-54, or SEQ ID NO: 58.

[0017] In one aspect, a tricistronic expression construct encoding a polyprotein, comprising: a. the polyprotein comprises a signal peptide, a first gut peptide, a second gut peptide, and a third gut peptide; b. The polyprotein coding sequence is i. a sequence encoding the signal peptide; ii. a sequence encoding the first gut peptide; iii. a sequence encoding the second gut peptide; and iv. comprising a sequence encoding the third gastrointestinal peptide; The above expression constructs are provided.

[0018] In some embodiments, the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence selected from the group consisting of hGLP-1 peptide, hGIP peptide, hOXM peptide, peptide YY (PYY), hGlucagon, and amylin peptide. 7-37 In an embodiment, the hGIP peptide is 1-42 In some embodiments, the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 1-5. In some embodiments, the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 1-4. In some embodiments, the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence selected from SEQ ID NOs: 1-5.

[0019] In some embodiments, the sequence encoding the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 6-12. In some embodiments, the sequence encoding the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 6-12. In some embodiments, the sequence encoding the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence selected from SEQ ID NOs: 6-12.

[0020] In some embodiments, the first gut peptide, the second gut peptide, and the third gut peptide are the same gut peptide. In some embodiments, the sequence encoding the first gut peptide, the sequence encoding the second gut peptide, and the sequence encoding the third gut peptide are different. In some embodiments, at least one of the sequence encoding the first gut peptide, the sequence encoding the second gut peptide, and the sequence encoding the third gut peptide is codon-optimized. In some embodiments, the sequence encoding the first gut peptide, the sequence encoding the second gut peptide, and the sequence encoding the third gut peptide are codon-optimized.

[0021] In some embodiments, the first gut peptide, the second gut peptide, and the third gut peptide are hGLP-1.

[0022] In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence that is at least 80% identical to any one of SEQ ID NOs: 59-61, or SEQ ID NO: 75. In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence that is at least 90% identical to any one of SEQ ID NOs: 59-61, or SEQ ID NO: 75. In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence selected from SEQ ID NOs: 59-61, or SEQ ID NO: 75.

[0023] In some embodiments, the tricistronic expression construct comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 67-69, or SEQ ID NO: 78. In some embodiments, the tricistronic expression construct comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 67-69, or SEQ ID NO: 78. In some embodiments, the tricistronic expression construct comprises a sequence selected from SEQ ID NOs: 67-69, or SEQ ID NO: 78.

[0024] In some embodiments, the first gut peptide and the second gut peptide are different gut peptides. In some embodiments, the first gut peptide, the second gut peptide, and the third gut peptide are different gut peptides.

[0025] In some embodiments, the first gut peptide, the second gut peptide, and the third gut peptide are selected from the group consisting of: (1) an hGLP-1 peptide, an hOXM peptide, and a PYY, or (2) an hGLP-1 peptide, an hGlucagon peptide, and an hGIP peptide. 7-37 In an embodiment, the hGIP peptide is 1-42 It is a peptide.

[0026] In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence that is at least 80% identical to any one of SEQ ID NOs: 62-66, or SEQ ID NOs: 76-77. In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence that is at least 90% identical to any one of SEQ ID NOs: 62-66, or SEQ ID NOs: 76-77. In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence comprising any one of SEQ ID NOs: 62-66, or SEQ ID NOs: 76-77.

[0027] In some embodiments, the tricistronic expression construct comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 70-74, or SEQ ID NOs: 79-80. In some embodiments, the tricistronic expression construct comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 70-74, or SEQ ID NOs: 79-80. In some embodiments, the tricistronic expression construct comprises any one of SEQ ID NOs: 70-74, or SEQ ID NOs: 79-80.

[0028] In some embodiments, the bicistronic or tricistronic expression construct encodes a polyprotein, and the polyprotein comprises a signal peptide. In some embodiments, the signal peptide is selected from the group consisting of immunoglobulin M (IgM) signal peptide, human insulin (hInsul) signal peptide, mouse Igh protein (mIgh) protein signal peptide, human growth hormone (hGH) signal peptide, mouse erythropoietin (mEpo) signal peptide, mouse growth hormone releasing hormone (mGHRH) signal peptide, human albumin signal peptide, and human factor IX (FIX) signal peptide. In some embodiments, the signal peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 13-20. In some embodiments, the signal peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 13-20. In some embodiments, the signal peptide comprises a sequence selected from SEQ ID NOs: 13-20. In some embodiments, the sequence encoding the signal peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 21-28. In some embodiments, the sequence encoding the signal peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 21-28. In some embodiments, the sequence encoding the signal peptide comprises a sequence selected from SEQ ID NOs: 21-28.

[0029] In some embodiments, the bicistronic or tricistronic expression construct further comprises a promoter sequence, hi some embodiments, the promoter is a CMV or CASI promoter.

[0030] In some embodiments, the bicistronic or tricistronic expression construct encodes a polyprotein that includes a protease cleavage site located between a first gut peptide and a second gut peptide, hi some embodiments, the tricistronic expression construct encodes a polyprotein, the polyprotein further comprising a protease cleavage site that allows release of the first gut peptide, the second gut peptide, and / or a third peptide from the polyprotein.

[0031] In some embodiments, at least one of the protease cleavage sites is a furin cleavage site.

[0032] In some embodiments, the bicistronic or tricistronic expression construct comprises a riboswitch that comprises an aptamer, where the aptamer binds a small molecule.

[0033] In some embodiments, the bicistronic or tricistronic expression construct comprises a gene regulatory cassette that includes an aptamer, where the aptamer binds a small molecule.

[0034] Provided herein is a vector comprising the bicistronic or tricistronic expression construct disclosed herein. In some embodiments, the vector is an adeno-associated virus (AAV) vector.

[0035] Provided herein is a cell comprising the vector disclosed herein. In some embodiments, the cell is isolated.

[0036] Provided herein is a pharmaceutical composition comprising a vector disclosed herein and a pharma- ceutically acceptable excipient.

[0037] In one aspect, there is provided a method of inducing satiety in a subject in need thereof, said method comprising administering to said subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0038] In one aspect, there is provided a method of treating obesity in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0039] In one aspect, there is provided a method of suppressing appetite in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0040] In one aspect, there is provided a method of reducing weight loss or decreasing weight gain in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0041] In one aspect, there is provided a method of improving glucose tolerance in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0042] In one aspect, there is provided a method of inducing insulin release in a subject in need thereof, said method comprising administering to said subject an expression construct, vector, or pharmaceutical composition disclosed herein. [Brief description of the drawings]

[0043] [Figure 1A] Figure 1 shows expression of gut peptides using monocistronic expression constructs. Expression of gut peptide hGLP-17-37 peptide measured by ELISA. See Tables 5 and 6 for nomenclature of hGLP-1 expression constructs. [Figure 1B] Figure 1 shows expression of gut peptides using monocistronic expression constructs. Expression of gut peptide hGLP-17-37 peptide measured by ELISA. See Tables 5 and 6 for nomenclature of hGLP-1 expression constructs. [Figure 1C]Figure 1 shows the expression of gut peptides using monocistronic expression constructs. Expression of gut peptide hGIP1-42 peptide measured by ELISA. See Tables 5 and 6 for the nomenclature of hGIP expression constructs. [Figure 2A] 1 shows expression of gut peptides using mono-, bi-, and tricistronic expression constructs. Exemplary bi- and tricistronic expression constructs. [Figure 2B] Expression of gastrointestinal peptides using mono-, bi-, and tricistronic expression constructs. Comparison of monocistronic (GLP-1_M), bicistronic (2xGLP-1_2xB), or tricistronic (3xGLP-1_3xB) expression of GLP-17-37 peptide measured by ELISA. The ELISA kit used was designed to detect GLP-17-36. See Tables 5-10 for nomenclature of expression constructs. [Figure 2C] Figure 1 shows the expression of gut peptides using mono-, bi-, and tricistronic expression constructs. Comparison of certain monocistronic and tricistronic constructs encoding GLP17-37 peptide. Expression was determined by ELISA. Expression was measured by ELISA. See Tables 5-6 and 9-10 for nomenclature of expression constructs. [Figure 3A] Figure 1 shows the expression of gastrointestinal peptides using mono- and tricistronic expression constructs. Expression of GLP-17-37 peptide from a bicistronic expression construct encoding a polyprotein containing GLP-17-37 peptide and hGIP1-42 peptide. For the nomenclature of expression constructs, see Tables 7 and 8. [Figure 3B] Figure 1 shows the expression of gastrointestinal peptides using mono- and tricistronic expression constructs. Expression of hGIP1-42 peptide from a bicistronic expression construct encoding a polyprotein containing GLP-17-37 peptide and hGIP1-42 peptide. For the nomenclature of expression constructs, see Tables 7 and 8. [Figure 3C]Figure 1 shows the expression of gastrointestinal peptides using mono- and tricistronic expression constructs. Expression of GLP-17-37 from monocistronic expression constructs encoding GLP-17-37 peptides (GLP1_J and GLP-1_L) or hGIP1-42 peptide (GIP_G), and from tricistronic expression constructs expressing GLP-17-36 peptide, hGIP1-42 peptide, and hGlucagon peptide (GGG_A). For the nomenclature of expression constructs, see Tables 5, 6, 9, and 10. [Figure 3D] Figure 1 shows the expression of gastrointestinal peptides using mono- and tricistronic expression constructs. Expression of hGIP1-42 from monocistronic expression constructs encoding GLP-17-37 peptides (GLP1_J and GLP-1_L) or hGIP1-42 peptides (GIP_G), and from tricistronic expression constructs expressing GLP-17-37 peptides, hGIP1-42 peptides, and hGlucagon peptides (GGG_A). For the nomenclature of expression constructs, see Tables 5, 6, 9, and 10. [Figure 3E] Expression of gut peptides using mono- and tricistronic expression constructs is shown. Expression of GLP-17-37 with the indicated tricistronic expression constructs (expressing GLP-17-37 peptide, OXM peptide, and PYY). See Tables 9 and 10 for nomenclature of expression constructs. The ELISA kit used was designed to detect GLP-17-36. [Figure 4A] Figure 1 shows riboswitch-regulated expression of gut peptides. Expression of GLP-1 peptide by the indicated controllable bicistronic expression constructs based on GG_L (expressing hGLP-17-37 and hGIP1-42 peptides) as shown in Example 4. Concentrations of small molecule inducers are shown in μM. [Figure 4B]Figure 1 shows riboswitch-regulated expression of gut peptides. Expression of hGIP1-42 peptide by the indicated controllable bicistronic expression constructs (expressing hGLP-17-37 and hGIP1-42 peptides) as shown in Example 4. No significant expression was observed with 0 mM small molecule inducer. Small molecule inducer concentrations are shown in μM. [Figure 4C] Figure 2 shows riboswitch-regulated expression of gut peptides. Expression of hGLP-17-37 peptide by the indicated controllable tricistronic expression construct 3xGLP-1_3xC, described in Example 4 (containing three hGLP-17-37 peptide coding sequences). [Figure 4C] Figure 1 shows riboswitch-regulated expression of gut peptides. Expression of hGLP-17-37 peptide by the indicated controllable bicistronic and tricistronic expression constructs described in Example 4. MX-001 is a small molecule inducer. [Figure 4D] Figure 2 shows riboswitch-regulated expression of gut peptides. Expression of hGLP-17-37 peptide by the indicated controllable bicistronic expression construct based on GG_F described in Example 4 (expressing hGLP-17-36 and hGIP1-42 peptides). [Figure 4E] Figure 2 shows riboswitch-regulated expression of gut peptides. Expression of PYY from a controllable tricistronic expression construct expressing a polyprotein containing GLP-1, hOXM, and PYY. The ELISA kit used was designed to detect GLP-17-36. [Figure 5A] Figure 1 shows that gut peptides expressed from the polycistronic expression constructs disclosed herein are biologically active. Biological activity of hGLP-17-37 peptides expressed by the mono-, bi-, and tricistronic expression constructs shown. [Figure 5B]Figure 1 shows that gut peptides expressed from the polycistronic expression constructs disclosed herein are biologically active. Biological activity of hGIP1-42 peptides expressed by the mono-, bi-, and tricistronic expression constructs shown. [Figure 5C] Male C57Bl / 6 mice were fed a high-fat diet (HFD) from 6 weeks of age. At 8 weeks of age, mice were injected with either PBS or AAV8 vectors containing GG_F. Mice on a low-fat diet (LFD) were injected with PBS and served as the control group. Animal weights were monitored weekly before and after AAV injection. [Figure 6A] Figure 1 shows that GLP-1 and GIP peptides expressed from the AAV8.GG_F_7-GLP-1 vector improve glucose tolerance in vivo. Experimental set-up. [Figure 6B] 1 shows that GLP-1 and GIP peptides expressed from the AAV8.GG_F_7-GLP-1 vector improve glucose tolerance in vivo. GLP-1 and GIP peptides expressed from the AAV8.GG_F_7-GLP-1 vector improve glucose tolerance in vivo. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0044] Provided herein are expression constructs that encode one or more gut peptides, as well as methods of using these expression constructs. In embodiments, the peptides are expressed as polyproteins, and the polyproteins are cleaved to produce the desired gut peptides. As used herein, a polyprotein is a protein that is to be processed to produce two or more polypeptide products.

