Method for preparation of loop-forked libraries

JP2025508229A5Pending Publication Date: 2026-03-25ILLUMINA INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2023-03-15
Publication Date
2026-03-25

AI Technical Summary

Technical Problem

The prior art is difficult to effectively solve the problem of double-stranded DNA molecules in double-stranded DNA molecules, especially in terms of compatibility with sequencing technologies.

Method used

The aptamer structures containing restriction sites are formed by attaching the aptamer to different endpoints of the double-stranded DNA, thereby cleaving and expanding during sequencing to achieve double-stranded serialization.

Benefits of technology

It improves the sequencing accuracy and efficiency of double-stranded DNA, enhances compatibility with sequencing technology, and performs excellently in sequence error correction.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present invention relates to methods and kits for use in nucleic acid sequencing, particularly methods for use in simultaneous sequencing, especially simultaneous sequencing of tandem insert libraries.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to methods and kits for use in nucleic acid sequencing, particularly methods for use in simultaneous sequencing, especially simultaneous sequencing of tandem insert libraries. [Background technology]

[0002] It is generally expected that complementary sequences of a double-stranded DNA molecule should carry identical information, and therefore sequencing one strand of the molecule should be sufficient to determine the sequence. However, in practice, this concept is not accurate. The most common case in which the symmetry of information between complementary strands can be broken is due to DNA damage. Different bases of DNA have different sensitivities to different forms of damage. For example, G is highly sensitive to oxidative damage that leads to the formation of oxo-G, the formation of which is one of the main causes of library preparation-dependent sequencing errors, since DNA polymerases often incorrectly pair oxo-G with A, resulting in high-quality C>A sequencing errors. Another situation in which the symmetry of information between strands can be broken is during methyl-C (mC) sequencing. Standard protocols modify C or mC to alternative bases such as U, thereby changing the sequence information only in one strand.

[0003] Various strategies have been proposed to allow sequencing of both strands of a double-stranded DNA molecule, commonly known as double-stranded sequencing.

[0004] The original method of double-stranded sequencing used bioinformatics methods or deep sequencing data to identify clusters corresponding to each of the strands in the original template DNA molecule, and used this information to correct potential sequencing errors. Other methods used physical separation or UMI index sequences to differentially label the strands of DNA derived from the same double-stranded template. Naturally, such methods are very complicated or inefficient in identifying the correct double-stranded molecule.

[0005] Recently, a more efficient strategy was proposed to generate double-stranded sequencing information for the purpose of sequencing error correction. This method generates a tandem insert library that contains sequence information from each strand of a double-stranded template in a tandem repeat format. The tandem repeat format of this library is essential for its function, as it avoids rehybridization of the sequencing template during sequencing by synthesis (SBS). This method is compatible with SBS, but has a very low conversion efficiency during library preparation.

[0006] There is therefore a need to develop improved methods capable of sequencing both strands of a double-stranded DNA molecule (duplex sequencing), and in particular methods that are compatible with SBS. Summary of the Invention

[0007] According to one aspect of the present invention, there is provided a method of preparing at least one polynucleotide library strand template, the method comprising: Attaching a first adaptor to a first end of the double-stranded polynucleotide sequence, the first end comprising a 3' end of a forward strand and a 5' end of a reverse strand of the double-stranded polynucleotide sequence; attaching a second adaptor to a second end of the double-stranded polynucleotide sequence, the second end comprising a 5' end of a forward strand and a 3' end of a reverse strand of the double-stranded polynucleotide sequence; the first adaptor comprises a polynucleotide loop and the second adaptor comprises at least one primer binding sequence and at least one primer binding complementary sequence; The first adaptor comprises a first restriction site for an endonuclease and / or the second adaptor further comprises at least one cleavable site and / or the complement of a cleavable site.

[0008] In one embodiment, the first adaptor comprises a base-paired stem and a loop, and the first restriction site is within the base-paired stem. Alternatively or additionally, the first restriction site is within the loop.

[0009] In one embodiment, the first restriction site is a restriction site for a nicking endonuclease or a restriction endonuclease.

[0010] In one embodiment, the second adaptor further comprises at least one cleavable site and / or the complement of the cleavable site. In one example, the second adaptor comprises a base-paired stem and a fork, the fork comprising a primer binding complement sequence and a primer binding sequence. In one embodiment, the cleavable site and / or the complement of the cleavable site is within the base-paired stem. In an alternative embodiment, the second adaptor comprises a base-paired stem and a loop, the loop comprising the second cleavable site.

[0011] In one embodiment, at least one cleavable site and / or the complement of a cleavable site is a restriction site for a nicking endonuclease, and the restriction site may be a second restriction site.

[0012] In one embodiment, the first adaptor further comprises an affinity tag.

[0013] In another aspect of the present invention, a polynucleotide library strand for sequencing is provided, comprising a first adaptor, an identified double-stranded polynucleotide sequence, and a second adaptor, the first adaptor is attached to a first end of the double-stranded polynucleotide sequence, the first end comprising a 3' end of a forward strand and a 5' end of a reverse strand of the double-stranded polynucleotide sequence; a second adaptor is attached to a second end of the double-stranded polynucleotide sequence, the second end comprising a 5' end of the forward strand and a 3' end of the reverse strand of the double-stranded polynucleotide sequence; the first adaptor comprises a base-paired stem and loop; the second adaptor comprises a base-paired stem, a primer binding complement sequence, and a primer binding sequence; The first adaptor contains at least one restriction site for an endonuclease.

[0014] In one embodiment, the second adaptor comprises at least one cleavable site and / or the complement of the cleavable site, which may be a restriction site for a nicking endonuclease.

[0015] In another aspect of the invention, there is provided a method of identifying at least a first region of a polynucleotide sequence, the method comprising: a. preparing at least one polynucleotide library strand as described above; b. amplifying a polynucleotide library strand to generate a first and a second library strand, each library strand comprising a first and a second region; c. hybridizing the first or second library strand to a first and second immobilized primer, respectively, on a solid support and performing a first extension reaction to generate a first or second immobilized template strand; d. hybridizing the first or second immobilized template strand to a second or first immobilized primer, respectively, and performing a second extension reaction to generate a second and a first immobilized template strand; e. hybridizing the first and second immobilized template strands; f. applying a first endonuclease; g. sequencing the first and second immobilized template strands, wherein sequencing the first and second immobilized template strands comprises identifying a first region.

[0016] In one embodiment, identifying comprises determining the sequence of the first region and / or identifying any epigenetic modifications, which may be modified cytosines.

[0017] In one embodiment, each of the first and second library strands comprises a primer binding complement sequence, a first portion, a first adapter sequence, a second portion and a primer binding sequence, wherein the first adapter comprises a first restriction site for an endonuclease.

[0018] In one embodiment, the first restriction site is a restriction site for a nicking endonuclease or a restriction endonuclease.

[0019] In one embodiment, the primer binding sequence and the primer binding complement sequence comprise at least one cleavable site and / or the complement of the cleavable site. In one embodiment, the cleavable site and / or the complement of the cleavable site is a second restriction site.

[0020] In one embodiment, after cleavage of the first restriction site, the non-immobilized library strands are dehybridized and the immobilized template strands are sequenced by single-stranded SBS (sequencing by synthesis). Alternatively, after cleavage of the first restriction site, the immobilized template strands are sequenced by double-stranded SBS (sequencing by synthesis).

[0021] In one embodiment, at least one nicking endonuclease cleaves the second restriction site and the immobilized strand is sequenced by double-stranded SBS (sequencing by synthesis).

[0022] In one embodiment, the method further comprises blocking the 3' ends of all or substantially all of the immobilized strands that are sequenced.

[0023] In one embodiment, the method further comprises applying a second nicking endonuclease and sequencing the first and second immobilized template strands to identify a second region, where the second nicking endonuclease cleaves a different restriction site than the first nicking endonuclease.

[0024] In one embodiment, the method further comprises performing an extension reaction to regenerate the first and second immobilized strands.

[0025] In one embodiment, the method further comprises applying a second nicking endonuclease and sequencing the first and second immobilized template strands to identify a second region, where the second nicking endonuclease cleaves a different restriction site than the first nicking endonuclease.

[0026] In another aspect of the invention, an inverted repeat tandem insert polynucleotide library strand for sequencing is provided, the library strand comprising a primer binding complement sequence, an identified first portion, a first adapter sequence, an identified second portion and a primer binding sequence, the sequence of the second portion being in a reverse orientation relative to the first portion, and the loop sequence comprising at least one restriction site.

[0027] In another aspect of the invention, a library preparation kit is provided comprising a plurality of first adaptors and a plurality of second adaptors, wherein the first adaptors comprise a base-paired stem and loop, the first adaptors comprise at least one restriction site, and the second adaptors comprise a base-paired stem, a primer binding sequence and a primer binding complement sequence, and optionally the second adaptors comprise at least one restriction site. [Brief description of the drawings]

