Compositions and methods for targeted delivery of therapeutic and / or diagnostic species - Patents.com

Abstract

In one aspect, a composition is described herein. The composition described herein includes a nanoparticle, a therapeutic species, and a linker that couples the nanoparticle to the therapeutic species. The linker that couples the nanoparticle to the therapeutic species comprises a Diels-Alder cycloaddition reaction product. Additionally, in some embodiments, the nanoparticle is a core-shell-shell metal nanoparticle.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. § 119 to U.S. Provisional Patent Application No. 63 / 291,133, filed December 17, 2021, the entirety of which is hereby incorporated by reference in its entirety.

[0002] Statement on Federally Sponsored Research This invention was made with government support under Grant No. DE024790 awarded by the National Institutes of Health, Grant No. CBET1722533 awarded by the National Science Foundation, and Grant No. W81XWH-18-1-0115 awarded by the U.S. Army / MRMC. The Government has certain rights in this invention.

[0003] The present invention relates generally to the delivery of therapeutic and / or diagnostic species to biological compartments, and more specifically to the use of nanoparticles with therapeutic agents attached by cleavable linkers. [Background technology]

[0004] Techniques for stimuli-responsive delivery of therapeutic and / or diagnostic species have gained increasing interest in recent years. Several techniques, including drug delivery, have been investigated. However, achieving control of drug delivery (e.g., time control, location control, and / or control of the amount of drug delivered to a biological compartment) remains a significant challenge. Thus, there is a need for improved compositions and methods for targeted delivery of therapeutic and / or diagnostic species. Summary of the Invention

[0005] In some embodiments, compositions and methods are described herein that overcome one or more of the aforementioned shortcomings and / or concerns of previous stimuli-responsive delivery techniques. For example, in some cases, the compositions and methods described herein provide improved location control of the delivery of therapeutic and / or diagnostic species. In one aspect, a composition is described herein. In some examples, the compositions described herein include nanoparticles, a therapeutic species, and a linker that couples the nanoparticles to the therapeutic species. The linker that couples the nanoparticles to the therapeutic species includes a Diels-Alder cycloaddition reaction product.

[0006] The nanoparticles of the compositions described herein can be any nanoparticles not inconsistent with the objectives of the present disclosure. In some cases, for example, the nanoparticles are metal nanoparticles. Metal nanoparticles can be formed, for example, from silver or gold. Furthermore, in some embodiments, the metal nanoparticles can also have a plasmon resonance or resonant frequency in the visible or near infrared region of the electromagnetic spectrum. In other cases, the nanoparticles of the compositions described herein are magnetic nanoparticles. More specifically, in some embodiments, the magnetic nanoparticles can be formed from a magnetic metal or metal oxide. For example, the nanoparticles described herein can be formed from Fe2O3, Fe3O4, MnFe2O4, CoFe2O4, or NiFe2O4. Furthermore, in some embodiments, the magnetic nanoparticles can exhibit a specific loss power (SLP) of greater than 20 W / g at a frequency of 850 kHz and / or a specific loss power (SLP) of greater than 2 W / g at a frequency of 200 kHz.

[0007] In some embodiments, the nanoparticles described herein include core-shell-shell nanoparticles. Such core-shell (CSS) nanoparticles may include a core, a first shell covering the core, and a second shell covering the first shell. As will be understood by one of skill in the art, the first shell can completely or substantially completely (e.g., at least 95%, at least 98%, or at least 99%) cover or "coat" the surface of the core such that the core is contained within or "encased" by the first shell. Similarly, the second shell can completely or substantially completely cover or "coat" the surface of the first shell such that both the core and the first shell are contained within or "encased" by the second shell. The core, first shell, and second shell may be formed from any material not inconsistent with the objectives of the present disclosure. For example, in some cases, the core, first shell, and / or second shell include or are formed from a metal or a combination, alloy, or mixture of metals, where a "metal" is a metal in elemental or zero oxidation state, as opposed to a metal ion such as may be found in a metal oxide. The metal or combination, alloy, or mixture of metals can be the same or different for the core and one or more shells. For example, in some cases, the nanoparticles include gold-silver-gold core-shell nanoparticles. As described further herein below, other nanoparticle structures are also possible.

[0008] Additionally, in some examples, the nanoparticles described herein have a light absorption peak in the near infrared (NIR) region of the electromagnetic spectrum, such as between 800 nm and 900 nm.

[0009] The therapeutic species of the compositions described herein can be any therapeutic species that is not inconsistent with the objectives of the present disclosure. In some embodiments, for example, the therapeutic species is a small molecule, a nucleic acid, a peptide, a protein, or any combination thereof. The nucleic acid can include a plasmid, a small interfering RNA ("siRNA"), a microRNA ("miRNA"), a miRNA mimic, or any combination thereof. Furthermore, the therapeutic species can be covalently attached to a linker, and the linker can be covalently attached to the nanoparticle.

[0010] The linkers of the compositions described herein comprise or include a Diels-Alder cycloaddition reaction product. Any such reaction product may be included in or form at least a portion of the linkers described herein. For example, in some embodiments, the Diels-Alder cycloaddition reaction product is a reaction product of a dienophile and a furan, a reaction product of a dienophile and a thiophene, or a reaction product of a dienophile and a pyrrole. Further, in some such cases, the Diels-Alder cycloaddition reaction product has a retro Diels-Alder activation temperature of 45°C to 180°C, 45°C to 170°C, 45°C to 160°C, 45°C to 150°C, 45°C to 120°C, or 45°C to 80°C.

[0011] In another aspect, a method for delivering a therapeutic species to a biological compartment is described herein. In some cases, such a method includes two steps. The first step is to place a composition described herein in the biological compartment. Any composition described herein can be used. For example, in some cases, the composition includes a metal or magnetic nanoparticle and a linker that connects the nanoparticle to the therapeutic species, the linker including a Diels-Alder cycloaddition product. Returning to the exemplary methods described herein, the second step of the method can include initiating a retro-Diels-Alder reaction to degrade the Diels-Alder cycloaddition product of the composition. In this way, the linker can be cleaved and the therapeutic species can be detached from the nanoparticle including the desired location.

[0012] Additionally, the step of initiating the retro Diels-Alder reaction may include heating the nanoparticles (e.g., metal or magnetic nanoparticles) to an activation temperature of the retro Diels-Alder reaction, which may be between 45° C. and 160° C. In some such embodiments, the nanoparticles (e.g., metal nanoparticles) have a plasmon resonance frequency, and heating the nanoparticles to the activation temperature includes exposing the nanoparticles to electromagnetic radiation including a frequency corresponding to the plasmon resonance frequency. In other cases, the nanoparticles are magnetic nanoparticles, and heating the magnetic nanoparticles to the activation temperature includes exposing the magnetic nanoparticles to an alternating magnetic field.

[0013] In another aspect, methods of inducing tissue regeneration are described herein. In some cases, the methods include disposing a composition described herein in a biological compartment. In some cases, the composition includes a metal or magnetic nanoparticle and a linker that connects the nanoparticle to a therapeutic species, the linker including a Diels-Alder cycloaddition product. Any Diels-Alder cycloaddition product described herein can be used. In some embodiments, the therapeutic species can include a tissue regeneration species, such as an osteogenic modulator, a chondrogenic modulator, an endotheliologenic modulator, or a myogenic modulator.

[0014] The method of inducing tissue regeneration can further include initiating a retro Diels-Alder reaction to degrade a Diels-Alder cycloaddition product of the composition and release a therapeutic species into the biological compartment. In some embodiments, the released therapeutic species induces bone formation upregulation.

[0015] The step of initiating the retro Diels-Alder reaction may include heating nanoparticles (e.g., metal or magnetic nanoparticles) to an activation temperature of the retro Diels-Alder reaction, as previously described herein.

[0016] In another aspect, methods of treating cancer are described herein. In some cases, the methods include disposing a composition described herein in a biological compartment. In some cases, the composition includes a metal or magnetic nanoparticle and a linker that couples the nanoparticle to a therapeutic species, the linker including a Diels-Alder cycloaddition product. Any Diels-Alder cycloaddition product described herein can be used. In some embodiments, the therapeutic species can include an anti-cancer drug. Exemplary embodiments of anti-cancer drugs can include paclitaxel, afatinib, dimaleate, bortezomib, carfilzomib, doxorubicin, fluorouracil, miRNA 148b, -135, -124, -101, -29c, -15a, and -34 (MRX34) mimetics.

[0017] Further non-limiting examples of therapeutic microRNAs include miRNA-34a-5p, miRNA-7-5p, miRNA-218-5p, miRNA-148b-3p, miRNA433-3p, miRNA-181a-5p, or a combination of two or more of the above. In some embodiments, these miRNAs may demonstrate benefit in the treatment of certain types of cancers and / or tumors, such as cancers and / or tumors of nervous system tissues (e.g., glioblastoma multiforme, astrocytoma, etc.).

[0018] The method of treating cancer can further include initiating a retro Diels-Alder reaction to degrade the Diels-Alder cycloadduct of the composition and release an anti-cancer agent into the biological compartment. In some embodiments, the released therapeutic species induces cell apoptosis, inhibits metastasis, suppresses tumor growth ("tumor suppressors"), or inhibits cancer stemness.

[0019] The step of initiating the retro Diels-Alder reaction can include heating nanoparticles (e.g., metal or magnetic nanoparticles) to an activation temperature of the retro Diels-Alder reaction, as previously described herein. These and other embodiments are described in more detail in the detailed description that follows. [Brief description of the drawings]

[0020] The invention will now be described, by way of example only, with reference to the accompanying drawings, in which:

[0021] [Figure 1] 1 shows the absorption spectrum of metal nanoparticles.

[0022] [Diagram 2] 1 shows a plot of specific loss force ("SLP") values ​​of magnetic nanoparticles.

[0023] [Diagram 3] 1 shows a plot of intrinsic loss power ("ILP") values ​​of magnetic nanoparticles.

[0024] [Figure 4] 1 shows a schematic of a linker covalently attached to a therapeutic species.

[0025] [Diagram 5] Schematic of the Diels-Alder reaction between a diene and the dienophile 6-maleimidohexanoic acid to form a linker.

[0026] [Figure 6] Figure 5 shows a schematic of an exemplary retro Diels-Alder reaction of the product.

[0027] [Figure 7] A graph showing the cleavage temperatures of different linkers in the retro Diels-Alder reaction.

[0028] [Figure 8] Calculated forward and reverse ΔHrxn for the formation of three different linkers are shown.

[0029] [Figure 9]Fluorescence intensity of a control (untreated) sample and a chemically cleaved (treated) sample containing products formed by reacting a furan-based linker with EDC / NHS and fluorescently labeled si-RNA is shown.

[0030] [Figure 10] Graph showing temperature dependence of the retro Diels-Alder reaction (and release of fluorescent si-RNA) of the furan-based linker product (attached to nanoparticles) after heating at 37 °C, 60 °C, and 80 °C for 1 h.

[0031] [Figure 11] Figure 13 shows the temperature dependence of the retro Diels-Alder reaction (and release of fluorescent si-RNA) of a thiophene-based linker product (attached to nanoparticles) after heating at 37 °C, 60 °C, and 80 °C for 2 h.

[0032] [Figure 12] 4 shows transmission electron microscope (TEM) images of MnFe2O4 and Fe3O4 nanoparticles.

[0033] [Figure 13] TEM image of CoFe2O4 nanoparticles.

[0034] [Figure 14] TEM image of NiFe2O4 nanoparticles.

[0035] [Figure 15] High resolution TEM (HRTEM) images of CoFe2O4 and NiFe2O4 nanoparticles are shown.

[0036] [Figure 16] 13A-13C graphically show hysteresis loops of CoFe2O4, MnFe2O4, and Fe3O4 nanoparticles.

[0037] [Figure 17] The magnetic field sweep is shown graphically.

[0038] [Figure 18] Graph showing second harmonic intensity of thiophene, furan, or pyrrole-based linkers connecting si-RNA to plasmonic silver nanoparticles (SNPs).

[0039] [Figure 19] 13 graphically depicts second harmonic intensity at a particular temperature as a function of time for a composition comprising an siRNA-SNP having a pyrrole-based linker.

[0040] [Figure 20] 13 graphically illustrates second harmonic intensity at a particular temperature as a function of time for a composition comprising plasmonic silver nanoparticles connected to si-RNA via a furan-based linker.

[0041] [Figure 21] The decay constants of compositions having a furan-based linker (FFT) are graphically compared to compositions having a thiophene-based linker (TMT).

[0042] [Figure 22] 13A-C graphically show relative release of fluorescently labeled miRNA from heterodimeric Fe 3 O 4 / Au measured with respect to time at 155 kHz and 9.76 mT.

[0043] [Figure 23A] 13 is a negative control showing fluorescence of PAM212 cells in the presence of silver nanoparticles.

[0044] [Figure 23B] Positive control showing PAM212 cells transfected with FAM-tagged miRN-148b.

[0045] [Figure 23C]1 shows PAM212 cells in the presence of (fluorescein) FAM-tagged miRN-148b and a furan-based linker conjugated to SNP when the composition is not photoactivated.

[0046] [Figure 23D] 1 shows PAM212 cells in the presence of FAM-tagged miRN-148b and a furan-based linker conjugated to a SNP composition when the composition is photoactivated.

[0047] [Figure 24A] Negative control showing fluorescence of Ras-induced keratinocyte cells.

[0048] [Figure 24B] Positive control showing fluorescence of Ras-induced keratinocyte cells chemically transfected with 100 Nm of miRN-148b.

[0049] [Figure 24C] 4 shows the fluorescence of Ras-induced keratinocyte cells in the presence of FAM-tagged miRN-148b and a furan-based linker conjugated to a SNP composition when the composition is photoactivated.

[0050] [Figure 25A] Shown is the negative control of stromal medium of hASC cells and Alizarin Red stained D21.

[0051] [Figure 25B] Shown is a positive control of osteogenic medium for hASC cells and Alizarin Red staining D21.

[0052] [Figure 25C] FIG. 13 shows a negative control of Alizarin Red staining D21 of hASC cells transfected with AuFe3O4 nanoparticles without RF activation.

[0053] [Figure 25D]Alizarin red staining D21 of hASC cells transfected with AuFe3O4 nanoparticles bearing miRN-148b conjugated with a furan-based Diels-Alder linker after RF activation.

[0054] [Figure 26A] FIG. 13 is a graphical representation of SEM / EDS (scanning electron microscopy / energy dispersive X-ray spectroscopy) showing the mineralization level of hASC cells with RF-activated AuFe 3 O 4 nanoparticles without miRN-148b.

[0055] [Figure 26B] FIG. 13 is a graphical representation of SEM / EDS showing the mineralization level of hASC cells after RF activation of AuFe3O4 nanoparticles with miRN-148b conjugated with a furan-based Diels-Alder linker.

[0056] [Figure 27] A multi-step process for the synthesis of gold-silver-gold core-shell-shell nanoparticles is presented.

