Exon skipping to treat Usher syndrome
Patent Information
- Application Number
- JP2024546064
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-02-04
- Filing Date
- 2023-02-03
- Publication Date
- 2026-02-12
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 306,833, filed February 4, 2022, the contents of which are incorporated herein by reference in their entirety.
[0002] Federally Sponsored Research or Development This invention was made with Government support under Grant Nos. DC016875 and TR002636 awarded by the National Institutes of Health. The Government has certain rights in this invention.
[0003] Compositions for use in treating subjects with USH2A-associated retinal degeneration and / or cochlear degeneration caused by mutations in exon 13 of the USH2A gene by deleting the exon 13 splicing acceptor sequence from the USH2A gene or transcript, as well as methods of use thereof, as well as genetically modified animals and cells. [Background technology]
[0004] Usher syndrome (USH) is the leading cause of inherited combined hearing-visual loss. Among patients with Usher syndrome, approximately two out of three suffer from Usher syndrome type II (USH2), of which more than 75% of cases are caused by mutations in the USH2A gene. Patients with USH2 exhibit moderate to severe hearing loss, postpubertal onset of retinitis pigmentosa (RP), and normal vestibular reflexes, and USH2 represents the most common form of inherited deaf-blindness, estimated to affect approximately 1 in 17,000 individuals. In particular, mutations in exon 13 account for approximately 35% of all USH2 cases, including a single base deletion at position 2299 (c.2299delG), which is the most common mutation accounting for approximately 24% of cases. Summary of the Invention
[0005] Provided herein is a nucleic acid comprising a sequence encoding a Cas9 protein, and a first gRNA and a second gRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244 provided in Table 1, and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431 provided in Table 2. The target sequence of the first gRNA is within 1000 base pairs (bp) 3' of intron 12, and the target sequence of the second gRNA is within exon 13; any combination of a first gRNA having a target sequence of any one of SEQ ID NOs: 2-244 and a second gRNA having a target sequence of any one of SEQ ID NOs: 245-431 can be used to delete a relevant DNA fragment from a genome. In some embodiments, the target sequence of the first gRNA is SEQ ID NO: 17, and the target sequence of the second gRNA is SEQ ID NO: 313. In some embodiments, the target sequence of the first gRNA is SEQ ID NO: 17, and the target sequence of the second gRNA is SEQ ID NO: 260. The paired gRNA-mediated deletions provided herein include portions of intron 12 and portions of exon 13, with deletion sizes ranging from 6 bp to several kilobase pairs (kb), all of which are capable of inducing human USH2A exon 13 skipping, with a preferred range of 6 kb to 2 kb using certain preferred combinations of gRNAs.
[0006] In some embodiments, the nucleic acid encodes S. pyogenes Cas9 or S. aureus Cas9 (optionally KKH SaCas9). In some embodiments, the Cas9 comprises a nuclear localization signal, e.g., a C-terminal nuclear localization signal and / or an N-terminal nuclear localization signal, and / or the sequence encoding the Cas9 comprises a polyadenylation signal.
[0007] In some embodiments, the gRNA is a unimolecular S. aureus or S. pyogenes gRNA, or a corresponding two-part modular S. aureus or S. pyogenes gRNA (see, e.g., WO 2018 / 026976).
[0008] In some embodiments, the nucleic acid comprises a viral delivery vector, preferably an adeno-associated viral (AAV) vector. In some embodiments, the viral delivery vector comprises a promoter for Cas9, preferably a CMV, EFS, U1A, or hGRKl promoter. In some embodiments, the nucleic acid comprises: (i) a first guide RNA comprising a targeting domain sequence selected from any one of SEQ ID NOs: 2 to 244, and a second guide RNA comprising a targeting domain sequence selected from any one of SEQ ID NOs: 245 to 431; (ii) a first and a second inverted terminal repeat (ITR); and (iii) a promoter for driving expression of Cas9 selected from the group consisting of CMV, EFS, U1A, or hGRKl promoters.
[0009] The nucleic acids described herein can be used, for example, in therapy or in the preparation of a medicament. For example, the nucleic acids can be used in a method of treating a subject having a condition associated with a mutation in exon 13 of the USH2A gene.
[0010] In some embodiments, the condition is Usher syndrome type 2 or autosomal recessive retinitis pigmentosa (arRP).
[0011] In some embodiments, the AAV vector is delivered to the subject's retina by injection, such as a subretinal injection, or delivered to the subject's inner ear by injection, for example through the round window.
[0012] Additionally provided herein are compositions comprising a first ribonucleoprotein (RNP) complex comprising a Cas9 protein and a first gRNA or sgRNA, and / or a second RNP complex comprising a Cas9 protein and a second gRNA or sgRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244, and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431. In some embodiments, the Cas9 is S. aureus Cas9, optionally, KKH SaCas9 (optionally, KKH SaCas9), or S. pyogenes Cas9.
[0013] Further provided is a method for deleting a sequence comprising exon 13 splice acceptor sequence from USH2A gene in a cell, said deletion containing a portion of intron 12 and a portion of exon 13, ranging from 6 bp to several kb, all of which deletions can induce USH2A exon 13 skipping, with an ideal range of less than 2 kb. The method comprises contacting the cell with a nucleic acid or composition as described herein.
[0014] Also provided herein is a method of genome editing in a human cell, comprising using CRISPR editing to create a first double-stranded break in intron 12 of the human USH2A gene and a second double-stranded break in exon 13 of the human USH2A gene, resulting in removal of a fragment of genomic DNA containing a portion of intron 12 and a portion of exon 13 of the USH2A gene on chromosome 1. In some embodiments, the first double-stranded break is generated using a gRNA having a target sequence of any one of SEQ ID NOs: 2-244, and the second double-stranded break is generated using a gRNA having a target sequence of any one of SEQ ID NOs: 245-431.
[0015] In some embodiments, the cell is in or derived from a subject having a mutation in the USH2A gene, hi some embodiments, the cell is a cell of the eye or inner ear of a mammal.