[0028] Features of examples of the present disclosure will become apparent upon reference to the following detailed description and the drawings in which like reference numbers correspond to similar, but possibly not identical, components. For purposes of brevity, reference numbers or features having previously described functions may or may not be described in conjunction with the other drawings in which they appear. [Figure 1] An exemplary solid support is shown. [Figure 2-1]Illustrated are the steps of bridge amplification and generation of amplified clusters, including: (A) library strands hybridizing to an immobilized primer; (B) generation of template strands from the library strands; (C) dehybridization and washing of the library strands; (D) hybridization of the template strand to another immobilized primer; (E) generation of a template complement strand from the template strand by bridge amplification; (F) dehybridization of the sequence bridge; (G) hybridization of the template strand and template complement strand to an immobilized primer; and (H) subsequent bridge amplification to provide multiple templates and template complement strands. [Figure 2-2] Illustrated are the steps of bridge amplification and generation of amplified clusters, including: (A) library strands hybridizing to an immobilized primer; (B) generation of template strands from the library strands; (C) dehybridization and washing of the library strands; (D) hybridization of the template strand to another immobilized primer; (E) generation of a template complement strand from the template strand by bridge amplification; (F) dehybridization of the sequence bridge; (G) hybridization of the template strand and template complement strand to an immobilized primer; and (H) subsequent bridge amplification to provide multiple templates and template complement strands. [Figure 2-3] Illustrated are the steps of bridge amplification and generation of amplified clusters, including: (A) library strands hybridizing to an immobilized primer; (B) generation of template strands from the library strands; (C) dehybridization and washing of the library strands; (D) hybridization of the template strand to another immobilized primer; (E) generation of a template complement strand from the template strand by bridge amplification; (F) dehybridization of the sequence bridge; (G) hybridization of the template strand and template complement strand to an immobilized primer; and (H) subsequent bridge amplification to provide multiple templates and template complement strands. [Figure 2-4]Illustrated are the steps of bridge amplification and generation of amplified clusters, including: (A) library strands hybridizing to an immobilized primer; (B) generation of template strands from the library strands; (C) dehybridization and washing of the library strands; (D) hybridization of the template strand to another immobilized primer; (E) generation of a template complement strand from the template strand by bridge amplification; (F) dehybridization of the sequence bridge; (G) hybridization of the template strand and template complement strand to an immobilized primer; and (H) subsequent bridge amplification to provide multiple templates and template complement strands. [Diagram 3] Detection of nucleobases using four-channel, two-channel and one-channel chemistries is shown. [Figure 4] It is shown that starting from a double-stranded polynucleotide sequence comprising a forward strand of sequence and a reverse strand of sequence, adaptors can be ligated to generate a loop-fork ligated polynucleotide sequence, which can then be amplified using PCR to generate a self-tandem insert library. [Diagram 5] Shown are three adapter configurations generated after adapter ligation, one representing the desired loop / fork configuration. PCR and / or clustering steps eliminate the loop / loop configuration because it lacks a primer binding site. A single affinity-based system eliminates the undesired fork / fork molecules. [Figure 6] Binding of primers to primer binding sequences on the template duplexes, thus preparing tandem library fragments for sequencing, is shown. [Figure 7] Using the 9QAM coding scheme, two simultaneously received base calls can be accurately distinguished, and by plotting the relative intensities of the optical signals obtained from read 1.1 and read 1.2, we show that an arrangement of nine clouds is obtained. Clouds in the four corners represent high quality, accurate base calls, whereas clouds outside the four corners represent potential library preparation / sequencing errors that can be removed. [Figure 8]Using the 9QAM coding scheme, we have shown that genomic and epigenetic data can be sequenced simultaneously, e.g., epigenetic conversion of polynucleotide library strands by bisulfite / EM-Seq or TAPS and subsequent sequencing allows mC and standard bases to be identified simultaneously. [Figure 9] An exemplary nicking arrangement is shown to facilitate sequencing of the entire inverted repeat tandem insert duplex. After nicking of the lone primer and sequencing of the first strand (read 1), the free end of the sequenced strand is blocked. Nicking enzymes specific for alternative recognition sites are added to nick recognition sites within the loop sequence, generating two initiation sites for simultaneous sequencing of the other strand of the original polynucleotide duplex. [Figure 10] An exemplary nicking arrangement is shown to facilitate sequencing of the entire inverted repeat tandem insert duplex. The first nicking event can occur within the loop sequence, and the polynucleotide sequence is dehybridized for the first read. The sequenced strand is extended to regenerate the 3' primer binding sequence. A nicking enzyme can be applied to nick the lone primer, generating two sequencing start sites that allow simultaneous sequencing from opposite ends of both inserts. [Figure 11] Shown is a nick arrangement in the loop sequence that creates two immobilized extension strands, effectively halving the tandem insert. After dehybridization, first and second sequencing primers can be applied and bound to their respective primer binding sequences to facilitate Read 1.1 and Read 1.2. [Figure 12]An example of a method for sequencing an inverted repeat tandem insert library strand is shown. After library preparation, cluster generation occurs to form loop-hybridized sequence bridges. A nicking enzyme can be applied to simultaneously nick the sequence bridges at a pair of recognition sequences in the loop stems to provide sequencing initiation sites for different strands of the original double-stranded template. The strands can be sequenced simultaneously by standard SBS or double-stranded SBS (e.g., strand-displacement SBS). In standard SBS sequencing, non-immobilized sequences, i.e., sequences 3' to the nicked site, are washed away before the sequencing steps of R1.1 and R1.2. In double-stranded SBS (e.g., strand-displacement SBS), non-immobilized sequences 3' to the nicked site are not washed away. [Figure 13] 1 is a plot showing a graphical representation of 16 distributions of signals generated by polynucleotide sequences according to one embodiment. [Figure 14] FIG. 1 is a flow diagram showing a method for base calling according to one embodiment. [Figure 15] 1 is a plot showing a graphical representation of nine distributions of signals generated by polynucleotide sequences according to one embodiment. [Figure 16] 1 shows a scatter plot illustrating the effect of unmodified cytosine to uracil conversion treatment of double-stranded polynucleotides and the resulting distribution of signals generated by polynucleotide sequences. [Figure 17] 1 shows a scatter plot illustrating the effect of modified cytosine to thymine conversion treatment of double-stranded polynucleotides and the resulting distribution of signals generated by polynucleotide sequences. [Figure 18] 1 shows alternative signal distributions using different dye coding schemes. [Figure 19] 1 shows alternative signal distributions using different dye coding schemes. [Figure 20] 1 shows alternative signal distributions using different dye coding schemes. [Figure 21] FIG. 2 is a flow diagram illustrating a method for determining sequence information according to one embodiment. [Figure 22A] 9 shows a 9QaM analysis performed on signals obtained from a custom second hybridization run of Example 1. The x-axis shows signal intensity from the "red" wavelength channel, and the y-axis shows signal intensity from the "green" wavelength channel. G does not appear to be associated with any association and therefore does not contribute intensity to both the "red" and "green" channels. C associates with the "red" dye and therefore contributes intensity to the "red" channel but not to the "green" channel. T associates with the "green" dye and therefore contributes intensity to the "green" channel but not to the "red" channel. A associates with the association of the "red" and "green" dyes and therefore contributes intensity to both the "red" and "green" channels. Because the template contains forward and reverse complementary strands that are sequenced simultaneously, the majority of the reads generate a cloud of (G,G) reads (lower left corner), (C,C) reads (lower right corner), (T,T) reads (upper left corner), and (A,A) reads (upper right corner). However, the central cloud, which corresponds to (C,T) or (T,C) reads, corresponds to the presence of modified cytosines. [Figure 22B] 1 shows sequence data generated from two different primers (HYB2'-ME and HP10) used in the custom second hybridization run of Example 1. Mismatches between the two sequences allow for the identification of modified cytosines. For example, a 5-mC present in the original forward strand of the target polynucleotide is read as a T in the HP10 read, while a C present in the original reverse complementary strand of the target polynucleotide (corresponding to the same position as the 5-mC in the original forward strand of the target polynucleotide) is read as a C in the HYB2'-ME read. [Figure 23A-1]9QaM analysis performed on signals obtained from Example 2 (library fragments 1-6). The x-axis shows signal intensity from the "red" wavelength channel and the y-axis shows signal intensity from the "green" wavelength channel. A CA dye swap was performed in this MiniSeq run compared to the standard MiniSeq run. G does not appear to be associated with any association and therefore does not contribute intensity to both the "red" and "green" channels. A associates with the "red" dye and therefore contributes intensity to the "red" channel but not to the "green" channel. T associates with the "green" dye and therefore contributes intensity to the "green" channel but not to the "red" channel. C associates with both the "red" and "green" dyes and therefore contributes intensity to both the "red" and "green" channels. Because the template contains forward and reverse complementary strands that are sequenced simultaneously, the reads generate a (T,T) read (top left corner), a (T,C) read (top center), a (C,C) read (top right corner), a (G,G) read (bottom left corner), a (G,A) read (bottom center), and an (A,A) read (bottom right corner). The top right corner corresponds to a (5-mC)-G base pair and the bottom left corner corresponds to a G-(5-mC) base pair and thus the presence of a modified cytosine. The groupings are as follows: T (labeled "T") in the forward strand of the upper left library, C (labeled "C") in the forward strand of the upper center library, 5-mC (labeled "c") in the forward strand of the upper right library, G (labeled "g") in the forward strand of the library that is associated with 5-mC in the reverse strand of the lower left library, G (labeled "G") in the forward strand of the library that is associated with C in the reverse strand of the lower center library, and A (labeled "A") in the forward strand of the lower right library. In Figures 23A-23C, two scatter plots are shown, where the plot labeled "Read-Colored" corresponds to the assignment of each base to a particular group during the read process, and the plot labeled "Reference-Colored" shows the true assignment of each base to a particular group, indicating where errors occurred in the read process.Figures 23D-23F show a combination of "read-colored" and "reference-colored" plots, where the read and reference are different, boundaries are shown for the read assignments, and the center of the circle shows the actual assignment. Additionally, Figures 23A-23F show a sequence alignment of the read sequence against a true methylated pUC19 sample, where an "m" above or below a C represents a 5-mC, while an "m" above or below a G represents a G that base pairs with a 5-mC. Red boxes indicate errors in the read (in sequence or methylation state). [Figure 23A-2]9QaM analysis performed on signals obtained from Example 2 (library fragments 1-6). The x-axis shows signal intensity from the "red" wavelength channel and the y-axis shows signal intensity from the "green" wavelength channel. A CA dye swap was performed in this MiniSeq run compared to the standard MiniSeq run. G does not appear to be associated with any association and therefore does not contribute intensity to both the "red" and "green" channels. A associates with the "red" dye and therefore contributes intensity to the "red" channel but not to the "green" channel. T associates with the "green" dye and therefore contributes intensity to the "green" channel but not to the "red" channel. C associates with both the "red" and "green" dyes and therefore contributes intensity to both the "red" and "green" channels. Because the template contains forward and reverse complementary strands that are sequenced simultaneously, the reads generate a (T,T) read (top left corner), a (T,C) read (top center), a (C,C) read (top right corner), a (G,G) read (bottom left corner), a (G,A) read (bottom center), and an (A,A) read (bottom right corner). The top right corner corresponds to a (5-mC)-G base pair and the bottom left corner corresponds to a G-(5-mC) base pair and thus the presence of a modified cytosine. The groupings are as follows: T (labeled "T") in the forward strand of the upper left library, C (labeled "C") in the forward strand of the upper center library, 5-mC (labeled "c") in the forward strand of the upper right library, G (labeled "g") in the forward strand of the library that is associated with 5-mC in the reverse strand of the lower left library, G (labeled "G") in the forward strand of the library that is associated with C in the reverse strand of the lower center library, and A (labeled "A") in the forward strand of the lower right library. In Figures 23A-23C, two scatter plots are shown, where the plot labeled "Read-Colored" corresponds to the assignment of each base to a particular group during the read process, and the plot labeled "Reference-Colored" shows the true assignment of each base to a particular group, indicating where errors occurred in the read process.Figures 23D-23F show a combination of "read-colored" and "reference-colored" plots, where the read and reference are different, boundaries are shown for the read assignments, and the center of the circle shows the actual assignment. Additionally, Figures 23A-23F show a sequence alignment of the read sequence against a true methylated pUC19 sample, where an "m" above or below a C represents a 5-mC, while an "m" above or below a G represents a G that base pairs with a 5-mC. Red boxes indicate errors in the read (in sequence or methylation state). [Figure 23B-1]9QaM analysis performed on signals obtained from Example 2 (library fragments 1-6). The x-axis shows signal intensity from the "red" wavelength channel and the y-axis shows signal intensity from the "green" wavelength channel. A CA dye swap was performed in this MiniSeq run compared to the standard MiniSeq run. G does not appear to be associated with any association and therefore does not contribute intensity to both the "red" and "green" channels. A associates with the "red" dye and therefore contributes intensity to the "red" channel but not to the "green" channel. T associates with the "green" dye and therefore contributes intensity to the "green" channel but not to the "red" channel. C associates with both the "red" and "green" dyes and therefore contributes intensity to both the "red" and "green" channels. Because the template contains forward and reverse complementary strands that are sequenced simultaneously, the reads generate a (T,T) read (top left corner), a (T,C) read (top center), a (C,C) read (top right corner), a (G,G) read (bottom left corner), a (G,A) read (bottom center), and an (A,A) read (bottom right corner). The top right corner corresponds to a (5-mC)-G base pair and the bottom left corner corresponds to a G-(5-mC) base pair and thus the presence of a modified cytosine. The groupings are as follows: T (labeled "T") in the forward strand of the upper left library, C (labeled "C") in the forward strand of the upper center library, 5-mC (labeled "c") in the forward strand of the upper right library, G (labeled "g") in the forward strand of the library that is associated with 5-mC in the reverse strand of the lower left library, G (labeled "G") in the forward strand of the library that is associated with C in the reverse strand of the lower center library, and A (labeled "A") in the forward strand of the lower right library. In Figures 23A-23C, two scatter plots are shown, where the plot labeled "Read-Colored" corresponds to the assignment of each base to a particular group during the read process, and the plot labeled "Reference-Colored" shows the true assignment of each base to a particular group, indicating where errors occurred in the read process.Figures 23D-23F show a combination of "read-colored" and "reference-colored" plots, where the read and reference are different, boundaries are shown for the read assignments, and the center of the circle shows the actual assignment. Additionally, Figures 23A-23F show a sequence alignment of the read sequence against a true methylated pUC19 sample, where an "m" above or below a C represents a 5-mC, while an "m" above or below a G represents a G that base pairs with a 5-mC. Red boxes indicate errors in the read (in sequence or methylation state). [Figure 23B-2]9QaM analysis performed on signals obtained from Example 2 (library fragments 1-6). The x-axis shows signal intensity from the "red" wavelength channel and the y-axis shows signal intensity from the "green" wavelength channel. A CA dye swap was performed in this MiniSeq run compared to the standard MiniSeq run. G does not appear to be associated with any association and therefore does not contribute intensity to both the "red" and "green" channels. A associates with the "red" dye and therefore contributes intensity to the "red" channel but not to the "green" channel. T associates with the "green" dye and therefore contributes intensity to the "green" channel but not to the "red" channel. C associates with both the "red" and "green" dyes and therefore contributes intensity to both the "red" and "green" channels. Because the template contains forward and reverse complementary strands that are sequenced simultaneously, the reads generate a (T,T) read (top left corner), a (T,C) read (top center), a (C,C) read (top right corner), a (G,G) read (bottom left corner), a (G,A) read (bottom center), and an (A,A) read (bottom right corner). The top right corner corresponds to a (5-mC)-G base pair and the bottom left corner corresponds to a G-(5-mC) base pair and thus the presence of a modified cytosine. The groupings are as follows: T (labeled "T") in the forward strand of the upper left library, C (labeled "C") in the forward strand of the upper center library, 5-mC (labeled "c") in the forward strand of the upper right library, G (labeled "g") in the forward strand of the library that is associated with 5-mC in the reverse strand of the lower left library, G (labeled "G") in the forward strand of the library that is associated with C in the reverse strand of the lower center library, and A (labeled "A") in the forward strand of the lower right library. In Figures 23A-23C, two scatter plots are shown, where the plot labeled "Read-Colored" corresponds to the assignment of each base to a particular group during the read process, and the plot labeled "Reference-Colored" shows the true assignment of each base to a particular group, indicating where errors occurred in the read process.Figures 23D-23F show a combination of "read-colored" and "reference-colored" plots, where the read and reference are different, boundaries are shown for the read assignments, and the center of the circle shows the actual assignment. Additionally, Figures 23A-23F show a sequence alignment of the read sequence against a true methylated pUC19 sample, where an "m" above or below a C represents a 5-mC, while an "m" above or below a G represents a G that base pairs with a 5-mC. Red boxes indicate errors in the read (in sequence or methylation state). [Figure 23C-1]9QaM analysis performed on signals obtained from Example 2 (library fragments 1-6). The x-axis shows signal intensity from the "red" wavelength channel and the y-axis shows signal intensity from the "green" wavelength channel. A CA dye swap was performed in this MiniSeq run compared to the standard MiniSeq run. G does not appear to be associated with any association and therefore does not contribute intensity to both the "red" and "green" channels. A associates with the "red" dye and therefore contributes intensity to the "red" channel but not to the "green" channel. T associates with the "green" dye and therefore contributes intensity to the "green" channel but not to the "red" channel. C associates with both the "red" and "green" dyes and therefore contributes intensity to both the "red" and "green" channels. Because the template contains forward and reverse complementary strands that are sequenced simultaneously, the reads generate a (T,T) read (top left corner), a (T,C) read (top center), a (C,C) read (top right corner), a (G,G) read (bottom left corner), a (G,A) read (bottom center), and an (A,A) read (bottom right corner). The top right corner corresponds to a (5-mC)-G base pair and the bottom left corner corresponds to a G-(5-mC) base pair and thus the presence of a modified cytosine. The groupings are as follows: T (labeled "T") in the forward strand of the upper left library, C (labeled "C") in the forward strand of the upper center library, 5-mC (labeled "c") in the forward strand of the upper right library, G (labeled "g") in the forward strand of the library that is associated with 5-mC in the reverse strand of the lower left library, G (labeled "G") in the forward strand of the library that is associated with C in the reverse strand of the lower center library, and A (labeled "A") in the forward strand of the lower right library. In Figures 23A-23C, two scatter plots are shown, where the plot labeled "Read-Colored" corresponds to the assignment of each base to a particular group during the read process, and the plot labeled "Reference-Colored" shows the true assignment of each base to a particular group, indicating where errors occurred in the read process.Figures 23D-23F show a combination of "read-colored" and "reference-colored" plots, where the read and reference are different, boundaries are shown for the read assignments, and the center of the circle shows the actual assignment. Additionally, Figures 23A-23F show a sequence alignment of the read sequence against a true methylated pUC19 sample, where an "m" above or below a C represents a 5-mC, while an "m" above or below a G represents a G that base pairs with a 5-mC. Red boxes indicate errors in the read (in sequence or methylation state). [Figure 23C-2]9QaM analysis performed on signals obtained from Example 2 (library fragments 1-6). The x-axis shows signal intensity from the "red" wavelength channel and the y-axis shows signal intensity from the "green" wavelength channel. A CA dye swap was performed in this MiniSeq run compared to the standard MiniSeq run. G does not appear to be associated with any association and therefore does not contribute intensity to both the "red" and "green" channels. A associates with the "red" dye and therefore contributes intensity to the "red" channel but not to the "green" channel. T associates with the "green" dye and therefore contributes intensity to the "green" channel but not to the "red" channel. C associates with both the "red" and "green" dyes and therefore contributes intensity to both the "red" and "green" channels. Because the template contains forward and reverse complementary strands that are sequenced simultaneously, the reads generate a (T,T) read (top left corner), a (T,C) read (top center), a (C,C) read (top right corner), a (G,G) read (bottom left corner), a (G,A) read (bottom center), and an (A,A) read (bottom right corner). The top right corner corresponds to a (5-mC)-G base pair and the bottom left corner corresponds to a G-(5-mC) base pair and thus the presence of a modified cytosine. The groupings are as follows: T (labeled "T") in the forward strand of the upper left library, C (labeled "C") in the forward strand of the upper center library, 5-mC (labeled "c") in the forward strand of the upper right library, G (labeled "g") in the forward strand of the library that is associated with 5-mC in the reverse strand of the lower left library, G (labeled "G") in the forward strand of the library that is associated with C in the reverse strand of the lower center library, and A (labeled "A") in the forward strand of the lower right library. In Figures 23A-23C, two scatter plots are shown, where the plot labeled "Read-Colored" corresponds to the assignment of each base to a particular group during the read process, and the plot labeled "Reference-Colored" shows the true assignment of each base to a particular group, indicating where errors occurred in the read process.Figures 23D-23F show a combination of "read-colored" and "reference-colored" plots, where the read and reference are different, boundaries are shown for the read assignments, and the center of the circle shows the actual assignment. Additionally, Figures 23A-23F show a sequence alignment of the read sequence against a true methylated pUC19 sample, where an "m" above or below a C represents a 5-mC, while an "m" above or below a G represents a G that base pairs with a 5-mC. Red boxes indicate errors in the read (in sequence or methylation state). [Figure 23D]9QaM analysis performed on signals obtained from Example 2 (library fragments 1-6). The x-axis shows signal intensity from the "red" wavelength channel and the y-axis shows signal intensity from the "green" wavelength channel. A CA dye swap was performed in this MiniSeq run compared to the standard MiniSeq run. G does not appear to be associated with any association and therefore does not contribute intensity to both the "red" and "green" channels. A associates with the "red" dye and therefore contributes intensity to the "red" channel but not to the "green" channel. T associates with the "green" dye and therefore contributes intensity to the "green" channel but not to the "red" channel. C associates with both the "red" and "green" dyes and therefore contributes intensity to both the "red" and "green" channels. Because the template contains forward and reverse complementary strands that are sequenced simultaneously, the reads generate a (T,T) read (top left corner), a (T,C) read (top center), a (C,C) read (top right corner), a (G,G) read (bottom left corner), a (G,A) read (bottom center), and an (A,A) read (bottom right corner). The top right corner corresponds to a (5-mC)-G base pair and the bottom left corner corresponds to a G-(5-mC) base pair and thus the presence of a modified cytosine. The groupings are as follows: T (labeled "T") in the forward strand of the upper left library, C (labeled "C") in the forward strand of the upper center library, 5-mC (labeled "c") in the forward strand of the upper right library, G (labeled "g") in the forward strand of the library that is associated with 5-mC in the reverse strand of the lower left library, G (labeled "G") in the forward strand of the library that is associated with C in the reverse strand of the lower center library, and A (labeled "A") in the forward strand of the lower right library. In Figures 23A-23C, two scatter plots are shown, where the plot labeled "Read-Colored" corresponds to the assignment of each base to a particular group during the read process, and the plot labeled "Reference-Colored" shows the true assignment of each base to a particular group, indicating where errors occurred in the read process.Figures 23D-23F show a combination of "read-colored" and "reference-colored" plots, where the read and reference are different, boundaries are shown for the read assignments, and the center of the circle shows the actual assignment. Additionally, Figures 23A-23F show a sequence alignment of the read sequence against a true methylated pUC19 sample, where an "m" above or below a C represents a 5-mC, while an "m" above or below a G represents a G that base pairs with a 5-mC. Red boxes indicate errors in the read (in sequence or methylation state). [Figure 23E]9QaM analysis performed on signals obtained from Example 2 (library fragments 1-6). The x-axis shows signal intensity from the "red" wavelength channel and the y-axis shows signal intensity from the "green" wavelength channel. A CA dye swap was performed in this MiniSeq run compared to the standard MiniSeq run. G does not appear to be associated with any association and therefore does not contribute intensity to both the "red" and "green" channels. A associates with the "red" dye and therefore contributes intensity to the "red" channel but not to the "green" channel. T associates with the "green" dye and therefore contributes intensity to the "green" channel but not to the "red" channel. C associates with both the "red" and "green" dyes and therefore contributes intensity to both the "red" and "green" channels. Because the template contains forward and reverse complementary strands that are sequenced simultaneously, the reads generate a (T,T) read (top left corner), a (T,C) read (top center), a (C,C) read (top right corner), a (G,G) read (bottom left corner), a (G,A) read (bottom center), and an (A,A) read (bottom right corner). The top right corner corresponds to a (5-mC)-G base pair and the bottom left corner corresponds to a G-(5-mC) base pair and thus the presence of a modified cytosine. The groupings are as follows: T (labeled "T") in the forward strand of the upper left library, C (labeled "C") in the forward strand of the upper center library, 5-mC (labeled "c") in the forward strand of the upper right library, G (labeled "g") in the forward strand of the library that is associated with 5-mC in the reverse strand of the lower left library, G (labeled "G") in the forward strand of the library that is associated with C in the reverse strand of the lower center library, and A (labeled "A") in the forward strand of the lower right library. In Figures 23A-23C, two scatter plots are shown, where the plot labeled "Read-Colored" corresponds to the assignment of each base to a particular group during the read process, and the plot labeled "Reference-Colored" shows the true assignment of each base to a particular group, indicating where errors occurred in the read process.Figures 23D-23F show a combination of "read-colored" and "reference-colored" plots, where the read and reference are different, boundaries are shown for the read assignments, and the center of the circle shows the actual assignment. Additionally, Figures 23A-23F show a sequence alignment of the read sequence against a true methylated pUC19 sample, where an "m" above or below a C represents a 5-mC, while an "m" above or below a G represents a G that base pairs with a 5-mC. Red boxes indicate errors in the read (in sequence or methylation state). [Figure 23F]9QaM analysis performed on signals obtained from Example 2 (library fragments 1-6). The x-axis shows signal intensity from the "red" wavelength channel and the y-axis shows signal intensity from the "green" wavelength channel. A CA dye swap was performed in this MiniSeq run compared to the standard MiniSeq run. G does not appear to be associated with any association and therefore does not contribute intensity to both the "red" and "green" channels. A associates with the "red" dye and therefore contributes intensity to the "red" channel but not to the "green" channel. T associates with the "green" dye and therefore contributes intensity to the "green" channel but not to the "red" channel. C associates with both the "red" and "green" dyes and therefore contributes intensity to both the "red" and "green" channels. Because the template contains forward and reverse complementary strands that are sequenced simultaneously, the reads generate a (T,T) read (top left corner), a (T,C) read (top center), a (C,C) read (top right corner), a (G,G) read (bottom left corner), a (G,A) read (bottom center), and an (A,A) read (bottom right corner). The top right corner corresponds to a (5-mC)-G base pair and the bottom left corner corresponds to a G-(5-mC) base pair and thus the presence of a modified cytosine. The groupings are as follows: T (labeled "T") in the forward strand of the upper left library, C (labeled "C") in the forward strand of the upper center library, 5-mC (labeled "c") in the forward strand of the upper right library, G (labeled "g") in the forward strand of the library that is associated with 5-mC in the reverse strand of the lower left library, G (labeled "G") in the forward strand of the library that is associated with C in the reverse strand of the lower center library, and A (labeled "A") in the forward strand of the lower right library. In Figures 23A-23C, two scatter plots are shown, where the plot labeled "Read-Colored" corresponds to the assignment of each base to a particular group during the read process, and the plot labeled "Reference-Colored" shows the true assignment of each base to a particular group, indicating where errors occurred in the read process.Figures 23D-23F show a combination of "read-colored" and "reference-colored" plots, where the read and reference are different, boundaries are shown for the read assignments, and the center of the circle shows the actual assignment. Additionally, Figures 23A-23F show a sequence alignment of the read sequence against a true methylated pUC19 sample, where an "m" above or below a C represents a 5-mC, while an "m" above or below a G represents a G that base pairs with a 5-mC. Red boxes indicate errors in the read (in sequence or methylation state). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0029] All patents, patent applications, and other publications, including all sequences disclosed in these references and referred to herein, are expressly incorporated herein by reference to the same extent as if each publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. All cited documents are, in relevant part, incorporated herein by reference in their entirety for the purposes indicated by the context of the citation herein. However, the citation of any document should not be construed as an admission that it is prior art to the present disclosure.

[0030] The present invention can be used in sequencing, particularly double-stranded sequencing.The method applicable to the present invention is described in WO 08 / 041002, WO 07 / 052006, WO 98 / 44151, WO 00 / 18957, WO 02 / 06456, WO 07 / 107710, WO 05 / 068656, US Patent Application No. 13 / 661,524 and US Patent Application No. 2012 / 0316086, the contents of which are incorporated herein by reference. Further information can be found in U.S. Patent Application No. 20060024681, U.S. Patent Application No. 20060292611, WO 06 / 110855, WO 06 / 135342, WO 03 / 074734, WO 07 / 010252, WO 07 / 091077, WO 00 / 179553, WO 98 / 44152 and WO 2022 / 087150, the contents of which are incorporated herein by reference.

[0031] As used herein, the term "variant" refers to a variant polypeptide sequence or portion of a polypeptide sequence that retains a desired function of the complete non-variant sequence. For example, the desired function of an immobilized primer is to retain the ability to bind (i.e., hybridize) to a target sequence.

[0032] As used in any embodiment described herein, a "variant" refers to a nucleic acid sequence that is at least 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 1090%, 1091%, 1092%, 1093%, 1094%, 1095%, 1096%, 1097%, 1098%, 1099%, 1000%, 1001%, 102%, 103%, 104%, 105%, 106%, 107, 108, 1091, 1092, 1093, 1094, 1095, %, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% overall sequence identity. Sequence identity of variants can be determined using any number of sequence alignment programs known in the art. As an example, one can use Emboss Stretcher from EMBL-EBI, https: / / www.ebi.ac.uk / Tools / psa / emboss_stretcher / (using default parameters: for proteins, paired output format, Matrix=BLOSUM62, Gap open=1, Gap extend=1; for nucleotides, paired output format, Matrix=DNAfull, Gap open=16, Gap extend=4).

[0033] As used herein, the term "fragment" refers to a functionally active contiguous stretch of nucleic acid derived from a longer nucleic acid sequence. A fragment may be at least 99%, at least 95%, at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, or at least 30% of the length of the longer nucleic acid sequence. A fragment as used herein may also retain the ability to bind (i.e., hybridize) to a target sequence.

[0034] Sequencing generally typically involves four basic steps: 1) library preparation to form a plurality of target polynucleotides for identification, 2) cluster generation to form an array of amplified template polynucleotides, 3) sequencing the cluster array of amplified template polynucleotides, and 4) data analysis to identify features of target polynucleotides from the amplified template polynucleotide sequences, which are described in more detail below.

[0035] Library Strand and Template Terminology For a given double-stranded polynucleotide sequence that is identified (also referred to herein as a polynucleotide library), the polynucleotide sequence includes a forward strand of the sequence and a reverse strand of the sequence.

[0036] Typically, when a polynucleotide sequence is replicated (e.g., using DNA / RNA polymerase), a complementary version of the forward strand of the sequence and a complementary version of the reverse strand of the sequence are generated, which may be referred to as the forward complement of the sequence and the reverse complement of the sequence, respectively.

[0037] By using the forward complement of a sequence as a template for complementary base pairing, the sequencing process (e.g., a sequencing by synthesis or sequencing by ligation process) recreates the information that was present in the original forward strand of the sequence. The forward complement of a sequence may be referred to as the forward strand of the template.

