TIGIT antibodies and their uses

Abstract

The present invention provides an anti-TIGIT antibody or an antigen-binding fragment thereof that specifically binds to TIGIT, a composition comprising the anti-TIGIT antibody or an antigen-binding fragment thereof, and use thereof in the diagnosis and treatment of TIGIT-related diseases.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to a Chinese PCT application filed on December 17, 2021, bearing application number PCT / CN2021 / 139122 and titled "TIGIT ANTIBODY AND ITS USE THEREOF," the entire contents of which are incorporated herein by reference. [Technical field]

[0002] The present invention relates to an antibody or an antigen-binding fragment thereof that specifically binds to TIGIT (a T cell immunoreceptor having Ig and ITIM domains), a pharmaceutical composition comprising an anti-TIGIT antibody or an antigen-binding fragment thereof, and uses thereof. [Background technology]

[0003] In recent years, tumor immunotherapy has made great progress and is a promising new method for tumor treatment. In particular, therapies that block tumor immune suppression checkpoints, including PD-1 / PD-L1 and CTLA-4, have attracted attention. Since 2000, the FDA has approved the use of PD-1 / PD-L1 monoclonal antibodies in the clinical treatment of malignant tumors such as melanoma, non-small cell lung cancer, and prostate cancer, and has achieved good therapeutic effects. However, the clinical response rate of PD-1 / PD-L1 monoclonal antibody therapy is still limited, which greatly restricts its clinical use. Therefore, the search for new immune suppression checkpoints has become a research hotspot.

[0004] TIGIT is a new immunosuppressant factor discovered by the Genentech team in 2009 (Nat Immunol, 2009, 10:48-57). It is a member of the PVR-like protein family. TIGIT inhibits the function of CD4 + T cells, CD8 +It is expressed in T cells, including T cells and Treg cells, and NK cells. In general, the expression level of TIGIT is low, but when T cells and NK cells are activated, the expression of TIGIT increases significantly (J Immunol, 2012, 188: 3869-3875, Cancer Cell 26, 923-937, Nat Immunol, 19, 723-732). TIGIT ligands discovered so far include CD155, CD112, and CD113, among which CD155 is the main ligand of TIGIT. Crystal structure analysis has shown that TIGIT and CD155 form homodimers, and further form heterotetramers through interaction between the ligand and the receptor (Proc Natl Acad Sci USA 2012; 109: 5399-404). The binding affinity of TIGIT to CD112 or CD113 is significantly lower than that of TIGIT to CD155. CD155 is mainly expressed in dendritic cells, T cells, B cells, macrophages, and non-hematopoietic tissues (e.g., kidney, nervous system, small intestine). Like TIGIT, the activating receptors DNAM-1 and CD96 can also bind to CD155, but their affinities are weaker than TIGIT. In summary, the ligand-receptor mode of action of TIGIT / CD155 is similar to that of the CTLA-4 / CD28 pathway. High-affinity inhibitory receptors and low-affinity activating receptors compete to bind to the same ligand, thereby precisely controlling the immune response. TIGIT bound to CD155 can exert immunosuppressive effects by controlling the function of DCs, suppressing the activity of effector T cells, interfering with the coactivation of DNAM-1, and improving the suppression of Tregs (Clinical and Experimental Immunology, 2020 May; 200(2): 108-119, Immunity 40, 569-581).

[0005] Several studies in humans and mice have found that TIGIT is highly expressed in tumor-infiltrating lymphocytes. TIGIT is upregulated in a variety of malignancies, including melanoma, breast cancer, non-small cell lung cancer, colon adenocarcinoma, gastric cancer, acute myeloid leukemia, and multiple myeloma (Clinical and Experimental Immunology, 2020 May; 200(2):108-119). Several studies have also shown that TIGIT is involved in the regulation of CD8 + It was also found to be highly expressed in T cells, tumor-infiltrating Treg and NK cells. + Expression of TIGIT in T cells and NK cells generally coincides with high expression of other inhibitory receptors (e.g., PD-1, LAG-3, Tim-3) and low expression of DNAM-1. High expression of TIGIT is generally associated with poor prognosis of malignant tumors. High expression of TIGIT in NK cells is associated with disease severity. TIGIT knockout mice have significantly reduced tumor growth and improved survival.

[0006] Due to the nature of macromolecules, antibody drugs are generally associated with immune-related adverse events (irAEs). TIGIT knockout mice have neither spontaneous autoimmune symptoms nor impaired hematopoietic cell development. The incidence of autoimmune disease is improved only after hybridization with mice prone to autoimmune disease. Animal studies have shown that the incidence of irAEs is lower during administration of anti-TIGIT mAb compared with PD-1 and CTLA-4 mAbs (Oncoimmunology 2018;7:e1445949). Therefore, antibody drugs targeting TIGIT are high-quality candidates for clinical anticancer drugs with a relatively low risk of side effects.

[0007] As shown by past clinical trial results, the combination of TIGIT antibody and PD-1 / PD-L1 monoclonal antibody can significantly increase the response rate of patients, improve the therapeutic effect, and eliminate drug resistance in some patients (Cancers 2019;11:877, Cancer Discov,10:1086-1087(2020)). Currently, there are no monoclonal antibodies against TIGIT approved for sale worldwide, so it is necessary to develop antibodies with high affinity and activity as candidate drugs. Summary of the Invention

[0008] The inventors of the present invention have conducted extensive testing and have developed a transchromosomal mouse (TC mAb TM By screening using a mouse model, we unexpectedly obtained an antibody that specifically binds to TIGIT, which shows excellent affinity for TIGIT and has potential for drug discovery.

[0009] The present invention provides improved drugs and therapies for cancer and chronic viral infections, comprising anti-TIGIT antibodies or antigen-binding fragments thereof that specifically bind to human TIGIT (huTIGIT). The present specification provides isolated antibodies, e.g., monoclonal antibodies, particularly human monoclonal antibodies, that specifically bind to huTIGIT and have desired functional properties, e.g., specific binding to huTIGIT with high affinity, binding to monkey TIGIT (e.g., cynomolgus TIGIT), the ability to block the binding of TIGIT to PVR and Nectin-2, the ability to block the interaction of TIGIT with DNAM, or any combination of these properties.

[0010] The present invention relates to antibodies that bind to huTIGIT in competition with antibodies having the heavy and light chain variable domain sequences disclosed herein and that cross-block the binding of antibodies having the heavy and light chain variable domain sequences disclosed herein to huTIGIT.

[0011] In some embodiments, the anti-TIGIT antibody or antigen-binding fragment thereof of the present invention enhances anti-tumor immune responses, e.g., antigen-specific T cell responses. In other embodiments, the anti-TIGIT antibody or antigen-binding fragment thereof of the present invention increases killing by NK-mediated anti-tumor responses by blocking TIGIT-mediated inhibitory signaling and enabling PVR / DNAM costimulation of NK cells. In another embodiment, the anti-TIGIT antibody or antigen-binding fragment thereof of the present invention depletes regulatory T cell populations in tumors that would otherwise suppress anti-tumor immune responses. In another embodiment, the anti-TIGIT antibody of the present invention in IgG1 form enhances CD8 + By depleting exhaustible T cells and Tregs, new non-exhaustable CD8 + In some embodiments, the anti-TIGIT antibody of the present invention in IgG1 form inhibits CD8 T cells in the tumor microenvironment. + In other embodiments, the anti-TIGIT antibodies or antigen-binding fragments thereof of the present invention play a role through one or more of the above mechanisms, as these mechanisms are not necessarily mutually exclusive.

[0012] In some embodiments, the anti-TIGIT antibodies or antigen-binding fragments thereof of the present invention do not bind to activating Fcγ receptors (FcγRs), e.g., in embodiments that rely on enhancement of anti-tumor activity of TIGIT-expressing cells. In alternative embodiments, the anti-TIGIT antibodies or antigen-binding fragments thereof of the present invention bind to TIGIT-expressing cells (e.g., CD8 + In embodiments that rely on the killing of T cells or Tregs, they bind to one or more activating FcγR.

[0013] In a first aspect, the present invention provides an anti-TIGIT antibody or an antigen-binding fragment thereof that specifically binds to TIGIT, the anti-TIGIT antibody or antigen-binding fragment thereof comprising a heavy chain variable region (VH) and / or a light chain variable region (VL), the heavy chain variable region comprising CDRH1, CDRH2, and CDRH3, and the light chain variable region comprising CDRL1, CDRL2, and CDRL3.

[0014] In some embodiments of the present invention, (a) the CDRH1 comprises the sequence of SEQ ID NO:23, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:41, SEQ ID NO:47, SEQ ID NO:53, SEQ ID NO:59, SEQ ID NO:65, SEQ ID NO:75, or SEQ ID NO:81, or the CDRH1 comprises a sequence derived from SEQ ID NO:23, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:41, SEQ ID NO:47, SEQ ID NO:53, SEQ ID NO:59, SEQ ID NO:65, SEQ ID NO:75, or SEQ ID NO:81 by one or more amino acid additions, deletions, or substitutions; (b) the CDRH2 comprises the sequence of SEQ ID NO:24, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:42, SEQ ID NO:48, SEQ ID NO:54, SEQ ID NO:60, SEQ ID NO:66, SEQ ID NO:76, or SEQ ID NO:82, or the CDRH1 comprises a sequence derived from SEQ ID NO:24, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:42, SEQ ID NO:48, SEQ ID NO:54, SEQ ID NO:60, SEQ ID NO:66, SEQ ID NO:76, or SEQ ID NO:82 by addition, deletion, or substitution of one or more amino acids; and (c) the CDRH3 comprises the sequence of SEQ ID NO:25, SEQ ID NO:31, SEQ ID NO:37, SEQ ID NO:43, SEQ ID NO:49, SEQ ID NO:55, SEQ ID NO:61, SEQ ID NO:67, SEQ ID NO:77, or SEQ ID NO:83, or the CDRH1 comprises a sequence derived from SEQ ID NO:25, SEQ ID NO:31, SEQ ID NO:37, SEQ ID NO:43, SEQ ID NO:49, SEQ ID NO:55, SEQ ID NO:61, SEQ ID NO:67, SEQ ID NO:77, or SEQ ID NO:83 by addition, deletion or substitution of one or more amino acids.

[0015] In some other embodiments of the present invention, (a) the CDRL1 comprises the sequence of SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:32, SEQ ID NO:38, SEQ ID NO:44, SEQ ID NO:50, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:72, or SEQ ID NO:78, or the CDRH1 comprises a sequence derived from SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:32, SEQ ID NO:38, SEQ ID NO:44, SEQ ID NO:50, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:72, or SEQ ID NO:78 by addition, deletion, or substitution of one or more amino acids; (b) the CDRL2 comprises the sequence of SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:33, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:51, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:73, or SEQ ID NO:79, or the CDRH1 comprises a sequence derived from SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:33, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:51, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:73, or SEQ ID NO:79 by one or more amino acid additions, deletions, or substitutions; and (c) the CDRL3 comprises the sequence of SEQ ID NO:22, SEQ ID NO:28, SEQ ID NO:34, SEQ ID NO:40, SEQ ID NO:46, SEQ ID NO:52, SEQ ID NO:58, SEQ ID NO:64, SEQ ID NO:74, or SEQ ID NO:80, or the CDRH1 comprises a sequence derived from SEQ ID NO:22, SEQ ID NO:28, SEQ ID NO:34, SEQ ID NO:40, SEQ ID NO:46, SEQ ID NO:52, SEQ ID NO:58, SEQ ID NO:64, SEQ ID NO:74, or SEQ ID NO:80 by addition, deletion, or substitution of one or more amino acids.

[0016] In some other embodiments of the present invention, (a) the CDRH1 comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to a sequence selected from the group consisting of SEQ ID NO:23, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:41, SEQ ID NO:47, SEQ ID NO:53, SEQ ID NO:59, SEQ ID NO:65, SEQ ID NO:75, and SEQ ID NO:81; (b) the CDRH2 comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NO:24, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:42, SEQ ID NO:48, SEQ ID NO:54, SEQ ID NO:60, SEQ ID NO:66, SEQ ID NO:76, and SEQ ID NO:82; and (c) the CDRH3 comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NO:25, SEQ ID NO:31, SEQ ID NO:37, SEQ ID NO:43, SEQ ID NO:49, SEQ ID NO:55, SEQ ID NO:61, SEQ ID NO:67, SEQ ID NO:77, and SEQ ID NO:83; and / or (d) the CDRL1 comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to a sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:32, SEQ ID NO:38, SEQ ID NO:44, SEQ ID NO:50, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:72, and SEQ ID NO:78; (e) the CDRL2 comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:33, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:51, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:73, and SEQ ID NO:79; and (f) the CDRL3 comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to a sequence selected from the group consisting of SEQ ID NO:22, SEQ ID NO:28, SEQ ID NO:34, SEQ ID NO:40, SEQ ID NO:46, SEQ ID NO:52, SEQ ID NO:58, SEQ ID NO:64, SEQ ID NO:74, and SEQ ID NO:80.

