Next-generation mRNA vaccines

Abstract

Described herein are next generation vaccine compositions, including mRNA vaccines with flavivirus untranslated regions, and vaccines that contain (major histocompatibility complex) MHC binding peptides.

Description

[Technical field]

[0001] REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 312,745, filed February 22, 2022, and U.S. Provisional Patent Application No. 63 / 479,974, filed January 13, 2023, both of which are incorporated by reference in their entireties herein.

[0002] Sequence Listing Reference This application contains a Sequence Listing, which has been submitted electronically in XML format and is incorporated by reference in its entirety. The XML copy created on February 20, 2023 is named FUTR62558_701_601.xml and is 263,220 bytes in size. [Background technology]

[0003] An mRNA vaccine is a gene-based vaccine that uses mRNA as a vehicle to deliver genetic sequences encoding antigens to induce an immune response in a subject. Several mRNA vaccine platforms have been developed in recent years, especially in response to the COVID-19 pandemic. However, such first-generation mRNA vaccines have several drawbacks, including production with modified nucleotides, require large doses for efficacy, and require healthy cell lines to translate the mRNA in vivo. Thus, there is a need for mRNA vaccines with improved efficacy, stability, and safety. Summary of the Invention

[0004] In one aspect, the present invention provides a second-generation mRNA vaccine that overcomes one or more shortcomings of the first-generation mRNA vaccine.In some cases, the present invention provides an mRNA vaccine that comprises one or more untranslated regions of flavivirus.In some cases, the present invention provides an mRNA vaccine that can translate during cell stress response.

[0005] Further provided herein are non-mRNA vaccines that use one or more features of second generation vaccines. For example, in some cases, mRNA and non-mRNA vaccines include MHC (major histocompatibility complex) binding peptides as molecular boosters.

[0006] Certain embodiments herein include a nucleic acid composition comprising a 5' untranslated region (5'UTR) of a first flavivirus, a 3' untranslated region (3'UTR) of a second flavivirus, a first polynucleotide encoding a first peptide that is exogenous to the first flavivirus and / or the second flavivirus, and a polynucleotide encoding a major histocompatibility complex (MHC) binding peptide. Certain embodiments herein include a method of expressing a first peptide in a cell, the method comprising delivering to a cell a nucleic acid composition comprising a 5' untranslated region (5'UTR) of a first flavivirus, a 3' untranslated region (3'UTR) of a second flavivirus, a first polynucleotide encoding a first peptide, where the first peptide is exogenous to the first flavivirus and / or the second flavivirus, and a polynucleotide encoding a major histocompatibility complex (MHC) binding peptide. Certain embodiments herein include a method of inducing an immune response in a subject, the method comprising administering to the subject a nucleic acid composition comprising a 5' untranslated region (5'UTR) of a first flavivirus, a 3' untranslated region (3'UTR) of a second flavivirus, a first polynucleotide encoding a first peptide that is exogenous to the first flavivirus and / or the second flavivirus, and a polynucleotide encoding a major histocompatibility complex (MHC)-binding peptide.

[0007] In some embodiments, the 5'UTR is a 5'UTR of Dengue Virus (DENV), West Nile Virus (WNV), Japanese Encephalitis Virus (JEV), Yellow Fever Virus (YFV), Zika Virus (ZIKV) or Tick-borne Encephalitis Virus (TBEV), and the 3'UTR is a 3'UTR of Dengue Virus (DENV), West Nile Virus (WNV), Japanese Encephalitis Virus (JEV), Yellow Fever Virus (YFV), Zika Virus (ZIKV) or Tick-borne Encephalitis Virus (TBEV), and / or the first flavivirus is the same as the second flavivirus. In some embodiments, the 5'UTR is a 5'UTR of DENV, and the 3'UTR is a 3'UTR of DENV. In some embodiments, the 5'UTR is homologous or at least 80% identical to one of the sequences in Table 1, and the 3'UTR is homologous or at least 80% identical to one of the sequences in Table 2. In some embodiments, the MHC binding peptide comprises a sequence that is homologous or at least 80% identical to any one of SEQ ID NOs: 136-163. In some embodiments, the MHC binding peptide comprises a sequence that is at least 80% identical to 10 or more than 10 nucleic acid bases of the pathogen. In some embodiments, the polynucleotide encoding the MHC binding peptide encodes a plurality of MHC binding peptides, optionally each of the plurality of MHC binding peptides being identical or different from another of the plurality of MHC binding peptides. In some embodiments, the plurality of MHC binding peptides is about 2, 3, 4, 5, 6, 7, 8, 9, or 10 MHC binding peptides. In some embodiments, the nucleic acid composition comprises a polynucleotide linker between two polynucleotides encoding two of the plurality of MHC binding peptides. In some embodiments, the polynucleotide linker encodes a cleavage site. In some embodiments, the nucleic acid composition is more resistant to RNAse degradation compared to a control composition comprising a polynucleotide encoding a non-flavivirus 5'UTR, a non-flavivirus 3'UTR, and a first peptide. In some embodiments, the nucleic acid composition comprises a polynucleotide encoding a signal peptide.In some embodiments, the nucleic acid composition comprises a polynucleotide encoding a cleavage site. In some embodiments, the nucleic acid composition does not comprise a sequence encoding 10 or more consecutive amino acids of one structural protein of the first or second flavivirus. In some embodiments, the nucleic acid composition does not comprise a sequence encoding 10 or more consecutive amino acids of one nonstructural protein of the first or second flavivirus. In some embodiments, the first peptide is a pathogen-associated antigen.

[0008] Certain embodiments herein include a method of expressing a peptide in a cell, the method comprising delivering to a cell a nucleic acid composition comprising a 5' untranslated region (5'UTR) of a first flavivirus, a 3' untranslated region (3'UTR) of a second flavivirus, and a polynucleotide encoding the peptide, wherein the polynucleotide encoding the peptide is exogenous to the first flavivirus and / or the second flavivirus. Certain embodiments herein include a method of inducing an immune response in a subject, the method comprising administering to a subject a nucleic acid composition comprising a 5' untranslated region (5'UTR) of a first flavivirus, a 3' untranslated region (3'UTR) of a second flavivirus, and a polynucleotide encoding the peptide, wherein the polynucleotide encoding the peptide is exogenous to the first flavivirus and / or the second flavivirus. In some embodiments, the polynucleotide is translated into the peptide during cellular stress. In some embodiments, the peptide is expressed from the nucleic acid composition to a greater extent than the peptide expressed from a control composition comprising a non-flavivirus 5'UTR, a non-flavivirus 3'UTR, and a polynucleotide encoding the peptide.

[0009] Certain embodiments herein include a nucleic acid composition comprising a 5' untranslated region (5'UTR) of a first flavivirus, a 3' untranslated region (3'UTR) of a second flavivirus, and a polynucleotide encoding a peptide, wherein the polynucleotide is exogenous to the first flavivirus and / or the second flavivirus.

[0010] In some embodiments, the nucleic acid composition is more resistant to RNAse degradation compared to a control composition comprising a non-flavivirus 5'UTR, a non-flavivirus 3'UTR, and a polynucleotide encoding the peptide. In some embodiments, the nucleic acid comprises a polynucleotide encoding a signal peptide. In some embodiments, the nucleic acid composition comprises a polynucleotide encoding a cleavage site. In some embodiments, the 5'UTR is a 5'UTR of Dengue Virus (DENV), West Nile Virus (WNV), Japanese Encephalitis Virus (JEV), Yellow Fever Virus (YFV), Zika Virus (ZIKV), or Tick-Borne Encephalitis Virus (TBEV). In some embodiments, the 3'UTR is a 3'UTR of Dengue Virus (DENV), West Nile Virus (WNV), Japanese Encephalitis Virus (JEV), Yellow Fever Virus (YFV), Zika Virus (ZIKV), or Tick-Borne Encephalitis Virus (TBEV). In some embodiments, the 5'UTR is a 5'UTR of DENV and the 3'UTR is a 3'UTR of DENV. In some embodiments, the 5'UTR is homologous or at least 80% identical to one of the sequences in Table 1 and the 3'UTR is homologous or at least 80% identical to one of the sequences in Table 2. In some embodiments, the nucleic acid composition does not include a sequence that encodes 10 or more contiguous amino acids of one structural protein of the first flavivirus or the second flavivirus. In some embodiments, the nucleic acid composition does not include a sequence that encodes 10 or more contiguous amino acids of one nonstructural protein of the first flavivirus or the second flavivirus. In some embodiments, the nucleic acid composition of any one of claims 23-32, wherein the peptide is a pathogen-associated antigen.

[0011] Certain embodiments herein include a method of inducing an immune response in a subject, the method comprising administering to the subject a nucleic acid composition comprising a polynucleotide encoding a first peptide and a polynucleotide encoding a major histocompatibility complex (MHC) binding peptide. Certain embodiments herein include a nucleic acid composition comprising a polynucleotide encoding a first peptide and a polynucleotide encoding an MHC binding peptide. In some embodiments, the polynucleotide encoding the MHC binding peptide encodes a plurality of MHC binding peptides, optionally each of the plurality of MHC binding peptides being identical or different from another of the plurality of MHC binding peptides. In some embodiments, the plurality of MHC binding peptides is about 2, 3, 4, 5, 6, 7, 8, 9, or 10 MHC binding peptides. In some embodiments, the nucleic acid composition comprises a polynucleotide linker between two polynucleotides encoding two of the plurality of MHC binding peptides. In some embodiments, the polynucleotide linker encodes a cleavage site. In some embodiments, the MHC binding peptide comprises a sequence that is homologous or at least 80% identical to any one of SEQ ID NOs: 136-163. In some embodiments, the MHC binding peptide comprises a sequence that is at least 80% identical to 10 or more nucleobases of a pathogen. In some embodiments, the first peptide is a pathogen-associated antigen. In some embodiments, a method of expressing the first peptide in a cell is provided, the method comprising delivering a nucleic acid composition to the cell.

[0012] In one aspect, provided herein is a nucleic acid comprising: (i) a first exogenous polynucleotide; and (ii) a 5' untranslated region (5'UTR) of a first flavivirus and / or a 3' untranslated region (3'UTR) of a second flavivirus. In some embodiments, the first flavivirus is a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a no known vector flavivirus (NKFV), or an unclassified flavivirus (NCFV).In some embodiments, the first flavivirus is selected from the group consisting of Dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Zika virus (ZIKV), Tick-borne encephalitis virus (TBEV), Usutu virus (USUV), Apoi virus (APOIV), Border disease virus (BDV), Bovine viral diarrhea virus (BVDV), Bussuquara virus (BSQV), cell fusing agent virus (CFAV), Classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (ENTV), Pestivirus Kirin-1, Hepatitis C virus (HCV), Hepatitis GB virus B, GBV-B, GB virus C / hepatitis G virus (GBV-C), Ilheus virus (ILHV), Kamiti river virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TABV), or Yokose virus In some embodiments, the first flavivirus is a dengue virus (DENV). In some embodiments, the dengue virus is dengue virus serotype 4 (DENV-4).In some embodiments, the second flavivirus is a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a flavivirus with no known vector (NKFV), or an unclassified flavivirus (NCFV). In some embodiments, the second flavivirus is selected from the group consisting of Dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Zika virus (ZIKV), Tick-borne encephalitis virus (TBEV), Usutu virus (USUV), Apoi virus (APOIV), Border disease virus (BDV), Bovine viral diarrhea virus (BVDV), Bussuquara virus (BSQV), cell fusing agent virus (CFAV), Classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (Entebbe bat virion), Entebbe bat virion, ... encephalitis virus (ELV), pestivirus Kirin-1, hepatitis C virus (HCV), hepatitis GB virus B (GBV-B), hepatitis GB virus C / G virus (GBV-C), Ilheus virus (ILHV), Kamiti river virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TAV), virus] (TABV), or Yokose virus] (YOKV).In some embodiments, the second flavivirus is a dengue virus (DENV). In some embodiments, the dengue virus is dengue virus serotype 4 (DENV-4). In some embodiments, the first flavivirus and the second flavivirus are the same flavivirus.

[0013] In some embodiments, the 5'UTR comprises a sequence at least about 80% identical to any one of SEQ ID NOs: 1-36, or a sequence at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of a virus in Table 1. In some embodiments, the 5'UTR comprises a sequence from any one of SEQ ID NOs: 1-36, or of a virus in Table 1. In some embodiments, the 5'UTR is at least 80% identical to SEQ ID NO: 5 or 36.

[0014] In some embodiments, the 3'UTR comprises a sequence at least about 80% identical to any one of SEQ ID NOs: 37-70, or a sequence at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of a virus in Table 2. In some embodiments, the 3'UTR comprises a sequence from any one of SEQ ID NOs: 37-70, or of a virus in Table 2. In some embodiments, the 3'UTR is at least 80% identical to SEQ ID NO: 40.

[0015] In some embodiments, the 5'UTR comprises a stem loop A of the 5'UTR of the first flavivirus. In some embodiments, the 5'UTR comprises a stem loop B of the 5'UTR of the first flavivirus. In some embodiments, the 5'UTR comprises a 5'ATG of the first flavivirus. In some embodiments, the 5'UTR comprises a capsid coding region hairpin element (cHP) of the first flavivirus. In some embodiments, the 5'UTR comprises a 5' conserved sequence of the first flavivirus. In some embodiments, the 3'UTR comprises at least one endonuclease resistant sequence of the second flavivirus. In some embodiments, the 3'UTR comprises a short hairpin structure of the second flavivirus. In some embodiments, the 3'UTR comprises a 3' cyclization sequence of the second flavivirus. In some embodiments, the 3'UTR comprises a 3'TAG, TAA, or TGA of the second flavivirus. In some embodiments, the 5'UTR does not include a 5' cap modification. In some embodiments, the 5'UTR includes a 5' cap modification. In some embodiments, the 5'UTR has a length of about 80 bases to about 200 bases. In some embodiments, the 3'UTR has a length of about 200 to about 700 bases.

[0016] In some embodiments, the nucleic acid does not include a sequence encoding 10 or more contiguous amino acids of one structural protein of the first or second flavivirus. In some embodiments, the nucleic acid does not include a sequence encoding 10 or more contiguous amino acids of any structural protein of the first or second flavivirus. In some embodiments, the structural protein is a capsid, membrane, or envelope protein of the first or second flavivirus. In some embodiments, the nucleic acid does not include a sequence encoding 10 or more contiguous amino acids of one nonstructural protein of the first or second flavivirus. In some embodiments, the nucleic acid does not include a sequence encoding 10 or more contiguous amino acids of any nonstructural protein of the first or second flavivirus. In some embodiments, the nucleic acid does not include a sequence 3' to the exogenous nucleotide sequence that includes at least 10 bases with at least 80% adenosine residues. In some embodiments, the exogenous polynucleotide encodes a polypeptide. In some embodiments, the exogenous polynucleotide is translated into a polypeptide in a normal cell or during a cellular stress response.

[0017] In some embodiments, the nucleic acid is resistant to degradation by RNAse. In some embodiments, the RNAse is XRN-1. In some embodiments, the RNAse comprises one or more extracellular RNAses selected from the group consisting of hRNAse1, hRNAse2, hRNAse3, hRNAse4, hRNAse5, hRNAse6, hRNAse7, hRNAse8, hRNAse9, hRNAse10, hRNAse11, hRNAse12, hRNAse13, bovine sperm RNAse, bovine milk RNAse, rodent RNAse, frog RNAse, RNAseT2, plant self-incompatible RNAse, or bacterial RNAse.

[0018] In some embodiments, the nucleic acid has fewer than 10 base modifications or no base modifications. In some embodiments, the nucleic acid has fewer than 10 backbone modifications or no backbone modifications. In some embodiments, the nucleic acid has fewer than 10 sugar modifications or no sugar modifications. In some embodiments, the nucleic acid is deoxyribonucleic acid (DNA).

[0019] Also provided herein is ribonucleic acid (RNA) transcribed from the DNA described herein. In some embodiments, the RNA is transcribed in vitro or in vivo.

[0020] In some embodiments, the nucleic acid is a ribonucleic acid (RNA). In some embodiments, the RNA is a messenger RNA. In some embodiments, the nucleic acid comprises a self-cleavage site. In some embodiments, the nucleic acid comprises an internal ribosome entry site. In some embodiments, the nucleic acid comprises a sequence encoding a peptide that induces ribosome skipping during translation. In some embodiments, the nucleic acid comprises a sequence encoding a peptide motif of DxExNPGP, where x is any amino acid. In some embodiments, the nucleic acid comprises a sequence at least 80% identical to SEQ ID NO: 71. In some embodiments, the nucleic acid comprises a sequence encoding a signal peptide. In some embodiments, the signal peptide is Gaussia luciferase, human albumin, human chymotrypsinogen, human interleukin 2, or human trypsinogen-2. In some embodiments, the signal peptide is at least 80% identical to any one of SEQ ID NOs: 107-112. In some embodiments, the signal peptide is at least 80% identical to SEQ ID NO: 107. In some embodiments, the nucleic acid comprises a sequence encoding a cleavage site located between the 5'UTR and the exogenous polynucleotide. In some embodiments, the cleavage site comprises an exopeptidase, an endopeptidase, and / or an exopeptidase cleavage site. In some embodiments, the cleavage site is a proteasome cleavage site, a cysteine ​​protease cleavage site, an aspartate protease cleavage site, a serine protease cleavage site, or a combination thereof. In some embodiments, the sequence encoding the cleavage site comprises a sequence at least 80% identical to any one of SEQ ID NOs: 73-82. In some embodiments, the sequence encoding the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 81. In some embodiments, the cleavage site comprises a sequence at least 80% identical to any one of SEQ ID NOs: 83-92. In some embodiments, the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 91.

[0021] In some embodiments, the exogenous polynucleotide encodes an antigen associated with a pathogen. In some embodiments, the pathogen is a virus, a bacterium, a fungus, a protozoan, or a helminth. In some embodiments, the exogenous polynucleotide encodes a viral structural protein, a viral envelope protein, a viral capsid protein, or a viral non-structural protein, or any combination thereof. In some embodiments, the exogenous polynucleotide is selected from the group consisting of coronaviruses (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); retroviridae (e.g., human immunodeficiency viruses, such as HIV-1); picornaviridae (e.g., polio viruses, hepatitis A viruses; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); caliciviridae (e.g., strains that cause gastroenteritis); dogaviridae (e.g., equine encephalitis viruses, rubella viruses); flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses, Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza viruses);viruses); Bunyaviridae (e.g., Hantaan viruses, Bunga viruses, Phleboviruses, and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviurses, and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B viruses); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses, viruses); Adenoviridae; Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpes virus, Epstein-Barr virus); Poxviridae (variola virus, vaccinia virus, pox virus); and Iridoviridae (e.g., African swine fever virus); Hepatitis C virus; Norwalk virus; and Astrovirus. In some embodiments, the exogenous polynucleotide is selected from the group consisting of Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis, M.bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus ) (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp.The antibodies encode antigens derived from bacteria selected from: Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira sp., and Actinomyces israelii. In some embodiments, the exogenous polynucleotide encodes an antigen from a fungus selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans. In some embodiments, the exogenous polynucleotide encodes an antigen from a protozoan selected from Plasmodium spp. (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania Major. In some embodiments, the exogenous polynucleotide comprises a sequence at least 80% identical to any one of SEQ ID NOs: 93-96. In some embodiments, the exogenous polynucleotide encodes an antigen having a sequence at least 80% identical to any one of SEQ ID NOs: 97-100.

