Tomato plants resistant to tomato spotted wilt virus

Abstract

The present invention relates to a plant of the species S. lycopersicum that is resistant to a tospovirus, wherein the plant comprises a TSWV resistance gene. More specifically, the present invention relates to a tomato plant (S. lycopersicum) that is resistant to Tomato spotted wilt virus (TSWV). The present invention further relates to a resistance gene or genomic sequence that provides resistance to a tospovirus. Furthermore, the present invention relates to a method for providing a S. lycopersicum plant that is resistant to a tospovirus.

Description

[Technical field]

[0001] The present invention relates to a plant of the species S. lycopersicum that is resistant to a tospovirus, which plant comprises a TSWV resistance gene. More specifically, the present invention relates to a tomato plant (S. lycopersicum) that is resistant to Tomato spotted wilt virus (TSWV). The present invention further relates to a resistance gene or genomic sequence that provides resistance to a tospovirus. Furthermore, the present invention relates to a method for providing a S. lycopersicum plant that is resistant to a tospovirus. [Background technology]

[0002] Tospoviruses are severe plant pathogens with a wide host range, infecting over 1000 plant species belonging to 80 different families. These include any of the food crops, including watermelon, pepper, zucchini, and tomato. Transmission of Tospoviruses is usually via thrips, and Tospoviruses are prevalent in warm climates in areas with high thrips populations. The Tospovirus genus includes Tomato spotted wilt virus (TSWV), Groundnut ringspot virus (GRSV), Groundnut bud necrosis virus (GBNV), Capsicum chlorotic virus (CaCV), and Tomato chlorotic spot virus (TCSV). TSWV has been described as an emerging viral disease of plants, causing severe losses in economically important crops and is one of the most economically destructive plant viruses in the world. Infection by tospoviruses results in plant spotting and wilting, reduced plant yield, and ultimately death. The most efficient way to contain the disease is genetic resistance. No antiviral treatment exists for tospovirus-infected plants, and infected plants must be removed from the field and destroyed to prevent the spread of the disease. Tospoviruses cause estimated crop losses of US$1 billion per year and are considered one of the most destructive plant viruses worldwide.

[0003] Plants use both cell surface resident pattern recognition receptors (PRRs) and intracellular nucleotide-binding leucine-rich repeat (NLR) receptors to detect a variety of pathogens, including tospoviruses. PRRs recognize conserved pathogen-associated molecular patterns (PAMPs) to provide broad-spectrum resistance, whereas NLRs detect pathogen strain-specific effectors to confer cultivar-specific resistance. Plant NLRs recognize small conserved peptides of phylogenetically related pathogens. The tomato Sw-5 resistance gene is an NLR (Brommonschenkel and Tanksley, 1997) and is an effective dominant resistance gene that provides broad-spectrum resistance to tomato-infecting tospoviruses, including Tomato Spotted Wilt Virus (TSWV), Peanut Ring Mottle Virus (GRSV), and Tomato Chlorotic Spot Virus (TCSV). The Sw-5 protein recognizes the TSWV movement protein, which is required for cell-to-cell movement and systemic infection of tospoviruses.

[0004] In the fight against tospoviruses, resistance has been introduced into tomatoes by the transfer of the Sw-5 gene, resulting in resistance. However, new strains of tospoviruses that have overcome resistance have recently emerged, and Sw-5 resistance-breaking tospovirus species (more specifically TSWV strains) have been reported in Australia, the United States, Europe and Mexico. Although Sw-5 resistance is still very useful, these resistance-breaking strains of TSWV are becoming more widespread around the world and creating increasing problems. Therefore, there is a need to identify and / or combine new resistance genes to provide crops that are resistant, especially to new TSWV strains. Summary of the Invention

[0005] In view of the above, there is a need in the art for TSWV-resistant tomato plants, more specifically, TSWV-resistant S. lycopersicum. More specifically, there is a need for TSWV-resistant plants that are resistant to resistance-breaking isolates of TSWV. Furthermore, there is a need in the art for providing methods and means for providing TSWV-resistant S. lycopersicum plants.