[0017] In some other embodiments of the present invention, (a) the CDRH1 comprises a sequence selected from the group consisting of SEQ ID NO:23, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:41, SEQ ID NO:47, SEQ ID NO:53, SEQ ID NO:59, SEQ ID NO:65, SEQ ID NO:75, and SEQ ID NO:81; (b) the CDRH2 comprises a sequence selected from the group consisting of SEQ ID NO:24, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:42, SEQ ID NO:48, SEQ ID NO:54, SEQ ID NO:60, SEQ ID NO:66, SEQ ID NO:76, and SEQ ID NO:82; (c) the CDRH3 comprises a sequence selected from the group consisting of SEQ ID NO:25, SEQ ID NO:31, SEQ ID NO:37, SEQ ID NO:43, SEQ ID NO:49, SEQ ID NO:55, SEQ ID NO:61, SEQ ID NO:67, SEQ ID NO:77, and SEQ ID NO:83; (d) the CDRL1 comprises a sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:32, SEQ ID NO:38, SEQ ID NO:44, SEQ ID NO:50, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:72, and SEQ ID NO:78; (e) the CDRL2 comprises a sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:33, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:51, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:73, and SEQ ID NO:79; and (f) the CDRL3 comprises a sequence selected from the group consisting of SEQ ID NO:22, SEQ ID NO:28, SEQ ID NO:34, SEQ ID NO:40, SEQ ID NO:46, SEQ ID NO:52, SEQ ID NO:58, SEQ ID NO:64, SEQ ID NO:74, and SEQ ID NO:80.

[0018] In some other embodiments of the invention, the heavy chain variable region comprises CDRH1, CDRH2, CDRH3, and (a) said CDRH1 comprises the sequence set forth in SEQ ID NO:23, said CDRH2 comprises the sequence set forth in SEQ ID NO:24, and said CDRH3 comprises the sequence set forth in SEQ ID NO:25; (b) said CDRH1 comprises the sequence set forth in SEQ ID NO:29, said CDRH2 comprises the sequence set forth in SEQ ID NO:30, and said CDRH3 comprises the sequence set forth in SEQ ID NO:31; (c) said CDRH1 comprises the sequence set forth in SEQ ID NO:35, said CDRH2 comprises the sequence set forth in SEQ ID NO:36, and said CDRH3 comprises the sequence set forth in SEQ ID NO:37; (d) said CDRH1 comprises the sequence set forth in SEQ ID NO:41, said CDRH2 comprises the sequence set forth in SEQ ID NO:42, and said CDRH3 comprises the sequence set forth in SEQ ID NO:43; (e) said CDRH1 comprises the sequence set forth in SEQ ID NO:47, said CDRH2 comprises the sequence set forth in SEQ ID NO:48, and said CDRH3 comprises the sequence set forth in SEQ ID NO:49; (f) said CDRH1 comprises the sequence set forth in SEQ ID NO:53, said CDRH2 comprises the sequence set forth in SEQ ID NO:54, and said CDRH3 comprises the sequence set forth in SEQ ID NO:55; (g) said CDRH1 comprises the sequence set forth in SEQ ID NO:59, said CDRH2 comprises the sequence set forth in SEQ ID NO:60, and said CDRH3 comprises the sequence set forth in SEQ ID NO:61; (h) said CDRH1 comprises the sequence set forth in SEQ ID NO:65, said CDRH2 comprises the sequence set forth in SEQ ID NO:66, and said CDRH3 comprises the sequence set forth in SEQ ID NO:67; (i) said CDRH1 comprises the sequence of SEQ ID NO: 75, said CDRH2 comprises the sequence of SEQ ID NO: 76, and said CDRH3 comprises the sequence of SEQ ID NO: 77, or (j) said CDRH1 comprises the sequence of SEQ ID NO: 81, said CDRH2 comprises the sequence of SEQ ID NO: 82, and said CDRH3 comprises the sequence of SEQ ID NO: 83.

[0019] In some other embodiments of the invention, the light chain variable region comprises CDRL1, CDRL2, CDRL3, and (a) said CDRL1 comprises the sequence set forth in SEQ ID NO:20, said CDRL2 comprises the sequence set forth in SEQ ID NO:21, and said CDRL3 comprises the sequence set forth in SEQ ID NO:22; (b) said CDRL1 comprises the sequence set forth in SEQ ID NO:26, said CDRL2 comprises the sequence set forth in SEQ ID NO:27, and said CDRL3 comprises the sequence set forth in SEQ ID NO:28; (c) said CDRL1 comprises the sequence set forth in SEQ ID NO:32, said CDRL2 comprises the sequence set forth in SEQ ID NO:33, and said CDRL3 comprises the sequence set forth in SEQ ID NO:34; (d) said CDRL1 comprises the sequence set forth in SEQ ID NO:38, said CDRL2 comprises the sequence set forth in SEQ ID NO:39, and said CDRL3 comprises the sequence set forth in SEQ ID NO:40; (e) said CDRL1 comprises the sequence set forth in SEQ ID NO:44, said CDRL2 comprises the sequence set forth in SEQ ID NO:45, and said CDRL3 comprises the sequence set forth in SEQ ID NO:46; (f) said CDRL1 comprises the sequence set forth in SEQ ID NO:50, said CDRL2 comprises the sequence set forth in SEQ ID NO:51, and said CDRL3 comprises the sequence set forth in SEQ ID NO:52; (g) said CDRL1 comprises the sequence set forth in SEQ ID NO:56, said CDRL2 comprises the sequence set forth in SEQ ID NO:57, and said CDRL3 comprises the sequence set forth in SEQ ID NO:58; (h) said CDRL1 comprises the sequence set forth in SEQ ID NO:62, said CDRL2 comprises the sequence set forth in SEQ ID NO:63, and said CDRL3 comprises the sequence set forth in SEQ ID NO:64; (i) said CDRL1 comprises the sequence of SEQ ID NO: 72, said CDRL2 comprises the sequence of SEQ ID NO: 73, and said CDRL3 comprises the sequence of SEQ ID NO: 74, or (j) said CDRL1 comprises the sequence of SEQ ID NO: 78, said CDRL2 comprises the sequence of SEQ ID NO: 79, and said CDRL3 comprises the sequence of SEQ ID NO: 80.

[0020] In some other embodiments of the present invention, (a) said CDRH1 comprises the sequence set forth in SEQ ID NO:23, said CDRH2 comprises the sequence set forth in SEQ ID NO:24, and said CDRH3 comprises the sequence set forth in SEQ ID NO:25, and said CDRL1 comprises the sequence set forth in SEQ ID NO:20, said CDRL2 comprises the sequence set forth in SEQ ID NO:21, and said CDRL3 comprises the sequence set forth in SEQ ID NO:22; (b) said CDRH1 comprises the sequence set forth in SEQ ID NO:29, said CDRH2 comprises the sequence set forth in SEQ ID NO:30, and said CDRH3 comprises the sequence set forth in SEQ ID NO:31, and said CDRL1 comprises the sequence set forth in SEQ ID NO:26, said CDRL2 comprises the sequence set forth in SEQ ID NO:27, and said CDRL3 comprises the sequence set forth in SEQ ID NO:28; (c) said CDRH1 comprises the sequence set forth in SEQ ID NO:35, said CDRH2 comprises the sequence set forth in SEQ ID NO:36, and said CDRH3 comprises the sequence set forth in SEQ ID NO:37, and said CDRL1 comprises the sequence set forth in SEQ ID NO:32, said CDRL2 comprises the sequence set forth in SEQ ID NO:33, and said CDRL3 comprises the sequence set forth in SEQ ID NO:34; (d) said CDRH1 comprises the sequence set forth in SEQ ID NO:41, said CDRH2 comprises the sequence set forth in SEQ ID NO:42, and said CDRH3 comprises the sequence set forth in SEQ ID NO:43, and said CDRL1 comprises the sequence set forth in SEQ ID NO:38, said CDRL2 comprises the sequence set forth in SEQ ID NO:39, and said CDRL3 comprises the sequence set forth in SEQ ID NO:40; (e) said CDRH1 comprises the sequence set forth in SEQ ID NO:47, said CDRH2 comprises the sequence set forth in SEQ ID NO:48, and said CDRH3 comprises the sequence set forth in SEQ ID NO:49, and said CDRL1 comprises the sequence set forth in SEQ ID NO:44, said CDRL2 comprises the sequence set forth in SEQ ID NO:45, and said CDRL3 comprises the sequence set forth in SEQ ID NO:46; (f) said CDRH1 comprises the sequence set forth in SEQ ID NO:53, said CDRH2 comprises the sequence set forth in SEQ ID NO:54, and said CDRH3 comprises the sequence set forth in SEQ ID NO:55, and said CDRL1 comprises the sequence set forth in SEQ ID NO:50, said CDRL2 comprises the sequence set forth in SEQ ID NO:51, and said CDRL3 comprises the sequence set forth in SEQ ID NO:52; (g) said CDRH1 comprises the sequence set forth in SEQ ID NO:59, said CDRH2 comprises the sequence set forth in SEQ ID NO:60, and said CDRH3 comprises the sequence set forth in SEQ ID NO:61, and said CDRL1 comprises the sequence set forth in SEQ ID NO:56, said CDRL2 comprises the sequence set forth in SEQ ID NO:57, and said CDRL3 comprises the sequence set forth in SEQ ID NO:58; (h) said CDRH1 comprises the sequence set forth in SEQ ID NO:65, said CDRH2 comprises the sequence set forth in SEQ ID NO:66, and said CDRH3 comprises the sequence set forth in SEQ ID NO:67, and said CDRL1 comprises the sequence set forth in SEQ ID NO:62, said CDRL2 comprises the sequence set forth in SEQ ID NO:63, and said CDRL3 comprises the sequence set forth in SEQ ID NO:64; (i) said CDRH1 comprises the sequence of SEQ ID NO: 75, said CDRH2 comprises the sequence of SEQ ID NO: 76, and said CDRH3 comprises the sequence of SEQ ID NO: 77, and said CDRL1 comprises the sequence of SEQ ID NO: 72, said CDRL2 comprises the sequence of SEQ ID NO: 73, and said CDRL3 comprises the sequence of SEQ ID NO: 74, or (j) said CDRH1 comprises the sequence of SEQ ID NO: 81, said CDRH2 comprises the sequence of SEQ ID NO: 82, and said CDRH3 comprises the sequence of SEQ ID NO: 83, and said CDRL1 comprises the sequence of SEQ ID NO: 78, said CDRL2 comprises the sequence of SEQ ID NO: 79, and said CDRL3 comprises the sequence of SEQ ID NO: 80.

[0021] In some other embodiments of the present invention, (a) the sequence of CDRH1 is set forth in SEQ ID NO:23, the sequence of CDRH2 is set forth in SEQ ID NO:24, and the sequence of CDRH3 is set forth in SEQ ID NO:25, and the sequence of CDRL1 is set forth in SEQ ID NO:20, the sequence of CDRL2 is set forth in SEQ ID NO:21, and the sequence of CDRL3 is set forth in SEQ ID NO:22; (b) the sequence of CDRH1 is set forth in SEQ ID NO:29, the sequence of CDRH2 is set forth in SEQ ID NO:30, and the sequence of CDRH3 is set forth in SEQ ID NO:31, and the sequence of CDRL1 is set forth in SEQ ID NO:26, the sequence of CDRL2 is set forth in SEQ ID NO:27, and the sequence of CDRL3 is set forth in SEQ ID NO:28; (c) the sequence of CDRH1 is set forth in SEQ ID NO:35, the sequence of CDRH2 is set forth in SEQ ID NO:36, and the sequence of CDRH3 is set forth in SEQ ID NO:37, and the sequence of CDRL1 is set forth in SEQ ID NO:32, the sequence of CDRL2 is set forth in SEQ ID NO:33, and the sequence of CDRL3 is set forth in SEQ ID NO:34; (d) the sequence of CDRH1 is set forth in SEQ ID NO:41, the sequence of CDRH2 is set forth in SEQ ID NO:42, and the sequence of CDRH3 is set forth in SEQ ID NO:43, and the sequence of CDRL1 is set forth in SEQ ID NO:38, the sequence of CDRL2 is set forth in SEQ ID NO:39, and the sequence of CDRL3 is set forth in SEQ ID NO:40; (e) the sequence of CDRH1 is set forth in SEQ ID NO:47, the sequence of CDRH2 is set forth in SEQ ID NO:48, and the sequence of CDRH3 is set forth in SEQ ID NO:49, and the sequence of CDRL1 is set forth in SEQ ID NO:44, the sequence of CDRL2 is set forth in SEQ ID NO:45, and the sequence of CDRL3 is set forth in SEQ ID NO:46; (f) the sequence of CDRH1 is set forth in SEQ ID NO:53, the sequence of CDRH2 is set forth in SEQ ID NO:54, and the sequence of CDRH3 is set forth in SEQ ID NO:55, and the sequence of CDRL1 is set forth in SEQ ID NO:50, the sequence of CDRL2 is set forth in SEQ ID NO:51, and the sequence of CDRL3 is set forth in SEQ ID NO:52; (g) the sequence of CDRH1 is set forth in SEQ ID NO:59, the sequence of CDRH2 is set forth in SEQ ID NO:60, and the sequence of CDRH3 is set forth in SEQ ID NO:61, and the sequence of CDRL1 is set forth in SEQ ID NO:56, the sequence of CDRL2 is set forth in SEQ ID NO:57, and the sequence of CDRL3 is set forth in SEQ ID NO:58; (h) the sequence of CDRH1 is set forth in SEQ ID NO:65, the sequence of CDRH2 is set forth in SEQ ID NO:66, and the sequence of CDRH3 is set forth in SEQ ID NO:67, and the sequence of CDRL1 is set forth in SEQ ID NO:62, the sequence of CDRL2 is set forth in SEQ ID NO:63, and the sequence of CDRL3 is set forth in SEQ ID NO:64; (i) the sequence of CDRH1 is set forth in SEQ ID NO: 75, the sequence of CDRH2 is set forth in SEQ ID NO: 76, and the sequence of CDRH3 is set forth in SEQ ID NO: 77, and the sequence of CDRL1 is set forth in SEQ ID NO: 72, the sequence of CDRL2 is set forth in SEQ ID NO: 73, and the sequence of CDRL3 is set forth in SEQ ID NO: 74; or (j) the sequence of CDRH1 is set forth in SEQ ID NO: 81, the sequence of CDRH2 is set forth in SEQ ID NO: 82, and the sequence of CDRH3 is set forth in SEQ ID NO: 83, and the sequence of CDRL1 is set forth in SEQ ID NO: 78, the sequence of CDRL2 is set forth in SEQ ID NO: 79, and the sequence of CDRL3 is set forth in SEQ ID NO: 80.