[0038] Similarly, by using the reverse complement of a sequence as a template for complementary base pairing, a sequencing process (e.g., a sequencing by synthesis or sequencing by ligation process) recreates the information that was present in the original reverse strand of the sequence. The reverse complement of a sequence may be referred to as the reverse strand of the template.

[0039] Library preparation Library preparation is the first step in any high-throughput sequencing platform. These libraries allow the creation of templates through complementary base pairing, which can then be clustered and amplified. During library preparation, nucleic acid sequences, e.g., genomic DNA samples, or cDNA or RNA samples, are converted into polynucleotide templates, which can then be sequenced. For the example of a DNA sample, the first step of library preparation is random fragmentation of the DNA sample. The sample DNA is first fragmented, and fragments of a specific size (typically 200-500 bp, but can be larger) are ligated, subcloned or "inserted" between two oligo adaptors (adapter sequences). The original sample DNA fragments are called "inserts". Target polynucleotides can also be advantageously size-divided prior to modification with adapter sequences.

[0040] As described herein, typically, the template generated from the library is double-stranded, comprising a first part that is the forward strand (of the template) and a second part that is the reverse strand (of the template).The generation of these templates from a particular library can be carried out according to methods known to those skilled in the art.However, some exemplary approaches to prepare libraries suitable for generating such templates are described below.

[0041] In some embodiments, the library is prepared by ligating adapter sequences to the duplex, for example, as described in more detail in International Publication No. WO 07 / 052006, which is incorporated herein by reference. In some cases, "tagmentation" can be used to attach sample DNA to adapters, for example, as described in more detail in International Publication No. WO 10 / 048605, US Patent Application Publication No. 2012 / 0301925, US Patent Application Publication No. 2013 / 0143774, and International Publication No. WO 2016 / 189331, each of which is incorporated herein by reference. In tagmentation, double-stranded DNA is simultaneously fragmented and tagged with adapter sequences and PCR primer binding sites. The combinatorial reaction eliminates the need for a separate mechanical shearing step during library preparation.

[0042] When the following features are described in relation to the "forward" strand, it should be considered that these features may be equally applied to the "reverse strand."

[0043] In one embodiment, as described in more detail below, libraries can be prepared using the loop-fork method described below. This procedure can be used, for example, to prepare templates that include a first polynucleotide sequence that includes a first portion and a second polynucleotide sequence that includes a second portion, where the first portion is the forward strand of the template and the second portion is the reverse complement of the template (or the first portion is the reverse strand of the template and the second portion is the forward complement of the template). This procedure can also be used, for example, to prepare templates that include linked polynucleotide sequences, where a single sequence includes both the forward and reverse strands of the template, or a copy of the forward strand of the template (i.e., the forward complement of the template) and a copy of the reverse strand of the template (i.e., the reverse complement of the template). In one aspect, the invention describes a method for preparing an inverted repeat tandem insert polynucleotide, where the orientation of the forward strand relative to the reverse strand (or the copy of the forward strand relative to the reverse strand) is in the opposite direction.

[0044] Starting with a double-stranded polynucleotide sequence comprising a forward strand of sequence and a reverse strand of sequence, an adaptor may be ligated to a first end of the sequence (e.g., using a process described in more detail in WO 07 / 052006, or the "tagmentation" method described above). A second end of the sequence (different from the first end) may be ligated to a loop connecting the forward strand of sequence and the reverse strand of sequence, thus generating a loop-fork ligated polynucleotide sequence. By performing PCR on the loop-fork ligated polynucleotide sequence, a new double-stranded polynucleotide sequence is generated, where one strand comprises the forward strand of sequence and the reverse strand of sequence, and the other strand comprises the forward complement of sequence and the reverse complement of sequence. The library is now ready for seeding, clustering and amplification.

[0045] As will be understood by those skilled in the art, double-stranded nucleic acids are typically formed from two complementary polynucleotide strands consisting of deoxyribonucleotides or ribonucleotides linked by phosphodiester bonds, but may further comprise one or more ribonucleotides and / or non-nucleotide chemical moieties and / or non-naturally occurring nucleotides and / or non-naturally occurring backbone bonds. In particular, double-stranded nucleic acids may comprise non-nucleotide chemical moieties, e.g., linkers or spacers, at the 5'-end of one or both strands. As non-limiting examples, double-stranded nucleic acids may comprise methylated nucleotides, uracil bases, phosphorothioate groups, peptide conjugates, and the like. Such non-DNA or non-natural modifications may be included to impart some desired properties to the nucleic acid, e.g., to allow covalent, non-covalent or metal coordinate binding to a solid support, or to act as a spacer to position the cleavage site at an optimal distance from the solid support. A single-stranded nucleic acid consists of one such polynucleotide strand. When a polynucleotide strand is only partially hybridized to a complementary strand, for example, a long polynucleotide strand hybridized to a short nucleotide primer, it may be referred to herein as a single-stranded nucleic acid.

[0046] A sequence that includes at least a primer binding sequence (a primer binding sequence and a sequencing primer binding site, or a combination of a primer binding sequence, an index sequence, and a sequencing primer binding site) may be referred to herein as an adapter sequence, and the insert (or the insert in the ligated strand) is flanked by a 5' adapter sequence and a 3' adapter sequence. The primer binding sequence may also include a sequencing primer for the index read.

[0047] As used herein, "adapters" refer to short sequence-specific oligonucleotides that are ligated to the 5' and 3' ends of each DNA (or RNA) fragment in a sequencing library as part of the library preparation. The adapter sequences may further comprise non-peptide linkers.

[0048] In a further embodiment, the P5' and P7' primer binding sequences are complementary to short primer sequences (or lone primers) present on the surface of a flow cell. For example, binding of P5' and P7' to their complements (P5 and P7) on the surface of a flow cell allows for nucleic acid amplification. As used herein, "'" indicates the complementary strand.

[0049] Primer binding sequences in the adapter that allow hybridization to an amplification primer (e.g., a lone primer) are typically about 20-40 nucleotides long, although the invention is not limited to sequences of this length. The exact identity of the amplification primer (e.g., a lone primer), and therefore the cognate sequence in the adapter, is generally not critical to the invention, as long as the primer binding sequence is able to interact with the amplification primer to direct PCR amplification. The sequences of the amplification primers can be specific to the particular target nucleic acid that is desired to be amplified, but in other embodiments, these sequences can be "universal" primer sequences that allow the amplification of any target nucleic acid of known or unknown sequence that has been modified to allow amplification by a universal primer. The criteria for the design of PCR primers are generally well known to those skilled in the art.

[0050] Index sequences (also known as barcode or tag sequences) are unique short DNA (or RNA) sequences that are added to each DNA (or RNA) fragment during library preparation. The unique sequences allow many libraries to be pooled together and sequenced simultaneously. Sequencing reads from the pooled libraries are identified and computationally sorted based on their barcodes before final data analysis. Library multiplexing is also a useful technique when working with small genomes or targeting genomic regions of interest. Multiplexing with barcodes can exponentially increase the number of samples analyzed in a single run without significantly increasing the running cost or run time. Examples of tag sequences are found in WO 05 / 068656, the entire contents of which are incorporated herein by reference. The tag can be read, for example, at the end of the first read, or equivalently at the end of the second read, using a sequencing primer complementary to the strand marked P7. The present invention is not limited by the number of reads per cluster, e.g., two reads per cluster; three or more reads per cluster can be easily obtained by simply dehybridizing the first extension sequencing primer and rehybridizing the second primer before or after the cluster reassembly / strand resynthesis step. Methods for preparing samples suitable for indexing are described, for example, in WO 2008 / 093098, which is incorporated herein by reference. Single or dual indexing may be used. With single indexing, up to 48 unique 6-base indexes can be used to generate up to 48 uniquely tagged libraries. With dual indexing, up to 24 unique 8-base index1 sequences and up to 16 unique 8-base index2 sequences can be used in combination to generate up to 384 uniquely tagged libraries. Pairs of indexes can also be used such that every i5 index and every i7 index are used only once.These unique dual indexes can be used to identify and filter indexed HopReads, providing even greater confidence in multiplexed samples.

[0051] A sequencing primer binding site is a sequencing and / or index primer binding site that indicates the start of a sequencing read. During the sequencing process, a sequencing primer anneals (i.e., hybridizes) to at least a portion of the sequencing primer binding site on the template strand. A polymerase enzyme binds to this site and incorporates complementary nucleotides, base by base, into the growing opposite strand.

[0052] The loop complement (or loop) may include an internal sequencing primer binding site. In other words, the internal sequencing primer binding site may form part of the loop complement. Alternatively, the loop complement may be an internal sequencing primer binding site. Thus, we may refer to the loop complement herein as including or as the second sequencing primer binding site.

[0053] Cluster generation and amplification Once double-stranded nucleic acid templates are formed, the library is typically subjected to denaturing conditions in advance to provide single-stranded nucleic acids. Suitable denaturing conditions will be clear to the skilled reader by referring to standard molecular biology protocols (Sambrook et al., 2001, Molecular Cloning, A Laboratory Manual, 4th Ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory Press, NY; Current Protocols, eds Ausubel et al). In one embodiment, chemical denaturation can be used.

[0054] After denaturation, the single-stranded library may be contacted in free solution onto a solid support that contains surface capture moieties (eg, P5 and P7 lawn primers).

[0055] Thus, embodiments of the present invention may be performed on a solid support 200 such as a flow cell. However, in alternative embodiments, seeding and clustering may be performed outside of a flow cell using other types of solid supports.

[0056] The solid support 200 may include a substrate 204. See Figure 1. The substrate 204 includes at least one well 203 (e.g., a nanowell), and typically includes a plurality of wells 203 (e.g., a plurality of nanowells).

[0057] In one embodiment, the solid support comprises at least one first immobilized primer and at least one second immobilized primer. These immobilized primers may also be known as lawn primers.

[0058] Thus, each well 203 may include at least one first immobilized primer 201, and typically may include a plurality of first immobilized primers 201. In addition, each well 203 may include at least one second immobilized primer 202, and typically may include a plurality of second immobilized primers 202. Thus, each well 203 may include at least one first immobilized primer 201 and at least one second immobilized primer 202, and typically may include a plurality of first immobilized primers 201 and a plurality of second immobilized primers 202.

[0059] The first immobilized primer 201 may be attached via the 5' end of its polynucleotide strand to the solid support 200. When extension occurs from the first immobilized primer 201, the extension may be in a direction away from the solid support 200.

[0060] The second immobilized primer 202 may be attached to the solid support 200 via the 5' end of its polynucleotide strand. When extension occurs from the second immobilized primer 202, the extension may be in a direction away from the solid support 200.

[0061] The first immobilized primer 201 may be different from the second immobilized primer 202 and / or the complement of the second immobilized primer 202. The second immobilized primer 202 may be different from the first immobilized primer 201 and / or the complement of the first immobilized primer 201.

[0062] The first immobilized primer 201 (or each of them) may comprise a sequence defined in SEQ ID NO: 1 or 5, or a variant or fragment thereof. The second immobilized primer 202 may comprise a sequence defined in SEQ ID NO: 2, or a variant or fragment thereof.

[0063] As a simple example, after binding of P5 and P7 primers to a solid support, the solid support may be contacted with a template and amplified under conditions that allow hybridization (or annealing - such terms may be used interchangeably) between the template and the immobilized primer. The template is usually added to the free solution under suitable hybridization conditions, which will be apparent to one of skill in the art. Typically, the hybridization conditions are, for example, 5xSSC at 40°C. However, other temperatures during hybridization may be used, for example, from about 50°C to about 75°C, from about 55°C to about 70°C, or from about 60°C to about 65°C. Solid-phase amplification may then proceed. The first step of amplification is a primer extension step in which nucleotides are added to the 3' end of the immobilized primer using the template to create a fully extended complementary strand. The template is then typically washed off the solid support. The complementary strand contains a primer binding sequence (i.e., either P5' or P7') at its 3' end that can bridge and bind to a second primer molecule immobilized on a solid support. The resulting structure is referred to herein as a sequence bridge. Further amplification (similar to a standard PCR reaction) results in the formation of clusters or colonies of template molecules bound to the solid support. This is referred to as clustering.

[0064] Thus, solid-phase amplification by methods similar to either the methods of WO 98 / 44151 or WO 00 / 18957 (the contents of which are incorporated herein by reference in their entirety) results in the generation of clustered arrays composed of colonies of "bridged" amplification products (or sequence bridges). This process is known as bridge amplification. Both strands of the amplification product are immobilized on a solid support at or near the 5' end, and this attachment will originate from the original attachment of the amplification primer. Typically, the amplification products within each colony originate from the amplification of a single template molecule. Other amplification procedures can be used and will be known to those skilled in the art. For example, the amplification may be an isothermal amplification using a strand-displacing polymerase, or an exclusive amplification as described in WO 2013 / 188582. Further information regarding amplification can be found in WO 02 / 06456 and WO 07 / 107710, the contents of which are incorporated herein by reference in their entirety.

[0065] Such an approach results in the formation of clusters of template molecules that contain copies of the template strand and copies of the complement of the template strand.

[0066] In some cases, to facilitate sequencing, one set of strands (either the original template strand or its complementary strand) may be removed from the solid support, leaving behind either the original template strand or the complementary strand. Suitable methods for removing such strands are described in more detail in WO 07 / 010251, the contents of which are incorporated herein by reference in their entirety.

[0067] The steps of cluster generation and amplification for a template containing a first portion and a second portion are shown below and in FIG.

[0068] Sequencing As described herein, the template provides information about the original target polynucleotide sequence (e.g., identification of gene sequences, identification of epigenetic modifications). For example, a sequencing process (e.g., sequencing by synthesis (referred to herein as SBS) or a sequencing by ligation process) can recreate the information that was present in the original target polynucleotide sequence by using complementary base pairing.

[0069] In one embodiment, sequencing can be performed using any suitable "sequencing by synthesis" technique, where nucleotides are added sequentially in cycles to a free 3' hydroxyl group to synthesize a polynucleotide chain in the 5' to 3' direction. The nature of the added nucleotide can be determined after each addition. One particular sequencing method relies on the use of modified nucleotides that can act as reversible chain terminators. Such reversible chain terminators contain a removable 3' blocking group. When such a modified nucleotide is incorporated into a growing polynucleotide chain complementary to a region of the template being sequenced, there is no free 3'-OH group available to induce further sequence extension, and therefore the polymerase cannot add additional nucleotides. Once the nature of the base incorporated into the growing chain is determined, the 3' block can be removed to allow the addition of the next successive nucleotide. By sequencing the products derived using these modified nucleotides, it is possible to deduce the DNA sequence of the DNA template. Such reactions can be performed in a single experiment if each of the modified nucleotides is attached to a different label known to correspond to a specific base, facilitating discrimination between the bases added at each incorporation step. Suitable labels are described in PCT Application No. PCT / GB2007 / 001770, the contents of which are incorporated herein by reference in their entirety. Alternatively, separate reactions may be carried out involving each of the modified nucleotides added individually.

[0070] The modified nucleotides may carry a label to facilitate their detection. Such a label may be configured to emit a signal, such as an electromagnetic signal or a (visible) light signal.

[0071] In certain embodiments, the label is a fluorescent label (e.g., a dye). Such labels can therefore be configured to emit electromagnetic or (visible) light signals. One method for detecting fluorescently labeled nucleotides includes the use of laser light of a wavelength specific to the labeled nucleotide, or other suitable illumination source. Fluorescence from the label on the incorporated nucleotide may be detected by a CCD camera or other suitable detection means. Suitable detection means are described in PCT / US2007 / 007991, the contents of which are incorporated herein by reference in their entirety.

[0072] However, the detectable label does not have to be a fluorescent label, any label that allows for detection of the incorporation of a nucleotide into a DNA sequence can be used.

[0073] Each cycle can involve the simultaneous delivery of four different nucleotide types to the array of template molecules. Alternatively, the different nucleotide types can be added sequentially, with images of the array of template molecules being obtained during each addition step.

[0074] In some embodiments, each nucleotide type may have a (spectrally) distinct label. In other words, four channels may be used to detect the four nucleobases (also known as four-channel chemistry) (Figure 3, left). For example, a first nucleotide type (e.g., A) may include a first label (e.g., configured to emit a first wavelength, such as red light), a second nucleotide type (e.g., G) may include a second label (e.g., configured to emit a second wavelength, such as blue light), a third nucleotide type (e.g., T) may include a third label (e.g., configured to emit a third wavelength, such as green light), and a fourth nucleotide type (e.g., C) may include a fourth label (e.g., configured to emit a fourth wavelength, such as yellow light). Four images can then be obtained, each using a detection channel selective for one of the four different labels. For example, a first nucleotide type (e.g., A) may be detected in a first channel (e.g., configured to detect a first wavelength, such as red light), a second nucleotide type (e.g., G) may be detected in a second channel (e.g., configured to detect a second wavelength, such as blue light), a third nucleotide type (e.g., T) may be detected in a third channel (e.g., configured to detect a third wavelength, such as green light), and a fourth nucleotide type (e.g., C) may be detected in a fourth channel (e.g., configured to detect a fourth wavelength, such as yellow light). Although specific pairings of bases to signal types (e.g., wavelengths) are described above, different signal types (e.g., wavelengths) and / or permutations may also be used.

[0075] In some embodiments, detection of each nucleotide type may be performed using fewer than four different labels. For example, sequencing by synthesis may be performed using the methods and systems described in U.S. Patent Application Publication No. 2013 / 0079232, which is incorporated herein by reference.

[0076] Thus, in some embodiments, two channels may be used to detect four nucleobases (also known as two-channel chemistry) (FIG. 3, center). For example, a first nucleotide type (e.g., A) may include a first label (e.g., configured to emit a first wavelength, such as green light) and a second label (e.g., configured to emit a second wavelength, such as red light), a second nucleotide type (e.g., G) may not include a first label and may not include a second label, a third nucleotide type (e.g., T) may include a first label (e.g., configured to emit a first wavelength, such as green light) and may not include a second label, and a fourth nucleotide type (e.g., C) may not include a first label and may include a second label (e.g., configured to emit a second wavelength, such as red light). Two images may then be acquired using the detection channels for the first and second labels. For example, a first nucleotide type (e.g., A) may be detected in both a first channel (e.g., configured to detect a first wavelength, such as red light) and a second channel (e.g., configured to detect a second wavelength, such as green light), a second nucleotide type (e.g., G) may not be detected in the first channel and may not be detected in the second channel, a third nucleotide type (e.g., T) may be detected in the first channel (e.g., configured to detect a first wavelength, such as red light) and may not be detected in the second channel, and a fourth nucleotide type (e.g., C) may not be detected in the first channel and may be detected in the second channel (e.g., configured to detect a second wavelength, such as green light). Although specific pairings of bases for combinations of signal types (e.g., wavelengths) and / or channels are described above, different signal types (e.g., wavelengths) and / or permutations may also be used.

[0077] In some embodiments, one channel may be used to cleave four nucleobases (also known as one-channel chemistry) (Figure 3 right). For example, a first nucleotide type (e.g., A) may include a cleavable label (e.g., configured to emit a wavelength such as green light), a second nucleotide type (e.g., G) may not include a label, a third nucleotide type (e.g., T) may include a non-cleavable label (e.g., configured to emit a wavelength such as green light), and a fourth nucleotide type (e.g., C) may include a label acceptor site that does not include a label. A first image may then be acquired and subsequent processing may be performed to cleave the label attached to the first nucleotide type and attach a label to the label acceptor site on the fourth nucleotide type. A second image may then be acquired. For example, a first nucleotide type (e.g., A) may be detected in a channel of a first image (e.g., configured to detect a wavelength such as green light) and not in a channel of a second image, a second nucleotide type (e.g., G) may be not detected in a channel of the first image and not detected in a channel of the second image, a third nucleotide type (e.g., T) may be detected in a channel of the first image (e.g., configured to detect a wavelength such as green light) and not in a channel of the second image, and a fourth nucleotide type (e.g., C) may be not detected in a channel of the first image and not in a channel of the second image (e.g., configured to detect a wavelength such as green light). Although specific pairings of bases to combinations of signal types (e.g., wavelengths) and / or images are described above, different signal types (e.g., wavelengths), images, and / or permutations may also be used.