[0006] It is an object of the present invention, among other objects, to address the above-mentioned needs in the art, which are achieved, among other objects, by the invention as outlined in the appended claims. [Brief description of the drawings]

[0007] [Figure 1-1] FIG. 1 shows the protein sequence (SEQ ID NO: 1), coding sequence (SEQ ID NO: 2) and genomic sequence (SEQ ID NO: 3) of the TSWV resistance gene of the present invention, including the transcript sequence (SEQ ID NO: 4, coding sequence including UTR sequence). [Figure 1-2] This is a continuation of Figure 1-1. [Figure 1-3] This is a continuation of Figure 1-2. [Figure 1-4] This is a continuation of Figure 1-3. [Figure 1-5] This is a continuation of Figure 1-4. [Figure 1-6] This is a continuation of Figure 1-5. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0008] Specifically, the above objects, among other objects, are achieved according to the present invention, according to a first aspect, by a plant of the species S. lycopersicum, which is resistant to tospoviruses, comprising a TSWV resistance gene encoding a TSWV resistance protein, said protein having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, preferably at least 95%, more preferably at least 98%, even more preferably at least 99%, most preferably 100% amino acid sequence identity with SEQ ID NO: 1. The plant may comprise a TSWV resistance gene encoding a TSWV resistance protein of Solanum (S.) pervianum. The TSWV resistance gene is predicted to encode an NBS-LRR resistance protein. Pathogen recognition by plants occurs via two related families of host receptors, which comprise two main types of proteins, namely receptor-like kinases or proteins (RLKs or RLPs) and nucleotide-binding site leucine-rich repeat proteins (NBS-LRR resistance proteins). The first group is the pattern recognition receptors (PRRs) that are specialized for the recognition of pathogen-associated molecular patterns (PAMPS). RLPs or RLKs are extracellular immune receptors that are attached to the cell membrane. Plant RLKs are involved in plant pathogen interactions and defense responses, and plant receptor kinases (PRKs) can be defined as proteins that contain an extracellular domain, a single transmembrane domain, and a cytoplasmic serine / threonine (ser / thr) protein kinase domain. Plant LRR-RLKs (leucine-rich repeat receptor-like kinases) have a functional cytoplasmic kinase domain, and all plant LRR-RLKs analyzed so far have ser / thr kinase activity. The resistance to pathogens provided by these receptors is called PAMP-induced immunity (PTI). The other group mainly includes intracellular receptors called resistance proteins (R proteins). The majority of disease resistance genes in plants encode nucleotide-binding site leucine-rich repeat proteins, also known as NBS-LRR proteins.These proteins are characterized by nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains, as well as variable amino- and carboxy-terminal domains, and are involved in the detection of a variety of pathogens, including bacteria, viruses, fungi, nematodes, insects, and oomycetes. Most of the identified genomic sequences that confer tospovirus resistance contain multiple LRR domains. These domains are thought to determine effector recognition and therefore disease susceptibility / resistance.

[0009] Pathogens develop counter strategies to overcome PTI by modifying or altering PAMPs or MAMPs. Alternatively, plants have developed another way to recognize pathogens by triggering a faster and stronger secondary defense response known as effector-induced immunity (ETI). ETI is mediated by R proteins that recognize so-called pathogen effectors and result in localized cell death around the infection site. The availability of newly identified resistance genes and / or genomic regions encoding NBS-LRR proteins and / or plant receptor kinases may reduce the chances of pathogens overcoming resistance or, if combined with other resistance genes, disease resistance may be further improved.

[0010] According to a preferred embodiment, the present invention relates to a plant, wherein the TSWV resistance gene comprises a coding sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, preferably at least 95%, more preferably at least 98%, even more preferably at least 99%, and most preferably 100% sequence identity with SEQ ID NO: 2 and / or SEQ ID NO: 4. SEQ ID NO: 2 is the coding sequence of the TSWV resistance gene, and SEQ ID NO: 4 is similar to SEQ ID NO: 2 but additionally comprises the UTR sequence of the TSWV resistance gene.

[0011] According to another preferred embodiment, the present invention relates to a plant comprising a genomic sequence having at least 90%, preferably at least 95% sequence identity with SEQ ID NO: 3. The genomic sequence comprises a plurality of sequences having homology with sequences encoding NBS-LRR resistance proteins. The genomic sequence encodes one or more genes and / or genetic elements that provide resistance to Tospoviruses. The sequences have been tested for gene homology using the public databases of the National Center for Biotechnology Information (NCBI). Three genomic sequences have homology with sequences encoding NBS-LRR resistance proteins. One of these specific sequences was proven to contain a TSWV resistance gene after VIGS silencing experiments.