[0022] In some other embodiments of the invention, the heavy chain variable region comprises a sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:69, and SEQ ID NO:71.

[0023] In some other embodiments of the invention, the light chain variable region comprises a sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:68, and SEQ ID NO:70.

[0024] In some other embodiments of the present invention, (a) the heavy chain variable region comprises the sequence set forth in SEQ ID NO:5, and the light chain variable region comprises the sequence set forth in SEQ ID NO:4; (b) the heavy chain variable region comprises the sequence set forth in SEQ ID NO:7, and the light chain variable region comprises the sequence set forth in SEQ ID NO:6; (c) the heavy chain variable region comprises the sequence set forth in SEQ ID NO:9, and the light chain variable region comprises the sequence set forth in SEQ ID NO:8; (d) the heavy chain variable region comprises the sequence set forth in SEQ ID NO:11, and the light chain variable region comprises the sequence set forth in SEQ ID NO:10; (e) the heavy chain variable region comprises the sequence set forth in SEQ ID NO:13, and the light chain variable region comprises the sequence set forth in SEQ ID NO:12; (f) the heavy chain variable region comprises the sequence set forth in SEQ ID NO:15, and the light chain variable region comprises the sequence set forth in SEQ ID NO:14; (g) the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 17, and the light chain variable region comprises the sequence set forth in SEQ ID NO: 16; or (h) the heavy chain variable region comprises the sequence set forth in SEQ ID NO:19, and the light chain variable region comprises the sequence set forth in SEQ ID NO:18.

[0025] In some other embodiments of the present invention, (a) the sequence of the heavy chain variable region is set forth in SEQ ID NO:5 and the sequence of the light chain variable region is set forth in SEQ ID NO:4; (b) the sequence of the heavy chain variable region is set forth in SEQ ID NO:7 and the sequence of the light chain variable region is set forth in SEQ ID NO:6; (c) the sequence of the heavy chain variable region is set forth in SEQ ID NO: 9 and the sequence of the light chain variable region is set forth in SEQ ID NO: 8; (d) the sequence of the heavy chain variable region is set forth in SEQ ID NO:11, and the sequence of the light chain variable region is set forth in SEQ ID NO:10; (e) the sequence of the heavy chain variable region is set forth in SEQ ID NO: 13 and the sequence of the light chain variable region is set forth in SEQ ID NO: 12; (f) the sequence of the heavy chain variable region is set forth in SEQ ID NO: 15 and the sequence of the light chain variable region is set forth in SEQ ID NO: 14; (g) the sequence of the heavy chain variable region is set forth in SEQ ID NO: 17 and the sequence of the light chain variable region is set forth in SEQ ID NO: 16; (h) the sequence of the heavy chain variable region is set forth in SEQ ID NO: 19 and the sequence of the light chain variable region is set forth in SEQ ID NO: 18; (i) the heavy chain variable region comprises the sequence of SEQ ID NO: 69 and the light chain variable region comprises the sequence of SEQ ID NO: 68; or (j) the heavy chain variable region comprises the sequence of SEQ ID NO: 71, and the light chain variable region comprises the sequence of SEQ ID NO: 70.

[0026] In some other embodiments of the invention, the anti-TIGIT antibody or antigen-binding fragment thereof comprises a heavy chain variable region (VH) and / or a light chain variable region (VL), (a) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO:5, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO:4; (b) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO:7, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO:6; (c) the VH comprises CDRH1, CDRH2, and CDRH3 of the VH set forth in SEQ ID NO: 9, and / or the VL comprises CDRL1, CDRL2, and CDRL3 of the VL set forth in SEQ ID NO: 8; (d) the VH comprises CDRH1, CDRH2, and CDRH3 of the VH set forth in SEQ ID NO:11, and / or the VL comprises CDRL1, CDRL2, and CDRL3 of the VL set forth in SEQ ID NO:10; (e) the VH comprises CDRH1, CDRH2, and CDRH3 of the VH set forth in SEQ ID NO: 13, and / or the VL comprises CDRL1, CDRL2, and CDRL3 of the VL set forth in SEQ ID NO: 12; (f) the VH comprises CDRH1, CDRH2, and CDRH3 of the VH set forth in SEQ ID NO: 15, and / or the VL comprises CDRL1, CDRL2, and CDRL3 of the VL set forth in SEQ ID NO: 14; (g) the VH comprises CDRH1, CDRH2, and CDRH3 of the VH set forth in SEQ ID NO: 17, and / or the VL comprises CDRL1, CDRL2, and CDRL3 of the VL set forth in SEQ ID NO: 16; (h) the VH comprises CDRH1, CDRH2, and CDRH3 of the VH set forth in SEQ ID NO: 19, and / or the VL comprises CDRL1, CDRL2, and CDRL3 of the VL set forth in SEQ ID NO: 18; (i) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO: 69, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO: 68, or (j) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO: 71, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO: 70.

[0027] In some embodiments, among the isolated monoclonal antibodies or antigen-binding fragments thereof of the present invention, (a) some antibodies can block the binding of themselves (1B2-8C) to tiragolumab, 4A042-H3, 4A042-H7, and 4B030a, and can partially block the binding of 4A063, but cannot block the binding of 4B037a, 4B056a, 4A063, 4D035a, and 4E061a; and (b) some antibodies can block the binding of themselves (4A042-H3), (c) some antibodies can block the binding of themselves (4A042-H7) to 1B2-8C, 4A042-H3 and 4B030a, and can partially block the binding of 4B037a and 4A063, but cannot block the binding of 4B056a, 4D035a and 4E061a; (d) some antibodies can block the binding of themselves ( (e) some antibodies can block binding to themselves (4B037a, 4A063), 4B056a, 4D035a and 4E061a, and can partially block binding to tiragolumab, 1B2-8C, 4A042-H3, 4A042-H7 and 4B030a; (f) some antibodies can block binding to themselves (4B056a ), 4B037a, 4A063, 4D035a and 4E061a, and can partially block the binding of tiragolumab, 1B2-8C, 4A042-H3 and 4B030a, but cannot block the binding of 4A042-H7; (g) some antibodies can block the binding of themselves (4D035a, 4E061a), 4B037a, 4B056a, 4A063, but do not block the binding of tiragolumab, 1B2-8C, 4A042-H3, 4A042-H7 and 4B030a.

[0028] In some embodiments, the anti-huTIGIT antibodies, or antigen-binding fragments thereof, of the invention also bind to cynomolgus TIGIT.

[0029] In some other embodiments of the invention, the anti-TIGIT antibody or antigen-binding fragment thereof further comprises a heavy chain constant region selected from the heavy chain constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, and IgD.

[0030] In some embodiments of the invention, the heavy chain constant region is a human IgG heavy chain constant region or a variant thereof.

[0031] In some other embodiments of the present invention, the anti-TIGIT antibody or antigen-binding fragment thereof is in a form selected from the group consisting of F(ab')2, Fab', Fab, Fv, scFv, bispecific antibody, and combinations thereof.

[0032] The present invention also provides immunoconjugates comprising an anti-TIGIT antibody described herein conjugated to a reagent (eg, a detectable label or a cytotoxic agent).

[0033] In another embodiment, the antibodies of the invention comprise antigen-binding domains present in a bispecific molecule and further comprise antigen-binding domains that specifically bind to different immune regulatory receptors, including but not limited to PD-1, CTLA-4, or LAG3.

[0034] In a second aspect, the present invention provides a polynucleotide encoding an anti-TIGIT antibody or an antigen-binding fragment thereof.

[0035] In a third aspect, the present invention provides an expression vector that expresses the anti-TIGIT antibody or an antigen-binding fragment thereof.

[0036] In a fourth aspect, the present invention provides an engineered cell comprising a vector expressing the anti-TIGIT antibody or antigen-binding fragment.

[0037] In a fifth aspect, the present invention provides a pharmaceutical composition comprising the anti-TIGIT antibody or antigen-binding fragment thereof of the first aspect, the polynucleotide of the second aspect, the vector of the third aspect or the cell of the fourth aspect, and a pharma- ceutically acceptable carrier. The present invention further provides an antibody-drug conjugate comprising the anti-TIGIT antibody or antigen-binding fragment thereof of the first aspect. The present specification also provides a kit comprising the anti-TIGIT antibody or antigen-binding fragment thereof and an instruction manual.

[0038] In a sixth aspect, the present invention provides a use of the anti-TIGIT antibody or antigen-binding fragment thereof of the first aspect, the polynucleotide of the second aspect, the vector of the third aspect, the cell of the fourth aspect, or the pharmaceutical composition of the fifth aspect in the manufacture of a medicament for treating a TIGIT-associated disease. Preferably, the TIGIT-associated disease is a T cell dysfunction disease, more preferably, the TIGIT-associated disease is a tumor, an immune disease, or an infectious disease, more preferably, the cancer is selected from the group consisting of melanoma, breast cancer, non-small cell lung cancer, colon adenocarcinoma, gastric cancer, acute myeloid leukemia, and multiple myeloma. More preferably, the cells of the tumor are CD155-positive or PVR-positive.

[0039] In some embodiments, the invention provides a method of enhancing an antigen-specific T cell response, comprising contacting a T cell with an anti-huTIGIT antibody, or antigen-binding fragment thereof, of the invention, thereby enhancing the antigen-specific T cell response, e.g., by reducing an inhibitory signal that would otherwise attenuate the anti-tumor response. In some embodiments, the antigen-specific T cell is a tumor antigen-specific effector T cell, e.g., a CD8 +T cells, and for example, by enhancing the blockade of inhibitory effectors mediated by TIGIT, thereby increasing antitumor activity. The anti-huTIGIT antibody or antigen-binding fragment thereof of the present invention can also increase their antitumor activity by reducing inhibitory signals in NK cells. Without being bound to a particular theory, the anti-huTIGIT antibody of the present invention improves the function of effector T cells or NK cells by blocking the binding of TIGIT to PVR, thereby reducing or eliminating the inhibitory signal that would otherwise be delivered to the cell. Alternatively or additionally, the anti-TIGIT antibody or antigen-binding fragment thereof of the present invention can inhibit the interaction between TIGIT and DNAM-1 / CD226, which would otherwise reduce immune activation mediated by DNAM-1.

[0040] The present invention relates to a method for treating tumors in a subject in need thereof, comprising administering an effective amount of an anti-huTIGIT antibody of the present invention. regs and a method for reducing or depleting T in tumors, the antibody having effector function or enhanced effector function. regs Reduce the number of

[0041] The invention provides methods for enhancing an immune response in a subject, comprising administering to the subject an effective amount of an anti-huTIGIT antibody or antigen-binding fragment thereof of the invention, thereby enhancing the immune response in the subject. In some embodiments, the subject has a tumor, and an immune response against the tumor is enhanced. In another embodiment, the subject has a viral infection, and an anti-viral immune response is enhanced.