[0016] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art of the present invention. Methods and materials are described herein for use in the present invention; other suitable methods and materials known in the art can also be used. Materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0017] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. [Brief description of the drawings]
[0018] [Figure 1] FIG. 1 is a schematic diagram of the CRISPR / Cas9 splice acceptor targeting strategy to induce USH2A exon 13 skipping by a pair of gRNAs targeting the genomic DNA flanking the splice acceptor site. [Figure 2-1] 2A-I show that the splicing acceptor targeting strategy increases exon 12 (equivalent to human exon 13) skipping in-frame Ush2A transcripts in mouse cells. (a) Gel image showing the complete exon 12 deletion strategy in the genome using CRISPR / Cas9. Red asterisks indicate the deleted fragment. (b) Schematic diagram of the complete exon 12 deletion strategy. [Figure 2-2](A-I) Splice acceptor targeting strategy increases exon 12 (equivalent to human exon 13) skipping in-frame Ush2A transcripts in mouse cells. (c) Next generation sequencing (NGS) of edited genomic DNA confirms the deletion of exon 12. [Figure 2-3] 2A-I show that the splicing acceptor targeting strategy increases exon 12 (equivalent to human exon 13) skipping in-frame Ush2A transcripts in mouse cells. (d) Gel image showing the splicing acceptor targeting strategy to delete the Ush2A exon 12 splicing acceptor in HEI-OC1 cells. Asterisks indicate the deleted fragment. (e) Schematic of the splicing acceptor targeting strategy. [Figure 2-4] 2A-I show that the splice acceptor targeting strategy increases exon 12 (equivalent to human exon 13) skipping in-frame Ush2A transcripts in mouse cells. (f) NGS demonstrating genome editing efficiency of the complete exon 12 deletion and splice acceptor targeting deletion strategies. [Figure 2-5] 2A-I show that splicing acceptor targeting strategy increases exon 12 (equivalent to human exon 13) skipping in-frame Ush2A transcripts in mouse cells. (g) Quantification of genome editing efficiency of complete exon 12 deletion (sgL1+sgR1) and splicing acceptor targeting (sgL1+sgK4) deletion strategies. (h) Gel images showing different Ush2A transcripts with and without genome editing. (i) qPCR quantification of exon 12 non-skipped (top) and skipped (bottom) transcripts with and without genome editing. [Figure 3-1]3A-H show efficient genome editing at the USH2A exon 13 locus using a splice acceptor targeting strategy in human cells. (a) Schematic of the complete exon 13 deletion strategy shows the expected in-frame transcript with exon 13 skipped. (b) Gel image showing complete USH2A exon 13 deletion in the WERI-RB1 cell genome. Asterisks indicate the deleted fragment. (c) Pie chart showing the percentage of deletions and indels after genome editing using the complete USH2A exon 13 strategy. [Figure 3-2] 3A-H show efficient genome editing at the USH2A exon 13 locus using a splice acceptor targeting strategy in human cells. (d) Schematic of splice site-targeting splice acceptor targeting deletion strategy shows the expected in-frame transcript with exon 13 skipped. (e) Gel image showing fragment deletion using the splice acceptor targeting strategy in WERI-RB1 cells. Asterisks indicate the fragment after deletion. [Figure 3-3] 3A-H show efficient genome editing at USH2A exon 13 locus using splice acceptor targeting strategy in human cells. (f) Pie chart showing percentage of deletion and indel after genome editing using paired gRNA sgRNA-L1 (sgL1), sgRNA-K4 (sgK4). (g) Pie chart showing percentage of deletion and indel after genome editing using paired gRNA sgRNA-L1 (sgL1), sgRNA-K5 (sgK5). [Diagram 3-4] Figure 3A-H shows efficient genome editing at the USH2A exon 13 locus using a splice acceptor targeting strategy in human cells. (h) NGS of edited genomic DNA showing USH2A exon 13 splice acceptor deletion after genome editing with sgRNA-L1 and sgRNA-K5. [Figure 3-5] Figure 3A-H shows efficient genome editing at the USH2A exon 13 locus using a splice acceptor targeting strategy in human cells. (h) (continued) NGS of edited genomic DNA showing USH2A exon 13 splice acceptor deletion after genome editing with sgRNA-L1, sgRNA-K5. [Figure 4-1] 4A-I show that small deletions caused by splice acceptor targeting strategy result in robust generation of USH2A exon 13 skipping transcripts in human cells. (a) Schematic of exon 13 non-skipped (top) and skipped (bottom) transcripts of human USH2A. (b) Gel images showing exon skipping efficiency with and without genome editing. Red arrows indicate USH2A transcripts. (c) Representative Sanger sequencing data showing exon 13 skipping in USH2A transcripts after genome editing. [Figure 4-2] 4A-I show that small deletions caused by splice acceptor targeting strategies result in robust generation of USH2A exon 13 skipping transcripts in human cells. (d) Pie chart showing percentage of distinct USH2A transcripts in unedited cells. (e) Pie chart showing percentage of distinct USH2A transcripts in cells edited with paired gRNAs sgL1 and sgR2. (f) Pie chart showing percentage of distinct USH2A transcripts in cells edited with paired gRNAs sgL1 and sgK4. (g) Pie chart showing percentage of distinct USH2A transcripts in cells edited with paired gRNAs sgL1 and sgK5. This combination produces the highest percentage of exon 13 skipping USH2A transcripts in human cells (73%). [Figure 4-3](A-I) Small deletions caused by splice acceptor targeting strategies result in robust generation of USH2A exon 13 skipping transcripts in human cells. (h) NGS data generated from cDNA derived from human cells edited with paired gRNAs sgL1 and sgK4 showing the different USH2A transcripts generated by splice acceptor targeting genome editing. [Figure 4-4] 4A-I show that small deletions caused by splice acceptor targeting strategy result in robust generation of USH2A exon 13 skipping transcripts in human cells. (i) NGS data generated from cDNA derived from human cells edited with paired gRNAs sgL1 and sgK5 showing the different USH2A transcripts generated by splice acceptor targeting genome editing. [Figure 5-1] 5A-F show that splice acceptor targeting strategy induces USH2A exon 13 skipped transcripts in human induced pluripotent stem cells (hiPSCs) derived from USH2 patients with homozygous mutation c.2299delG. (a) Sequence information of USH2A mutation in hiPSCs derived from USH2 patients. (b) Gel images showing genome editing efficiency after editing of hiPSCs with different dosages of CRISPR / Cas9-sgL1 / sgK5 targeting splice acceptor sites. Arrows indicate edited fragments after deletion. [Figure 5-2]5A-F show that splicing acceptor targeting strategy induces USH2A exon 13 skipped transcripts in human induced pluripotent stem cells (hiPSCs) derived from a USH2 patient with homozygous mutation c.2299delG. (c) Pie chart showing percentage of deletions and indels after genome editing with CRISPR / Cas9-sgL1 / sgK5, which is 75% efficient for exon 13 skipping. (d) Schematic diagram of USH2A transcript activation using dCas9 / gRNA-directed synergistic activation mediator (SAM) system. [Figure 5-3] 5A-F show that splicing acceptor targeting strategy induces USH2A exon 13 skipped transcripts in human induced pluripotent stem cells (hiPSCs) derived from USH2 patients with homozygous mutation c.2299delG. (e) Gel image showing exon 13 skipping in edited hiPSCs derived from USH2 patients after SAM activation. (f) Pie chart showing the percentage of different USH2A transcripts in edited hiPSCs derived from USH2 patients after SAM activation. 