[0012] According to a preferred embodiment of the present invention, the plant detailed above is not a plant obtained exclusively by an essentially biological process. The genomic regions or fragments can be introduced into tomato plants by introgression, but since the nucleotide sequences of the genomic fragments are known, these genomic fragments can be constructed artificially, for example in yeast, and then recombined with the susceptible tomato genome. Alternatively, these genomic regions or fragments can be amplified by long-range PCR amplification, and the obtained amplified fragments can be transformed into tomato cells in a single step or in a series of transformations, finally obtaining the tomato plant. The genomic fragments of the present invention can also be isolated, completely or in parts that are subsequently reconstructed, for example after restriction digestion from a gel or column, and then transformed into tomato cells. Furthermore, mutations, deletions or insertions in the genome can be obtained by EMS mutagenesis and / or CRISPR techniques. As a further alternative, the genomic fragment of interest can be introduced into a vector under a (strong) promoter. A susceptible plant can then be transformed with the vector, and the sequence of interest is expressed resulting in resistance. These techniques are readily available to the skilled person. The construction of artificial chromosomes containing the genomic fragments is also contemplated within the context of the present invention.

[0013] In another preferred embodiment, the present invention relates to a plant, wherein the tospovirus is one or more selected from the group consisting of Tomato spotted wilt virus (TSWV), Peanut ring spot virus (GRSV), Peanut bud necrosis virus (GBNV), Pepper chlorotic virus (CaCV), and Tomato chlorotic spot virus (TCSV), preferably TSWV.

[0014] According to yet another preferred embodiment, the present invention relates to a plant which is resistant to Tomato spotted wilt virus (TSWV).

[0015] According to yet another preferred embodiment, the present invention relates to a plant in which the TSWV comprises a C118Y mutation and / or a T120N mutation in the nonstructural movement (NSm) protein of TSWV. The present TSWV resistance disrupting strain, for example the virus isolate AJ137, is known to comprise a C118Y mutation and / or a T120N mutation. The present plant shows resistance to this specific TSWV resistance disrupting virus containing a C118Y mutation. Two mutations have been described, both resulting in amino acid changes C118Y and T120N in the nonstructural movement (NSm) protein of TSWV (GenBank: ATL64765.1). These amino acids are located in the 21 amino acid region of the NSm protein that is recognized by the Sw-5 protein (Zhu et al., 2017). The increased cultivation of the Sw-5 variant has recently led to the emergence of resistance disrupting strains of TSWV in California, all of which contained the C118Y mutation (Batuman et al., 2018).

[0016] According to yet another preferred embodiment, the present invention relates to a plant, in which the genomic sequence and / or the TSWV resistance gene is homozygous present in the genome of said plant. From the experimental data it can be concluded that the resistance is incompletely dominant and that in order to provide complete resistance to Tospoviruses, the TSWV resistance gene and / or the genomic sequence must be homozygous present in the genome of the plant.

[0017] According to another preferred embodiment, the present invention relates to a plant, wherein the TSWV resistance gene and / or genome sequence is found in deposit accession number NCIMB 43771. Solanum lycopersicum seeds were deposited on May 7, 2021 at NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, AB21 9YA Aberdeen, UK. These seeds can be obtained by crossing with wild tomato plants of Solanum peruvianum obtained from the Tomato Genetic Resources and Research Centre, Department of Plant Sciences, University of California, Davis, USA.

[0018] According to a preferred embodiment, the present invention relates to a plant further comprising a Sw-5 resistance gene encoding a Sw-5 protein having at least 95% amino acid sequence identity, more preferably at least 98%, even more preferably at least 99%, and most preferably 100% sequence identity to SEQ ID NO: 11. The coding sequence encoding the Sw-5 protein is included herein as SEQ ID NO: 12.

[0019] According to a second aspect, the present invention relates to plants, plant parts, tissues, cells and / or seeds, including progeny plants derived from the plants of the present invention.

[0020] The present invention relates according to a further aspect to a resistance gene for providing resistance to Tospovirus in S. lycopersicum plants (TSWV resistance gene), said resistance gene being represented by a coding sequence having at least 90% nucleotide sequence identity with SEQ ID NO: 2 and / or SEQ ID NO: 4. The resistance gene may be part of a composition, in which the gene or genomic sequence is combined with other sequences, for example in a vector or gene expression construct.