[0042] The present invention also provides a method for inhibiting tumor growth in a subject, comprising inhibiting tumor growth by administering to the subject an anti-huTIGIT antibody or antigen-binding fragment thereof of the present invention.

[0043] The present invention further provides a method of treating cancer by immunotherapy, comprising, for example, administering a therapeutically effective amount of an anti-huTIGIT antibody or antigen-binding fragment thereof of the present invention to a subject in need thereof, e.g., as a pharmaceutical composition, thereby treating the cancer. In some embodiments, the cancer is bladder cancer, breast cancer, uterine or cervical cancer, ovarian cancer, prostate cancer, testicular cancer, esophageal cancer, gastrointestinal cancer, pancreatic cancer, colorectal cancer, colon cancer, kidney cancer, head and neck cancer, lung cancer, gastric cancer, germ cell tumor, bone tumor, liver cancer, thyroid cancer, skin cancer, central nervous system tumor, lymphoma, leukemia, myeloma, sarcoma, viral cancer. In some embodiments, the cancer is metastatic cancer, refractory cancer, or recurrent cancer.

[0044] In a seventh aspect, the present invention provides a method for treating a TIGIT-associated disease, comprising administering to a subject in need thereof an effective amount of an anti-TIGIT antibody or antigen-binding fragment thereof of the first aspect, a polynucleotide of the second aspect, a vector of the third aspect, a cell of the fourth aspect, or a pharmaceutical composition of the fifth aspect.

[0045] In an eighth aspect, the present invention provides a pharmaceutical composition for treating a TIGIT-related disease, comprising an anti-TIGIT antibody or an antigen-binding fragment thereof of the first aspect, a polynucleotide of the second aspect, a vector of the third aspect, or a cell of the fourth aspect, in combination with one or more additional therapeutic agents, or acting as a bispecific reagent with one or more additional therapeutic agents, such as an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-LAG3 antibody, an anti-GITR antibody, an anti-OX40 antibody, an anti-CD73 antibody, an anti-CD40 antibody, an anti-CD137mAb, an anti-CD27mAb, an anti-CSF-1R antibody, and / or an anti-CTLA-4 antibody, a TLR agonist, or a small molecule antagonist of IDO or TGFβ. In certain embodiments, anti-huTIGIT therapy is combined with anti-PD-1 and / or anti-PD-L1 therapy (e.g., treatment with an antibody or antigen-binding fragment thereof that binds to human PD-1, or treatment with an antibody or antigen-binding fragment thereof that binds to human PD-L1).

[0046] The invention also provides methods for detecting the presence of TIGIT in a sample, on cells in a sample (e.g., FACS) or at specific locations in cells or tissues (e.g., IHC), or for sorting cells based on the presence or absence of TIGIT on their surface (e.g., FACS), comprising contacting a sample with an anti-huTIGIT antibody or antigen-binding fragment thereof of the invention under conditions that allow the formation of a complex between the antibody or antigen-binding fragment thereof and TIGIT, and detecting the formation of said complex. In some embodiments, the detecting anti-TIGIT antibody is conjugated to a detectable label.

[0047] In the present invention, a transchromosomal mouse (TC-mAb) into which a full-length human antibody gene sequence (including a gene regulatory sequence) has been introduced is TM In this study, a transchromosomal mouse (transgenic mouse) model is used. The target antigen is used to directly obtain a fully humanized antibody by immunizing the transchromosomal mouse. The obtained antibody does not require subsequent humanization and affinity modification, thus reducing costs and shortening development time. In addition, since the antibody is a fully human antibody derived from a transchromosomal mouse, its immunogenicity is significantly reduced, making it more useful for drug development. [Brief description of the drawings]

[0048] [Figure 1] 1 is a graph showing the results of huTIGIT binding affinity of anti-TIGIT antibodies induced using recombinant huTIGIT protein and certain TC-mAb™ mice of the present invention, see Example 3. [Figure 2A] FIG. 1 shows the results of epitope competition of anti-TIGIT antibodies induced using recombinant huTIGIT protein and a given TC-mAb™ mouse of the present invention. See Example 3. [Figure 2B] FIG. 1 shows the results of epitope competition of anti-TIGIT antibodies induced using recombinant huTIGIT protein and a given TC-mAb™ mouse of the present invention. See Example 3. [Figure 3A]1 is a graph showing the results of measuring CHO-TIGIT binding at different concentrations of anti-TIGIT antibodies induced using CHO cells expressing human TIGIT and a given TC-mAb™ mouse of the present invention. [Figure 3B] 1 is a graph showing the results of CHO-TIGIT binding measurements at different concentrations of anti-TIGIT antibodies induced using CHO cells expressing cynomolgus TIGIT (mkTIGIT) and a given TC-mAb™ mouse of the present invention, see Example 4. [Figure 4] 1 is a graph showing the results of CHO-TIGIT CD155 blocking assay at different concentrations of anti-TIGIT antibodies induced using CHO cells expressing human TIGIT and certain TC-mAb™ mice of the present invention, see Example 5. [Figure 5A] 1 is a graph showing the inhibitory effect of anti-TIGIT antibody 4A063 induced by a given TC-mAbTM mouse of the present invention in combination with an anti-PD1 antibody on tumor growth in a human TIGIT gene recombinant mouse model. [Figure 5B] The average body weight of mice in each group is shown as a function of time, see Example 6. [Figure 6A] Graph showing the modulation of the percentage of tumor-infiltrating lymphocyte CD8+T (CD8+TIL) cells in the CD3+T cell population in CT26 tumor treated with anti-TIGIT antibody 4A063 induced by a given TC mAbTM in combination with anti-PD1 antibody.See Example 7. [Figure 6B] 1 is a graph showing the modulation of the percentage of CD8+ T cells in the CD3+ T cell population in splenocytes in CT26 tumor-bearing human TIGIT transgenic mice treated with anti-TIGIT antibody 4A063 induced by a given TC mAbTM in combination with anti-PD1 antibody.See Example 7. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0049] (definition) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The present specification describes methods and materials used in the present invention, but other suitable methods and materials conventional in the art may also be used. The materials, methods, and examples are illustrative and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated herein by reference in their entirety. In the case of conflict, the present specification (including definitions) will control.

[0050] Although the disclosure provides numerical ranges and parameter approximations as broad ranges, the numerical values ​​provided in the specific examples are as precise as possible. However, any numerical value contains inherent error, which arises from the standard deviation in measurements. Also, all ranges disclosed herein are understood to cover any and all subranges thereof. For example, the range "1-10" is considered to include any and all subranges between the minimum value of 1 and the maximum value of 10 (including the end points), i.e., all subranges beginning with the minimum value of 1 or greater (e.g., 1-6.1) and all subranges ending with the maximum value of 10 or less (e.g., 5.5-10).

[0051] It is to be noted that, in this specification, the use of the singular includes the plural of the reference unless clearly and expressly limited to one reference. The terms "or" and "and / or" are used interchangeably unless the context indicates otherwise.

[0052] As used herein, the term "comprises" or "contains" means that various components may be used in combination in the mixtures or compositions of the present invention. Thus, the terms "consisting essentially of" or "consisting of" are included within the term "comprises".

[0053] As used herein, the terms "identity," "percentage identity," "homology," or "identical" refer to sequence identity between two amino acid sequences or between two nucleic acid sequences. Percentage identity may be determined by aligning the two sequences and refers to comparing the number of identical residues (i.e., amino acids or nucleotides) at common positions in the sequences. Sequence alignment and comparison may be performed using standard algorithms in the art (e.g., Smith and Waterman, 1981, Adv. Appl. Math. 2:482; Needleman and Wunsch, 10 1970, J. MoI. Biol. 48:443; Pearson and Lipman, 1988, Proc. Natl. Acad. Sci., USA, 85:2444) or computerized versions of these algorithms (Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive, Madison, WI), which are disclosed and available as BLAST and FASTA. Also, ENTREZ, available from the National Institutes of Health, Bethesda, MD, can be used to compare sequences. When using BLAST or Gapped BLAST programs, the default parameters of each program (e.g., BLASTN, available at the National Center for Biotechnology Information website) may be used. In one embodiment, GCG with a Gap Weight of 1 can be used to determine the percentage identity between two sequences. Any amino acid gap is assigned a weight as if it were a mismatch of one amino acid between the two sequences. Alternatively, the ALIGN program (v2.0), which is part of the sequence comparison software package by GCG (Accelrys, San Diego, Calif.), can be used.

[0054] As used herein, the term "antibody" refers to any antigen-binding molecule that contains at least one (e.g., one, two, three, four, five, or six) complementarity determining regions (CDRs) (e.g., any of the three CDRs from an immunoglobulin light chain or any of the three CDRs from an immunoglobulin heavy chain) and can specifically bind to an epitope. Non-limiting examples of antibodies include monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), single-chain antibodies, chimeric antibodies, human antibodies, and humanized antibodies. In some embodiments, an antibody may contain an Fc region of a human antibody. The term "antibody" includes derivatives such as, for example, bispecific antibodies, single-chain antibodies, diabodies, linear antibodies, and multispecific antibodies formed from antibody fragments.

[0055] A conventional antibody structural unit generally comprises a tetramer. Each tetramer is generally composed of two pairs of identical polypeptide chains, each having one "light" and one "heavy" chain. Human light chains are classified as kappa and lambda light chains. Heavy chains are classified as μ, δ, γ, α, and ε, and antibody isotypes are defined as IgM, IgD, IgG, and IgE, respectively. IgG has multiple subclasses, including but not limited to IgG1, IgG2, IgG3, and IgG4. IgM has subclasses, including but not limited to IgM1 and IgM2. Thus, as used herein, "isotype" refers to any subclass of immunoglobulin defined by the chemical and antigenic characteristics of the constant region. Conventional human immunoglobulin isotypes are IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, IgM1, IgM2, IgD, and IgE. Additionally, therapeutic antibodies may include hybrid isotypes and / or subclasses.

[0056] As used herein, "CDR region" or "CDR" refers to the hypervariable regions of the heavy and light chains of immunoglobulins as defined by Kabat et al. (Kabat et al., Sequences of proteins of immunological interest, 5th Ed., USDepartment of Health and Human Services, NIH, 1991, and later). There are three heavy chain CDRs and three light chain CDRs. As used herein, the term "CDR or CDRs" refers to one, more than one, or all of these regions, which contain the majority of amino acid residues bound by affinity between the antibody and the antigen or its epitope.

[0057] As used herein, the term "antibody fragment" or "antigen-binding fragment" refers to a portion of a full-length antibody and antibody analogs of an antibody that retains the ability to specifically bind to an antigen (e.g., tigit) and generally includes at least a portion of the antigen-binding or variable region of the parent antibody. In some embodiments, the antigen-binding fragment contains at least one variable domain (e.g., a heavy chain variable domain or a light chain variable domain). The antibody fragment retains at least a portion of the binding specificity of the parent antibody. Generally, when expressed as a molar activity, the antibody fragment retains at least 10% of the binding activity of the parent. Preferably, the antibody fragment retains at least 20%, 50%, 70%, 80%, 90%, 95% or 100% of the binding affinity of the parent antibody for the target. Antibody fragments include, but are not limited to, Fab fragments, Fab' fragments, F(ab')2 fragments, Fv fragments, scFv fragments, FD fragments, complementarity determining region (CDR) fragments, disulfide stabilized proteins (dsFv), linear antibodies, single chain antibodies (e.g., scFv single chain antibodies) (produced by Genmab's technology), bivalent single chain antibodies, phage-displayed single chain antibodies, single domain antibodies (e.g., VH domain antibodies), domain antibodies (produced by Ablynx's technology), multispecific antibodies formed from antibody fragments (e.g., three-chain antibodies, four-chain antibodies, etc.), modified antibodies by genetic engineering (e.g., chimeric antibodies such as humanized mouse antibodies), heteroconjugate antibodies, etc. These antibody fragments can be obtained by those skilled in the art using conventional techniques, and the utility of these fragments is screened in the same manner as for complete antibodies.

[0058] As used herein, the term "single chain antibody" refers to a single polypeptide that contains at least two immunoglobulin variable domains (e.g., the variable domains of a mammalian immunoglobulin heavy or light chain) and is capable of specifically binding to an antigen. Non-limiting examples of single chain antibodies are described herein.

[0059] In one embodiment, the antibodies of the present invention may be multispecific antibodies, in particular bispecific antibodies, sometimes called "diabodies". These are antibodies that bind to two (or more) different antigens or different epitopes of the same antigen. Diabodies may be produced in a variety of ways conventional in the art, for example, by chemical methods or from hybridomas.

[0060] As used herein, the term "transchromosomal mice (TC-mAbs) TM "TC-mAb" refers to a mouse containing a mouse artificial chromosome, the mouse artificial chromosome containing a human antibody heavy chain gene or locus and / or a human antibody kappa light chain gene or locus and / or a human antibody lambda light chain gene or locus, and at least two mouse endogenous antibody genes or loci corresponding to the human antibody genes or loci have been knocked out. TM The mouse and its progeny stably retain the human antibody genes and are capable of producing human antibodies.