[0022] In one aspect, provided herein is a method of inducing an immune response in a subject, the method comprising administering to the subject a nucleic acid.

[0023] In another aspect, provided herein is a nucleic acid composition comprising a first sequence encoding a first antigen and a second sequence encoding an MHC binding peptide. In some embodiments, the MHC binding peptide is an MHC class I and / or MHC class II peptide. In some embodiments, the second sequence comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 113-135. In some embodiments, the second sequence comprises a sequence that is at least 80% identical to SEQ ID NO: 113. In some embodiments, the MHC binding peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 136-163. In some embodiments, the MHC binding peptide comprises a sequence that is at least 80% identical to SEQ ID NO: 136. In some embodiments, the second sequence comprises a pathogen-associated sequence.

[0024] In some embodiments, the pathogen is a virus, a bacterium, a fungus, a protozoan, or a helminth. In some embodiments, the second sequence is selected from the group consisting of coronaviruses (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); retroviridae (e.g., human immunodeficiency viruses, such as HIV-1); picornaviridae (e.g., polio viruses, hepatitis A viruses; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); caliciviridae (e.g., strains that cause gastroenteritis); dogaviridae (e.g., equine encephalitis viruses, rubella viruses); flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); coronaviruses (e.g., coronaviruses); rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses, Filoviridae (e.g., Ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumpss viruses, measles viruses, respiratory syncytial viruses); Orthomyxoviridae (e.g., influenza viruses); Bunyaviridae (e.g., Hantaan viruses, Bunga viruses, phleboviruses, and Nairo viruses); Arena viridae (hemorrhagic fever viruses);Reoviridae (e.g., reoviruses, orbiviurses, and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae; Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpes virus, Epstein-Barr virus); Poxviridae (variola virus, vaccinia virus, pox virus); and Iridoviridae (e.g., African swine fever virus); Hepatitis C virus; Norwalk virus virus); and Astrovirus;

[0025] In some embodiments, the second sequence is selected from the group consisting of Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp.), Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides sp., Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis, Treponema pallidum, In some embodiments, the second sequence is at least 80% identical to 10 or more nucleobases from a bacterium selected from Treponema pallidum, Treponema pertenue, Leptospira sp, and Actinomyces israelii. In some embodiments, the second sequence is at least 80% identical to 10 or more nucleobases from a fungus selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans. In some embodiments, the second sequence is a sequence encoding a malaria parasite (Plasmodium spp.) (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania major.

[0026] In some embodiments, the MHC binding peptide has a length of between 7 and 20 peptides. In some embodiments, the nucleic acid comprises two or more sequences encoding the MHC binding peptide.

[0027] In some embodiments, the first sequence is selected from the group consisting of coronaviruses (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); retroviridae (e.g., human immunodeficiency viruses, such as HIV-1); picornaviridae (e.g., polio viruses, hepatitis A viruses; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); caliciviridae (e.g., strains that cause gastroenteritis); dogaviridae (e.g., equine encephalitis viruses, rubella viruses); flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses, coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumpss viruses, measles viruses, respiratory syncytial viruses); Orthomyxoviridae (e.g., influenza viruses); Bunyaviridae (e.g., Hantaan viruses, Bunga viruses, phleboviruses, and Nairo viruses); Arena viridae (hemorrhagic fever viruses,viruses); Reoviridae (e.g., reoviruses, orbiviurses, and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae; Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpes virus, Epstein-Barr virus); Poxviridae (variola virus, vaccinia virus, pox virus); and Iridoviridae (e.g., African swine fever virus); Hepatitis C virus; Norwalk virus virus); and Astrovirus. In some embodiments, the first sequence is selected from the group consisting of Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, monocytogenes, Streptococcus pyogenes [Group A StreptococcusStreptococcus, Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis anthracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides sp., Fusobacterium nucleatum, Escherichia coli Pathogenic strains of Bacillus coli, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira spp.In some embodiments, the first sequence is at least 80% identical to 10 or more nucleobases from a bacterium selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans. In some embodiments, the first sequence is at least 80% identical to 10 or more nucleobases from a protozoan selected from Plasmodium spp. (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania major.

[0028] In some embodiments, the first antigen has a sequence that is at least 80% identical to any one of SEQ ID NOs: 97-100. In some embodiments, the first sequence comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 93-96. In some embodiments, the first sequence and the second sequence are present on two separate nucleic acid strands. In some embodiments, the first sequence and the second sequence are linked.

[0029] In some embodiments, the nucleic acid comprises a sequence encoding a cleavage site. In some embodiments, the cleavage site comprises an exopeptidase, an endopeptidase, and / or an exopeptidase cleavage site. In some embodiments, the cleavage site is a proteasome cleavage site, a cysteine ​​protease cleavage site, an aspartate protease cleavage site, or a serine protease cleavage site. In some embodiments, the sequence encoding the cleavage site comprises a sequence at least 80% identical to any one of SEQ ID NOs: 73-82. In some embodiments, the sequence encoding the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 81. In some embodiments, the cleavage site comprises a sequence at least 80% identical to any one of SEQ ID NOs: 83-92. In some embodiments, the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 91.

[0030] In some embodiments, the nucleic acid comprises a sequence encoding a signal peptide. In some embodiments, the signal peptide is Gaussia luciferase, human albumin, human chymotrypsinogen, human interleukin 2, or human trypsinogen 2. In some embodiments, the signal peptide is at least 80% identical to any one of SEQ ID NOs: 107-112. In some embodiments, the signal peptide is at least 80% identical to SEQ ID NO: 107.

[0031] In some embodiments, the nucleic acid is deoxyribonucleic acid (DNA).

[0032] Further provided herein is ribonucleic acid (RNA) transcribed from DNA. In some embodiments, the RNA is transcribed in vitro or in vivo.

[0033] In some embodiments, the nucleic acid is ribonucleic acid (RNA). In some embodiments, the RNA is messenger RNA.

[0034] Also provided herein are peptides translated from the nucleic acids.

[0035] In another aspect, provided herein is a method of inducing an immune response in a subject, comprising administering to the subject a nucleic acid or peptide. In some embodiments, the nucleic acid is delivered via a lipid nanoparticle, a virus-like particle, or delivered naked.

[0036] In another aspect, provided herein is a nucleic acid comprising: (i) a first exogenous polynucleotide; (ii) a 5' untranslated region (5'UTR) of a first flavivirus and / or a 3' untranslated region (3'UTR) of a second flavivirus; and a polynucleotide encoding an MHC-binding peptide. In some embodiments, the first flavivirus is a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a no known vector flavivirus (NKFV), or an unclassified flavivirus (NCFV).In some embodiments, the first flavivirus is selected from the group consisting of Dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Zika virus (ZIKV), Tick-borne encephalitis virus (TBEV), Usutu virus (USUV), Apoi virus (APOIV), Border disease virus (BDV), Bovine viral diarrhea virus (BVDV), Bussuquara virus (BSQV), cell fusing agent virus (CFAV), Classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (Entebbe bat virion), Entebbe bat virion, ... encephalitis virus (ELV), pestivirus Kirin-1, hepatitis C virus (HCV), hepatitis GB virus B (GBV-B), hepatitis GB virus C / G virus (GBV-C), Ilheus virus (ILHV), Kamiti river virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TAV), In some embodiments, the first flavivirus is a dengue virus (DENV). In some embodiments, the dengue virus is dengue virus serotype 4 (DENV-4).In some embodiments, the second flavivirus is a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a flavivirus with no known vector (NKFV), or an unclassified flavivirus (NCFV). In some embodiments, the second flavivirus is selected from the group consisting of Dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Zika virus (ZIKV), Tick-borne encephalitis virus (TBEV), Usutu virus (USUV), Apoi virus (APOIV), Border disease virus (BDV), Bovine viral diarrhea virus (BVDV), Bussuquara virus (BSQV), cell fusing agent virus (CFAV), Classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (Entebbe bat virion), Entebbe bat virion, ... encephalitis virus (ELV), pestivirus Kirin-1, hepatitis C virus (HCV), hepatitis GB virus B (GBV-B), hepatitis GB virus C / G virus (GBV-C), Ilheus virus (ILHV), Kamiti river virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TAV), virus] (TABV), or Yokose virus] (YOKV).In some embodiments, the second flavivirus is a dengue virus (DENV). In some embodiments, the dengue virus is dengue virus serotype 4 (DENV-4). In some embodiments, the first flavivirus and the second flavivirus are the same flavivirus.

[0037] In some embodiments, the 5'UTR comprises a sequence at least about 80% identical to any one of SEQ ID NOs: 1-36, or a sequence at least 80% identical for at least 50, 60, 70, 80, 90, or 100 consecutive bases of a virus in Table 1. In some embodiments, the 5'UTR comprises a sequence from any one of SEQ ID NOs: 1-36, or a virus in Table 1. In some embodiments, the 5'UTR is at least 80% identical to SEQ ID NO: 5 or 36. In some embodiments, the 3'UTR comprises a sequence at least about 80% identical to any one of SEQ ID NOs: 37-70, or a sequence at least 80% identical for at least 50, 60, 70, 80, 90, or 100 consecutive bases of a virus in Table 2. In some embodiments, the 3'UTR comprises a sequence from any one of SEQ ID NOs: 37-70, or a virus in Table 2. In some embodiments, the 3'UTR is at least 80% identical to SEQ ID NO: 40. In some embodiments, the 5'UTR comprises stem loop A of the 5'UTR of the first flavivirus. In some embodiments, the 5'UTR comprises stem loop B of the 5'UTR of the first flavivirus. In some embodiments, the 5'UTR comprises the 5'ATG of the first flavivirus. In some embodiments, the 5'UTR comprises the capsid coding region hairpin element (cHP) of the first flavivirus. In some embodiments, the 5'UTR comprises the 5' conserved sequence of the first flavivirus.

[0038] In some embodiments, the 3'UTR comprises at least one endonuclease-resistant sequence of the second flavivirus. In some embodiments, the 3'UTR comprises a short hairpin structure of the second flavivirus. In some embodiments, the 3'UTR comprises a 3' cyclization sequence of the second flavivirus. In some embodiments, the 3'UTR comprises a 3'TAG, TAA, or TGA of the second flavivirus.

[0039] In some embodiments, the 5'UTR does not include a 5' cap modification. In some embodiments, the 5'UTR includes a 5' cap modification. In some embodiments, the 5'UTR has a length of about 80 bases to about 200 bases. In some embodiments, the 3'UTR has a length of about 200 to about 700 bases.

[0040] In some embodiments, the nucleic acid does not include a sequence encoding 10 or more contiguous amino acids of one structural protein of the first or second flavivirus. In some embodiments, the nucleic acid does not include a sequence encoding 10 or more contiguous amino acids of any structural protein of the first or second flavivirus. In some embodiments, the structural protein is a capsid, membrane, or envelope protein of the first or second flavivirus. In some embodiments, the nucleic acid does not include a sequence encoding 10 or more contiguous amino acids of one nonstructural protein of the first or second flavivirus. In some embodiments, the nucleic acid does not include a sequence encoding 10 or more contiguous amino acids of any nonstructural protein of the first or second flavivirus. In some embodiments, the nucleic acid does not include a sequence 3' to the exogenous nucleotide sequence that comprises at least 10 bases with at least 80% adenosine residues. In some embodiments, the exogenous polynucleotide encodes a polypeptide. In some embodiments, the exogenous polynucleotide is translated into a polypeptide in a normal cell or during a cellular stress response.

[0041] In some embodiments, the nucleic acid is resistant to degradation by RNAse. In some embodiments, the RNAse is XRN-1. In some embodiments, the RNAse comprises one or more extracellular RNAses selected from the group consisting of hRNAse1, hRNAse2, hRNAse3, hRNAse4, hRNAse5, hRNAse6, hRNAse7, hRNAse8, hRNAse9, hRNAse10, hRNAse11, hRNAse12, hRNAse13, bovine sperm RNAse, bovine milk RNAse, rodent RNAse, frog RNAse, RNAseT2, plant self-incompatible RNAse, or bacterial RNAse.

[0042] In some embodiments, the nucleic acid has fewer than 10 base modifications or no base modifications. In some embodiments, the nucleic acid has fewer than 10 backbone modifications or no backbone modifications. In some embodiments, the nucleic acid has fewer than 10 sugar modifications or no sugar modifications.

[0043] In some embodiments, the nucleic acid is deoxyribonucleic acid (DNA).

[0044] Further provided herein is ribonucleic acid (RNA) transcribed from DNA. In some embodiments, the RNA is transcribed in vitro or in vivo.

[0045] In some embodiments, the nucleic acid is a ribonucleic acid (RNA). In some embodiments, the RNA is messenger RNA. In some embodiments, the nucleic acid comprises a self-cleavage site. In some embodiments, the nucleic acid comprises an internal ribosome entry site. In some embodiments, the nucleic acid comprises a sequence encoding a peptide that induces ribosomal skipping during translation. In some embodiments, the nucleic acid comprises a sequence encoding a peptide motif of DxExNPGP, where x is any amino acid. In some embodiments, the nucleic acid comprises a sequence at least 80% identical to SEQ ID NO:71.

[0046] In some embodiments, the nucleic acid comprises a sequence encoding a signal peptide. In some embodiments, the signal peptide is Gaussia luciferase, human albumin, human chymotrypsinogen, human interleukin 2, or human trypsinogen 2. In some embodiments, the signal peptide is at least 80% identical to any one of SEQ ID NOs: 107-112. In some embodiments, the signal peptide is at least 80% identical to SEQ ID NO: 107.

[0047] In some embodiments, the nucleic acid comprises a sequence encoding a cleavage site. In some embodiments, the sequence encoding the cleavage site is located between the 5'UTR and the exogenous polynucleotide. In some embodiments, the cleavage site comprises an exopeptidase, an endopeptidase, and / or an exopeptidase cleavage site. In some embodiments, the cleavage site is a proteasome cleavage site, a cysteine ​​protease cleavage site, an aspartate protease cleavage site, a serine protease cleavage site, or a combination thereof. In some embodiments, the sequence encoding the cleavage site comprises a sequence at least 80% identical to any one of SEQ ID NOs: 73-82. In some embodiments, the sequence encoding the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 81. In some embodiments, the cleavage site comprises a sequence at least 80% identical to any one of SEQ ID NOs: 83-92. In some embodiments, the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 91.

[0048] In some embodiments, the exogenous polynucleotide encodes an antigen associated with a pathogen, hi some embodiments, the pathogen is a virus, a bacterium, a fungus, a protozoan, or a helminth.

[0049] In some embodiments, the exogenous polynucleotide encodes a viral structural protein, a viral envelope protein, a viral capsid protein, or a viral nonstructural protein, or any combination thereof. In some embodiments, the exogenous polynucleotide is selected from the group consisting of coronaviruses (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); retroviridae (e.g., human immunodeficiency viruses, such as HIV-1); picornaviridae (e.g., polio viruses, hepatitis A viruses; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); caliciviridae (e.g., strains that cause gastroenteritis); dogaviridae (e.g., equine encephalitis viruses, rubella viruses); flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses, Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumps viruses, measles viruses, respiratory syncytial viruses); Orthomyxoviridae (e.g., influenza viruses); Bunyaviridae (e.g., Hantaan viruses, Bunga viruses,viruses, Phleboviruses, and Nairo viruses; Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviurses, and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B viruses); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyomaviruses, viruses); Adenoviridae; Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpes virus, Epstein-Barr virus); Poxviridae (variola virus, vaccinia virus, pox virus); Iridoviridae (e.g., African swine fever virus); Hepatitis C virus; Norwalk virus; and Astrovirus, and optionally the exogenous polynucleotide comprises a sequence at least 80% identical to 10 or more nucleobases from the virus. In some embodiments, the exogenous polynucleotide is selected from the group consisting of Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus,aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides sp., Fusobacterium nucleatumnucleatum, a pathogenic strain of Escherichia coli, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira sp, and Actinomyces israelii, and optionally the exogenous polynucleotide comprises a sequence at least 80% identical to 10 or more nucleobases from the bacterium. In some embodiments, the exogenous polynucleotide encodes an antigen from a fungus selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans, and optionally, the exogenous polynucleotide comprises a sequence at least 80% identical to 10 or more nucleobases from the fungus. In some embodiments, the exogenous polynucleotide encodes an antigen from a protozoan selected from Plasmodium spp. (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania major, and optionally, the exogenous polynucleotide comprises a sequence at least 80% identical to 10 or more nucleobases from the protozoan.

[0050] In some embodiments, the exogenous polynucleotide comprises a sequence at least 80% identical to any one of SEQ ID NOs: 93-96. In some embodiments, the exogenous polynucleotide encodes an antigen having a sequence at least 80% identical to any one of SEQ ID NOs: 97-100.

[0051] In some embodiments, the first exogenous polynucleotide and the polynucleotide encoding the MHC binding peptide are present on two separate nucleic acid strands, hi some embodiments, the first exogenous polynucleotide and the polynucleotide encoding the MHC binding peptide are linked.

[0052] In some embodiments, the MHC binding peptide is an MHC class I and / or MHC class II peptide. In some embodiments, the polynucleotide encoding the MHC binding peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 113-135. In some embodiments, the polynucleotide encoding the MHC binding peptide comprises a sequence that is at least 80% identical to SEQ ID NO: 113. In some embodiments, the MHC binding peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 136-163. In some embodiments, the MHC binding peptide comprises a sequence that is at least 80% identical to SEQ ID NO: 136. In some embodiments, the polynucleotide encoding the MHC binding peptide comprises a pathogen-associated sequence.