[0021] According to a further aspect, the present invention relates to a genomic sequence for providing resistance to Tospovirus in S. lycopersicum plants, the genomic sequence having at least 90% sequence identity with SEQ ID NO:3, at least 91%, at least 92%, at least 93%, at least 94%, preferably at least 95%, more preferably at least 98%, even more preferably at least 99%, and most preferably 100% sequence identity.

[0022] According to a further aspect, the present invention relates to a resistance gene or genomic sequence for providing resistance in S. lycopersicum plants to a tospovirus, the tospovirus being one or more selected from the group consisting of Tomato spotted wilt virus (TSWV), Peanut ring mottle virus (GRSV), Peanut bud necrosis virus (GBNV), Pepper chlorotic virus (CaCV) and Tomato chlorotic spot virus (TCSV), preferably TSWV. According to a preferred embodiment of the present invention, the resistance gene, genomic sequence or resistance locus provides resistance to TSWV. The TSWV preferably comprises a C118Y and / or a T120N mutation in the nonstructural movement (NSm) protein of TSWV.

[0023] According to a further aspect, the present invention relates to a method for providing a plant of the species S. lycopersicum which is resistant to a tospovirus, comprising the steps of: a) selecting tomato plants that are resistant to Tospovirus, said selection comprising establishing the presence of a TSWV resistance gene or a TSWV genomic sequence of the invention; and b) introducing the identified genomic sequence or locus of step a) into a S. lycopersicum plant, thereby conferring Tospovirus resistance to said S. lycopersicum plant. The introduction can be carried out, for example, by crossing a selected resistant tomato plant (e.g., S. pervianum) with S. lycopersicum. Tospovirus-resistant S. lycopersicum plants can then be selected.

[0024] According to yet another preferred embodiment, the present invention relates to a method, wherein said tomato plant that is resistant to Tospovirus is a S. lycopersicum or S. pervianum plant, preferably a S. pervianum plant.

[0025] According to another preferred embodiment, the present invention relates to a method, wherein after step b), a first S. lycopersicum plant that is resistant to Tospovirus is selected and crossed with a second S. lycopersicum plant that is not resistant to Tospovirus, followed by selection of a S. lycopersicum plant that is resistant to Tospovirus.

[0026] According to a preferred embodiment, the present invention relates to a method, wherein in step a) the establishment of the presence of a resistance gene (TSWV resistance gene) or a resistance-conferring genomic sequence in a tomato plant is carried out by means of one or more markers selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 and SEQ ID NO: 10, preferably SEQ ID NO: 9 and 10.

[0027] According to a further aspect, the present invention relates to the use of a marker for establishing the presence of a TSWV resistance gene or a resistance-conferring genomic sequence according to claim 8 or 9 in a tomato plant, wherein the marker is one or more selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10, preferably SEQ ID NO:9 and SEQ ID NO:10.

[0028] According to a further aspect, the present invention relates to a method for providing a tomato plant that is resistant to the above-mentioned Tospovirus, the method comprising the step of introducing into the genome of a susceptible tomato plant a TSWV resistance gene encoding a TSWV resistance protein, the protein having at least 90% amino acid sequence identity with SEQ ID NO:1.

[0029] According to a preferred embodiment, the present invention relates to a method for providing a tomato plant resistant to tospovirus, wherein the step of introducing a TSWV resistance gene is achieved by genome editing techniques, such as CRISPR Cas. The resistance gene, or a genome fragment, can be inserted into the genome via CRISPR technology, either completely or in a part that is subsequently reconstructed.

[0030] The invention is explained in further detail in the figures and examples. EXAMPLES

[0031] Inoculation of tomato plants with TSWV and identification of resistance.

[0032] Disease assays were performed using TSWV isolate D191 (Sw-5 disrupted isolate, Australia). As plant material, line OT9, a tomato inbred line susceptible to TSWV, was used for virus maintenance. Symptomatic leaves from the original sample were used for sap mechanical inoculation into line OT9. The virus was maintained in systemically infected tomato plants OT9 by monthly sap mechanical inoculation of new 3-week-old seedlings.