[0061] The antibodies of the present invention are generally isolated or recombinant. "Isolated" describes various polypeptides disclosed herein and refers to a polypeptide that has been identified, separated and / or recovered from a cell or cell culture expressing the polypeptide. Typically, an isolated polypeptide is obtained via at least one purification step. An "isolated antibody" refers to an antibody that is substantially free of other antibodies having different antigen specificities.

[0062] The present invention further provides variant antibodies. That is, various modifications may be made to the antibodies of the present invention, including, but not limited to, amino acid modifications in the CDRs (affinity maturation), amino acid modifications in the Fc region, glycosylation variants, and other types of covalent modifications. For example, as used herein, "variant" refers to a polypeptide sequence that differs from that of a parent polypeptide by at least one amino acid modification. Amino acid modifications may include substitutions, insertions, and deletions. In general, variants may include any number of modifications, so long as the function of the protein described herein is retained.

[0063] As used herein, the term "epitope" refers to a determinant that interacts with a specific antigen-binding site (called the paratope) of the variable region of an antibody molecule. An epitope is generally a collection of molecules (e.g., amino acids or sugar side chains) that have specific structural features and specific charge characteristics. An antigen may have one or more epitopes.

[0064] An epitope may include amino acid residues that are directly involved in binding (also called the immunodominant component of the epitope) and other amino acid residues that are not directly involved in binding, e.g., amino acid residues that are effectively blocked by a specific antigen-binding peptide, in other words, amino acid residues that are within the footprint of a specific antigen-binding peptide. An epitope generally includes at least three, more usually at least five or eight to ten amino acids that exhibit a particular conformation. Antibodies that recognize the same epitope can be verified in a simple immunoassay that shows the ability of the antibody to block the binding of another antibody to the target antigen.

[0065] As used herein, the terms "polypeptide," "peptide" and "protein" are used interchangeably to refer to amino acid polymers of any length consisting of at least two amino acids.

[0066] As used herein, the terms "polynucleotide," "nucleic acid molecule," and "nucleic acid sequence" are used interchangeably herein to refer to nucleotide polymers of any length consisting of at least two nucleotides, and include, but are not limited to, DNA, RNA, DNA / RNA hybrids, and variants thereof.

[0067] As used herein, the terms "pharmaceutical composition," "drug combination," and "drug combination" are used interchangeably to refer to a combination of at least one drug and, optionally, a pharma- ceutically acceptable carrier or excipient to achieve a particular purpose. In some embodiments, a pharmaceutical composition may include combinations separated in time and / or space, so long as they act together to achieve the purpose of the present disclosure.

[0068] As used herein, a "therapeutically effective amount" or "effective amount" refers to a dose sufficient to exert a benefit on the subject to which it is administered. The actual amount administered and the rate and duration of administration will depend on the condition and severity of the person being treated. Treatment prescription (e.g., determining the dosage, etc.) is ultimately the responsibility and judgment of general practitioners and other physicians, and generally takes into account the disease being treated, the condition of the individual patient, the site of delivery, the method of administration, and other factors known to physicians.

[0069] As used herein, the terms "subject" and "patient" are used interchangeably throughout the specification and refer to an animal, human or non-human, receiving treatment with the methods of the invention. Veterinary and non-veterinary applications are contemplated by the present invention. Human patients may be adults or adolescents (e.g., persons under the age of 18). In addition to humans, patients also include, but are not limited to, mice, rats, hamsters, guinea pigs, rabbits, ferrets, cats, dogs, and primates. For example, non-human primates (e.g., monkeys, chimpanzees, gorillas, etc.), rodents (e.g., rats, mice, gerbils, hamsters, ferrets, rabbits), lagomorphs, pigs (e.g., domesticated boars, minipigs), horses, dogs, cats, cows, and other livestock, farm animals, and zoo animals.

[0070] The antibodies and chemotherapeutic formulations of the invention are administered to a subject by conventional methods, for example, intravenously in the form of a single dose or by continuous infusion over a period of time, intramuscularly, intraperitoneally, intracerebrospinal, subcutaneously, intraarticularly, intrasynovially, intramedullary, orally, topically, or by inhalation.

[0071] As used herein, the term "pharmaceutical acceptable" means that the compound is physiologically tolerable when administered to a human and does not cause adverse events, such as gastrointestinal disorders, dizziness or other adverse events or systemic adverse events similar to these adverse events.

[0072] In the present disclosure, the term "pharmaceutical acceptable carrier" includes, but is not limited to, binders (e.g., microcrystalline cellulose, alginates, gelatin, polyvinylpyrrolidone), fillers (e.g., starch, sucrose, glucose, lactic anhydride), disintegrants (e.g., cross-linked PVP, sodium starch cross-glycolate, sodium cross-carboxymethylcellulose, low-substituted hydroxypropylcellulose), lubricants (magnesium stearate, aluminum stearate, talc, polyethylene glycol, sodium benzoate), wetting agents (e.g., glycerin), surfactants (e.g., cetyl alcohol), and absorption enhancers, flavoring agents, sweeteners, diluents, coating agents, and the like.

[0073] Unless otherwise indicated, the term "TIGIT" or "T cell immunoreceptor having Ig and ITIM domains" as used herein refers to any naturally occurring TIGIT from any vertebrate, including mammals (e.g., primates (e.g., humans)), rodents (e.g., mice, rats), and TIGIT is also known in the art as DKFZp667A205, FLJ39873, V-set, immunoglobulin domain-containing protein 9, V-set, transmembrane domain-containing protein 3, VSIGU, VSTM3, and WUCAM. The term covers "full-length," unprocessed TIGIT (e.g., full-length human TIGIT having the amino acid sequence of a given SEQ ID NO), and any form of TIGIT. The term also covers naturally occurring TIGIT variants, such as splice variants or allelic variants. The term "TIGIT-associated disease" refers to abnormal expression of TIGIT protein or its ligand CD155 in a tumor (e.g., melanoma, breast cancer, non-small cell lung cancer (NSCLC), colon adenocarcinoma (COAD), gastric cancer, acute myeloid leukemia (AML), multiple myeloma (MM) (Clin Exp Immunol. 2020 May;200(2):108-119)) or immune-related disease (e.g., T-cell dysfunction disease) in a subject (e.g., human). When an anti-TIGIT antibody blocks the binding of the ligand to the TIGIT antibody, the anti-TIGIT antibody can achieve a therapeutic effect of the disease by suppressing the proliferation of tumor cells, or alleviating the symptoms of other diseases, or curing the associated disease. Such diseases are defined as TIGIT-associated diseases.

[0074] A "T cell dysfunction disease" is a T cell disease or condition characterized by reduced responsiveness to antigenic stimulation. In some embodiments, the T cell dysfunction disease is characterized by exhaustion of T cells. In certain embodiments, the T cell dysfunction disease is a disease that is clearly related to inappropriately reduced signaling through OX40 and / or OX40L. In another embodiment, the T cell dysfunction disease is a disease in which T cells are unresponsive or have a reduced ability to secrete cytokines, proliferate, or perform cytolytic functions. In certain aspects, the reduced responsiveness abrogates control against pathogens or tumors that express immunogens. Examples of T cell dysfunction diseases characterized by impaired T cell function include unresolved acute infections, chronic infections, and tumor immunity. In some embodiments, the subject is a human.

[0075] The terms "cancer" and "tumor" are used interchangeably. They refer to a range of diseases characterized by the uncontrolled growth of abnormal cells in the body. Uncontrolled cell division may lead to the formation of malignant tumors or cell infiltration into adjacent tissues and may metastasize to distant ends of the body via the lymphatic system or bloodstream. Cancer includes benign and malignant cancers, as well as dormant tumors or micrometastases. Cancer also includes hematological malignancies.

[0076] "Hematologic malignancies" include lymphomas, leukemias, myelomas or lymphoid malignancies, cancers of the spleen and lymph nodes. Exemplary lymphomas include B-cell lymphomas and T-cell lymphomas. B-cell lymphomas include Hodgkin's lymphoma and most non-Hodgkin's lymphomas. Non-limiting examples of B-cell lymphomas include diffuse follicular lymphoma, large B-cell lymphoma, mucosa-associated lymphoid tissue lymphoma, small lymphocytic lymphoma (included in chronic lymphocytic leukemia), Burkitt's lymphoma, mantle cell lymphoma (MCL), mediastinal large B-cell lymphoma, Waldenström's macroglobulinemia, nodal marginal zone B-cell lymphoma, splenic marginal zone lymphoma, primary effusion lymphoma, intravascular large B-cell lymphoma, and lymphomatoid granulomatosis. Non-limiting examples of T-cell lymphomas include extranodal T-cell lymphoma, cutaneous T-cell lymphoma, anaplastic large cell lymphoma, and angioimmunoblastic T-cell lymphoma. Hematological malignancies also include leukemias, including but not limited to secondary leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myelogenous leukemia, and acute lymphocytic leukemia. Hematological malignancies further include myelomas, including but not limited to multiple myeloma and smoldering multiple myeloma. Other hematological cancers and / or B-cell or T-cell related cancers are covered by the term hematological malignancies.

[0077] The term "PVR-positive tumor" refers to tumors in which the expression of PVR is increased in the cancer tissue. PVR-positive tumors include, but are not limited to, adrenocortical carcinoma, chromophobe renal cell carcinoma, papillary renal cell carcinoma, hepatocellular carcinoma, pancreatic ductal adenocarcinoma, pheochromocytoma and paraganglioma, lung adenocarcinoma, head and neck squamous cell carcinoma, prostate cancer, uterine cancer (endometrial cancer), cervical cancer, melanoma (skin), mesothelioma, urothelial carcinoma (bladder cancer), colorectal adenocarcinoma, clear cell renal cell carcinoma, lung squamous cell carcinoma, uterine carcinoma sarcoma, sarcoma, ovarian serous cystadenocarcinoma, thyroid papillary carcinoma, glioblastoma multiforme, breast cancer, low-grade glioma, and diffuse B-cell lymphoma.

[0078] As used herein, the term "immune related disease" refers to an immune related disease in a mammal that is caused, mediated, or otherwise caused by components of the mammalian immune system, including diseases whose progression can be ameliorated by stimulating or interfering with the immune response. "Immune related disease" includes immune mediated inflammatory diseases, non-immune mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, tumors, and the like.

[0079] The anti-TIGIT antibodies or antigen-binding fragments thereof of the present invention may be used to treat an infection or infectious disease in a subject (e.g., a human). In some preferred embodiments, the infection or infectious disease is selected from a viral infection, a bacterial infection, a fungal infection, and a parasitic infection, including, but not limited to, HIV, hepatitis virus, herpes virus, CMV, EBV, and influenza virus.

[0080] Certain preferred embodiments and aspects of the present invention are further described below in conjunction with specific examples, which should not be construed as limitations on the scope of the invention.

[0081] (Example) Example 1: Generation of anti-TIGIT monoclonal antibodies 1. TIGIT Recombinant Protein for Antigen Immunization and Binding Measurement The cDNA was synthesized based on the cDNA encoding full-length human TIGIT (huTIGIT, SEQ ID NO: 1) according to the GenBank sequence (locus: NM_173799), and the cDNA was purchased from Eurofins. The coding region of the extracellular domain ECD corresponding to amino acids (AA) 1-141 (SEQ ID NO: 2) of full-length human TIGIT was amplified by PCR and cloned into an expression vector to produce expression plasmids of two recombinant fusion proteins, Trx-huTIGIT-HIS and Gst-huTIGIT-HIS, respectively. To produce the recombinant fusion proteins, the expression plasmids of the recombinant fusion proteins (Trx-TIGIT-HIS and Gst-TIGIT-HIS) were transferred to E. coli competent cells (E. coli gamiB(DE3)pLysS, Novagen) and cultured. After IPTG induction, the E. coli cells were centrifuged to collect the precipitate. The E. coli was disrupted in ultrasound and then centrifuged to obtain the precipitate. The precipitate was dissolved by adding solubilizing reagent, and then purified by Ni-NTA column (Qiagen, Ni-NTA Superflow, #30410), which was dialyzed. The efficiency of the purification of the recombinant protein was detected by PAGE, and the recombinant protein was then aliquoted and stored at -30°C. ATGCGCTGGTGTCTCCTCCTGATCTGGGCCCAGGGGCTGAGGCAGGCTCCCCTCGCCTCAGGAATGATGACAGGCACAATAGAAACAACGGGGAACATTTCTGCAGAGAAAGGTGGCTCTATCATCTTACAATGTCACCTCTCCTCCACCACGGCACAAGTGACCCAGGTCAACTGGGAGCAGCAGGACCAGCTTCTGGCCATTTGTAATGCTGACTTGGGGTGGCACATCTCCCCATCCTTCAAGGATCGAGTGGCCCCAGGTCCCGGCCTGGGCCTCACCCTCCAGTCGCTGACCGTGAACGATACAGGGGAGTACTTCTGCATCTATCACACCTACCCTGATGGGACGTACACTGGGAGAATCTTCCTGGAGGTCCTAGAAAGCTCAGTGGCTGAGCACGGTGCCAGGTTCCAGATTCCATTGCTTGGAGCCATGGCCGCGACGCTGGTGGTCATCTGCACAGCAGTCATCGTGGTGGTCGCGTTGACTAGAAAGAAGAAAGCCCTCAGAATCCATTCTGTGGAAGGTGACCTCAGGAGAAAATCAGCTGGACAGGAGGAATGGAGCCCCAGTGCTCCCTCACCCCCAGGAAGCTGTGTCCAGGCAGAAGCTGCACCTGCTGGGCTCTGTGGAGAGCAGCGGGGAGAGGACTGTGCCGAGCTGCATGACTACTTCAATGTCCTGAGTTACAGAAGCCTGGGTAACTGCAGCTTCTTCACAGAGACTGGTTAG(SEQ ID NO: 1) MMTGTIETTGNISAEKGGSIILQCHLSSTTAQVTQVNWEQQDQLLAICNADLGWHISPSFKDRVAPGPGLGLTLQSLTVNDTGEYFCIYHTYPDGTYTGRIFLEVLESSVAEHGAR FQIP(SEQ ID NO: 2)