[0045] Expression constructs Provided herein are monocistronic, bicistronic, tricistronic and other polycistronic expression constructs for expressing gut peptides.

[0046] In embodiments, the expression construct is a monocistronic expression construct for expressing a single polypeptide.

[0047] In embodiments, the expression construct is a bicistronic expression construct for expressing two polypeptides, which can be expressed as a polyprotein and the individual polypeptides can be released from the polyprotein after proteolytic cleavage.

[0048] In an embodiment, the expression construct is a tricistronic expression construct for expressing three polypeptides, which can be expressed as a polyprotein and the individual polypeptides can be released from the polyprotein after proteolytic cleavage.

[0049] In embodiments, the expression construct is a polycistronic expression construct for expressing two or more polypeptides. Two or more polypeptides can be expressed as a polyprotein, and individual polypeptides can be released from the polyprotein after proteolytic cleavage. In some embodiments, the polycistronic expression construct expresses 2, 3, 4, 5, 6, 7, 8, 9, or 10 polypeptides. Two or more polypeptides can be the same or different polypeptides.

[0050] In one aspect, the expression constructs provided herein encode one or more gut peptides.

[0051] Monocistronic expression constructs In some embodiments, the gastrointestinal peptide is a human glucagon-like peptide 1 (hGLP-1) peptide, a human gastric inhibitory peptide (hGIP) peptide, a human oxyntomodulin (hOXM) peptide, peptide YY or peptide tyrosine tyrosine (PYY), a human glucagon peptide, or an amylin peptide (also called insulinoma amyloid polypeptide (IAPP)). In embodiments, the hGLP-1 peptide is hGLP-1 7-36 In an embodiment, the hGIP peptide is 1-42 In some embodiments, the gut peptide is a gut peptide disclosed in Table 1, or a portion of one of the gut peptides disclosed in Table 1.

[0052] In some embodiments, an expression construct is provided that encodes a polypeptide comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1. In some embodiments, the expression construct encodes a polypeptide comprising SEQ ID NO:1.

[0053] In some embodiments, an expression construct is provided that encodes a polypeptide comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2. In some embodiments, the expression construct encodes a polypeptide comprising SEQ ID NO:2.

[0054] In some embodiments, an expression construct is provided that encodes a polypeptide comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 3. In some embodiments, the expression construct encodes a polypeptide comprising SEQ ID NO:3.

[0055] In some embodiments, an expression construct is provided that encodes a polypeptide comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4. In some embodiments, the expression construct encodes a polypeptide comprising SEQ ID NO:4.

[0056] In some embodiments, an expression construct is provided that encodes a polypeptide comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 5. In some embodiments, the expression construct encodes a polypeptide comprising SEQ ID NO:5. [Table 1]

[0057] In some embodiments, the expression construct comprises a sequence disclosed in Table 2, or a portion of a sequence disclosed in Table 2.

[0058] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 6. In some embodiments, the expression construct comprises SEQ ID NO: 6.

[0059] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 7. In one embodiment, the promoter sequence comprises SEQ ID NO:7.

[0060] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 8. In some embodiments, the expression construct comprises SEQ ID NO:8.

[0061] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 9. In some embodiments, the expression construct comprises SEQ ID NO:9.

[0062] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10. In some embodiments, the expression construct comprises SEQ ID NO:10.

[0063] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 11. In some embodiments, the expression construct comprises SEQ ID NO:11.

[0064] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 12. In some embodiments, the expression construct comprises SEQ ID NO:12. [Table 2]

[0065] In some embodiments, the expression construct encodes a gut peptide, and the gut peptide is fused to a signal peptide. In some embodiments, the signal peptide is an immunoglobulin M (IgM) signal peptide, a human insulin (hInsul) signal peptide, a mouse Igh protein (mIgh) signal peptide, a human growth hormone (hGH) signal peptide, a mouse erythropoietin (mEpo) signal peptide, a mouse growth hormone releasing hormone (mGHRH) signal peptide, a human albumin (hAlbumin) signal peptide, or a human factor IX (hFIX) signal peptide. In some embodiments, the signal peptide is a signal peptide disclosed in Table 3 or a portion of a signal peptide disclosed in Table 3.

[0066] In some embodiments, the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 13. In some embodiments, the signal peptide comprises SEQ ID NO: 13.

[0067] In some embodiments, the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 14. In some embodiments, the signal peptide comprises SEQ ID NO:14.

[0068] In some embodiments, the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 15. In some embodiments, the signal peptide comprises SEQ ID NO: 15.

[0069] In some embodiments, the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 16. In some embodiments, the signal peptide comprises SEQ ID NO:16.

[0070] In some embodiments, the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 17. In some embodiments, the signal peptide comprises SEQ ID NO:17.

[0071] In some embodiments, the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 18. In some embodiments, the signal peptide comprises SEQ ID NO:18.

[0072] In some embodiments, the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 19. In some embodiments, the signal peptide comprises SEQ ID NO: 19.

[0073] In some embodiments, the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 20. In some embodiments, the signal peptide comprises SEQ ID NO:20. [Table 3]

[0074] In some embodiments, the expression construct comprises a sequence encoding a signal peptide, and the signal peptide is fused to a gut peptide. In some embodiments, the sequence encoding the signal peptide comprises a sequence disclosed in Table 4, or a portion of a sequence disclosed in Table 4.

[0075] In some embodiments, the sequence encoding the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 21. In some embodiments, the sequence encoding the signal peptide comprises SEQ ID NO:21.

[0076] In some embodiments, the sequence encoding the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 22. In some embodiments, the sequence encoding the signal peptide comprises SEQ ID NO:22.

[0077] In some embodiments, the sequence encoding the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 23. In some embodiments, the sequence encoding the signal peptide comprises SEQ ID NO:23.

[0078] In some embodiments, the sequence encoding the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 24. In some embodiments, the sequence encoding the signal peptide comprises SEQ ID NO:24.

[0079] In some embodiments, the sequence encoding the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 25. In some embodiments, the sequence encoding the signal peptide comprises SEQ ID NO:25.

[0080] In some embodiments, the sequence encoding the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 26. In some embodiments, the sequence encoding the signal peptide comprises SEQ ID NO:26.

[0081] In some embodiments, the sequence encoding the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 27. In some embodiments, the sequence encoding the signal peptide comprises SEQ ID NO:27.

[0082] In some embodiments, the sequence encoding the signal peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 28. In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO: 28. In some embodiments, the sequence encoding the signal peptide comprises SEQ ID NO: 28. [Table 4]

[0083] Provided are expression constructs that encode a polypeptide comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 29-36. Provided are expression constructs that encode a polypeptide comprising any one of SEQ ID NOs: 29-36.

[0084] Provided are expression constructs that encode a polypeptide comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 30, 21, or 34. Provided are expression constructs that encode a polypeptide comprising any one of SEQ ID NOs: 30, 21, or 34.

[0085] Expression constructs encoding a polypeptide comprising any one of the sequences disclosed in Table 5, or a portion of the sequences disclosed in Table 5, are provided. [Table 5-1] [Table 5-2]

[0086] Provided is an expression construct comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 37 to 44. Provided is an expression construct that encodes a polypeptide comprising any one of SEQ ID NOs: 37 to 44.

[0087] Provided are expression constructs comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 38, 39, or 42. Provided are expression constructs that encode a polypeptide comprising any one of SEQ ID NOs: 38, 39, or 42.

[0088] An expression comprising any one of the sequences disclosed in Table 6, or a portion of the sequences disclosed in Table 6, is provided. [Table 6-1] [Table 6-2]

[0089] Bicistronic expression constructs In one aspect, a bicistronic expression construct encoding a polyprotein comprising: a. the polyprotein comprises a signal peptide, a first gut peptide, and a second gut peptide; b. The polyprotein coding sequence is i. a sequence encoding the signal peptide; ii. a sequence encoding the first gastrointestinal peptide; and iii. comprising a sequence encoding the second gastrointestinal peptide; The above expression constructs are provided.

[0090] In some embodiments, the first gut peptide and / or the second gut peptide comprises a sequence selected from the group consisting of a GLP-1 peptide, an hGIP peptide, an hOXM peptide, PYY, hGlucagon, and an amylin peptide. 7-37 In an embodiment, the hGIP peptide is 1-42In some embodiments, the first gut peptide and / or the second gut peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 1-5. In some embodiments, the first gut peptide and / or the second gut peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 1-5. In some embodiments, the first gut peptide and / or the second gut peptide comprises a sequence selected from SEQ ID NOs: 1-5.

[0091] In some embodiments, the sequence encoding the first gut peptide gut peptide and / or the second gut peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 6-12. In some embodiments, the sequence encoding the first gut peptide gut peptide and / or the second gut peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 6-12. In some embodiments, the sequence encoding the first gut peptide gut peptide and / or the second gut peptide comprises a sequence selected from SEQ ID NOs: 6-12.

[0092] In some embodiments, the first gut peptide and the second gut peptide are the same gut peptide. In some embodiments, the first gut peptide and the second gut peptide are the same gut peptide, but the sequence encoding the first gut peptide and the sequence encoding the second gut peptide are different. In some embodiments, at least one of the sequence encoding the first gut peptide and the sequence encoding the second gut peptide is codon-optimized. In some embodiments, the sequence encoding the first gut peptide and the sequence encoding the second gut peptide are codon-optimized. In some embodiments, the first gut peptide and the sequence encoding the second gut peptide are hGLP-1.

[0093] In some embodiments, the first gut peptide and the second gut peptide comprise a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1. In some embodiments, the first gut peptide and the second gut peptide comprise a sequence that is at least 90% identical to SEQ ID NO: 1. In some embodiments, the first gut peptide and the second gut peptide comprise SEQ ID NO: 1.

[0094] In some embodiments, the sequence encoding the first gastrointestinal peptide and the sequence encoding the second gastrointestinal peptide comprise a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to a sequence selected from SEQ ID NOs: 6-8. In some embodiments, the sequence encoding the first gastrointestinal peptide and the sequence encoding the second gastrointestinal peptide comprise a sequence that is at least 90% identical to a sequence selected from SEQ ID NOs: 6-8. In some embodiments, the sequence encoding the first and second gastrointestinal peptides are selected from SEQ ID NOs: 6-8.

[0095] In some embodiments, the bicistronic expression construct comprises a sequence disclosed in Table 7, or a portion of a sequence disclosed in Table 7.

[0096] In some embodiments, the bicistronic expression construct comprises a sequence encoding a polypeptide that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 45 or SEQ ID NO: 55. In some embodiments, the bicistronic expression construct comprises a sequence encoding a polypeptide that is at least 90% identical to SEQ ID NO: 45 or SEQ ID NO: 55. In some embodiments, the bicistronic expression construct encodes a polypeptide comprising SEQ ID NO: 45 or SEQ ID NO: 55.

[0097] In some embodiments, the bicistronic expression construct encodes a sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 46-49, or SEQ ID NO: 56. In some embodiments, the bicistronic expression construct encodes a sequence comprising a sequence that is at least 90% identical to any one of SEQ ID NOs: 46-49, or SEQ ID NO: 56. In some embodiments, the bicistronic expression construct encodes a sequence comprising any one of SEQ ID NOs: 46-49, or SEQ ID NO: 56. [Table 7]

[0098] In some embodiments, the bicistronic expression comprises a sequence disclosed in Table 8, or a portion of a sequence disclosed in Table 8.

[0099] In some embodiments, the bicistronic expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:50 or SEQ ID NO:57. In some embodiments, the bicistronic expression construct comprises a sequence that is at least 90% identical to SEQ ID NO:50 or SEQ ID NO:57. In some embodiments, the bicistronic expression construct comprises SEQ ID NO:50 or SEQ ID NO:57.

[0100] In some embodiments, the bicistronic expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 51-54, or SEQ ID NO: 58. In some embodiments, the bicistronic expression construct comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 51-54, or SEQ ID NO: 58. In some embodiments, the bicistronic expression construct comprises a sequence selected from SEQ ID NOs: 51-54, or SEQ ID NO: 58. [Table 8-1] [Table 8-2]

[0101] Tricistronic expression constructs In one aspect, a tricistronic expression construct encoding a polyprotein, comprising: a. the polyprotein comprises a signal peptide, a first gut peptide, a second gut peptide, and a third gut peptide; b. The polyprotein coding sequence is i. A sequence encoding the signal peptide ii. a sequence encoding the first gut peptide; iii. a sequence encoding the second gut peptide; and iv. comprising a sequence encoding the third gastrointestinal peptide; The above expression constructs are provided.

[0102] In some embodiments, the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence selected from the group consisting of an hGLP-1 peptide, an hGIP peptide, an hOXM peptide, (PYY, hGlucagon, and an amylin peptide. In embodiments, the hGLP-1 peptide is an hGLP-1 7-37 In an embodiment, the hGIP peptide is 1-42 In some embodiments, the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 1-5. In some embodiments, the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 1-5. In some embodiments, the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence selected from SEQ ID NOs: 1-5.

[0103] In some embodiments, the sequence encoding the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 6-12. In some embodiments, the sequence encoding the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 6-12. In some embodiments, the sequence encoding the first gut peptide, the second gut peptide, and / or the third gut peptide comprises a sequence selected from SEQ ID NOs: 6-12.

[0104] In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence disclosed in Table 9, or a portion of a sequence disclosed in Table 9. In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence disclosed in Table 10, or a portion of a sequence disclosed in Table 10.