[0033] Tomato plants (S. peruvianum) were screened. Seeds were sown in vermiculite and seedlings were transplanted into rockwool blocks and inoculated 4 weeks after sowing. Plants were inoculated by mechanical infection with a virus suspension at the 4th leaf stage. Plants were scored for visual symptoms. The presence of small brownish ring spots on the leaves, leaf deformation (purple coloration and upward curling of the leaves, and stunting of the leaves), and wilting of the plants were monitored. If no such symptoms were observed on the leaves and plants, the plants were classified as "resistant". Plants showing any symptoms were classified as "susceptible". Leaf samples were collected from symptomless plants (i.e. resistant) and tested for the presence of the virus by ELISA. Resistant plants were selected from this test. Plant line OT1286 (containing the Sw-5 resistance gene) and susceptible plant line OT9 were used as controls.

[0034] Screening allowed the selection of several candidates for resistance breeding. Cuttings from the resistant F1 plants were used to produce F2 seeds. As these F1 plants were self-incompatible, F2 seeds were obtained by performing crosses with different F1 plants (in the same background), and the F2 seeds were tested with the isolate D191, which showed incomplete dominant inheritance of a single gene.

[0035] Determination of TSWV infection by ELISA Infection was determined by ELISA. One apical leaf (fully expanded) of every plant was taken. The leaves were crushed using a R302 D63N-472 machine (VECTOR aandrijftechniek BV, Rotterdam, The Netherlands) and the sap was collected by adding 2 mL of PBS-Tween buffer. 100 μL of extract was used for ELISA with an antibody against TSWV (supplied by Prime Diagnostics, Wageningen, The Netherlands). ELISA readings were taken by measuring the absorbance at 405 nm using a FLUOstar Galaxy instrument. Plants that gave an absorbance value more than 1.5 times that of clean control plants were considered infected (susceptible).

[0036] Bioassay and mapping of TSWV resistance genomic sequences The F2 population containing 276 plants was tested in a bioassay with TSWV isolate D191. Plants were visually phenotyped (as described above) and resistant plants were measured by Elisa. All plants were saved for F3 seed production. Plants that produced F3 seeds were tested in the D191 bioassay. Based on these results, a selection of 94 F2 plants was made for DNA genotyping with 96 markers distributed across the tomato genome. Markers located at the end of chromosome 11 were associated with the resistance phenotype.

[0037] A segregating population of about 1600 plants was then genotyped with flanking markers M1 (position 51044245bp on chromosome 11) and M2 (position 52849899bp) to select recombinant plants for fine mapping using TSWV No. AJ137 isolate. 25 markers between M1 and M2 were then developed for fine mapping of resistance, and resistance was further fine-mapped to a position between 52333713bp and 52385754bp. Selected plants after fine mapping were kept for F3 seed production for further fine mapping, resulting in a region of 52373639bp to 52385754bp based on markers M18 and M22, which is a region of 12.114bp based on reference genome SL2.40 (see Table 1). Based on the reference genome SL2.40 and in silico prediction analysis (ITAG2.3), one gene, Solyc11g072000.1, is present in the fine-mapped region encoding an NBS-LRR resistance protein.

[0038] The recombinant plants were further genotyped using an additional genetic marker, M27 (Table 1), which is located on the gene transcript of the newly identified TSWV resistance locus and is 100% associated with TSWV resistance (see also Table 2).

[0039] [Table 1]

[0040] Identification and sequencing of the TSWV resistance locus in a TSWV-resistant plant (LYC00346) Genomic DNA was isolated from the resistant plant of the present invention (LYC00346, S. lycopersicum), i.e., a plant containing a TSWV resistance locus, according to the protocol published in Nature, Protocol Exchange (2018), Rachael Workman et al., "High Molecular Weight DNA Extraction from Recalcitrant Plant Species for Third Generation Sequencing" on April 27, 2018. Sequencing libraries were prepared using the PCR-free, non-multiplex, DNA ligation sequencing kit-Promethion (SQK-LSK109). The isolation procedure yielded high-quality sequencing libraries used for sequencing (ONT sequencing) on ​​the Oxford Nanopore system. Promethion Flowcell Packs (3000 pores / flowcell) version R9.4.1 were used for sequencing.

[0041] In addition, to further elucidate the TSWV locus and identify genes that provide TSWV resistance, we performed ONT sequencing on the resistant plants. Sequencing of all transcript isoforms in the resistant plants was performed using the Iso-Seq analysis application (Pacific Biosciences of California, PacBio).