[0053] In some embodiments, the pathogen is a virus, a bacterium, a fungus, a protozoan, or a helminth. In some embodiments, the polynucleotide encoding the MHC-binding peptide is selected from the group consisting of Coronaviridae (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1); Picornaviridae (e.g., polio viruses, hepatitis A viruses; enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Caliciviridae (e.g., strains that cause gastroenteritis); Dogaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses, coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumpss viruses, measles viruses, respiratory syncytial viruses); Orthomyxoviridae (e.g., influenza viruses); Bunyaviridae (e.g., Hantaan viruses, Bunga viruses, phleboviruses, and Nairoviruses).viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviurses, and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B viruses); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae; Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpes virus, Epstein-Barr virus); Poxviridae (variola virus, vaccinia virus, pox virus); and Iridoviridae (e.g., African swine fever virus, virus); Hepatitis C virus; Norwalk virus; and Astrovirus. In some embodiments, the polynucleotide encoding the MHC binding peptide is selected from the group consisting of Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis,meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter species sp., Enterococcus sp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides sp. sp., Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis,moniliformis, Treponema pallidum, Treponema pertenue, Leptospira sp, and Actinomyces israelii. In some embodiments, the polynucleotide encoding the MHC-binding peptide is at least 80% identical to 10 or more nucleobases from a fungus selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans. In some embodiments, the polynucleotide encoding the MHC binding peptide is at least 80% identical to 10 or more nucleobases from a protozoan selected from Plasmodium spp. (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania Major.

[0054] In some embodiments, the MHC binding peptide has a length of between 7 and 20 peptides. In some embodiments, the nucleic acid comprises two or more sequences encoding the MHC binding peptide.

[0055] Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 1. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 2. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 3. Any of the nucleic acids may comprise a sequence that encodes a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 3. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to four sequences in Table 1. Any of the nucleic acids may comprise a sequence that encodes a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one sequence in Table 4. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 5.Any of the nucleic acids may comprise a sequence that encodes a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 5. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 6. Any of the nucleic acids may comprise a sequence encoding a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 7. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 8. Any of the nucleic acids may comprise a sequence homologous to one of the sequences in Table 1. Any of the nucleic acids may comprise a sequence homologous to one of the sequences in Table 2. Any of the nucleic acids may comprise a sequence homologous to one of the sequences in Table 3. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 3. Any of the nucleic acids may comprise a sequence homologous to one of the sequences in Table 4. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 4. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 5. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 5. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 6. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 7. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 8.

[0056] Also provided herein are peptides translated from the nucleic acids disclosed herein. Also provided herein are methods for expressing peptides translated from the nucleic acids disclosed herein.

[0057] Also provided herein are methods of inducing an immune response in a subject, comprising administering to the subject a nucleic acid or peptide. In some embodiments, the nucleic acid is delivered via a lipid nanoparticle, a virus-like particle, or delivered naked. [Brief description of the drawings]

[0058] Exemplary embodiments are illustrated in the referenced drawings, in which: It is intended that the embodiments and drawings disclosed herein be considered illustrative and not restrictive.

[0059] [Figure 1] FIG. 1 is a schematic diagram of an exemplary mRNA vaccine described herein. [Figure 2A] FIG. 1 is a schematic diagram of an exemplary mRNA vaccine with a booster located at the 5′ end of the antigen sequence (* indicates that the signal peptide mRNA sequence is optional for this particular construct). [Figure 2B] FIG. 1 is a schematic diagram of an exemplary mRNA vaccine with a booster located at the 3′ end of the antigen sequence (* indicates that the signal peptide mRNA sequence is optional for this particular construct). [Figure 2C] FIG. 1 is a schematic diagram of an exemplary mRNA vaccine containing multiple antigens and boosters (* indicates that the signal peptide mRNA sequence is optional for this particular construct). [Diagram 3] One embodiment of the mRNA vaccine is shown to have flavivirus UTRs for canonical and non-canonical translation of the antigen. [Figure 4] 4A-4D are schematic diagrams of exemplary mRNA vaccine constructs. [Diagram 5]4A-4D show in vitro transcription of RNA. [Figure 6A] 6A-6C show that the exemplary UTRs described herein promote protein expression of exogenous polynucleotides in cell-free and mammalian cell systems. [Figure 6B] 6A-6C show that the exemplary UTRs described herein promote protein expression of exogenous polynucleotides in cell-free and mammalian cell systems. [Figure 6C] 6A-6C show that the exemplary UTRs described herein promote protein expression of exogenous polynucleotides in cell-free and mammalian cell systems. [Figure 7] FIG. 7 shows that the exemplary mRNA constructs described herein are resistant to cellular stress. [Figure 8] FIG. 8 shows that exemplary mRNA constructs described herein with flavivirus UTRs are resistant to XRN1 degradation compared to mRNA constructs with commercially available UTRs. [Figure 9A] 9A-9B show that the exemplary UTRs described herein facilitate protein expression of exogenous polynucleotides in mammalian cells. [Figure 9B] 9A-9B show that the exemplary UTRs described herein facilitate protein expression of exogenous polynucleotides in mammalian cells. [Figure 10] We demonstrate that the exemplary UTRs described herein enhance translation of the RBD in mammalian cell systems. [Figure 11A] 11A-11B show that an exemplary mRNA vaccine described herein induces IFN-γ by antigen-primed CD4+ T cells in vitro. [Figure 11B] 11A-11B show that an exemplary mRNA vaccine described herein induces IFN-γ by antigen-primed CD4+ T cells in vitro. [Figure 12]We demonstrate that the exemplary UTRs described herein facilitate protein translation in vivo. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0060] In one aspect, the present specification describes a nucleic acid composition comprising one or more flavivirus non-translated regions and an exogenous polynucleotide.In one embodiment, the nucleic acid composition is an mRNA vaccine, and the exogenous polynucleotide encodes an antigen.In some cases, the exogenous polynucleotide is translated in both healthy and stressed cells, the nucleic acid composition is resistant to RNAse, and / or the nucleic acid is produced in fewer steps than conventional mRNA vaccines.

[0061] In one embodiment, a nucleic acid composition is provided herein, comprising a first sequence encoding an antigen and a second sequence encoding an MHC-binding peptide. Optionally, the nucleic acid composition comprises one or more flavivirus untranslated regions. Further, a peptide composition is provided, comprising the first antigen and the MHC-binding peptide. Optionally, the nucleic acid composition and / or the peptide composition is a vaccine composition.

[0062] Nucleic acid composition Provided herein is a nucleic acid composition comprising (i) a first exogenous polynucleotide and (ii) a 5' untranslated region (5'UTR) of a first flavivirus and / or a 3' untranslated region (3'UTR) of a second flavivirus. An exogenous polynucleotide encodes a first antigen. Non-limiting examples of exogenous polynucleotides and UTRs are described herein.

[0063] In another aspect, provided herein is a nucleic acid composition comprising a first sequence encoding a first antigen and a second sequence encoding an MHC binding peptide.

[0064] Further provided is a nucleic acid composition comprising a polynucleotide encoding a first antigen, a 5'UTR of a first flavivirus and / or a 3'UTR of a second flavivirus, and a polynucleotide encoding an MHC-binding peptide.

[0065] Figure 1 provides a schematic diagram of an exemplary nucleic acid composition comprising a flavivirus UTR as described herein. The composition of Figure 1 comprises a 5' flavivirus UTR (single line), a polynucleotide encoding an antigen (dashed line), and a 3' flavivirus UTR (single line). In this example, the 5' UTR is for canonical and / or alternative translation of the antigen, there is no polyadenylation, and the 3' UTR is endonuclease resistant (e.g., to RNAses such as XRN-1).

[0066] Figure 2A provides a schematic diagram of an exemplary nucleic acid composition that includes a booster located at the 5' end of a polynucleotide encoding an antigen. The composition of Figure 2A includes a 5' flavivirus UTR, a polynucleotide encoding a signal peptide, a polynucleotide encoding an MHC-I / MHC-II binding peptide (sometimes referred to as a booster), a polynucleotide encoding a cleavage site (cleavage motif), a polynucleotide encoding an antigen (antigen mRNA sequence), and a 3' flavivirus UTR. In this example, the signal peptide is optional.

[0067] Figure 2B provides a schematic diagram of an exemplary mRNA vaccine with a booster located at the 3' end of a polynucleotide encoding an antigen. The composition of Figure 2B includes a 5' flavivirus UTR, a polynucleotide encoding a signal peptide, a polynucleotide encoding an antigen (antigen mRNA sequence), a polynucleotide encoding an MHC-I / MHC-II binding peptide (sometimes referred to as a booster), a polynucleotide encoding a cleavage site (cleavage motif), and a 3' flavivirus UTR. In this example, the signal peptide is optional.

[0068] Figure 2C provides a schematic diagram of an exemplary mRNA vaccine with sequences encoding multiple antigens and a booster. The composition of Figure 2C includes a 5' flavivirus UTR, a polynucleotide encoding a first antigen (mRNA sequence of antigen 1), a polynucleotide encoding a cleavage site (cleavage motif), a polynucleotide encoding MHC-I / MHC-II binding peptide 1 (booster 1), a polynucleotide encoding a second antigen (mRNA sequence of antigen 2), a polynucleotide encoding MHC-I / MHC-II binding peptide 2 (booster 2), and a 3' flavivirus UTR. In this example, the signal peptide is optional. The antigens can be the same or different. The MHC-I / MHC-II binding peptides (boosters) can be the same or different.

[0069] In some embodiments, mRNA vaccines having flavivirus UTRs are capable of canonical (Cap-1 dependent) and non-canonical (Cap-1 independent) translation of antigens, for example, as determined via the methods provided in Example 2.

[0070] Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 1. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 2. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 3. Any of the nucleic acids may comprise a sequence that encodes a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 3. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to four sequences in Table 1. Any of the nucleic acids may comprise a sequence that encodes a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one sequence in Table 4. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 5.Any of the nucleic acids may comprise a sequence that encodes a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 5. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 6. Any of the nucleic acids may comprise a sequence encoding a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 7. Any of the nucleic acids may comprise a sequence that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one of the sequences in Table 8. Any of the nucleic acids may comprise a sequence homologous to one of the sequences in Table 1. Any of the nucleic acids may comprise a sequence homologous to one of the sequences in Table 2. Any of the nucleic acids may comprise a sequence homologous to one of the sequences in Table 3. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 3. Any of the nucleic acids may comprise a sequence homologous to one of the sequences in Table 4. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 4. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 5. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 5. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 6. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 7. Any of the nucleic acids may comprise a sequence that encodes a sequence homologous to one of the sequences in Table 8.

[0071] Untranslated Regions

[0072] Certain nucleic acid compositions herein include flavivirus untranslated regions (UTRs). In certain aspects, UTRs refer to the untranslated terminal mRNA regions surrounding the protein-coding regions of an mRNA molecule. In some embodiments, UTRs can be located upstream (5') from the start codon of the expression sequences described herein. In some embodiments, UTRs can be located downstream (3') from the stop codon of the expression sequences described herein. UTRs play an important role in the stability and translation of mRNA molecules in mammalian cells. The use of flavivirus UTRs described herein provides several advantageous features for mRNA vaccine applications. In some aspects, nucleic acid compositions including flavivirus UTRs can initiate canonical and non-canonical protein synthesis in normal cells as well as during cellular stress responses. Cells undergo a wide variety of molecular changes in response to environmental stressors, including but not limited to temperature extremes, exposure to toxins or microorganisms, mechanical injury, tumors, and / or nutrient depletion. In some embodiments, by using UTR of flavivirus, the nucleic acid composition of the present specification can initiate the translation process of mRNA even under stress conditions. In some embodiments, the nucleic acid composition comprising UTR of flavivirus described herein is resistant to degradation of 3'UTR by RNAse, which can significantly improve the stability of mRNA vaccine. Furthermore, in some embodiments, the nucleic acid composition comprising UTR of flavivirus described herein does not require polyadenylation in 3'UTR, thus reducing production time and cost.

[0073] In some embodiments, a nucleic acid composition is provided herein that comprises a 5'UTR of a first flavivirus and / or a 3'UTR of a second flavivirus. In some embodiments, the nucleic acid composition comprises a 5'UTR or a 3'UTR of a first flavivirus and a second flavivirus. In some embodiments, the first flavivirus and the second flavivirus are the same flavivirus. In other embodiments, the first flavivirus and the second flavivirus are different flaviviruses.

[0074] Provided herein, in certain embodiments, is a nucleic acid composition comprising a 5'UTR of a first flavivirus. In some embodiments, the first flavivirus is a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a no known vector flavivirus (NKFV), or an unclassified flavivirus (NCFV).In some embodiments, the first flavivirus is selected from the group consisting of Dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Zika virus (ZIKV), Tick-borne encephalitis virus (TBEV), Usutu virus (USUV), Apoi virus (APOIV), Border disease virus (BDV), Bovine viral diarrhea virus (BVDV), Bussuquara virus (BSQV), cell fusing agent virus (CFAV), Classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (Entebbe bat virion), Entebbe bat virion, ... encephalitis virus (ELV), pestivirus Kirin-1, hepatitis C virus (HCV), hepatitis GB virus B (GBV-B), hepatitis GB virus C / G virus (GBV-C), Ilheus virus (ILHV), Kamiti river virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TAV), virus] (TABV), or Yokose virus] (YOKV).

[0075] In some embodiments, the first flavivirus is a dengue virus (DENV). Examples of dengue viruses (DENV) include, but are not limited to, dengue virus serotype 1 (DENV-1), dengue virus serotype 2 (DENV-2), dengue virus serotype 3 (DENV-3), and dengue virus serotype 4 (DENV-4).

[0076] In some embodiments, the 5'UTR comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences of SEQ ID NOs: 1-36. In some embodiments, the 5'UTR comprises a sequence at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of one of the viruses in Table 1.

[0077] In some embodiments, the 5'UTR comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 36. In some embodiments, the 5'UTR comprises a sequence at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of Dengue virus type 4.

[0078] In some embodiments, the 5'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 164. In some embodiments, the 5'UTR comprises a sequence that is at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of the 5'UTR of SEQ ID NO:164. In some embodiments, the 5'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR of SEQ ID NO: 166. In some embodiments, the 5'UTR comprises a sequence that is at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of the 5'UTR of SEQ ID NO:166. In some embodiments, the 5'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 5'UTR of SEQ ID NO: 175. In some embodiments, the 5'UTR comprises a sequence that is at least 80% identical to at least 30, 40, or 50 contiguous bases of the 5'UTR of SEQ ID NO: 175.

[0079] In some embodiments, the 5'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the first 161 bases of SEQ ID NO: 164. In some embodiments, the 5'UTR comprises a sequence that is at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of the first 161 bases of SEQ ID NO: 164. In some embodiments, the 5'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the first 161 bases of SEQ ID NO: 166. In some embodiments, the 5'UTR comprises a sequence that is at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of the first 161 bases of SEQ ID NO: 166. In some embodiments, the 5'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the first 54 bases of SEQ ID NO: 175. In some embodiments, the 5'UTR comprises a sequence that is at least 80% identical to at least 30, 40, or 50 contiguous bases of the first 54 bases of SEQ ID NO: 175.

[0080] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0081] In some embodiments, the 5'UTR is provided as a flanking region to a nucleic acid (e.g., an mRNA). In some embodiments, the 5'UTR is homologous or heterologous to the coding region found in the nucleic acid. In some embodiments, multiple 5'UTRs are included in the flanking region. In some embodiments, multiple 5'UTRs are present from the same or different sequences. In some embodiments, any portion (including none) of the flanking region is codon-optimized. In some embodiments, codon optimization is a method of matching codon frequencies in the target and host organisms to ensure proper folding, customizing transcriptional and translational control regions, inserting or removing protein trafficking sequences, removing / adding post-translational modification sites (e.g., glycosylation sites) in the encoded protein, adding, removing, or shuffling protein domains, biasing GC content to increase mRNA stability or reduce secondary structure, minimizing tandem repeat codons or base runs that may impair gene assembly or expression, inserting or deleting restriction sites, or modifying ribosome binding sites and mRNA degradation sites. Examples of codon optimization tools, algorithms and services include, but are not limited to, services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA), and / or proprietary methods.

[0082] In some embodiments, the 5'UTR sequence comprises at least one translation enhancer element. In some embodiments, the translation enhancer element is a sequence that increases the amount of a polypeptide or protein produced from a polynucleotide. In some embodiments, the translation enhancer element is located between a transcription promoter and a start codon. In some embodiments, the translation enhancer element is located in the 5'UTR of a nucleic acid (e.g., an mRNA) that undergoes cap-dependent or cap-independent translation.

[0083] In some embodiments, the 5'UTR comprises stem loop A of the 5'UTR of the first flavivirus. In some embodiments, the 5'UTR comprises stem loop B of the 5'UTR of the first flavivirus. In some embodiments, the 5'UTR comprises a 5'ATG of the first flavivirus. In some embodiments, the 5'UTR comprises a capsid coding region hairpin element (cHP) of the first flavivirus. As a non-limiting example, SEQ ID NO:36 comprises a cHP. In some embodiments, the 5'UTR comprises a 5' conserved sequence of the first flavivirus. In some embodiments, the 5'UTR does not comprise a 5' cap modification. In other embodiments, the 5'UTR comprises a 5' cap modification.

[0084] In some embodiments, the 5'UTR has a length of about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500 bases, or more than 500 bases. In some embodiments, the 5'UTR has a length of about 80-200, 80-180, 80-160, 80-140, 80-120, 80-100, 100-200, 100-180, 100-160, 100-140, 100-120, 120-200, 120-180, 120-160, 120-140, 140-200, 160-180, or 180-200 bases.

[0085] In some embodiments, the 5'UTR is a 5'UTR of a flavivirus, which is not a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a flavivirus with no known vector (NKFV), or an unclassified flavivirus (NCFV).In some embodiments, the 5'UTR is a 5'UTR of a flavivirus, the flavivirus being selected from the group consisting of Dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Zika virus (ZIKV), Tick-borne encephalitis virus (TBEV), Usutu virus (USUV), Apoi virus (APOIV), Border disease virus (BDV), Bovine viral diarrhea virus (BVDV), Bussuquara virus (BSQV), cell fusing agent virus (CFAV), Classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (Entebbe bat encephalitis virus (ELV), pestivirus Kirin-1, hepatitis C virus (HCV), hepatitis GB virus B (GBV-B), hepatitis GB virus C / G virus (GBV-C), Ilheus virus (ILHV), Kamiti river virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TAV), In some cases, the flavivirus is not Tabacco virus (TABV), or Yokose virus (YOKV). In some cases, the flavivirus is not West Nile virus (WNV). In some cases, the flavivirus is not Japanese encephalitis virus (JEV). In some cases, the flavivirus is not Yellow fever virus (YFV). In some cases, the flavivirus is not Zika virus (ZIKV).In some cases, the flavivirus is not a tick-borne encephalitis virus (TBEV). In some cases, the flavivirus is not a Ustu virus (USUV). In some cases, the flavivirus is not an Apoivirus (APOIV). In some cases, the flavivirus is not a Border disease virus (BDV). In some cases, the flavivirus is not a Bovine viral diarrhea virus (BVDV). In some cases, the flavivirus is not a Buscuara virus (BSQV). In some cases, the flavivirus is not a Cell Fusion Factor virus (CFAV). In some cases, the flavivirus is not a Classical Swine Fever virus (CSFV). In some cases, the flavivirus is not a Culex flavivirus (CxFV). In some cases, the flavivirus is not an Entebbe bat virus (ENTV). In some cases, the flavivirus is not a Pestivirus Kirin-1. In some cases, the flavivirus is not a Hepatitis C virus (HCV). In some cases, the flavivirus is not a Hepatitis GB virus B (GBV-B). In some cases, the flavivirus is not GB virus C / G hepatitis virus (GBV-C). In some cases, the flavivirus is not Ilheus virus (ILHV). In some cases, the flavivirus is not Kamiti River virus (KRV). In some cases, the flavivirus is not Kokobera virus (KOKV). In some cases, the flavivirus is not Langat virus (LGTV). In some cases, the flavivirus is not Louping ill virus (LIV). In some cases, the flavivirus is not Modoc virus (MODV). In some cases, the flavivirus is not Montana myotis leukoencephalitis virus (MMLV). In some cases, the flavivirus is not Murray Valley encephalitis virus (MVEV). In some cases, the flavivirus is not Omsk hemorrhagic fever virus (OHFV). In some cases, the flavivirus is not Powassan virus (POWV). In some cases, the flavivirus is not Rio Bravo virus (RBV). In some cases, the flavivirus is not Sepic virus (SEPV). In some cases, the flavivirus is not Tamana bat virus (TABV).In some cases, the flavivirus is not Yokosevirus (YOKV).