[0057] [Figure 28A] Transmission electron microscope (TEM) images of gold seed (or core), gold-silver core-shell, and gold-silver-gold core-shell-shell nanoparticles. Scale bar = 50 nm.

[0058] [Figure 28B] FIG. 28B shows STEM EDX mapping of the nanoparticles of FIG. 28A for gold (Au) and silver (Ag). Scale bar=20 nm.

[0059] [Figure 29] 1 shows the UV-VIS absorption spectra of gold core, gold-silver core-shell, and gold-silver-gold core-shell-shell nanoparticles.

[0060] [Diagram 30] An exemplary Diels-Alder cycloaddition reaction between 6-maleimidohexanoic acid and a diene is shown.

[0061] [Diagram 31] 1 shows an exemplary synthesis of a diene bearing a sulfhydryl group by conjugation of cysteamine.

[0062] [Diagram 32] EDC / NHS coupling chemistry for appending 3' amine siRNA to the Diels-Alder linker is shown.

[0063] [Diagram 33] 1 shows an exemplary gold-silver-gold core-shell-shell photoinducible delivery vehicle.

[0064] [Diagram 34] Irradiation with light in the near infrared range (850 nm) is shown to cause photothermal cleavage of the Diels-Alder linker and subsequent release of the siRNA payload.

[0065] [Diagram 35] FIG. 27 shows an exemplary UV-VIS absorption spectrum of gold-silver-gold core-shell-shell nanoparticles (similar to FIG. 29) with an 850 nm LED used for photoactivation.

[0066] [Diagram 36] Step function like payload release profiles from gold-silver-gold core-shell-shell nanoparticles functionalized with a furan-based Diels-Alder linker bearing fluorescein as the payload. The nanoparticles were irradiated with an LED (850 nm) at various light energy output.

[0067] [Figure 37A] 1 illustrates an exemplary embodiment of the present disclosure.

[0068] [Figure 37B] 1 shows a graph illustrating payload release as a function of applied energy.

[0069] [Figure 37C] 1 shows an image of an exemplary nanoparticle according to the present disclosure.

[0070] [Figure 38A] 1 shows a graph displaying cell numbers according to different treatment modalities in different cell lines.

[0071] [Figure 38B] 1 shows a graph depicting relative optical density for different treatment modalities.

[0072] [Figure 39A] Graphs showing localized Ag content in kidney, lung, liver, spleen, tumor, and heart are shown.

[0073] [Figure 39B] 1 shows a graph depicting relative tumor volume over time according to different treatment modalities.

[0074] [Diagram 40] FIG. 1 shows an exemplary implementation of the present disclosure using photoactivation to initiate a retro Diels-Alder reaction.

[0075] [Figure 41A] 1 shows exemplary absorption spectra over different wavelengths for various nanoparticle structures.

[0076] [Figure 41B] 1 shows exemplary TEM images of non-limiting exemplary nanoparticle structures.

[0077] [Figure 41C] 1 shows exemplary STEM / EDS images of non-limiting exemplary nanoparticle structures.

[0078] [Diagram 42] 1 shows a graph depicting normalized strength versus size for various compositions.

[0079] [Figure 43A] An exemplary reaction scheme for synthesizing a Diels-Alder linkage is shown.

[0080] [Figure 43B] An exemplary Francois-Alder (FDA) reaction is shown.

[0081] [Figure 44A] 1 shows the SHG intensity of Au core nanoparticles as a function of time.

[0082] [Figure 44B] 1 shows the SHG intensity of Ag-core nanoparticles as a function of time.

[0083] [Figure 44C] FIG. 1 shows the SHG intensity of Au-Ag-Au core-shell-shell nanoparticles as a function of time.

[0084] [Diagram 45] FIG. 1 shows an exemplary schematic illustrating the enhancement of photothermal efficiency and penetration depth of different nanoparticles (Au vs. Ag vs. Au-Ag-Au core-shell-shell nanoparticles).

[0085] [Figure 46] 1 shows a bar graph showing absolute fluorescence from emitted siRNA versus near-infrared (NIR) light energy, indicating the energy required for emission of therapeutic species, according to some embodiments described herein.

[0086] [Figure 47A] An example of cell uptake / transfection efficiency without activation energy ("-LiGeR").

[0087] [Figure 47B] An example of therapeutic payload release with activation energy ("+LiGeR") is shown.

[0088] [Figure 48A]Images of intracellular release are shown.

[0089] [Figure 48B] 47B shows an image of the intracellular release of FIG. 47A at enhanced zoom.

[0090] [Figure 49] 1 shows plots of cell numbers upon exposure to different treatment modalities.

[0091] [Figure 50A] Bar graphs showing two index negative delta-delta counts as indicators of gene expression of ROCK1, TGF2, MYC, and STAT3 under mir-NC or mir-34a conditions are shown.

[0092] [Figure 50B] Bar graphs showing two index negative delta-delta counts as indicators of gene expression of ROCK1, TGF2, MYC, and STAT3 under mir-NC or mir-34a conditions are shown.

[0093] [Figure 50C] Bar graphs showing two index negative delta-delta counts as indicators of gene expression of ROCK1, TGF2, MYC, and STAT3 under mir-NC or mir-34a conditions are shown.

[0094] [Figure 50D] Bar graphs showing two index negative delta-delta counts as indicators of gene expression of ROCK1, TGF2, MYC, and STAT3 under mir-NC or mir-34a conditions are shown.

[0095] [Figure 50E] Shown is an image of an electrophoretic gel stained after application of samples taken under the conditions indicated at the top of the gel to evaluate the genes on the left.

[0096] [Figure 51]A line graph showing tumor volume over days in mice receiving the indicated treatments / conditions is shown.

[0097] [Figure 52] Figure 1 shows live / dead staining of TE10 cells transfected with Au-Ag-Au core-shell-shell (CSS) particles with 850 nm light-activated payload and miRNA mimics that mimic light to release miRNA mimics, according to some embodiments described herein. Cells were treated with either particles carrying only one miRNA mimic or a combination of particles carrying different miRNA mimics.

[0098] [Figure 53] Figure 1 shows live / dead staining of Cal27 cells transfected with Au-Ag-Au core-shell-shell (CSS) particles with 850 nm light-activated payload and miRNA mimics that mimic light to release miRNA mimics, according to some embodiments described herein. Cells were treated with either particles carrying only one miRNA mimic or a combination of particles carrying different miRNA mimics.

[0099] [Figure 54] Figure 1 shows live / dead staining of SCC cells transfected with Au-Ag-Au core-shell-shell (CSS) particles with 850 nm light-activated payload and miRNA mimics that mimic light to release miRNA mimics, according to some embodiments described herein. Cells were treated with either particles carrying only one miRNA mimic or a combination of particles carrying different miRNA mimics. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0100] The embodiments described herein may be more readily understood by reference to the following detailed description, examples, and drawings. However, the elements, devices, and methods described herein are not limited to the specific embodiments presented in the detailed description, examples, and drawings. It should be recognized that these embodiments are merely illustrative of the principles of the present invention. Numerous modifications and adaptations will be readily apparent to those skilled in the art without departing from the spirit and scope of the present invention.

[0101] Additionally, all ranges disclosed herein should be understood to encompass any and all subranges contained therein. For example, a range stated as "1.0 to 10.0" should be considered to include any and all subranges beginning with a minimum value equal to or greater than 1.0 and ending with a maximum value equal to or less than 10.0, such as 1.0 to 5.3, or 4.7 to 10.0, or 3.6 to 7.9.

[0102] All ranges disclosed herein should also be considered to include the endpoints of the range, unless expressly stated otherwise. For example, the ranges "between 5 and 10," "from 5 to 10," or "5-10" should generally be considered to include the endpoints 5 and 10.

[0103] Additionally, when the phrase "up to" is used in connection with an amount or quantity, it should be understood that the amount is at least a detectable amount or quantity. For example, a material present in an amount "up to" a specified amount can be present from a detectable amount up to and including the specified amount.

[0104] Also, the article "a" or "an" should be understood to refer to "at least one," unless the context of the particular usage requires otherwise.

[0105] I. Therapeutic and / or Diagnostic Compositions In one aspect, the compositions described herein. In some embodiments, the compositions described herein include (a) nanoparticles, (b) a therapeutic species, and (c) a linker that connects the therapeutic species and the nanoparticles. The linker includes a Diels-Alder cycloaddition reaction product. As further described herein, such compositions are capable of delivering a therapeutic species (or other species) to a biological compartment (or other environment) in some cases. Without intending to be bound by any particular theory, it is believed that such delivery can occur when externally applied light or magnetic energy "heats" the nanoparticles, followed by a transfer of thermal energy from the nanoparticles to the linker. If the transferred energy is sufficient to activate (or initiate) a retro (or reverse) Diels-Alder reaction, the linker is cleaved and the therapeutic species is detached and released from the nanoparticle.

[0106] The linkers of the nanoparticles, therapeutic species, and compositions of the present disclosure are described in further detail below.

[0107] A. Nanoparticles The nanoparticles of the compositions described herein are not particularly limited and can be any nanoparticles not inconsistent with the objectives of the present invention. For example, the nanoparticles can be metal nanoparticles in some embodiments, or magnetic nanoparticles in other embodiments.

[0108] Metal nanoparticles can be formed from any suitable metal, such as any metal that can be heated by an external stimulus or signal (such as light). For example, in some cases, the nanoparticles described herein are formed from silver, gold, platinum, or mixtures or alloys thereof. In some embodiments, the metal nanoparticles are "plasmonic" metal nanoparticles, particularly metal nanoparticles that have a plasmon resonance frequency at wavelengths of light suitable for use in biological environments, such as visible light, infrared (IR) light, or near infrared (NIR). For example, in some cases, visible light is light corresponding to wavelengths of 300 nm to 700 nm, 390 nm to 700 nm, 390 nm to 600 nm, 390 nm to 500 nm, 390 nm to 450 nm, 450 nm to 700 nm (e.g., 415 nm), 500 nm to 650 nm, 550 nm to 600 nm, 500 nm to 700 nm, 550 nm to 650 nm, or 600 nm to 700 nm. In some examples, the infrared light is light corresponding to a wavelength of 700 nm to 1 mm, 800 nm to 900 μm, 900 nm to 800 μm, 1000 μm to 700 μm, 900 μm to 800 μm, 700 nm to 900 μm, 700 nm to 800 μm, 700 nm to 700 μm, 700 nm to 600 μm, 700 nm to 500 μm, 700 nm to 400 μm, 700 nm to 300 μm, 700 nm to 200 μm, 700 nm to 100 μm, 700 nm to 1000 nm, 700 nm to 900 nm, or 700 nm to 800 nm. In some examples, near infrared light is light corresponding to wavelengths of 700 nm to 1 μm (1000 nm), 750 nm to 950 nm, 800 nm to 900 nm, 750 nm to 1 mm, 800 nm to 1 mm, 850 nm to 1 mm, 900 nm to 1 mm, 950 nm to 1 mm, 700 nm to 950 nm, 700 nm to 900 nm, 700 nm to 850 nm, 700 nm to 800 nm, or 700 nm to 750 nm.

[0109] In some embodiments, the nanoparticles described herein include core-shell-shell nanoparticles. Such core-shell (CSS) nanoparticles may include a core, a first shell covering the core, and a second shell covering the first shell. As will be understood by one of skill in the art, the first shell can completely or substantially completely (e.g., at least 95%, at least 98%, or at least 99%) cover or "coat" the surface of the core such that the core is contained within or "encased" by the first shell. Similarly, the second shell can completely or substantially completely cover or "coat" the surface of the first shell such that both the core and the first shell are contained within or "encased" by the second shell. The core, first shell, and second shell may be formed from any material not inconsistent with the objectives of the present disclosure. For example, in some cases, the core, first shell, and / or second shell include or are formed from a metal or a metal combination, alloy, or mixture, where a "metal" is a metal in elemental or zero oxidation state, as opposed to a metal ion such as may be found in a metal oxide. The metal or metal combination, alloy, or mixture can be the same or different for the core and one or more shells. For example, in some cases, the nanoparticles include gold-silver-gold core-shell nanoparticles.

[0110] It is also possible to use "core-shell" nanoparticles that include a core and two or more different shells. In this context, the term "core-shell" nanoparticles can be used to refer to nanoparticles that have a core and one or more shells that radially or concentrically cover or encase the core. For example, in some embodiments, the nanoparticles described herein can include a core and n consecutive shells, where the nth (or outermost) shell completely or substantially completely covers or encases or wraps the (n-1)th shell until the core is reached, and the (n-1)th shell completely or substantially completely covers or encases or wraps the (n-2)th shell. In such examples, n can be any integer not inconsistent with the objectives of the present disclosure, including any integer in the range of 3 to 20 or 3 to 10. It is further noted that in some embodiments, the consecutive shells are in direct contact with each other (and, ultimately, with the core).

[0111] The core-shell nanoparticles described herein can be made by any method consistent with the objectives of the present disclosure, including the methods further described herein. In some cases, the core-shell nanoparticles are formed by first synthesizing the core, and then sequentially synthesizing each shell, with or without a purification step between the growth of the shell layers. Such synthesis can include redox reactions of metal shell precursors, or other reactions (electrochemical or otherwise) to deposit or form the shell on the particle surface.

[0112] The core of the core-shell nanoparticles described herein can have any size as further described herein. Similarly, any particular shell of a core-shell nanoparticle can have any thickness consistent with the purposes of this disclosure (thickness, of course, being understood to refer to the radial dimension of the shell). For example, in some embodiments, the outermost (e.g., second) or any other shell of the nanoparticle has an average thickness of at least 25 nm, at least 30 nm, at least 40 nm, or at least 50 nm. In some cases, the average thickness of the shell (e.g., the outermost shell) is 25-100 nm, 25-50 nm, 30-100 nm, 30-70 nm, or 50-100 nm.

[0113] Additionally, in some cases, the outermost shell or exterior surface of the nanoparticles described herein is smooth. For example, in some embodiments, the nanoparticles have a surface roughness of 20 nm or less, 10 nm or less, or 5 nm or less, and such surface roughness can be measured in any manner consistent with the objectives of the present disclosure, such as using one or more of the following parameters: Ra, Rq, Rvi, Rpi, Rzi, or corresponding area parameters such as Sa or Sq. Furthermore, in some embodiments, the exterior surface of the nanoparticles described herein does not include or is substantially free of spikes or protrusions having a height of 2 nm or more, 5 nm or more, or 10 nm or more.

[0114] The nanoparticles described herein may have any optical properties not inconsistent with the objectives of the present disclosure. For example, in some preferred embodiments, the nanoparticles have optical absorption peaks in the near infrared (NIR) region of the electromagnetic spectrum, including within certain wavelength ranges further described herein. For example, in some implementations, the nanoparticles have optical absorption peaks between 800 nm and 900 nm.