[0082] 2. Construction of stable expression cell line Based on the cDNAs encoding full-length human TIGIT (huTIGIT, SEQ ID NO: 1) and cynomolgus TIGIT (mkTIGIT, SEQ ID NO: 3) according to GenBank sequences (NM_73799) and (XM_005548101.2), respectively, the cDNAs were purchased from Genscript. After PCR amplification, the DNA products were cloned into the pcDNA3.1 expression vector (Invitrogen) and transduced into CHO-K1 cell line (JCRB, #JCRB9018) to generate CHO-huTIGIT and CHO-mkTIGIT cell lines. HuTIGIT or mkTIGIT high expression stable cell lines were selected by culturing in G418-containing medium, eGFP expression, and binding measurement by FACS. ATGCGGTGGTGTCTCTTCCTGATCTGGGCCCAGGGGCTGAGGCAGGCTCCCCTCGCCTCAGGAATGATGACAGGCACAATAGAAACAACGGGGAACATTTCTGCAAAGAAAGGTGGCTCTGTTATCTTACAATGTCACCTCTCCTCCACCATGGCACAAGTGACCCAGGTCAACTGGGAGCAGCATGACCATTCGCTTCTGGCCATTCGTAATGCTGAGTTGGGGTGGCACATCTACCCAGCCTTCAAGGATCGAGTGGCCCCGGGTCCTGGCCTGGGCCTCACCCTCCAGTCGCTGACCATGAATGATACAGGGGAGTACTTCTGCACCTATCACACCTACCCTGATGGGACTTACAGAGGGAGAATCTTCCTGGAGGTCCTAGAAAGCTCAGTGGCTGAGCACAGTGCCAGGTTCCAGATTCCATTGCTTGGAGCCATGGCCATGATGCTGGTGGTCATCTGCATAGCAGTCATCGTGGTGGTCGTGTTGGCTAGAAAGAAGAAATCCCTCAGAATCCATTCTGTGGAAAGTGGCCTCCAGAGAAAATCAACTGGACAGGAAGAACAGATTCCCAGTGCTCCCTCACCCCCAGGAAGCTGTGTCCAGGCAGAAGCTGCACCTGCTGGGCTCTGTGGAGAGCAGCAGGGAGATGACTGTGCCGAGCTGCATGACTACTTCAATGTCCTGAGTTACAGAAGCCTGGGGAGCTGCAGCTTCTTCACAGAGACTGGGTAG(SEQ ID NO: 3)

[0083] 3. Immunization, Hybridoma Fusion and Cloning 6 - 8 week-old transgenic mice (TC-mAb TMFor the first immunization injection of mice (100μg / mouse), human TIGIT recombinant protein (Trx-huTIGIT-HIS fusion protein, 100μg / mouse for first immunization, 50μg / mouse for boost) was mixed with complete Freund's adjuvant (FCA, purchased from BD, catalog number 263810, 100μL / mouse for first immunization), and boost immunization injection was performed using Sigma Adjust System® (SAS, purchased from sigma, catalog number s6322-1vl, 50μL / mouse for boost), with an interval of 2-3 weeks. The final immunization does not require adjuvant, and only Trx-huTIGIT-HIS fusion protein (50μg / mouse for final immunization) is required. All immunizations were performed by intraperitoneal injection.

[0084] Three days after the final immunization, mice were euthanized, and the spleen and lymph nodes were removed under sterile conditions, and mouse lymphocytes were isolated and extracted under sterile conditions. The resulting lymphocyte population was fused with mouse myeloma cells (1:1, P3X63-Ag8.653, ATCC, #CRL-1580) by electrofusion. The fused cells were placed in HAT medium in a 96-well plate and incubated at 37°C, 5% CO2 for 7 days, then replaced with HT medium and incubated for 5 days.

[0085] 4. Evaluation of anti-TIGIT antibody binding activity by ELISA, immunocytochemistry (ICC) and flow cytometry Human TIGIT protein was used to screen the supernatants containing specific anti-TIGIT antibodies by ELISA. 96-well plates (Nunc, Cat. No. 44-2404) were coated with Gst-huTIGIT-HIS fusion protein, Trx-huTIGIT-HIS (50ng / well), respectively, diluted with PBS buffer, and incubated at 4°C overnight. Then, 300μL of TBS containing skim milk and Tween20 was used to block the wells for 30 minutes at room temperature. After washing, 100μL of supernatant and / or serum was added and incubated at room temperature. To detect the specificity of the antibodies, anti-human IgG antibody conjugated with horseradish peroxidase (goat anti-human IgG-Fc fragment cross-adsorbed antibody conjugated with HRP, BETHYL, #A80-304P) was diluted to the optimal concentration in PBS containing 0.05% Tween20, then added at 100μL / well after washing, and incubated at room temperature for 30 minutes. The plate was washed three times using 300 μL of TBS containing 0.05% Tween 20. 100 μL of matrix solution containing 0.5 mg / mL OPD and 0.03% H2O2 was added, the plate was incubated at room temperature for 30 minutes, then 25 μL of 1M H2SO4 (Nacalai Tesque, #95626-06) was added, and then read at 492 nm. Positive clones were selected and inoculated into a new 96-well plate. After 3 days, the supernatants of the new 96-well plate were screened by ELISA using human TIGIT protein. Hybridoma cell lines that bound human TIGIT were expanded and cultured for 2-4 days, and ELISA-positive clones were detected by ICC and flow cytometry using CHO-huTIGIT and CHO-mkTIGIT cells, and positive clones were also selected. After several days of culture, secondary detection was performed according to the method described above. Secondary positive clones were limiting diluted and again tested by ICC and flow cytometry two weeks later, again at limiting dilution.

[0086] Example 2: Sequence analysis of anti-TIGIT antibodies After preliminary screening by ELISA, ICC and FACS, positive hybridoma clones were subcloned by limiting dilution. After verification again, the cloned hybridoma cells were cultured in 10 cm petri dishes. When the cell density reached 80%-90%, the cells were collected and suspended in solution. RNA was extracted from the suspended cells using a microKit (QIAGEN, #74104). The extracted RNA was rapidly amplified at the 5' cDNA end using a kit (Takara, #Z4858N). The sequence analysis (Eurofins) results of the products are shown in Table 1. Based on the sequence, TIGIT antibody expression plasmids were constructed and expressed in HEK293 cells. Eight antibodies were purified by protein A and analyzed by SDS-PAGE, and the purity of the antibodies was more than 95%. The amino acid sequences of the obtained 10 antibodies were determined, and the sequences of the heavy chain variable region (VH) and light chain variable region (VL) are shown in Table 1.

[0087] [Table 1] TIFF2025503446000003.tif255170TIFF2025503446000004.tif233170

[0088] The IMGT program was used to predict the CDRs of VL and VH, and the results are shown in Table 2. [Table 2]

[0089] Depending on the CDR prediction program used, there may be slight differences, such as changes in amino acid positions, even in CDRs of the same VH or VL. These different CDRs from the same VH or VL are also included in the scope of the present invention.

[0090] Example 3: Selected TC-mAbs against recombinant human TIGIT protein TM Measurement of the affinity of anti-TIGIT antibodies induced by mice The equilibrium dissociation constants (K D The measurement was performed by a conventional method (Estep, P et al., High throughput solution based measurement of antibody-antigen affinity and epitope binning, MAbs, 2013.5(2):p.270-8). TM The affinity of the anti-TIGIT antibody of the present invention induced by mice was measured. An NTA (HIS-tag) sensor was used. After the sensor was equilibrated in the analysis buffer, human TIGIT-HIS was loaded onto the NTA sensor (fortebio) to measure the affinity. The antigen-loaded sensor was placed in a solution containing the antibody (antibody concentrations were 5, 2.5, 0.83, 0.278, 0.09, 0.03, and 0.01 μg / mL, respectively) until the stationary phase was reached, and then the sensor was transferred to the analysis buffer and allowed to dissociate for at least 2 minutes for the measurement of the dissociation rate. Kinetic analysis was performed using a 1:1 combination model.

[0091] In the above described tests, certain TC-mAbs of the present invention TM K of anti-TIGIT antibodies induced in mice D The values ​​are shown in Table 3. [Table 3]

[0092] The epitopes of all human TIGIT antibodies (1B2-8C, 4A042-H3, 4A042-H7, 4B030a, 4B037a, 4B056a, 4A063, 4D035a, 4E061a) bound to human TIGIT were studied using Octet binding tests, in comparison with the anti-TIGIT antibody reference Tiragolumab (synthesized based on the Tiragolumab sequence disclosed in the KEGG-DRUG database). The test procedure was as follows: the sensor loaded with TIGIT-HIS (Biointron, BI120) was placed in a solution containing TIGIT antibodies until it reached stationary phase, then the sensor was transferred to the assay buffer to saturate, and then the sensor was transferred to another analyte or buffer containing the reference antibody (Tiragolumab). When the binding reached stationary phase, it was eluted. As the epitope cluster shows, there is competition between the three candidate clone epitopes compared with tiragolumab, i.e., they bind to the same antigenic epitope of TIGIT. The results are shown in Figure 2A.

[0093] Epitope competition is observed between various antibodies of the present invention. 1B2-8C can block the binding of itself to tiragolumab, 4A042-H3, 4A042-H7 and 4B030a, and can partially block the binding of 4A063, but does not block the binding of 4B037a, 4B056a, 4A063, 4D035a and 4E061a; tiragolumab and 4A042-H3 can block the binding of tiragolumab, 1B2-8C, 4A042-H7 and 4B030a, but does not block the binding of 4B037a, 4B056a, 4A063, 4D035a and 4E061a. 4A042-H7 can block the binding of itself to tiragolumab, 1B2-8C, 4A042-H3 and 4B030a and partially block the binding of 4B037a and 4A063, but does not block the binding of 4B056a, 4D035a and 4E061a, and 4B030a can block the binding of itself to tiragolumab, 1B2-8C, 4A042-H3 and 4B030a and partially block the binding of 4B037a and 4A063. 4B037a and 4A063 can partially block the binding of 4B037a, 4B056a, 4A063, 4D035a and 4E061a, and can partially block the binding of tiragolumab, 1B2-8C, 4A042-H3, 4A042-H7 and 4B030a; 4B056a can partially block the binding of itself to 4B037a, 4A063, 4D035a and 4E061a, and can partially block the binding of tiragolumab, 1B2-8C, 4A042-H3, 4A042-H7 and 4B030a; 61a, partially blocking the binding of tiragolumab, 1B2-8C, 4A042-H3 and 4B030a, but not blocking the binding of 4A042-H7, and 4D035a and 4E061a, blocking the binding of 4B037a, 4B056a, 4A063, 4D035a and 4E061a, but not blocking the binding of tiragolumab, 1B2-8C, 4A042-H3, 4A042-H7 and 4B030a. The results are shown in Figure 2B and Figure 2C.

[0094] Example 4: Predefined TC-mAbs against cell surface TIGIT TM Binding activity of anti-TIGIT monoclonal antibodies induced by mice CHO-huTIGIT cells or CHO-mkTIGIT cells were seeded in a 96-well plate. The antibodies of Example 2 were each diluted to different concentrations and added (100 μL / well) to the 96-well plate covered with cells, and incubated at 4° C. (on ice) for 1 hour.