71% of USH2A transcripts showed exon 13 skipping. [Figure 6] 6A-6B show efficient exon skipping in inner ear organoids generated from hiPSCs derived from USH2 patients. (a) Gel images show full-length USH2A transcripts in healthy controls and inner ear organoids generated from hiPSCs derived from USH2 patients. As indicated by arrows at day 50, exon 13 was skipped in the majority of transcripts after exon skipping. (b) Bar graphs showing quantification of the ratio of USH2A exon 13 skipped transcripts to full-length USH2A transcripts, showing more than 75% exon skipping mediated by sgRNA pair sgL1 / sgK5 in inner ear organoids generated from hiPSCs derived from USH2 patients. [Figure 7]7A-7B show that exon 5 skipping in the Ush2a gene causes hearing loss in mice. (a) Plots of auditory brainstem response (ABR) threshold shifts show that in a mouse model of Usher syndrome in which one Ush2a allele is normal but the other allele is disrupted, skipping exon 5 in the normal allele results in hearing loss. (b) Plots of distortion product otoacoustic emissions (DPOAE) threshold shifts show that in a mouse model of Usher syndrome in which one Ush2a allele is normal but the other allele is disrupted, skipping exon 5 in the normal allele results in hearing loss. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0019] Gene therapy of USH2 by AAV is largely hampered by the size of the USH2A cDNA (15,606 nucleotides), which exceeds the cargo capacity of AAV by a significant margin. Alternatively, skipping exon 13 in the USH2A transcript may be a promising treatment modality, with the resulting transcript encoding a slightly truncated, in-frame USHERIN protein that lacks some of the laminin EGF-like domain. The USHERIN protein translated from the exon 13-skipped transcript retains functionality, and therefore the exon 13 skipping strategy has therapeutic potential for any hearing loss caused by mutations in USH2A exon 13.
[0020] Robust exon skipping induced by exon 13 splicing acceptor deletion using CRISPR / dual sgRNA Deletion of the splicing acceptor can mediate exon 13 skipping in the USH2A transcript. The splicing acceptor can be deleted by gene editing with higher efficiency than deleting the entire exon 13. Cas9 and the dual sgRNA can be delivered to the patient's inner ear, for example, by an AAV vector or lipid nanoparticles.
[0021] Compared with other potential treatments for Usher syndrome, such as antisense oligonucleotide (AON)-based treatments, whose efficacy is difficult to assess and may require multiple treatments throughout the subject's life, the compositions and methods disclosed herein provide a one-time treatment involving an exon 13 skipping strategy that may be durable for the entire lifespan of the patient.In addition, the present disclosure provides evidence of robust induction of specific targeted exon skipping, which can be developed into gene editing treatments for diseases involving other splicing mutations.
[0022] The specific combination of gRNAs mediates the efficient removal of USH2A exon 13 in multiple human cell lines, such as WERI-RB1 cells, and human induced pluripotent stem cells (hiPSCs) derived from Usher syndrome patients. Exon 13 removal results in the efficient production of USH2A in-frame transcripts that exclude exon 13, which transcripts have been shown to be functional and promote hearing and vision rescue in mouse models. The inventors have also generated human inner ear organoids from hiPSCs derived from Usher syndrome patients and healthy control individuals.
[0023] The USHERIN protein, encoded by USH2A (GenBank Accession No. NC_000001.11, Reference GRCh38.p7 Primary Assembly, Range 215622894-216423396, complement; SEQ ID NO: 1), is a transmembrane protein anchored to the plasma membrane of photoreceptor cells (van Wijk, E., et al., Am J Hum Genet, 2004. 74(4): p. 738-44;Grati, M., et al., J Neurosci, 2012. 32(41): p. 14288-93). Its extracellular part, which accounts for more than 96% of the protein length and projects into the interciliary matrix, is thought to have important structural and potential signaling roles for the long-term maintenance of photoreceptor cells (van Wijk, E., et al., Am J Hum Genet, 2004. 74(4): p. 738-44;Grati, M., et al., J Neurosci, 2012. 32(41): p. 14288-93). Two isoforms of USH2A have been described. Isoform b (GenBank accession numbers NM_206933.2 (transcript) and NP_996816.2 (protein)) is the most abundantly expressed in the retina and is used as the reference standard sequence in the literature and in this application.
[0024] Treatment Method CRISPR / Cas-based exon skipping has been successfully used to restore functional dystrophin expression and dystrophic muscle function in a Duchenne muscular dystrophy mouse model. The methods described herein include methods for the treatment of disorders associated with mutations in exon 13 of the USH2A gene.
[0025] In some embodiments, the disorder is Usher syndrome, e.g., Usher syndrome type 2. Subjects with Usher syndrome type 2 (USH2) typically have moderate to severe hearing loss at birth and vision that progressively deteriorates beginning in adolescence. In some embodiments, the disorder is autosomal recessive retinitis pigmentosa (arRP). In general, the method comprises administering a therapeutically effective amount of a genome editing system as described herein to a subject in need of, or determined to be in need of, such treatment. The term "genome editing system" refers to any system that has RNA-guided DNA editing activity. The genome editing system of the present disclosure comprises at least two components adapted from the naturally occurring CRISPR system: a gRNA and an RNA-guided nuclease. These two components form a complex that associates with a specific nucleic acid sequence in a cell and is capable of editing DNA within or around that nucleic acid sequence, for example, by generating one or more of a single-strand break (SSB or nick), a double-strand break (DSB), and / or a base substitution. For a complete description of exemplary genome editing systems, see, e.g., WO 2018 / 026976.