[0078] In one embodiment, the sequencing process includes a first sequencing read (herein referred to as R1) and a second sequencing read (herein referred to as R2). As described below, in each read, at least two different polynucleotide strands are sequenced simultaneously to generate R1.1 and R1.2 reads and R2.1 and R2.2 reads. The first sequencing read and the second sequencing read can also be performed simultaneously. In other words, the first sequencing read and the second sequencing read can be performed simultaneously.

[0079] The first sequencing read may include binding of a first sequencing primer (also known as a lead 1 sequencing primer) to the first sequencing primer binding site. The second sequencing read may include binding of a second sequencing primer (also known as a lead 2 sequencing primer) to the second sequencing primer binding site.

[0080] Alternative methods of sequencing include sequencing by ligation as described, for example, in US Pat. No. 6,306,597 or WO 06 / 084132, the contents of which are incorporated herein by reference.

[0081] Data Analysis using 16QaM FIG. 13 is a scatter plot showing 16 example distributions of signals generated by the polynucleotide sequences disclosed herein.

[0082] The scatter plot in FIG. 13 shows 16 distributions (or bins) of intensity values ​​from a combination of a brighter signal (i.e., a first signal as described herein) and a dimmer signal (i.e., a second signal as described herein). The two signals may be co-localized and may not be optically resolved as described above. The intensity values ​​shown in FIG. 13 may be up to a scale or normalization factor, and the units of the intensity values ​​may be arbitrary or relative (i.e., representing the ratio of the actual intensity to a reference intensity). The sum of the brighter signal generated by the first portion and the dimmer signal generated by the second portion results in a composite signal. The composite signal may be captured by a first optical channel and a second optical channel. The brighter signal may be A, T, C, or G, and the dimmer signal may be A, T, C, or G, so there are 16 possibilities for the composite signal, corresponding to 16 distinguishable patterns when optically captured. That is, each of the 16 possibilities corresponds to a bin shown in FIG. 13. The computer system can map the generated composite signal into one of 16 bins and thus determine the nucleobases added in the first portion and the nucleobases added in the second portion, respectively.

[0083] For example, if the synthesis signal is mapped to bin 1612 for a base calling cycle, the computer processor base calls both the nucleobase added in the first portion and the nucleobase added in the second portion as C. If the synthesis signal is mapped to bin 1614 for a base calling cycle, the processor base calls the nucleobase added in the first portion as C and the nucleobase added in the second portion as T. If the synthesis signal is mapped to bin 1616 for a base calling cycle, the processor base calls the nucleobase added in the first portion as C and the nucleobase added in the second portion as G. If the synthesis signal is mapped to bin 1618 for a base calling cycle, the processor base calls the nucleobase added in the first portion as C and the nucleobase added in the second portion as A.

[0084] If the synthesis signal is mapped to bin 1622 for a base calling cycle, the processor base calls the nucleobase added in the first portion as T and the nucleobase added in the second portion as C. If the synthesis signal is mapped to bin 1624 for a base calling cycle, the processor base calls both the nucleobase added in the first portion and the nucleobase added in the second portion as T. If the synthesis signal is mapped to bin 1626 for a base calling cycle, the processor base calls the nucleobase added in the first portion as T and the nucleobase added in the second portion as G. If the synthesis signal is mapped to bin 1628 for a base calling cycle, the processor base calls the nucleobase added in the first portion as T and the nucleobase added in the second portion as A.

[0085] If the synthesis signal is mapped to bin 1632 for a base calling cycle, the processor base calls the nucleobase added in the first portion as G and the nucleobase added in the second portion as C. If the synthesis signal is mapped to bin 1634 for a base calling cycle, the processor base calls the nucleobase added in the first portion as G and the nucleobase added in the second portion as T. If the synthesis signal is mapped to bin 1636 for a base calling cycle, the processor base calls both the nucleobase added in the first portion and the nucleobase added in the second portion as G. If the synthesis signal is mapped to bin 1638 for a base calling cycle, the processor base calls the nucleobase added in the first portion as G and the nucleobase added in the second portion as A.

[0086] If the synthesis signal is mapped to bin 1642 for a base calling cycle, the processor base calls the nucleobase added in the first portion as A and the nucleobase added in the second portion as C. If the synthesis signal is mapped to bin 1644 for a base calling cycle, the processor base calls the nucleobase added in the first portion as A and the nucleobase added in the second portion as T. If the synthesis signal is mapped to bin 1646 for a base calling cycle, the processor base calls the nucleobase added in the first portion as A and the nucleobase added in the second portion as G. If the synthesis signal is mapped to bin 1648 for a base calling cycle, the processor base calls both the nucleobase added in the first portion and the nucleobase added in the second portion as A.

[0087] In this particular example, T is configured to emit a signal in both the image 1 and image 2 channels, A is configured to emit a signal only in the image 1 channel, C is configured to emit a signal only in the image 2 channel, and G is configured to emit no signal in either channel. However, the same effect can be achieved by performing a dye swap using a different permutation of the nucleobases. For example, A may be configured to emit a signal in both the image 1 and image 2 channels, T may be configured to emit a signal only in the image 1 channel, C may be configured to emit a signal only in the image 2 channel, and G may be configured to emit no signal in either channel.

[0088] Further details regarding performing base calling based on a scatter plot with 16 bins can be found in U.S. Patent Application Publication No. 2019 / 0212294, the disclosure of which is incorporated herein by reference.

[0089] FIG. 14 is a flow diagram showing a method 1700 of base calling according to the present disclosure. The described method allows for simultaneous sequencing of two (or more) parts (e.g., a first part and a second part) in a single sequencing run from a single composite signal obtained from the first part and the second part, thus requiring less consumption of sequencing reagents and faster generation of data from both the first part and the second part. Furthermore, the simplified method may reduce the number of workflow steps while producing the same yield compared to existing next-generation sequencing methods. Thus, the simplified method may result in a shortened sequencing run time.

[0090] 14, the disclosed method 1700 may begin at block 1701. The method may then move to block 1710.

[0091] In block 1710, intensity data is acquired. The intensity data includes first intensity data and second intensity data. The first intensity data includes a combined intensity of a first signal component obtained based on each first nucleobase of the first portion and a second signal component obtained based on each second nucleobase of the second portion. Similarly, the second intensity data includes a combined intensity of a third signal component obtained based on each first nucleobase of the first portion and a fourth signal component obtained based on each second nucleobase of the second portion.

[0092] Thus, the first portion is capable of generating a first signal comprising a first signal component and a third signal component, and the second portion is capable of generating a second signal comprising a second signal component and a fourth signal component.

[0093] As mentioned above, the first and second portions may be arranged on the solid support such that the signals from the first and second portions are detected by a single sensing moiety, and / or may comprise a single cluster such that the first and second signals from each of the respective first and second portions are not spatially resolvable.

[0094] In one example, acquiring the intensity data includes selecting intensity data corresponding to two (or more) distinct portions (e.g., a first portion and a second portion). In one example, the intensity data is selected based on a chastity score. The chastity score may be calculated as the ratio of the brightest base intensity divided by the sum of the brightest base intensity and the second brightest base intensity. The desired chastity score may vary depending on the expected intensity ratio of the emissions associated with the different portions. As described above, it may be desirable to generate a cluster including a first portion and a second portion that yield signals in a 2:1 ratio. In one example, high quality data corresponding to two portions having a 2:1 intensity ratio may have a chastity score of about 0.8 to 0.9.

[0095] After the intensity data is obtained, the method may proceed to block 1720. In this step, one of a plurality of classifications is selected based on the intensity data. Each classification represents a possible combination of the respective first and second nucleobases. In one example, the plurality of classifications includes 16 classifications as shown in FIG. 13, each representing a unique combination of the first and second nucleobases. When two portions are present, there are 16 possible combinations of the first and second nucleobases. Selecting a classification based on the first and second intensity data includes selecting a classification based on a combined intensity of the first and second signal components and a combined intensity of the third and fourth signal components.

[0096] The method may then proceed to block 1730, where each of the first and second nucleobases is base called based on the classification selected in block 1720. The signal generated during the sequencing cycle indicates the identity of the nucleobase added during sequencing (e.g., using sequencing by synthesis). It is understood that there is a direct correspondence between the identity of the nucleobase incorporated and the identity of the complementary base at the corresponding position of the template sequence bound to the solid support. Thus, any reference herein to a base call of each nucleobase in the two parts includes a base call of the nucleobase hybridized to the template sequence, and alternatively or additionally, an identification of the corresponding nucleobase of the template sequence. The method may then end at block 1740.

[0097] Data Analysis using 9QaM For two parts of a polynucleotide sequence (e.g., a first part and a second part as described herein), there are 16 possible combinations of nucleobases at any given position (i.e., A in the first part and A in the second part, A in the first part and T in the second part, etc.). If the same nucleobase is present at a given position in both parts, the emission associated with each target sequence during the relevant base calling cycle is characteristic of the same nucleobase. In effect, the two parts behave as a single part, and the identity of the base at that position can be uniquely called.

[0098] However, if the nucleobase of the first part is different from the nucleobase of the corresponding position of the second part, the signal associated with each part in the relevant base call cycle is characteristic of different nucleobases.In one embodiment, the first signal from the first part has substantially the same intensity as the second signal from the second part.The two signals may also be co-localized and may not be spatially and / or optically resolved.Thus, if different nucleobases are present at the corresponding positions of the two parts, the identity of the nucleobases cannot be uniquely called from the composite signal alone.However, useful sequencing information can still be determined from these signals.

[0099] The scatter plot in FIG. 15 shows nine distributions (or bins) of intensity values ​​from a combination of two co-localized signals of substantially equal intensity.

[0100] The intensity values ​​shown in FIG. 15 may be up to a scale or normalization factor, and the units of the intensity values ​​may be arbitrary or relative (i.e., representing the ratio of the actual intensity to a reference intensity). The sum of the first signal generated from the first portion and the second signal generated from the second portion results in a composite signal. The composite signal may be captured by the first optical channel and the second optical channel. The computer system may map the generated composite signal to one of nine bins, and thus determine sequence information regarding the nucleobases added in the first portion and the nucleobases added in the second portion.

[0101] Bins are selected based on the combined intensity of signals arising from each target sequence during the base calling cycle. For example, bin 1803 may be selected following detection of a high intensity (or "on / on") signal in the first channel and a high intensity signal in the second channel. Bin 1806 may be selected following detection of a high intensity signal in the first channel and a medium intensity ("on / off" or "off / on") signal in the second channel. Bin 1809 may be selected following detection of a high intensity signal in the first channel and a low or zero intensity ("off / off") signal in the second channel. Bin 1802 may be selected following detection of a medium intensity signal in the first channel and a high intensity signal in the second channel. Bin 1805 may be selected following detection of a medium intensity signal in the first channel and a medium intensity signal in the second channel. Bin 1808 may be selected following detection of a medium intensity signal in the first channel and a low or zero intensity signal in the second channel. Bin 1801 may be selected following detection of a low intensity signal in a first channel and a high intensity signal in a second channel. Bin 1804 may be selected following detection of a low or zero intensity signal in a first channel and a medium intensity signal in a second channel. Bin 1807 may be selected following detection of a low or zero intensity signal in a first channel and a low intensity signal in the second channel.

[0102] Four of the nine bins represent a match between each of the nucleobases of the two portions sensed during the cycle (bins 1801, 1803, 1807, and 1809). In response to mapping the composite signal to the bins representing a match, the computer processor may detect a match between the first portion and the second portion at the sensed position. In response to mapping the composite signal to the bins representing a match, the computer processor may base call each of the nucleobases. For example, if the composite signal is mapped to bin 1801 for a base calling cycle, the computer processor base calls both the nucleobase added in the first portion and the nucleobase added in the second portion as T. If the composite signal is mapped to bin 1803 for a base calling cycle, the processor base calls both the nucleobase added in the first portion and the nucleobase added in the second portion as A. If the composite signal is mapped to bin 1807 for a base calling cycle, the processor base calls both the nucleobase added in the first portion and the nucleobase added in the second portion as G. If the composite signal is mapped to bin 1809 for the base calling cycle, the processor base calls both the nucleobase added in the first portion and the nucleobase added in the second portion as C.

[0103] The remaining five bins are "ambiguous". That is, each of these bins represents two or more possible combinations of the first and second nucleobases. Bins 1802, 1804, 1806, and 1808 each represent two possible combinations of the first and second nucleobases. Meanwhile, bin 1805 represents four possible combinations. Nevertheless, mapping the composite signal to the ambiguous bins may still allow sequencing information to be determined. For example, bins 1802, 1804, 1805, 1806, and 1808 represent mismatches between the respective nucleobases of the two portions sensed during the cycle. Thus, in response to mapping the composite signal to the bins representing mismatches, the computer processor may detect a mismatch between the first portion and the second portion at the sensed position.

[0104] In this particular example, A is configured to emit a signal in both the first and second channels, C is configured to emit a signal only in the first channel, T is configured to emit a signal only in the second channel, and G does not emit a signal in either channel. However, the same effect can be achieved by performing a dye swap using a different permutation of the nucleobases. For example, A may be configured to emit a signal in both the first and second channels, T may be configured to emit a signal only in the first channel, C may be configured to emit a signal only in the second channel, and G may be configured to not emit a signal in either channel.

[0105] The number of classifications that can be selected based on the composite signal strength can be predetermined, for example, based on the number of moieties expected to be present in the nucleic acid cluster. Although Figure 15 shows a set of nine possible classifications, the number of classifications can be greater or less.

[0106] In addition to identifying matches and mismatches, mapping of the composite signal to each of the different bins (e.g., in combination with additional knowledge such as the library preparation method used) can provide additional information about the first and second portions, or about the sequences from which the first and second portions were derived. For example, given the nucleic acid material input and the processing method used to generate the nucleic acid clusters, the first and second portions may be expected to be identical at a given position. In this case, mapping of the composite signal to a bin representing a mismatch may indicate an error introduced during library preparation. In addition, the first and second portions may be expected to be different, for example, due to intentional sequence modifications introduced during library preparation to detect modified cytosines.

[0107] Errors occur during NGS library preparation, for example due to PCR artifacts or DNA damage. The error rate is determined by the library preparation method used, for example the number of cycles of PCR amplification carried out, and a typical error rate may be as low as 0.1%. This limits the sensitivity of diagnostic assays based on sequencing and may obscure true variants. The method allows the identification of library preparation errors from fewer sequencing reads.

[0108] In the absence of any library preparation / sequencing errors, the signals generated by sequencing the two parts (e.g., using sequencing by synthesis) will match. Thus, the synthetic signal can be mapped to one of the four "corner" clouds shown in Figures 7 and 8 and Figure 15, and the identity of the nucleobase at the corresponding position of the original library polynucleotide can be determined. If the identity of the nucleobase at that position suggests a rare or even unknown variant, it can be determined with a high level of confidence that the base call represents a true variant, as opposed to a library preparation error. On the other hand, if the synthetic signal is mapped to any of the other clouds, this indicates that the sequences of the first and second parts do not match and an error occurred in the library preparation. Thus, in response to mapping the synthetic signal to a classification that represents a mismatch between the two nucleobases, a library preparation error can be identified.

[0109] As mentioned herein, library preparation may include treatment with a conversion agent. When the conversion agent is configured to convert unmodified cytosine to a nucleobase read as uracil or thymine / uracil, the correspondence between the bases in the original polynucleotide and the bases in the converted strand is shown in FIG. 16 along with a scatter plot showing the potential resulting distribution of the combined signal intensity resulting from simultaneous sequencing of the target sequence. An AT or TA base pair in the original molecule results in a match (A / A or T / T) in the corresponding position of the forward and reverse complementary strands of the library. An mC-G or G-mC base pair in the library also results in a match (G / G or C / C) in the corresponding position of the forward and reverse complementary strands of the library. However, for a CG base pair, conversion of an unmodified cytosine in the forward strand ("top" strand) of the library to uracil (or a nucleobase read as thymine / uracil) results in a T in the corresponding position of the forward strand of the library. Meanwhile, the corresponding position on the reverse complementary strand ("bottom" strand) of the library is occupied by a C. Alternatively, for GC base pairs, conversion of an unmodified cytosine in the reverse complementary strand ("bottom" strand) of the library to uracil (or a nucleobase that is read as thymine / uracil) results in an A at the corresponding position of the reverse complementary strand of the library, while the corresponding position of the forward strand ("top" strand) of the library is occupied by a G. Thus, in response to mapping of the synthetic signal to a distribution representing G / G or C / C, the presence of a modified cytosine can be determined at the corresponding position in the original polynucleotide.

[0110] In other cases where the conversion reagent is configured to convert modified cytosines to nucleobases that are read as thymine or thymine / uracil, FIG. 17 shows the correspondence between bases in the original polynucleotide and the bases in the converted strand, together with a scatter plot showing the potential resulting distribution of composite signal intensities resulting from simultaneous sequencing of the target sequence. An AT or TA base pair in the library results in a match (A / A or T / T) at the corresponding position of the forward and reverse complementary strands of the library. A CG or GC base pair in the library also results in a match (G / G or C / C) at the corresponding position of the forward and reverse complementary strands of the library. However, for mC-G base pairs, conversion of 5-methylcytosine to thymine in the forward strand of the library (the "top" strand) results in a T at the corresponding position of the forward strand of the library. Meanwhile, the corresponding position on the reverse complementary strand of the library (the "bottom" strand) is occupied by a C. Alternatively, conversion of a 5-methylcytosine to a thymine in the reverse strand (the "bottom" strand) of the library results in an A at the corresponding position in the reverse complementary strand of the library, while the corresponding position in the forward strand (the "top" strand) of the library is occupied by a G. Thus, in response to mapping the synthetic signal to distributions representing A / G, G / A, T / C, or C / T mismatches, the presence of the modified cytosine can be determined at the corresponding position in the original polynucleotide.

[0111] FIG. 18 depicts the distribution resulting from the use of an alternative dye-coding scheme following the use of a conversion reagent configured to convert unmodified cytosine to a nucleobase that is read as uracil or thymine / uracil, and FIG. 19 depicts the distribution resulting from the use of a subsequent alternative dye-coding scheme following the use of a conversion reagent configured to convert modified cytosine to a nucleobase that is read as thymine or thymine / uracil.

[0112] Figure 20 depicts yet another distribution resulting from the use of an alternative dye-coding scheme following the use of a conversion reagent configured to convert modified cytosines to thymine or nucleobases (read as thymine / uracil), in this case the modified cytosines falling within the central bin.

[0113] In this example, six possibilities can be assumed for each base pair in the original double-stranded DNA molecule: AT, TA, CG, GC, mC-G, and G-mC. As shown in Figures 16-19, each of these possibilities is uniquely represented by one of a number of classifications. Thus, according to the present method, it is possible to determine both the sequence and the "methylation" state (i.e., the presence of modified cytosines) of a double-stranded polynucleotide in a single sequencing run.

[0114] In addition to determining the "methylation" status, it may also be possible to identify library preparation / sequencing errors. Using the dye coding scheme shown in Figures 16 and 17, the center column of the distribution indicates such errors. Using the dye coding scheme shown in Figures 18 and 19, the center row of the distribution indicates such errors.

[0115] Dye coding scheme can be optimized to resolve different combinations of first and second nucleobases.This can be particularly useful when known types of sequence modifications are introduced into the first and second parts.For example, when sequence modifications are introduced that convert unmodified cytosine into nucleobases that are read as uracil or thymine / uracil, or convert modified cytosine into nucleobases that are read as thymine or thymine / uracil, dye coding scheme can be selected so that the resulting combinations of first and second nucleobases do not fall within the central bin (representing four different nucleobase combinations).