[0115] Additionally, in some embodiments, the structure of the nanoparticles can be selected to provide optical properties that relate in a particular way to other optical properties of other components of the compositions, systems, or methods described herein. The structures or properties of the other components can be selected in a similar manner. For example, in some embodiments, the Diels-Alder cycloaddition products of the compositions described herein do not have an optical absorption peak within 200 nm, within 150 nm, within 100 nm, within 50 nm, or within 30 nm of the optical absorption peak of the nanoparticle. Alternatively, in other examples, the Diels-Alder cycloaddition products of the compositions described herein can have an optical absorption peak within 5 nm, within 10 nm, within 20 nm, within 50 nm, or within 100 nm of the optical absorption peak of the nanoparticle. Such optical absorption peaks of the Diels-Alder cycloaddition products can, in some cases, provide efficient energy transfer between the Diels-Alder cycloaddition products and the plasmons of the nanoparticles, resulting in efficient release of the payloads described herein.

[0116] The magnetic nanoparticles of the compositions described herein can be formed from any magnetic material not inconsistent with the objectives of the present disclosure. For example, in some cases, the magnetic nanoparticles are formed from metal oxides such as Fe2O3, Fe3O4, MnFe2O4, CoFe2O4, or NiFe2O4.

[0117] Further, the nanoparticles described herein can have any size consistent with the objectives of the present disclosure. In some cases, the nanoparticles of the compositions described herein have a size or diameter of 1-500 nm, 1-300 nm, 1-200 nm, 1-100 nm, 1-50 nm, 1-30 nm, 1-10 nm, 10-500 nm, 10-300 nm, 10-200 nm, 10-100 nm, 10-50 nm, 20-300 nm, 20-100 nm, 50-500 nm, 50-200 nm, or 50-100 nm in two or three dimensions. A population of nanoparticles of the compositions described herein can also have an average size or diameter as described above.

[0118] Similarly, the nanoparticles of the compositions described herein can have any shape that is not inconsistent with the objectives of the present disclosure.For example, in some cases, the nanoparticles described herein have a spherical or rod shape.Furthermore, the nanoparticles can have a regular or irregular shape.

[0119] Also, without intending to be bound by theory, it is believed that the size, shape, and chemical composition of the nanoparticles described herein affect the ability of the nanoparticles to heat in response to an external stimulus as described herein, such as the application of light, a magnetic field, or other energy source.

[0120] The present disclosure describes the use of photothermal and / or magnetothermal properties of the nanoparticles described herein, such as metallic and / or magnetic nanoparticles. As will be understood by those skilled in the art, these properties refer to the ability of the nanoparticle to convert light (photo) or magnetic (magnetic force) energy into thermal energy that heats the nanoparticle. The thermal energy from the nanoparticle can then be transferred to a linker, cleaving the linker and separating the therapeutic species from the nanoparticle.

[0121] An example of the conversion of light energy to thermal energy occurs in plasmonic metal nanoparticles. Plasmonic metal nanoparticles resonate (e.g., form resonant plasmons) at discrete photon wavelengths of the applied light. These resonant plasmons can decay into photons, which heat the particle in a manner directly proportional to the light capture cross section and the quantum efficiency of plasmon-to-phonon conversion. Thus, heating of plasmonic nanoparticles occurs primarily when the wavelength of the applied light matches the nanoparticle's inherent resonant frequency, forming a resonant plasmon.

[0122] The primary determinant of the resonant frequency in these plasmonic metal nanoparticles is their composition: for example, silver nanoparticles have a local maximum resonant frequency at about 420 nm, as shown in Figure 1, while gold nanoparticles resonate at about 535 nm and platinum nanoparticles resonate at about 215 nm.

[0123] Another determinant of the resonant frequency is the morphology. As an example, nanorods have multiple resonant frequencies that correlate to transverse and longitudinal modes. The longitudinal modes provide red-shifted resonant frequencies in the near-infrared (NIR) region of the spectrum. The transverse modes have much shorter wavelengths, typically found in the optical or visible region of the electromagnetic spectrum.

[0124] Because of the discrete resonant frequencies of the plasmonic nanoparticles described herein, heating of the nanoparticles, and the resulting cleavage of the linker and detachment of the therapeutic species from the nanoparticle, can be controlled. Generally, for heating of the plasmonic nanoparticles to occur sufficiently to cleave the linker in the manner described herein, the frequency of the applied light must match or substantially match the resonant frequency of the plasmonic nanoparticle.

[0125] In some embodiments, the compositions described herein comprise a plurality of different plasmonic nanoparticles. More specifically, in some cases, the different plasmonic nanoparticles have different compositions and / or morphologies. Thus, such nanoparticles can have different resonant frequencies. In these embodiments, the detachment of therapeutic species from the nanoparticles (e.g., within a biological compartment) can be spatiotemporally controlled by using different colors (frequencies and wavelengths) of light for stimulation of the plurality of nanoparticles at different times or different locations (e.g., different locations within a biological compartment). The different light frequencies can each match or substantially match at least one of the resonant frequencies of the different plasmonic nanoparticles.

[0126] Another example of the above conversion of incident, external, or activation energy to thermal energy can occur when magnetic nanoparticles are used. Magnetic nanoparticles can convert magnetic energy from an applied alternating magnetic field into thermal energy that heats the nanoparticles. Magnetic nanoparticles, such as plasmonic metal nanoparticles, can be tailored to have discrete frequency responses for specific loss powers or based on their chemical composition and morphology. As will be appreciated by those skilled in the art, specific loss power (SLP) is a figure of merit for converting magnetic energy from an applied alternating electric field into thermal energy. The higher the SLP, the higher the conversion efficiency at a particular frequency. Depending on the frequency regime, particles can exhibit different SLP values ​​based on the particle composition and morphology. For example, as shown in FIG. 2A, the CoFe2O4 magnetic nanoparticles described herein had higher SLP values ​​at frequencies of 450 and 650 kHz in some embodiments compared to MnFe2O4, NiFe2O4, and Fe3O4 magnetic nanoparticles. 2A, the Fe3O4 nanoparticles, in some embodiments, had higher SLP values ​​at a frequency of 200 kHz than the other nanoparticles. In some embodiments, the magnetic nanoparticles described herein have SLP values ​​of greater than 20, 25, 30, or 40 W / g at an applied alternating magnetic field frequency of 850 kHz. For example, at an applied alternating magnetic field frequency of 850 kHz, the magnetic nanoparticles have an SLP value of 20 W / g to 80 W / g, 20 W / g to 70 W / g, 20 W / g to 60 W / g, 20 W / g to 50 W / g, 20 W / g to 40 W / g, 20 W / g to 30 W / g, 30 W / g to 80 W / g, 40 W / g to 80 W / g, 50 W / g to 80 W / g, 60 W / g to 80 W / g, 70 W / g to 80 W / g, 25 W / g to 70 W / g, 30 W / g to 60 W / g, or 35 W / g to 50 W / g. Furthermore, in some cases, the magnetic nanoparticles described herein have an SLP value of greater than 2, 5, or 10 W / g at an applied alternating magnetic field frequency of 200 kHz.For example, at an applied alternating magnetic field frequency of 200 kHz, the magnetic nanoparticles have an SLP value of 1 W / g to 20 W / g, 1 W / g to 15 W / g, 1 W / g to 10 W / g, 1 W / g to 9 W / g, 1 W / g to 8 W / g, 1 W / g to 7 W / g, 1 W / g to 6 W / g, 1 W / g to 5 W / g, 1 W / g to 4 W / g, 1 W / g to 3 W / g, 2 W / g to 12 W / g, 2 W / g to 12 W / g, 3 W / g to 12 W / g, 4 W / g to 12 W / g, 5 W / g to 12 W / g, 6 W / g to 12 W / g, 7 W / g to 12 W / g, 8 W / g to 12 W / g, 9 W / g to 12 W / g, or 10 W / g to 12 W / g.

[0127] As will be appreciated by those skilled in the art, intrinsic loss power (ILP) is another indicator of heating efficiency at a given magnetic frequency. Higher ILP values ​​correspond to higher heating efficiency. ILP data for nanoparticles according to some embodiments described herein is provided in FIG. 2B. In some examples, ILP values ​​for nanoparticles described herein range from 0.1 to 12 nHm. 2 / kg, 0.1-11nHm 2 / kg, 0.1-10nHm 2 / kg, 0.1-9nHm 2 / kg, 0.1-8nHm 2 / kg, 0.1-7nHm 2 / kg, 0.1-6nHm 2 / kg, 0.1-5nHm 2 / kg, 0.1-4nHm 2 / kg, 0.23-3.1nHm 2 / kg, 0.1-2nHm 2 / kg, or 0.1 to 1 nHm 2 / kg range.

[0128] B. Treatment species The therapeutic species of the compositions described herein is not particularly limited. Any therapeutic species not inconsistent with the objectives of the present disclosure can be used. Moreover, the therapeutic species can be any species useful for treating a patient's disease or condition, including treating a human patient in vivo. For example, in some cases, the therapeutic species of the compositions described herein is a small molecule, a nucleic acid, a peptide, a protein, or any combination thereof. The nucleic acid can include a plasmid, a small interfering RNA ("siRNA"), a microRNA ("miRNA"), a miRNA mimic, or any combination thereof. As will be understood by those skilled in the art, a miRNA mimic is a chemically modified double-stranded RNA that mimics an endogenous miRNA and allows for miRNA functional analysis by upregulating miRNA activity. In some embodiments, the therapeutic species described herein is an RNA sequence. The term small molecule is understood by those of skill in the art to mean any of the following: 100 Daltons to 1000 Daltons, 100 Daltons to 900 Daltons, 100 Daltons to 800 Daltons, 100 Daltons to 700 Daltons, 100 Daltons to 600 Daltons, 100 Daltons to 500 Daltons, 100 Daltons to 400 Daltons, 100 Daltons to 300 Daltons, 100 Daltons to 200 Daltons, 200 Daltons to 900 Daltons, 250 Daltons to 800 Daltons, 300 Daltons to 700 Daltons, 400 Daltons to 500 Daltons, 500 Daltons to 600 Daltons, 700 Daltons to 800 Daltons, 800 Daltons to 900 Daltons, 900 Daltons to 1000 Daltons, 1000 Daltons to 1000 Daltons, 1000 Daltons to 200 Daltons, 2000 Daltons to 900 Daltons, 2500 Daltons to 800 Daltons, 3000 Daltons to 7000 Daltons, 4000 Daltons to 5000 Daltons, 5000 Daltons to 6000 Daltons, 5000 Daltons to 7000 Daltons, 6000 Daltons to 8000 Daltons, 8000 Daltons to 9000 Daltons, 9000 Daltons to 10000 Daltons, 10000 Daltons to 10000 Daltons, It is understood that small molecules include hydrocarbon-based compounds having molecular weights of 100 to 150 daltons, 350 to 600 daltons, 400 to 500 daltons, 200 to 1000 daltons, 300 to 1000 daltons, 400 to 1000 daltons, 500 to 1000 daltons, 600 to 1000 daltons, 700 to 1000 daltons, 800 to 1000 daltons, or 900 to 1000 daltons. Small molecules can also include hydrocarbon-based compounds having additional heteroatoms such as O, N, S, B, P, or any combination thereof. Additionally, small molecules can be saturated or unsaturated and have single, double, or triple bonds. Small molecules can also be linear or cyclic (both aromatic and non-aromatic) in some cases.

[0129] Additionally, in some cases, the therapeutic species of the compositions described herein may be a theranostic species. Such species can be used to diagnose and treat diseases or conditions. Non-limiting examples of theranostic species include the therapeutic species described above, which may also be luminescent (e.g., fluorescent or phosphorescent), radioactive, MRI active, or otherwise imageable or trackable, including in vivo in human patients.

[0130] In still other cases, the therapeutic or theranostic species described herein may be replaced, or at least partially replaced, by a diagnostic or imaging species. Such diagnostic species may be used to diagnose a disease or condition, rather than treat the disease or condition. For example, in some embodiments, the diagnostic agent may be an antibody specific to a biomarker expressed in cells. For example, the diagnostic agent may be an antigen specific to a particular cell type or disease, such as prostate specific antigen (PSA) for diagnosing the presence of prostate cancer.

[0131] The contrast agent, in some cases, includes a computed tomography (CT) contrast agent, such as a radiological contrast agent or an iodized contrast agent. In some examples, the contrast agent includes a magnetic resonance imaging (MRI) contrast agent, such as a positive magnetic resonance (T1) contrast agent. In some embodiments, such a positive contrast agent includes a species that includes gadolinium or another lanthanide, for example, gadolinium chloride. Furthermore, the contrast agent suitable for use in some embodiments described herein may be a molecular contrast agent or a particulate contrast agent. The contrast agent may also be a nanoparticle material. In some cases, the contrast agent includes a superparamagnetic iron oxide (SPIO), such as ferraheme or ferumoxytol, gold manganese, or gadolinium. Other contrast agents may also be used.

[0132] The imaging agent, in some embodiments, comprises a luminescent species, e.g., a fluorescent species or a phosphorescent species. In some examples, the imaging agent comprises an organic fluorophore or dye, such as rhodamine, coumarin, or cyanine (such as NIR-797). In some embodiments, the imaging agent comprises a luminescent biomolecule, such as a plasmid DNA vector (pEYFP-N1) encoding green fluorescent protein (GFP) or yellow fluorescent protein. The imaging agent may also comprise an organic fluorophore or dye conjugated to a biomolecule, such as rhodamine-conjugated bovine serum albumin (BSA-rhodamine). In still other cases, the imaging agent comprises an inorganic material, such as a semiconductor nanocrystal or quantum dot, which may comprise II-VI semiconductor nanocrystals (such as CdSe) or III-V semiconductor nanocrystals (such as InP or InAs).

[0133] Additionally, the imaging agents described herein may emit light having any wavelength or emission profile not inconsistent with the objectives of the present disclosure. For example, in some embodiments, the imaging agents emit light having wavelengths centered in the near infrared region of the electromagnetic spectrum. The imaging agents may also emit light having wavelengths centered in the visible or non-near infrared region of the electromagnetic spectrum. In some cases, for example, the imaging agents described herein have emission profiles centered at wavelengths of 400 nm to 700 nm, 500 nm to 650 nm, 600 nm to 900 nm, 700 nm to 900 nm, 750 nm to 850 nm, 800 nm to 1100 nm, 1100 nm to 1400 nm.

[0134] Furthermore, the therapeutic species (or therapeutic or diagnostic species or imaging agent) described herein can be connected, attached, or bonded to the linker in any manner consistent with the objectives of this disclosure. In some embodiments, for example, the therapeutic species is connected to the linker via a covalent bond. For example, an amine-terminated therapeutic species (e.g., an amine-terminated nucleic acid) can be covalently attached to the linker by reacting the amine-terminated nucleic acid with the carboxy-terminated end of the linker via EDC (1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide) coupling or other carbodiimide coupling. Carbodiimide coupling is described in Dunetz J, Magano J, Weisenburger G., "Large-Scale Applications of Amide Coupling Reagents for the Synthesis of Pharmaceuticals," Org. Process Res. Dev. 2016, 20, 140-177, which is incorporated herein by reference in its entirety. Figures 4 and 5 also show such linkages. Specifically, FIG. 4 shows an exemplary EDC coupling reaction of an amine-terminated RNA sequence that is covalently attached to the carboxy-terminated end of a linker.