[0026] As used in this context, "treating" refers to alleviating at least one symptom of the disorder associated with a mutation in exon 13 of the USH2A gene. Often, these mutations result in hearing loss and / or vision loss; thus, treatment including administration of a therapeutic gene editing system as described herein can result in a reduction in hearing loss and / or vision loss; a reduction in the rate of progression of hearing loss and / or vision loss; and / or restoration or approach to normal hearing and / or vision. Hearing and vision can be tested using known methods, such as electroretinogram, optical coherence tomography, video nystagmus recording, and hearing tests.
[0027] The method can be used to treat any subject (e.g., a mammalian subject, preferably a human subject) that has a mutation in exon 13 of the USH2A gene, such as the c.2299delG mutation or the c.2276G>T mutation in one or both alleles of USH2A. As used herein, an "allele" is one of a pair or series of genetic variants of a polymorphism (also called a mutation) at a particular genomic location. As used herein, a "genotype" refers to a diploid combination of alleles for a given genetic polymorphism. A homozygous subject has two copies of the same allele, and a heterozygous subject has two different alleles. Methods for identifying subjects with such mutations are known in the art; see, for example, Yan et al., J Hum Genet. 2009 Dec; 54(12): 732-738; Leroy et al., Exp Eye Res. 2001 May; 72(5): 503-9; or Consugar et al., Genet Med. 2015 Apr; 17(4): 253-261. For example, gel electrophoresis, capillary electrophoresis, size exclusion chromatography, sequencing, and / or arrays can be used to detect the presence or absence of alleles or genotypes. If desired, amplification of nucleic acid can be achieved using methods known in the art, such as PCR. In one example, a sample (e.g., a sample containing genomic DNA) is obtained from a subject. The DNA in the sample is then examined to identify or detect the presence of alleles or genotypes as described herein. Allele or genotype can be identified or determined by any method described herein, for example, Sanger sequencing or next generation sequencing (NGS).Since the size of exon 13 is 643bp, genotype identification of patients with exon 13 mutation is simple and straightforward using Sanger sequencing or NGS.Other methods can include hybridization of genes in genomic DNA, RNA, or cDNA to nucleic acid probes, for example, DNA probes (including cDNA and oligonucleotide probes) or RNA probes.Nucleic acid probes can be designed to specifically or preferentially hybridize to particular mutations (also called polymorphic variants).
[0028] Other methods of nucleic acid analysis include direct manual sequencing (Church and Gilbert, Proc. Natl. Acad. Sci. USA 81:1991-1995 (1988); Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977); Beavis et al., U.S. Pat. No. 5,288,644); automated fluorescent sequencing; single-stranded conformation polymorphism assays (SSCP) (Schafer et al., Nat. Biotechnol. 15:33-39 (1995)); clamped denaturing gel electrophoresis (CDGE); two-dimensional gel electrophoresis (2DGE or TDGE); conformation sensitive gel electrophoresis (CSGE); denaturing gradient gel electrophoresis (DGGE) (Sheffield et al., Proc. Natl. Acad. Sci. USA 86:232-236 (1989)); denaturing high performance liquid chromatography (DHPLC, Underhill et al., Genome Res. 7:996-1005 (1997)); infrared matrix-assisted laser desorption / ionization (IR-MALDI) mass spectrometry (WO 99 / 57318); mobility shift analysis (Orita et al., Proc. Natl. Acad. Sci. USA 86:2766-2770 (1989)); restriction enzyme analysis (Flavell et al., Cell 15:25 (1978);Geever et al., Proc. Natl. Acad. Sci. USA 78:5081 (1981)); quantitative real-time PCR (Raca et al., Genet Test 8(4):387-94 (2004)); heteroduplex analysis; chemical mismatch cleavage (CMC) (Cotton et al., Proc. Natl. Acad. Sci. USA 85:4397-4401 (1985)); ribonuclease protection assays (Myers et al., Science 230:1242 (1985)); the use of polypeptides that recognize nucleotide mismatches, such as the E. coli mutS protein; allele-specific PCR, and combinations of such methods. See, e.g., Gerber et al., U.S. Patent Application Publication No. 2004 / 0014095, incorporated herein by reference in its entirety.
[0029] In certain embodiments, the present disclosure provides an AAV vector encoding a CRISPR / Cas9 genome editing system comprising a first gRNA and a second gRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244 provided in Table 1, and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431 provided in Table 2, and uses of such vectors to treat USH2A-associated diseases. Exemplary AAV vector genomes are known in the art, see, for example, Figure 9 of PCT / US2019 / 023934, which shows certain fixed and variable elements of these vectors: inverted terminal repeats (ITRs), one or two gRNA sequences and promoter sequences for driving their expression, a Cas9 coding sequence and another promoter for driving its expression. Each of these elements is discussed in detail herein. Although a single vector can be used to deliver Cas9 and the two gRNAs, in some embodiments, multiple vectors are used, where one vector is used to deliver Cas9 and another vector is used to deliver one or more gRNAs (e.g., one vector for one gRNA, one vector for two gRNAs, or two vectors for each of two gRNAs).
[0030] RNA-guided nuclease / Cas9 For example, various RNA-guided nucleases, such as those described in WO 2018 / 026976, can be used in this method. This approach can use different CRISPR proteins and their corresponding gRNAs, including Streptococcus pyogenes Cas9 (SpCas9) and engineered SpCas9 variants, Staphylococcus aureus Cas9 (SaCas9), KKH variant SaCas9 (Kleinstiver et al., Nat Biotechnol. 2015 Dec; 33(12): 1293-1298; see WO 2016 / 141224), Cpf1 (also known as Cas12a, e.g., AsCpf1, LPCpf1), Cas12f (e.g., Un1Cas12f1, AsCas12f1), etc. In some embodiments, the RNA-guided nuclease used in the methods and compositions is S. aureus Cas9 or S. pyogenes Cas9. In some embodiments of this disclosure, the Cas9 sequence is modified to include two nuclear localization sequences (NLSs) (e.g., PKKKRKV (SEQ ID NO: 432)) at the C-terminus and N-terminus of the Cas9 protein, as well as a mini-polyadenylation signal (or polyA sequence). Exemplary NLSs are the SV40 large T antigen NLS (PKKKRRV (SEQ ID NO: 433)) and the nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO: 434)). Other NLSs are known in the art; see, e.g., Cokol et al., EMBO Rep. 2000 Nov 15; 1(5):411-415; Freitas and Cunha, Curr Genomics. 2009 Dec; 10(8): 550-557. An exemplary polyadenylation signal is TAGCAATAAAGGATCGTTTATTTTCATTGGAAGCGTGTGTTGGTTTTTTGATCAGGCGCG (SEQ ID NO: 435).Exemplary S. aureus Cas9 sequences (both nucleotide and peptide) are set forth in Table 4 of WO 2018 / 026976, e.g., SEQ ID NOs: 10 and 11 therein.