[0042] Sequencing the resistance LYC00346 region using Oxford Nanopore sequencing technology yielded a locus of 32,928 bp. Based on fine mapping, the size and location of the genome sequence carrying the TSWV resistance gene, designated as the Sw-8 locus between markers M18 and M22, is 20,814 bp larger than the SL2.40 reference genome of S. lycopersicum (12,114 bp vs. 32,928 bp, respectively). Thus, it is highly likely that one or more genes are located in this region and provide TSWV resistance.

[0043] Based on the reference genome SL2.40 and in silico prediction analysis (ITAG2.3), at least one gene is located in the fine-mapped region encoding a CC-NBS-LRR resistance protein, and is represented in the present application as SEQ ID NO:1.

[0044] Verification of resistance to TSWV strains in plants containing a TSWV resistance locus including the Sw-8 resistance gene Two resistance-breaking mutations have been described in TSWV, both resulting in amino acid changes C118Y and T120N in the nonstructural movement (NSm) protein. These amino acids are located in the 21 amino acid region of the NSm protein that is recognized by the Sw-5 protein (Zhu et al., 2017). Increased cultivation of Sw-5 variants has recently led to the emergence of resistance-breaking strains of TSWV in California, USA, and all of these strains were determined to contain the C118Y mutation (Batuman et al., 2018). Our diagnostic pipeline identified several resistance-breaking isolates of TSWV in samples from the USA (AJ137) and Italy (AJ034), and sequence analysis of the NSm gene showed that these breaker isolates have the mutation at amino acid 118 described as a determinant of breaker isolates, and the identified strains have the amino acid C118Y mutation.

[0045] The inventors confirmed the resistance-breaking properties of these isolates by bioassays with the Sw-5 germplasm, whereas the germplasm containing the Sw-8 locus was shown to be resistant to these isolates. Several tomato plants (S. lycopersicum) of the invention containing the Sw-8 locus were tested for resistance to these TSWV isolates AJ034 (Italy) and AJ137 (USA). The presence of the Sw-8 locus was determined by the marker M27 (Table 2). As a control, a plant was selected that did not contain the TSWV resistance locus (OT9). Table 2 shows the results obtained with the AJ034 and AJ137 isolates.

[0046] [Table 2]

[0047] Plants according to the invention, ie at least when marker M27 is present, have been shown to be resistant to the AJ034 and AJ137 isolates, indicating that the plants according to the invention are resistant to the C118Y disrupted TSWV isolate.

[0048] Transcriptional analysis and identification of TSWV resistance genes To further elucidate the TSWV resistance locus and identify TSWV resistance genes that confer Sw-8 resistance, we sequenced all transcript isoforms of the resistant LYC00346 line using the Iso-Seq analysis application (Pacific Biosciences of California, PacBio), which yielded three candidate transcripts located at 3991 to 9274 bp (transcript 1), 10.393 to 20.755 bp (transcript 2), and 26.332 to 31.426 bp (transcript 3) of the Sw-8 resistance locus, respectively.

[0049] The transcript sequences were searched for gene homology using the public databases of the National Center for Biotechnology Information (NCBI). All three transcript sequences share homology with sequences encoding NBS-LRR resistance proteins.

[0050] Genetic validation using VIGS We further investigated the function of the identified transcripts that provide TSWV resistance and sought to identify whether one or more of these transcripts are in fact genes that confer resistance to TSWV. Therefore, virus-induced gene silencing (VIGS) analysis was performed. Tobacco rattle virus (TRV)-derived VIGS vectors have been extensively described to study gene function in plants such as Arabidopsis thaliana, Nicotiana benthamiana, Solanum lycopersicum, and other plants (see, e.g., Huang C, Qian Y, Li Z, Zhou X.:Virus-induced gene silencing and its application in plant functional genomics., Sci China Life Sci., 2012;55(2):99-108).

[0051] Therefore, three VIGS constructs were developed (Table 3, VIGS-1, VIGS-2 and VIGS-3), with each construct VIGS-1, 2 or 3 specifically targeting transcript 1, 2 or transcript 3, respectively.

[0052] [Table 3]

[0053] VIGS fragments were synthesized (IDT, gBlocks) and then cloned into the TRV vector. The DNA sequence was confirmed by Sanger sequencing. The vector contains all sequences encoding proteins required for functional TRV particles, including the target sequence. The VIGS vector containing the VIGS construct was transformed into Agrobacterium tumefaciens strain GV3101 and used in VIGS experiments to reduce endogenous mRNA levels in the tomato plants used in this experiment. The homozygous Sw-8 resistant line of the present invention (0511-003), a line containing the Sw-5 resistance gene (OT1286) and a susceptible control line (OT9) were used in the VIGS experiment, and the plants were infiltrated with Agrobacterium at the seedling stage (cotyledon) followed by TSWV inoculation 3 weeks after Agrobacterium infiltration. Two weeks after TSWV inoculation, individual plants were phenotyped by ELISA.