[0105] In some embodiments, the first gut peptide, the second gut peptide, and the third gut peptide are the same gut peptide. In some embodiments, the first gut peptide, the second gut peptide, and the third gut peptide are the same gut peptide, but the sequence encoding the first gut peptide, the sequence encoding the second gut peptide, and the sequence encoding the third gut peptide are different. In some embodiments, at least one of the sequence encoding the first gut peptide, the sequence encoding the second gut peptide, and the sequence encoding the third gut peptide is codon-optimized. In some embodiments, the sequence encoding the first gut peptide, the sequence encoding the second gut peptide, and the sequence encoding the third gut peptide is codon-optimized.

[0106] In some embodiments, the first gut peptide, the second gut peptide, and the third gut peptide are hGLP-1.

[0107] In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 59-61, or SEQ ID NO: 75. In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence that is at least 90% identical to any one of SEQ ID NOs: 59-61, or SEQ ID NO: 75. In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence selected from SEQ ID NOs: 59-61, or SEQ ID NO: 75.

[0108] In some embodiments, the tricistronic expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 67-69, or SEQ ID NO: 78. In some embodiments, the tricistronic expression construct comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 67-69, or SEQ ID NO: 78. In some embodiments, the tricistronic expression construct comprises a sequence selected from SEQ ID NOs: 67-69, or SEQ ID NO: 78.

[0109] In some embodiments, the first gut peptide and the second gut peptide are different gut peptides. In some embodiments, the first gut peptide, the second gut peptide, and the third gut peptide are different gut peptides.

[0110] In some embodiments, the first gut peptide, the second gut peptide, and the third gut peptide are selected from the group consisting of: (1) an hGLP-1 peptide, an hOXM peptide, and a PYY, or (2) an hGLP-1 peptide, an hGlucagon peptide, and an hGIP peptide. 7-37 In an embodiment, the hGIP peptide is 1-42 It is a peptide.

[0111] In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 62-66, or SEQ ID NOs: 76-77. In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence that is at least 90% identical to any one of SEQ ID NOs: 62-66, or SEQ ID NOs: 76-77. In some embodiments, the tricistronic expression construct encodes a sequence comprising a sequence comprising any one of SEQ ID NOs: 62-66, or SEQ ID NOs: 76-77.

[0112] In some embodiments, the tricistronic expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 70-74, or SEQ ID NOs: 79-80. In some embodiments, the tricistronic expression construct comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 70-74, or SEQ ID NOs: 79-80. In some embodiments, the tricistronic expression construct comprises any one of SEQ ID NOs: 70-74, or SEQ ID NOs: 79-80. [Table 9-1] [Table 9-2] [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4]

[0113] Furin recognition and cleavage sequence Provided herein are expression constructs that encode one or more sequences recognized by a protease. In an embodiment, the protease is furin. Furin cleaves proteins immediately downstream of a minimal furin cleavage site of basic amino acids. In an embodiment, this minimal furin cleavage site is Arg-XX-Arg (preferably Arg-X-(Arg / Lys)-Arg). However, furin may recognize a longer sequence in a target polypeptide in addition to the minimal furin cleavage site. This longer sequence (including the minimal furin cleavage site) is referred to herein as a "furin recognition and cleavage sequence." Inclusion of a furin recognition and cleavage sequence can facilitate complete processing and production of a functional N-terminus of an expressed polypeptide (such as a gut peptide or a polyprotein that includes one or more gut peptides) in non-endocrine cells.

[0114] In some embodiments, the Furin recognition and cleavage sequence comprises a portion of (1) any one of SEQ ID NOs: 89, 92-96, or (2) a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 89, 92-96. In some embodiments, the Furin recognition and cleavage sequence comprises a portion of (1) any one of SEQ ID NOs: 89, 92-96, or (2) a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 89, 92-96.

[0115] In embodiments, an expression construct is provided that includes a sequence encoding any one of SEQ ID NOs: 89, 92-96, or a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 89, 92-96.

[0116] In embodiments, an expression construct is provided that includes a sequence encoding any one of the sequences RKKR (SEQ ID NO: 97), RMQR (SEQ ID NO: 98), VFRR (SEQ ID NO: 99), or RKKR (SEQ ID NO: 100).

[0117] In embodiments, the monocistronic, bicistronic, or tricistronic expression construct comprises a sequence disclosed in Table 11, or a portion of a sequence disclosed in Table 11. In embodiments, the monocistronic, bicistronic, or tricistronic expression construct comprises a sequence encoding a sequence disclosed in Table 11, or a portion of a sequence disclosed in Table 11.

[0118] Provided herein are expression constructs that include one or more sequences that are at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any of the sequences disclosed herein. Provided herein are expression constructs that include one or more sequences that include a portion of any of the sequences disclosed herein.

[0119] Provided herein are expression constructs that encode one or more sequences that are at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 91%, at least 97%, at least 98%, or at least 99% identical to any of the sequences disclosed herein. Provided herein are expression constructs that encode one or more sequences that include a portion of any of the sequences disclosed herein. [Table 11]

[0120] Leader sequence In embodiments, the expression constructs disclosed herein include a leader sequence. As used herein, a "leader sequence" is a sequence that includes (1) a signal peptide and a protease recognition and cleavage sequence, and / or (2) a signal peptide and a minimal protease cleavage site. In embodiments, the leader sequence includes (1) a signal peptide and a Furin recognition and cleavage sequence, and / or (2) a signal peptide and a minimal Furin cleavage site. Inclusion of a Furin recognition and cleavage sequence in a leader sequence can facilitate complete processing and production of a functional N-terminus of an expressed polypeptide, such as a gut peptide or a polyprotein that includes one or more gut peptides, in non-endocrine cells.

[0121] The leader sequence can be derived from a naturally occurring, secreted polypeptide or from a variant of a naturally occurring, secreted polypeptide, hi embodiments, the leader sequence, or a portion thereof, is derived from influenza virus hemagglutinin, human growth hormone, mouse growth hormone releasing hormone, or human albumin.

[0122] promoter Any suitable promoter can be used in the expression constructs disclosed herein. In some embodiments, the promoter is a CMV or CASI promoter.

[0123] Regulation of gene expression In some embodiments, the expression constructs disclosed herein provide for constitutive expression of a polypeptide disclosed herein.

[0124] In some embodiments, the expression constructs disclosed herein provide for controllable expression of a polypeptide disclosed herein.

[0125] In embodiments, the sequence encoding a polypeptide disclosed herein comprises a riboswitch comprising an aptamer, and the riboswitch is operably linked to the sequence encoding the polypeptide. In embodiments, the sequence encoding a polypeptide disclosed herein comprises a gene regulatory cassette, and the gene regulatory cassette comprises an aptamer. In embodiments, the polypeptide is a polyprotein disclosed herein.

[0126] Aptamers are single-stranded nucleic acid molecules that fold into a three-dimensional structure to non-covalently bind to a particular ligand with high affinity and specificity. Aptamer ligands include ions, small molecules, proteins, viruses, and cells. Aptamer ligands can be, for example, organic compounds, amino acids, steroids, carbohydrates, or nucleotides. Non-limiting examples of small molecule aptamer ligands include antibiotics, therapeutic drugs, dyes, cofactors, metabolites, molecular markers, neurotransmitters, pollutants, toxins, food impurities, carcinogens, and drugs of abuse. Aptamers are therefore useful for the detection of small molecules. Applications of small molecule detection by aptamers include environmental monitoring, food safety, medicine (including diagnostics), microbiology, analytical chemistry, forestry science, agriculture, and basic biology research. As used herein, the term "aptamer" refers to an RNA polynucleotide (or a DNA sequence encoding an RNA polynucleotide) that specifically binds to a class of ligand. The term "ligand" refers to a molecule that is specifically bound by an aptamer. Aptamers have a binding region capable of forming a complex with a target molecule of interest (i.e., a ligand). Aptamers are typically about 15 to about 200 nucleotides in length. More commonly, aptamers are about 30 to about 100 nucleotides in length, e.g., 70 to 90 nucleotides in length. Aptamers typically include multiple paired (P) regions, where the aptamers form stems, and unpaired regions, where the aptamers form binding (J) or loop (L) regions. The paired regions can be numbered consecutively starting from the 5' end (P1), with the numbering continuing down each stem (P2, P3, etc.). The loops (L1, L2, etc.) are numbered based on adjacent paired regions, and the binding regions are numbered according to the paired regions to which they are linked. Aptamers are oligonucleotides that bind to target ligands with high affinity and specificity.

[0127] In embodiments, the presence of a small molecule that binds to an aptamer results in increased expression of the sequence that encodes the polypeptide disclosed herein, compared to the expression of the sequence that encodes the polypeptide disclosed herein in the absence of the small molecule.In such embodiments, the aptamer constitutes an "on" switch.In embodiments, the expression of the sequence that encodes the polypeptide disclosed herein increases at least 3-fold, at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 100-fold, at least 1000-fold, or at least 10,000-fold in the presence of a small molecule that binds to an aptamer, compared to the expression of the sequence that encodes the polypeptide disclosed herein in the absence of the small molecule. In embodiments, expression of a sequence encoding a polypeptide disclosed herein is increased 2-fold to 10-fold, 5-fold to 10-fold, 5-fold to 15-fold, 5-fold to 20-fold, 5-fold to 25-fold, 5-fold to 30-fold, 10-fold to 20-fold, 10-fold to 30-fold, 10-fold to 40-fold, 10-fold to 50-fold, 10-fold to 100-fold, 10-fold to 500-fold, 10-fold to 1,000-fold, 50-fold to 100-fold, 50-fold to 500-fold, 50-fold to 100-fold, 50-fold to 1,000-fold, 100-fold to 1,000-fold, or 100-fold to 10,000-fold in the presence of a small molecule that binds to the aptamer compared to in the absence of the small molecule.

[0128] In embodiments, the presence of a small molecule that binds to the aptamer results in a decrease in the expression of the sequence that encodes the polypeptide disclosed herein, compared to the expression of the sequence that encodes the polypeptide disclosed herein in the absence of the small molecule.In such embodiments, the aptamer constitutes an "off" switch.In embodiments, the expression of the sequence that encodes the polypeptide disclosed herein is decreased by at least 3 times, at least 5 times, at least 10 times, at least 15 times, at least 20 times, at least 25 times, at least 30 times, at least 40 times, at least 50 times, at least 100 times, at least 1000 times, or at least 10,000 times in the presence of a small molecule that binds to the aptamer, compared to the expression of the sequence that encodes the polypeptide disclosed herein in the absence of the small molecule. In one embodiment, expression of a sequence encoding a polypeptide disclosed herein is reduced by 2-fold to 10-fold, 5-fold to 10-fold, 5-fold to 15-fold, 5-fold to 20-fold, 5-fold to 25-fold, 5-fold to 30-fold, 10-fold to 20-fold, 10-fold to 30-fold, 10-fold to 40-fold, 10-fold to 50-fold, 10-fold to 100-fold, 10-fold to 500-fold, 10-fold to 1,000-fold, 50-fold to 100-fold, 50-fold to 500-fold, 50-fold to 100-fold, 50-fold to 1,000-fold, 100-fold to 1,000-fold, or 100-fold to 10,000-fold in the presence of a small molecule that binds to the aptamer compared to in the absence of the small molecule.

[0129] In embodiments, the aptamer is part of a riboswitch. A riboswitch is a regulatory segment of an RNA polynucleotide that controls the stability of the RNA polynucleotide and / or the production of a protein from the RNA polynucleotide in response to the presence or absence of an aptamer-specific ligand molecule. In embodiments, the riboswitch comprises a sensor region (e.g., an aptamer region) and an effector region, both of which are responsible for sensing the presence of a ligand (e.g., a small molecule) and triggering an effect that results in an increase or decrease in the expression of a sequence encoding a polypeptide disclosed herein. The riboswitches described herein are recombinant and utilize polynucleotides from two or more sources. In embodiments, the sensor and effector regions are linked by a polynucleotide linker. In embodiments, the polynucleotide linker forms an RNA stem or pairing region (i.e., a region of the RNA polynucleotide that is double stranded). In embodiments, the pairing region that links the aptamer to the effector region comprises all or a portion of the aptamer stem (e.g., all or a portion of the aptamer P1 stem).

[0130] Riboswitches containing aptamer sequences can be used to control the formation of rho-independent transcription termination hairpins, for example, which result in premature transcription termination. Riboswitches containing aptamer sequences can also induce conformational changes in RNA, resulting in sequestration of ribosome binding sites and inhibition of translation. Alternative riboswitch structures containing aptamer sequences disclosed herein can also affect splicing of mRNA in response to the presence of small molecule ligands.

[0131] Alternative splicing riboswitches In one embodiment, the riboswitches described herein are encoded as part of a gene regulatory cassette to control aptamer / ligand-mediated alternative splicing of the resulting RNA (e.g., pre-mRNA) encoding a polypeptide as disclosed herein. In this context, the gene regulatory cassette comprises a riboswitch that includes a sensor region (e.g., an aptamer as described herein) and an effector region that together sense the presence of a small molecule ligand and are responsible for alternative splicing to alternative exons. Splicing refers to the process by which intronic sequences are removed from the nascent pre-messenger RNA (pre-mRNA) and exons are joined to form the mRNA. Splice sites are the junctions between exons and introns and are defined by consensus sequences of different splice sites at the 5' and 3' ends of the intron (i.e., splice donor and splice acceptor sites, respectively). Splicing is performed by a large multicomponent structure called the splicesome, which is an assembly of small nuclear ribonucleoproteins (snRNPs) and an array of diverse auxiliary proteins. By recognizing various cis-regulatory sequences, the splicesome defines exon / intron boundaries, removes intronic sequences, and splices exons into the final message (e.g., mRNA). In the case of alternative splicing, the inclusion or exclusion of certain exons can alter the final coding message and thus the resulting expressed protein.