[0031] Guide RNA In some embodiments, the gRNAs used in this disclosure can be unimolecular or modular, as described below.
[0032] Described herein is an approach for treating subjects with mutations in exon 13 of USH2A that uses dual gRNAs for deletion of exon 13. Two gRNAs (sgRNA-L and sgRNA-R, one with a target sequence in intron 12 and one with a target sequence in intron 13) are used in combination to delete a small DNA fragment containing the exon 13 splicing acceptor. sgRNA-L has a target sequence in intron 12 and sgRNA-R has a target sequence in exon 13. Tables 1 and 2 provide exemplary sequences for target sequences of sgRNAs targeting intron 12 (sgRNA-L) and exon 13 (sgRNA-R), respectively. The sgRNA targets are within 1000 bp 3' of intron 12 (SEQ ID NOs: 2-244) and exon 13 (SEQ ID NOs: 245-431). Note that in the sequences provided herein, the actual sgRNAs have U's instead of T's.
[0033] In some embodiments of these methods, any combination of a first gRNA having a target sequence of any one of SEQ ID NOs: 2-244 and a second gRNA having a target sequence of any one of SEQ ID NOs: 245-431 can be used to delete a particular DNA fragment from the genome, although certain combinations as exemplified below may be more preferred.
[0034] In some embodiments, the compositions and methods disclosed herein use Staphylococcus aureus Cas9 (SaCas9) and corresponding gRNA. SaCas9 is one of several smaller Cas9 orthologs that are suitable for viral delivery (Horvath et al., J Bacteriol 190, 1401-1412 (2008); Ran et al., Nature 520, 186-191 (2015); Zhang et al., Mol Cell 50, 488-503 (2013)). Its wild type recognizes the longer NNGRRT PAM, which is predicted to occur once every 32 bp of random DNA; or the alternative NNGRRA PAM. Tables 1 and 2 provide exemplary sequences for target sites in exons 12 and 13, respectively. Note that the "target site" sequences provided herein are those of the gRNA (but the gRNA has U instead of T).
[0035] [Table 1-1]
[0036] [Table 1-2]
[0037] [Table 1-3]
[0038] [Table 1-4]
[0039] [Table 1-5]
[0040] [Table 1-6]
[0041]
Table 2-1
[0042]
Table 2-2
[0043]
Table 2-3
[0044]
Table 2-4
[0045]
Table 2-5
[0046] AAV delivery system The method comprises the delivery of the CRISPR / Cas9 genome editing system comprising Cas9 nuclease and one or two guide RNAs to a subject in need thereof.The delivery method can include, for example, viral delivery, preferably using an adeno-associated virus (AAV) vector encoding Cas9 and one or more guide RNAs.AAV is a naturally occurring defective virus that requires another virus, such as adenovirus or herpesvirus, as a helper virus for efficient replication and productive life cycle (for review, see Muzyczka et al., Curr. Topics in Micro and Immunol.158:97-129 (1992)).AAV vectors can efficiently transduce various cell types and produce long-term expression of transgenes in vivo. AAV vectors have been widely used for gene augmentation or replacement and have shown therapeutic effects in various animal models as well as in the clinic; see, e.g., Mingozzi and High, Nature Reviews Genetics 12, 341-355 (2011); Deyle and Russell, Curr Opin Mol Ther. 2009 Aug; 11(4): 442-447; Asokan et al., Mol Ther. 2012 April; 20(4): 699-708. AAV vectors as small as 300 base pairs of AAV can be packaged and produce recombinant protein expression. For example, AAV2, AAV5, AAV2 / 5, AAV2 / 8, and AAV2 / 7 vectors have been used to introduce DNA into photoreceptor cells (see, e.g., Pang et al., Vision Research 2008, 48(3):377-385; Khani et al., Invest Ophthalmol Vis Sci. 2007 Sep;48(9):3954-61; Allocca et al., J. Virol. 2007 81(20):11372-11380).In some embodiments, the AAV vector may comprise an AAV capsid polypeptide (or a sequence encoding same) described in PCT / US2014 / 060163; for example, a viral particle comprising an AAV capsid polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 of PCT / US2014 / 060163, and a Cas9 sequence and a guide RNA sequence as described herein. In some embodiments, the AAV capsid polypeptide is an Anc80 polypeptide, e.g., Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc80L33; Anc80L36; or Anc80L44. In some embodiments, the AAV incorporates an inverted terminal repeat (ITR) derived from the AAV2 serotype. Exemplary left and right ITRs are provided in Table 6 of WO 2018 / 026976. However, it should be noted that many modified versions of AAV2 ITRs are used in the art, and the ITR sequences shown below are exemplary and are not intended to be limiting. Modifications of these sequences are known in the art or would be apparent to one of skill in the art, and are therefore included within the scope of this disclosure.
[0047] Cas9 expression can be driven by promoters known in the art. In some embodiments, expression is driven by one of three promoters: cytomegalovirus (CMV), elongation factor-1 (EFS), or human G protein-coupled receptor kinase-1 (hGRKl) promoters, which are specifically expressed in retinal photoreceptor cells. The nucleotide sequences for each of these promoters are provided in Table 5 of WO 2018 / 026976. Modifications of these sequences may be possible or desirable in certain applications, and such modifications are within the scope of this disclosure.
[0048] Expression of the gRNA in the AAV vector is driven by a promoter known in the art. In some embodiments, a polymerase III promoter, such as the human U6 promoter. An exemplary U6 promoter sequence is shown below:
[0049] [ka]
[0050] In some embodiments, the nucleic acid or AAV vector shares at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity with one of the nucleic acids or AAV vectors listed above.
[0051] The AAV genomes described above can be packaged into AAV capsids (e.g., AAV5 capsids), and the capsids can be included in compositions (e.g., pharmaceutical compositions) and / or administered to a subject. Exemplary pharmaceutical compositions comprising AAV capsids according to this disclosure can include balanced salt solution (BSS) and one or more detergents (e.g., Tween 20) and / or a pharma- ceutically acceptable carrier, such as a temperature-sensitive or inverse temperature-sensitive polymer (e.g., Pluronic). Other pharmaceutical formulation elements known in the art can also be suitable for use in the compositions described herein.