[0054] OT9 and Sw-5 plants were susceptible as expected. The Sw-8 resistant line 0511-003, previously shown to be completely resistant, became susceptible to TSWV when transcript 3 was silenced using a VIGS-3 construct designed to specifically target this gene, whereas silencing using VIGS-1 and 2 constructs did not result in any susceptibility of the plants tested. Based on these results, it can be concluded that gene 3 confers a resistance gene to TSWV. Susceptibility was found in resistant plants infiltrated with construct VIGS-3, whereas little susceptibility was detected in resistant plants infiltrated with constructs VIGS-1 and 2 (Table 4). Based on these results, it can be concluded that the coding sequence of transcript 3 (included herein as SEQ ID NO: 4) confers resistance to TSWV.

[0055] [Table 4]

[0056] Targeted insertion of Sw-8 gene in S. lycopersicum by CRISPR / Cas9 By using the CRISPR / Cas9 system, double-strand breaks (DSBs) can be introduced into the genome of tomato plants. These DSBs can be repaired by two mechanisms: non-homologous end joining (NHEJ) or homology-directed repair (HDR). HDR depends on the presence of a donor repair template (DRT) in the vicinity of the DSB. It has been shown that for several crops, the low efficiency of HDR can be improved by providing sufficient donor repair templates in cells, including tobacco and tomato, using geminivirus replicons (GVRs) (Baltes et al., 2014; Cermak et al., 2015; Dahan-Meir et al., 2018). By using this system in combination with a replicon of BYDV (Bean yellow dwarf virus), it is possible to achieve targeted integration of DNA into the genome, i.e., into a target region of chromosome 11 of tomato plants (S. lycopersicum). The donor sequence was flanked on both sides by 250 bp homology arms matching the sequences flanking the DSB to facilitate directional insertion.

[0057] Plants were transformed with one construct that contained all the components for the gene insertion strategy. Briefly, this construct was adapted from Dahan-Meir et al. with minor modifications, and consisted of Cas9 under the Ubi10 promoter, a gRNA targeted to the fine mapping location in S. lycopersicum on chromosome 11 driven by the U6-26 promoter. The sequence of the gRNA was ACCAAGTATAACCCAACAAG TGG(PAM sequence underlined) and is located in the intergenic region immediately adjacent to Solyc11g072000.1. This plasmid further contains the viral rolling circle replication (RCR) components, the replication initiator complex (Rep and RepA), and the long and short intergenic regions (LIR, SIR), all of which are described in Dahan-Meir et al. Through this experimental setup, strong Cas9 expression and efficient amplification of the donor template were achieved, since all components are present in one construct. In the replicon sequence, the Sw-8 sequence was incorporated. To obtain proper expression, we added 500 bp before the start codon, including the UTR and promoter regions. The coding sequence (SEQ ID NO: 2), consisting of 3966 bp combined with 500 bp, and two 250 bp homology arms, generated a total of 4966 bp of template and were included in the replicon.

[0058] Tomato cotyledon transformation using Agrobacterium was then performed essentially as described by Van Eck et al. (2018). To verify integration of the Sw-8 gene, a specific PCR was performed using primers that would generate only one amplicon on successfully repaired HDR events, one primer annealing to Sw-8 and one primer annealing to the insertion position just outside the 250 bp homology arms to prevent false positives due to amplification of non-integrated donors.

[0059] The amplicons were then Sanger sequenced to confirm the correct insertion. Plants containing the Sw-8 gene were set to seed and the T1 progeny were genotyped again to confirm heritability. The plants were subjected to a TSWV test and disease symptoms were recorded. The expected resistance phenotype was observed, and no TSWV disease symptoms were observed in plants containing the Sw-8 gene.

Claims

1. 1. A plant of the species S. lycopersicum that is resistant to a Tospovirus, said plant comprising a TSWV resistance gene encoding a TSWV resistance protein, said protein having at least 90% amino acid sequence identity with SEQ ID NO:

1.