[0116] In the case of conversion of modified cytosine to thymine (or nucleobases read as thymine / uracil), T / C or G / A mismatches between the forward and reverse complements indicate the presence of mC-G or G-mC base pairs at the corresponding positions in the library. Thus, dye coding schemes can be designed such that these mismatches can be resolved from other possible combinations of nucleobases. This can be accomplished by detecting emission from A and T bases in the first irradiation cycle and emission from C and T bases in the second irradiation cycle. In another example, emission can be detected from C and G bases in the first irradiation cycle and from C and T bases in the second irradiation cycle. In another example, emission can be detected from C and A bases in the first irradiation cycle and from C and G bases in the second irradiation cycle.

[0117] In the case of unmodified cytosine to uracil (or nucleobases read as thymine / uracil), a C / C or G / G match between the forward and reverse complements indicates the presence of a mC-G or G-mC base pair at the corresponding position in the library. In this case, the mC-G or G-mC base pair is always resolvable. However, dye coding schemes can be designed to optimize the resolution between unmodified bases.

[0118] 21 is a flow diagram showing a method 1900 of determining sequence information according to the present disclosure. The method described allows for the determination of sequence information from two (or more) portions (e.g., a first portion and a second portion) in a single sequencing run from a single composite signal obtained from the first portion and the second portion.

[0119] In one embodiment, the first portion comprises or consists of a sequence (e.g., an insert) derived from a nucleic acid sample, and the second portion comprises or consists of a sequence (e.g., an insert) derived from a nucleic acid sample.

[0120] In one embodiment, the first portion is at least 25 or at least 50 base pairs and the second portion is at least 25 base pairs or at least 50 base pairs.

[0121] 21, the disclosed method 1900 may begin at block 1901. The method may then move to block 1910.

[0122] In block 1910, intensity data is acquired. The intensity data includes first intensity data and second intensity data. The first intensity data includes a combined intensity of a first signal component obtained based on each first nucleobase of the first portion and a second signal component obtained based on each second nucleobase of the second portion. Similarly, the second intensity data includes a combined intensity of a third signal component obtained based on each first nucleobase of the first portion and a fourth signal component obtained based on each second nucleobase of the second portion.

[0123] Thus, the first portion is capable of generating a first signal comprising a first signal component and a third signal component, and the second portion is capable of generating a second signal comprising a second signal component and a fourth signal component.

[0124] As mentioned above, the first and second portions may be arranged on the solid support such that the signals from the first and second portions are detected by a single sensing moiety, and / or may comprise a single cluster such that the first and second signals from each of the respective first and second portions are not spatially resolvable.

[0125] In one example, obtaining the intensity data includes, for example, selecting the intensity data based on a chastity score. The chastity score may be calculated as the ratio of the brightest base intensity divided by the sum of the brightest base intensity and the second brightest base intensity. In one example, high quality data corresponding to two portions having a substantially equal intensity ratio may have a chastity score of about 0.8 to 0.9, for example, 0.89 to 0.9.

[0126] After the intensity data is acquired, the method may proceed to block 1920. In this step, one of a plurality of classifications is selected based on the intensity data. Each classification represents one or more possible combinations of the respective first and second nucleobases, and at least one classification of the plurality of classifications represents two or more possible combinations of the respective first and second nucleobases. In one example, the plurality of classifications includes nine classifications as shown in FIG. 15. Selecting a classification based on the first and second intensity data includes selecting a classification based on a combined intensity of the first and second signal components and a combined intensity of the third and fourth signal components.

[0127] The method may then proceed to block 1930, where each of the first and second sequence information is determined based on the classification selected in block 1920. The signal generated during the cycle of sequencing indicates the identity of the nucleobase added during sequencing (e.g., using sequencing by synthesis). For example, it may be determined that there is a match or mismatch between each of the first and second nucleobases. If it is determined that there is a match between each of the first and second nucleobases, the nucleobases may be base called. Whether there is a match or mismatch, additional or alternative information may be obtained, as described above. It is understood that there is a direct correspondence between the identity of the nucleobase incorporated and the identity of the complementary base at the corresponding position of the template sequence bound to the solid support. Thus, any reference herein to the base call of each nucleobase in the two parts includes the base call of the nucleobase hybridized to the template sequence, and alternatively or additionally, the identification of the corresponding nucleobase of the template sequence. The method may then end at block 1940.

[0128] Methods for preparing and sequencing tandem libraries In one aspect of the invention, a method for preparing at least one polynucleotide library strand is provided, the method comprising: Attaching a first adaptor to a first end of the double-stranded polynucleotide sequence, the first end comprising a 3' end of a forward strand and a 5' end of a reverse strand of the double-stranded polynucleotide sequence; attaching a second adaptor to a second end of the double-stranded polynucleotide sequence, the second end comprising a 5' end of a forward strand and a 3' end of a reverse strand of the double-stranded polynucleotide sequence; the first adaptor comprises a polynucleotide loop and the second adaptor comprises at least one primer binding sequence and at least one primer binding complementary sequence; The first adaptor contains a first restriction site for an endonuclease.

[0129] In another aspect of the invention, a method for preparing at least one polynucleotide library strand is provided, the method comprising: Attaching a first adaptor to a first end of the double-stranded polynucleotide sequence, the first end comprising a 3' end of a forward strand and a 5' end of a reverse strand of the double-stranded polynucleotide sequence; attaching a second adaptor to a second end of the double-stranded polynucleotide sequence, the second end comprising a 5' end of a forward strand and a 3' end of a reverse strand of the double-stranded polynucleotide sequence; the first adaptor comprises a polynucleotide loop and the second adaptor comprises at least one primer binding sequence and at least one primer binding complementary sequence; The second adaptor comprises a cleavable site and / or the complement of the cleavable site.

[0130] In another aspect of the invention, a method for preparing at least one polynucleotide library strand is provided, the method comprising: Attaching a first adaptor to a first end of the double-stranded polynucleotide sequence, the first end comprising a 3' end of a forward strand and a 5' end of a reverse strand of the double-stranded polynucleotide sequence; attaching a second adaptor to a second end of the double-stranded polynucleotide sequence, the second end comprising a 5' end of a forward strand and a 3' end of a reverse strand of the double-stranded polynucleotide sequence; the first adaptor comprises a polynucleotide loop and the second adaptor comprises at least one primer binding sequence and at least one primer binding complementary sequence; The first adaptor comprises a first restriction site for an endonuclease and the second adaptor comprises a cleavable site and / or the complement of the cleavable site.

[0131] In another aspect of the invention, there is provided a polynucleotide library strand for sequencing comprising a first adaptor, an identified double-stranded polynucleotide sequence and a second adaptor, wherein the first adaptor is attached to a first end of the double-stranded polynucleotide sequence, the first end comprising a 3' end of a forward strand and a 5' end of a reverse strand of the double-stranded polynucleotide sequence, the second adaptor is attached to a second end of the double-stranded polynucleotide sequence, the second end comprising a 5' end of the forward strand and a 3' end of the reverse strand of the double-stranded polynucleotide sequence, the first adaptor comprising a loop connecting the 3' end of the forward strand and the 5' end of the reverse strand, the second adaptor comprising a base-paired stem, a primer binding complementary sequence and a primer binding sequence, and the first adaptor comprising at least one restriction site for an endonuclease.

[0132] The first and second adaptors can be attached to the polynucleotide using, for example, a process as described in more detail in WO 07 / 052006, or the "tagmentation" method as described above.

[0133] In a further embodiment, the second adaptor may also comprise at least one cleavable site. In other words, the first adaptor comprises at least one restriction site and the second adaptor comprises at least one cleavable site. The cleavable site may also be a restriction site.

[0134] "Restriction site" means a sequence of nucleotides recognized by an endonuclease, such as a single-stranded endonuclease. A restriction site may also be called a "recognition site" or a "recognition sequence," and such terms may be used interchangeably.

[0135] In one embodiment, the endonuclease is a single-stranded restriction endonuclease, a nicking endonuclease or a nicking enzyme or a nickase (again, such terms may be used interchangeably), any of which refers to an enzyme that can hydrolyze only one strand of a double-stranded polynucleotide (duplex) to produce a DNA molecule that is "nicked" rather than completely cut on both strands.

[0136] Examples of suitable nicking enzymes that can be used include, but are not limited to, Nb.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BtsI, Nt.AlwI, Nt.BsmAI, Nt.BspQI, Nt.BstNBI, BssSI, Nb.Bpu101, and Nt.CviPII. These nickases can be used alone or in various combinations. Other suitable nicking endonucleases are available from commercial sources, including New England Biolabs and Fisher Scientific.

[0137] The restriction site will vary depending on the nickase used and is well known in the art. In one example, the restriction site is selected from the following:

[0138] In one embodiment, the nickase is Nb.BssSI, the restriction site is CACGAG, and Nb.BssSI catalyzes a single-stranded cleavage within the recognition sequence.

[0139] In one embodiment, the nickase is Nt.BspQI, the restriction site is GCTCTTC(1 / -7), and Nt.BspQI catalyzes a single-stranded cleavage one base 3' to the restriction site.

[0140] In one embodiment, the nickase is Nt.CviPII, the restriction site is (0 / -1)CCD, and Nt.CviPII catalyzes a single-stranded cleavage 5' to the restriction site.

[0141] In one embodiment, the nickase is Nt.BstNBI, the restriction site is GAGTC(4 / -5), and Nt.BstNBI catalyzes a single-stranded cleavage four bases 3' to the restriction site.

[0142] In one embodiment, the nickase is Nb.BsrDI, the restriction site is GCAATG, and Nb.BsrDI catalyzes a single-stranded cleavage within the restriction site.

[0143] In one embodiment, the nickase is Nb.BtsI, the restriction site is GCAGTG, and Nb.BtsI catalyzes a single-stranded cleavage within the restriction site.

[0144] In one embodiment, the nickase is Nt.AlwI, the restriction site is GGATC(4 / -5), and Nt.AlwI catalyzes a single-stranded cleavage four bases 3' to the restriction site.

[0145] In one embodiment, the nickase is Nb.BbvCI, the restriction site is CCTCAGC, and Nb.BbvCI catalyzes a single-stranded cleavage within the restriction site.

[0146] In one embodiment, the nickase is Nb.BsmI, the restriction site is GAATGC, and Nb.BsmI catalyzes a single-stranded cleavage within the restriction site.

[0147] In one embodiment, the nickase is Nt.BsmAI, the restriction site is GTCTC(1 / -5), and Nt.BsmAI catalyzes a single-stranded cleavage one base 3' to the restriction site.

[0148] In one embodiment, the nickase is Nb.Bpu10I, the restriction site is CCTNAGC, and Nb.Bpu10I catalyzes a single-stranded cleavage within the restriction site.

[0149] When a restriction site is written in the following format (x / -y), x is the number of nucleotides beyond (i.e., 3') the 3' end of the restriction site at which cleavage occurs and y is the number of nucleotides at the restriction site.

[0150] In an alternative embodiment, the endonuclease is a Cas9 endonuclease.

[0151] Examples of Cas9 nickases include Cas9 D10A and Cas9 H840A. For example, in one embodiment, the Cas9 protein may contain a D10A or H840A amino acid substitution. These nickases are complementary to the gRNA and cleave only the DNA strand recognized by the gRNA.

[0152] In one embodiment, the restriction site may be or include a PAM (protospacer adjacent motif) sequence. Examples of suitable PAM sequences include NGG, NGAG, NGCG, NGN, NG, GAA, GAT, NNG, NGN, NRN, YG, NNGRRT, NNNRRT, NNAGAA, NNNNGATT, and NNNNCRAA and their complements.

[0153] In further embodiments, the Cas9 protein may alternatively or additionally comprise an N863A or N854A amino acid substitution.

[0154] In further embodiments, the Cas9 protein is modified to improve activity. For example, in one embodiment, the Cas9 protein may further comprise a D1135E substitution. Alternatively, the Cas9 protein may be a VQR variant.

[0155] In one embodiment, when both the first and second adaptors contain a restriction site, the restriction sites are different sequences. Thus, in one embodiment, the first adaptor contains a first restriction site and the second adaptor contains a second restriction site.

[0156] In one embodiment, the target polynucleotide to be sequenced is a double-stranded polynucleotide molecule (also referred to herein as duplex), for example as shown in FIG. 4. Thus, the target polynucleotide may be considered to have an identified first portion and an identified second portion, the first portion being the forward strand and the second portion being the reverse strand. As shown in FIG. 4, A represents the 5' "half" of the forward strand and B represents the 3' "half" of the forward strand. Similarly, A' represents the complement of the 5' "half" of the forward strand (i.e., is the 3' "half" of the reverse strand) and B' represents the complement of the 3' "half" of the forward strand (i.e., is the 5' "half" of the reverse strand).

[0157] A first adaptor can be attached to the 5' end of the first portion and the 3' end of the second portion. Similarly, a second adaptor can be attached to the 3' end of the first portion and the 5' end of the second portion.

[0158] In one embodiment, the first adaptor is added to the 3' end of the polynucleotide duplex (i.e., the 3' end of the forward strand and the 5' end of the reverse strand). The first adaptor may be an oligonucleotide of any structure or sequence that allows the forward and reverse strands to be connected. For example, the adaptor may be capable of forming a loop. In one example, as shown in FIG. 4, the first adaptor includes a base-paired stem and a hairpin loop (e.g., a loop structure with unpaired or non-Watson-Crick paired nucleotides) that connects the 3' end of the forward strand with the 5' end of the reverse strand.

[0159] In one embodiment, the (first) restriction site is within the base-paired stem, at either the 5' or 3' end of the base-paired stem. In one aspect, the restriction site is at the 5' end.

[0160] If the first adaptor contains a first restriction site, the location of the restriction sequence will depend on whether the cleavage site of the target endonuclease is immediately 3' to the restriction site, or whether the endonuclease cleaves (nicks) a few nucleotides 3' to the restriction site, as described above. Of course, it is desirable for the endonuclease not to cleave in the target polynucleotide to be sequenced or in its complement on the template (i.e. in the first or second portions that are the portions that allow the target polynucleotide to be sequenced).

[0161] In one embodiment, the second adaptor comprises at least one primer binding sequence. In another embodiment, the second adaptor comprises at least one primer binding complementary sequence. In an alternative embodiment, the second adaptor comprises both a primer binding sequence and a primer binding complementary sequence. The primer binding sequence can be bound to a lawn immobilized on the surface of the solid support or to an immobilized primer. For example, the primer binding sequence can be either P5' (e.g., SEQ ID NO: 3 or a variant or fragment thereof) or P7' (e.g., SEQ ID NO: 4 or a variant or fragment thereof). Similarly, the primer binding complementary sequence can be either P5 (e.g., SEQ ID NO: 1 or 5 or a variant or fragment thereof) or P7 (e.g., SEQ ID NO: 2 or a variant or fragment thereof). When the primer binding sequence is P5', the primer binding complementary sequence is P7. When the primer binding sequence is P7', the primer binding complementary sequence is P5.

[0162] As shown in Figure 4, the second adapter comprises a base-paired stem, a primer binding sequence and a primer binding complementary sequence. Specifically, the second adapter may comprise a first and second strand, which are base-paired (forming the base-paired stem) for a portion of their sequences and are non-complementary for the remainder of their sequences, e.g., P5' and P7 or P7' and P5, and subsequently form a fork structure, where a first arm of the fork structure comprises the primer binding sequence and a second arm of the fork structure comprises the primer binding complementary sequence.

[0163] In one embodiment, the second adaptor comprises a (first) cleavable site. In one embodiment, the cleavable site is within the base-paired stem. As described above, the base-paired stem comprises two strands. In one example, the first strand comprises the cleavable site and the second strand comprises the complement of the cleavable site. In one embodiment, the strand bound to the primer binding complementary sequence comprises the cleavable site, and the strand bound to the primer binding sequence comprises the complement of the cleavable site. The cleavable site and the complement of the cleavable site may be cleavable by the same cleavage agent (i.e., they are complementary sequences), but it is also possible that the sequences are cleavable by different agents (i.e., they are not complementary sequences to each other).

[0164] Alternatively, the second adaptor does not contain a cleavable site in the base-paired stem.

[0165] In another embodiment, the second adapter comprises a base-paired stem and fork first arm and a fork second arm, the first arm comprising a primer binding sequence and a complement of a cleavable site, and the second arm comprising a primer binding complement sequence and a cleavable site, Again, the cleavable site and its complement may be cleavable by the same or different cleaving agents, as described above.

[0166] Alternatively, the second adaptor may comprise a base-paired stem and a hairpin loop, the loop comprising a primer binding sequence, a second cleavable site and a primer binding complementary sequence, the cleavable site being between the primer binding sequence and the primer binding complementary sequence. In one embodiment, the first adaptor comprises a first cleavable site in the base-paired stem as described above and a second cleavable site in the loop and between the primer binding sequence and the primer binding complementary sequence. Alternatively, the second adaptor does not comprise a first cleavable site.

[0167] As used herein, "cleavable site" refers to any moiety, e.g., modified nucleotides, that allows for selective cleavage of an adapter sequence. As non-limiting examples, cleavable sites may include uracil bases, phosphorothioate groups, ribonucleotides, diol bonds, disulfide bonds, peptides, etc.

[0168] In one example, the cleavable site is uracil, which can be cleaved using uracil glycosylase or the USER enzyme mix, which is a cocktail of uracil glycosylase and endonuclease VIII.

[0169] In another example, the cleavable site is 8-oxoguanine, which can be cleaved using FPG glycosylase.

[0170] Alternatively, the cleavable site is a restriction site. In one embodiment, the first cleavable site is a restriction site. Thus, when referred to herein, the first cleavable site can be referred to as the second restriction site, and the second cleavable site can be referred to herein as the third restriction site. In some embodiments, the first, second and third restriction sites are all different (i.e., different restriction site sequences).

[0171] In one embodiment, the method may include cleaving the loop of the second adaptor at the cleavable site to open the loop, thereby generating a fork structure as described above. Specifically, after cleavage, the second adaptor forms a base-paired stem and then a fork.

[0172] Although not shown in Figure 4, the first and second adapters also contain one or more sequencing primer binding sites and / or sequencing primer binding sites, both commonly referred to as primer binding sites.

[0173] In the first adaptor, the sequencing primer binding site may be in the loop sequence or in the base-paired stem. In one embodiment, the base-paired stem comprises at least one sequencing primer binding site. In one embodiment, the sequencing primer binding site is in the base-paired stem and in the portion of the stem that connects to the reverse strand of the double-stranded polynucleotide. In another embodiment, the loop may comprise two sequencing primer sites. In one example, the loop comprises two sequencing primer sites and a restriction site, with the sequencing primer sites on either side of the restriction site.

[0174] In the second adaptor, the sequencing primer binding site may also be within the base-paired stem. Alternatively, each fork of the second adaptor may further comprise a sequencing primer binding site.

[0175] A sequencing primer binding site is a sequencing and / or index primer binding site that indicates the start of a sequencing read. During the sequencing process, a sequencing primer anneals (i.e., hybridizes) to at least a portion of the sequencing primer binding site on the template strand. A polymerase enzyme binds to this site and incorporates complementary nucleotides, base by base, into the growing opposite strand.

[0176] The sequence of the sequencing primer and the sequencing primer binding site are not important to the methods of the present invention, so long as the sequencing primer is capable of binding to the sequencing primer binding site to allow amplification and sequencing of the identified region.

[0177] In a further embodiment, also not shown in FIG. 4, the first and / or second adaptor may further comprise one or more index sequences (or one or more index sequence complements).

[0178] As shown in Figure 5, after adapter ligation, three configurations are obtained, one of which represents the desired loop / fork configuration. The loop / loop configuration does not contain any primer binding site and is therefore automatically eliminated during the PCR and / or clustering steps. However, the fork / fork configuration poses the risk of inefficiency in the process.

[0179] Thus, in one embodiment, the first adaptor comprises at least one affinity tag. Thus, when required, unwanted forks / forks molecules can be easily removed from the workflow via a single affinity-based purification system. The affinity tag may therefore be any tag that can be used in this system. Examples include biotin, avidin (e.g., streptavidin), antibodies, haptens, cucurbiturils, adamantanes (e.g., 1-adamantylamine), ammonium ions (e.g., amino acids), ferrocene, cyclodextrins, calixarenes, crown ethers (e.g., 18-crown-6, 15-crown-5, 12-crown-4), cryptands (e.g., [2.2.2] cryptands), His tags (e.g., His 6 Tags), but are not limited to these.