[0086] Provided herein in certain embodiments is a nucleic acid composition comprising a 3'UTR of a second flavivirus. In some embodiments, the second flavivirus is a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a no known vector flavivirus (NKFV), or an unclassified flavivirus (NCFV).In some embodiments, the second flavivirus is selected from the group consisting of Dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Zika virus (ZIKV), Tick-borne encephalitis virus (TBEV), Usutu virus (USUV), Apoi virus (APOIV), Border disease virus (BDV), Bovine viral diarrhea virus (BVDV), Bussuquara virus (BSQV), cell fusing agent virus (CFAV), Classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (Entebbe bat virion), Entebbe bat virion, ... encephalitis virus (ELV), pestivirus Kirin-1, hepatitis C virus (HCV), hepatitis GB virus B (GBV-B), hepatitis GB virus C / G virus (GBV-C), Ilheus virus (ILHV), Kamiti river virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TAV), virus] (TABV), or Yokose virus] (YOKV).

[0087] In some embodiments, the second flavivirus is a dengue virus (DENV). Examples of dengue viruses (DENV) include, but are not limited to, dengue virus serotype 1 (DENV-1), dengue virus serotype 2 (DENV-2), dengue virus serotype 3 (DENV-3), and dengue virus serotype 4 (DENV-4).

[0088] In some embodiments, the 3'UTR comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 37-70. In some embodiments, the 3'UTR comprises a sequence at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of a virus in Table 2.

[0089] In some embodiments, the 3'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 40. In some embodiments, the 3'UTR comprises a sequence that is at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of Dengue virus type 4.

[0090] In some embodiments, the 3'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 3'UTR of SEQ ID NO: 164. In some embodiments, the 3'UTR comprises a sequence that is at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of the 3'UTR of SEQ ID NO:164. In some embodiments, the 3'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the last 384 bases of SEQ ID NO: 164. In some embodiments, the 3'UTR comprises a sequence that is at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of the last 384 bases of SEQ ID NO: 164. In some embodiments, the 3'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the 3'UTR of SEQ ID NO: 175. In some embodiments, the 3'UTR comprises a sequence that is at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of the 3'UTR of SEQ ID NO: 175. In some embodiments, the 3'UTR comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the last 296 underlined bases of SEQ ID NO: 175. In some embodiments, the 3'UTR comprises a sequence that is at least 80% identical to at least 50, 60, 70, 80, 90, or 100 contiguous bases of the last 296 bases of SEQ ID NO: 175.

[0091] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7]

[0092] In some embodiments, the 3'UTR contains adenylate-uridylate-rich elements (AREs). In some embodiments, AREs are regions with high frequency of adenine and uridine bases in the mRNA. In some embodiments, AREs include class I AREs with AUUUA motifs dispersed within or near the rich region, class II AREs with overlapping AUUUA motifs within or near the U-rich region, and class III AREs with U-rich regions but without AUUUA repeats. In some embodiments, AREs contribute to the stability of RNA stability in mammalian cells. Proteins that bind to AREs and stabilize mRNAs include, but are not limited to, HuA, HuB, HuC, HuD, and HuR. Proteins that bind to AREs and destabilize mRNAs include, but are not limited to, AUF1, TTP, BRF1, TIA-1, TIAR, and KSRP. In some embodiments, AREs are removed or mutated to improve the intracellular stability of the RNA, thereby increasing translation and production of the resulting protein.

[0093] In some embodiments, the 3'UTR comprises at least one endonuclease-resistant sequence of the second flavivirus. In some embodiments, the 3'UTR comprises a short hairpin structure of the second flavivirus. In some embodiments, the 3'UTR comprises a 3' cyclization sequence of the second flavivirus. In some embodiments, the 3'UTR comprises a stop codon of the second flavivirus. For example, the stop codon of the second flavivirus is TAG, TAA, or TGA.

[0094] In some embodiments, the 3'UTR is about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520 , 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 bases in length or more than 1000 bases in length. In some embodiments, the 3'UTR is about 200 to 700, 200 to 650, 200 to 600, 200 to 550, 200 to 500, 200 to 450, 200 to 400, 200 to 350, 200 to 300, 200 to 250, 250 to 700, 250 to 650, 250 to 600, 250 to 550, 250 to 500, 250 to 450, 250 to 400, 250 to 350, 250 to 300, 300 to 700, 300 to 650, 300 to 600, 300 to 550, 300 to 500, 300 to 450, 300 to 400, 300 to 350, The length is 350-700, 350-650, 350-600, 350-550, 350-500, 350-450, 350-400, 400-700, 400-650, 400-600, 400-550, 400-500, 400-450, 450-700, 450-650, 450-600, 450-550, 450-500, 500-700, 500-650, 500-600, 500-550, 550-700, 550-650, 550-600, 600-700, 600-650, or 650-700 bases.

[0095] In some embodiments, the 3'UTR is a 3'UTR of a flavivirus, which is not a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a flavivirus with no known vector (NKFV), or an unclassified flavivirus (NCFV).In some embodiments, the 5'UTR is a 5'UTR of a flavivirus, the flavivirus being selected from the group consisting of Dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Zika virus (ZIKV), Tick-borne encephalitis virus (TBEV), Usutu virus (USUV), Apoi virus (APOIV), Border disease virus (BDV), Bovine viral diarrhea virus (BVDV), Bussuquara virus (BSQV), cell fusing agent virus (CFAV), Classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (Entebbe bat encephalitis virus (ELV), pestivirus Kirin-1, hepatitis C virus (HCV), hepatitis GB virus B (GBV-B), hepatitis GB virus C / G virus (GBV-C), Ilheus virus (ILHV), Kamiti river virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TAV), In some cases, the flavivirus is not Tabacco virus (TABV), or Yokose virus (YOKV). In some cases, the flavivirus is not West Nile virus (WNV). In some cases, the flavivirus is not Japanese encephalitis virus (JEV). In some cases, the flavivirus is not Yellow fever virus (YFV). In some cases, the flavivirus is not Zika virus (ZIKV).In some cases, the flavivirus is not a tick-borne encephalitis virus (TBEV). In some cases, the flavivirus is not a Ustu virus (USUV). In some cases, the flavivirus is not an Apoivirus (APOIV). In some cases, the flavivirus is not a Border disease virus (BDV). In some cases, the flavivirus is not a Border disease virus (BDV). In some cases, the flavivirus is not a Bovine viral diarrhea virus (BVDV). In some cases, the flavivirus is not a Buscuara virus (BSQV). In some cases, the flavivirus is not a Cell Fusion Factor virus (CFAV). In some cases, the flavivirus is not a Classical Swine Fever virus (CSFV). In some cases, the flavivirus is not a Culex flavivirus (CxFV). In some cases, the flavivirus is not an Entebbe bat virus (ENTV). In some cases, the flavivirus is not a Pestivirus Kirin-1. In some cases, the flavivirus is not a Hepatitis C virus (HCV). In some cases, the flavivirus is not Hepatitis GB virus B (GBV-B). In some cases, the flavivirus is not Hepatitis GB virus C / Hepatitis G virus (GBV-C). In some cases, the flavivirus is not Ilheus virus (ILHV). In some cases, the flavivirus is not Kamiti River virus (KRV). In some cases, the flavivirus is not Kokobera virus (KOKV). In some cases, the flavivirus is not Langat virus (LGTV). In some cases, the flavivirus is not Louping ill virus (LIV). In some cases, the flavivirus is not Modoc virus (MODV). In some cases, the flavivirus is not Montana myotis leukoencephalitis virus (MMLV). In some cases, the flavivirus is not Murray Valley encephalitis virus (MVEV). In some cases, the flavivirus is not Omsk hemorrhagic fever virus (OHFV). In some cases, the flavivirus is not Powassan virus (POWV). In some cases, the flavivirus is not Rio Bravo virus (RBV). In some cases, the flavivirus is not a Sepic virus (SEPV).In some cases, the flavivirus is not Tamana bat virus (TABV). In some cases, the flavivirus is not Yokose virus (YOKV).

[0096] Exogenous Polynucleotides

[0097] Certain nucleic acid compositions herein include an exogenous polynucleotide. In some embodiments, the exogenous polynucleotide is a polynucleotide that is not present in a subject (e.g., a mammalian subject). In some embodiments, the exogenous polynucleotide is a polynucleotide that codes for an antigen. In some embodiments, the exogenous polynucleotide is not a flavivirus polynucleotide.

[0098] In some embodiments, as used herein, subject refers to any animal, including, but not limited to, humans, non-human primates, rodents, and livestock and sports animals. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, such as rhesus monkeys. Rodents include mice, rats, wood mice, ferrets, rabbits, and hamsters. Livestock and sports animals include dairy cows, horses, pigs, deer, bison, buffalo, feline species, such as domestic cats, canine species, such as dogs, foxes, wolves, avian species, such as chickens, emus, ostriches, and fish, such as trout, catfish, and salmon. In some embodiments, the subject is a human.

[0099] In some embodiments, the exogenous polynucleotide encodes a polypeptide. In some embodiments, the exogenous polynucleotide is translated into a polypeptide in normal cells or during cellular stress response. In some embodiments, cellular stress response encompasses a wide variety of molecular changes that cells undergo in response to environmental stressors, including, but not limited to, temperature extremes, exposure to toxins or microorganisms, mechanical injury, tumors, and / or nutrient depletion. In the absence of stress response, cells may be considered healthy.

[0100] Non-limiting examples of exogenous polynucleotides are described elsewhere herein, including, but not limited to, those encoding viral, bacterial, fungal, protozoan and helminth antigens, and the polynucleotides and peptides of Table 4.

[0101] Nuclease Resistant

[0102] In some embodiments, nucleic acid compositions are provided herein that are resistant to degradation by RNAse. In some embodiments, the nucleic acid compositions are resistant to degradation by XRN-1 (gene ID 54464). In some embodiments, the nucleic acid compositions are resistant to degradation by one or more extracellular RNAses. The extracellular RNAses include, but are not limited to, mammalian, amphibian, and bacterial RNAses. In some embodiments, the extracellular RNAse is a member of a vertebrate-specific gene superfamily. In some embodiments, the vertebrate-specific gene superfamily is the RNAseA superfamily. Non-limiting examples of members of the RNAseA superfamily include hRNAse1, hRNAse2, hRNAse3, hRNAse4, hRNAse5, hRNAse6, hRNAse7, hRNAse8, hRNAse9, hRNAse10, hRNAse11, hRNAse12, and hRNAse13. Other vertebrate RNAseA family members include, but are not limited to, bovine seminal RNAse, bovine milk RNAse, rodent RNAse, and frog RNAse(s). Other extracellular RNAses include, but are not limited to, RNAsesT2, plant self-incompatible RNAse (S-RNAse), and bacterial RNAse(s).

[0103] 5' Cap Sequence

[0104] In some embodiments, a nucleic acid composition is provided herein that does not include a 5' cap sequence. In other embodiments, the nucleic acid composition described herein includes a 5' cap sequence. In some aspects, the 5' cap sequence is a modified nucleotide at the 5' end of an mRNA molecule that includes a guanine (G) nucleotide linked to the mRNA via a 5'-5' triphosphate linkage. This guanosine is methylated at position 7 by a methyltransferase immediately after capping in vivo. This process is called 5' capping. In some embodiments, the nucleic acid composition does not require a 5' capping process. In some embodiments, the nucleic acid composition does not include a 5' cap sequence can maintain the stability and efficiency of a vaccine (e.g., an mRNA vaccine) by using a 5' flavivirus UTR and / or a 3' flavivirus UTR. Because the nucleic acid composition does not require a 5' cap, production time and costs can be significantly reduced.

[0105] PolyA sequence

[0106] In some embodiments, nucleic acid compositions are provided herein that do not include a polyA sequence. In other embodiments, the nucleic acid compositions described herein include a polyA sequence. A polyA sequence is a region of an mRNA located downstream from the 3' UTR that protects the mRNA from enzymatic degradation and allows the mature mRNA molecule to be exported from the nucleus and translated into protein by ribosomes in the cytoplasm. In some cases, the polyA sequence is a long chain of adenine nucleotides. For example, the polyA sequence includes 10-300 adenosine nucleotides. In some cases, the polyA sequence includes at least 10 bases with at least 80% adenosine residues. In some embodiments, the nucleic acid composition does not require a polyA sequence. In some embodiments, the nucleic acid composition does not include a polyA sequence can maintain the stability and efficiency of the vaccine (e.g., mRNA vaccine) by using the 5' flavivirus UTR and / or the 3' flavivirus UTR. In some cases where the nucleic acid composition does not require a polyA sequence, the manufacturing process and costs can be reduced by eliminating the enzymatic steps.

[0107] Cutting site

[0108] In some embodiments, a nucleic acid composition is provided herein that comprises a polynucleotide that encodes a cleavage site. In some cases, the nucleic acid composition comprises one or more polynucleotides that encode one or more cleavage sites. For example, the nucleic acid comprises 2, 3, 4, 5, 6, 7, or 8 polynucleotides, each of which encodes one cleavage site. In some embodiments, the one or more polynucleotides can be the same or different. In some embodiments, the cleavage site is located between the 5'UTR and the exogenous polynucleotide. In some embodiments, the cleavage site comprises an exopeptidase, an endopeptidase, and / or an exopeptidase cleavage site. In some embodiments, the cleavage site is a proteasome cleavage site, a cysteine ​​protease cleavage site (cathepsin B, F, H, L, S, Z, and AEP for asparaginylendopeptidase), an aspartate protease cleavage site (cathepsin D, E), a serine protease cleavage site (cathepsin A, G) or a combination thereof. In some embodiments, the cleavage site comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:81.

[0109] In some embodiments, the nucleic acid composition comprises a self-cleavage site. In some embodiments, the nucleic acid composition comprises an internal ribosome entry site. In some embodiments, the nucleic acid composition comprises a sequence encoding a peptide that induces ribosome skipping during translation. In some embodiments, the sequence encoding a peptide that induces ribosome skipping during translation is a peptide motif of DxExNPGP (SEQ ID NO: 165), where x is any amino acid. In some embodiments, the peptide motif of DxExNPGP is encoded by a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 71 (GCCACCAACTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGCCCC). In some embodiments, the peptide motif of DxExNPGP comprises at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:72 (ATNFSLLKQAGDVEENPGP).

[0110] In some embodiments, the nucleic acid composition comprises a cleavage site comprising a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences in SEQ ID NOs: 73-82. In some embodiments, the nucleic acid composition comprises a polynucleotide encoding a cleavage site comprising a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the sequences in SEQ ID NOs: 83-92.

[0111] [Table 3]

[0112] Signal peptide

[0113] In some embodiments, a nucleic acid composition is provided herein that includes a polynucleotide encoding a signal peptide. Non-limiting examples of signal peptides include Gaussia luciferase, human albumin, human chymotrypsinogen, human interleukin 2, and human trypsinogen 2. Additional non-limiting examples of exogenous polynucleotides are described elsewhere herein, including but not limited to those described in Tables 5 and 8. In some embodiments, the signal peptide is encoded by a signal peptide sequence in SEQ ID NO: 164, 172, 173, 178, or 179. In some embodiments, the signal peptide is a signal peptide in SEQ ID NO: 171, 174, 174, or 180.

[0114] Nucleic acid modification

[0115] In some embodiments, the nucleic acid composition has 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base modifications. In some embodiments, the nucleic acid composition has 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 backbone modifications. In some embodiments, the nucleic acid composition has 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 sugar modifications. In some embodiments, the nucleic acid composition has no base modifications. In some embodiments, the nucleic acid composition has no backbone modifications. In some embodiments, the nucleic acid composition has no sugar modifications. In non-limiting examples, the nucleic acid composition has no base modifications, no backbone modifications, and no sugar modifications.

[0116] RNA composition

[0117] In some embodiments, the nucleic acid composition is a ribonucleic acid (RNA). In some embodiments, the RNA is a messenger RNA (mRNA). mRNA refers to any polynucleotide that encodes one or more polypeptides and can be translated to produce a polypeptide in vivo, in situ, or ex vivo. Those skilled in the art will understand that the nucleic acid sequences described herein, even if "T" in the DNA sequence, are substituted with "U" when describing an RNA sequence (e.g., mRNA). Thus, any RNA polynucleotide encoded by a DNA identified by a particular sequence identification number includes the corresponding RNA (e.g., mRNA) sequence encoded by that DNA, where each "T" in the DNA sequence is substituted with "U".

[0118] Flavivirus structural and nonstructural proteins

[0119] In some embodiments, the nucleic acid does not include a sequence that codes for 10 or more consecutive amino acids of one structural protein of the first or second flavivirus. Non-limiting examples of structural proteins include capsid, membrane, and envelope proteins of the first or second flavivirus. In some embodiments, the nucleic acid does not include a sequence that codes for 10 or more consecutive amino acids of any structural protein of the first or second flavivirus.

[0120] In some embodiments, the nucleic acid does not include a sequence that encodes 10 or more contiguous amino acids of a nonstructural protein of the first or second flavivirus, In some embodiments, the nucleic acid does not include a sequence that encodes 10 or more contiguous amino acids of any nonstructural protein of the first or second flavivirus.

[0121] MHC-binding peptides

[0122] Provided herein, in some embodiments, are nucleic acid compositions comprising polynucleotides encoding MHC-binding peptides, sometimes referred to as "boosters." Non-limiting examples of MHC-binding peptides are described elsewhere herein, including, but not limited to, viral peptides, bacterial peptides, fungal peptides, protozoan peptides, synthetic peptides, mammalian peptides, and helminth peptides, as well as those disclosed in Tables 6 and 7. In some embodiments, the compositions herein comprise one or more boosters, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 boosters or MHC-binding peptides.