[0135] In some embodiments, the compositions described herein are for use in tissue regeneration. In this example, the therapeutic species is a tissue regeneration species (i.e., a "tissue regenerating agent"). The tissue regeneration species can include an osteogenic modulator, a chondrogenic modulator, an endothelialization modulator, or a myogenic modulator. Exemplary embodiments of osteogenic modulators can include simvastatin, strontium ranelate, miRNA 26a, 148b, 27a, and 489, or any osteogenic modulator not inconsistent with the objectives of the present disclosure. Exemplary embodiments of chondrogenic modulators include miR-9, miR-140, and miR-30A, although the chondrogenic modulators described herein can be any chondrogenic modulator not inconsistent with the objectives of the present disclosure. Exemplary embodiments of endothelialization modulators include miR-210, miR-195, miR-155, miR-106b, miR-93, and miR-25, although the endothelialization modulators described herein can be any endothelialization modulator not inconsistent with the objectives of the present disclosure. Exemplary embodiments of myogenesis modulators include miR-206, miR-1, siGDF-8, miR-133, miR-24, and miR-16, although the myogenesis modulators described herein can be any myogenesis modulator not inconsistent with the objectives of the present disclosure.

[0136] In some embodiments, the compositions described herein are for use in cancer chemotherapy. In this example, the therapeutic species can include anti-cancer or anti-tumor agents (hereinafter generally referred to as "anti-cancer agents"). Exemplary embodiments of the anti-cancer species include paclitaxel, afatinib, dimaleate, bortezomib, carfilzomib, doxorubicin, fluorouracil, miRNA-148b, -135, -124, -101, -29c, -15a, and -34 (MRX34) mimics, or any anti-cancer agent not inconsistent with the objectives of the present disclosure.

[0137] More specifically, in certain embodiments, the compositions described herein can be used for the treatment / chemotherapy of brain tumors, such as glioblastoma multiforme (GBM). In some such implementations, the therapeutic species can include one or more miRNA species. Exemplary miRNAs that can be included in exemplary implementations are listed in Table 1 below. [Table 1]

[0138] In some embodiments, the compositions described herein can include one or a combination of two or more miRNA species (or other therapeutic species) described herein. For example, combination therapy can be used in certain implementations. Some compositions according to the present disclosure can include a first metal nanoparticle linked to a first miRNA and a second metal nanoparticle linked to a second miRNA, where the first miRNA is different from the second miRNA. It is also possible for a single nanoparticle described herein to be linked to multiple different miRNA species (or other therapeutic species), such as a first miRNA species and a second miRNA species different from the first miRNA species. In some preferred embodiments, a combination of a first and a second miRNA species is used, for example, as described in Table 2 below. [Table 2]

[0139] C. Linker The linker of the compositions described herein is not particularly limited and may be any linker not inconsistent with the objectives of the present disclosure. As described above, the linker includes a Diels-Alder cycloaddition product. As will be understood by those skilled in the art, the Diels-Alder reaction is a conjugate addition reaction between a conjugated diene and a dienophile. Furthermore, the dienophile may include an ethylenically unsaturated moiety. For example, in some cases, the dienophile is a substituted or unsubstituted alkene or alkyne. In some embodiments, the Diels-Alder cycloaddition product of the compositions described herein is a reaction product of a dienophile with a furan, thiophene, or pyrrole. An exemplary Diels-Alder reaction of a furan, thiophene, or pyrrole (each of which is an exemplary diene) with 6-maleimidohexanoic acid (an exemplary dienophile) is shown, for example, in FIG. 5.

[0140] In addition, exemplary dienes according to the present disclosure can further include additional functional groups or reactive moieties, such as sulfhydryl groups. Non-limiting examples of dienes containing sulfhydryl groups include: 2-thiophenemethanethiol, 3-thiophenemethanethiol, 2-methylthiophene-3-thiol, 1-(2-thienyl)ethanethiol, 5-methylthiophene-2-thiol, 5-methyl-3-thiophenethiol, 5-ethylthiophene-2-thiol, 2,5-bis(mercaptomethyl)thiophene, 2,5-dimethylthiophene-3-thiol, thiol-decanethiol, 1-(2-methylthiophen-3-yl)sulfanylethanethiol, 2-thiopheneethanethiol, 5-methylthiophene-2-methanethiol, 5-ethylthiophene-3-thiol, 1-thiophene-2-ylpropane-1,1-dithiol, 1-thiophene-2-ylpropane-2-thiol, 5-methylthiophene-2,3-dithiol, 5-mercapto-2-thienylbutane, furfuryl mercaptan, 5-methyl-2-furanmethanethiol, 2-(1 -mercaptoethyl)furan, (3-methylfuran-2-yl)methanethiol, 2-methyl-3-furanthiol, 5-methyl-3-furanthiol, (2-methylfuran-3-yl)methanedithiol, 2-furanethanethiol, [5-(sulfanylmethyl)furan-2-yl]methanethiol, furan-2-ylmethanedithiol, 1-(2-methylfuran-3-yl)ethanethiol, 3-(furan-2-yl)propane-1-thiol, 1-(furan-2-yl)propane-1-thiol, 1-(furan-2-yl)ethane ... -ylmethylsulfanyl)butane-2-thiol, 2-[2-[2-(furan-2-yl)-1,3-dithiol-4-yl]ethylsulfanyl]ethanethiol, 1-(furan-2-yl)ethane-1,2-dithiol, (3-ethylfuran-2-yl)methanethiol, (5-ethylfuran-2-yl)methanethiol, 2-[1-(disulfanyl)ethyl]furan, 1-(furan-2-yl)propane-2-thiol, 2-(furan-2-yl)ethane-1,1-Dithiol, 1-(5-methylfuran-2-yl)ethane-1-thiol, (2-methylfuran-3-yl)methanethiol, 2-[2-(disulfanyl)ethyl]furan, 4-(furan-2-yl)butane-2-thiol, 2-furanpropanethiol, 2-(5-methylfuran-2-yl)ethanethiol, 2-(disulfanylmethyl)furan, 3-(furan-2-ylmethylsulfanyl)propane propane-1-thiol, 2-(furan-2-ylmethoxy)ethanethiol, 1H-pyrrol-2-ylmethanethiol, (3-methyl-1H-pyrrol-2-yl)methanethiol, 2-(2-methyl-1H-pyrrol-3-yl)ethanethiol, 1-(1H-pyrrol-2-ylmethyl)piperidine-3-thiol, 5-ethyl-1H-pyrrole-3-thiol, 2-methyl-1H-pyrrole-3-thiol 1-(2-ethyl-1H-pyrrol-3-yl)ethanethiol, 5-methyl-1H-pyrrole-3-thiol, 2-(disulfanylmethyl)-1H-pyrrole, 2-(1H-pyrrol-2-yl)propane-2-thiol, 1-(1H-pyrrol-2-yl)ethanethiol, 12-(1H-pyrrol-2-yl)dodecane-1-thiol, 8-(1H-pyrrol-2-yl)octane-1-thiol ol, 11-(1H-pyrrol-2-yl)undecane-1-thiol, 2-(1H-pyrrol-2-yl)ethanethiol, 1-cyclopropyl-2-(1H-pyrrol-2-yl)ethanethiol, 4-(1H-pyrrol-2-yl)butane-1-thiol, 3-(1H-pyrrol-2-yl)propane-1-thiol, and 2-methyl-2-(1H-pyrrol-2-yl)propane-1-thiol.

[0141] Such dienes bearing sulfhydryl or another additional functional group ("additional" functional group refers to a functional group that is not required for the Diels-Alder cycloaddition reaction, but may be used to react separately with another species, such as to form a covalent bond with the therapeutic species and / or nanoparticle surface described herein) are preferred in some embodiments described herein. Non-limiting additional functional groups can include hydroxyl or carboxyl groups, as well as sulfhydryl or thiol groups. Thus, in some embodiments of the compositions described herein, the linker is covalently attached to the nanoparticle and / or therapeutic species via an RSX bond, where R is an alkyl or another organic substituent attached to the sulfur through a carbon atom, and X is the nanoparticle or therapeutic species.

[0142] As mentioned above, in some implementations, the diene can include a carboxyl group. Some non-limiting examples of dienes that include a carboxyl group include: 1H-pyrrole-2-carboxylic acid, 1H-pyrrole-3-carboxylic acid, 3,5-dimethyl-1H-pyrrole-2-carboxylic acid, 1,5-dimethyl-1H-pyrrole-2-carboxylic acid, 2,4,5-trimethyl-1H-pyrrole-3-carboxylic acid, 5-phenyl-1H-pyrrole-2-carboxylic acid, 2,4-dimethyl-1H-pyrrole-3-carboxylic acid, 2,5-dimethyl-1H-pyrrole-3-carboxylic acid, 3-methyl-1H-pyrrole-2-carboxylic acid, 5-(3,4-dimethylphenyl)-2-methyl-1H-pyrrole-3-carboxylic acid, 1-methyl-1H-pyrrole-2-carboxylic acid, 2-methyl-1H-pyrrole-3 -carboxylic acid, furan-2-carboxylic acid, furan-3-carboxylic acid, 2-(furan-2-yl)acetic acid, 3-(5-methylfuran-2-yl)propanoic acid, 5-ethylfuran-2-carboxylic acid, 5-isobutyl-2-methylfuran-3-carboxylic acid, 4,5-dimethylfuran-2-carboxylic acid, thiophene-2-carboxylic acid, 4,5-dimethylthiophene-2-carboxylic acid, 3-methylthiophene-2-carboxylic acid, 5-methylthiophene-2-carboxylic acid, 5-phenylthiophene-2-carboxylic acid, 2-(thiophen-2-yl)acetic acid, thiophene-3-carboxylic acid, 2-(thiophen-3-yl)acetic acid, 5-ethylthiophene-2-carboxylic acid, and 5-methyl-4-phenylthiophene-3-carboxylic acid.

[0143] Dienes bearing sulfhydryl groups can be prepared in any manner consistent with the objectives of this disclosure, including using the protocols described in the specific examples below. Instead of cysteamine, one or more of the following reactants can be used to form such modified dienes: 3-aminopropanethiol, 1-aminoethanethiol, thiocysteamine, 2-(disulfanyl)ethanamine, 1-aminoethane-1,2-bisthiol, (2-aminoethyldisulfanyl)methanethiol, 2,4-bis-(4-methoxyphenyl)-1,3-dithia-2,4-diphosphetane 2,4-disulfide, 4-aminobutane-1-thiol, 1-aminopropane-1-thiol, 1-aminopropane-2-thiol, 3-aminopropane-1,2-dithiol, 3-(trisulfanyl)propan-1-amine, 1-aminopropane-1 ,3-dithiol, 5-aminopentane-1-thiol, 1-amino-2-butanethiol, 1-aminobutane-3-thiol, 1,2-aminobutanethiol, 1-aminobutane-2,3-dithiol, 1-aminobutane-1,3-dithiol, 1-aminobutane-1,4-dithiol, 4-aminobutane-1,1-dithiol, 4-(disulfanyl)butan-1-amine, 1-aminobutane-1,2-dithiol, 4-aminobutane-1,2-dithiol, 4-aminobutane-1,3-dithiol, 6-aminohexane-1-thiol, 2-aminohexane-1-thiol, 5-aminohexane-2-thiol, 6-aminohexane-1,3-dithiol, 6-aminohexane-1,1-Dithiol, 6-aminohexane-3-thiol, 6-aminohexane-2-thiol, 5-aminohexane-1-thiol, 4-aminohexane-1-thiol, 7-aminoheptane-1-thiol, 7-aminoheptane-3-thiol, 1-aminoheptane-1-thiol, 1-aminopentane-3-thiol, 5-aminopentane-2-thiol, 1-aminoheptane-4-thiol, 1-aminohexane-3-thiol, 3-aminohexane 1-aminohexane-2-thiol, 5-aminopentane-1-thiol, 6-aminoheptane-1-thiol, 6-aminohexane-1-thiol, 8-amino-1-octanethiol, 9-aminononane-1-thiol, 9-aminononane-1,1-dithiol, 10-aminodecane-1-thiol, 11-amino-1-undecanethiol, 12-aminododecane-1-thiol, and 15-aminopentadecane-1-thiol.

[0144] Exemplary dienophiles suitable for use in some embodiments described herein include: 2-maleimidoacetic acid, 3-maleimidopropionic acid, 3-maleimidobenzoic acid, 3-(2,5-dioxopyrrol-1-yl)hexanoic acid, 4-maleimidobutyric acid, 4-maleimidobenzoic acid, 4-(2,5-dioxopyrrol-1-yl)hexanoic acid, 4-(2,5-dioxo-2,5-dihydro-pyrrol-1-yl)-benzoic acid, 5-maleimidopentanoic acid, 6-maleimidohexanoic acid, 6-(3-methyl-2,5-dioxopyrrol-1-yl)hexanoic acid, 6-(2,5-dioxopyrrol-1-yl)-2-methylhexanoic acid, 6- (2,5-dioxopyrrol-1-yl)-4-methylhexanoic acid, 7-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)heptanoic acid, 9-(2,5-dioxopyrrol-1-yl)nonanoic acid, 10-(2,5-dioxopyrrol-1-yl)decanoic acid, 11-maleimidoundecanoic acid, 13-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)tridecanoic acid, N-(carboxyheptyl)maleimide, N-(4-carboxy-3-hydroxyphenyl)maleimide, 1,1'-(methylenedi-4,1-phenylene)bismaleimide, and α-maleimidyl-ω-carboxyl poly(ethylene glycol).

[0145] As described further herein, the Diels-Alder cycloaddition product in the linker can undergo a retro (or reverse) Diels-Alder reaction. This retro (or reverse) Diels-Alder reaction decomposes the cycloaddition product formed by the (forward) Diels-Alder reaction back to the reaction precursor that originally formed the cycloaddition product in the forward Diels-Alder reaction. As shown in Figure 6, this decomposition or cleavage of the Diels-Alder cycloaddition product in the linker results in the detachment of the therapeutic species and the nanoparticles. For different Diels-Alder cycloaddition products, the retro (or reverse) Diels-Alder reaction occurs or is initiated at different temperatures (i.e., different activation temperatures). Thus, by varying the Diels-Alder cycloaddition product in the linker group, the decomposition or cleavage of the Diels-Alder cycloaddition product (and the concomitant detachment of the therapeutic species and the nanoparticles) can be "tuned" to occur at different temperatures. For example, the activation temperature of the pyrrole-based linker group in FIG. 7 was measured and found to be 40° C., the furan-based linker group was measured and found to be 60° C., and the activation temperature of the thiophene-based linker group in FIG. 7 was found to be about 80° C. It was also found that cleavage of the furan-based linker occurs faster at lower temperatures than the thiophene-based linker, as can be seen, for example, in FIGS. 10 and 11. FIG. 10 shows the temperature dependence of the retro Diels-Alder reaction (and release of fluorescent si-RNA) of the furan-based linker group (attached to nanoparticles) after heating for 1 hour at 37° C., 60° C., and 80° C., with 25% cleavage of the linker observed at 60° C. FIG. 11 shows the temperature dependence of the retro Diels-Alder reaction (and release of fluorescent si-RNA) of the thiophene-based linker group (attached to nanoparticles) after heating for 2 hours at 37° C., 60° C., and 80° C., with no cleavage of the linker observed until 80° C.