[0132] In one embodiment, control of expression of sequences encoding the polypeptides disclosed herein is achieved using any of the DNA constructs disclosed in PCT Patent Publication No. WO2016 / 126747, which is incorporated herein by reference in its entirety. In an embodiment of the disclosure, the riboswitch and polynucleotide cassettes disclosed in PCT Patent Publication No. WO2016 / 126747 include an aptamer sequence described herein in place of the aptamer sequence disclosed in PCT Patent Publication No. WO2016 / 126747.

[0133] In one embodiment, the polynucleotide cassette comprises (a) a riboswitch and (b) an alternatively spliced ​​exon flanked by a 5' intron and a 3' intron, the riboswitch comprising (i) a stem forming sequence comprising the 5' splice site sequence of the 3' intron and an effector region comprising a sequence complementary to the 5' splice site sequence of the 3' intron, and (ii) an aptamer. In an embodiment, the effector region comprises an intronic 5' splice site ("5'ss") sequence of the intron immediately 3' to the alternative exon, as well as a sequence complementary to the 5'ss sequence of the 3' intron. When the aptamer binds to its ligand, the effector region forms a stem, thus preventing splicing to the splice donor site at the 3' end of the alternative exon. Under certain conditions (e.g., when the aptamer does not bind its ligand), the effector region is in the context of conferring access to a splice donor site at the 3' end of the alternative exon, and the alternative exon is included in the mRNA of the sequence encoding the polypeptide disclosed herein. In some embodiments, the polynucleotide cassette is placed in the sequence encoding the polypeptide gene disclosed herein and controls expression of the sequence encoding the polypeptide disclosed herein in response to a ligand. In one embodiment, the alternatively spliced ​​exon includes a stop codon that is in frame with the sequence encoding the polypeptide disclosed herein when the alternatively spliced ​​exon is spliced ​​into the mRNA of the sequence encoding the polypeptide disclosed herein.

[0134] In one embodiment, the gene regulatory cassette comprises the sequence of SEQ ID NO: 101, where -X- represents the aptamer sequence. The lower case letters indicate paired stem sequences that link the aptamer to the remainder of the riboswitch. In one embodiment, an alternative exon (underlined in SEQ ID NO: 101 below) is replaced with another alternative exon sequence.

[0135] [ka]

[0136] The alternative exons are flanked by 5' and 3' intron sequences. The 5' and 3' intron sequences that can be used in the gene regulatory cassettes disclosed herein can be any sequence that can be spliced ​​from the sequences encoding the polypeptides disclosed herein to create either the mRNA of the sequences encoding the polypeptides disclosed herein or the mRNA of the sequences encoding the polypeptides disclosed herein that includes the alternative exons. The 5' and 3' intron sequences each have the necessary sequences for splicing to occur, i.e., splice donor, splice acceptor, and branch point sequences. In one embodiment, the 5' and 3' intron sequences of the gene regulatory cassette are derived from one or more naturally occurring introns or portions thereof. In one embodiment, the 5' and 3' intron sequences are derived from a truncated human β-globin intron 2 (IVS2Δ), intron 2 of the human β-globin gene, an SV40 mRNA intron (used in the pCMV-LacZ vector from Clontech Laboratories, Inc.), intron 6 of the human triosephosphate isomerase isomerase (TPI) gene (Nott Ajit, et al. RNA. 2003, 9:6070617), an intron of human factor IX (Sumiko Kurachi, et al. J. Bio. Chem. 1995, 270(10), 5276), or any genomic fragment or synthetic intron (Yi Lai, et al. Hum Gene Ther. 2006:17(10): 1036) that contains sufficient elements for regulated splicing (Thomas A. Cooper, Methods 2005 (37):331).

[0137] The splice donor and splice acceptor sites in the alternative splicing gene regulatory cassette can be modified to strengthen or weaken. That is, the splice site sequence can be modified by standard cloning methods, site-directed mutagenesis, etc. to approach the splice donor or acceptor consensus. Splice site sequences that are more similar to the splice consensus sequence tend to promote splicing and therefore be strengthened. Splice site sequences that are less similar to the splice consensus sequence tend to inhibit splicing and therefore be weakened. The consensus for the most common class of splice donors in introns (U2) is A / CAG||GTA / GAGT (SEQ ID NO: 102, where || represents the exon / intron boundary). The consensus for the splice acceptor is CAG||G (where || represents the exon / intron boundary). The frequency of particular nucleotides at splice donor and acceptor sites has been described in the art (see, e.g., Zhang, MQ, Hum Mol Genet. 1988. 7(5):919-932). The strength of the 5' and 3' splice sites can be adjusted to regulate the splicing of alternative exons.

[0138] Further modifications to the 5' and 3' introns present in the alternative splicing gene regulatory cassette that can modulate splicing include modifying, deleting and / or adding intronic splicing enhancer elements, intronic splicing suppressor elements and / or splice sites and / or modifying branch point sequences.

[0139] In one embodiment, the 5' intron is modified to contain a stop codon that is in frame with the sequence encoding the polypeptide disclosed herein. The 5' and 3' intron sequences can also be modified to remove hidden slice sites, which can be identified with publicly available software (see, for example, Kapustin, Y. et al. Nucl. Acids Res. 2011. 1-8).

[0140] For example, the length of the 5' and 3' intron sequences can be adjusted to meet size requirements for the viral expression construct. In one embodiment, the 5' and / or 3' intron sequences are from about 50 to about 300 nucleotides in length. In one embodiment, the 5' and / or 3' intron sequences are from about 125 to about 240 nucleotides in length.

[0141] The stem portion of the effector region must be of sufficient length (and GC content) to substantially prevent alternative splicing of the alternative exon when a ligand binds to the aptamer, while still allowing access to the splice site when the ligand is not present in sufficient amounts. In an embodiment, the stem portion of the effector region comprises a stem sequence in addition to the 5' splice site sequence of the 3' intron and the complement of the 5' splice site sequence. In an embodiment, this additional stem sequence comprises a sequence from the aptamer stem. The length and sequence of the stem portion can be modified using known techniques to identify stems that allow acceptable background expression of sequences encoding the polypeptides disclosed herein in the absence of ligand, and acceptable expression levels of sequences encoding the polypeptides disclosed herein in the presence of ligand. In one embodiment, the length of the effector region stem of the riboswitch is about 7 to about 20 base pairs. In one embodiment, the length of the effector region stem is 8 to 11 base pairs. In addition to stem length, the GC base pair content of the stem can be varied to modify the stability of the stem.

[0142] In one embodiment, the alternative exon that is part of the alternative splicing gene regulatory cassette disclosed herein is a polynucleotide sequence that can be transcribed into a pre-mRNA and alternatively spliced ​​into the mRNA of the sequence encoding the polypeptide disclosed herein. In one embodiment, the alternative exon contains at least one sequence that inhibits translation when the alternative exon is included in the mRNA of the sequence encoding the polypeptide disclosed herein, such that expression of the sequence encoding the polypeptide disclosed herein from the mRNA is prevented or reduced. In a preferred embodiment, the alternative exon contains a stop codon (TGA, TAA, TAG) that is in frame with the sequence encoding the polypeptide disclosed herein when the alternative exon is included in the mRNA of the sequence encoding the polypeptide disclosed herein by splicing. In an embodiment, the alternative exon contains another sequence in addition to or as an alternative to the stop codon that reduces or substantially prevents translation when the alternative exon is incorporated into the mRNA of the sequence encoding the polypeptide disclosed herein by splicing, for example, containing a microRNA binding site, resulting in degradation of the mRNA. In one embodiment, the alternative exon contains a miRNA binding sequence that results in degradation of the mRNA. In one embodiment, the alternative exon codes for a polypeptide sequence that reduces the stability of a protein containing the polypeptide sequence. In one embodiment, the alternative exon codes for a polypeptide sequence that directs degradation of a protein containing the polypeptide sequence.

[0143] Baseline or background levels of splicing of alternative exons can be optimized by altering exon splice enhancer (ESE) and exon splice suppressor (ESS) sequences and / or by introducing ESE or ESS sequences into alternative exons. Such changes to the sequences of alternative exons can be achieved using methods well known in the art, including, but not limited to, site-directed mutagenesis. Alternatively, oligonucleotides of desired sequences (e.g., including all or part of an alternative exon) can be obtained from commercial sources and cloned into a gene regulatory cassette. Identification of ESS and ESE or ESS sequences can be achieved by methods well known in the art, including, for example, ESEfinder 3.0 (Cartegni, L. et al. ESEfinder: a web source for identifying exon splicing enhancers, Nucleic Acid Research, 2003, 31(13): 3568-3571, and / or other available resources.

[0144] In one embodiment, the alternative exon is a naturally occurring exon. In another embodiment, the alternative exon is derived from all or a portion of a known exon. In this context, "derived from" refers to an alternative exon that contains a sequence that is substantially homologous to a naturally occurring exon or a portion thereof, but may contain various mutations, such as mutations generated by altering exon splice enhancer (ESE) and exon splice suppressor (ESS) sequences and / or by introducing ESE or ESS sequences into the alternative exon. As used herein, "homology" and "homology" refer to the percent identity of two polynucleotide sequences or two polypeptide sequences. The correspondence of one sequence to another can be measured by techniques well known in the art. For example, homology can be measured by directly comparing two polypeptide molecules by aligning the sequences and using readily available computer programs. Alternatively, homology can be measured by hybridizing polynucleotides under conditions that form stable duplexes between the homologous regions, followed by digestion with single-strand specific nuclease(s) and measuring the size of the digested fragments. Two polynucleotides, or two polypeptide sequences, are "substantially homologous" to each other if, after optimal alignment with appropriate insertions or deletions, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of the nucleotides or amino acids, respectively, match over a defined length of the molecules, as measured using the above methods.

[0145] In one embodiment, the alternative exon is exogenous to the sequence encoding the polypeptide disclosed herein, however, the alternative exon can be derived from a sequence derived from the organism in which the sequence encoding the polypeptide disclosed herein is expressed. As used herein, "exogenous" means derived from an element that is genotypically different from the rest of the element to which it is compared or introduced or incorporated. For example, a polynucleotide introduced into a different cell type by genetic engineering techniques is a heterologous polynucleotide (and can encode a heterologous polypeptide upon expression). In one embodiment, the alternatively spliced ​​exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), exon 5 of mutant human Wilms tumor 1, mouse calcium / calmodulin-dependent protein kinase II delta exon 16, or exon 6 of SIRT1. In an embodiment, the alternatively spliced ​​exon is or includes the modified DHFR exon 2 (GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAAATCTTCAGTAGAAG) in SEQ ID NO: 103. In embodiments, the alternatively spliced ​​exon is or comprises modified DHFR exon 2 (GAATGAATTCAGATATTTCCAGAGAATGAAAAAAAATCTTCAGTAGAAG) in SEQ ID NO:104.

[0146] Aptamer-mediated cleavage by a self-cleaving ribozyme In one embodiment, aptamer-mediated expression of sequences encoding polypeptides disclosed herein is controlled by aptamer-mediated regulation of small endonucleolytic ribozymes. Ribozymes are RNA enzymes that catalyze chemical reactions. The ribozyme can be any small endonucleolytic ribozyme that self-cleaves in a target cell type, including but not limited to hammerhead, hairpin, hepatitis delta virus, Varkud satellite, twister, twister sister, pistol, or hatchet ribozymes. Thus, in one embodiment, an expression cassette is provided that includes a riboswitch and a riboswitch that contains a ribozyme linked to an aptamer. WO2017 / 136608, the entirety of which is incorporated herein by reference, describes a riboswitch that activates the self-cleavage of a ribozyme in the presence of an aptamer ligand (an "off" switch) or inhibits the self-cleavage of a ribozyme in the presence of an aptamer (an "on" switch).

[0147] In the "off" switch scenario, the binding of the aptamer / ligand increases the ribonuclease function of the ribozyme, resulting in cleavage of the RNA of the sequence encoding the polypeptide disclosed herein, which contains the polynucleotide cassette, thereby decreasing the expression of the sequence encoding the polypeptide disclosed herein. An example of such an off switch includes a polynucleotide cassette for controlling the expression of the sequence encoding the polypeptide disclosed herein, which comprises a riboswitch comprising a twister ribozyme linked to an aptamer by a stem, where the stem linking the twister ribozyme to the aptamer is attached to the ribozyme at the position of the P3 stem of the twister ribozyme, and the sequence encoding the polypeptide disclosed herein is linked to the P1 stem of the twister ribozyme (see, for example, Figures 1a, 1b, or 3a of WO2017 / 136608 and related text, which are incorporated herein by reference).