[0123] Peptide Composition In one aspect, provided herein is a peptide composition comprising a peptide translated from an exogenous polynucleotide described herein. In another aspect, provided herein is a peptide composition comprising an antigenic peptide. Non-limiting examples of peptides translated from exogenous polynucleotides and antigenic peptides are described elsewhere herein. For example, without limitation, viral peptides, bacterial peptides, fungal peptides, protozoan peptides, helminth peptides, viral antigens, bacterial antigens, fungal antigens, protozoan antigens, helminth antigens, and peptides of Table 4. In some embodiments, the translated peptide and / or antigenic peptide comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 97-100.

[0124] In another aspect, provided herein is a peptide composition comprising an MHC binding peptide. Non-limiting examples of MHC binding peptides are described elsewhere herein, including, but not limited to, viral peptides, bacterial peptides, fungal peptides, protozoan peptides, and helminth peptides, as well as those disclosed in Tables 6 and 7. In some embodiments, the MHC peptide comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 136-163. In some embodiments, the MHC peptide is encoded by a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs:113-135.

[0125] In yet another aspect, provided herein is a peptide composition comprising a peptide and an MHC binding peptide, including a peptide translated from an exogenous polynucleotide as described herein. In yet another aspect, provided herein is a peptide composition comprising an antigenic peptide and an MHC binding peptide as described herein. The MHC peptide may be linked to the translated peptide or antigen or may be separate.

[0126] In some embodiments, the peptide compositions herein are peptide vaccines. The peptides may be translated in vitro or in vivo.

[0127] vaccine Various embodiments of the nucleic acid and peptide compositions described herein are vaccines. A vaccine is a composition that induces an immune response against a particular pathogen or disease. Traditional protein-based vaccines typically contain an agent that resembles the disease-causing microorganism and is often made from a weakened or dead form of the microorganism, a toxin of the microorganism, or one of the surface proteins of the microorganism. The agent induces an immune response to recognize the agent as a threat and remove it from the subject's body. If the subject is exposed to the same infectious agent in the future, any microorganisms and proteins associated with the agent will be quickly recognized and destroyed. Gene-based vaccines use a different approach that exploits the process that cells use to make proteins. Gene-based vaccines deliver genetic sequences that code for antigens with DNA or RNA vectors into host cells. The host cells then use the genetic information to produce antigens that induce an immune response in the subject. There are two types of gene-based vaccines, DNA vaccines and mRNA vaccines. As with DNA vaccines, mRNA vaccines have several advantages over traditional protein-based vaccines. First, mRNA vaccines can respond more quickly and effectively to infectious diseases because they can synthesize antigens via translation from mRNA immediately after transfection. Second, mRNA vaccines can be produced easily and more cheaply in the laboratory using DNA templates with readily available materials. Third, mRNA vaccines are as safe as traditional protein-based vaccines because mRNA is an infection-free platform and there is no potential risk of infection. Fourth, mRNA vaccines are a safer platform than DNA vaccines because mRNA carries short sequences that are translated and does not interact with the host genome. Because antigen translation occurs in the cytoplasm rather than the nucleus, mRNA is less likely to integrate itself into the host genome than DNA vaccines, and once the protein is made, the RNA strand in the vaccine is degraded.Any gene-based vaccine or therapy may benefit from the disclosure described herein. Gene-based vaccines include, but are not limited to, DNA vaccines and mRNA vaccines. In addition, protein-based molecules (e.g., vaccine agents, therapies, tools) produced with mRNA design may also benefit from the disclosure described herein.

[0128] In certain aspects, provided herein are vaccines (e.g., mRNA vaccines) that produce prophylactically and / or therapeutically effective levels, concentrations and / or titers of antigen-specific antibodies in the blood or serum of vaccinated subjects. In certain aspects, the term "antibody titer" refers to the amount of antigen-specific antibodies produced in a subject. In some embodiments, the antibody titer is determined or measured by enzyme-linked immunosorbent assay (ELISA). In other embodiments, the antibody titer is determined or measured by a neutralization assay (e.g., microneutralization assay). In certain aspects, the antibody titer measurement is expressed as a ratio of 1:40, 1:100, etc. Further provided herein are vaccines (e.g., mRNA vaccines) that produce high antibody titers. For example, an effective vaccine will generate antibody titers of greater than 1:40, greater than 1:100, greater than 1:400, greater than 1:1000, greater than 1:2000, greater than 1:3000, greater than 1:4000, greater than 1:500, greater than 1:6000, greater than 1:7500, greater than 1:10000. In some embodiments, the antibody titer occurs or is achieved 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 20 days, 30 days, 40 days, 50 days, 60 days, 70 days, 80 days, 90 days, 100 days, 110 days, 120 days, 130 days, 140 days, 150 days, 160 days, 170 days, 180 days, or more than 180 days after vaccination. In some embodiments, the titer occurs or is achieved after a single dose of vaccine is administered to the subject. In other embodiments, the titer occurs or is achieved after multiple doses, for example, after a first and a second dose (e.g., a booster dose). In certain embodiments, antigen-specific antibodies are measured in units of μg / ml, or in units of IU / L (International Units per Liter) or mIU / ml (milli-International Units per ml).In some embodiments, an effective vaccine produces >0.05μg / ml, >0.1μg / ml, >0.2μg / ml, >0.3μg / ml, >0.4μg / ml, >0.5μg / ml, >1μg / ml, >2μg / ml, >3μg / ml, 4μg / ml, >5μg / ml, >6μg / ml, >7μg / ml, >8μg / ml, >9μg / ml, or >10μg / ml. In some embodiments, an effective vaccine produces >10mIU / ml, >20mIU / ml, >30mIU / ml, >40mIU / ml, >50mIU / ml, >60mIU / ml, >70mIU / ml, >80mIU / ml, >90mIU / ml, >100mIU / ml, >200mIU / ml. In some embodiments, the antibody level or concentration occurs or is achieved 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 20 days, 30 days, 40 days, 50 days, 60 days, 70 days, 80 days, 90 days, 100 days, 110 days, 120 days, 130 days, 140 days, 150 days, 160 days, 170 days, 180 days, or more than 180 days after vaccination. In some embodiments, the level or concentration occurs or is achieved after administration of a single dose of the vaccine to the subject. In other embodiments, the level or concentration occurs or is achieved after multiple doses, for example, after a first and a second dose (e.g., a booster dose). In some embodiments, the antibody level or concentration is determined or measured by enzyme-linked immunosorbent assay (ELISA). In other embodiments, the antibody level or concentration is determined or measured by a neutralization assay, for example, a microneutralization assay.

[0129] In certain aspects, the vaccines (e.g., mRNA vaccines) described herein can be administered by any route that produces a therapeutically effective result. Non-limiting examples of administration methods include intradermal, intramuscular, intravenous, and / or subcutaneous administration. The present disclosure provides a method comprising administering a vaccine (e.g., mRNA vaccine) to a subject in need thereof. The exact amount required will vary from subject to subject, depending on the subject's age, general condition, and immune status, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. Vaccine (e.g., mRNA vaccine) compositions are typically formulated in dosage unit form for ease of administration and uniformity of dosage. The total daily dose of a vaccine (e.g., mRNA) composition can be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend on factors including, but not limited to, the disease being treated and the severity of the disease, the activity of the particular compound being administered, the particular composition being administered, the age, weight, general health, sex, and diet of the patient, the time of administration, route of administration, and excretion rate of the particular compound being administered, the duration of treatment, drugs used in combination or concomitantly with the particular compound being administered, and similar factors well known in the medical arts.

[0130] Exogenous Polynucleotides and Antigens In one aspect, provided herein is a nucleic acid composition comprising an exogenous polynucleotide. In another aspect, provided herein is a nucleic acid composition comprising a polypeptide encoding an antigen. In another aspect, provided herein is a peptide composition comprising an antigen. In some embodiments, the exogenous polynucleotide encodes an antigen.

[0131] In some embodiments, the nucleic acid composition comprises an exogenous polynucleotide encoding an antigen associated with a pathogen. In some embodiments, the peptide composition comprises an antigen associated with a pathogen. Pathogens include, but are not limited to, viruses, bacteria, fungi, protozoa, and helminths.

[0132] Viral antigens

[0133] In some embodiments, the pathogen-associated antigen is a viral antigen. Non-limiting examples of viral antigens include Coronaviridae (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1); Picornaviridae (e.g., polio viruses, hepatitis A viruses, enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Caliciviridae (e.g., strains that cause gastroenteritis); Dogaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses, and the like); coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumpss viruses, measles viruses, respiratory syncytial viruses); Orthomyxoviridae (e.g., influenza viruses); Bunyaviridae (e.g., Hantaan viruses, Bunga viruses, phleboviruses, and Nairo viruses);Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g., reoviruses, orbiviurses, and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B viruses); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae; Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpes virus, Epstein-Barr virus); Poxviridae (variola virus, vaccinia virus, pox virus); and Iridoviridae (e.g., African swine fever virus, Hepatitis C virus; Norwalk virus; and Astrovirus.

[0134] bacterial antigen

[0135] In some embodiments, the pathogen-associated antigen is a bacterial antigen. Non-limiting examples of bacterial antigens include Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, and the like. monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp.), Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp. sp., Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira sp., and Actinomyces israelii.

[0136] fungal antigen

[0137] In some embodiments, the pathogen-associated antigen is a fungal antigen. Non-limiting examples of fungal antigens include antigens from viruses selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans.

[0138] Protozoan antigens

[0139] In some embodiments, the pathogen-associated antigen is a protozoan antigen. Non-limiting examples of protozoan antigens include antigens from protozoa selected from Plasmodium spp. (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania major.

[0140] helminth antigen

[0141] In some embodiments, the pathogen-associated antigen is a helminth antigen. Non-limiting examples of helminth antigens include antigens from viruses selected from hookworm, Onchocerca volvulus, Brugia malayi, and Ascaris lumbricoides, Ancylostoma caninum excretory / secretory products (AcES), and Ancylostoma caninum.

[0142] Non-limiting examples of antigen sequences

[0143] In some embodiments, the exogenous polynucleotide encodes a viral structural protein, a viral envelope protein, a viral capsid protein, or a viral nonstructural protein, or any combination thereof.

[0144] In some embodiments, the exogenous polynucleotide encodes an antigen. Non-limiting examples of antigens include Spike SARS-Cov-2, and Hepatitis B surface antigen, (L1 major capsid protein of human papillomavirus (HPV)), HA hemagglutinin [Influenza A virus (A / goose / Guangdong / 1 / 1996(H5N1))], and derivatives thereof.

[0145] In some embodiments, the antigen comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 97-100. In some embodiments, a polynucleotide encoding the antigen comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 93-96. In some embodiments, the exogenous polynucleotide comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 93-96. In some embodiments, the exogenous polynucleotide encoding an antigen encodes an antigen comprising a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 97-100. In some embodiments, the exogenous polynucleotide encodes an antigen of SEQ ID NO: 97, where the antigen is an antigen RBD as disclosed in Table 8 or is a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the antigen RBD as disclosed in Table 8.

[0146] In some embodiments, the polynucleotide encoding the antigen is codon-optimized. In some embodiments, codon optimization is a method of matching codon frequencies in target and host organisms to ensure proper folding, customizing transcriptional and translational control regions, inserting or removing protein trafficking sequences, removing / adding post-translational modification sites (e.g., glycosylation sites) in the encoded protein, adding, removing, or shuffling protein domains, biasing GC content to improve mRNA stability or reduce secondary structure, minimizing tandem repeat codons or base runs that may impair gene assembly or expression, inserting or removing restriction sites, or modifying ribosome binding sites and mRNA degradation sites. As a non-limiting example, the polynucleotide encoding the antigen is optimized for human subjects. For example, SEQ ID NO: 93 is a human-optimized codon. As another non-limiting example, the antigen includes one or more amino acid substitutions (e.g., 10% or less or 5% or less of the total amino acid sequence). The one or more amino acid substitutions can render the antigen more stable (e.g., less prone to aggregation) compared to an antigen that does not have the one or more amino acid substitutions. For example, SEQ ID NO:97 contains the following substitutions: K986P, V987P, K417T, E484K, and N501Y.

[0147] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6]

[0148] Signal peptide Herein, in some embodiments, a nucleic acid composition is provided that includes a polynucleotide encoding a signal peptide. Additionally, in some embodiments, a peptide composition is provided that includes a signal peptide. In some embodiments, a signal peptide refers to a short polypeptide, about 3-60 amino acids in length, that is present at the 5' (or N-terminus) of a newly synthesized protein. A signal peptide functions to prompt a cell to translocate a protein to the cell membrane via the secretory pathway. A signal peptide generally encompasses an N-terminal region that includes positively charged amino acids, a hydrophobic region, and a short carboxy-terminal peptide region. In eukaryotes, a signal peptide directs ribosomes to the endoplasmic reticulum (ER) membrane and initiates translocation of the newly synthesized protein for processing. Some signal peptides are cleaved from the protein by signal peptidases after the protein is transported. Others remain uncleaved and function as membrane anchors.

[0149] In some embodiments, the signal peptide is a natural signal peptide or a non-natural signal peptide. In some embodiments, the signal peptide is Gaussia luciferase, human albumin, human chymotrypsinogen, human interleukin 2, or human trypsinogen 2. In some embodiments, the signal peptide comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 107-112. In some embodiments, the polynucleotide encoding the signal peptide comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs:101-106.

[0150] [Table 5]

[0151] MHC-binding peptides In one aspect, the present specification provides a nucleic acid composition comprising a sequence encoding an MHC binding peptide.In some embodiments, the nucleic acid composition comprises a first sequence encoding an antigen and a second sequence encoding an MHC binding peptide, and the first and second sequences are located on the same or separate nucleic acid sequences.As a non-limiting example, where the first and second sequences are located on separate nucleic acid sequences, the first sequence is administered before, during, or after the administration of the second sequence.

[0152] In another aspect, the present invention provides a peptide composition comprising MHC-binding peptide.In some embodiments, the peptide composition comprises MHC-binding peptide and peptide antigen, and the MHC-binding peptide and peptide antigen are on separate polypeptides or on linked polypeptides.As a non-limiting example where the MHC-binding peptide and peptide antigen are on separate polypeptides, the MHC-binding peptide is administered to the subject before, during, or after administration of the peptide antigen.Exemplary peptide compositions include vaccines, such as vaccines against pathogens such as Hepatitis B, SARS-Cov2, Ebola, pertussis, tetanus, HPV, and diphtheria.

[0153] In some embodiments, the nucleic acid composition comprising a sequence encoding an MHC-binding peptide further comprises a flavivirus 5'UTR and / or a flavivirus 3'UTR, e.g., as disclosed herein. In some embodiments, the nucleic acid composition comprising a sequence encoding an MHC-binding peptide does not comprise a flavivirus 5'UTR. In some embodiments, the nucleic acid composition comprising a sequence encoding an MHC-binding peptide does not comprise a flavivirus 3'UTR.

[0154] In some embodiments, MHC-binding peptide refers to a peptide that binds to the major histocompatibility complex (MHC). The major histocompatibility complex (MHC) is a complex of genes that code for proteins found on the surface of cells that are important for signaling between lymphocytes and antigen-presenting cells or diseased cells in the immune system, and MHC molecules bind peptides and present them for recognition by T cell receptors. There are two types of MHC molecules, MHC class I molecules and MHC class II molecules. MHC class I molecules are expressed in the membrane of almost all cells in organisms, while MHC class II molecules are restricted to macrophages and lymphocytes. In some embodiments, MHC class I molecules have a length of about 5, 10, 15, or 20 amino acids. For example, MHC class I molecules have a length of about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids. In some embodiments, the MHC class II molecule has a length of about 5, 10, 15, 20, 25, 30, 35, or 40 amino acids. For example, the MHC class I molecule has a length of about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 amino acids.

[0155] In some embodiments, provided herein are MHC binding peptides that bind to major histocompatibility complexes (MHC) with sufficient affinity to allow the peptide / MHC complex to interact with a T cell receptor on a T cell. The binding affinity of the peptide / MHC complex with a T cell receptor on a T cell can be measured by cytokine production and / or T cell proliferation. In embodiments, the MHC binding peptide has an affinity IC50 value of 5000nM or less, 500nM or less, and 50nM or less for binding to an MHC molecule. For example, the MHC I binding peptide has an affinity IC50 value of 5000nM or less, 500nM or less, or 50nM or less for binding to an MHC class I molecule. For example, the MHC II binding peptide has an affinity IC50 value of 5000nM or less, 500nM or less, or 50nM or less for binding to an MHC class II molecule.

[0156] In some embodiments, T cell antigen refers to CD4+ T cell antigen or CD+ T cell antigen. In some embodiments, CD4+ T cell antigen refers to any antigen recognized by T cell receptor on CD4+ T cells through presentation of antigen or part thereof bound to MHC class II molecules. In other embodiments, CD8+ T cell antigen refers to any antigen recognized by T cell receptor on CD8+ T cells through presentation of antigen or part thereof bound to MHC class I molecules. In some embodiments, T cell antigen is an antigen that stimulates CD4+ T cell response or CD8+ T cell response. In some embodiments, T cell antigen is a protein or peptide, but may be other molecules such as lipids and glycolipids. In some embodiments, an antigen that is a T cell antigen is also a B cell antigen. In other embodiments, T cell antigen is not a B cell antigen.

[0157] In some embodiments, the MHC binding peptide comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to about 7 or more amino acids of a pathogen protein. Pathogens include, but are not limited to, viruses, bacteria, fungi, protozoa, and helminths. In some cases, the 7 or more amino acids of a pathogen protein are about 7 to about 20 amino acids of the pathogen protein. For example, about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids of the pathogen protein.

[0158] Viral Proteins

[0159] In some embodiments, the MHC binding peptide comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to about 7 or more amino acids of a viral protein. Non-limiting examples of viruses include coronaviruses (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1); Picornaviridae (e.g., polio viruses, hepatitis A viruses, enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Caliciviridae (e.g., strains that cause gastroenteritis); Dogaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); coronaviruses (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, stomatitis viruses, rabies viruses); Filoviridae (e.g., Ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumps viruses, measles viruses, respiratory syncytial viruses); Orthomyxoviridae (e.g., influenza viruses);Family: Bunyaviridae (e.g., Hantaan viruses, Bunga viruses, Phleboviruses, and Nairo viruses); Family: Arena viridae (hemorrhagic fever viruses); Family: Reoviridae (e.g., reoviruses, orbiviurses, and rotaviruses); Family: Birnaviridae; Family: Hepadnaviridae (Hepatitis B viruses); Family: Parvoviridae (parvoviruses); Family: Papovaviridae (papilloma viruses, polyoma viruses, viruses); Adenoviridae; Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes virus, Epstein-Barr virus); Poxviridae (variola virus, vaccinia virus, pox virus); and Iridoviridae (e.g., African swine fever virus); Hepatitis C virus; Norwalk virus; and Astrovirus.