[0146] In some embodiments, the activation temperature for the retro (or reverse) Diels-Alder reaction of the linkers described herein is between 30°C and 170°C, between 30°C and 150°C, between 40°C and 85°C, between 45°C and 100°C, between 50°C and 80°C, or between 55°C and 70°C.

[0147] As further described herein, the activation temperature of the retro Diels-Alder reaction can be achieved, at least in part, by the transfer of thermal energy from the nanoparticle to the linker, by increasing the temperature of the linker or the temperature of the linker's immediate environment. Additionally, in some embodiments, the Diels-Alder cycloaddition reaction product of the compositions described herein has a forward reaction activation energy and a reverse reaction activation energy. The forward reaction activation energy can be the activation energy (e.g., from the Arrhenius equation) of the Diels-Alder reaction that forms the cycloaddition reaction product. Similarly, the reverse reaction activation energy can be the activation energy of the retro Diels-Alder reaction. In some embodiments described herein, the reverse reaction activation energy is at least 1.5 times or at least 1.2 times the forward reaction activation energy. In some cases, the reverse reaction activation energy is 0.5-2 times, 0.5-1.5 times, 0.5-1 times, 0.5-0.9 times, 0.5-0.7 times, 1-1.2 times, 1-1.5 times, 1.2-2 times, 1.5-3 times, or 1.5-5 times the forward reaction activation energy. Additionally, in some implementations, the reverse reaction activation energy is greater than the thermal energy provided by the aqueous environment of the nanoparticle at a temperature of 310 K. In yet other examples, the reverse reaction activation energy (in kJ / mol) is less than the maximum thermal energy (in kJ) of the nanoparticle generated by the absorption by the nanoparticle of a mole of photons at the NIR light absorption peak of the nanoparticle. Compositions with such properties as described above, in some cases, can be both stable in an environment, such as an in vivo environment, and can be activated or cleaved (such that payload release occurs) at a relatively low energy or energies (e.g., provided by light irradiation or magnetic field exposure) that provide one or more clinical advances, such as precise payload release control.

[0148] Additionally, in some embodiments, the compositions described herein can include two or more different linkers, where the linkers include different Diels-Alder cycloaddition products. The use of multiple different linkers can allow for detachment of the therapeutic species and nanoparticles at different temperatures. In this manner, the amount and / or type of therapeutic species delivered to the biological compartment can be controlled. For example, when different therapeutic species are attached to different nanoparticles via different linkers, the release of the different therapeutic species can be controlled by heating the population of different nanoparticles to the retro (or reverse) Diels-Alder activation temperature of one linker group, but not the other. Such heating can result in the release of one therapeutic species, but not the other.

[0149] The linkers described herein can be connected, attached, or bonded to the therapeutic species and / or nanoparticles in any manner consistent with the objectives of the present disclosure. For example, in some cases, the linkers are attached to the nanoparticles via one or more metal-ligand bonds (such as those shown in Figures 4-6 for metallic nanoparticles, and for magnetic nanoparticles (not shown)). Such bonds can be covalent or non-covalent. For example, in some embodiments, the linkers are attached to the nanoparticles via one or more ionic bonds.

[0150] II. Methods for delivering therapeutic and / or diagnostic species to the environment In another aspect, methods of delivering therapeutic and / or diagnostic species to an environment are described herein. In some cases, such methods include placing a composition described herein in an environment, such as a biological compartment. Any of the compositions described in section I herein above can be used. For example, in some cases, the composition includes a metal or magnetic nanoparticle and a linker that connects the nanoparticle to the therapeutic species, the linker including a Diels-Alder cycloaddition product. The methods described herein can further include initiating a retro-Diels-Alder reaction to degrade the Diels-Alder cycloaddition product of the composition. In this manner, the linker can be cleaved and the therapeutic species can be detached from the nanoparticle including the desired location. Specific steps of the methods described herein are now described in more detail.

[0151] A. Placement of the composition in the environment The compositions described herein can be placed in the environment in any manner consistent with the objectives of the present disclosure. Moreover, the environment can be any environment consistent with the objectives of the present disclosure. In some cases, for example, the environment is a biological environment or compartment. Such an environment or compartment includes or essentially consists of a cell, tissue, organ, or body cavity of a living mammal, such as a human, in some examples. Furthermore, in some embodiments, the compositions described herein are placed in the biological compartment by injecting the composition directly or indirectly into the compartment, such as can be achieved by subcutaneous injection or injection into the vascular system of the mammal.

[0152] The compositions described herein can also be placed in a biological compartment of a mammal by topically applying the composition to the surface of the skin or other surface of the mammal.In some cases, the compositions described herein are placed in a biological compartment by diffusing the composition into the compartment or by oral ingestion.Other methods of placing the composition in the environment can also be used.

[0153] B. Initiation of the Retro Diels-Alder Reaction The step of initiating the retro Diels-Alder reaction to decompose the Diels-Alder cycloaddition product, thereby cleaving the linker and detaching the therapeutic species from the magnetic or thermally activated nanoparticles, can be performed or carried out in any manner consistent with the objectives of the present disclosure. Cleaving the linker and detaching the therapeutic species releases the therapeutic species. In some embodiments, when the linker is cleaved in the biological compartment, the therapeutic species is released in the biological compartment. In some embodiments, the step of initiating the retro Diels-Alder reaction includes heating the nanoparticles of the compositions described herein to an activation temperature of the retro Diels-Alder reaction.

[0154] As noted above, heating of nanoparticles can be achieved in different ways based on the type of nanoparticle (e.g., metallic nanoparticles or magnetic nanoparticles). For example, in the case of metallic nanoparticles, heating can be achieved by irradiating the nanoparticles with light that includes a wavelength (or frequency) that matches or corresponds to the resonant frequency of the nanoparticle. Irradiating the nanoparticles with such light can result in the formation of resonant plasmons. These resonant plasmons can decay into photons that heat the particle, as described above.

[0155] In such embodiments in which metal nanoparticles are used, the applied light can have a mean wavelength in the visible, infrared, or near infrared spectrum, as previously described above. Such wavelengths can in some cases be particularly advantageous when used at sub-toxic intensities.

[0156] In some cases, exposure to light is used to heat the nanoparticles and / or release the payload, particularly NIR. In some such embodiments, the NIR light has a wavelength distribution centered around a central exposure wavelength within 30 nm, 20 nm, or 10 nm of the NIR light absorption peak of the nanoparticles. Furthermore, in some instances, the nanoparticles absorb at least a portion of the energy of the NIR light in a surface plasmon resonance process to provide absorbed plasmon resonance energy. Furthermore, in some embodiments, the absorbed plasmon resonance energy is at least partially converted to thermal energy of the nanoparticles, thereby increasing the temperature of the nanoparticles. Additionally, increasing the temperature of the nanoparticles can result in heating the nanoparticles to an activation temperature of the Diels-Alder reaction.

[0157] In some embodiments described herein, the Diels-Alder cycloaddition product does not absorb more than 3%, more than 5%, more than 10%, or more than 15% of incident photons having wavelengths within the wavelength distribution of NIR light. In this way, photon "competition" between the Diels-Alder cycloaddition product and the nanoparticles can be avoided or minimized. It should be understood that the above references to NIR light can be replaced with different wavelengths of light absorbed by the nanoparticles (e.g., corresponding to the optical absorption peak or plasmon resonance frequency of the nanoparticles). Thus, in some cases, the Diels-Alder cycloaddition product does not absorb more than 3%, more than 5%, more than 10%, or more than 15% of incident photons having wavelengths within 30 nm, within 20 nm, or within 10 nm of the NIR optical absorption peak of the nanoparticles.

[0158] In the case of magnetic nanoparticles, heating can be achieved by applying an alternating magnetic field. As described above, this magnetic energy can be converted to thermal energy that heats the magnetic particles. In some such embodiments, the applied alternating magnetic field can have a frequency in the range of 100-1,000 kHz, 150-950 kHz, 200-900 kHz, 250-850 kHz, 300-800 kHz, 350-750 kHz, 400-700 kHz, 450-650 kHz, or 500-600 kHz. Without intending to be bound by theory, these alternating magnetic field frequencies are believed to be sub-toxic.

[0159] One observed advantage of using an alternating magnetic field to heat magnetic nanoparticles is the ability to heat the nanoparticles at greater depths within a biological compartment compared to irradiating plasmonic metal nanoparticles with light that matches the resonant frequency of at least one of the nanoparticles. Without wishing to be bound by any particular theory, it is believed that this result occurs because the alternating magnetic field is not attenuated by the biological compartment to the same extent as light (due to the presence of water or one or more biomolecules). Thus, in some cases, the compositions and methods described herein may be particularly suitable for use in deep tissue cancer imaging and / or treatment.

[0160] III. Methods for inducing tissue regeneration In another aspect, methods of inducing tissue regeneration are described herein. In some examples, such methods include placing a composition described herein in an environment, such as a biological compartment, and decomposing the Diels-Alder cycloaddition product, thereby cleaving the linker and releasing the therapeutic species, as described above in Section II. Any of the nanoparticles and linkers described in Section I herein above can be used. In some embodiments, the therapeutic species includes a tissue regeneration species, such as an osteogenesis modulator, a chondrogenesis modulator, an endotheliogenesis modulator, or a myogenesis modulator. Exemplary embodiments of tissue regeneration species include nucleic acids, microRNAs ("miRNAs"), small interfering RNAs (siRNAs), peptides, small molecules, antibiotics, antifungals, antibodies, proteins, or any combination thereof. Particular embodiments of osteogenesis modulators, chondrogenesis modulators, endotheliogenesis modulators, myogenesis modulators can include one or more of the examples described in Section I herein.

[0161] In one embodiment, the tissue regenerating species is a miRNA-148b mimic. miRN-148b induces the differentiation of human autologous adipose-derived mesenchymal stromal / stem cells (hASCs) into osteogenic lineage. In some cases, the release of miRNA-148b into the biological compartment of cells (such as hASCs) increases alkaline phosphatase (ALP) activity in the cell membrane and the mineralization of cells. ALP is one of the early protein enzymes expressed during bone formation and is present in the extracellular portion of the plasma membrane, resulting in an increase in the local concentration of inorganic phosphate, a mineralization promoter, and a decrease in the concentration of extracellular pyrophosphate, which is an inhibitor of mineral formation. In some examples, the release of miRN-148b using the methods described herein induces the upregulation of the expression of mRNA for early, intermediate, and late osteogenic marks, such as ALP, RunX2, and osteocalcin (OCN).

[0162] IV. Methods of Treating Cancer In another aspect, methods of treating cancer are described herein. In some examples, the methods include placing a composition described herein in an environment, such as a biological compartment, and decomposing the Diels-Alder cycloaddition product, thereby cleaving the linker and detaching the therapeutic species, as described above in Section II. Any of the nanoparticles and linkers described in Section I herein above can be used. In some embodiments, the therapeutic species includes an anti-cancer species according to any of the embodiments described in Section I herein. In one embodiment, the anti-cancer species is a miRN-148b mimic. miRN-148b has been shown to function as a tumor suppressor and promote carcinogenesis. Without intending to be bound by any theory, it is believed that miRN-148b functions as a tumor suppressor by targeting specific cancer genes in a wide variety of tissues, dramatically suppressing the growth of cancer cells due to the induction of apoptosis and cell cycle arrest in the S phase. In some examples, the release of miRN-148b using the methods described herein treats cancer by suppressing the growth of cancer cells or by killing cancer cells. In another preferred embodiment, miR34a is used as an anti-cancer agent for treating glioblastoma.

[0163] Additional aspects of the compositions and methods of the present disclosure are further illustrated in the following non-limiting examples.

[0164] Example 1 Synthesis of silver nanoparticles Colloidal silver nanoparticles (SNPs) were prepared as follows to obtain SNPs with a diameter size of about 75 nm. At room temperature, 35 mL each of 125 mM silver nitrate (AgNO3) and 61.5 mM formaldehyde (HCOH) was gradually added at 0.5 mL / min to a pre-made solution of 0.5 g NaOH, 0.31 g HPC, 330 mL deionized (DI) water (18.2 MX), and 5 mL antifoam A. For purification, the nanoparticles were filtered via dialysis and lyophilized under vacuum for 72 h before use. Then, a stock solution of 200 ppm in DI water was prepared for further chemical modification.

[0165] Example 2 Synthesis of magnetically activated nanoparticles Magnetically activated AuFe3O4 dumbbell nanoparticles were synthesized as described in Yu, Heng, et al. “Dumbbell-like Bifunctional Au-Fe3O4 Nanoparticles.” Nano Letters 5.2 (2005): 379-82, which is incorporated herein by reference in its entirety. Under a nitrogen flow, 0.30 ml of Fe(CO)5 (2 mmol) was injected into a premixed solution consisting of 1.87 mL of oleic acid (6 mmol), 1.97 mL of oleylamine (6 mmol), 2.58 g of 1,2-hexadecanediol (10 mmol), and 20 ml of 1-octadecene at 120 °C for 20 min. After 3 min, 40 mg of HAuCl4·(H2O)3 (0.1 mmol), 0.5 ml of oleylamine (1.5 mmol), and 5 ml of 1-octadecene were added to the solution. The mixture was then heated by reflux to approximately 300°C for 45 min, cooled to room temperature, and aerated for 1 h. The particles were precipitated with either isopropanol or ethanol and a magnetic bar, washed, and redispersed in hexane. Figures 12-15 show TEM images of MnFe2O4 and Fe3O4 nanoparticles (Figure 12), CoFe2O4 nanoparticles (Figure 13), NiFe2O4 nanoparticles (Figure 14), and CoFe2O4 and NiFe2O4 nanoparticles (Figure 15, HRTEM images) made according to this procedure.

[0166] Experimental Example 3 Diels-Alder linker formation Three different linkers containing Diels-Alder cycloaddition products were formed by the reactions shown in Figure 5, where X is O (furan), S (thiophene), or NH (pyrrole). Figure 8 shows the calculated forward and reverse ΔH for the formation of the three different linkers by the (forward) Diels-Alder reaction in Figure 5 and the (retro) Diels-Alder reaction in Figure 6. rxnThe Diels-Alder cycloaddition product of the linker can be selected, as was done here, such that the forward cycloaddition reaction is more energetically favorable than the backward (retro or reverse) reaction. This allows the Diels-Alder cycloaddition product to form at sub-cleavage (or retro or reverse Diels-Alder) temperatures.