[0148] In the "on" switch scenario, binding of the aptamer / ligand inhibits the ribonuclease function of the ribozyme, reducing cleavage of RNA of the sequence encoding the polypeptide disclosed herein containing the polynucleotide cassette, thereby increasing expression of the sequence encoding the polypeptide disclosed herein in the presence of the ligand. An example of an on-switch is a riboswitch comprising a twister ribozyme linked to an aptamer, where the aptamer is linked to the 3' or 5' end of the twister ribozyme P1 stem, such that when the aptamer is linked to the 3' end of the twister ribozyme P1 stem, a portion of the 3' arm of the twister ribozyme P1 stem is instead the 5' arm of the aptamer P1 stem, and when the aptamer is linked to the 5' end of the twister ribozyme P1 stem, a portion of the 5' arm of the twister ribozyme P1 stem is instead the 3' arm of the aptamer P1 stem (see, e.g., Figures 6a-6b and related text of WO2017 / 136608, which are incorporated herein by reference).

[0149] Aptamer modulation of polyadenylation In embodiments, expression of sequences encoding the polypeptides disclosed herein is controlled by aptamer-mediated polyadenylation. The 3' end of nearly all eukaryotic mRNAs contains a poly(A) tail - a homopolymer of 20 to 250 adenosine residues. Adding a poly(A) tail to an mRNA protects it from degradation, and thus controlling the polyadenylation of the corresponding mRNA can affect gene expression.

[0150] In one embodiment, expression of sequences encoding the polypeptides disclosed herein is controlled by aptamer-mediated accessibility of a polyadenylation signal, as described in WO2018 / 156658, which is incorporated herein by reference in its entirety. In such an embodiment, the riboswitch comprises an effector stem loop and an aptamer, where the effector stem loop comprises a polyadenylation signal, and the aptamer and effector stem loop are linked by an alternative shared stem arm that comprises a sequence complementary to a non-shared arm of the aptamer stem and to a non-shared arm of the effector stem loop. (See, e.g., Figures 1a, 1b, 2a, and 5a of WO2018 / 156658, which is incorporated herein by reference, and associated text). In one embodiment, the effector stem loop is located on the 3' side of the aptamer such that the alternative shared stem arm comprises all or a portion of the 3' aptamer stem arm and all or a portion of the 5' arm of the effector stem. In one embodiment, the effector stem loop is located on the 5' side of the aptamer such that the alternative shared stem arm comprises all or a portion of the 5' aptamer stem arm and all or a portion of the 3' arm of the effector stem. In one embodiment, the polyadenylation signal is AATAAA (SEQ ID NO: 105) or ATTAAA (SEQ ID NO: 106). In one embodiment, the polyadenylation signal is a downstream element (DSE). In one embodiment, the polyadenylation signal is an upstream sequence element (USE). In one embodiment, the polynucleotide cassette comprises two riboswitches, the effector stem loop of the first riboswitch comprises all or part of the polyadenylation signal AATAAA (SEQ ID NO: 105) or ATTAAA (SEQ ID NO: 106), and the effector stem loop of the second riboswitch comprises all or part of the downstream element (DSE). In one embodiment, the two riboswitches each comprise an aptamer that binds to the same ligand. In one embodiment, the two riboswitches comprise different aptamers that bind to different ligands.

[0151] In some embodiments, a riboswitch comprises a sensing region (e.g., an aptamer) and an effector region that includes a binding site for the small nuclear ribonucleoprotein (snRNP) U1, which is part of the spliceosome. WO2017 / 136591 describes a riboswitch, where the effector region includes a U1 snRNP binding site, and is incorporated by reference in its entirety. When the aptamer binds to its ligand, the effector region forms a stem and sequesters the U1 snRNP binding site so that it does not bind U1 snRNP. Under certain conditions (e.g., when the aptamer does not bind to its ligand), the effector region is in the context of granting access to the U1 snRNP binding site, allowing U1 snRNP to bind to mRNA and inhibit polyadenylation, resulting in degradation of the message. The U1 snRNP binding site can be any polynucleotide sequence capable of binding to U1 snRNP, thereby recruiting U1 snRNP to the 3'UTR of a sequence encoding a polypeptide disclosed herein and inhibiting polyadenylation of the mRNA of a sequence encoding a polypeptide disclosed herein. In one embodiment, the U1 snRNP binding site is the consensus site CAGGTAAGTA (SEQ ID NO: 107) (or, if present in the mRNA, CAGGUAAGUA, SEQ ID NO: 108). In some embodiments, the U1 snRNP binding site is a variation of this consensus sequence, including, for example, a sequence that is shorter than the consensus sequence or has one or more nucleotides that vary from the consensus sequence. In one embodiment, the U1 snRNP binding site contains the sequence CAGGTAAG (SEQ ID NO: 109). In some embodiments, the binding site is encoded by a sequence selected from CAGGTAAGTA (SEQ ID NO: 107), CAGGTAAGT (SEQ ID NO: 110), and CAGGTAAG (SEQ ID NO: 109). The U1 snRNP binding site can be any 5' splice site from the gene, for example, the 5' splice site from human DHFR exon 2.

[0152] Aptamer-mediated modulation of ribonuclease cleavage In one embodiment, expression of sequences encoding the polypeptides disclosed herein is controlled by aptamer-mediated ribonuclease cleavage. Ribonucleases (RNases) recognize and cleave specific ribonuclease substrate sequences. Provided herein are recombinant DNA constructs that, when incorporated into the DNA of sequences encoding the polypeptides disclosed herein, confer the ability to control expression of sequences encoding the polypeptides disclosed herein by aptamer / ligand-mediated ribonuclease cleavage of the resulting RNA. In some embodiments, the sequences encoding the aptamers described herein are part of a construct that contains or encodes a ribonuclease substrate sequence and a riboswitch that includes an effector region and an aptamer, such that expression of sequences encoding the polypeptides disclosed herein occurs when the aptamer binds to the ligand (as described in WO2018 / 161053, which is incorporated herein by reference in its entirety). In embodiments, an RNase P substrate sequence is linked to a riboswitch, where the riboswitch comprises an effector region and an aptamer, where the effector region comprises a sequence complementary to a portion of the RNase P substrate sequence. Binding of a suitable ligand to the aptamer induces a conformational change in the aptamer and effector region that changes the accessibility of the ribonuclease substrate sequence to cleavage by the ribonuclease.

[0153] In one embodiment, the aptamer sequence is located 5' to the RNase P substrate sequence, and the effector region comprises all or a portion of the leader sequence and all or a portion of the 5' acceptor stem sequence of the RNase P substrate sequence. See, e.g., Figures 1a, 1b, and 3b of WO2018 / 161053 and associated text, which are incorporated herein by reference. In further embodiments, the acceptor stem of the RNase P substrate and the riboswitch effector region are separated by 0, 1, 2, 3, or 4 nucleotides. In other embodiments, the effector region stem comprises, in addition to the leader sequence (and its complement), one or more nucleotides of the acceptor stem of the RNase P substrate and a sequence complementary to one or more nucleotides of the acceptor stem.

[0154] In one embodiment, the aptamer sequence of the polynucleotide cassette is located 3' to the RNase P substrate sequence, and the effector region comprises a sequence complementary to all or a portion of the 3' acceptor stem of the RNase P substrate sequence. See, for example, FIG. 3a and associated text of WO2018 / 161053, which is incorporated herein by reference. In a further embodiment, the effector region sequence complementary to the 3' acceptor stem of the RNase P substrate is 1-7 nucleotides. In other words, the effector region stem comprises 1-7 nucleotides of the acceptor stem and comprises a sequence complementary to said 1-7 nucleotides of the acceptor stem. In an embodiment, the riboswitch is located 3' to the RNase P substrate, such that the effector region stem and the acceptor stem of the RNase P substrate do not overlap. In an embodiment, the effector region and the acceptor stem of the RNase P substrate are directly adjacent (i.e., do not overlap). In other embodiments, the effector region and the acceptor stem of the RNase P substrate are separated by 1, 2, 3, 4, 5, or more nucleotides.

[0155] vector In one aspect, a recombinant vector for introducing an expression construct disclosed herein and its use are provided. In some embodiments, the vector disclosed herein comprises additional DNA elements, including DNA segments, that provide for the replication of DNA in a host cell and / or the expression of a sequence encoding a polypeptide disclosed herein in a target cell at an appropriate level. Those skilled in the art understand that an expression control sequence (promoter, enhancer, etc.) is selected according to its ability to promote the expression of a sequence encoding a polypeptide disclosed herein in a target cell. By "vector" is meant a recombinant plasmid, yeast artificial chromosome (YAC), minichromosome, DNA minicircle or virus (including virus-derived sequences) that comprises a polynucleotide that can be delivered to a host cell either in vitro or in vivo. In one embodiment, the recombinant vector is a viral vector or a combination of multiple viral vectors.

[0156] Viral vectors for expressing the sequence encoding the polypeptide disclosed herein in target cells, tissues, or living organisms are well known in the art, and include adenovirus (AV) vectors, adeno-associated virus (AAV) vectors, retrovirus and lentivirus vectors, and herpes simplex type 1 (HSV1) vectors. Also included are viral particles that contain the nucleic acid encoding the polypeptide disclosed herein. In an embodiment, the viral particle is an AAV particle.

[0157] Adenoviral vectors include, for example, those based on human adenovirus type 2 and human adenovirus type 5, which have been rendered replication-deficient by deletion of the E1 and E3 regions. A transcription cassette can be inserted into the E1 region to obtain an E1 / E3 deleted recombinant AV vector. Adenoviral vectors include helper-dependent, large-capacity adenoviral vectors (also known as large-capacity, "gutless" or "gutted" vectors) that do not contain viral coding sequences. These vectors contain cis-acting elements required for viral DNA replication and packaging, mainly inverted terminal repeats (ITRs) and packaging signals (CYs). These helper-dependent AV vector genomes have the potential to carry foreign DNA from several hundred base pairs to about 36 kb.

[0158] Recombinant adeno-associated virus "rAAV" vectors include any vector derived from any adeno-associated virus serotype, including, but not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7, and AAV-8, AAV-9, AAV-10, AAVrhlO, and AAV2-retro (disclosed in PCT Patent Publication No. WO2017218842A1, which is incorporated herein in its entirety). rAAV vectors can have one or more of the AAV wild-type genes, preferably the Rep and / or Cap genes, deleted in whole or in part, but retaining functional flanking ITR sequences. The functional ITR sequences are retained for rescue, replication, packaging, and potential chromosomal integration of the AAV genome. The ITRs do not have to be the wild-type nucleotide sequence, but can be altered (eg, by insertion, deletion, or substitution of nucleotides) so long as the sequence provides for functional rescue, replication, and packaging.

[0159] Alternatively, other systems such as lentiviral vectors can be used.Lentiviral-based systems can transduce non-dividing cells as well as dividing cells, making them useful for targeting non-dividing cells of the CNS, for example.Lentiviral vectors are derived from human immunodeficiency virus, and like that virus, they can be integrated into host genome, providing the possibility of very long-term gene expression.

[0160] Polynucleotides, including plasmids, YACs, minichromosomes and minicircles, carrying sequences encoding the polypeptides disclosed herein, containing gene regulatory cassettes, can also be introduced into cells or organisms by non-viral vector systems, for example, using cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) polymer and polyethyleneimine (PEI) polymer systems can also be used to deliver vectors to cells. Other methods of delivering vectors to cells include the use of hydrodynamic injection, electroporation, and ultrasound, both for cell cultures and organisms. For a review of viral and non-viral delivery systems for gene delivery, see Nayerossadat, N. et al. (Adv Biomed Res. 2012;1:27), which is incorporated herein by reference.

[0161] Pharmaceutical Compositions Provided herein are pharmaceutical compositions comprising any of the expression constructs, vectors, or viral particles disclosed herein and a pharma- ceutically acceptable excipient. These compositions may contain, in addition to the expression constructs, vectors, or viral particles, pharma- ceutical and / or physiologically acceptable excipients, carriers, buffers, stabilizers, antioxidants, preservatives, or other additives known to those skilled in the art. Such materials must be non-toxic and must not interfere with the effectiveness of the active ingredient. The exact nature of the carrier or other materials can be determined by the skilled artisan according to the route of administration. Pharmaceutical compositions are typically in liquid form. Liquid pharmaceutical compositions generally include a liquid carrier, such as water, petroleum, animal or vegetable oils, mineral oil, or synthetic oil. Additional carriers are provided in International Patent Publication No. WO00 / 15822, which is incorporated herein by reference. Saline, magnesium chloride, dextrose, or other sugar solutions, or glycols, such as ethylene glycol, propylene glycol, or polyethylene glycol, may be included. Optionally, a surfactant may be used, for example pluronic acid (PF68) 0.001%. In some cases, Ringer's solution, lactated Ringer's solution, or Hartmann's solution is used. If necessary, preservatives, stabilizers, buffers, antioxidants and / or other additives may be included.

[0162] For delayed release, the expression construct, vector, or viral particle may be included in a pharmaceutical composition formulated for sustained release, such as in microcapsules formed from biocompatible polymers or liposome carrier systems by methods known in the art.

[0163] If the expression constructs, vectors, or viral particles are to be stored for long periods of time, they can be frozen in the presence of glycerol, or other cryopreservative.

[0164] method In one aspect, there is provided a method of inducing satiety in a subject in need thereof, said method comprising administering to said subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0165] In one aspect, there is provided a method of treating obesity in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0166] In one aspect, there is provided a method of suppressing appetite in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0167] In one aspect, there is provided a method of reducing weight gain in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0168] In one aspect, there is provided a method of improving glucose tolerance in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0169] In one aspect, there is provided a method of treating diabetes in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0170] In one aspect, there is provided a method of inducing insulin release in a subject in need thereof, said method comprising administering to said subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0171] Provided herein is an expression construct, vector, or pharmaceutical composition as disclosed herein for use in a method of inducing satiety in a subject in need thereof.