[0052] A composition comprising an AAV vector according to this disclosure can be administered to a subject by any suitable means, including but not limited to injection, for example, subretinal injection or injection through the round window. The concentration of the AAV vector in the composition is selected to ensure that a sufficient AAV dose is administered to the retina or inner ear of the subject, taking into account, among other things, the dead volume in the injection device and the relative limiting volume that can be safely administered. Suitable doses include, for example, 1×10 11 viral genomes (vg) / mL, 2 x 10 11 viral genomes (vg) / mL, 3×10 11viral genomes (vg) / mL, 4 x 10 11 viral genomes (vg) / mL, 5×10 11 viral genomes (vg) / mL, 6 x 10 11 viral genomes (vg) / mL, 7 x 10 11 viral genomes (vg) / mL, 8×10 11 viral genomes (vg) / mL, 9 x 10 11 viral genomes (vg) / mL, 1 x 10 12 vg / mL, 2×l0 12 viral genomes (vg) / mL, 3×10 12 viral genomes (vg) / mL, 4×10 12 viral genomes (vg) / mL, 5×10 12 viral genomes (vg) / mL, 6×10 12 viral genomes (vg) / mL, 7×10 12 viral genomes (vg) / mL, 8×10 12 viral genomes (vg) / mL, 9×10 12 viral genomes (vg) / mL, l x 10 13 vg / mL, 2×l0 13 viral genomes (vg) / mL, 3×10 13 viral genomes (vg) / mL, 4×10 13 viral genomes (vg) / mL, 5×10 13 viral genomes (vg) / mL, 6×10 13 viral genomes (vg) / mL, 7×10 13 viral genomes (vg) / mL, 8×10 13 viral genomes (vg) / mL, or 9 x 10 13 The composition may include 10 ...
[0053] While any region of the retina may be targeted, the fovea (extending approximately 1 degree outward from the center of the eye) may be preferred in some cases due to its role in central vision and the relatively high concentration of cone photoreceptor cells relative to peripheral regions of the retina. Alternatively or additionally, injections may be targeted to the parafoveal region (extending approximately between 2 degrees and 10 degrees from the center), which is characterized by the presence of all three types of retinal photoreceptor cells. In addition, injections into the parafoveal region may be made at a relatively sharp angle with a needle path that crosses the midline of the retina. By way of example, the injection path may extend from the nasal side of the sclera near the limbus through the vitreous chamber to the temporal parafoveal retina, from the temporal surface of the sclera to the nasal parafoveal retina, from a portion of the sclera superior to the cornea to an inferior parafoveal location, and / or from a lower portion of the sclera to a superior parafoveal location. The use of a relatively small angle of injection relative to the retinal surface may advantageously reduce or limit the likelihood of vector spillover from the bleb into the vitreous, resulting in reduced loss of vector during delivery. In other cases, the macula (including the fovea) may be targeted, and in other cases, additional retinal regions may be targeted or receive a spillover dose.
[0054] For delivery to the inner ear, injection into the cochlear duct, which is filled with potassium-rich endolymphatic fluid, can provide direct access to hair cells. However, changes to this delicate fluid environment can disrupt the endocochlear potential and increase the risk of injection-related toxicity. The perilymph-filled spaces surrounding the cochlear duct, scala tympani, and scala vestibuli can be accessed from the middle ear through either the oval window membrane or the round window membrane (RWM). The RWM is the only non-bony opening to the inner ear and is relatively easily accessible in many animal models, and administration of viral vectors using this route is well tolerated. Administration through the oval window or across the tympanic membrane can also be used. See, for example, WO2017100791 and US7206639.
[0055] For preclinical development purposes, the systems, compositions, nucleotides, and vectors according to this disclosure can be evaluated ex vivo using human retinal explant systems, or in vivo using animal models such as mice, rabbits, pigs, and non-human primates.The retinal explants can be optionally maintained on a support matrix, and the AAV vectors can be delivered by injection into the space between the photoreceptor cell layer and the support matrix to mimic subretinal injection.Tissues for retinal explants can be obtained from human or animal subjects, such as mice.
[0056] Explants are particularly useful for studying the expression of gRNA and / or Cas9 after viral transduction, as well as for studying genome editing over a relatively short interval. These models also allow for higher throughput than may be possible in animal models, and can predict expression and genome editing in animal models and subjects. Small animal models (mouse, rat) and large animal models (rabbit, pig, non-human primate, etc.) can be used for pharmacological and / or toxicological studies, and to test the systems, nucleotides, vectors, and compositions of this disclosure under conditions and volumes that are closer to those used in the clinic. Model systems are selected to reproduce relevant aspects of human anatomy and / or physiology, and data obtained in these systems will generally (although not necessarily) predict the behavior of AAV vectors and compositions according to this disclosure in human and animal subjects. EXAMPLES
[0057] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[0058] [Example 1] Efficient deletion of mouse Ush2A exon 12 splicing acceptor using paired gRNAs in mouse cells Mouse organ of Corti HEI-OC1 cells were used as an in vitro cell line model to test the methods disclosed herein. HEI-OC1 cells are derived from mouse cochlea (Kalinec et al. (1999) Cell biology international 23(3):175-184; Kelley et al. (1993) Development 119(4):1041-1053). HEI-OC1 cells express USHERIN, therefore these cells are particularly suitable for these studies.
[0059] CRISPR / Cas9 genome editing technology was used to induce mouse exon 12 or human exon 13 skipping in Ush2a / USH2A transcripts. LONZA 4D-Nucleofector™ was used to deliver Cas9 / sgRNA protein complexes to cells. The transfection program was optimized according to the manufacturer's instructions (DS120, SG Cell Line 4D-Nucleofector™X Kit). Purified sgRNA was incubated with Cas9 protein for 5 minutes before transfection. Approximately 16 hours after nucleofection, the medium was changed, and approximately 96 hours later, cells were harvested for subsequent genomic DNA extraction.