[0180] In one embodiment, the affinity tag is biotin. This allows for the removal of forks / fork molecules using streptavidin beads (e.g., magnetic streptavidin beads) before / after PCR (Figure 5). Thus, in a further embodiment of the method, the method comprises removing the polynucleotide library strands using a second adaptor attached to the first end and a second adaptor attached to the second end.

[0181] In one embodiment, the method may include preparing a polynucleotide library strand as described above and applying an epigenetic conversion strategy. Such a conversion strategy includes treating the polynucleotide library strand with a conversion reagent configured to convert modified cytosines to nucleobases that are read as thymine or thymine / uracil, and / or configured to convert unmodified cytosines to nucleobases that are read as uracil or thymine / uracil. Suitable strategies are well understood by those skilled in the art. Non-limiting examples of such conversion strategies include bisulfite sequencing (BS-seq), oxidized bisulfite sequencing (oxBS-seq), reduced bisulfite sequencing (redBS-seq), TET-assisted bisulfite sequencing (TAB-seq), APOBEC-coupled epigenetic sequencing (ACE-seq), enzymatic methyl sequencing (EM-seq), TET-assisted pyridine borane sequencing (TAPS), TET-assisted pyridine borane sequencing with β-glucosyltransferase blocking (TAPSβ), chemically assisted pyridine borane sequencing (CAPS), pyridine borane sequencing (PS), and pyridine borane sequencing of 5-caC (PS-c). Non-limiting examples of conversion reagents include sulfites (e.g., bisulfite), cytidine deaminases (e.g., wild-type or mutant enzymes of the APOBEC family), and boron-based reducing agents (e.g., amine-borane or azine-borane compounds such as t-butylamine borane, ammonia borane, ethylenediamine borane, dimethylamine borane, pyridine borane, and 2-picoline borane).

[0182] As used herein, the term "modified cytosine" may refer to any one or more of 5-methylcytosine (5-mC), 5-hydroxymethylcytosine (5-hmC), 5-formylcytosine (5-fC) and 5-carboxylcytosine (5-caC);

[0183] [ka] Here, the wavy line indicates the point of attachment of the modified cytosine to the polynucleotide.

[0184] The resulting library can either be further amplified via PCR or used directly for clustering in a PCR-free workflow. If amplified, the resulting amplified (double-stranded) library strands are shown in FIG.

[0185] As shown in FIG. 6, following binding of a primer (e.g., an immobilized lawn primer, such as P7 (but which may be P5 depending on the placement of the forked adaptor)) to a primer binding sequence (e.g., P7' (but which may be P5 depending on the placement of the forked adaptor)), the library strands can be amplified. Following the first round of amplification, the resulting double-stranded polynucleotide library strands generated from the original library fragments include a forward strand that corresponds to the complement of the original library fragment (including the complement of the restriction site) and a reverse strand that corresponds to the original library fragment.

[0186] Thus, the forward strand of the resulting amplified library is (in the 5' to 3' direction): - the complement of the first strand of the first adaptor (comprising a primer binding complement sequence (e.g., P5, e.g., SEQ ID NO: 1 or 5 or a variant or fragment thereof) and the complement of the first strand of the base-paired stem); - a copy of the 3' end of the reverse strand (of the original library fragment) (A' copy), - a copy of the 5' end of the reverse strand (of the original library fragment) (the B' copy), - the complement of the first adaptor (including the complement of the original loop sequence (L') adjacent to the complement of the base-paired stem of the first adaptor); - a copy of the 3' end of the forward strand (of the original library fragment) (the B copy), - a copy of the 5' end of the forward strand (of the original library fragment) (the A copy), and - comprises the complement of the second strand of the first adaptor (including the complement of the second strand of the base-paired stem of the first adaptor and the complement of a primer binding complement sequence (e.g., the first primer binding sequence - e.g., P7', e.g., SEQ ID NO: 4 or a variant or fragment thereof).

[0187] The reverse strand of the resulting amplified library is (in the 3' to 5' direction) - a first strand of a second adapter, comprising a second primer binding sequence (e.g., P5', e.g., SEQ ID NO: 3 or 6 or a variant or fragment thereof) and a first strand of a base-paired stem; - the complement of the 5' "half" of the original forward strand (i.e. the 3' "half" of the reverse strand) (A'), - the complement of the 3' "half" of the forward strand (i.e. the 5' "half" (B') of the reverse strand), - a first adaptor comprising a loop sequence (L) adjacent to the base-paired stem of the first adaptor, - the 3' "half" of the forward strand (B), - the 5' "half" of the forward strand (A), and - the second strand of the first adaptor (comprising the second strand of the base-paired stem of the first adaptor and a second primer binding complementary sequence (e.g., P7, e.g., SEQ ID NO: 2 or a variant or fragment thereof)).

[0188] As shown in FIG. 4, the amplified library strand is described as including a loop sequence (or loop complement sequence), which refers to the structure of the sequence when present in the first adaptor. The loop sequence in the amplified library strand may be a linear sequence. Thus, this sequence may be referred to as a linear first adaptor sequence (or simply a first adaptor sequence) or a loop sequence, and such terms may be used interchangeably herein, but when "loop sequence" is used, for ease of reference, in the context of the amplified library strand, it is not intended to limit the structure to a loop (i.e., linear sequences are included).

[0189] Also, as shown in FIG. 4, the orientation of the identified polynucleotide sequence (i.e., insert) is reversed on either side of the loop, i.e., the sequence is AB-loop-B'-A' (e.g., instead of AB-loop-A'-B'). This results in an inverted repeat tandem insert polynucleotide library strand. Such polynucleotides may be referred to herein as inverted repeat tandem insert polynucleotide library strands. As explained above, the expectation is that complementary sequences of double-stranded DNA molecules should contain the same (i.e., exactly complementary) information. This may not actually be the case for several reasons (e.g., DNA damage, e.g., oxidative damage to one or more bases of one strand). Sequencing of the inverted repeat tandem insert polynucleotide library strands can be used to determine mismatches (e.g., asymmetries) between complementary strands.

[0190] Thus, in a further aspect of the invention, there is provided an inverted repeat tandem insert polynucleotide library strand as further described above, the library strand comprising a primer binding complementary sequence, an identified first portion, a loop sequence, an identified second portion and a primer binding sequence, the first and second portions being complementary sequences, the sequence of the second portion being inverse to the first portion, and the loop sequence comprising at least one restriction site for a nicking endonuclease. In a further embodiment, the primer binding sequence and the primer binding complementary sequence comprise at least one cleavable site and / or the complement of the cleavable site. In one embodiment, the cleavable site is a restriction site. The inverted repeat tandem insert polynucleotide library strand may be single-stranded or double-stranded.

[0191] In one embodiment, the first portion comprises or consists of a sequence (e.g., an insert) derived from a nucleic acid sample, and the second portion comprises or consists of a sequence (e.g., an insert) derived from a nucleic acid sample.

[0192] In one embodiment, the first portion is at least 25 or at least 50 base pairs and the second portion is at least 25 base pairs or at least 50 base pairs.

[0193] Sequencing the ends of such inverted repeat tandem insert library strands results in equivalent sequences of the same orientation (e.g., AB-loop-B'-A'), whereby each end represents the sequence of a different strand of the original duplex (Figure 4).

[0194] If the library strand is unmodified, e.g., no epigenetic conversion strategy is applied as described above, the inverted repeat tandem insert library strand is susceptible to rehybridization during SBS. A solution to this problem is described below.

[0195] In one aspect of the invention, there is provided a method of identifying at least a first region of a polynucleotide sequence, the method comprising: a. preparing at least one polynucleotide library strand as described above; b. amplifying a polynucleotide library strand to generate a first and a second library strand, each library strand comprising a first and a second region; c. hybridizing the first or second library strand to a first and second immobilized primer, respectively, on a solid support and performing a first extension reaction to generate a first or second immobilized template strand; d. hybridizing the first or second immobilized template strand to a second or first immobilized primer, respectively, and performing a second extension reaction to generate a second and a first immobilized template strand; e. hybridizing the first and second immobilized template strands; f. applying a first endonuclease; g. sequencing the first and second immobilized template strands, wherein sequencing the first and second immobilized template strands comprises identifying a first region.

[0196] In a further embodiment, the method comprises displacing or dehybridizing the (non-immobilized) library strand from the first or second immobilized strand, and hybridizing the first immobilized template strand to the 5' end of the second immobilized strand (including the 5' primer sequence) or hybridizing the second immobilized template strand to the 5' end of the first immobilized strand (also including the 5' primer sequence). This allows for the extension of the second or first immobilized strand using the crosslinked first extended strand as a template. This process is called clustering. In one embodiment, the clusters are generated by bridge amplification.

[0197] "Identification" or "identifying" as used herein means obtaining genetic information from one or more polynucleotide strands. This may include identifying (i.e., sequencing) the genetic sequence of one or more polynucleotide strands. Furthermore, this may alternatively or additionally include identifying mismatched base pairs. Furthermore, this may alternatively or additionally include identifying any epigenetic modifications, such as methylation. Thus, "identification" may refer to identifying one or more polynucleotide strands, identifying the genetic sequence of mismatched base pairs, and / or identifying any epigenetic modifications.

[0198] In one embodiment, the polynucleotide library strands are amplified to generate an identified first region and a second region (which may also be identified), such as on a single polynucleotide strand. As described above, the first and second regions may be complementary sequences and are oriented as inverted repeat tandem inserts, i.e., both regions are on the same polynucleotide strand and are in reverse sequence relative to each other (as shown in FIG. 4). Thus, in one embodiment, the method includes generating a plurality of inverted repeat tandem insert library strands, each library strand including the first and second regions. In one embodiment, the method further includes dehybridizing the library strands to generate single stranded inverted repeat tandem insert library strands.

[0199] In one embodiment, each of the first and second library strands comprises a primer binding complementary sequence, an identified first portion, a loop sequence, an identified second portion and a primer binding sequence, the first and second portions being complementary sequences, the sequence of the second portion being in a reverse orientation relative to the first portion, and the loop sequence comprising at least one restriction site (first restriction site) for an endonuclease. In a further embodiment, the primer binding sequence and the primer binding complementary sequence comprise at least one cleavable site and / or at least one complement of the cleavable site. In one embodiment, the cleavable site / complement of the cleavable site is a restriction site / complement of the restriction site.

[0200] The inverted repeat tandem insert polynucleotide library strands may be single-stranded or double-stranded.

[0201] In a further embodiment, the method comprises converting any epigenetic modifications (eg, modified cytosines) using a conversion reagent, as described above.

[0202] In a further embodiment, the method includes applying a plurality of inverted repeat tandem insert library strands in solution to a solid support (such as a flow cell), where each inverted repeat tandem insert library strand comprises a first or second 3' primer binding sequence (e.g., P5' or P7'), as described above, and the solid support has immobilized thereon a plurality of lawn primer sequences complementary to the first and second 3' primer binding sequences.

[0203] In a further embodiment, the method comprises hybridizing the 3' primer binding sequence of the first library strand (single-stranded inverted repeat tandem insert library strand) to a first loan primer or hybridizing the 3' primer binding sequence of the second library strand (single-stranded inverted repeat tandem insert library strand) to a second loan primer, and performing an extension reaction to extend the loan primer to generate a first or second immobilized template strand complementary to the library strand (also referred to herein as extension), the immobilized strand comprising a 3' (second or first, respectively) primer binding sequence. Thus, in one embodiment, the first and second library strands comprise first and second 3' primer binding sequences, the solid support comprises first and second immobilized primers, and the first and second library strands hybridize to the first and second immobilized primers by their 3' primer binding sequences.

[0204] In a further embodiment, the method comprises displacing or dehybridizing the (non-immobilized) library strand from the first or second immobilized strand, and hybridizing the first immobilized template strand to the 5' end of the second immobilized strand (including the 5' primer sequence) or hybridizing the second immobilized template strand to the 5' end of the first immobilized strand (also including the 5' primer sequence). This allows for the extension of the second or first immobilized strand using the crosslinked first extended strand as a template. This process is called clustering. In one embodiment, the clusters are generated by bridge amplification.

[0205] In a further embodiment, the method includes hybridizing a first immobilized template strand to the 5' end of a second immobilized strand (including a 5' primer sequence) and hybridizing a second immobilized template strand to the 5' end of the first immobilized strand (also including a 5' primer sequence). This structure may be referred to herein as a sequence bridge. The sequence bridge is hybridized at at least three locations: (1) the 5' primer of the first extended strand is hybridized to the 3' primer binding region (e.g., P5') of the second extended strand, (2) the loop sequences of both the first and second extended strands, and (3) the 5' primer of the second extended strand (e.g., P7) is hybridized to the 3' primer binding region (e.g., P7') of the first extended strand. Thus, this structure may be referred to herein as a loop-hybridized sequence bridge.

[0206] In a further embodiment, the method includes applying (i.e., adding / flowing over the surface of the solid support) a first nicking enzyme. In one example, the nicking enzyme cleaves the first or second restriction site in the template strand.

[0207] In one embodiment, the first nicking enzyme cleaves the first restriction site. These are restriction sites within (or naturally present in) the first adaptor. In one embodiment, the first restriction site is within the loop sequence. In an alternative embodiment, the second restriction site is within the base-paired stem (adjacent to the loop sequence).

[0208] In another embodiment, the first nicking enzyme cleaves a second restriction site. These are restriction sites within the second adaptor. In one embodiment, the second restriction site is within the base-paired stem (at the 3' end of the second adaptor sequence in the single-stranded template).

[0209] In one embodiment, after cleavage, the sequence located 3' to the cleaved sequence is dehybridized and washed away.

[0210] In a further embodiment, the method includes performing a first sequencing read to simultaneously determine the sequence of the first and second immobilized strands, such as by a sequencing-by-synthesis technique or a sequencing-by-ligation technique.

[0211] An example of a method for sequencing an inverted repeat tandem insert library strand is shown in FIG. 12. Each inverted repeat tandem insert duplex is dehybridized and a single strand is flowed onto a solid support (e.g., a flow cell) where it is bound and immobilized to the solid support via Watson-Crick binding to a complementary loan primer (P5 or P7). The loan primers (P5 and P7) are then extended (using the hybridized strand as a "template") to generate a first or second immobilized template strand. For example, the first extended immobilized strand may include a first primer sequence (e.g., P5) at its 5' end and a first primer binding sequence (e.g., P7') at its 3' end. Similarly, the second extended immobilized strand may include a second primer sequence (e.g., P7) at its 5' end and a second primer binding sequence (e.g., P5') at its 3' end.

[0212] Following extension of the loan primer to generate the first and second extended strands, the 3' end of each extended strand bends to bind to the other unbound loan adaptor (P7 or P5) to form a sequence bridge. As described above, this sequence bridge differs from a conventional sequence bridge because the sequence bridge hybridizes at least three locations: (1) the 5' primer (e.g., P5) of the first extended strand hybridizes to the 3' primer binding region (e.g., P5') of the second extended strand, (2) the loop sequences of both the first and second extended strands, and (3) the 5' primer (e.g., P7) of the second extended strand hybridizes to the 3' primer binding region (e.g., P7') of the first extended strand. As described above, this structure may be referred to herein as a loop-hybridized sequence bridge. The sequence bridge may further hybridize within the region to be identified.

[0213] The next step is the addition of a nicking enzyme, which can be flowed across the solid support following the formation of clustered and loop-hybridized sequence bridges as described above.

[0214] As shown in FIG. 12, if the loop sequence (or loop complement sequence) contains a 3' restriction site (i.e., the restriction site is at the 3' end of the loop sequence), a nicking enzyme may be applied to nick the sequence bridge at a pair of recognition sequences within the loop stem (e.g., the base-paired stem). This leaves the first and second extended strands hybridized in a loop structure, each of which provides a sequencing start site for a different strand of the original duplex template. These strands can be sequenced simultaneously by standard SBS or double-stranded SBS (e.g., strand-displacement SBS), as shown in FIG. 12. However, in all configurations of this workflow, the sequencing start sites are formed simultaneously by the nicking enzyme, thus allowing both strands of the duplex to be sequenced simultaneously.

[0215] In standard SBS sequencing, non-immobilized sequences, i.e., sequences 3' to the nick site, are washed away before addition of read 1.1 (SBSR1.2) and read 1.2 (SBS-R1.2) sequencing primers that anneal to the nick site in the loop sequences of the first and second extension strands, respectively, and polymerase. As shown in FIG. 12, read 1.1 sequences B' and A' (i.e., the reverse strand of the original duplex in the 3' to 5' direction), and read 1.2 sequences the B copy and A copy (the forward strand copy of the original duplex in the 3' to 5' direction). This allows any errors in the reverse strand to be identified.

[0216] In double-stranded SBS (eg, strand-displacement SBS), non-immobilized sequences 3' to the nick site are not washed away.

[0217] Single-strand displacement SBS is an effective method for sequencing prepared duplexes. This method requires a nick in the duplex sequence and a primer for DNA polymerase to utilize to incorporate a reversibly terminated labeled dNTP into the complementary strand of one of the template strands.

[0218] Single strand displacement SBS combines the principles of single strand replication and sequencing by synthesis techniques to sequence a duplex. Single strand displacement SBS utilizes a DNA polymerase capable of strand displacement but lacking exonuclease activity, such as phi29 DNA polymerase. To enable both leads 1 and 2, a DNA polymerase lacking exonuclease activity in both the 5'-3' and 3'-5' directions is required. A nick site within the duplex target and the annealed primer provides a binding site for such a DNA polymerase to bind. After docking, the DNA polymerase extends the primer adjacent to the nick site to generate the sequencing strand. The sequencing strand is formed by incorporation of a labeled deoxynucleoside triphosphate (dNTP) complementary to the associated template strand. The labeled dNTP acts as a terminator for polymerization, so that after each dNTP incorporation, a fluorescent dye is imaged to identify the base and then enzymatically cleaved to allow incorporation of the next nucleotide. Since all four reversible terminator-bound dNTPs (A, C, T, G) exist as single, separate molecules, natural competition minimizes incorporation bias. Concurrent with polymerization of the complementary strand, DNA polymerase uses its strand displacement activity to displace the other "non-template" strand for access. In the present invention, this workflow is performed simultaneously for each read (R1.1 and R1.2 / R2.1 and R2.2).

[0219] FIG. 6 describes an alternative method of sequencing an inverted repeat tandem insert template. A sequence bridge is formed as described in FIG. 3. In this example, the 3' ends of the loan primer sequences (e.g., both P5 and P7) contain a restriction site as described above (second restriction site). This restriction site is the complement of the restriction site present in the base-paired stem of the second adaptor. Simultaneous nicking of these restriction sites provides two sequencing initiation sites, which allows for simultaneous sequencing at opposite ends of both inserts, i.e., in the 5' to 3' direction, and at opposite ends of the inserts relative to FIG. 12. As described in FIG. 6, these strands can be sequenced simultaneously by double-stranded SBS, such as strand-displacing SBS. As shown in Figure 6, read 1.1 (SBS R1.1) sequences the A' and B' copies (reverse strand copies of the original duplex in the 5' to 3' direction) and read 1.2 (SBS R1.2) sequences A and B (forward strands of the original duplex in the 5' to 3' direction), allowing any errors in the forward strand to be identified.

[0220] As shown in FIG. 7, a 9QAM coding scheme can be used to accurately distinguish between two simultaneously received base calls. By plotting the relative intensities of the light signals obtained from read 1.1 and read 1.2, an arrangement of nine clouds is obtained. Each of these clouds allows sequence information to be identified from the two reads. In this particular coding scheme, the top left corner of the four clouds corresponds to a base call corresponding to A, the top right corner of the four clouds corresponds to a base call corresponding to T, the bottom left corner of the four clouds corresponds to a base call corresponding to G, and the bottom right corner of the four clouds corresponds to a base call corresponding to C. However, other coding schemes are possible, and each of C, G, A, and T may be mapped to a different cloud permutation. By plotting the light intensities in this way, it is possible to determine the exact base call from a library preparation or sequencing error (library preparation or sequencing error means herein that there is a mismatch between read 1.1 and read 1.2, which may indicate an asymmetry between the forward and reverse strands, for example, due to DNA damage to one strand).