[0160] bacterial protein

[0161] In some embodiments, the MHC binding peptide comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to about 7 or more amino acids of a bacterial protein. Non-limiting examples of bacteria include Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacteria sps (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, and the like. monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp.), Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp. sp., Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira sp., and Actinomyces israelii.

[0162] Fungal Proteins

[0163] In some embodiments, the MHC binding peptide comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to about 7 or more amino acids of a fungal protein. Non-limiting examples of fungi include Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans.

[0164] Protozoan proteins

[0165] In some embodiments, the MHC binding peptide comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to about 7 or more amino acids of the protozoan protein. Non-limiting examples of protozoa include Plasmodium spp. (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania Major.

[0166] Helminth Proteins

[0167] In some embodiments, the MHC binding peptide comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to about 7 or more amino acids of a helminth protein. Non-limiting examples of helminths include hookworm, Onchocerca volvulus, Brugia malayi, and Ascaris lumbricoides, Ancylostoma caninum excretory / secretory products (AcES), and Ancylostoma caninum.

[0168] MHC binding sequence non-limiting example In some embodiments, the sequence encoding the MHC-binding peptide comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs:113-135.

[0169] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11] [Table 6-12] [Table 6-13] [Table 6-14] [Table 6-15] [Table 6-16] [Table 6-17]

[0170] In some embodiments, the MHC binding peptide comprises a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 136-163.

[0171] [Table 7-1] [Table 7-2]

[0172] In some embodiments, the compositions herein encode or include two or more MHC binding peptides. For example, the two or more MHC binding peptides are 2, 3, 4, 5, 6, 7, 8, 9, or 10 MHC binding peptides. The two MHC binding peptides can be the same or different. The two or more MHC binding peptides can be connected by a linker. The linker can be cleavable or non-cleavable. In some embodiments, the two or more MHC binding peptides are connected by a linker that includes a cleavage site. Non-limiting examples of cleavage sites include exopeptidase, endopeptidase, and exopeptidase cleavage sites. In some embodiments, the cleavage site is a proteasome cleavage site, a cysteine ​​protease cleavage site (cathepsin B, F, H, L, S, Z, and AEP for asparaginylendopeptidase), an aspartate protease cleavage site (cathepsin D, E), a serine protease cleavage site (cathepsin A, G) or a combination thereof. In some embodiments, the polynucleotide encoding the cleavage site comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:81.

[0173] Further non-limiting examples of cleavage sites are described elsewhere herein, including but not limited to those listed in Table 3. In some embodiments, the cleavage site comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 83-92. In some embodiments, the polynucleotide encoding the cleavage site comprises a sequence at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 73-82.

[0174] Methods for producing nucleic acids In some embodiments, nucleic acid constructs (e.g., constructs that are transcribed into mRNA) are generated using nucleic acid construction methods, including, but not limited to, gene synthesis, vector amplification, plasmid purification, plasmid linearization, and cDNA template synthesis. Once an antigen of interest is selected, a primary construct is designed. A first region of linked nucleotides that encodes an antigen of interest can be constructed using the open reading frame (ORF) of the selected nucleic acid transcript. In some embodiments, the ORF includes wild-type ORFs, isoforms, and variants of fragments thereof. In some embodiments, an open reading frame (ORF) refers to a region of a nucleic acid molecule that is capable of encoding a polypeptide of interest. OFRs often begin with a codon and end with a nonsense or stop codon or signal.

[0175] In some embodiments, the nucleic acid is codon-optimized. Codon optimization is a method that matches the codon frequency in the target organism and the host organism to ensure proper folding, customizes the transcriptional and translational control regions, inserts or removes protein transport sequences, removes / adds post-translational modification sites (e.g., glycosylation sites) in the encoded protein, adds, removes, or shuffles protein domains, biases GC content to increase mRNA stability or reduce secondary structure, minimizes tandem repeat codons or base runs that may impair gene assembly or expression, inserts or removes restriction sites, or modifies ribosome binding sites and mRNA degradation sites. Examples of codon optimization tools, algorithms, and services include, but are not limited to, services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA), and / or proprietary methods.

[0176] In some embodiments, the mRNA is generated by the following processes, including but not limited to in vitro transcription, cDNA template removal, mRNA capping, and tailing reactions. In some embodiments, the mRNA construct is subjected to a purification process to separate the mRNA from at least one contaminant. In some embodiments, the contaminant is any substance that makes another incompatible, impure, or defective. Purification processes include, but are not limited to, mRNA cleanup, quality assurance, and quality control. mRNA cleanup can be performed by methods such as AGENCOURT® beads (Beckman Coulter Genomics, Danvers, Mass.), poly-T beads, LNA™ Oligo-T capture probes (EXIQON® Inc, Vedbaek, Denmark), or HPLC-based purification methods such as strong anion exchange HPLC, weak anion exchange HPLC, reversed-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). Quality assurance and quality control can be performed using methods such as gel electrophoresis, UV absorbance, or analytical HPLC.

[0177] In some embodiments, mRNA is quantified using methods such as ultraviolet-visible spectroscopy (UV / Vis). An example of a UV / Vis spectrometer includes, but is not limited to, a NANODROP® spectrometer (ThermoFisher, Waltham, Mass.). The quantified mRNA can be analyzed to determine the size of the mRNA and to check whether mRNA degradation has occurred. For example, mRNA degradation can be confirmed using agarose gel electrophoresis or HPLC-based purification methods. Examples of HPLC-based purification methods include, but are not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reversed-phase HPLC (RP-HPLC), hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography mass spectrometry (LCMS), capillary electrophoresis (CE), and capillary gel electrophoresis (CGE).

[0178] Nucleic Acid Delivery In some embodiments, the nucleic acid composition herein is delivered as naked or unmodified nucleic acid.In other embodiments, the nucleic acid composition herein is delivered via a vehicle.In some embodiments, the nucleic acid composition herein is delivered as DNA.In some embodiments, the nucleic acid composition herein is delivered as RNA, for example, mRNA.

[0179] In some embodiments, the nucleic acid is delivered to the subject via a vehicle. The vehicle can be a lipid nanoparticle or a virus-like particle.

[0180] In some embodiments, the nucleic acid is a lipid nanoparticle vehicle.Non-limiting lipid nanoparticles include, but are not limited to, 1,2-di-O-octadecenyl-3-trimethylammonium-propane (DOTMA), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOSPA), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), ethylphosphatidylcholine (ePC), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino) butanoate (DLin-MC3-DMA; MC3), l,l'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-l-yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate (ALC-0315), 3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione (cKK-E12), heptadecano-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Lipid H (SM-102)), (((3,6-dioxopiperazine-2,5-diyl)bis(butane-4,1-diyl))bis(azanetriyl))tetrakis(ethane-2,1-diyl) (9Z,9'Z,9”Z,9'”Z,12Z,12'Z,12”Z,12'”Z)-tetrakis(octadeca-9,12-dienoate) (OF-Deg-Lin), ethyl 5,5-di((Z)-heptadec-8-en-1-yl)-1-(3-(pyrrolidin-1-yl)propyl)-2,5-dihydro-1H-imidazole-2-carboxylate (A2-Iso5-2DC18), tetrakis(8-methylnonyl) 3,3',3”,3’”-(((methylazadiyl)bis(propane-3,1 diyl))bis(azanetriyl))tetrapropionate (306Oi10), bis(2-(dodecyldisulfanyl)ethyl)3,3'-((3-methyl-9-oxo-10-oxa-13,14-dithia-3,6-diazahexacosyl)azanediyl)dipropionate (BAME-O16B), N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3), decyl (2-(dioctylammonio)ethyl)phosphate (9A1P9), hexa(octan-3-yl) 9,9',9'',9''',9"",9'""-(((benzene-1,3,5-tricarbonyl) yris(azadiyl))tris (propane-3,1-diyl))tris(azatriyl))hexanoate (FTT5), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG 2000-DMG), 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159), cholesterol, 3β-[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol (DC-cholesterol), (3S,8S,9S,10R,13R,14S,17R)-17-((2R,5R)-5-ethyl-6-methylheptan-2-yl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol (β-sitosterol), rol), and 2-(((((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl)oxy)carbonyl)amino)-N,N-bis(2-hydroxyethyl)-N-methylethane-1-aminium bromide (BHEM-cholesterol).

[0181] In some embodiments, the nucleic acid is delivered via a virus-like particle vehicle. Non-limiting virus-like particles include, but are not limited to, non-enveloped VLPs (single or multi-capsid protein VLPs) and enveloped VLPs.

[0182] Methods for inducing an immune response Various embodiments provide a method of inducing an immune response in a subject by administering to the subject a composition described herein. The immune response can include an antibody response and / or a cell-mediated immune response in the subject. For example, the subject is administered a composition comprising an antigen to stimulate the production of antibodies that bind to the antigen. In another example, the subject is administered a composition comprising an mRNA that encodes the antigen to stimulate the production of antibodies that bind to the antigen. In some embodiments, the antigen is expressed from the mRNA. Certain compositions include or encode MHC-binding peptides. In some embodiments, the composition stimulates the production of antibodies by stimulating an adaptive immune response after delivery of the composition to the subject. In some embodiments, the subject's adaptive immune response includes stimulating B lymphocytes to release polyclonal antibodies that specifically bind to the antigen. In some embodiments, the subject's adaptive immune response includes stimulating a cell-mediated immune response.

[0183] Also provided herein is a method for evaluating a non-human or human subject for antibody production response to the composition. In some embodiments, the evaluation is before and / or after administration of the composition. A non-limiting method is provided in Example 3.

[0184] Pharmaceutical Compositions, Administration, and Dosage In various embodiments, the compositions herein are formulated for delivery via any route of administration. "Route of administration" may refer to any route of administration known in the art, including but not limited to intradermal, intramuscular, and / or subcutaneous administration. It is understood that the actual dosage may vary depending on the route of administration, the delivery system used, the target cell, organ, or tissue, the subject, and the degree of effect sought. The size and weight of the tissue, organ, and / or patient may also affect the dosage. The dose may further include additional agents, including but not limited to carriers. Non-limiting examples of suitable carriers are known in the art (e.g., water, saline, ethanol, glycerol, lactose, sucrose, dextran, agar, pectin, vegetable-derived oils, phosphate-buffered saline, and / or diluents).

[0185] In various embodiments, pharmaceutical compositions are provided that include a therapeutically effective amount of the nucleic acids and / or peptides described herein together with a pharma- ceutically acceptable excipient. By "pharmaceutically acceptable excipient" is meant an excipient that is generally safe, non-toxic, and useful for preparing a desired pharmaceutical composition, including excipients acceptable for veterinary use as well as for human pharmaceutical use. The active ingredient can be mixed with an excipient that is pharma- ceutically acceptable and compatible with the active ingredient in an amount suitable for use in the therapeutic methods described herein. Such excipients can be solid, liquid, semi-solid, or, in the case of an aerosol composition, gaseous. Suitable excipients are, for example, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, nonfat dry milk, water, saline, dextrose, propylene glycol, glycerin, ethanol, mannitol, polysorbates, and the like, and combinations thereof. In addition, if desired, the composition may contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, etc., which enhance or maintain the effectiveness of the active ingredient or increase the stability of the pharmaceutical. In addition, if desired, the composition may contain auxiliary substances to modify the density of the pharmaceutical. The therapeutic compositions described herein may contain pharmaceutically acceptable salts. Pharmaceutically acceptable salts include acid addition salts formed with inorganic acids, such as hydrochloric or phosphoric acid, organic acids, such as acetic, tartaric or mandelic acids, salts formed with inorganic bases, such as sodium, potassium, ammonium, calcium or ferric hydroxides, and salts formed with organic bases, such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, etc. Liquid compositions may contain liquid phases in addition to and apart from water, such as glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. Physiologically acceptable carriers are well known in the art. Physiologically acceptable carriers are well known in the art.

[0186] The pharmaceutical composition can be delivered in a therapeutically effective amount.The exact therapeutically effective amount is the amount of the composition that produces the most effective results in terms of efficacy in treating a given subject.This amount varies according to various factors, including but not limited to the characteristics of the nucleic acid (including activity, pharmacokinetics, pharmacodynamics and bioavailability), the physiological state of the subject (including age, sex, type and stage of disease, general health, response to a given dosage, and type of drug treatment), the nature of the pharmacologic acceptable carrier(s) in the formulation, and the route of administration.

[0187] kit Further, a kit is provided for carrying out the method described herein.The kit is a collection of components, including at least one of the compositions described herein.Thus, in some embodiments, the kit includes the nucleic acid and / or peptide composition described herein.The nucleic acid or peptide may be combined or complexed with another component, such as a vehicle for delivery, or may be unmodified for direct delivery.

[0188] Instructions for use of the components may be included in the kit. Optionally, the kit also includes other useful components, such as diluents, buffers, pharma- ceutically acceptable carriers, syringes, applicators, measuring tools, dressings, or other useful equipment, as would be readily recognized by one of skill in the art.

[0189] The materials or components assembled in the kit can be stored and provided to the practitioner in a convenient and suitable manner that maintains their operability and usefulness. For example, the components can be in dissolved, dehydrated, or lyophilized form and can be provided at room, refrigerated, or frozen temperatures. The components are typically included in suitable packaging materials. As used herein, the phrase "packaging material" refers to one or more physical structures used to contain the contents of the kit, such as the inventive composition. The packaging material is preferably constructed in a well-known manner to provide a sterile, contaminant-free environment. The packaging materials utilized in the kit are those that are conventionally utilized for gene expression assays and therapeutic administration. As used herein, the term "packaging" refers to a suitable solid matrix or material, such as glass, plastic, paper, foil, etc., capable of holding individual kit components. Thus, for example, the packaging can be a glass vial used for syringes to contain an appropriate amount of the composition as described herein. The packaging material typically has an exterior label indicating the contents and / or purpose of the kit and / or its components.