[0167] For the cycloaddition between 6-maleimidohexanoic acid and 2-furanmethanethiol, 4.18 g of the dienophile, maleimide, was combined with 1 mL of the diene reagent in a 1:1 (v / v) dichloromethane / methanol ("DCM:MeOH") solvent mixture. The reaction proceeded in a closed vessel at room temperature under stirring conditions for 7 days. For the Diels-Alder reaction between 2-thienylmethanethiol (0.5 mL) and 6-maleimidohexanoic acid (2.11 g), and between pyrrole-2-carboxylic acid (0.555 g) and 6-maleimidohexanoic acid (2.11 g), the reagents were again mixed together in MeOH only solvent. Both pyrrole and thiophene reactions were carried out in an oil bath at 60 °C for 3 days under controlled ventilation. The bicyclic products between the different dienes and dienophiles were purified by HPLC and analyzed by MALDI-MS, 1 H and 13 Characterized via C NMR, MALDI, FTIR, 1 H NMR, and 13 C NMR confirms the synthesis of all three linkers containing pyrrole, furan, and thiophene cycloaddition products. The results for linkers containing furan cycloaddition products, thiophene cycloaddition products, and pyrrole cycloaddition products are shown in Table 3 below. 13 The C NMR peaks, FTIR main peaks, and M / Z ratios all indicate the formation of the respective linkers. The M / Z ratios (observed) from the MALDI data are the results of the expected m / z ratios (calculated) in positive ion mode for the respective linkers. [Table 3]

[0168] Example 4 Connecting nanoparticles to linkers For nanoparticle conjugation to any one of the linkers described in Example 3, the solutions described in Examples 1 and 2 were dried with nitrogen gas to remove excess solvent and concentrate the samples before suspension without HPLC purification. Additionally, in the case of pyrrole-2-carboxylic acid Diels-Alder reaction, the diene was first crosslinked with cysteamine using EDC coupling chemistry for SNP modification. Briefly, EDC (1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (0.500 g), NHS (N-hydroxysuccinimide) (0.800 g), and cysteamine (0.400 g) were added to pyrrole-2-carboxylic acid (0.555 g) and stirred overnight at room temperature. Three 1 mL aliquots of SNP were centrifuged (10,000 rpm, 15 min) and after removing the supernatant, 0.5 mL of each Diels-Alder product was added directly to one of the 1 mL aliquots of pelleted SNP. The SNP surface modification step was left to proceed for 24 hours at room temperature for all three products, and then the nanoparticles were washed three times by successive centrifugations at 10,000 rpm for 10 min, where each step involved removal of the supernatant and resuspension in 1 mL of 70% (v / v) ethanol.

[0169] Example 5 Conjugation of nanoparticles / linkers with fluorescently labeled small interfering RNA (si-RNA) The three linkers above (pyrrole, furan, and thiophene-based) were each reacted with EDC / NHS (N-ethyl-N'-(3-(dimethylamino)propyl)carbodiimide / N-hydroxysuccinimide) and fluorescently labeled si-RNA. In this embodiment, a 3'amine / 5'-FAM modified antisense RFP single stranded siRNA with the sequence UUGGAGCCGUACUGGAACUUG ("miRN-148b") was used. Specifically, to conjugate the FAM tagged RFP antisense siRNA mimic, an EDC coupling protocol was used with 100 mL of EDC / NHS aqueous (100 mM) stock solution added to each of the three resuspended nanoparticle aliquots prepared in Example 3, followed by 50 mL of amine terminated siRNA (4 mM). After 24 hours, the particles were centrifuged again, washed, and resuspended in DI water. To test the stability of both amide and thiol bonds, control samples in which cysteamine-modified SNPs were linked to 6-maleimidohexanoic acid via EDC coupling were also prepared similar to the pyrrole-based reaction described above, but without the addition of diene. Linker and siRNA conjugation was tested by chemically reducing the Ag-linker bond using TCEP reagent (tris(2-carboxyethyl)phosphine hydrochloride) and measuring the FAM intensity of the supernatant. The products of these reactions (pyrrole-, furan-, and thiophene-based) were analyzed. For example, the temperature dependence of the retro Diels-Alder reaction (and release of fluorescent si-RNA) was evaluated.

[0170] Figure 9 shows the fluorescence intensity of a control (untreated) sample and a chemically cleaved (treated) sample containing the product formed by reacting a furan-based linker with EDC / NHS and a fluorescently labeled si-RNA. The fluorescence intensity of the treated sample is assumed to show maximum release (due to cleavage / retro (or reverse) Diels-Alder reaction). The magnetic moment of the three different nanoparticles used was also measured. Figure 16 shows the hysteresis loops of each of these nanoparticles, and Figure 17 shows the magnetic field sweep. Specifically, for Figure 16, the curve with the smallest vertical change in the y direction is MnFe2O4, the curve with the largest vertical change is CoFe2O4, and the middle curve is Fe2O4.

[0171] FIG. 18 graphically illustrates the second harmonic intensity of thiophene, furan, or pyrrole-based linkers connecting si-RNA to plasmonic silver nanoparticles (SNPs). FIG. 19 illustrates the second harmonic (SHG) intensity at a particular temperature as a function of time for a composition comprising an siRNA-SNP with a pyrrole-based linker as described herein in the Examples. The decrease in second harmonic intensity indicates cleavage via a retro (or reverse) Diels-Alder reaction, cleaving or releasing the SNP from the siRNA. FIG. 20 illustrates the second harmonic (SHG) intensity at a particular temperature as a function of time for a composition comprising a plasmonic silver nanoparticle connected to an siRNA via a furan-based linker as described herein in the Examples. The decay constants of compositions comprising plasmonic silver nanoparticles connected to an siRNA via a furan-based and thiophene-based linkers as described herein in the Examples were measured and compared. FIG. 21 illustrates that at 60° C. and 80° C., the decay constants of the composition comprising a furan-based linker were significantly higher than the decay constants of the composition comprising a thiophene-based linker. A composition was also formed that included heterodimeric Fe3O4 / Au magnetic nanoparticles connected to fluorescently labeled microRNA (miRNA). The relative release of fluorescently labeled miRNA from the heterodimeric Fe3O4 / Au was measured with respect to time at 155 kHz and 9.76 mT and normalized to a chemically released sample that was assumed to be nearly total release, as seen, for example, in FIG.

[0172] Example 6 Anticancer effect of miRN-148b released from retro Diels-Alder reaction in PAM 212 cells The anticancer effect of miRN-148b released from the compositions described herein on PAM212 skin cancer cells was investigated using a furan-based linker conjugated with FAM-tagged miRN-148b and SNPs. The furan-based linker compositions were prepared according to Examples 1-5. SNPs surface-modified with miRNA mimics via Diels-Alder linkages were sterilized in 70 / 30% ethanol and water solutions, followed by washing and resuspending in RNAse-free water. Subsequently, based on the required dosage, an appropriate volume of nanoparticle solution was added to an adherent monolayer of PAM212 cells at an optimal seeding density submerged in an appropriate cell culture medium. Transfection was performed at 37 °C for 24 h.

[0173] As seen in Figures 23A-23D, PAM212 cells were treated with a furan-based linker composition. Figure 23A is a negative control showing the fluorescence of PAM212 cells in the presence of silver nanoparticles prepared according to Example 1 after 7 days. Figure 23B is a positive control showing PAM212 cells transfected with FAM-tagged miRN-148b after 7 days from transfection. Figure 23C shows PAM212 cells in the presence of FAM-tagged miRN-148b and a furan-based linker conjugated with an SNP composition after 7 days when the composition is not photoactivated. Figure 23D shows PAM212 cells in the presence of FAM-tagged miRN-148b and a furan-based linker conjugated with an SNP composition after 7 days when the composition is photoactivated at 420 nm. As seen in Figures 23B and 23D, PAM212 cells exhibited reduced cell proliferation and growth in the presence of the positive control (Figure 23B) and the light-activated composition (Figure 23D). Notably, cell proliferation and growth was most dramatically reduced in the presence of the light-activated composition of Figure 23D. Cell growth in the negative control (Figure 23A) and the non-light-activated composition (Figure 23C) exhibited normal cell behavior. Thus, the light- or magnetically-activated compositions described herein can, in some cases, release anti-cancer / tumor therapeutic agents within cells using a retro Diels-Alder mechanism, and the released therapeutic agents can exhibit in vivo activity against cancer cells.

[0174] Example 7 Anticancer effect of miRN-148b released from retro Diels-Alder reaction in Ras-induced keratinocyte cells The anticancer effect of miRN-148b released from the compositions described herein against Ras-induced keratinocyte lung cancer cells was investigated using a furan-based linker conjugated with FAM-tagged miRN-148b and SNPs. The furan-based linker compositions were prepared according to Examples 1-5. SNPs surface-modified with miRNA mimics via Diels-Alder bonds were sterilized in 70 / 30% ethanol and water solutions, followed by washing and resuspending in RNAse-free water. Subsequently, based on the required dosage, an appropriate volume of nanoparticle solution was added to an adherent monolayer of PAM212 cells at an optimal seeding density submerged in an appropriate cell culture medium. Transfection was performed at 37 °C for 24 h.

[0175] Figure 24A shows a negative control of keratinocyte cells after 7 days in the absence of the composition and FAM-tagged miRN-148b. Figure 24B shows a positive control of keratinocyte cells after 7 days transfected with FAM-tagged miRN-148b (100 nM). Figure 24C shows keratinocyte cells transfected with a composition comprising FAM-tagged miRN-148b and a furan-based linker conjugated with a SNP, and the cells are photoactivated at 420 nm.

[0176] As seen in Figure 24C, keratinocyte cells showed reduced cell proliferation and growth in the presence of the light-activated composition after 7 days. Cell proliferation in the negative control (Figure 24A) and cells transfected with FAM-tagged miRN-148b alone (Figure 24B) showed normal cell behavior. Thus, the light- or magnetically-activated compositions described herein can, in some cases, release anti-cancer / tumor therapeutics in cells using a retro Diels-Alder mechanism, and the released therapeutics can exhibit in vivo activity against cancer cells.

[0177] Example 8 Tissue regeneration effect of miR-148b released from retro Diels-Alder reaction The tissue regeneration effect of miR-148b released from the compositions described herein was investigated using a furan-based linker conjugated with FAM-tagged miR-148b and magnetic nanoparticles. Specifically, the osteoinductive effect of miR-148b on hASCs was investigated using the furan-based linker compositions prepared according to Examples 1-5.

[0178] Magnetic nanoparticles surface-modified with miRNA mimics via Diels-Alder conjugation were sterilized in 70% / 30% ethanol and water solution, followed by washing and resuspending in RNAse-free water. Subsequently, based on the required dosage, an appropriate volume of nanoparticle solution was added to the adherent monolayer hASC cells at optimal seeding density submerged in appropriate cell culture medium. Transfection was performed for 24 hours at 37 °C. Figure 25A shows the stromal medium of hASC cells and the negative control of Alizarin Red staining D21. Figure 25B shows the osteogenic medium of hASC cells and the positive control of Alizarin Red staining D21. Figure 25C shows the negative control of Alizarin Red staining D21 of hASC cells transfected with AuFe3O4 nanoparticles without RF activation. FIG. 25D shows Alizarin Red staining of hASC cells transfected with AuFe3O4 nanoparticles bearing miRNA148b conjugated with a furan-based Diels-Alder linker after radiofrequency (RF) activation D21.

[0179] As seen in FIG. 25A, hASC cells grown on stromal medium exhibit very low levels of mineralization, whereas hASC cells grown on osteogenic medium exhibit high levels of mineralization (FIG. 25B). In the presence of AuFe3O4 nanoparticles without linker and therapeutic agent, hASC cells exhibit low levels of mineralization (FIG. 25C). However, hASC cells transfected with AuFe3O4 nanoparticles bearing miRN-148b attached with a furan-based Diels-Alder linker exhibit increased mineralization after RF activation, indicating that the composition releases miRN-148b upon RF activation, and that miRN-148b induces bone formation (FIG. 25D). Thus, the light- or magnetically-activated compositions described herein can, in some cases, release tissue regenerative therapeutic agents in cells using a retro-Diels-Alder mechanism, and the released therapeutic agents can exhibit in vivo tissue regenerative activity in cancer cells. Furthermore, Figures 26A and 26B show scanning electron microscopy / energy dispersive X-ray spectroscopy (SEM / EDS) data on the mineralization effect in hASC cells transfected with AuFe3O4 nanoparticles bearing miRN-148b conjugated with a furan-based Diels-Alder linker. Figure 26A shows the mineralization level of hASC cells with RF-activated AuFe3O4 nanoparticles without miRN-148b. Figure 26B shows the mineralization level of hASC cells after RF activation of AuFe3O4 nanoparticles bearing miRN-148b conjugated with a furan-based Diels-Alder linker. Comparison of Figures 26A and 26B shows that after activation of the composition and release of the therapeutic agent, hASC cells show increased levels of various minerals such as calcium and phosphorus.

[0180] Example 9 Synthesis of core-shell-shell nanoparticles A. Synthesis of Gold Nanoparticle Seeds Gold chloride (30 mL, 290 μM) was added to a 100 mL round bottom flask equipped with a reflux condenser. The solution was stirred vigorously and heated to boiling. Sodium citrate (900 μL, 34 mM) was then added. After 10 min, the solution was bright red and the reaction was cooled to room temperature.

[0181] B. Gold-silver core-shell nanoparticles Gold nanoparticle seeds (200 μL of pre-prepared solution) were added to 10 mL of ultrapure water and vigorously stirred. Ascorbic acid (60 μL, 100 mM), silver nitrate (15 μL, 100 mM), and sodium hydroxide (75 μL, 100 mM) were then added sequentially. The resulting gold-silver core-shell nanoparticles were centrifuged and resuspended in 10 mL of ultrapure water.

[0182] C. Gold-silver-gold core-shell-shell nanoparticles The previously prepared gold-silver core-shell nanoparticles were vigorously stirred. Gold chloride (100 μL, 29 mM), hydroquinone (100 μL, 0.03 M), and sodium citrate (25 μL, 34 mM) were then added successively. The resulting gold-silver-gold core-shell-shell nanoparticles were centrifuged and resuspended in ultrapure water before use (FIG. 27). With reference to FIG. 27, a gold core nanoparticle is shown diagrammatically on the far left, a gold-silver core-shell nanoparticle is shown in the middle (the outer sphere / circle represents the silver shell formed on the gold core), and a gold-silver-gold core-shell-shell nanoparticle is shown on the right (the outermost sphere / circle represents the gold shell formed on the silver shell which is itself formed on the gold core).