[0172] Provided herein is an expression construct, vector, or pharmaceutical composition disclosed herein for use in a method of treating obesity in a subject in need thereof.

[0173] Provided herein is an expression construct, vector, or pharmaceutical composition as disclosed herein for use in a method of suppressing appetite in a subject in need thereof.

[0174] Provided herein is an expression construct, vector, or pharmaceutical composition disclosed herein for use in a method of reducing weight gain in a subject in need thereof.

[0175] Provided herein is an expression construct, vector, or pharmaceutical composition disclosed herein for use in a method for improving glucose tolerance in a subject in need thereof.

[0176] Provided herein is an expression construct, vector, or pharmaceutical composition disclosed herein for use in a method of treating diabetes in a subject in need thereof.

[0177] Provided herein is an expression construct, vector, or pharmaceutical composition as disclosed herein for use in a method of inducing insulin release in a subject in need thereof.

[0178] Provided herein is the use of an expression construct, vector, or pharmaceutical composition disclosed herein in the manufacture of a medicament for inducing satiety in a subject in need thereof.

[0179] Provided herein is the use of an expression construct, vector, or pharmaceutical composition disclosed herein in the manufacture of a medicament for treating obesity in a subject in need thereof.

[0180] Provided herein is the use of an expression construct, vector, or pharmaceutical composition disclosed herein in the manufacture of a medicament for suppressing appetite in a subject in need thereof.

[0181] Provided herein is the use of an expression construct, vector, or pharmaceutical composition disclosed herein in the manufacture of a medicament for reducing weight gain in a subject in need thereof.

[0182] Provided herein is the use of an expression construct, vector, or pharmaceutical composition disclosed herein in the manufacture of a medicament for improving glucose tolerance in a subject in need thereof.

[0183] Provided herein is the use of an expression construct, vector, or pharmaceutical composition disclosed herein in the manufacture of a medicament for treating diabetes in a subject in need thereof.

[0184] Provided herein is the use of an expression construct, vector, or pharmaceutical composition disclosed herein in the manufacture of a medicament for inducing insulin release in a subject in need thereof.

[0185] Provided herein is a method of treating a subject in need of increased expression of a polypeptide (including a polyprotein) disclosed herein that is encoded by a polypeptide-encoding sequence, the method comprising administering to the patient a pharmaceutical composition that includes a ligand to which an aptamer binds or otherwise responds, wherein the patient has previously been administered recombinant DNA that includes a polypeptide-encoding sequence, the polypeptide-encoding sequence containing a gene regulatory cassette disclosed herein that confers the ability to control expression of a target gene by the aptamer ligand.

[0186] The terms "treat", "treated", "treating" or "treatment" as used herein refer to therapeutic treatment, the purpose of which is to slow down (alleviate) an undesirable physiological condition, disorder or disease, or to obtain a beneficial or desired clinical outcome. For purposes of the present invention, beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms; reduction in the extent of a condition, disorder or disease; stabilization (i.e., not worsening) of the pathological condition, disorder or disease state; delay in onset of a condition, disorder or disease, or delay in progression of a condition, disorder or disease; amelioration of a condition, disorder or pathology; and remission (partial or complete), or improvement or amelioration of a condition, disorder or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects.

[0187] In one embodiment, in the methods disclosed herein, the expression construct is delivered by gene therapy. The cell specificity of the sequence encoding the polypeptide disclosed herein can be controlled by the promoter and / or other elements in the vector and / or by the encapsidation of a viral vector. Delivery of the vector construct containing the sequence encoding the polypeptide disclosed herein and transfection of the target tissue resulting in stable transfection of the controlled sequence encoding the polypeptide disclosed herein is the first step in producing the polypeptide.

[0188] In some embodiments, when an aptamer in the sequence encoding the polypeptide disclosed herein is used, the sequence encoding the polypeptide disclosed herein is not expressed at a significant level, i.e., the sequence is in the "off state" in the absence of a specific ligand that binds to the aptamer contained in the regulatory cassette riboswitch. Expression of the sequence encoding the disclosed polypeptide is activated only when the aptamer-specific ligand is administered. Delivery of the vector construct containing the sequence encoding the polypeptide disclosed herein and delivery of the activating ligand are generally separated in time. Delivery of the activating ligand controls the timing of expression of the sequence encoding the polypeptide disclosed herein as well as the level of protein expression.

[0189] The expression constructs, vectors, or pharmaceutical compositions disclosed herein (and ligands, in the case of aptamer-mediated control of gene expression) can be delivered by a number of routes, including, but not limited to, intravitreal, intraocular, inhalation, subcutaneous, intramuscular, intradermal, intralesional, topical, intraperitoneal, intravenous (IV), intraarterial, perivascular, intracerebral, intraventricular, oral, sublingual, sublabial, buccal, nasal, intrathoracic, intracardiac, intrathecal, epidural, intraosseous, or intraarticular.

[0190] When using aptamers, the timing of ligand delivery can be adjusted as needed. For example, oral small molecule ligands can be delivered daily or multiple times per day. Alternatively, derivative ligands can be administered less frequently, for example, once a week, once every two weeks, or once a month.

[0191] Manufactured Products and Kits Kits or articles of manufacture for use in the methods described herein are also provided. In an embodiment, the kit comprises a composition described herein (e.g., a composition for delivering a vector comprising an expression construct disclosed herein) in suitable packaging. Suitable packaging for the compositions described herein (such as injectable ophthalmic compositions) is known in the art and includes, for example, vials (such as sealed vials), containers, ampoules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may further be sterilized and / or sealed.

[0192] Kits comprising the compositions described herein are also provided. These kits may further include instructions(s) on how to use the compositions, such as the uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts containing instructions for performing administration of the compositions or for performing any of the methods described herein. For example, in some embodiments, the kits include rAAV for expression of the polypeptides disclosed herein, a pharma- ceutically acceptable carrier suitable for injection, and one or more of buffers, diluents, filters, needles, syringes, and package inserts containing instructions for performing an injection. In some embodiments, the kits are suitable for intraocular injection, intramuscular injection, intravenous injection, and the like.

[0193] It is understood and anticipated that variations in the compositions and methods disclosed herein may be made by those skilled in the art, and such modifications are intended to be included within the scope of the present disclosure. The following examples further illustrate the present invention, but should not be construed as limiting the scope of the present invention in any way.

[0194] All references cited herein are incorporated herein by reference in their entirety. All nucleotide sequences provided herein are presented in 5' to 3' orientation unless otherwise indicated. The sequence listing is filed herewith, and the contents thereof are incorporated herein by reference in their entirety.

[0195] Summary of the sequences disclosed herein [Table 12] [Table 13] [Table 14] [Table 15] [Table 16] [Table 17-1] [Table 17-2] EXAMPLES

[0196] Example 1: Expression of secretable gut peptides using monocistronic expression constructs Testing Procedure: To construct an expression vector encoding a secretable peptide, a DNA sequence encoding a signal peptide, a sequence promoting a furin cleavage site, and a GLP-1 7-37 Alternatively, a gene fragment containing hGIP was synthesized (IDT) and cloned into an expression construct containing a CMV promoter.

[0197] For transfection, the day before transfection, 3.5 x 10 4Human embryonic kidney (HEK) 293 cells were plated. Plasmid DNA (500 ng) was added to the tube or 96-well U-bottom plate. Separately, TransIT-293 reagent (Mirus; 1.4 μL) was added to 50 μL of Optimum I medium (Life Technologies) and left at room temperature (RT) for 5 min. Then, 50 μL of this diluted transfection reagent was added to the DNA, mixed, and incubated at RT for 20 min. Finally, 7 μL of this solution was added to the wells of the cells in the 96-well plate. The supernatants of the transfected cells were collected 48 h after transfection and assayed for GLP-1 or GIP peptides.

[0198] For enzyme-linked immunosorbent assay (ELISA) of GLP-1, HEK 293 cells were transfected with a construct containing the coding sequence of the active form of human GLP-1 peptide using TransIT-293 transfection reagent (Mirus Bio). 200 nM sitagliptin phosphate monohydrate (Sigma) was added to the culture medium to inhibit dipeptidyl peptidase DPP-IV. 48 hours after transfection, supernatants were collected from the transfected cells and human GLP-1 in the supernatants was analyzed according to the manufacturer's instructions (Abcam). 7-36 To detect the .

[0199] result: To generate a secretable GLP-1 peptide expression construct, a sequence encoding a leader sequence (consisting of a signal peptide sequence and a furin recognition and cleavage sequence) is generated to express the GLP-1 peptide. 7-37The signal peptide was fused to the 5' end of the peptide-encoding sequence. Signal peptide sequences from various secreted proteins were selected and tested for their ability to promote secretion of GLP-1. The furin recognition and cleavage sequences included a sequence containing a minimal furin cleavage site (RXXR for consensus furin cleavage site) as well as a sequence N-terminal to the cleavage site that promotes furin recognition and cleavage. Inclusion of the furin recognition and cleavage sequence in the leader sequence promoted complete processing and production of a functional N-terminus of the GLP-1 peptide in non-endocrine cells.

[0200] The expression of active GLP-1 peptide was measured using 7-36 As shown in Figure 1A, of all eight constructs generated to express GLP-1 (see Tables 5 and 6), only constructs GLP-1_F (containing the human insulin signal peptide), _I (containing the mouse Ig heavy chain signal peptide), and _L (containing the mouse GHRH signal peptide) produced detectable active GLP-1 peptide.

[0201] A second validation experiment demonstrated that GLP-1_F, I, and L constructs were 7-37 Expression of GLP-1 was confirmed (Figure 1B). Construct GLP-1_M (containing human albumin signal peptide) expressed very small but detectable amounts of GLP-1. These expression results suggest that signal peptides from different secretory proteins have different efficiencies in promoting secretable GLP-1 expression. In addition, the ELISA assay detected the peptide cleaved by Furin. Therefore, low and undetectable amounts of GLP-1 were expressed. 7-37 Expression of is likely due to inefficient furin cleavage.

[0202] Using the same method, secretable human glucose-dependent insulinotropic peptide (GIP 1-42Constructs were generated for the expression of GIP_C, E, F, and G, respectively. The same leader sequences (see Tables 5 and 6) used in constructs GLP-1_C, N, M, and J were used to construct GIP_C, E, F, and G, respectively. 1-42 and GIP 3-42 Expression of the GIP peptide was assayed using an ELISA that detects both GLP-1 and GIP-1-dependent cleavage. GIP constructs containing leader sequences that result in very low or undetectable amounts of GLP-1 secretion expressed copious amounts of GIP (Fig. 1C). However, because the assay used here recognized the C-terminus of GIP, the efficiency of furin cleavage (at the N-terminus of the peptide) was not reflected in the assay.

[0203] Example 2: Expression of secretable gut peptides using bi- and tricistronic expression constructs To improve expression levels of gut peptides, bi- and tricistronic expression constructs were generated encoding polyproteins containing two or three GLP-1 peptides. The peptides were separated by a minimal furin cleavage site sequence (RXXR). Post-translational furin processing of the polyprotein in non-endocrine cells resulted in the release of the individual peptides.

[0204] First, a GLP-1 expression vector was constructed, in which the GLP-1_M construct was assembled (see SEQ ID NO: 35, for encoding a polypeptide containing a human albumin signal peptide sequence and a sequence containing a furin cleavage site downstream of the signal peptide). The GLP-1 coding sequence is 7-37 It can be any polynucleotide sequence that encodes a peptide.

[0205] Because the GLP-1_M construct (see Tables 5 and 6) expresses very little GLP-1, we tested whether two copies (bicistronic construct 2xGLP-1_2xB, see Tables 7 and 8) or three copies (tricistronic construct 3xGLP-1_3xB, see Tables 9 and 10) of the GLP-1 coding sequence would increase the expression level of the peptide (Figure 2A). As shown in Figure 2B, two copies of the GLP-1 coding sequence indeed increased the expression of active GLP-1, and three copies further increased GLP-1 expression substantially further.

[0206] Next, tricistronic expression constructs 3xGLP-1_3xC and 3xGLP-1_3xD (see Tables 9 and 10) were generated (containing the leader sequences in constructs GLP-1_F and GLP-1_L, respectively, see Tables 5 and 6). As shown in FIG. 2C, the tricistronic constructs expressed over 100-fold more GLP-1 than the monocistronic constructs GLP-1_F and GLP-1_L. This enhanced high level of GLP-1 was due to the fact that only furin-cleaved GLP-1 is detectable in this assay. 7-37 Expression is also an indication of efficient furin cleavage at the inserted furin site, linking each individual peptide to efficient post-translational processing.

[0207] These results demonstrated that small peptide expression can be improved using the expression constructs disclosed herein.

[0208] Example 3: Bi- and tricistronic expression constructs for expressing different gut peptides Testing Procedure: DNA sequence encoding the signal peptide, the furin cleavage sequence and human GLP-1 7-37 , human glucose-dependent insulinotropic peptide (GIP 1-42 ) and human peptide tyrosine tyrosine (PYY 3-36), as well as gene fragments containing human oxyntomodulin (OXM), were synthesized and cloned into an expression construct containing the CMV promoter.