[0060] These results demonstrate that using CRISPR / Cas9 with paired sgRNAs, one targeting intron 11 and one targeting intron 12, can delete the complete exon 12 from the mouse genome in HEI-OC1 cells. We screened different paired sgRNAs and identified one paired sgRNA, sgL1 / sgR1, which had a 23.4% deletion efficiency (Figure 2A-C). We then redesigned the genome editing strategy to target the exon 12 splicing acceptor as the deletion, which we called the acceptor-targeting paired sgRNA strategy (Figure 2E). The acceptor-targeting paired sgRNA strategy increased the genome editing efficiency, and the sgRNA pair, sgL1 and sgK4, showed an editing efficiency higher than 60% (Figure 2D, 2F, 2G). RT-PCR analysis of Ush2A transcripts showed that exon 12 skipping in-frame transcripts were increased in OC1 cells after genome editing (Figure 2H, 2I). Exon 12 skipping was also observed in unedited HEI-OC1 cells, in contrast to human cells, as spontaneous exon skipping was not observed in human cells. These results demonstrate that the acceptor-targeting paired sgRNA strategy efficiently induces exon 12 skipping in mouse HEI-OC1 cells.
[0061] [Example 2] Efficient targeting of the USH2A exon 13 locus using a splice acceptor targeting strategy in human cells To evaluate the acceptor-targeting paired sgRNA strategy in human cells, a human retinoblastoma-derived cell line (WERI-RB1) was used because WERI-RB1 cells express USHERIN. Multiple paired sgRNA combinations were screened to test the deletion efficiency in human USH2A exon 13, with each pair of sgRNAs containing one sgRNA targeting human USH2A intron 12 and the other targeting exon 13 (Figure 1). Removal of the exon 13 splicing acceptor by the paired sgRNA should abolish the recognition of the remaining exon 13 as an exon, resulting in the production of a USH2A transcript with exon 13 skipped (Figure 3D). SpCas9 protein and paired sgRNA were combined to form RNPs and delivered into cells by nucleofection. After 48 hours, genomic DNA was extracted from the cells. Next, PCR and next-generation sequencing (NGS) were performed to evaluate the deletion efficiency at the USH2A locus. NGS analysis showed that the acceptor-targeting paired sgRNA strategy resulted in a deletion efficiency of 69% for the sgL1 / sgK4 pair (having target sequences corresponding to SEQ ID NO: 17 and SEQ ID NO: 313, respectively) and 84% for the sgL1 / sgK5 pair (having target sequences corresponding to SEQ ID NO: 17 and SEQ ID NO: 260, respectively) (Figure 3E-H). In contrast, the complete exon 13 deletion strategy only reached an efficiency of about 25% in exon 13 skipping (Figure 3A-C).
[0062] The percentage of in-frame exon 13 skipping in the USH2A transcript was assessed after genome editing using RT-PCR. Two pairs of primers were designed to detect the wild-type USH2A transcript (E12-E13-E14) and the exon 13 skipping transcript (E12-E14) (Figure 4A). 96 hours after nucleofection, total RNA was amplified using the miRNeasy Mini Kit (QIAGEN, 217004) at approximately 10 6The cDNA was extracted from 1000 cells. First-strand cDNA was then generated using the PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara) with random hexamers according to the manufacturer's instructions. PCR was performed, and the results showed that sgL1 / sgK5 produced the highest exon 13 skipping induction efficiency (Figure 4B). Sanger sequencing of shorter fragments from DNA gel confirmed in-frame exon 13 skipping. To analyze the different types of USH2A transcripts generated by genome editing, NGS was performed on cDNA reverse transcribed from USH2A transcripts. The results showed that the sgL1 / sgK5 combination produced the highest efficiency of exon 13-skipped in-frame USH2A transcripts: 73% of the total USH2A transcripts were exon 13-skipped in-frame transcripts (Figures 4D-G). NGS reads of sgL1 / sgK4 and sgL1 / sgK5 are shown in Figure 4H, 4I. These data demonstrate that the acceptor-targeting paired sgRNA strategy mediates USH2A exon 13 skipping and produces in-frame USH2A transcripts in human cells.
[0063] [Example 3] Efficient induction of USH2A exon 13 skipped in-frame transcripts from USH2A patient-derived hiPSCs To test the acceptor-targeting paired sgRNA strategy in human cells with USH2A exon 13 mutation, human induced pluripotent stem cells (hiPSCs) derived from a female USH2 patient were obtained. The cells had a homozygous c.2299delG mutation (Figure 5A). The c.2299delG mutation is located in human USH2A exon 13 and is the most frequent pathogenic mutation observed in Usher syndrome patients. USH2A exon 13 skipping was induced in c.2299delG hiPSCs using sgL1 / sgK5 sgRNA. Several Cas9 / sgL1 / sgK5 RNP dosages were tested using nucleofection, and the results showed a dose-dependent deletion efficiency, with the highest efficiency obtained at dosages above 1000 nM (Figure 5B). NGS analysis of genomic DNA extracted from edited hiPSCs showed that 75% of the reads contained the skipped exon 13 (Figure 5C).
[0064] Because USH2A is not expressed in hiPSCs, to analyze the USH2A transcript after editing, USH2A expression was activated in hiPSCs using the synergistic activation mediator (SAM) system (Figure 5D). PB-SAM donor plasmid (addgene, 102559) together with sgRNA to activate USH2A expression was co-transfected with PiggyBac transposon vector (PB210PA, System Biosciences) in c.2299delG hiPSCs after genome editing with Cas9 / sgL1 / sgK5 RNP. Cells were cultured and selected in growth medium containing 10 μg / mL blasticidin. Total mRNA was isolated and reverse transcribed into cDNA, and NGS and RT-PCR were performed to analyze the expressed USH2A transcript with exon 13 skipped. Gel imaging showed that 1000 nM RNP delivery of the sgRNA pair, sgL1 / sgK5, induced efficient USH2A exon 13 skipping (Figure 5E), and NGS demonstrated that 73% of all USH2A transcripts contained in-frame skipping of exon 13. Taken together, these data demonstrate that the acceptor-targeting paired sgRNA strategy using Cas9 / sgL1 / sgK5 RNP shows therapeutic potential for treating diseases associated with USH2A exon 13 mutations by efficiently inducing in-frame exon 13 skipping.