[0183] D. Materials and Methods Gold(III) chloride trihydrate (HAuCl4·3H2O) was used for the synthesis of the nanoparticles. All stock solutions were prepared using ultrapure water. Washing of the nanoparticles by successive centrifugation and redispersion in ultrapure water was used to remove excess reagents before the next synthesis step. To avoid spikes on the surface of the nanoparticles and to obtain a smooth surface (Figure 28), a very low concentration of potassium iodide (micromolar range) was added. Both the smoothness and thickness of the shell can be adjusted to control the absorption peak of the core-shell-shell nanoparticles (Figure 29). To obtain nanoparticles with a broad absorption peak in the near infrared range (>800 nm), the surface of the shell is preferably smooth without spikes and the thickness of the gold shell is at least 25 nm. Nanoparticles containing more than two alternating silver and gold shells can also be synthesized using these or similar protocols.

[0184] Example 10 Synthesis of Diels-Alder linkers A. Exemplary Protocols for the Synthesis of Pyrrole or Thiophene-Based Diels-Alder Linkers Pyrrole or thiophene-based Diels-Alder linkers are typically prepared in a combination of methanol and dichloromethane (1:1 v / v) at 60 °C for 3 days. For example, using 2-thiophenemethanethiol as the diene and 6-maleimidohexanoic acid as the dienophile, 415 µL of 2-thiophenemethanethiol was combined with 7.5 mL of methanol and 7.5 mL of dichloromethane (DCM) in a glass vial. 6-maleimidohexanoic acid (1.75 g) was then added to the glass vial, which was then closed, wrapped in aluminum foil, and heated at 60 °C for 3 days.

[0185] B. Exemplary Protocol for the Synthesis of Furan-Based Diels-Alder Linkers Furan-based Diels-Alder linkers are typically prepared in a combination of methanol and dichloromethane (1:1 v / v) at room temperature for 7 days. For example, using 2-furanmethanethiol as the diene and 6-maleimidohexanoic acid as the dienophile, 6-maleimidohexanoic acid (1.6 g) was dissolved in methanol (7.5 mL) and dichloromethane (7.5 mL) in a glass vial. 2-furanmethanethiol (380 μL) was then added to the mixture. The vial was sealed and protected from light using aluminum foil, and the reaction was allowed to proceed under stirring at room temperature for 7 days.

[0186] Example 11 Plasmonic nanoparticle functionalization with linkers and therapeutic species In this example, sulfhydryl groups on the Diels-Alder linker allow for attachment of the linker on the surface of the core-shell-shell plasmonic particles described herein. One exemplary protocol is as follows:

[0187] The nanoparticles of Example 9 were resuspended in a 1 mL aliquot of the previously prepared Diels-Alder linker. The nanoparticles were left to proceed with the surface modification step under stirring at room temperature for 24 hours. EDC / NHS coupling chemistry was used for the attachment of siRNA to the Diels-Alder linker conjugated to the plasmonic particles (Figure 32). Exemplary protocol: For the addition of oligonucleotides, the nanoparticles were first centrifuged (10,000g, 10 min), resuspended in isopropanol three times, and subsequently mixed with EDC / NHS (100 μL, 100 mM) and the respective 3' amine miRNA mimic (30 μL, 4 μM) for 24 hours at room temperature to allow covalent conjugation.

[0188] Cysteamine could be conjugated to dienes containing carboxyl groups to obtain dienes containing sulfhydryl groups (Figure 31). Below is an example modification protocol of 4,5-dimethyl-2-thiophene carboxylic acid with cysteamine. 50 mg of 4,5-dimethyl-2-thiophene carboxylic acid, 24.7 mg of cysteamine, 143.3 mg of DCC, 95.5 mg of NHS, and 477.6 mg of Na2CO3 were dissolved with 42 mL of DMF and 100 mL of chloroform in a 250 mL round-bottom flask. The mixture was vigorously stirred at room temperature for 12 hours. The sample was then dried, redissolved in DCM, and washed three times with 1 M HCl for acid-base extraction, and the organic layer contained the product. The organic layer was dried and purified using column chromatography (hexane, DCM, acetic acid). The amount of 4,5-dimethyl-N-(2-sulfanylethyl)-2-thiophene carboxamide obtained was 20 mg.

[0189] Example 12 Photoactivation and Payload Release The plasmonic nanoparticles described herein generate heat via the photothermal effect after light illumination, retro-reacting Diels-Alder cycloadducts on the nanoparticle surface and releasing the conjugated siRNA payload (Figures 33, 34, and 35). In some cases, gold-silver-gold core-shell-shell nanoparticles generate highly efficient step-function-like release profiles when illuminated with as little as 10 J (Figure 36).

[0190] Example 13 Characterization and Uses of Nanoparticle Compositions As shown in FIG. 37A, an exemplary silver nanoparticle (SNP) was irradiated with light at a wavelength of 415 nm to produce localized heat generation, which provided the energy for the retro-Diels-Alder release of miR-148b. As shown in FIG. 37B, miR-148b was released over time upon exposure to energy from light at a wavelength of 415 nm, as illustrated in FIG. 37A. Light was initiated at time zero (0 min) and the release of the therapeutic species was followed up to 25 min. A control under the same conditions without 415 nm light showed that miR-148b was not released in the absence of energy from irradiation. A transmission electron microscope (TEM) image of the nanoparticle is shown in FIG. 37C.

[0191] A comparative study was performed using primary keratinocytes and keratinocytes carrying the HRas variant Ras gene (v-HRas), as well as PAM212 cells. These cells were cultured under different conditions and the total cell number was followed as a percentage of the initial cells. The results (Figure 38A and Figure 38B) showed that under control (C) conditions, the difference in cell number was not significant. Under exposure to light (L), the difference in cell number was marginally significant between primary keratinocyte cells and PAM212 cells. Under exposure to silver nanoparticles carrying scrambled non-coding siRNA (SNP-NC), there was no significant (ns) difference in cell number. Under exposure to silver nanoparticles loaded with miR-148b, there was a significant difference in cell number between primary non-cancerous keratinocytes and two other cancer cell lines. The relative DNA content of cells grown in the vessel was measured as a proxy for growth / survival. The two cancer cell lines showed a significant reduction in cell number compared to the primary non-cancerous cells. The mechanism of cell death was determined to be apoptosis since the ratio of cleaved caspase-3 (the caspase enzyme in its active form) to pro-caspase-3 (the caspase enzyme before activation) was significantly increased.

[0192] Figure 39A shows the distribution of nanoparticles with miR-148b payload in mouse tissues after retro-orbital intravenous injection at 6, 12, and 24 hours post-injection. In kidney, lung, and tumor tissues, concentrations peak at 6 hours post-injection, with maximum concentrations in kidney and spleen tissues reached at 12 hours post-injection. Concentrations in the liver continue to increase up to 24 hours as the nanoparticles are cleared.

[0193] Figure 39B shows the effect of different treatments on tumor volume in mice treated with modalities: silver nanoparticles linked to miR-148b (SNP-148b), silver nanoparticles with scrambled non-coding siRNA (SNP-NC), or cell growth medium (phosphate buffered saline, PBS). As shown, PBS and nanoparticles with non-coding siRNA increase the volume indicating tumor growth. However, nanoparticles coupled to miR148-b show a reduction in tumor size, indicating that the tumor disappears almost completely after 7 days.

[0194] Gold-silver-gold core-shell-shell nanoparticles (prepared according to Example 9 above) were also used to provide beneficial clinical results as described herein. As shown diagrammatically in FIG. 40, si-RNA is coupled to the nanoparticles via a Diels-Alder linker that is cleaved upon exposure to light initiating a retro-Diels-Alder reaction. FIG. 41A shows exemplary absorption spectra of core Au nanoparticles, Au-Ag core-shell nanoparticles, and Au-Ag-Au core-shell-shell (CSS) nanoparticles. The addition of the shell shifts the local surface plasmon resonance (LSPR) in a manner that depends on both the composition and thickness of the shell material. The addition of a silver shell to the gold core shifts the LSPR from about 535 nm (green light) to about 420 nm (blue light). The addition of an additional gold shell to the gold core-silver shell particle creates an Au-Ag-Au core-shell-shell particle, shifting the LSPR into the near-infrared region of the spectrum. Depending on the thickness of the final gold shell, the LPSR maximum can shift over a range of about 700 nm to about 1700 nm. This allows tuning the LSPR of the particles to discrete wavelengths within the nIR biological window. Furthermore, as will be appreciated by those skilled in the art, the thickness of the final gold shell can be controlled based on the amount of gold precursor and / or the gold shell growth conditions (e.g., time and temperature). Figure 41B shows TEM images of the three nanoparticle types, and Figure 41C shows scanning tunneling electron microscopy (STEM) and energy dispersive X-ray diffraction spectroscopy (EDS) images of the same nanoparticles, showing the gold (Au) and silver (Ag) content of the nanoparticles.

[0195] Figure 42 shows size histograms of the same three nanoparticle types: gold core (Core) NPs, gold-silver (Au-Ag) core-shell NPs, gold-silver-gold (Au-Ag-Au) core-shell-shell NPs, and core-shell-shell NPs (CSS) conjugated to microRNA (CSS+miR34a). The Au-Ag-Au core-shell-shell NPs size range of approximately 60 nm to 140 nm can provide efficient cell transfection and LSPR peaks in the near-infrared window I (NIR-I) of 700 to 900 nm. Transfection efficiencies of up to 95% can be achieved with the above-mentioned particles.

[0196] As described herein, various Diels-Alder linkers can be used to connect the nanoparticles described herein (such as CSS nanoparticles) to the therapeutic species described herein (such as miRNA species or combinations thereof). The synthesis of Diels-Alder linkers is described broadly above herein. Additionally, FIG. 43A shows a reaction for producing a composition including a furan-based Diels-Alder linker. As shown in FIG. 43A, the synthesis process includes combining a diene and a dienophile in methanol and heating the composition at 80° C. for 3 days to produce an intermediate including a Diels-Alder cycloaddition product. The intermediate (Diels-Alder product) is then further reacted to couple the therapeutic species to the Diels-Alder product (in this example, the therapeutic species is an siRNA). In this example, EDC / NHS chemistry is used to couple the carboxylic acid moiety of the intermediate to the siRNA via reaction with the 3' amine of the siRNA.

[0197] As shown in Figure 43B (and described elsewhere herein), reactions between dienes (e.g., furans) and dienophiles can be reversible. The reaction barriers (enthalpy and Gibbs free energy) for the forward and reverse Diels-Alder reactions of the indicated furan-based Diels-Alder linkers (FDA) at different temperatures are shown in Figure 43B.

[0198] Figures 44A-C show the relative photothermal efficiency (as indicated by SHG intensity) of three particle types: Au particles (Figure 44A), Ag particles (Figure 44B), and Au-Ag-Au core-shell-shell particles (Figure 44C). The Au-Ag-Au core-shell-shell particles have significantly higher photothermal quantum efficiency than the core nanoparticles (especially compared to gold particles). To obtain the data shown in Figures 44A-C, a titanium:sapphire oscillator laser centered at 800 nm with a pulse duration of 70 fs, a repetition rate of 80 MHz, and an average power of 2.6 W is used. The SHG signal is collected in the positive direction using a highly sensitive charge-coupled device (CCD) spectroscopic detector coupled to a monochromator spectrograph. A portion of the oscillator laser beam passes through a beam splitter to seed the amplifier laser. The amplifier produces a laser beam centered at 800 nm with a pulse duration of 75 fs, a repetition rate of 10 kHz, and an average power of 7 W. The amplifier laser is used to irradiate the CSS nanoparticle sample to induce photothermal cleavage of the siRNA, while the remainder of the oscillator laser is used to monitor the photothermal cleavage kinetics in real time using SHG spectroscopy. A computer-controlled beam block is used to block the amplifier illumination beam while taking the SHG signal with the oscillator laser. For SHG measurements, the oscillator laser power is attenuated to a constant value of 300 mW to minimize photothermal emission from the CSS surface while probing the kinetics. A 1 cm x 1 cm quartz cuvette is used to contain 2 mL of the nanoparticle sample. The amplifier laser power is varied and the photothermal cleavage kinetics is monitored as a function of irradiation time and power.

[0199] Figure 46 shows the efficiency of light initiating the retro Diels-Alder reaction and the release of fluorophore-labeled siRNA as a function of the energy applied. The retro Diels-Alder reaction was initiated with 5 Joules (J) of 860 nm light, resulting in approximately 70% of siRNA payload release. Irradiating the particles with 10 J of 860 nm light can result in approximately 100% release of fluorophore-labeled siRNA. Treatment with the chemical releasing agent dithiothreitol (DTT) is used as a standard to determine 100% release from the particles.

[0200] FIG. 47A shows flow cytometry results from a no-particle control for transfection efficiency in TE10 esophageal carcinoma cells.

[0201] Figure 47B shows flow cytometry results of uptake of Au-Ag-Au core-shell-shell nanoparticles with Cy5 fluorophore-labeled siRNA payload, showing a transfection efficiency of 92% when gated on the no particle control.

[0202] Figure 48A shows a no light control for an intracellular release experiment of TE10 cells transfected with Au-Ag-Au core-shell-shell nanoparticles with a Cy5 fluorophore-labeled siRNA payload. The fluorophore is quenched when siRNA binds to the particle, so only scattered light from the particle (red, shown here in grayscale) and nuclear staining (blue, shown here in grayscale) are visible.

[0203] Figure 48B shows NIR light-activated release of Cy5 fluorophore-labeled siRNA payload (green, shown here in grayscale) from Au-Ag-Au core-shell-shell nanoparticles upon illumination of nanoparticle-transfected TE10 cells with 860 nm light. After release of the siRNA, the Cy5 fluorophore is no longer quenched by proximity to the particle and fluorescence is visible, indicating controlled release.

[0204] FIG. 49 shows a graph of cell counts (#) upon exposure to different conditions. NT indicates no treatment, CSS indicates core-shell-shell nanoparticles, CSS-miR## indicates core-shell-shell nanoparticles linked to the listed microRNAs, and "L" indicates the presence of light (specifically, light that provides the activation energy to heat the nanoparticles and initiate the retro Diels-Alder reaction). As shown, the greatest reduction in cell counts is seen when cells are treated with CSS-miR34a+L.

[0205] Figures 50A-49D show graphs depicting changes in counts of measured tumor and / or cancer growth factors: ROCK1, TGF2, MYC, and STAT3. As shown in the figures, counts were measured under two conditions: in the absence of inhibitory microRNA (mir-NC) and in the presence of inhibitory microRNA (mir-34a). As shown, the reduction in counts is greatest in the presence of inhibitory microRNA for each of the genes studied.

[0206] Figure 50E shows an image of a gel stained for the genes indicated on the left, under the conditions indicated at the top.

[0207] FIG. 51 shows a graph of tumor volume in mice provided with different treatment modalities. In the control experiment, treatment without an active agent is provided. In this case, core-shell-shell nanoparticles that are not bound to miRNA and / or siRNA are provided. In the -treatment experiment, no treatment is provided. As expected, the -treatment and control experiments show nearly identical profiles indicating that tumor growth is not affected in these experiments. In the +treatment experiment, an exemplary composition according to the present disclosure is provided, including CSS nanoparticles and a therapeutic species linked to the CSS nanoparticles via a Diels-Alder cycloaddition product.