[0209] Secretable human GLP-1 was expressed in HEK 293 cells. 7-37 And GIP 1-42 or containing a coding sequence for a peptide, such as GLP-1 7-37 , oxyntomodulin, and peptide tyrosine tyrosine (PYY 3-36 TransIT-293 transfection reagent (Mirus Bio) was used to transfect cells with a construct containing the coding sequence for GLP-1. 200 nM sitagliptin phosphate monohydrate (Sigma) was added to the culture medium to inhibit dipeptidyl peptidase DPP-IV. 48 hours after transfection, supernatants were collected from the transfected cells and analyzed for active GLP-1 according to the manufacturer's instructions. 7-36 (Abcam) and total GIP (EMD Millipore) and total PYY (EMD Millipore) were run through ELISA assays.

[0210] result: Expression constructs were then designed to encode polyproteins containing the different gut peptides using the methods for generating polyprotein sequences discussed in Example 2.

[0211] The leader sequences used in constructs GLP-1_J, F, L, and M (see Tables 5 and 6) were used to synthesize GLP-1 7-37 Peptides and GIP 1-42 GG_J, F, L, M were constructed to simultaneously express peptide (GG) (see Tables 7 and 8).

[0212] As shown in Figure 3A, all four bicistronic GG expression constructs expressed higher levels of GLP-1 compared with the monocistronic GLP-1 expression construct. 7-37 The construct encoding the peptide containing the human insulin signal sequence expressed the highest amount of GLP-1.7-37 The peptides were expressed (see GG_F in FIG. 3A and GLP-1_F in FIGS. 1A and 1B).

[0213] Similarly, GIP expression from the GG constructs was higher than that from constructs containing GIP alone, with GG_F expressing the highest amount of GIP (FIG. 3B).

[0214] Next, GLP-1 7-37 Peptides, glucagon peptides, and GIP 1-42 Tricistronic expression constructs were generated that encode polyproteins containing the peptides. The tricistronic construct GGG_A (see Tables 9 and 10) has the same leader sequence as the monocistronic constructs GLP-1_J and GIP_G (see Tables 5 and 6), but has a higher GLP-1 expression level than the monocistronic constructs. 7-37 Peptide (Figure 3C) and GIP 1-42 Both of the peptides (FIG. 3D) were significantly more highly expressed.

[0215] Next, the leader sequences used in constructs GLP-1_J, F, L, and M (see Tables 5 and 6) were used to synthesize GLP-1 7-37 Constructs GOP_J, F, L, and M were constructed to simultaneously express GLP-1 peptide, OXM peptide, and PYY (GOP), respectively (Tables 9 and 10). As shown in FIG. 3E, all four tricistronic GOP constructs expressed higher levels of GLP-1 peptide compared to the monocistronic constructs. Again, GOP_F expressed the highest amount of GLP-1. 7-37 Furthermore, the GOP_F construct expressed approximately 27,158 pg / mL of PYY. 3-36 was expressed.

[0216] These results demonstrate that the tricistronic expression constructs disclosed herein provide significantly increased expression compared to monocistronic expression constructs and constitute an efficient method for simultaneously expressing multiple small peptides.

[0217] Example 4: Riboswitch-controlled expression of gut peptides We next investigated whether regulated expression of gut peptides could be used in gene therapy to treat diabetes, obesity, and other metabolic indications. To this end, we inserted the riboswitch N5-12G6 cassette () into the bicistronic expression construct GG_L (hGLP-1 7-37 Peptides and hGIP 1-42The riboswitch was inserted into the coding polypeptide sequence of the vector pGFR1, pGFR2, pGFR3, pGFR4, pGFR5, pGFR6, pGFR7, pGFR8, pGFR9, pGFR10, pGFR11, pGFR12, pGFR13, pGFR14, pGFR15, pGFR16, pGFR17, pGFR19, pGFR20, pGFR21, pGFR22, pGFR35, pGFR40, pGFR50, pGFR61, pGFR72, pGFR8, pGFR9, pGFR11, pGFR12, pGFR15, pGFR16, pGFR17, pGFR18, pGFR19, pGFR19, pGFR20, pGFR19, pGFR21, pGFR22, pGFR19, pGFR20

[0218] As shown in Figure 4A, after transfection into HEK 293 cells, these constructs upregulated hGLP-1 in a dose-dependent manner in response to small molecule inducer treatment. 7-37 Another peptide, hGIP, was expressed from the same construct. 1-42 Regulation of expression of hGIP was also measured. Constructs GG_1 and GG_L_4 downregulated the expression of hGIP in a dose-dependent manner. 1-42 was expressed (Fig. 4B).

[0219] The riboswitch cassette was then inserted into the construct tricistronic expression construct 3xGLP-1_3xC (see Tables 9 and 10) at nucleotide positions between positions 172 and 173 (counting from the start codon in the sequence encoding the polypeptide) to obtain the controllable GLP-1_3xC_4 construct. As shown in FIG. 4C, the GLP-1_3xC_4 construct upregulated GLP-1 in a dose-dependent manner in response to small molecule inducer treatment. 7-37 was expressed.

[0220] The riboswitch cassette was then inserted into the bicistronic expression construct GG_F (hGLP-1 7-37 Peptides and hGIP 1-42 As shown in Figure 4D, after transfection into HEK 293 cells, these constructs upregulated hGLP-1 in a dose-dependent manner in response to small molecule inducer treatment. 7-37 In particular, the controllable bicistronic expression construct GG_F_7 expressed maximal levels of GLP-1 at each of the concentrations of small molecule inducers shown.7-37 was expressed.

[0221] Next, an additional furin cleavage site and GLP-1 7-37 A sequence encoding an additional copy of the peptide (agaaagaagagaCATGCTGAAGGGACATTTACCTCAGATGTTTCTTCATACCTGGAAGGACAGGCTGCCAAGGAATTTATTGCATGGCTTGTGAAAGGCAGGGGCTGA, SEQ ID NO: 115) was added 3' to the nucleic acid encoding the last amino acid codon of the GG_F_7 construct, resulting in a controllable tricistronic GG_F_7-GLP-1 expression construct. 7-37 Two copies of the peptide and hGIP 1-42 The GG_F_GLP-1 construct, which encodes a polyprotein containing one copy of the peptide, further enhanced levels of hGLP-1 in a dose-responsive manner. 7-37 The peptide was expressed (Figure 4D).

[0222] Finally, a controllable tricistronic expression construct expressing a polyprotein containing GLP-1, hOXM, and PYY expressed PYY in a dose-dependent manner in response to an inducer.

[0223] Example 5: GLP-1 and GIP peptides are biologically active in vitro and in vivo. Testing Procedure: For transfection, the day before transfection, 3.5 x 10 4Human embryonic kidney (HEK) 293 cells were plated. Plasmid DNA (500 ng) was added to the tube or 96-well U-bottom plate. Separately, TransIT-293 reagent (Mirus; 1.4 μL) was added to 50 μL of Optimum I medium (Life Technologies) and left at room temperature (RT) for 5 min. Then, 50 μL of this diluted transfection reagent was added to the DNA, mixed, and incubated at RT for 20 min. Finally, 7 μL of this solution was added to the wells of the cells in the 96-well plate. The supernatant of the transfected cells was collected 48 h after transfection and used as conditioned medium for the source of expressed GLP-1 or GIP peptides.

[0224] For GLP-1 and GIP bioactivity assays, HEK293 cells stably expressing the human GLP-1 receptor (HEK-293-hGLP-1R) or stably expressing the human GIP receptor (HEK-293-hGIPR) were generated by stably transfecting HEK293 cells with pCMV3 plasmid (SinoBiological) containing hGLP-1R cDNA or hGIPR cDNA. The established stable cell lines were transfected with pCRE Tluc16-DD (Thermo Scientific), which contains the TurboLuc luciferase gene driven under the cAMP response element (CRE) promoter. Five hours after transfection, the transfected cells were plated at 2 × 10 per well. 4 Cells were plated in 96-well plates at 100°C and the next day conditioned medium containing GLP-1 and / or GIP peptides was added. One hour after addition of 100 μL of conditioned medium, luciferase assays were performed using the TurboLuc Luciferase One-step Proliferation Assay Kit (Thermo Scientific) according to the manufacturer's instructions, and luminescence was measured using a Tecan microplate reader.

[0225] For AAV2 / 8 (AAV2 genome, AAV8 capsid) viral particle production, the expression construct GG_F encoding hGLP-1 and hGIP was cloned into the AAV2 plasmid vector. Expression of the hGLP-1 and hGIP genes was driven by the CASI promoter containing the CMV and ubiquitin C enhancer elements, and the chicken β-actin promoter. The AAV plasmid vector was packaged into the AAV8 capsid to generate the AAV viral vector AAV8.GG_F.

[0226] For animal studies, male C57Bl / 6 mice (Jackson Laboratory) were fed a high-fat diet (HFD) starting at 6 weeks of age. At 8 weeks, mice were injected with PBS or 2.5 × 10 11 Either genome copies (GC) were injected into both the quadriceps and gastrocnemius muscles of the hind limbs. PBS was injected as a control group into 8-week-old male mice (Jackson Laboratory) fed a low-fat diet (LFD). Animal weights were monitored weekly before and after AAV injection.

[0227] result: To further measure the biological activity of the GLP-1 and GIP peptides expressed by the polycistronic expression constructs herein, HEK 293 cells stably expressing the GLP-1 or GIP receptor were used. The activity of the GLP-1 and GIP peptides was assayed as described in the Experimental Procedures.

[0228] As shown in Figure 5A, the monocistronic expression construct GLP-1_F (hGLP-1 7-37 (expressing the peptide, see Tables 5 and 6), bicistronic expression construct GG_F (expressing hGLP-1 7-37 Peptides and hGIP 1-42 peptide, see Tables 7 and 8), and the tricistronic expression construct GLP-1_3xC (hGLP-1 7-37hGLP-1 expressed from a guinea pig (see Tables 9 and 10), which expresses a polyprotein containing three copies of the peptide 7-37 The peptides showed activity in luciferase driven by the CRE promoter. Supernatants from cultures transfected with GIP constructs that do not express the GLP-1 peptide showed no activity in HEK 293 cells expressing the GLP-1 receptor (negative control).

[0229] As shown in Figure 5B, the bicistronic expression construct GG_F (hGLP-1 7-37 Peptides and hGIP 1-42 peptide, see Tables 7 and 8), and the monocistronic expression construct GIP_F (hGIP-1 1-42 hGIP expressed from the IgG1-expressing peptide (see Tables 5 and 6) 1-42 The peptide activated the luciferase gene driven by the CRE promoter. The monocistronic expression construct GLP-1_F (hGLP-1 7-37 peptide, see Tables 5 and 6), or the tricistronic expression construct GLP-1_3xC (hGLP-1 7-37 Supernatants from the guinea pigs expressing a polyprotein containing three copies of the peptide (see Tables 9 and 10) did not activate the luciferase gene driven by the CRE promoter (negative control). These results demonstrate that the gut peptides expressed from the polycistronic expression constructs disclosed herein are biologically active.

[0230] To further test the biological activity of the incretin peptides hGLP-1 and hGIP and their ability to inhibit weight gain from a high-fat diet (HFD), AAV vectors (containing the expression construct GG_F) were used to express hGLP-1 and hGIP in mice fed a high-fat diet. Mice injected with AAV vectors expressing the hGLP-1 and hGIP genes had reduced weight gain compared to mice without AAV.GG_F (Figure 5C). This data indicates that the hGLP-1 and hGIP expressed from the expression constructs herein are biologically active and useful in gene therapy to treat obesity.

[0231] Example 6: Riboswitch-controlled expression of GLP-1 and GIP enhances glucose tolerance Testing Procedure: The peptide-encoding sequence was cloned into an AAV plasmid backbone containing the AAV2 ITRs, the CSAI promoter, and the human β-globin polyA sequence and packaged into an AAV8 capsid to generate the AAV8.GG_F_7-GLP-1 vector (see Example 4).

[0232] For animal studies (Figure 6A), Balb / c mice were inoculated with a total of 2.5 × 10 11 The subjects received intramuscular injections of 100 viral genomes (VG) into both the quadriceps and gastrocnemius muscles. Chemical structure [ka] Compound 004, having the formula: was formulated in 0.5% methylcellulose (MC): 0.25% Tween® 80 in deionized (DI) water for oral administration. Thirty days after AAV vector delivery, mice were orally treated by oral gavage with 300 mg / kg of compound 004 for 4 days.

[0233] For non-fasting intraperitoneal glucose tolerance test (IPGTT), mice (N=5) injected with AAV vectors were treated with 300 mg / kg compound 004 for 4 days and administered 300 mg / kg 5 hours after IPGTT. Blood glucose in tail vein blood was measured with a portable glucose meter (CVS Health). Glucose was measured before glucose injection (0 min), followed by peritoneal injection of glucose (2 g / kg) at 15 min, 30 min, 60 min, and 120 min.

[0234] result: As shown in FIG. 6B, mice treated with small molecule inducers exhibited better glucose tolerance than mice receiving vehicle.

[0235] This indicates that the GLP-1 and GIP peptides expressed by the injected vectors increased insulin release and therefore improved glucose tolerance.