[0190] Non-Limiting Numbered Embodiments 1. A nucleic acid comprising: (i) a first exogenous polynucleotide; and (ii) a 5' untranslated region (5'UTR) of a first flavivirus and / or a 3' untranslated region (3'UTR) of a second flavivirus. 2. The nucleic acid of embodiment 1, wherein the first flavivirus is a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a no known vector flavivirus (NKFV), or an unclassified flavivirus (NCFV). 3. The first flaviviruses were Dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Zika virus (ZIKV), Tick-borne encephalitis virus (TBEV), Ustu virus (USUV), Apoivirus (APOIV), Border disease virus (BDV), Bovine viral diarrhea virus (BVDV), Buscuara virus (BSQV), Cell fusion factor virus (CFAV), Classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (ENTV), Pestivirus Kirin-1, Hepatitis C virus (HCV), Hepatitis G-B virus B, and Hepatitis B virus (GBV). 3. The nucleic acid of embodiment 1 or embodiment 2, wherein the nucleic acid is selected from the group consisting of GBV-B, GB virus C / Hepatitis G virus (GBV-C), Ilheus virus (ILHV), Kamiti River virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TABV), or Yokose virus (YOKV). 4. The nucleic acid of embodiment 1, wherein the first flavivirus is a dengue virus (DENV). 5. The nucleic acid of embodiment 4, wherein the dengue virus is dengue virus serotype 4 (DENV-4). 6. The nucleic acid of any one of embodiments 1 to 5, wherein the second flavivirus is a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a flavivirus with no known vector (NKFV), or an unclassified flavivirus (NCFV). 7. Second flaviviruses have been identified as dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), Zika virus (ZIKV), tick-borne encephalitis virus (TBEV), Ustu virus (USUV), Apoivirus (APOIV), Border disease virus (BDV), bovine viral diarrhea virus (BVDV), Buscuara virus (BSQV), cell fusion factor virus (CFAV), classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (ENTV), pestivirus Kirin-1, hepatitis C virus (HCV), hepatitis B virus (GBV), hepatitis B virus (HCV), hepatitis C virus (HCV), hepatitis B ... C virus (HCV), hepatitis B virus (HCV), hepatitis C virus (HCV), hepatitis C virus (HCV), hepatitis B virus (HCV), hepatitis C virus (HCV), hepatitis C virus (HCV), hepatitis C virus (HCV), hepatitis B virus (HCV), hepatitis C virus (HCV), hepatitis C virus (HCV), hepatitis C The nucleic acid according to any one of embodiments 1 to 6, wherein the nucleic acid is selected from the group consisting of GBV-B, GB virus C / Hepatitis G virus (GBV-C), Ilheus virus (ILHV), Kamiti River virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TABV), or Yokose virus (YOKV). 8. The nucleic acid of any one of embodiments 1 to 5, wherein the second flavivirus is a dengue virus (DENV). 9. The nucleic acid of embodiment 8, wherein the dengue virus is dengue virus serotype 4 (DENV-4). 10. The nucleic acid of any one of embodiments 1 to 9, wherein the first flavivirus and the second flavivirus are the same flavivirus. 11. The nucleic acid of any one of embodiments 1 to 10, wherein the 5'UTR comprises a sequence that is at least about 80% identical to any one of SEQ ID NOs: 1 to 36, or a sequence that is at least 80% identical to at least 50, 60, 70, 80, 90, or 100 consecutive bases of a virus in Table 1. 12. The nucleic acid of any one of embodiments 1 to 10, wherein the 5'UTR comprises a sequence derived from any one of SEQ ID NOs: 1 to 36 or from a virus of Table 1. 13. The nucleic acid of embodiment 11, wherein the 5'UTR is at least 80% identical to SEQ ID NO: 5 or 36. 14. The nucleic acid of any one of embodiments 1 to 13, wherein the 3'UTR comprises a sequence at least about 80% identical to any one of SEQ ID NOs: 37-70, or a sequence at least 80% identical to at least 50, 60, 70, 80, 90, or 100 consecutive bases of a virus in Table 2. 15. The nucleic acid of any one of embodiments 1 to 13, wherein the 3'UTR comprises a sequence derived from any one of SEQ ID NOs: 37 to 70 or from a virus of Table 2. 16. The nucleic acid of embodiment 14, wherein the 3'UTR is at least 80% identical to SEQ ID NO:40. 17. The nucleic acid of any one of embodiments 1 to 16, wherein the 5'UTR comprises stem-loop A of the 5'UTR of a first flavivirus. 18. The nucleic acid of any one of embodiments 1 to 17, wherein the 5'UTR comprises stem-loop B of the 5'UTR of a first flavivirus. 19. The nucleic acid of any one of embodiments 1 to 18, wherein the 5'UTR comprises the 5'ATG of a first flavivirus. 20. The nucleic acid of any one of embodiments 1 to 19, wherein the 5'UTR comprises a capsid coding region hairpin element (cHP) of a first flavivirus. 21. The nucleic acid of any one of embodiments 1 to 20, wherein the 5'UTR comprises a 5' conserved sequence of a first flavivirus. 22. The nucleic acid of any one of embodiments 1 to 21, wherein the 3'UTR comprises at least one endonuclease-resistant sequence of a second flavivirus. 23. The nucleic acid of any one of embodiments 1 to 22, wherein the 3'UTR comprises a short hairpin structure of a second flavivirus. 24. The nucleic acid of any one of embodiments 1 to 23, wherein the 3'UTR comprises a 3' circularization sequence of a second flavivirus. 25. The nucleic acid of any one of embodiments 1 to 17, wherein the 3'UTR comprises a 3'TAG, TAA, or TGA of a second flavivirus. 26. The nucleic acid of any one of embodiments 1 to 25, wherein the 5'UTR does not comprise a 5'cap modification. 27. The nucleic acid of any one of embodiments 1 to 25, wherein the 5'UTR comprises a 5'cap modification. 28. The nucleic acid according to any one of embodiments 1 to 27, wherein the 5'UTR has a length of about 80 bases to about 200 bases. 29. The nucleic acid according to any one of embodiments 1 to 28, wherein the 3'UTR has a length of about 200 to about 700 bases. 30. The nucleic acid of any one of embodiments 1 to 29, wherein the nucleic acid does not contain a sequence encoding 10 or more consecutive amino acids of one of the structural proteins of the first or second flavivirus. 31. The nucleic acid of any one of embodiments 1 to 30, wherein the nucleic acid does not contain a sequence encoding 10 or more consecutive amino acids of any structural protein of the first or second flavivirus. 32. The nucleic acid of embodiment 30 or embodiment 31, wherein the structural protein is a capsid, membrane, or envelope protein of a first flavivirus or a second flavivirus. 33. The nucleic acid of any one of embodiments 1 to 32, wherein the nucleic acid does not contain a sequence encoding 10 or more consecutive amino acids of one of the nonstructural proteins of the first or second flavivirus. 34. The nucleic acid of any one of embodiments 1 to 33, wherein the nucleic acid does not contain a sequence encoding 10 or more consecutive amino acids of any nonstructural protein of the first or second flavivirus. 35. The nucleic acid according to any one of the preceding embodiments, wherein the nucleic acid does not comprise a sequence 3' to the exogenous nucleotide sequence, the sequence comprising at least 10 bases having at least 80% adenosine residues. 36. The nucleic acid of any one of embodiments 1 to 35, wherein the exogenous polynucleotide encodes a polypeptide. 37. The nucleic acid of embodiment 36, wherein the exogenous polynucleotide is translated into a polypeptide in a normal cell or during a cellular stress response. 38. The nucleic acid according to any one of the preceding embodiments, wherein the nucleic acid is resistant to degradation by RNAses. 39. The nucleic acid of embodiment 38, wherein the RNAse is XRN-1. 40. The nucleic acid of embodiment 38, wherein the RNAse comprises one or more extracellular RNAses selected from the group consisting of hRNAse1, hRNAse2, hRNAse3, hRNAse4, hRNAse5, hRNAse6, hRNAse7, hRNAse8, hRNAse9, hRNAse10, hRNAse11, hRNAse12, hRNAse13, bovine sperm RNAse, bovine milk RNAse, rodent RNAse, frog RNAse, RNAseT2, plant self-incompatible RNAse, or bacterial RNAse. 41. The nucleic acid according to any one of embodiments 1 to 40, wherein the nucleic acid has less than 10 base modifications or no base modifications. 42. The nucleic acid according to any one of embodiments 1 to 41, wherein the nucleic acid has less than 10 backbone modifications or no backbone modifications. 43. The nucleic acid according to any one of embodiments 1 to 42, wherein the nucleic acid has less than 10 sugar modifications or no sugar modifications. 44. The nucleic acid according to any one of the preceding embodiments, wherein the nucleic acid is a deoxyribonucleic acid (DNA). 45. A ribonucleic acid (RNA) transcribed from the DNA of embodiment 44. 46. ​​The RNA according to embodiment 45, wherein the RNA is transcribed in vitro or in vivo. 47. The nucleic acid according to any one of embodiments 1 to 43, wherein the nucleic acid is a ribonucleic acid (RNA). 48. The nucleic acid according to any one of embodiments 45 to 43, wherein the RNA is messenger RNA. 49. The nucleic acid according to any one of embodiments 1 to 48, comprising a self-cleavage site. 50. The nucleic acid of any one of embodiments 1 to 49, comprising an internal ribosome entry site. 51. A nucleic acid according to any one of the preceding embodiments, comprising a sequence encoding a peptide that induces ribosomal skipping during translation. 52. The nucleic acid according to any one of the preceding embodiments, comprising a sequence encoding a peptide motif of DxExNPGP, where x is any amino acid. 53. The nucleic acid according to any one of the preceding embodiments, comprising a sequence at least 80% identical to SEQ ID NO: 71. 54. The nucleic acid according to any one of the preceding embodiments, comprising a sequence encoding a signal peptide. 55. The nucleic acid of embodiment 54, wherein the signal peptide is Gaussia luciferase, human albumin, human chymotrypsinogen, human interleukin 2, or human trypsinogen-2. 56. The nucleic acid according to embodiment 54 or embodiment 55, wherein the signal peptide is at least 80% identical to any one of SEQ ID NOs: 107 to 112. 57. The nucleic acid of embodiment 54 or embodiment 55, wherein the signal peptide is at least 80% identical to SEQ ID NO: 107. 58. The nucleic acid of any one of the preceding embodiments, comprising a sequence encoding a cleavage site located between the 5'UTR and the exogenous polynucleotide. 59. The nucleic acid according to any one of embodiments 1 to 53, wherein the cleavage site comprises an exopeptidase, an endopeptidase, and / or an exopeptidase cleavage site. 60. The nucleic acid of embodiment 58 or embodiment 59, wherein the cleavage site is a proteasome cleavage site, a cysteine ​​protease cleavage site, an aspartate protease cleavage site, a serine protease cleavage site, or a combination thereof. 61. The nucleic acid according to any one of embodiments 58 to 60, wherein the sequence encoding the cleavage site comprises a sequence at least 80% identical to any one of SEQ ID NOs: 73 to 82. 62. The nucleic acid according to any one of embodiments 58 to 60, wherein the sequence encoding the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 81. 63. The nucleic acid according to any one of embodiments 58 to 60, wherein the cleavage site comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 83 to 92. 64. The nucleic acid according to any one of embodiments 58 to 60, wherein the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 91. 65. The nucleic acid of any one of embodiments 1 to 64, wherein the exogenous polynucleotide encodes a pathogen-associated antigen. 66. The nucleic acid of embodiment 65, wherein the pathogen is a virus, a bacterium, a fungus, a protozoan, or a helminth. 67. The nucleic acid of embodiment 65 or embodiment 66, wherein the exogenous polynucleotide encodes a viral structural protein, a viral envelope protein, a viral capsid protein, or a viral nonstructural protein, or any combination thereof. 68. The exogenous polynucleotide is selected from the group consisting of: Coronaviridae (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1); Picornaviridae (e.g., polio viruses, hepatitis A viruses, enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Caliciviridae (e.g., strains that cause gastroenteritis); Dogaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses, Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumpss viruses, measles viruses, respiratory syncytial viruses); Orthomyxoviridae (e.g., influenza viruses); Bunyaviridae (e.g., Hantaan viruses, Bunga viruses, phleboviruses, and Nairo viruses); Arena viridae (hemorrhagic fever viruses);Reoviridae (e.g., reoviruses, orbiviurses, and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae; Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpes virus, Epstein-Barr virus); Poxviridae (variola virus, vaccinia virus, pox virus); and Iridoviridae (e.g., African swine fever virus); Hepatitis C virus; Norwalk virus 68. The nucleic acid of any one of embodiments 65 to 67, encoding an antigen from a virus selected from: A virus; and Astrovirus; 69. The exogenous polynucleotide is not intended to be used to identify or identify any of the following: Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacterium species (e.g., Mycobacterium tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Meningococcemia, Listeria monocytogenes, Streptococcus pyogenes (group A streptococci), Streptococcus agalactiae (group B streptococci), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter 68. The nucleic acid of any one of embodiments 65-67, encoding an antigen from a bacterium selected from: Enterococcus spp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium spp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp., Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis, Treponema pallidum, Treponema yasum, Leptospira spp., and Actinomyces israelii. 70. The nucleic acid of any one of embodiments 65 to 67, wherein the exogenous polynucleotide encodes an antigen from a fungus selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans. 71. The nucleic acid of any one of embodiments 65 to 67, wherein the exogenous polynucleotide encodes an antigen from a protozoan selected from Plasmodium spp. (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania Major. 72. The nucleic acid according to any one of the preceding embodiments, wherein the exogenous polynucleotide comprises a sequence at least 80% identical to any one of SEQ ID NOs: 93-96. 73. The nucleic acid according to any one of the preceding embodiments, wherein the exogenous polynucleotide encodes an antigen having a sequence at least 80% identical to any one of SEQ ID NOs: 97-100. 74. A method for inducing an immune response in a subject, the method comprising administering to the subject a nucleic acid described in any one of embodiments 1 to 73. 75. A nucleic acid composition comprising a first sequence encoding a first antigen and a second sequence encoding an MHC-binding peptide. 76. The nucleic acid of embodiment 75, wherein the MHC binding peptide is an MHC class I and / or MHC class II peptide. 77. The nucleic acid according to embodiment 75 or embodiment 76, wherein the second sequence comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 113 to 135. 78. The nucleic acid of embodiment 77, wherein the second sequence comprises a sequence that is at least 80% identical to SEQ ID NO: 113. 79. The nucleic acid according to embodiment 75 or embodiment 76, wherein the MHC binding peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 136 to 163. 80. The nucleic acid of embodiment 79, wherein the MHC binding peptide comprises a sequence that is at least 80% identical to SEQ ID NO: 136. 81. The nucleic acid of embodiment 75 or embodiment 76, wherein the second sequence comprises a pathogen-associated sequence. 82. The nucleic acid of embodiment 81, wherein the pathogen is a virus, a bacterium, a fungus, a protozoan, or a helminth. 83. The second sequence is selected from the group consisting of Coronaviridae (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1); Picornaviridae (e.g., polio viruses, hepatitis A viruses, enteroviruses, human coxsackie viruses, rhinoviruses, echoviruses); Caliciviridae (e.g., strains that cause gastroenteritis); Dogaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses, Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g., ebola viruses); Paramyxoviridae (e.g., parainfluenza viruses, mumpss viruses, measles viruses, respiratory syncytial viruses); Orthomyxoviridae (e.g., influenza viruses); Bunyaviridae (e.g., Hantaan viruses, Bunga viruses, phleboviruses, and Nairo viruses); Arena viridae (hemorrhagic fever viruses);Reoviridae (e.g., reoviruses, orbiviurses, and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae; Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpes virus, Epstein-Barr virus); Poxviridae (variola virus, vaccinia virus, pox virus); and Iridoviridae (e.g., African swine fever virus); Hepatitis C virus; Norwalk virus 83. The nucleic acid of embodiment 81 or embodiment 82, which is at least 80% identical to a sequence of 10 or more nucleobases from a virus selected from: Astrovirus; 84. The second sequence is Helicobacter pylori pylori), Borrelia burgdorferi, Legionella pneumophila, Mycobacterial species (e.g., Mycobacterium tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Meningococcemia, Listeria monocytogenes, Streptococcus pyogenes (group A streptococci), Streptococcus agalactiae (group B streptococci), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter species, Enterococcus species, Haemophilus influenzae, 83. The nucleic acid of embodiment 81 or embodiment 82, which is at least 80% identical to 10 or more nucleobases from a bacterium selected from: Vacillus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium spp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp., Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis, Treponema pallidum, Treponema yaweis, Leptospira spp., and Actinomyces israelii. 85. The nucleic acid of embodiment 81 or embodiment 82, wherein the second sequence is at least 80% identical to 10 or more nucleobases from a fungus selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans. 86. The nucleic acid of embodiment 81 or embodiment 81, wherein the second sequence is at least 80% identical to 10 or more nucleobases from a protozoan selected from Plasmodium spp. (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania Major. 87. The nucleic acid according to any one of embodiments 75 to 86, wherein the MHC binding peptide has a length of 7 to 20 peptides. 88. The nucleic acid according to any one of embodiments 75 to 87, comprising two or more sequences encoding MHC-binding peptides. 89. The first sequence may be from a Coronaviridae (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1); Picornaviridae (e.g., poliovirus, hepatitis A virus; enterovirus, human coxsackievirus, rhinovirus, echovirus); Caliciviridae (e.g., strains that cause gastroenteritis); Dogaviridae (e.g., equine encephalitis virus, rubella virus); Flaviviridae (e.g., dengue virus, encephalitis virus, yellow fever virus); Coronaviridae (e.g., coronavirus); Rhabdoviridae (e.g., vesicular stomatitis virus, rabies virus); Filoviridae (e.g., Ebola virus); Paramyxoviridae (e.g., parainfluenza virus, mumps virus), measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza 89. The nucleic acid of any one of embodiments 75-88, which is at least 80% identical to 10 or more nucleobases from a virus selected from: Bunyaviridae (e.g., Hantaan virus, Bunyaviridae, Phlebovirus, and Nairovirus); Arenaviridae (hemorrhagic fever viruses); Reoviridae (e.g., Reovirus, Orbivirus, and Rotavirus); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (Parvovirus); Papovaviridae (Papillomavirus, Polyomavirus); Adenoviridae; Herpesviridae (Herpes simplex virus (HSV) 1 and 2, Varicella-zoster virus, Cytomegalovirus (CMV), Herpes virus, Epstein-Barr virus); Poxviridae (Vaccinia virus, Pox virus); and Iridoviridae (e.g., African swine fever virus); Hepatitis C virus; Norwalk virus; and Astrovirus. 90. The first sequence is Helicobacter pylori pyloris), Borrelia burgdorferi, Legionella pneumophila, Mycobacterial species (e.g., Mycobacterium tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Meningococcemia, Listeria monocytogenes, Streptococcus pyogenes (group A streptococci), Streptococcus agalactiae (group B streptococci), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter species, Enterococcus species, Haemophilus influenzae, 89. The nucleic acid of any one of embodiments 75-88, which is at least 80% identical to 10 or more nucleobases from a bacterium selected from: Vacillus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium spp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp., Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis, Treponema pallidum, Treponema yaweis, Leptospira spp., and Actinomyces israelii. 91. The nucleic acid of any one of embodiments 75-88, wherein the first sequence is at least 80% identical to 10 or more nucleobases from a fungus selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans. 92. The nucleic acid of any one of embodiments 75-88, wherein the first sequence is at least 80% identical to 10 or more nucleobases from a protozoan selected from Plasmodium spp. (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania Major. 93. The nucleic acid according to any one of embodiments 75 to 88, wherein the first antigen has a sequence that is at least 80% identical to any one of SEQ ID NOs: 97 to 100. 94. The nucleic acid according to any one of embodiments 75 to 88, wherein the first sequence comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 93 to 96. 95. The nucleic acid according to any one of embodiments 75 to 94, wherein the first sequence and the second sequence are present on two separate nucleic acid strands. 96. The nucleic acid according to any one of embodiments 75 to 94, wherein the first and second sequences are linked. 97. The nucleic acid according to any one of embodiments 75 to 96, comprising a sequence encoding a cleavage site. 98. The nucleic acid of embodiment 97, wherein the cleavage site comprises an exopeptidase, endopeptidase, and / or exopeptidase cleavage site. 99. The nucleic acid of embodiment 97 or embodiment 98, wherein the cleavage site is a proteasome cleavage site, a cysteine ​​protease cleavage site, an aspartate protease cleavage site, or a serine protease cleavage site. 100. The nucleic acid according to any one of embodiments 97 to 99, wherein the sequence encoding the cleavage site comprises a sequence at least 80% identical to any one of SEQ ID NOs: 73 to 82. 101. The nucleic acid according to any one of embodiments 97 to 99, wherein the sequence encoding the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 81. 