[0208] 52-54 show live / dead staining of TE10 cells (FIG. 52), Cal27 cells (FIG. 53), and SCC cells (FIG. 54) transfected with Au-Ag-Au core-shell-shell (CSS) particles with 850 nm light-activated payload and miRNA mimics that mimic light to release miRNA mimics, according to some embodiments described herein. Cells were treated with either particles carrying only one miRNA mimic or a combination of particles carrying different miRNA mimics.

[0209] Some additional non-limiting exemplary embodiments are described below. Embodiment 1. A composition comprising: a core-shell-shell nanoparticle comprising a core, a first shell over the core, and a second shell over the first shell; The type of treatment, a linker that connects the nanoparticle to the therapeutic species; the linker comprises a Diels-Alder cycloaddition product; the nanoparticles have a light absorption peak in the near infrared (NIR) region of the electromagnetic spectrum; the Diels-Alder cycloaddition reaction product does not have an optical absorption peak within 100 nm of the optical absorption peak of the nanoparticles.

[0210] Embodiment 2. The composition of embodiment 1, wherein the core, the first shell, and / or the second shell of the nanoparticle are formed from a metal or an alloy, mixture, or combination of metals.

[0211] Embodiment 3. The composition of embodiment 1, wherein the nanoparticles comprise gold-silver-gold core-shell-shell nanoparticles.

[0212] Embodiment 4. The composition of any one of the preceding embodiments, wherein the second shell of the nanoparticles has an average thickness of at least 25 nm.

[0213] Embodiment 5. The composition of embodiment 4, wherein the nanoparticles have a surface roughness of 10 nm or less.

[0214] Embodiment 6. The composition of embodiment 5, wherein the outer surface of the nanoparticles is free or substantially free of spikes or protrusions having a height of 2 nm or more.

[0215] Embodiment 7. The composition of any one of the preceding embodiments, wherein the nanoparticles have a light absorption peak between 800 nm and 900 nm.

[0216] Embodiment 8. the nanoparticles comprise gold-silver-gold core-shell-shell nanoparticles; The nanoparticles have a diameter or size of 60 nm to 140 nm; 2. The composition of embodiment 1, wherein the nanoparticles have a localized surface plasmon resonance (LSPR) peak in the range of 700 nm to 900 nm.

[0217] EMBODIMENT 9. the Diels-Alder cycloaddition reaction product has a forward reaction activation energy and a reverse reaction activation energy, The composition of any one of the preceding embodiments, wherein the reverse reaction activation energy is at least 1.5 times the forward reaction activation energy.

[0218] Embodiment 10. The composition of any one of the preceding embodiments, wherein the back reaction activation energy is greater than the thermal energy provided by the aqueous environment of the nanoparticles at a temperature of 310K.

[0219] Embodiment 11. A composition according to any one of the preceding embodiments, wherein the reverse reaction activation energy (in kJ / mol) is less than the maximum thermal energy (in kJ) of the nanoparticle generated by absorption by the nanoparticle of a mole of photons at the NIR light absorption peak of the nanoparticle.

[0220] Embodiment 12. The composition of any one of the preceding embodiments, wherein the therapeutic species is an osteogenesis modulator, a chondrogenesis modulator, an endotheliogenesis modulator, or a myogenesis modulator.

[0221] Embodiment 13. A composition according to embodiment 12 for use in tissue regeneration.

[0222] Embodiment 14. The composition of any one of the preceding embodiments, wherein the therapeutic species is an anti-cancer agent.

[0223] Embodiment 15. The composition of embodiment 14 for use in cancer chemotherapy.

[0224] Embodiment 16. The composition of embodiment 12 or 14, wherein the therapeutic species is a small molecule, a nucleic acid, a peptide, a protein, or any combination thereof.

[0225] Embodiment 17. The composition of embodiment 16, wherein the nucleic acid comprises a plasmid, a small interfering RNA ("siRNA"), a microRNA ("miRNA"), a miRNA mimic, or any combination thereof.

[0226] Embodiment 18. The composition of any one of the preceding embodiments, wherein the therapeutic species comprises miRNA-34a-5p, miRNA-7-5p, miRNA-218-5p, miRNA-148b-3p, miRNA433-3p, miRNA-181a-5p, or a combination of two or more of the foregoing.

[0227] Embodiment 19. The composition of any one of the preceding embodiments, wherein the linker is covalently attached to the nanoparticle.

[0228] Embodiment 20. The composition of any one of the preceding embodiments, wherein the linker is covalently attached to the therapeutic species.

[0229] Embodiment 21. The composition of embodiment 19 or 20, wherein the linker is covalently attached to the nanoparticle and / or the therapeutic species via an RSX bond, where R is an alkyl or another organic substituent attached to sulfur through a carbon atom, and X is the nanoparticle or the therapeutic species.

[0230] Embodiment 22. A method of delivering a therapeutic species to a biological compartment, comprising: placing a composition according to any one of embodiments 1 to 21 within said biological compartment; initiating a retro Diels-Alder reaction to decompose the Diels-Alder cycloaddition product, thereby cleaving the linker and detaching the therapeutic species from the nanoparticle.

[0231] Embodiment 23. A method for inducing tissue regeneration, comprising: Disposing a composition according to any one of embodiments 1 to 21 in a biological compartment; initiating a retro Diels-Alder reaction to decompose the Diels-Alder cycloaddition product, thereby cleaving the linker and detaching the therapeutic species from the nanoparticle; The method, wherein the therapeutic agent is a tissue regeneration agent.

[0232] Embodiment 24. A method of treating cancer comprising: Disposing a composition according to any one of embodiments 1 to 21 in a biological compartment; initiating a retro Diels-Alder reaction to decompose the Diels-Alder cycloaddition product, thereby cleaving the linker and detaching the therapeutic species from the nanoparticle; The method, wherein the therapeutic agent is an anticancer agent.

[0233] Embodiment 25 The method of embodiment 22 or 23, wherein the therapeutic species is an osteogenesis modulator, a chondrogenesis modulator, an endotheliogenesis modulator, or a myogenesis modulator.

[0234] Embodiment 26 The method of embodiment 22, wherein the therapeutic agent is an anti-cancer agent.

[0235] Embodiment 27. The method of any one of embodiments 22 to 24, wherein the therapeutic species is a small molecule, or a nucleic acid, a peptide, a protein, or any combination thereof.

[0236] Embodiment 28. The composition of embodiment 27, wherein the nucleic acid comprises a plasmid, a small interfering RNA ("siRNA"), a microRNA ("miRNA"), a miRNA mimic, or any combination thereof.

[0237] Embodiment 29. The method of any one of embodiments 22 to 24, wherein initiating the retro Diels-Alder reaction comprises heating the nanoparticles to an activation temperature of the retro Diels-Alder reaction.

[0238] Embodiment 30. The method of embodiment 29, wherein the activation temperature is between 45°C and 150°C.

[0239] Embodiment 31. The method of embodiment 29, wherein heating the nanoparticles to the activation temperature comprises exposing the nanoparticles to NIR light.

[0240] Embodiment 32. The method of embodiment 31, wherein the NIR light has a wavelength distribution centered around a central exposure wavelength within 30 nm, 20 nm, or 10 nm of the NIR light absorption peak of the nanoparticles.

[0241] EMBODIMENT 33. the nanoparticles absorb at least a portion of the energy of the NIR light in a surface plasmon resonance process to provide absorbed plasmon resonance energy; the absorbed plasmon resonance energy is at least partially converted into thermal energy in the nanoparticle, thereby increasing a temperature of the nanoparticle; 33. The method of embodiment 32, wherein increasing the temperature of the nanoparticles results in heating the nanoparticles to the activation temperature of the Diels-Alder reaction.

[0242] Embodiment 34. The method of embodiment 32 or 33, wherein the Diels-Alder cycloaddition product does not absorb more than 5% of incident photons having wavelengths within the wavelength distribution of the NIR light.

[0243] Embodiment 35. The method of embodiment 34, wherein the Diels-Alder cycloaddition product does not absorb more than 5% of incident photons having wavelengths within 30 nm, within 20 nm, or within 10 nm of the NIR light absorption peak of the nanoparticle.

[0244] Various embodiments of the present invention have been described in fulfillment of various objectives of the present invention. It is to be recognized that these embodiments are merely illustrative of the principles of the present invention. Numerous modifications and adaptations thereof will be readily apparent to those skilled in the art without departing from the spirit and scope of the present invention.

Claims

1. 1. A composition comprising: a core-shell-shell nanoparticle comprising a core, a first shell covering the core, and a second shell covering the first shell; The type of treatment and a linker that connects the nanoparticle to the therapeutic species; the linker comprises a Diels-Alder cycloaddition product; the nanoparticles have an optical absorption peak in the near-infrared (NIR) region of the electromagnetic spectrum; The composition, wherein the Diels-Alder cycloaddition reaction product does not have an optical absorption peak within 100 nm of the optical absorption peak of the nanoparticles.

2. 10. The composition of claim 1, wherein the nanoparticles comprise gold-silver-gold core-shell-shell nanoparticles.

3. The composition of claim 1 , wherein the second shell of the nanoparticles has an average thickness of at least 25 nm.

4. The composition of claim 1 , wherein the nanoparticles have a surface roughness of 10 nm or less.

5. 10. The composition of claim 1, wherein the outer surface of the nanoparticles is free or substantially free of spikes or protrusions having a height of 2 nm or more.

6. The composition according to claim 1, wherein the nanoparticles have a light absorption peak of 800 nm to 900 nm.

7. the nanoparticles comprise gold-silver-gold core-shell-shell nanoparticles; the nanoparticles have a diameter of 60 nm to 140 nm; 10. The composition of claim 1, wherein the nanoparticles have a localized surface plasmon resonance (LSPR) peak in the range of 700 nm to 900 nm.

8. the Diels-Alder cycloaddition reaction product has a forward reaction activation energy and a reverse reaction activation energy, 2. The composition of claim 1, wherein the reverse reaction activation energy is at least 1.5 times the forward reaction activation energy.

9. 9. The composition of claim 8, wherein the back reaction activation energy is greater than the thermal energy provided by the aqueous environment of the nanoparticles at a temperature of 310K.

10. 9. The composition of claim 8, wherein the back reaction activation energy (in kJ / mol) is less than the maximum thermal energy (in kJ) of the nanoparticles produced by absorption by the nanoparticles of a mole of photons at the NIR light absorption peak of the nanoparticles.

11. 10. The composition of claim 1, wherein the therapeutic species is an osteogenic modulator, a chondrogenic modulator, an endotheliogenic modulator, or a myogenic modulator.

12. 12. The composition of claim 11 for use in tissue regeneration.

13. The composition of claim 1 , wherein the therapeutic agent is an anti-cancer agent.

14. 14. The composition of claim 13 for use in cancer chemotherapy.

15. 14. The composition of claim 11 or 13, wherein the therapeutic species is a small molecule, a nucleic acid, a peptide, a protein, or any combination thereof.

16. 16. The composition of claim 15, wherein the nucleic acid comprises a plasmid, a small interfering RNA (siRNA), a microRNA (miRNA), a miRNA mimic, or any combination thereof.

17. 10. The composition of claim 1, wherein the therapeutic species comprises miRNA-34a-5p, miRNA-7-5p, miRNA-218-5p, miRNA-148b-3p, miRNA433-3p, miRNA-181a-5p, or a combination of two or more of the foregoing.

18. The composition of claim 1 , wherein the linker is covalently attached to the nanoparticle.

19. The composition of claim 1 , wherein the linker is covalently attached to the therapeutic species.

20. 20. The composition of claim 18 or 19, wherein the linker is covalently attached to the nanoparticle and / or the therapeutic species via an R-S-X bond, where R is an alkyl or another organic substituent attached to sulfur through a carbon atom, and X is the nanoparticle or the therapeutic species.

21. 10. The composition of claim 1 for use in a method for delivering a therapeutic species to a biological compartment, said method comprising: disposing the composition within the biological compartment; initiating a retro Diels-Alder reaction to decompose the Diels-Alder cycloaddition product, thereby cleaving the linker and detaching the therapeutic species from the nanoparticle.

22. 10. The composition of claim 1 for use in a method of inducing tissue regeneration, said method comprising: placing the composition within a biological compartment; initiating a retro Diels-Alder reaction to decompose the Diels-Alder cycloaddition product, thereby cleaving the linker and releasing the therapeutic species from the nanoparticle; The composition wherein the therapeutic species is a tissue regenerative agent.

23. 10. The composition of claim 1 for use in a method of treating cancer, the method comprising: placing the composition within a biological compartment; initiating a retro Diels-Alder reaction to decompose the Diels-Alder cycloaddition product, thereby cleaving the linker and releasing the therapeutic species from the nanoparticle; The composition, wherein the therapeutic agent is an anti-cancer agent.

24. 23. The composition of claim 21 or 22, wherein the therapeutic species is an osteogenesis modulator, a chondrogenesis modulator, an endotheliogenesis modulator, or a myogenesis modulator.

25. 22. The composition of claim 21, wherein the therapeutic species is an anti-cancer agent.

26. The composition of any one of claims 21 to 23, wherein the therapeutic species is a small molecule, or a nucleic acid, a peptide, a protein, or any combination thereof.

27. 27. The composition of claim 26, wherein the nucleic acid comprises a plasmid, a small interfering RNA (siRNA), a microRNA (miRNA), a miRNA mimic, or any combination thereof.

28. 24. The composition of any one of claims 21 to 23, wherein initiating the retro Diels-Alder reaction comprises heating the nanoparticles to an activation temperature of the retro Diels-Alder reaction.

29. 29. The composition of claim 28, wherein the activation temperature is from 45°C to 150°C.

30. 30. The composition of claim 28, wherein heating the nanoparticles to the activation temperature comprises exposing the nanoparticles to NIR light.

31. 31. The composition of claim 30, wherein the NIR light has a wavelength distribution centered around a central exposure wavelength within 30 nm, 20 nm, or 10 nm of the NIR light absorption peak of the nanoparticles.

32. the nanoparticles absorb at least a portion of the energy of the NIR light in a surface plasmon resonance process to provide absorbed plasmon resonance energy; the absorbed plasmon resonance energy is at least partially converted into thermal energy in the nanoparticle, thereby increasing the temperature of the nanoparticle; 32. The composition of claim 31 , wherein increasing the temperature of the nanoparticles results in heating the nanoparticles to the activation temperature of the Diels-Alder reaction.

33. 32. The composition of claim 31 , wherein the Diels-Alder cycloaddition reaction product does not absorb more than 5% of incident photons having wavelengths within the wavelength distribution of the NIR light.

34. 34. The composition of claim 33, wherein the Diels-Alder cycloaddition reaction product does not absorb more than 5% of incident photons having wavelengths within 30 nm, 20 nm, or 10 nm of the NIR light absorption peak of the nanoparticles.

Images