Claims

1. 1. An expression construct comprising a sequence encoding a polyprotein, said expression construct being a bicistronic expression construct, comprising: a. the polyprotein comprises a signal peptide, a first gut peptide, and a second gut peptide; b. the polyprotein-encoding sequence is i. a sequence encoding the signal peptide; ii. a sequence encoding the first gastrointestinal peptide; iii. a sequence encoding a first protease cleavage site that allows separation of the first gut peptide and the second gut peptide; and iv. the expression construct comprising a sequence encoding the second gut peptide.

2. 1. An expression construct comprising a sequence encoding a polyprotein, said expression construct being a tricistronic expression construct, comprising: a. the polyprotein comprises a signal peptide, a first gut peptide, a second gut peptide, and a third gut peptide; b. the polyprotein-encoding sequence is i. a sequence encoding the signal peptide; ii. a sequence encoding the first gastrointestinal peptide; iii. a sequence encoding a first protease cleavage site that allows separation of the first gut peptide and the second gut peptide; iv. a sequence encoding the second gut peptide; v. a sequence encoding a second protease cleavage site that allows for separation of the second gut peptide and the third gut peptide; and vi. the expression construct, comprising a sequence encoding the third gastrointestinal peptide.

3. 3. The expression construct of claim 1, wherein the signal peptide is selected from the group consisting of immunoglobulin M (IgM) signal peptide, human insulin (hInsul) signal peptide, mouse Igh protein (Igh) signal peptide, human growth hormone (hGH) signal peptide, mouse erythropoietin (mEpo) signal peptide, mouse growth hormone-releasing hormone (mGHRH) signal peptide, human albumin signal peptide, and human factor IX (FIX) signal peptide.

4. An expression construct as described in claim 3, wherein (a) the signal peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 13 to 20, or (b) the sequence encoding the signal peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 21 to 28.

5. An expression construct as described in claim 4, wherein (a) the signal peptide comprises any one of SEQ ID NOs: 13 to 20, or (b) the sequence encoding the signal peptide comprises any one of SEQ ID NOs: 21 to 28.

6. 3. The expression construct of claim 1 or 2, wherein the first gastrointestinal peptide and / or the second gastrointestinal peptide are encoded by expression constructs that independently comprise a sequence selected from the group consisting of human protein glp-1 (hGLP-1), human glucose-dependent insulinotropic peptide (hGIP), human oxyntomodulin (hOXM), peptide YY (PYY), human glucagon, and amylin, and / or the expression construct of claim 2, wherein the third gastrointestinal peptide is encoded by an expression construct that independently comprises a sequence selected from the group consisting of human hGLP-1, hGIP, hOXM, PYY, human glucagon, and amylin.

7. The expression construct described in claim 6, wherein (a) the first gastrointestinal peptide, the second gastrointestinal peptide and / or the third gastrointestinal peptide independently comprise a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 5, and / or (b) the sequences encoding the first gastrointestinal peptide, the second gastrointestinal peptide and / or the third gastrointestinal peptide independently comprise a sequence that is at least 90% identical to any one of SEQ ID NOs: 6 to 12.

8. The expression construct described in claim 7, wherein (a) the first gastrointestinal peptide, the second gastrointestinal peptide and / or the third gastrointestinal peptide independently comprise any one of SEQ ID NOs: 1 to 5, and / or (b) the sequences encoding the first gastrointestinal peptide, the second gastrointestinal peptide and / or the third gastrointestinal peptide independently comprise any one of SEQ ID NOs: 6 to 12.

9. 3. The expression construct of claim 1 or 2, wherein the sequences encoding the first gut peptide, the second gut peptide are codon-optimized, or the expression construct of claim 2, wherein the third gut peptide is codon-optimized.

10. 2. The expression construct of claim 1, wherein the first gut peptide and the second gut peptide are hGLP-1.

11. An expression construct as described in claim 10, wherein (a) the first gastrointestinal peptide and the second gastrointestinal peptide each comprise a sequence that is at least 90% identical to SEQ ID NO: 1, or (b) the sequences encoding the first and second gastrointestinal peptides each comprise a sequence that is at least 90% identical to any one of SEQ ID NOs: 6 to 8.

12. The expression construct described in claim 11, wherein (a) the first gastrointestinal peptide and the second gastrointestinal peptide each comprise SEQ ID NO: 1, or (b) the sequences encoding the first and second gastrointestinal peptides each comprise any one of SEQ ID NOs: 6 to 8.

13. 11. The expression construct of claim 10, wherein the expression construct comprises (a) a sequence encoding a polypeptide that is at least 90% identical to SEQ ID NO:45 or SEQ ID NO:55, or (b) a sequence that is at least 90% identical to SEQ ID NO:50 or SEQ ID NO:

57.

14. 14. The expression construct of claim 13, wherein the expression construct comprises (a) a sequence encoding a polypeptide comprising SEQ ID NO: 45 or SEQ ID NO: 55, or (b) SEQ ID NO: 50 or SEQ ID NO:

57.

15. 2. The expression construct of claim 1, wherein the first gut peptide and the second gut peptide are different and independently selected from the group consisting of hGLP-1 and hGIP.

16. The expression construct described in claim 15, wherein (a) the first gastrointestinal peptide comprises a sequence that is at least 90% identical to SEQ ID NO: 1, and the second gastrointestinal peptide comprises a sequence that is at least 90% identical to SEQ ID NO: 2, or (b) the sequence encoding the first gastrointestinal peptide comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 6 to 8, and the sequence encoding the second gastrointestinal peptide comprises a sequence that is at least 90% identical to SEQ ID NO:

9.

17. The expression construct described in claim 16, wherein (a) the first gastrointestinal peptide comprises SEQ ID NO: 1 and the second gastrointestinal peptide comprises SEQ ID NO: 2, or (b) the sequence encoding the first gastrointestinal peptide comprises any one of SEQ ID NOs: 6 to 8 and the sequence encoding the second gastrointestinal peptide comprises SEQ ID NO:

9.

18. 16. The expression construct of claim 15, wherein the expression construct comprises (a) a sequence encoding a polypeptide that is at least 90% identical to any one of SEQ ID NOs:46-49, or SEQ ID NO:56, or (b) a sequence that is at least 90% identical to any one of SEQ ID NOs:51-54, or SEQ ID NO:

58.

19. 19. The expression construct of claim 18, wherein the expression construct comprises (a) a sequence encoding a polypeptide comprising any one of SEQ ID NOs:46-49, or SEQ ID NO:56, or (b) any one of SEQ ID NOs:51-54, or SEQ ID NO:

58.

20. The first gut peptide, the second gut peptide, and the third gut peptide are different and include the following: a. hGLP-1, hOXM, and PYY; and b. The expression construct of claim 2, wherein each of said proteins is independently selected from the group consisting of hGLP-1, hGlucagon, and hGIP.

21. A method for producing a gastrointestinal peptide comprising the steps of: (a) administering to a mammalian subject the invention comprising ... b. the sequence encoding the first gastrointestinal peptide comprises a sequence at least 90% identical to any one of SEQ ID NOS: 6-8, the sequence encoding the second gastrointestinal peptide comprises a sequence at least 90% identical to SEQ ID NOS: 10, and the sequence encoding the third gastrointestinal peptide comprises a sequence at least 90% identical to SEQ ID NOS: 11; 21. The expression construct of claim 20.

22. A method for producing a gastrointestinal peptide comprising the steps of: a. a) administering to a subject a first gastrointestinal peptide comprising: a) administering to a subject a first gastrointestinal peptide comprising: a) administering to a subject a first gastrointestinal peptide comprising: a) administering to a subject a second ... b. the sequence encoding the first gastrointestinal peptide comprises any one of SEQ ID NOs: 6-8, the sequence encoding the second gastrointestinal peptide comprises SEQ ID NO: 10, and the sequence encoding the third gastrointestinal peptide comprises SEQ ID NO: 11; 22. The expression construct of claim 21.

23. A method for producing a gastrointestinal peptide comprising the steps of: (a) administering to a mammalian subject the invention comprising ... b. the sequence encoding the first gastrointestinal peptide comprises a sequence at least 90% identical to any one of SEQ ID NOs: 6-8, the sequence encoding the second gastrointestinal peptide comprises a sequence at least 90% identical to SEQ ID NO: 12, and the sequence encoding the third gastrointestinal peptide comprises a sequence at least 90% identical to SEQ ID NO: 9; 21. The expression construct of claim 20.

24. A method for treating a gastrointestinal tract disease comprising administering to a mammalian subject the method of claim 1, a ... b. the sequence encoding the first gastrointestinal peptide comprises any one of SEQ ID NOs: 6-8, the sequence encoding the second gastrointestinal peptide comprises SEQ ID NO: 12, and the sequence encoding the third gastrointestinal peptide comprises SEQ ID NO: 9; 24. The expression construct of claim 23.

25. 21. The expression construct of claim 20, wherein the expression construct comprises (a) a sequence encoding a polypeptide that is at least 90% identical to any one of SEQ ID NOs: 62-66, or SEQ ID NOs: 76-77, or (b) a sequence that is at least 90% identical to any one of SEQ ID NOs: 70-74, or SEQ ID NOs: 79-80.

26. 26. The expression construct of claim 25, wherein the expression construct comprises (a) a sequence encoding a polypeptide comprising any one of SEQ ID NOs: 62-66, or SEQ ID NOs: 76-77, or (b) any one of SEQ ID NOs: 70-74, or SEQ ID NOs: 79-80.

27. ​​The expression construct described in claim 25, wherein the expression construct comprises (a) a sequence encoding a polypeptide that is at least 90% identical to SEQ ID NO: 66, or (b) a sequence that is at least 90% identical to SEQ ID NO:

77.

28. The expression construct described in claim 27, wherein the expression construct comprises (a) an array encoding a polypeptide comprising SEQ ID NO: 66, or (b) SEQ ID NO:

77.

29. 3. The expression construct of claim 2, wherein the first gut peptide, the second gut peptide, and the third gut peptide are hGLP-1.

30. The expression construct of claim 29, wherein (a) the first gastrointestinal peptide, the second gastrointestinal peptide, and the third gastrointestinal peptide each comprise a sequence that is at least 90% identical to SEQ ID NO: 1, or (b) the sequences encoding the first gastrointestinal peptide, the second gastrointestinal peptide, and the third gastrointestinal peptide each comprise a sequence that is at least 90% identical to any one of SEQ ID NOs: 6 to 8.

31. The expression construct described in claim 30, wherein (a) the first gastrointestinal peptide, the second gastrointestinal peptide, and the third gastrointestinal peptide each comprise SEQ ID NO: 1, or (b) the sequences encoding the first gastrointestinal peptide, the second gastrointestinal peptide, and the third gastrointestinal peptide each comprise any one of SEQ ID NOs: 6 to 8.

32. 30. The expression construct of claim 29, wherein the expression construct comprises (a) a sequence encoding a polypeptide sequence that is at least 90% identical to any one of SEQ ID NOs:59-61, or SEQ ID NO:75, or (b) a sequence that is at least 90% identical to any one of SEQ ID NOs:67-69, or SEQ ID NO:

78.

33. 33. The expression construct of claim 32, wherein the expression construct comprises (a) a sequence encoding a polypeptide comprising any one of SEQ ID NOs:59-61, or SEQ ID NO:75, or (b) any one of SEQ ID NOs:67-69, or SEQ ID NO:

78.

34. The expression construct of claim 1 or 2, further comprising a promoter sequence.

35. 35. The expression construct of claim 34, wherein the promoter is a CMV promoter or a CASI promoter.

36. An expression construct as described in claim 1 or 2, wherein the first protease cleavage site or the second protease cleavage site is a furin cleavage site, or an expression construct as described in claim 2, wherein the second protease cleavage site is a furin cleavage site.

37. 3. The expression construct of claim 1 or 2, wherein the polyprotein-encoding sequence comprises a riboswitch comprising an aptamer, wherein the aptamer binds a small molecule.

38. A vector comprising the expression construct of claim 1 or 2.

39. 39. The vector of claim 38, wherein the vector is an AAV vector.

40. 39. A pharmaceutical composition comprising the vector of claim 38 and a pharmaceutically acceptable excipient.

41. 10. A pharmaceutical composition for inducing satiety in a subject in need thereof, comprising: (a) an expression construct of any one of claims 1, 2, or 10-33, or a vector comprising an expression construct of any one of claims 1, 2, or 10-33; and (b) a pharmaceutically acceptable excipient.

42. 10. A pharmaceutical composition for treating obesity in a subject in need thereof, comprising: (a) an expression construct of any one of claims 1, 2, or 10-33, or a vector comprising an expression construct of any one of claims 1, 2, or 10-33; and (b) a pharmaceutically acceptable excipient.

43. 10. A pharmaceutical composition for suppressing appetite in a subject in need thereof, comprising: (a) an expression construct of any one of claims 1, 2, or 10-33, or a vector comprising an expression construct of any one of claims 1, 2, or 10-33; and (b) a pharmaceutically acceptable excipient.

44. 10. A pharmaceutical composition for reducing weight gain in a subject in need thereof, comprising: (a) an expression construct of any one of claims 1, 2, or 10-33, or a vector comprising an expression construct of any one of claims 1, 2, or 10-33; and (b) a pharmaceutically acceptable excipient.

45. 34. A pharmaceutical composition for improving glucose tolerance in a subject in need thereof, comprising: (a) an expression construct according to any one of claims 1, 2, or 10-33, or a vector comprising the expression construct according to any one of claims 1, 2, or 10-33; and (b) a pharmaceutically acceptable excipient.

Images