[0095] The cells were washed by adding 200 μL / well of wash buffer, centrifuged at 1600 rpm (approximately 260×g) for 3 min at 4° C., and the supernatant was discarded, which was repeated twice. 30 μL of wash buffer containing anti-human IgG secondary antibody (Jackson ImmunoResearch, #109-585-190, Alexa Fluor® 594 AffiniPure goat anti-human IgG, Fcγ fragment specificity) was added to each well, and the cells were incubated for 1 h at 4° C. (on ice). After two washes, the cells were transferred to a flat-bottom 96-well plate and analyzed on the CytoFLEX S. The antibody concentration was plotted as the base 10 logarithm on the abscissa and the median fluorescence intensity of the two channels on the ordinate. EC 50 (CHO-huTIGIT and CHO-mkTIGIT) were compared to the peak values ​​of the curves (μg / mL). The results are shown in Table 4 and Figures 3A and 3B. [Table 4]

[0096] Example 5: TC-mAbs of the invention TM Blockade of TIGIT-CD155 binding by anti-TIGIT monoclonal antibodies induced in mice CHO-huTIGIT-eGFP cells were seeded in a V-bottom 96-well plate. The antibody of Example 2 and the reference antibody were each diluted to different concentrations, and 100 μL per well was added to the 96-well plate covered with cells (100%) and incubated at 4° C. for 1 hour.

[0097] The cells were washed by adding 200 μL / well of wash buffer and centrifuged at 1600 rpm (approximately 260 × g) for 3 min at 4 °C, discarding the supernatant, and repeating this twice. 30 μL of wash buffer containing biotinylated human CD155 (human CD155 / PVR / NECL5 protein (Fc tag), biotinylated, Sin Biological, 10109-H02H-B) was added, and the cells were then incubated for 1 h at 4 °C (on ice). 30 μL of wash buffer containing streptavidin-594 (fc = 10 μg / mL) was added to the wells, and the cells were then incubated for 30 min at 4 °C. After one wash, the cells were transferred to a flat-bottom 96-well plate and analyzed on a CytoFLEX S. The abscissa was the base 10 logarithm of the antibody concentration (μg / mL) and the ordinate was the median fluorescence intensity corresponding to each antibody concentration. The IC of the curves 50 were analyzed to distinguish the blocking ability of different antibodies against the binding of CD155 to TIGIT.

[0098] Eight antibodies against CD155 were tested for their blocking ability, with IgG1 as a negative control antibody. IC 50 (μg / mL) Results are shown in Table 5, Figure 4. [Table 5]

[0099] Example 6: In vivo efficacy of combination therapy of anti-TIGIT antibody and anti-PD-1 antibody To evaluate the in vivo synergistic effect of anti-TIGIT and anti-PD-1 antibodies, mouse colorectal cancer cell line CT26.WT (5 × 10 5 The mean tumor volume was 120±50 mm. 3When tumor volume reached 100 μg / mouse, mice were randomly divided into groups (n=3) according to tumor volume and administered IgG negative control antibody (anti-HEL human IgG1 isotype, biointron, 200 μg / mouse each time), anti-mPD-1 antibody (in vivo MAb anti-mouse PD-1, Approval Number: 795720D1, 20 μg / mouse each time), combination of positive reference antibody (tiragolumab-hIgG1, 200 μg / mouse each time) and anti-mPD-1 antibody (20 μg / mouse each time), and combination of 4A063 antibody (4A063-hIgG1, 200 μg / mouse each time) and anti-mPD-1 antibody (20 μg / mouse each time), once every 3 days for a total of 6 times. Tumor volume and body weight were measured twice a week.

[0100] The results are shown in Figure 5, which provides the average tumor volume and average body weight of mice in each group as a function of time. Compared to the positive reference antibody, 4A063 showed significant inhibition of tumor growth (TGI: 44% vs. 92.33%), and there was no significant difference between the average body weights of each group.

[0101] Example 7: Study on the mechanism of action of the in vivo antitumor activity of combination therapy of anti-TIGIT antibody and anti-PD-1 antibody To study the in vivo mode of action of anti-TIGIT antibodies, tumor immune cell infiltration was analyzed by flow cytometry after combination treatment with anti-TIGIT antibody 4A063 (hIgG1) and anti-PD-1 antibody. Mice were inoculated and treated as described in Example 6. Three days after six treatments, mice were sacrificed and tumors and spleens were removed. Tumors were lysed with tumor digestion buffer (1 mg / mL type I collagenase and 20 μg / mL DNAase I, sigma) and spleens were ground to obtain single-cell spleen suspensions directly. After staining with Fc-block, cells were stained with anti-CD3 (FITC anti-mouse CD3, Biolegend, 100204) and anti-CD8 (PE anti-mouse CD8a, Biolegend, 100708). In addition, commercial buffers (BD Cytofix / Cytoperm TMAfter fixation and clearing with Fixation / Clearing Kit (554714), cells were stained with anti-IFNγ antibody (PerCP / Cyanine5.5 anti-mouse IFN-γ, Biolegend, 505822). After standard washing and filtration, cells were analyzed by flow cytometry.

[0102] The results are shown in Figure 6. As shown in Figure 6A, when compared with the control group, in vivo combination treatment of tumors with anti-TIGIT antibody 4A063 hIgG1 increased the number of CD8 + The proportion of TIL population was increased (P = 0.0335) in the combination treatment group, but this was not observed in the PD-1 antibody alone group. Also, the flow cytometry results of T cells in splenocytes (shown in Figure 6B) were consistent with the results in the tumor microenvironment, with CD8 + The proportion of TILs was found to be significantly higher than that in the subtype control group (P=0.0025) and higher than that in the PD-1 antibody monotherapy group (P=0.0171). This indicates that cytotoxic effector T cells are activated following combination treatment, which explains the difference between the combination treatment group and the PD-1 monotherapy group as discussed in Example 5. Comparison between the combination treatment groups revealed that CD8 + The increase in TILs was more pronounced. Combination treatment with the anti-TIGIT antibody 4A063 hIgG1 and PD-1 antibody also improved the function of T cells in the tumor and increased the CD3 + CD8 + There was increased production of IFNγ by T cells.

[0103] All publications and patents mentioned in this application are incorporated herein by reference.Various modifications and variations of the methods and compositions described in this invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention.Although the invention has been described in connection with certain preferred embodiments, the claimed invention should not be limited to these specific embodiments.Indeed, various modifications of the modes for carrying out the invention described herein are intended to be included within the scope of the claims, and these modifications will be apparent to those skilled in the art.

Claims

1. An anti-TIGIT antibody or an antigen-binding fragment thereof that specifically binds to TIGIT (a T cell immunoreceptor having an Ig and ITIM domain), An anti-TIGIT antibody or an antigen-binding fragment thereof comprising a heavy chain variable region (VH) and / or a light chain variable region (VL), wherein the heavy chain variable region comprises CDRH1, CDRH2, and CDRH3, and the light chain variable region comprises CDRL1, CDRL2, and CDRL3.

2. (a) the CDRH1 comprises a sequence selected from the group consisting of SEQ ID NO:23, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:41, SEQ ID NO:47, SEQ ID NO:53, SEQ ID NO:59, SEQ ID NO:65, SEQ ID NO:75, SEQ ID NO:81, and variant sequences thereof produced by adding, deleting, or substituting one or more amino acids; (b) the CDRH2 comprises a sequence selected from the group consisting of SEQ ID NO:24, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:42, SEQ ID NO:48, SEQ ID NO:54, SEQ ID NO:60, SEQ ID NO:66, SEQ ID NO:76, SEQ ID NO:82, and variant sequences thereof produced by adding, deleting, or substituting one or more amino acids; and (c) the CDRH3 comprises a sequence selected from the group consisting of SEQ ID NO:25, SEQ ID NO:31, SEQ ID NO:37, SEQ ID NO:43, SEQ ID NO:49, SEQ ID NO:55, SEQ ID NO:61, SEQ ID NO:67, SEQ ID NO:77, SEQ ID NO:83, and variant sequences thereof generated by adding, deleting or substituting one or more amino acids; and / or (d) the CDRL1 comprises a sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:32, SEQ ID NO:38, SEQ ID NO:44, SEQ ID NO:50, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:72, SEQ ID NO:78, and variant sequences thereof produced by adding, deleting or substituting one or more amino acids; (e) the CDRL2 comprises a sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:33, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:51, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:73, SEQ ID NO:79, and variant sequences thereof produced by adding, deleting or substituting one or more amino acids; and (f) The anti-TIGIT antibody or antigen-binding fragment thereof of claim 1, wherein the CDRL3 comprises a sequence selected from the group consisting of SEQ ID NO:22, SEQ ID NO:28, SEQ ID NO:34, SEQ ID NO:40, SEQ ID NO:46, SEQ ID NO:52, SEQ ID NO:58, SEQ ID NO:64, SEQ ID NO:74, SEQ ID NO:80, and variant sequences thereof generated by adding, deleting or substituting one or more amino acids.

3. (a) the CDRH1 comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NO:23, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:41, SEQ ID NO:47, SEQ ID NO:53, SEQ ID NO:59, SEQ ID NO:65, SEQ ID NO:75, and SEQ ID NO:81; (b) the CDRH2 comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NO:24, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:42, SEQ ID NO:48, SEQ ID NO:54, SEQ ID NO:60, SEQ ID NO:66, SEQ ID NO:76, and SEQ ID NO:82; and (c) the CDRH3 comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NO:25, SEQ ID NO:31, SEQ ID NO:37, SEQ ID NO:43, SEQ ID NO:49, SEQ ID NO:55, SEQ ID NO:61, SEQ ID NO:67, SEQ ID NO:77, and SEQ ID NO:83; and / or (d) the CDRL1 comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:32, SEQ ID NO:38, SEQ ID NO:44, SEQ ID NO:50, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:72, and SEQ ID NO:78; (e) the CDRL2 comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:33, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:51, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:73, and SEQ ID NO:79; and (f) The anti-TIGIT antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the CDRL3 comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NO: 22, SEQ ID NO: 28, SEQ ID NO: 34, SEQ ID NO: 40, SEQ ID NO: 46, SEQ ID NO: 52, SEQ ID NO: 58, SEQ ID NO: 64, SEQ ID NO: 74 and SEQ ID NO:

80.

4. (a) the CDRH1 comprises a sequence selected from the group consisting of SEQ ID NO:23, SEQ ID NO:29, SEQ ID NO:35, SEQ ID NO:41, SEQ ID NO:47, SEQ ID NO:53, SEQ ID NO:59, SEQ ID NO:65, SEQ ID NO:75, and SEQ ID NO:81; (b) the CDRH2 comprises a sequence selected from the group consisting of SEQ ID NO:24, SEQ ID NO:30, SEQ ID NO:36, SEQ ID NO:42, SEQ ID NO:48, SEQ ID NO:54, SEQ ID NO:60, SEQ ID NO:66, SEQ ID NO:76, and SEQ ID NO:82; (c) the CDRH3 comprises a sequence selected from the group consisting of SEQ ID NO:25, SEQ ID NO:31, SEQ ID NO:37, SEQ ID NO:43, SEQ ID NO:49, SEQ ID NO:55, SEQ ID NO:61, SEQ ID NO:67, SEQ ID NO:77, and SEQ ID NO:83; (d) the CDRL1 comprises a sequence selected from the group consisting of SEQ ID NO:20, SEQ ID NO:26, SEQ ID NO:32, SEQ ID NO:38, SEQ ID NO:44, SEQ ID NO:50, SEQ ID NO:56, SEQ ID NO:62, SEQ ID NO:72, and SEQ ID NO:78; (e) the CDRL2 comprises a sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:27, SEQ ID NO:33, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:51, SEQ ID NO:57, SEQ ID NO:63, SEQ ID NO:73, and SEQ ID NO:79; and (f) The anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, wherein the CDRL3 comprises a sequence selected from the group consisting of SEQ ID NO:22, SEQ ID NO:28, SEQ ID NO:34, SEQ ID NO:40, SEQ ID NO:46, SEQ ID NO:52, SEQ ID NO:58, SEQ ID NO:64, SEQ ID NO:74 and SEQ ID NO:

80.