[0065] [Example 4] Efficient exon skipping in human USH2A patient inner ear organoids Wild-type hiPSCs, USH2A delG / delG hiPSCs and genome-edited USH2A delG / delG The hiPSCs were differentiated into inner ear organoids, which model human cochlear development in vivo. Differentiation of each of the three types of hiPSCs generated hair cell-containing inner ear organoids. At day 50, organoid samples were collected and total mRNA was extracted and reverse transcribed into cDNA. RT-PCR performed on the cDNA identified wild-type hiPSCs and USH2AdelG / delG We demonstrated that only full-length USH2A transcripts containing exons 12, 13, and 14 were detected in organoids generated from hiPSCs. In contrast, efficient exon 13 skipping was detected in organoids generated from hiPSCs edited with Cas9 / sgL1 / sgK5 RNPs, as shown by the gel image in Figure 6A. As shown in Figure 6B, exon 13-skipped transcripts accounted for more than 75% of the USH2A transcripts detected in organoids generated from hiPSCs edited with Cas9 / sgL1 / sgK5 RNPs.
[0066] [Example 5] Exon 5 skipping in the Ush2a gene causes hearing loss Using a paired sgRNA genome editing strategy, we designed an AAV vector targeting Ush2a exon 5 and exon 12 (equivalent to human USH2A exon 13) in the mouse genome. The AAV vector was then inserted into a mouse model of a heterozygous Ush2a mutation (Ush2a + / - ) to a mouse model of Usher syndrome. Hearing tests demonstrated that exon 5 skipping could result in hearing loss in the mouse model, but exon 12 skipping could not. This study showed that exon 5, but not exon 12, is required for functional USHERIN protein in normal hearing in the Usher syndrome mouse model.
[0067] Other embodiments While the present invention has been described in conjunction with its detailed description, it is to be understood that the foregoing description is intended to illustrate, and not to limit, the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. A nucleic acid comprising a sequence encoding a Cas9 protein, and a first gRNA and a second gRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244 and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431.
2. 2. The nucleic acid of claim 1, wherein the target sequence of the first gRNA is SEQ ID NO: 17 and the target sequence of the second gRNA is SEQ ID NO:
313.
3. 2. The nucleic acid of claim 1, wherein the target sequence of the first gRNA is SEQ ID NO: 17 and the target sequence of the second gRNA is SEQ ID NO:
260.
4. 2. The nucleic acid of claim 1, encoding S. pyogenes Cas9 or S. aureus Cas9, optionally KKH SaCas9.
5. 5. The nucleic acid of claim 4, wherein the Cas9 comprises a nuclear localization signal, e.g., a C-terminal nuclear localization signal and / or an N-terminal nuclear localization signal, and / or the sequence encoding the Cas9 comprises a polyadenylation signal.
6. 2. The nucleic acid of claim 1, wherein the gRNA is a unimolecular S. pyogenes or S. aureus gRNA or a corresponding bipartite modular S. pyogenes or S. aureus gRNA.
7. The nucleic acid of claim 1 , comprising a viral delivery vector, preferably an adeno-associated virus (AAV) vector.
8. 8. The nucleic acid of claim 7, wherein the viral delivery vector comprises a promoter for Cas9, preferably a CMV, EFS, U1A, or hGRKl promoter.
9. 9. The nucleic acid of claim 8, comprising: (i) a first guide RNA comprising a targeting domain sequence selected from any one of SEQ ID NOs: 2-244, and a second guide RNA comprising a targeting domain sequence selected from any one of SEQ ID NOs: 245-431; (ii) a first and a second terminal inverted repeat (ITR); and (iii) a promoter for driving expression of Cas9 selected from the group consisting of CMV, EFS, U1A, or hGRK1 promoter.
10. A nucleic acid according to any one of claims 1 to 9 for use in therapy.
11. A nucleic acid according to any one of claims 1 to 9 for use in the preparation of a medicament.
12. 10. A nucleic acid according to any one of claims 1 to 9 for use in a method of treating a subject having a condition associated with a mutation in exon 13 of the USH2A gene.
13. 13. The nucleic acid for use according to claim 12, wherein the condition is Usher syndrome type 2 or autosomal recessive retinitis pigmentosa (arRP).
14. 13. The nucleic acid for use of claim 12, wherein the AAV vector is delivered to the subject's retina by injection, such as a subretinal injection, or to the subject's inner ear by injection, for example through the round window.
15. 1. A composition comprising a first ribonucleoprotein (RNP) complex comprising a Cas9 protein and a first gRNA, and / or a second RNP complex comprising a Cas9 protein and a second gRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244 and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431.
16. 16. The composition of claim 15, wherein the target sequence of the first gRNA is SEQ ID NO: 17 and the target sequence of the second gRNA is SEQ ID NO:
313.
17. 16. The composition of claim 15, wherein the target sequence of the first gRNA is SEQ ID NO: 17 and the target sequence of the second gRNA is SEQ ID NO:
260.
18. 16. The composition of claim 15, wherein the Cas9 is S. pyogenes Cas9 or S. aureus Cas9, optionally KKH SaCas9.
19. 19. A method for deleting a sequence comprising an exon 13 splicing acceptor sequence from a USH2A gene in a cell, wherein the deletion comprises a portion of intron 12 and a portion of exon 13 ranging from 6 bp to 2 KB, and wherein the deletion induces human USH2A exon 13 skipping, the method comprising the step of contacting the cell with a nucleic acid described in any one of claims 1 to 9 or a composition described in any one of claims 15 to 18.
20. 1. A method of genome editing in a human cell, comprising the step of using CRISPR editing to create a first double-stranded break within intron 12 of the human USH2A gene and a second double-stranded break within exon 13 of the human USH2A gene, resulting in the removal of a fragment of genomic DNA containing part of intron 12 and part of exon 13 of the USH2A gene on chromosome 1.
21. 21. The method of claim 20, wherein the first double-stranded break is generated using a first gRNA having a target sequence of any one of SEQ ID NOs: 2-244, and the second double-stranded break is generated using a second gRNA having a target sequence of any one of SEQ ID NOs: 245-431.
22. 22. The method of Claim 21, wherein the target sequence of the first gRNA is SEQ ID NO: 17 and the target sequence of the second gRNA is SEQ ID NO:
313.
23. 22. The method of Claim 21, wherein the target sequence of the first gRNA is SEQ ID NO: 17 and the target sequence of the second gRNA is SEQ ID NO:
260.
24. 20. The method of claim 19, wherein the cell is in or derived from a subject having a mutation in the USH2A gene.
25. 20. The method of claim 19, wherein the cell is a mammalian eye or inner ear cell.