[0221] The methods described herein can also be used to simultaneously sequence genomic and epigenetic data. After preparation of the polynucleotide library strands, epigenetic conversion is applied. The modified library strands can then be sequenced as described above, and the sequences of the duplexes can be read simultaneously. The 9QaM system is used to decode the simultaneously received read signals. Depending on which technique for epigenetic conversion is used, the C / C cloud may represent either mC (bisulfite / EM-Seq) or accurate C calls (TAPS), and vice versa, and the C / T cloud represents mC or accurate C calls, respectively (Figure 8).

[0222] Following sequencing of one strand of the duplex (i.e., read 1) as described above, the second strand of the other side of the duplex can be sequenced using either single-stranded or double-stranded SBS.

[0223] In one example, following nicking of the lone primer (as shown in Figures 6 or 12) and sequencing of the first strand (read 1), the free end of the sequenced strand is blocked as shown in Figure 9. By "free end" is meant the 3' terminus of an extended polynucleotide strand or the free 3' hydroxyl group of the 3' nucleotide.

[0224] Suitable blocking groups include hairpin loops (e.g., a 3'-terminally attached polynucleotide that includes, in a 5' to 3' direction, a cleavable site, such as a uracil-containing nucleotide, a loop portion, and a complementary portion, where the complementary portion is substantially complementary to all or a portion of a loan primer), a hydrogen atom in place of the 3'-OH group, a phosphate group, a propyl spacer (e.g., -O-(CH 2 ) 3 -OH), modifications that block the 3'-hydroxyl group (e.g., a hydroxyl protecting group such as a silyl ether group (e.g., trimethylsilyl, triethylsilyl, triisopropylsilyl, t-butyl(dimethyl)silyl, t-butyl(diphenyl)silyl), an ether group (e.g., benzyl, allyl, t-butyl, methoxymethyl (MOM), 2-methoxyethoxymethyl (MEM), tetrahydropyranyl), or an acyl group (e.g., acetyl, benzoyl), or an inverted nucleobase. However, the blocking group may be any modification that prevents extension (i.e., elongation) of the free end by a polymerase. Alternatively, instead of blocking the free ends, these strands are extended to regenerate the polynucleotide strands (i.e., resynthesize to generate 3' primer binding sequences).

[0225] In the next step, a nicking enzyme can be applied to nick the sequence bridge at a restriction site in the loop sequence (or loop complement sequence) using an alternative recognition site for the first nicking event. That is, nicking occurs at a restriction site at the 3' end of the loop sequence. As shown in FIG. 9, this generates two start sites for sequencing, allowing for simultaneous sequencing of the other strand of the original polynucleotide duplex. For example, as shown in FIG. 9, read 2.1 (SBS-R2.1) sequences B' and A' (i.e., the reverse strand of the original duplex in the 3' to 5' direction), and read 2.2 (SBS-R2.2) sequences the B copy and the A copy (the copy of the forward strand of the original duplex in the 3' to 5' direction). This allows any errors in the reverse strand to be identified. In this example, read 2 can be sequenced by either single-stranded or double-stranded SBS, as described above.

[0226] For example, as depicted in Figures 6 and 9, two reads, each with simultaneous sequencing of the two strands, make it possible to sequence the entire inverted repeat tandem insert duplex.

[0227] The order of the nicking reactions can also be reversed. For example, the first nicking step can be nicking of the loop sequence and the second nicking step can be nicking of the 3' end of the primer sequence. This is shown, for example, in FIG. 10.

[0228] As shown in Figure 10, read 1 is generated according to the method described in Figure 12. This allows any errors in the forward strand to be identified. Sequencing can be single-stranded or double-stranded SBS.

[0229] The sequenced strand is then extended (i.e., resynthesized) to regenerate the 3' primer binding sequence. In a next step, a nicking enzyme may be applied to nick the sequence bridge at the 3' end of the primer sequence (e.g., as described in FIG. 10). The simultaneous nicking of these restriction sites provides two sequencing initiation sites, which allows simultaneous sequencing at opposite ends of both inserts, i.e., in the 5' to 3' direction, and at opposite ends of the inserts relative to FIG. 12. As described in FIG. 10, these strands can be sequenced simultaneously by double-stranded SBS, such as strand-displacement SBS. As shown in FIG. 10, read 2.1 (SBS R2.1) sequences the A' and B' copies (reverse strand copies of the original duplex in the 5' to 3' direction), and read 2.2 (SBS R2.2) sequences A and B (forward strands of the original duplex in the 5' to 3' direction). This allows any errors in the forward strand to be identified.

[0230] Thus, in a further embodiment, following read 1, the method includes blocking all or substantially all of the free 3' ends of the immobilized strands. Alternatively, following read 1, each immobilized strand is extended to regenerate the loop-hybridized sequence bridge described (as shown in FIG. 10). Thus, in one embodiment, the method includes performing an extension reaction to extend each immobilized strand.

[0231] In a further embodiment, the method further comprises applying (i.e., adding / flowing onto the surface of the solid support) a second nicking enzyme. In one embodiment, the second nicking enzyme cleaves the first or second restriction site in the template strand. In another embodiment, the second nicking enzyme cleaves a different restriction site than the first nicking enzyme. Thus, if the first nicking enzyme cleaves the first restriction site (as shown in FIG. 10), the second nicking enzyme cleaves the second restriction site. Similarly, if the first nicking enzyme cleaves the second restriction site (as shown in FIG. 9), the second nicking enzyme cleaves the first restriction site.

[0232] In one embodiment, following read 1, if the first nicking enzyme cleaves the second restriction site, the method includes blocking all or substantially all of the free 3' ends of the immobilized strand and applying a second nicking enzyme, where the second nicking enzyme cleaves the first restriction site (shown in FIG. 9).

[0233] In an alternative embodiment, following read 1, if the first nicking enzyme cleaves a first restriction site, the method includes performing an extension reaction to extend the immobilized strand and applying a second nicking enzyme, where the second nicking enzyme cleaves a second restriction site as shown in FIG. 10.

[0234] In a further embodiment, the method includes performing a second sequencing read to simultaneously sequence the first and second immobilized strands, such as by sequencing-by-synthesis or sequencing-by-ligation techniques. This sequencing read is Read 2.

[0235] In an alternative embodiment, the method comprises generating a sequence bridge as described above and cleaving both strands of the bridge simultaneously, which is possible if the first restriction site is in the center of the loop or substantially in the center of the loop.

[0236] In one embodiment, the endonuclease is a double-stranded restriction endonuclease or a restriction enzyme. Both of these terms refer to an enzyme that can hydrolyze both strands of a double-stranded polynucleotide (duplex) to generate a DNA molecule that is cut on both strands. In one embodiment, the restriction enzyme is a type II restriction enzyme. In one example, the type II restriction enzyme is EcoRI, the restriction enzyme is G / AATTC, and EcoRI catalyzes a double-stranded cut within the recognition site. In another example, the type II restriction enzyme is Bg1II, the restriction site is A / GATCT, and Bg1II catalyzes a double-stranded cut within the recognition site. In a further example, the type II restriction enzyme is NotI, the restriction site is GC / GGCCGC, and NotI catalyzes a double-stranded cut within the recognition site.

[0237] Further, in this embodiment, the loop sequence in the first adaptor comprises the following structure: first sequencing primer binding sequence-restriction site-complement of second sequencing primer binding sequence. As a result, the first immobilized template (within the loop sequence) comprises the first sequencing primer binding sequence, the restriction site and the complement of the second sequencing primer binding sequence, and the second immobilized template comprises the complement of the first sequencing primer binding sequence, the restriction site and the complement of the second sequencing primer binding sequence. The first and second sequencing primer binding sequences bind to a sequencing primer which may be the same sequence. That is, they bind to the same sequencing primer. Alternatively, the first and second sequencing primer binding sequences are different. That is, they bind to different sequencing primers. The sequencing primer binding sequence may be in the base-paired stem of the loop sequence.

[0238] Following nicking of the loop sequence, two immobilized extensions are generated, a first immobilized extension and a second immobilized extension, as shown in Figure 11. In effect, this step halves the tandem insert. Each immobilized extension has a 3' sequencing primer binding sequence (either the first sequencing primer binding sequence or the second sequencing primer binding sequence). The non-immobilized strand may be washed away.

[0239] Binding of the first sequencing primer to the first sequencing primer binding sequence allows for sequencing of read 1.1. As shown in FIG.

[0240] Binding of a second sequencing primer to the second sequencing primer binding sequence allows for sequencing of read 1.2. As shown in FIG.

[0241] In one embodiment, binding of the first sequencing primer to the first sequencing primer binding sequence generates a first signal, and binding of the second sequencing primer to the second sequencing primer binding sequence generates a second signal, with the intensity of the first signal being greater than the intensity of the second signal. This allows for reads 1.1 and 1.2 to be read out simultaneously. This is accomplished using a mixed population of blocked and unblocked second sequencing primers that bind to the second sequencing primer binding site. Any ratio of blocked second primer:unblocked second primer that generates a second signal of lower intensity than the first signal can be used, for example, the ratio of blocked primer:unblocked primer can be 20:80 to 80:20, or 1:2 to 2:1. In one embodiment, a 50:50 ratio of blocked second primer:unblocked second primer is used, which generates a second signal that is about 50% of the intensity of the first signal.

[0242] The first and second sequencing primers can be added to the flow cell simultaneously, or separately but sequentially.

[0243] By "blocked" it is meant that the sequencing primer comprises a blocking group at the 3' end of the sequencing primer. Suitable blocking groups include hairpin loops (e.g., a polynucleotide attached to the 3' end that includes, in a 5' to 3' direction, a cleavable site such as a uracil-containing nucleotide, a loop portion, and a complementary portion, where the complementary portion is substantially complementary to all or a portion of the immobilized primer), deoxynucleotides, deoxyribonucleotides, a hydrogen atom in place of the 3'-OH group, a phosphate group, a phosphorothioate group, a propyl spacer (e.g., -O-(CH 2 ) 3-OH), modifications that block the 3'-hydroxyl group (e.g., a hydroxyl protecting group such as a silyl ether group (e.g., trimethylsilyl, triethylsilyl, triisopropylsilyl, t-butyl(dimethyl)silyl, t-butyl(diphenyl)silyl), an ether group (e.g., benzyl, allyl, t-butyl, methoxymethyl (MOM), 2-methoxyethoxymethyl (MEM), tetrahydropyranyl), or an acyl group (e.g., acetyl, benzoyl), or an inverted nucleobase. However, a blocking group may be any modification that prevents extension (i.e., lengthening) of the primer by a polymerase.

[0244] The sequence of the sequencing primer and the sequencing primer binding site are not important to the methods of the present invention, so long as the sequencing primer is capable of binding to the sequencing primer binding site to allow amplification and sequencing of the identified region.

[0245] In summary, the above examples allow spatially separated clusters to be read out simultaneously in time through the generation of optically unresolved signals that can be analytically separated using 16QaM.

[0246] In a further embodiment, the method may further comprise generating a complement of the Read 1 sequence (i.e., a half complement of the tandem insert shown in FIG. 10) and sequencing the complement as described above (i.e., following the same method as in FIG. 10 with sequencing primers that bind to the complements of the first and second primer binding sequences). This allows for sequencing of Read 2. Again, binding of the first sequencing primer to the complement of the first sequencing primer binding sequence generates a first signal and binding of the second sequencing primer to the complement of the second sequencing primer binding sequence generates a second signal, the intensity of the first signal being greater than the intensity of the second signal, allowing Reads 2.1 and 2.2 to be read simultaneously. In one embodiment, the complement of the Read 1 sequence may be obtained by modifying the solid support such that the solid support further comprises lawn primers (third and fourth lawn primers) that are complementary to the first and second primer binding sequences or at least a portion thereof. A bridge is formed when the 3' end of the immobilized Read 1 sequence (e.g., last diagram in FIG. 11) binds to the third and fourth primers (not shown). The third and fourth loan primers can be extended using bridge amplification and sequenced using the methods described above.

[0247] Thus, in an alternative embodiment, the method of identifying a polynucleotide comprises applying (i.e., loading / flowing onto the surface of a solid support) a first restriction enzyme, which cleaves a first restriction site, the first restriction site being in the loop sequence of a first adaptor. In one embodiment, after cleavage, the sequence 3' to the cleaved sequence is dehybridized and washed away.

[0248] In a further embodiment, the method includes performing a first sequencing read to simultaneously determine the sequence of the first and second immobilized strands, such as by a sequencing-by-synthesis technique or a sequencing-by-ligation technique.

[0249] kit In another aspect of the present invention, a library preparation kit is provided that includes a plurality of first adaptors and a plurality of second adaptors. In one embodiment, the kit further includes instructions for use. In a further embodiment, the kit may further include at least one single-stranded endonuclease or restriction endonuclease. In one aspect, the endonuclease is selected from Nt.BspQl, Cas9 D10A, and Cas9 H840A.

[0250] In another embodiment, the kit may further include an agent for epigenetic conversion. For example, the agent for epigenetic conversion may be a conversion agent described herein. Non-limiting examples of conversion reagents include sulfite (e.g., bisulfite), cytidine deaminase (e.g., wild-type or mutant enzymes of the APOBEC family), and boron-based reducing agents (e.g., amine-borane compounds or azine-borane compounds, such as t-butylamine borane, ammonia borane, ethylenediamine borane, dimethylamine borane, pyridine borane, and 2-picoline borane).

[0251] In another embodiment, the kit may further comprise uracil glycosylase or the USER enzyme mix, which is a cocktail of uracil glycosylase and endonuclease VIII.

[0252] In another aspect of the invention, there is provided a solid support comprising a plurality of third and / or fourth primers immobilized thereon, as described above.

[0253] Terms such as "about" or "approximately" are synonymous and are used to indicate that the value modified by the term has an understood range associated with it, which may be ±20%, ±15%, ±10%, ±5%, or ±1%. The term "substantially" is used to indicate that a result (e.g., a measurement) is close to a target value, where close may mean, for example, that the result is within 80% of the value, within 90% of the value, within 95% of the value, or within 99% of the value. The term "partially" is used to indicate that an effect is only partial or to a limited extent.

[0254] Unless otherwise noted, articles such as "a" or "an" should generally be construed to include one or more of the described items.

[0255] While the above detailed description has illustrated, described, and pointed out novel features applied to the exemplary embodiments, it will be understood that various omissions, substitutions, and changes in the form and details of the devices or algorithms shown can be made without departing from the spirit of the present disclosure. As will be recognized, certain embodiments described herein may be embodied in forms that do not provide all of the features and advantages described herein, since some features may be used or practiced separately from others. All changes that come within the meaning and range of equivalency of the claims are intended to be embraced within their scope.

[0256] It is to be understood that all combinations of the foregoing concepts (provided that such concepts are not mutually inconsistent) are intended to be part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated to be part of the inventive subject matter disclosed herein.

[0257] The invention will now be illustrated by the following non-limiting examples. EXAMPLES

[0258] Example 1-9 Mismatched base pair analysis for NA12878 sample using QaM Oligo sequence: asterisk( * ) indicates a phosphorothioate bond.

[0259] The bold text indicates the nicking restriction site (or its complement) of Nt.BspQI, which recognizes the following sequence (nicking site indicated by an arrow):

[0260]

number

[0261] [Biotin-T] has the following structure:

[0262] [ka]

[0263] [Table 1]

[0264] Adapter Annealing: A mixture of 1.4 μl of 100 μM P5_BbvCl_P7 oligo, 11 μl of water, 2 μl of 10×TEN buffer (Illumina) and 3 μl of IDTE buffer was heated to 98° C. for 30 seconds and then cooled slowly to room temperature (e.g., 0.1° C. / sec to room temperature). This results in a 20 μM stock of annealed P5_BbvCl_P7 adaptor. 2. Separately, a mixture of 4 μl of 100 μM BspQI_iSce_Loop oligo, 11 μl of water, 2 μl of 10×TEN buffer (Illumina) and 3 μl of IDTE buffer was heated to 98° C. for 30 seconds and then cooled slowly to room temperature (e.g., 0.1° C. / sec to room temperature). This results in a 20 μM stock of annealed BspQI_iSce_Loop adapter. 3. Mix equal amounts of the 20 μM stock of annealed P5_BbvCl_P7 adapter from step 1 and the 20 μM stock of annealed BspQI_iSce_Loop adapter from step 2 together to obtain a stock solution with 10 μM of annealed P5_BbvCl_P7 adapter and annealed BspQI_iSce_Loop adapter, respectively.

[0265] Library preparation 1. NEB Ultra II FS reagent was thawed at room temperature and kept on ice until use. 2. The Ultra II FS enzyme mix was vortexed for 5-8 seconds and placed on ice before use. 3. To a 0.2 ml PCR tube on ice, add 26 μl of DNA (100 ng input DNA (NA12878 sample) diluted to 26 μl with Milli-Q grade water), 7 μl of NEBNext Ultra II FS Reaction Buffer, and 2 μl of NEBNext Ultra II FS Enzyme Mix, vortex briefly, and spin in a microcentrifuge to mix. 4. In a thermocycler with the heated lid set at 75°C, the tubes were incubated at 37°C for 5 minutes, then at 65°C for 30 minutes, then held at 4°C. 5. The following was added to the FS reaction mixture from step 4: 30 μl of NEBNext Ultra II Ligation Master Mix, 1 μl of NEBNext Ligation Enhancer, and 2.5 μl of loop adapters P5_BbvCI_P7 and BspQI_iSce_Loop (10 μM each) prepared from step 3 of "Adapter Annealing." 6. The entire volume was mixed by pipetting up and down 10 times, then spun briefly in a microcentrifuge. 7. The mixture was incubated at 20° C. for 15 minutes in a thermocycler with the heated lid removed. 8.3 μl of USER enzyme (NEB) was added to the ligation mixture. 9. The mixture was mixed well and incubated at 37°C for 15 minutes with the heated lid set at >47°C. 10. The adaptor ligated DNA was then size selected via 0.8x SPRI (iTune beads) selection, 40 μl of iTune beads (ILMN) were added to the 68.5 μl ligation reaction, mixed and incubated at room temperature for 5 minutes. 11. The mixture was placed on a magnet for 5 minutes and the supernatant was discarded. 12. The beads were washed twice with 200 μl of 80% ethanol by adding 200 μl of 80% ethanol with the beads on the magnet followed by a 30 second wait, removal of the ethanol and then repeating the wash once more. 13. The last traces of ethanol were removed with a P10 pipette and tip. 14. The beads were then air dried for 5 minutes. 15. DNA was eluted from the beads with 40 μl of 0.1× TE buffer. 16. A second size selection was performed via another 0.8x SPRI (iTune beads) selection, 20 μl of iTune beads (ILMN) were added to the 68.5 μl ligation reaction, mixed and incubated at room temperature for 5 minutes. 17. The mixture was placed on a magnet for 5 minutes and the supernatant was discarded. 18. The beads were washed twice with 200 μl of 80% ethanol by adding 200 μl of 80% ethanol with the beads on the magnet followed by a 30 second wait, removal of the ethanol and then repeating the wash once more. 19. The last traces of ethanol were removed with a P10 pipette and tip. 20. The beads were then air dried for 5 minutes. The DNA was eluted from the beads with 21.15 μl of 0.1×TE buffer, of which 7.5 μl was carried forward to the next step. 22.175 μl HT1 buffer (ILMN hybridization buffer) and 10 μl HT1 washed MyOne Streptavidin T1 beads (Thermofisher) were added. The tube was incubated for 30 minutes at room temperature on a rocker. (This step selects for material with biotinylated loop adapters and removes material with P5 / P7 adapters at both ends). 23. The tube was placed on a magnet until the beads were pelleted. 24. The beads were washed twice with 200 μl of Tagmentation Wash Buffer (TWB, Illumina). 25. The beads were then washed once with 200 μl of resuspension buffer (RSB, Illumina). 26. The beads were resuspended in 20 μl of Milli-Q grade water and transferred to a 0.2 ml tube for the final PCR. 27. 20 μl of beads + DNA was combined with 25 μl of Illumina Enhanced PCR Mix (EPM) and 5 μl of PPC (PCR Primer Cocktail, Illumina). 28. The mixture was amplified by PCR: cycling procedure- 98°C for 3 min, followed by 12 cycles of (98°C for 45 sec, 60°C for 2 min, 68°C for 2 min), then 68°C for 5 min, then held at 4°C. 29. PCR products were analyzed by TapeStation D1000 (Agilent) and then subjected to further SPRI cleanup before quantification using the Qubit Broad Range dsDNA Assay Kit (Thermofisher).