5. the heavy chain variable region comprises CDRH1, CDRH2, CDRH3, and (a) said CDRH1 comprises the sequence of SEQ ID NO:23, said CDRH2 comprises the sequence of SEQ ID NO:24, and said CDRH3 comprises the sequence of SEQ ID NO:25; (b) said CDRH1 comprises the sequence of SEQ ID NO:29, said CDRH2 comprises the sequence of SEQ ID NO:30, and said CDRH3 comprises the sequence of SEQ ID NO:31; (c) said CDRH1 comprises the sequence of SEQ ID NO: 35, said CDRH2 comprises the sequence of SEQ ID NO: 36, and said CDRH3 comprises the sequence of SEQ ID NO: 37; (d) said CDRH1 comprises the sequence of SEQ ID NO: 41, said CDRH2 comprises the sequence of SEQ ID NO: 42, and said CDRH3 comprises the sequence of SEQ ID NO: 43; (e) the CDRH1 comprises the sequence of SEQ ID NO: 47, the CDRH2 comprises the sequence of SEQ ID NO: 48, and the CDRH3 comprises the sequence of SEQ ID NO: 49; (f) said CDRH1 comprises the sequence of SEQ ID NO:53, said CDRH2 comprises the sequence of SEQ ID NO:54, and said CDRH3 comprises the sequence of SEQ ID NO:55; (g) said CDRH1 comprises the sequence of SEQ ID NO:59, said CDRH2 comprises the sequence of SEQ ID NO:60, and said CDRH3 comprises the sequence of SEQ ID NO:61; (h) said CDRH1 comprises the sequence of SEQ ID NO:65, said CDRH2 comprises the sequence of SEQ ID NO:66, and said CDRH3 comprises the sequence of SEQ ID NO:67; (i) the CDRH1 comprises the sequence of SEQ ID NO: 75, the CDRH2 comprises the sequence of SEQ ID NO: 76, and the CDRH3 comprises the sequence of SEQ ID NO: 77; or (j) The anti-TIGIT antibody or antigen-binding fragment thereof of any one of claims 1 to 4, wherein the CDRH1 comprises the sequence of SEQ ID NO: 81, the CDRH2 comprises the sequence of SEQ ID NO: 82, and the CDRH3 comprises the sequence of SEQ ID NO:

83.

6. the light chain variable region comprises CDRL1, CDRL2, CDRL3, and (a) said CDRL1 comprises the sequence of SEQ ID NO:20, said CDRL2 comprises the sequence of SEQ ID NO:21, and said CDRL3 comprises the sequence of SEQ ID NO:22; (b) said CDRL1 comprises the sequence of SEQ ID NO:26, said CDRL2 comprises the sequence of SEQ ID NO:27, and said CDRL3 comprises the sequence of SEQ ID NO:28; (c) said CDRL1 comprises the sequence of SEQ ID NO: 32, said CDRL2 comprises the sequence of SEQ ID NO: 33, and said CDRL3 comprises the sequence of SEQ ID NO: 34; (d) said CDRL1 comprises the sequence of SEQ ID NO: 38, said CDRL2 comprises the sequence of SEQ ID NO: 39, and said CDRL3 comprises the sequence of SEQ ID NO: 40; (e) said CDRL1 comprises the sequence of SEQ ID NO: 44, said CDRL2 comprises the sequence of SEQ ID NO: 45, and said CDRL3 comprises the sequence of SEQ ID NO: 46; (f) said CDRL1 comprises the sequence of SEQ ID NO:50, said CDRL2 comprises the sequence of SEQ ID NO:51, and said CDRL3 comprises the sequence of SEQ ID NO:52; (g) said CDRL1 comprises the sequence of SEQ ID NO:56, said CDRL2 comprises the sequence of SEQ ID NO:57, and said CDRL3 comprises the sequence of SEQ ID NO:58; (h) said CDRL1 comprises the sequence of SEQ ID NO:62, said CDRL2 comprises the sequence of SEQ ID NO:63, and said CDRL3 comprises the sequence of SEQ ID NO:64; (i) said CDRL1 comprises the sequence of SEQ ID NO: 72, said CDRL2 comprises the sequence of SEQ ID NO: 73, and said CDRL3 comprises the sequence of SEQ ID NO: 74; or (j) The anti-TIGIT antibody or antigen-binding fragment thereof of any one of claims 1 to 5, wherein CDRL1 comprises the sequence of SEQ ID NO: 78, CDRL2 comprises the sequence of SEQ ID NO: 79, and CDRL3 comprises the sequence of SEQ ID NO:

80.

7. (a) the CDRH1 comprises the sequence of SEQ ID NO:23, the CDRH2 comprises the sequence of SEQ ID NO:24, and the CDRH3 comprises the sequence of SEQ ID NO:25, and the CDRL1 comprises the sequence of SEQ ID NO:20, the CDRL2 comprises the sequence of SEQ ID NO:21, and the CDRL3 comprises the sequence of SEQ ID NO:22; (b) the CDRH1 comprises the sequence of SEQ ID NO:29, the CDRH2 comprises the sequence of SEQ ID NO:30, and the CDRH3 comprises the sequence of SEQ ID NO:31, and the CDRL1 comprises the sequence of SEQ ID NO:26, the CDRL2 comprises the sequence of SEQ ID NO:27, and the CDRL3 comprises the sequence of SEQ ID NO:28; (c) the CDRH1 comprises the sequence of SEQ ID NO: 35, the CDRH2 comprises the sequence of SEQ ID NO: 36, and the CDRH3 comprises the sequence of SEQ ID NO: 37, and the CDRL1 comprises the sequence of SEQ ID NO: 32, the CDRL2 comprises the sequence of SEQ ID NO: 33, and the CDRL3 comprises the sequence of SEQ ID NO: 34; (d) the CDRH1 comprises the sequence of SEQ ID NO: 41, the CDRH2 comprises the sequence of SEQ ID NO: 42, and the CDRH3 comprises the sequence of SEQ ID NO: 43, and the CDRL1 comprises the sequence of SEQ ID NO: 38, the CDRL2 comprises the sequence of SEQ ID NO: 39, and the CDRL3 comprises the sequence of SEQ ID NO: 40; (e) the CDRH1 comprises the sequence of SEQ ID NO:47, the CDRH2 comprises the sequence of SEQ ID NO:48, and the CDRH3 comprises the sequence of SEQ ID NO:49, and the CDRL1 comprises the sequence of SEQ ID NO:44, the CDRL2 comprises the sequence of SEQ ID NO:45, and the CDRL3 comprises the sequence of SEQ ID NO:46; (f) the CDRH1 comprises the sequence of SEQ ID NO:53, the CDRH2 comprises the sequence of SEQ ID NO:54, and the CDRH3 comprises the sequence of SEQ ID NO:55, and the CDRL1 comprises the sequence of SEQ ID NO:50, the CDRL2 comprises the sequence of SEQ ID NO:51, and the CDRL3 comprises the sequence of SEQ ID NO:52; (g) the CDRH1 comprises the sequence of SEQ ID NO:59, the CDRH2 comprises the sequence of SEQ ID NO:60, and the CDRH3 comprises the sequence of SEQ ID NO:61, and the CDRL1 comprises the sequence of SEQ ID NO:56, the CDRL2 comprises the sequence of SEQ ID NO:57, and the CDRL3 comprises the sequence of SEQ ID NO:58; (h) the CDRH1 comprises the sequence of SEQ ID NO:65, the CDRH2 comprises the sequence of SEQ ID NO:66, and the CDRH3 comprises the sequence of SEQ ID NO:67, and the CDRL1 comprises the sequence of SEQ ID NO:62, the CDRL2 comprises the sequence of SEQ ID NO:63, and the CDRL3 comprises the sequence of SEQ ID NO:64; (i) the CDRH1 comprises the sequence of SEQ ID NO: 75, the CDRH2 comprises the sequence of SEQ ID NO: 76, and the CDRH3 comprises the sequence of SEQ ID NO: 77, and the CDRL1 comprises the sequence of SEQ ID NO: 72, the CDRL2 comprises the sequence of SEQ ID NO: 73, and the CDRL3 comprises the sequence of SEQ ID NO: 74; or (j) The anti-TIGIT antibody or antigen-binding fragment thereof of any one of claims 1 to 6, wherein the CDRH1 comprises the sequence of SEQ ID NO: 81, the CDRH2 comprises the sequence of SEQ ID NO: 82, and the CDRH3 comprises the sequence of SEQ ID NO: 83, and the CDRL1 comprises the sequence of SEQ ID NO: 78, the CDRL2 comprises the sequence of SEQ ID NO: 79, and the CDRL3 comprises the sequence of SEQ ID NO:

80.

8. The anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, wherein the heavy chain variable region comprises a sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:69 and SEQ ID NO:

71.

9. The anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, wherein the light chain variable region comprises a sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:68 and SEQ ID NO:

70.

10. (a) the heavy chain variable region comprises the sequence of SEQ ID NO:5 and the light chain variable region comprises the sequence of SEQ ID NO:4; (b) the heavy chain variable region comprises the sequence of SEQ ID NO:7, and the light chain variable region comprises the sequence of SEQ ID NO:6; (c) the heavy chain variable region comprises the sequence of SEQ ID NO:9, and the light chain variable region comprises the sequence of SEQ ID NO:8; (d) the heavy chain variable region comprises the sequence of SEQ ID NO:11, and the light chain variable region comprises the sequence of SEQ ID NO:10; (e) the heavy chain variable region comprises the sequence of SEQ ID NO: 13, and the light chain variable region comprises the sequence of SEQ ID NO: 12; (f) the heavy chain variable region comprises the sequence of SEQ ID NO: 15, and the light chain variable region comprises the sequence of SEQ ID NO: 14; (g) the heavy chain variable region comprises the sequence of SEQ ID NO: 17, and the light chain variable region comprises the sequence of SEQ ID NO: 16; (h) the heavy chain variable region comprises the sequence of SEQ ID NO: 19, and the light chain variable region comprises the sequence of SEQ ID NO: 18; (i) the heavy chain variable region comprises the sequence of SEQ ID NO:69, and the light chain variable region comprises the sequence of SEQ ID NO:68; or (j) An anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 9, wherein the heavy chain variable region comprises the sequence of SEQ ID NO: 71 and the light chain variable region comprises the sequence of SEQ ID NO:

70.

11. comprising a heavy chain variable region (VH) and / or a light chain variable region (VL); (a) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO:5, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO:4; (b) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO: 7, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO: 6; (c) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO: 9, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO: 8; (d) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO: 11, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO: 10; (e) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO: 13, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO: 12; (f) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO: 15, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO: 14; (g) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO: 17, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO: 16; (h) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO: 19, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO: 18; (i) the VH comprises CDRH1, CDRH2 and CDRH3 of the VH set forth in SEQ ID NO: 69, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL set forth in SEQ ID NO: 68; or (j) The anti-TIGIT antibody or its antigen-binding fragment of claim 1, wherein the VH comprises CDRH1, CDRH2 and CDRH3 of the VH shown in SEQ ID NO: 71, and / or the VL comprises CDRL1, CDRL2 and CDRL3 of the VL shown in SEQ ID NO:

70.

12. The anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 11, further comprising a heavy chain constant region selected from the heavy chain constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE and IgD, and / or further comprising a heavy chain constant region of human IgG.

13. F(ab′) ２ 13. The anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 12, which is in a form selected from the group consisting of Fab', Fab, Fv, scFv, a bispecific antibody, and combinations thereof.

14. The anti-TIGIT antibody or antigen-binding fragment thereof of any one of claims 1 to 13, which is conjugated to a reagent, the reagent being, for example, a detectable label or a cytotoxic drug.

15. A polynucleotide encoding the anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 14.

16. An expression vector enabling expression of the anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 14.

17. 17. An engineered cell comprising the polynucleotide of claim 15 or the vector of claim 16.

18. A pharmaceutical composition comprising an anti-TIGIT antibody or an antigen-binding fragment thereof according to any one of claims 1 to 14, a polynucleotide according to claim 15, a vector according to claim 16, or a cell according to claim 17, and a pharma- ceutical acceptable carrier.

19. The pharmaceutical composition of claim 18, further comprising an anti-TIGIT antibody or antigen-binding fragment thereof, which further comprises another immune checkpoint inhibitor, in particular a PD-1 / PD-L1 inhibitor and / or a CTLA-4 inhibitor, in particular the other inhibitor being an antibody or antigen-binding fragment thereof.

20. Use of the anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 14, the polynucleotide according to claim 15, the vector according to claim 16, the cell according to claim 17, or the pharmaceutical composition according to claim 18 or 19 in the manufacture of a drug for treating a TIGIT-related disease, comprising: Preferably, the TIGIT-related disease is a T cell dysfunction disease, More preferably, the TIGIT-related disease is a tumor, an immune disease or an infectious disease, and in particular, the cells of the tumor are CD155 positive or PVR positive, and More preferably, the tumor is selected from the group consisting of melanoma, breast cancer, non-small cell lung cancer, colon adenocarcinoma, gastric cancer, acute myeloid leukemia and multiple myeloma.

21. A method for treating a TIGIT-related disease, comprising administering to a subject in need thereof an effective amount of an anti-TIGIT antibody or antigen-binding fragment thereof according to any one of claims 1 to 14, a polynucleotide according to claim 15, a vector according to claim 16, a cell according to claim 17, or a pharmaceutical composition according to claim 18 or 19, Preferably, the TIGIT-related disease is a T cell dysfunction disease, More preferably, the TIGIT-related disease is a tumor, an immune disease or an infectious disease, and in particular, the cells of the tumor are CD155 positive or PVR positive, and More preferably, said tumor is selected from the group consisting of melanoma, breast cancer, non-small cell lung cancer, colon adenocarcinoma, gastric cancer, acute myeloid leukemia and multiple myeloma.

Images