2. The plant of claim 1 , wherein the TSWV resistance gene comprises a coding sequence having at least 90% sequence identity to SEQ ID NO:2 and / or SEQ ID NO:

4.

3. 3. The plant of claim 1 or 2, comprising a genomic sequence having at least 90% sequence identity with SEQ ID NO:

3.

4. The plant according to any one of claims 1 to 3, wherein the tospovirus is one or more selected from the group consisting of Tomato spotted wilt virus (TSWV), Peanut ring spot virus (GRSV), Peanut bud necrosis virus (GBNV), Pepper chlorotic virus (CaCV), and Tomato chlorotic spot virus (TCSV), preferably TSWV.

5. The plant of claim 4 , wherein the TSWV comprises a C118Y mutation and / or a T120N mutation in a nonstructural movement (NSm) protein of TSWV.

6. The plant according to any one of claims 1 to 5, wherein the TSWV resistance gene is present in the genome of the plant in a homozygous form.

7. 7. The plant of claim 1, wherein the TSWV resistance gene is found in deposit accession number NCIMB 43771.

8. The plant of any one of claims 1 to 7, wherein the plant further comprises a Sw-5 resistance gene encoding a Sw-5 protein having at least 95% amino acid sequence identity to SEQ ID NO:

11.

9. The plant according to any one of claims 1 to 8, wherein the TSWV resistance protein is a Solanum pervianum protein.

10. A plant, plant part, tissue, cell and / or seed derived from the plant according to any one of claims 1 to 8.

11. 1. A resistance gene for providing resistance to Tospovirus in S. lycopersicum plants, the resistance gene being represented by a coding sequence having at least 90% sequence identity to SEQ ID NO:2 and / or SEQ ID NO:

4.

12. A genomic sequence for providing resistance to Tospovirus in S. lycopersicum plants, the genomic sequence having at least 90% sequence identity with SEQ ID NO:

3.

13. The resistance gene or genome sequence according to claim 11 or 12, wherein the tospovirus is one or more selected from the group consisting of Tomato spotted wilt virus (TSWV), Peanut ring spot virus (GRSV), Peanut bud necrosis virus (GBNV), Pepper chlorotic virus (CaCV) and Tomato chlorotic spot virus (TCSV), preferably TSWV.

14. The resistance gene or genomic sequence of claim 13, wherein the TSWV comprises a C118Y mutation and / or a T120N mutation in the nonstructural movement (NSm) protein of TSWV.

15. 1. A method for providing a plant of the species S. lycopersicum that is resistant to a tospovirus, comprising the steps of: a) selecting tomato plants which are resistant to Tospovirus, said selection comprising establishing the presence of a resistance gene or a resistance-conferring genomic sequence according to any one of claims 10 to 13, preferably said resistance gene; and b) introducing, e.g., by breeding, the identified resistance gene, genomic sequence or locus of step a) into a S. lycopersicum plant, thereby conferring Tospovirus resistance to said S. lycopersicum plant.

16. 16. The method of claim 15, wherein the tomato plant is a S. lycopersicum plant or a S. pervianum plant.

17. 17. The method of claim 15 or 16, wherein after step b), a first S. lycopersicum plant that is resistant to Tospovirus is selected and crossed with a second S. lycopersicum plant that is not resistant to Tospovirus, followed by selection of a S. lycopersicum plant that is resistant to Tospovirus.

18. 18. The method according to any one of claims 15 to 17, wherein in step a) establishing the presence of said resistance gene or resistance-conferring genomic sequence in a tomato plant is carried out by means of one or more markers selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9 and SEQ ID NO:10, preferably SEQ ID NO:9 and SEQ ID NO:

10.

19. 11. A method for providing a tomato plant that is resistant to a Tospovirus according to any one of claims 1 to 10, said method comprising the step of introducing into the genome of a susceptible tomato plant a TSWV resistance gene encoding a TSWV resistance protein, said protein having at least 90% amino acid sequence identity with SEQ ID NO:

1.

20. 20. The method of claim 19, wherein the step of introducing a TSWV resistance gene is accomplished by genome editing techniques, such as CRISPR Cas.

21. 15. Use of a marker for establishing the presence of a TSWV resistance gene or resistance-conferring genomic sequence according to any one of claims 11 to 14 in a tomato plant, said marker being one or more selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9 and SEQ ID NO:10, preferably SEQ ID NO:9 and SEQ ID NO:10.

Images