[0266] Sequencing: Sequencing was performed using MiniSeq. 1. 400 μl BspQI mix was composed of 360 μl Milli-Q grade water, 40 μl rNEB3.1 buffer (NEB), and 8 μl Nt.BspQI (NEB combined). The mixture was mixed by vortexing and spun down briefly. The mixture was pipetted into the "EXT" position of the MiniSeq cartridge (position to the left of the custom primer position). 2. The library was denatured (0.1N NaOH) and diluted to a final concentration of 0.5 pM in HT1 buffer according to Illumina's protocol. 500 μl was loaded into the "library" position of the MiniSeq cartridge. 3. A standard MiniSeq run was used and setup was performed using the MiniSeq Control Software.

[0267] The results of 9QaM are shown in Figure 22, where mismatched base pairs can be identified by analyzing base calls that appear in the side or center clouds, rather than the corner clouds. The center cloud is one of the more dense clouds corresponding to mismatched base pairs, which can be mainly attributed to the (oxo-G)-A mismatched base pair.

[0268] Overall, these results show that analysis can be performed on polynucleotide sequences to identify mismatched base pairs. In particular, by allowing simultaneous sequencing of the forward and reverse complements of the template (or the reverse and forward complements of the template), mismatched base pairs can be rapidly and accurately identified. Such a process is made feasible by using the method of preparing a polynucleotide library as described herein.

[0269] Example 2-9 Methylation analysis on methylated pUC19 samples using QaM Oligo sequence: asterisk( * ) indicates a phosphorothioate bond.

[0270] Underlines indicate 5-methylcytosines instead of cytosines (in "P5_BbvCI_P7-methylated" and "BspQI_iSce_Loop-methylated" all cytosines are replaced with 5-methylcytosines to prevent undesired conversion of cytosines to uracil in the adapter sequence during bisulfite conversion).

[0271] The bold text indicates the nicking restriction site (or its complement) of Nt.BspQI, which recognizes the following sequence (nicking site indicated by an arrow):

[0272]

number

[0273] [Biotin-T] has the following structure:

[0274] [ka]

[0275] [Table 2]

[0276] Adapter Annealing: A mixture of 1.4 μl of 100 μM P5_BbvCl_P7-methylated oligo, 11 μl of water, 2 μl of 10×TEN buffer (Illumina) and 3 μl of IDTE buffer was heated to 98° C. for 30 seconds and then cooled slowly to room temperature (e.g., 0.1° C. / sec to room temperature). This results in a 20 μM stock of annealed P5_BbvCl_P7-methylated adapter. 2. Separately, a mixture of 4 μl of 100 μM BspQI_iSce_Loop-methylated oligo, 11 μl of water, 2 μl of 10×TEN buffer (Illumina) and 3 μl of IDTE buffer was heated to 98° C. for 30 seconds and then cooled slowly to room temperature (e.g., 0.1° C. / sec to room temperature). This results in a 20 μM stock of annealed BspQI_iSce_Loop-methylated adapter. 3. Mix equal amounts of the 20 μM stock of annealed P5_BbvCl_P7-methylated adapter from step 1 and the 20 μM stock of annealed BspQI_iSce_Loop-methylated adapter from step 2 together to obtain a stock solution with 10 μM of annealed P5_BbvCl_P7-methylated adapter and annealed BspQI_iSce_Loop-methylated adapter, respectively.

[0277] Library preparation 1. NEB Ultra II FS reagent was thawed at room temperature and kept on ice until use. 2. The Ultra II FS enzyme mix was vortexed for 5-8 seconds and placed on ice before use. 3. To a 0.2 ml PCR tube on ice, add 26 μl of DNA (100 ng of input DNA (methylated pUC19 sample) diluted to 26 μl with Milli-Q grade water), 7 μl of NEBNext Ultra II FS reaction buffer, and 2 μl of NEBNext Ultra II FS enzyme mix, vortex briefly, and spin in a microcentrifuge to mix. 4. In a thermocycler with the heated lid set at 75°C, the tubes were incubated at 37°C for 5 minutes, then at 65°C for 30 minutes, then held at 4°C. 5. The following was added to the FS reaction mixture from step 4: 30 μl of NEBNext Ultra II Ligation Master Mix, 1 μl of NEBNext Ligation Enhancer, and 2.5 μl of loop adapters P5_BbvCI_P7-methylated and BspQI_iSce_Loop-methylated (10 μM each) prepared from step 3 of "Adapter Annealing." 6. The entire volume was mixed by pipetting up and down 10 times, then spun briefly in a microcentrifuge. 7. The mixture was incubated at 20° C. for 15 minutes in a thermocycler with the heated lid removed. 8.3 μl of USER enzyme (NEB) was added to the ligation mixture. 9. The mixture was mixed well and incubated at 37°C for 15 minutes with the heated lid set at >47°C. 10. The adaptor ligated DNA was then size selected via 0.8x SPRI (iTune beads) selection, 57 μl of iTune beads (ILMN) were added to 68.5 μl of the ligation reaction, mixed and incubated at room temperature for 5 minutes. 11. The mixture was placed on a magnet for 5 minutes and the supernatant was discarded. 12. The beads were washed twice with 200 μl of 80% ethanol by adding 200 μl of 80% ethanol with the beads on the magnet followed by a 30 second wait, removal of the ethanol and then repeating the wash once more. 13. The last traces of ethanol were removed with a P10 pipette and tip. 14. The beads were then air dried for 5 minutes. 15. DNA was eluted from the beads with 40 μl of 0.1× TE buffer. At this stage, 20 μl was saved as a “non-converted” control, and the remaining 20 μl was processed for bisulfite conversion according to the Zymo Research EZ-96 DNA Methylation Gold MagPrep kit (steps 16-25 are taken from the kit instructions). 16. To a 0.2 ml PCR tube, add 20 μl of 0.8× SPRI selected ligation and 130 μl of CT conversion reagent (containing sodium metabisulfite). 17. The mixture was incubated on a thermocycler at 98°C for 10 minutes, then at 64°C for 2.5 hours, followed by holding at 4°C for up to 20 hours. 18. The sample was transferred to a 1.7 ml tube for the next step. 600 μl of M-Binding Buffer and 10 μl of MagBinding beads were added. The mixture was vortexed for 30 seconds. 19. Incubate at room temperature for 5 minutes and then place on magnet for 5 minutes. 20. The supernatant was removed and discarded. 400 μl of M-Wash Buffer was added to the beads and then vortexed for 30 seconds. The mixture was placed back on the magnet until the beads were pelleted. 21. The supernatant was removed and discarded. 22. 200 μl of M-Desulfonation Buffer was added to the beads, then vortexed for 30 seconds. The mixture was incubated at room temperature for 15-20 minutes. The mixture was then placed back on the magnet until the beads were pelleted. 23. The supernatant was removed and discarded. 400 μl of M-Wash Buffer was added to the beads and then vortexed for 30 seconds. The mixture was placed back on the magnet until the beads were pelleted. This wash step was repeated once. 24. Remove the supernatant after the second wash and transfer the tube to a 55°C hot block to air dry the beads for 20-30 minutes to remove any residual M-Wash Buffer. 25.25 μl of M-Elution Buffer was added to the dried beads and vortexed for 30 seconds. The elution mixture was heated to 55° C. for 4 minutes, then the tube was placed back on the magnet for 1 minute (or until the beads were pelleted). The eluate was removed and transferred to a new 1.7 mL tube. 26.175 μl HT1 buffer (ILMN hybridization buffer) and 10 μl HT1 washed MyOne Streptavidin T1 beads (Thermofisher) were added. The tube was incubated for 30 minutes at room temperature on a rocker. (This step selects for material with biotinylated loop adapters and removes material with P5 / P7 adapters at both ends). 27. The tube was placed on a magnet until the beads were pelleted. 28. The beads were washed twice with 200 μl of Tagmentation Wash Buffer (TWB, Illumina). 29. The beads were then washed once with 200 μl of resuspension buffer (RSB, Illumina). 30. The beads were resuspended in 20 μl of Milli-Q grade water and transferred to a 0.2 ml tube for the final PCR. 31. 20 μl of beads + DNA was mixed with 25 μl of Q5U Mastermix (NEB) and 5 μl of PPC (PCR Primer Cocktail, Illumina). 32. The mixture was amplified by PCR: cycling procedure- 98°C for 3 min, followed by 12 cycles of (98°C for 45 sec, 60°C for 2 min, 68°C for 2 min), then 68°C for 5 min, then held at 4°C. 33. PCR products were analyzed by TapeStation D1000 (Agilent) and then subjected to further SPRI cleanup before quantification using the Qubit Broad Range dsDNA Assay Kit (Thermofisher).

[0278] Sequencing: Sequencing was performed using MiniSeq. 1. 400 μl BspQI mix was composed of 360 μl Milli-Q grade water, 40 μl rNEB3.1 buffer (NEB), and 8 μl Nt.BspQI (NEB combined). The mixture was mixed by vortexing and spun down briefly. The mixture was pipetted into the "EXT" position of the MiniSeq cartridge (position to the left of the custom primer position). 2. The library was denatured (0.1N NaOH) and diluted to a final concentration of 0.5 pM in HT1 buffer according to Illumina's protocol. 500 μl was loaded into the "library" position of the MiniSeq cartridge. 3. A standard MiniSeq run was used and setup was performed using the MiniSeq Control Software. 4. For the CA dye swap, the standard IMX was removed from the IMX position of the MiniSeq cartridge, then the position was washed 5 times with Milli-Q grade water and replaced with 20 mL of custom IMX, replacing the standard two-dye system for A (A is represented as red and green) and one-dye system for C (C is represented as red) with the two-dye system for C (C is represented as red and green) and one-dye system for A (A is represented as red).

[0279] The 9QaM results are shown in Figures 23A-23F for six different library fragments, where modified cytosines can be identified by the characteristic clouds in the upper right and lower left corners of the plots. If the original strand in the library contained a (5mC)-G base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this corresponds to a CG base pair after bisulfite conversion. Thus, the forward strand of the template provides a C read (because the forward strand of the template has a G at the corresponding position) and the reverse complementary strand of the template also provides a C read (because the reverse complementary strand of the template also has a G at the corresponding position), thus appearing in the upper right corner of the plots in Figures 23A-23F (a (C,C) read).

[0280] In addition, if the original strand in the library contained a G-(5mC) base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this corresponds to a GC base pair after bisulfite conversion. Thus, the forward strand of the template will provide a G read (because the forward strand of the template has a C at the corresponding position), and the reverse complementary strand of the template will also provide a G read (because the reverse complementary strand of the template also has a C at the corresponding position), and thus appear in the lower left corner of the plots in Figures 23A-23F (a (G,G) read).

[0281] In contrast, if the original strand in the library contained a CG base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this corresponds to a TG mismatched base pair after bisulfite conversion (where C is converted to U and U is read as T). Thus, the forward strand of the template provides a T read (because the forward strand of the template has an A at the corresponding position) and the reverse complementary strand of the template provides a C read (because the reverse complementary strand of the template has a G at the corresponding position), thus appearing in the upper center portion of the plots in Figures 23A-23F ((T,C) reads).

[0282] If the original strand in the library contained a GC base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this corresponds to a GT mismatched base pair after bisulfite conversion (where C is converted to U and U is read as T). Thus, the forward strand of the template provides a G read (because the forward strand of the template has a C at the corresponding position) and the reverse complementary strand of the template provides an A read (because the reverse complementary strand of the template has a T at the corresponding position), thus appearing in the lower center portion of the plots in Figures 23A-23F ((G,A) reads).

[0283] If the original strand in the library contained a TA base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this remains as a TA base pair after bisulfite conversion. Thus, the forward strand of the template will provide a T read (because the forward strand of the template has an A at the corresponding position), and the reverse complementary strand of the template will also provide a T read (because the reverse complementary strand of the template also has an A at the corresponding position), and thus appear in the upper left corner of the plots in Figures 23A-F ((T,T) reads).

[0284] Finally, if the original strand in the library contained an AT base pair (the first base corresponding to the forward strand of the library polynucleotide, and the second base corresponding to the reverse strand of the library polynucleotide), this remains as an AT base pair after bisulfite conversion. Thus, the forward strand of the template will provide an A read (because the forward strand of the template has a T at the corresponding position), and the reverse complementary strand of the template will also provide an A read (because the reverse complementary strand of the template also has a T at the corresponding position), and thus appear in the lower right corner of the plots in Figures 23A-F (the (A,A) read).

[0285] [Table 3]

[0286] (Accuracy = number of correct base calls (GCAT, regardless of methylation status) / total number of bases; Sensitivity = number of true positive methylated base calls / total number of methylated bases; Specificity = number of true negative methylated base calls / (number of true negative methylated base calls + number of false positive methylated base calls))

[0287] Overall, these results indicate that methylation analysis can be performed on polynucleotide sequences to identify modified cytosines. In particular, by allowing simultaneous sequencing of the forward and reverse complements of the template (or the reverse and forward complements of the template), modified cytosines can be rapidly and accurately identified. Again, such a process is made feasible by using the methods of preparing polynucleotide libraries as described herein.

[0288] Sequence Listing SEQ ID NO:1: P5 sequence AATGATACGGCGACCACCGAGATCTACAC SEQ ID NO:2: P7 sequence CAAGCAGAAGACGGCATACGAGAT SEQ ID NO:3: P5' sequence (complementary to P5) GTGTAGATCTCGGTGGTCGCCGTATCATT SEQ ID NO:4: P7' sequence (complementary to P7) ATCTCGTATGCCGTCTTCTGCTTG SEQ ID NO: 5: Alternative P5 sequence AATGATACGGCGACCGA SEQ ID NO:6: Alternative P5' sequence (complementary to alternative P5 sequence) TCGGTCGCCGTATCATT

Claims

1. A method for preparing at least one polynucleotide library strand template, The first adapter is attached to the first end of a double-stranded polynucleotide sequence, wherein the first end includes the 3' end of the forward strand and the 5' end of the reverse strand of the double-stranded polynucleotide sequence. The method involves attaching a second adapter to the second end of a double-stranded polynucleotide sequence, wherein the second end includes the 5' end of the forward strand and the 3' end of the reverse strand of the double-stranded polynucleotide sequence. The first adapter comprises a polynucleotide loop, and the second adapter comprises at least one primer-binding sequence and at least one primer-binding complementary sequence. A method wherein the first adapter includes a first restriction site for an endonuclease, and / or the second adapter further includes at least one cleavable site and / or a complement of the cleavable site.

2. The method according to claim 1, wherein the first adapter includes a base-paired stem and a loop, and the first limiting region is located within the base-paired stem or within the loop.

3. The method according to claim 1, wherein the first restricting site is a restricting site of a nickeling endonuclease or a restricting endonuclease.

4. The method according to claim 1, wherein the second adapter comprises (a) at least one cleavable site and / or a complement of a cleavable site, (b) a base-paired stem and fork, wherein the fork comprises a base-paired stem and fork comprising a primer-binding complementary sequence and a primer-binding sequence, and / or (c) a base-paired stem and loop, wherein the loop comprises a base-paired stem and loop comprising a second cleavable site.

5. The method according to claim 1, wherein the cleavable site and / or complement of the cleavable site is (i) located in a base-paired stem and / or (ii) a restricting site of a nickeling endonuclease, preferably the restricting site is a second restricting site.

6. The method according to claim 1, wherein the first adapter further includes an affinity tag.

7. A polynucleotide library strand for sequencing, comprising a first adapter, a double-stranded polynucleotide sequence to be identified, and a second adapter, The first adapter is bonded to the first end of the double-stranded polynucleotide sequence, and the first end includes the 3' end of the forward strand and the 5' end of the reverse strand of the double-stranded polynucleotide sequence. The second adapter is bonded to the second end of the double-stranded polynucleotide sequence, and the second end includes the 5' end of the forward strand and the 3' end of the reverse strand of the double-stranded polynucleotide sequence. The first adapter includes a base-paired stem and loop, The second adapter includes a base-paired stem, a primer-binding complementary sequence, and a primer-binding sequence. The first adapter comprises a polynucleotide library strand containing at least one restriction site for endonucleases.

8. The polynucleotide library chain according to claim 7, wherein the second adapter includes at least one cleavable site and / or a complement of the cleavable site, the cleavable site and / or the complement of the cleavable site is preferably a limiting site of a nickel endonuclease.

9. A method for identifying at least a first region of a polynucleotide sequence, a. Prepare at least one polynucleotide library strand as described above, b. Amplifying the polynucleotide library strand to generate first and second library strands, wherein each library strand includes the first and second regions, c. Hybridizing the first or second library chain to the first and second immobilization primers on a solid support, respectively, and performing a first extension reaction to generate the first or second immobilization template chain, d. Hybridizing the first or second immobilized template chain with the second or first immobilized primer, respectively, and performing a second extension reaction to generate the second and first immobilized template chains, e. Hybridizing the first and second immobilized template chains, f. Applying the first endonuclease, g. A method comprising determining the arrangement of the first and second immobilized template chains, wherein determining the arrangement of the first and second immobilized template chains is equivalent to identifying a first region.

10. The method according to claim 9, wherein identification comprises determining the sequence of a first region and / or identifying any epigenetic modification, wherein the epigenetic modification is preferably a modified cytosine.

11. The method according to claim 9, wherein each first and second library strand comprises a primer-binding complementary sequence, a first portion, a first adapter sequence, a second portion, and a primer-binding sequence, the first adapter comprising a first restriction site of an endonuclease.

12. The method according to claim 11, wherein the primer binding sequence and the primer binding complementary sequence include at least one cleavable site and / or a complement of the cleavable site.

13. The method according to claim 12, wherein the cleavable site and / or a complement of the cleavable site is a second restriction site, and / or at least one nickel endonuclease cleaves the second restriction site and the immobilized chain is sequenced by double-stranded SBS (synthetic sequencing).

14. The method according to claim 9, wherein, after cutting the first restricting region, (a) the unimmobilized library strand is dehybridized and the immobilized template strand is sequenced by single-stranded SBS (sequencing), (b) the immobilized template strand is sequenced by double-stranded SBS (sequencing), or (c) both (a) and (b).

15. The method according to claim 9, wherein at least one nickel endonuclease cleaves the second restriction site and the immobilized chain is sequenced by double-stranded SBS (synthetic sequencing).

16. The method according to claim 9, further comprising blocking all or substantially all of the 3' ends of the sequenced immobilized strand.

17. The method according to claim 9, further comprising applying a second nickeling endonuclease and sequencing the first and second immobilized template chains to identify a second region, wherein the second nickeling endonuclease cleaves a restriction site different from that of the first nickeling endonuclease.

18. The method according to claim 9, wherein the method comprises (i) carrying out an extension reaction to regenerate the first and second immobilized chains, (ii) applying a second nickel endonuclease and sequencing the first and second immobilized template chains to identify a second region, wherein the second nickel endonuclease cleaves a restriction site different from that of the first nickel endonuclease, or (iii) further comprising both (i) and (ii).

19. A reverse repeat tandem insert polynucleotide library chain for sequencing, wherein the library chain comprises a primer-binding complementary sequence, a first portion to be identified, a first adapter sequence, a second portion to be identified, and a primer-binding sequence, wherein the sequence of the second portion is reversed with respect to the first portion, and the loop sequence comprises at least one restriction site.

20. A library preparation kit comprising a plurality of first adapters and a plurality of second adapters, wherein the first adapter comprises a base-paired stem and loop, the first adapter comprises at least one restriction site, and the second adapter comprises a base-paired stem, a primer-binding sequence and a primer-binding complementary sequence, and optionally the second adapter comprises at least one restriction site.