102. The nucleic acid according to any one of embodiments 97 to 99, wherein the cleavage site comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 83 to 92. 103. The nucleic acid according to any one of embodiments 97 to 99, wherein the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 91. 104. The nucleic acid according to any one of embodiments 75 to 103, comprising a sequence encoding a signal peptide. 105. The nucleic acid of embodiment 104, wherein the signal peptide is Gaussia luciferase, human albumin, human chymotrypsinogen, human interleukin 2, or human trypsinogen-2. 106. The nucleic acid according to embodiment 104 or embodiment 105, wherein the signal peptide is at least 80% identical to any one of SEQ ID NOs: 107 to 112. 107. The nucleic acid according to embodiment 104 or embodiment 105, wherein the signal peptide is at least 80% identical to SEQ ID NO: 107. 108. The nucleic acid according to any one of embodiments 75 to 107, wherein the nucleic acid is deoxyribonucleic acid (DNA). 109. A ribonucleic acid (RNA) transcribed from the DNA of embodiment 108. 110. The RNA according to embodiment 109, wherein the RNA is transcribed in vitro or in vivo. 111. The nucleic acid according to any one of embodiments 75 to 107, wherein the nucleic acid is a ribonucleic acid (RNA). 112. The nucleic acid according to any one of embodiments 109 to 111, wherein the RNA is messenger RNA. 113. A peptide translated from a nucleic acid according to any one of embodiments 109 to 112. 114. A method for inducing an immune response in a subject, the method comprising administering to the subject a nucleic acid described in embodiments 75 to 112 or a peptide described in embodiment 113. 115. The method of embodiment 74 or embodiment 114, wherein the nucleic acid is delivered via a lipid nanoparticle, a virus-like particle, or delivered naked. 116. A nucleic acid comprising (i) a first exogenous polynucleotide, and (ii) a 5' untranslated region (5' UTR) of a first flavivirus and / or a 3' untranslated region (3' UTR) of a second flavivirus, and a polynucleotide encoding an MHC-binding peptide. 117. The nucleic acid of embodiment 116, wherein the first flavivirus is a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a flavivirus with no known vector (NKFV), or an unclassified flavivirus (NCFV). 118. The first flaviviruses were identified as dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), Zika virus (ZIKV), tick-borne encephalitis virus (TBEV), Ustu virus (USUV), Apoivirus (APOIV), Border disease virus (BDV), bovine viral diarrhea virus (BVDV), Buscuara virus (BSQV), cell fusion factor virus (CFAV), classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (ENTV), pestivirus Kirin-1, hepatitis C virus (HCV), hepatitis B virus (GBV), hepatitis B virus (HCV), hepatitis C virus (HCV), hepatitis B ... C virus (HCV), hepatitis B virus (HCV), hepatitis C virus (HCV), hepatitis C virus (HCV), hepatitis B virus (HCV), hepatitis C virus (HCV), hepatitis C virus (HCV), hepatitis C virus (HCV), hepatitis B virus (HCV), hepatitis C virus (HCV), hepatitis C virus (HCV), hepat The nucleic acid of embodiment 116 or embodiment 117, wherein the nucleic acid is selected from the group consisting of GBV-B, GB virus C / Hepatitis G virus (GBV-C), Ilheus virus (ILHV), Kamiti River virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TABV), or Yokose virus (YOKV). 119. The nucleic acid of embodiment 116, wherein the first flavivirus is a dengue virus (DENV). 120. The nucleic acid of embodiment 119, wherein the dengue virus is dengue virus serotype 4 (DENV-4). 121. The nucleic acid of any one of embodiments 116 to 120, wherein the second flavivirus is a tick-borne flavivirus (TBFV), a mosquito-borne flavivirus (MBFV), an insect-specific flavivirus (ISFV), a flavivirus with no known vector (NKFV), or an unclassified flavivirus (NCFV). 122. Second flaviviruses are dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), Zika virus (ZIKV), tick-borne encephalitis virus (TBEV), Ustu virus (USUV), Apoivirus (APOIV), Border disease virus (BDV), bovine viral diarrhea virus (BVDV), Buscuara virus (BSQV), cell fusion factor virus (CFAV), classical swine fever virus (CSFV), Culex flavivirus (CxFV), Entebbe bat virus (ENTV), pestivirus Kirin-1, hepatitis C virus (HCV), hepatitis B virus (GBV), hepatitis B virus (GHB), hepatitis C virus (HCV), hepatitis B virus (HGBV), hepatitis C virus (HGBV ... C virus (HGBV), hepatitis B virus (HGBV), hepatitis C virus (HGBV), hepatitis C virus (HGBV), he The nucleic acid according to any one of embodiments 116 to 121, wherein the nucleic acid is selected from the group consisting of BV-B, GB virus C / Hepatitis G virus (GBV-C), Ilheus virus (ILHV), Kamiti River virus (KRV), Kokobera virus (KOKV), Langat virus (LGTV), Louping ill virus (LIV), Modoc virus (MODV), Montana myotis leukoencephalitis virus (MMLV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus (OHFV), Powassan virus (POWV), Rio Bravo virus (RBV), Sepik virus (SEPV), Tamana bat virus (TABV), or Yokose virus (YOKV). 123. The nucleic acid of any one of embodiments 116 to 120, wherein the second flavivirus is a dengue virus (DENV). 124. The nucleic acid of embodiment 123, wherein the dengue virus is dengue virus serotype 4 (DENV-4). 125. The nucleic acid of any one of embodiments 116 to 124, wherein the first flavivirus and the second flavivirus are the same flavivirus. 126. The nucleic acid of any one of embodiments 116-125, wherein the 5'UTR comprises a sequence at least about 80% identical to any one of SEQ ID NOs: 1-36, or a sequence at least 80% identical to at least 50, 60, 70, 80, 90, or 100 consecutive bases of a virus in Table 1. 127. The nucleic acid of any one of embodiments 116 to 125, wherein the 5'UTR comprises a sequence derived from any one of SEQ ID NOs: 1 to 36 or from a virus in Table 1. 128. The nucleic acid of embodiment 127, wherein the 5'UTR is at least 80% identical to SEQ ID NO: 5 or 36. 129. The nucleic acid of any one of embodiments 116-128, wherein the 3'UTR comprises a sequence at least about 80% identical to any one of SEQ ID NOs: 37-70, or a sequence at least 80% identical to at least 50, 60, 70, 80, 90, or 100 consecutive bases of a virus in Table 2. 130. The nucleic acid of any one of embodiments 116 to 128, wherein the 3'UTR comprises a sequence derived from any one of SEQ ID NOs: 37 to 70 or from a virus of Table 2. 131. The nucleic acid of embodiment 130, wherein the 3'UTR is at least 80% identical to SEQ ID NO:40. 132. The nucleic acid of any one of embodiments 116 to 131, wherein the 5'UTR comprises stem-loop A of the 5'UTR of a first flavivirus. 133. The nucleic acid of any one of embodiments 116 to 132, wherein the 5'UTR comprises stem-loop B of the 5'UTR of the first flavivirus. 134. The nucleic acid of any one of embodiments 116 to 133, wherein the 5'UTR comprises the 5'ATG of a first flavivirus. 135. The nucleic acid of any one of embodiments 116 to 134, wherein the 5'UTR comprises a capsid coding region hairpin element (cHP) of a first flavivirus. 136. The nucleic acid of any one of embodiments 116 to 135, wherein the 5'UTR comprises a 5' conserved sequence of a first flavivirus. 137. The nucleic acid of any one of embodiments 116 to 136, wherein the 3'UTR comprises at least one endonuclease-resistant sequence of a second flavivirus. 138. The nucleic acid of any one of embodiments 116 to 137, wherein the 3'UTR comprises a short hairpin structure of a second flavivirus. 139. The nucleic acid of any one of embodiments 126 to 138, wherein the 3'UTR comprises a 3'cyclization sequence of a second flavivirus. 140. The nucleic acid of any one of embodiments 126-139, wherein the 3'UTR comprises a 3'TAG, TAA, or TGA of a second flavivirus. 141. The nucleic acid of any one of embodiments 116 to 140, wherein the 5'UTR does not comprise a 5'cap modification. 142. The nucleic acid of any one of embodiments 116 to 141, wherein the 5'UTR comprises a 5'cap modification. 143. The nucleic acid of any one of embodiments 116 to 142, wherein the 5'UTR has a length of about 80 bases to about 200 bases. 144. The nucleic acid of any one of embodiments 116 to 143, wherein the 3'UTR has a length of about 200 to about 700 bases. 145. The nucleic acid according to any one of embodiments 116 to 144, wherein the nucleic acid does not contain a sequence encoding 10 or more consecutive amino acids of one structural protein of the first or second flavivirus. 146. The nucleic acid of any one of embodiments 116 to 145, wherein the nucleic acid does not contain a sequence encoding 10 or more consecutive amino acids of any structural protein of the first or second flavivirus. 147. The nucleic acid of embodiment 145 or embodiment 146, wherein the structural protein is a capsid, membrane, or envelope protein of a first flavivirus or a second flavivirus. 148. The nucleic acid according to any one of embodiments 116 to 147, wherein the nucleic acid does not contain a sequence encoding 10 or more consecutive amino acids of one nonstructural protein of the first or second flavivirus. 149. The nucleic acid of any one of embodiments 116 to 148, wherein the nucleic acid does not contain a sequence encoding 10 or more consecutive amino acids of any nonstructural protein of the first or second flavivirus. 150. The nucleic acid according to any one of embodiments 116 to 149, wherein the nucleic acid does not include a sequence 3' to the exogenous nucleotide sequence, the sequence comprising at least 10 bases having at least 80% adenosine residues. 151. The nucleic acid according to any one of embodiments 116 to 150, wherein the exogenous polynucleotide encodes a polypeptide. 152. The nucleic acid of embodiment 151, wherein the exogenous polynucleotide is translated into a polypeptide in a normal cell or during a cellular stress response. 153. The nucleic acid according to any one of embodiments 116 to 152, wherein the nucleic acid is resistant to degradation by RNAses. 154. The nucleic acid according to embodiment 153, wherein the RNAse is XRN-1. 155. The nucleic acid of embodiment 153, wherein the RNAse comprises one or more extracellular RNAses selected from the group consisting of hRNAse1, hRNAse2, hRNAse3, hRNAse4, hRNAse5, hRNAse6, hRNAse7, hRNAse8, hRNAse9, hRNAse10, hRNAse11, hRNAse12, hRNAse13, bovine sperm RNAse, bovine milk RNAse, rodent RNAse, frog RNAse, RNAseT2, plant self-incompatible RNAse, or bacterial RNAse. 156. The nucleic acid according to any one of embodiments 116 to 155, wherein the nucleic acid has less than 10 base modifications or no base modifications. 157. The nucleic acid according to any one of embodiments 116 to 156, wherein the nucleic acid has less than 10 backbone modifications or no backbone modifications. 158. The nucleic acid according to any one of embodiments 116 to 157, wherein the nucleic acid has fewer than 10 sugar modifications or no sugar modifications. 159. The nucleic acid according to any one of embodiments 116 to 158, wherein the nucleic acid is deoxyribonucleic acid (DNA). 160. A ribonucleic acid (RNA) transcribed from the DNA of embodiment 159. 161. The RNA according to embodiment 160, wherein the RNA is transcribed in vitro or in vivo. 162. The nucleic acid according to any one of embodiments 116 to 158, wherein the nucleic acid is a ribonucleic acid (RNA). 163. The nucleic acid according to any one of embodiments 160 to 162, wherein the RNA is messenger RNA. 164. The nucleic acid according to any one of embodiments 116 to 163, comprising a self-cleavage site. 165. The nucleic acid according to any one of embodiments 116 to 164, comprising an internal ribosome entry site. 166. The nucleic acid according to any one of embodiments 116 to 165, comprising a sequence encoding a peptide that induces ribosomal skipping during translation. 167. The nucleic acid according to any one of embodiments 116 to 166, comprising a sequence encoding a peptide motif of DxExNPGP, where x is any amino acid. 168. The nucleic acid according to any one of embodiments 116 to 167, comprising a sequence at least 80% identical to SEQ ID NO: 71. 169. The nucleic acid according to any one of embodiments 116 to 168, comprising a sequence encoding a signal peptide. 170. The nucleic acid of embodiment 169, wherein the signal peptide is Gaussia luciferase, human albumin, human chymotrypsinogen, human interleukin 2, or human trypsinogen 2. 171. The nucleic acid according to embodiment 169 or embodiment 170, wherein the signal peptide is at least 80% identical to any one of SEQ ID NOs: 107 to 112. 172. The nucleic acid according to embodiment 169 or embodiment 170, wherein the signal peptide is at least 80% identical to SEQ ID NO: 107. 173. The nucleic acid according to any one of embodiments 116 to 172, comprising a sequence encoding a cleavage site. 174. The nucleic acid of embodiment 173, wherein the sequence encoding the cleavage site is located between the 5'UTR and the exogenous polynucleotide. 175. The nucleic acid according to embodiment 173 or embodiment 174, wherein the cleavage site comprises an exopeptidase, an endopeptidase, and / or an exopeptidase cleavage site. 176. The nucleic acid according to embodiment 173 or embodiment 174, wherein the cleavage site is a proteasome cleavage site, a cysteine ​​protease cleavage site, an aspartate protease cleavage site, a serine protease cleavage site, or a combination thereof. 177. The nucleic acid according to any one of embodiments 116 to 176, wherein the sequence encoding the cleavage site comprises a sequence at least 80% identical to any one of SEQ ID NOs: 73 to 82. 178. The nucleic acid according to any one of embodiments 173 to 176, wherein the sequence encoding the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 81. 179. The nucleic acid according to any one of embodiments 173 to 176, wherein the cleavage site comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 83 to 92. 180. The nucleic acid according to any one of embodiments 173 to 176, wherein the cleavage site comprises a sequence at least 80% identical to SEQ ID NO: 91. 181. The nucleic acid according to any one of embodiments 116 to 180, wherein the exogenous polynucleotide encodes a pathogen-associated antigen. 182. The nucleic acid of embodiment 181, wherein the pathogen is a virus, a bacterium, a fungus, a protozoan, or a helminth. 183. The nucleic acid of embodiment 181 or embodiment 182, wherein the exogenous polynucleotide encodes a viral structural protein, a viral envelope protein, a viral capsid protein, or a viral nonstructural protein, or any combination thereof. 184. The exogenous polynucleotide may be selected from the group consisting of Coronaviridae (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); Retroviridae (e.g., human immunodeficiency viruses, such as HIV1); Picornaviridae (e.g., poliovirus, hepatitis A virus; enterovirus, human coxsackievirus, rhinovirus, echovirus); Caliciviridae (e.g., strains that cause gastroenteritis); Dogaviridae (e.g., equine encephalitis virus, rubella virus); Flaviviridae (e.g., dengue virus, encephalitis virus, yellow fever virus); Coronaviridae (e.g., coronavirus); Rhabdoviridae (e.g., vesicular stomatitis virus, rabies virus); Filoviridae (e.g., Ebola virus); Paramyxoviridae (e.g., parainfluenza virus, mumps virus), measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza virus); Bunyaviridae (e.g., The nucleic acid of any one of embodiments 181 to 183, encoding an antigen from a virus selected from, for example, Hantaan virus, Bunyaviridae, Phlebovirus, and Nairovirus; Arenaviridae (hemorrhagic fever viruses); Reoviridae (e.g., Reovirus, Orbivirus, and Rotavirus); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (Parvovirus); Papovaviridae (Papillomavirus, Polyomavirus); Adenoviridae; Herpesviridae (Herpes simplex virus (HSV) 1 and 2, Varicella-zoster virus, Cytomegalovirus (CMV), Herpes virus, Epstein-Barr virus); Poxviridae (Vaccinia virus, Pox virus); and Iridoviridae (e.g., African swine fever virus); Hepatitis C virus; Norwalk virus; and Astrovirus, and optionally, the exogenous polynucleotide comprises a sequence at least 80% identical to 10 or more nucleobases from the virus. 185. The exogenous polynucleotide is not intended to be used to identify or identify any of the following pathogenic bacteria: Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacterium species (e.g., Mycobacterium tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Meningococcemia, Listeria monocytogenes, Streptococcus pyogenes (group A streptococci), Streptococcus agalactiae (group B streptococci), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter species, Enterococcus species, and Haemophilus influenzae 184. The nucleic acid of any one of embodiments 181 to 183, wherein the exogenous polynucleotide encodes an antigen derived from a bacterium selected from Escherichia coli, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium spp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp., Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis, Treponema pallidum, Treponema yaweis, Leptospira spp., and Actinomyces israelii, and optionally, the exogenous polynucleotide comprises a sequence that is at least 80% identical to 10 or more nucleobases derived from the bacterium. 186. The nucleic acid of any one of embodiments 181 to 183, wherein the exogenous polynucleotide encodes an antigen derived from a fungus selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans, and optionally, the exogenous polynucleotide comprises a sequence that is at least 80% identical to 10 or more nucleic acid bases derived from the fungus. 187. The nucleic acid of any one of embodiments 181 to 183, wherein the exogenous polynucleotide encodes an antigen from a protozoan selected from Plasmodium spp. (e.g., Plasmodium falciparum), Trypanosomes (e.g., Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g., Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania major, and optionally, the exogenous polynucleotide comprises a sequence that is at least 80% identical to 10 or more nucleic acid bases from the protozoan. 188. The nucleic acid according to any one of embodiments 116 to 187, wherein the exogenous polynucleotide comprises a sequence at least 80% identical to any one of SEQ ID NOs: 93 to 96. 189. The nucleic acid according to any one of embodiments 116 to 188, wherein the exogenous polynucleotide encodes an antigen having a sequence at least 80% identical to any one of SEQ ID NOs: 97 to 100. 190. The nucleic acid according to any one of embodiments 116 to 189, wherein the first exogenous polynucleotide and the polynucleotide encoding the MHC-binding peptide are present on two separate nucleic acid strands. 191. The nucleic acid according to any one of embodiments 116 to 189, wherein the first exogenous polynucleotide and the polynucleotide encoding the MHC-binding peptide are linked. 192. The nucleic acid according to any one of embodiments 116 to 191, wherein the MHC binding peptide is an MHC class I and / or MHC class II peptide. 193. The nucleic acid according to any one of embodiments 116 to 192, wherein the polynucleotide encoding the MHC-binding peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 113 to 135. 194. The nucleic acid of embodiment 193, wherein the polynucleotide encoding the MHC-binding peptide comprises a sequence that is at least 80% identical to SEQ ID NO: 113. 195. The nucleic acid according to any one of embodiments 116 to 194, wherein the MHC binding peptide comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 136 to 163. 196. The nucleic acid of embodiment 195, wherein the MHC-binding peptide comprises a sequence that is at least 80% identical to SEQ ID NO: 136. 197. The nucleic acid according to any one of embodiments 116 to 192, wherein the polynucleotide encoding the MHC-binding peptide comprises a pathogen-associated sequence. 198. The nucleic acid of embodiment 197, wherein the pathogen is a virus, a bacterium, a fungus, a protozoan, or a helminth. 199. The polynucleotide encoding the MHC-binding peptide may be selected from the group consisting of Coronaviridae (e.g., severe acute respiratory syndrome coronaviruses, such as SARS-CoV-1, SARS-CoV-2, Middle East Respiratory Syndrome coronavirus (MERS-CoV)); Retroviridae (e.g., human immunodeficiency viruses, such as HIV1); Picornaviridae (e.g., poliovirus, hepatitis A virus; enterovirus, human coxsackievirus, rhinovirus, echovirus); Caliciviridae (e.g., strains causing gastroenteritis); Dogaviridae (e.g., equine encephalitis, rubella virus); Flaviviridae (e.g., dengue virus, encephalitis virus, yellow fever virus); Coronaviridae (e.g., coronavirus); Rhabdoviridae (e.g., vesicular stomatitis virus, rabies virus); Filoviridae (e.g., Ebola virus); Paramyxoviridae (e.g., parainfluenza virus, mumps virus), measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., , Influenza virus); Bunyaviridae (e.g., Hantaan virus, Bunyaviridae, Phlebovirus, and Nairovirus); Arenaviridae (hemorrhagic fever virus); Reoviridae (e.g., Reovirus, Orbivirus, and Rotavirus); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvoviridae (Parvovirus); Papovaviridae (Papilloma virus, Polyoma virus); Adenoviridae; Herpesviridae (Herpes simplex virus (HSV) 1 and 2, Varicella-zoster virus, Cytomegalovirus (CMV), Herpes virus, Epstein-Barr virus); Poxviridae (Vaccinia virus, Pox virus); and Iridoviridae (e.g., African swine fever virus); Hepatitis C virus; Norwalk virus; and Astrovirus. 200. Polynucleotides encoding MHC-binding peptides are capable of binding to Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacterium species (e.g., Mycobacterium tuberculosis, M. avium, M. intracellulare, M. kansasii, M. gordonae, M. bovis), Staphylococcus aureus, Neisseria gonorrhoeae, Meningococcemia, Listeria monocytogenes, Streptococcus pyogenes (group A streptococci), Streptococcus agalactiae (group B streptococci), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter species 199. The nucleic acid of embodiment 197 or embodiment 198, which is at least 80% identical to 10 or more nucleobases from a bacterium selected from: Enterococcus spp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium spp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp., Fusobacterium nucleatum, pathogenic strains of Escherichia coli, Streptobacillus moniliformis, Treponema pallidum, Treponema yaweis, Leptospira spp., and Actinomyces israelii. 201. The nucleic acid of embodiment 197 or embodiment 198, wherein the polynucleotide encoding the MHC-binding peptide is at least 80% identical to 10 or more nucleobases from a fungus selected from Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, and Candida albicans. 202. The nucleic acid of embodiment 197 or embodiment 198, wherein the polynucleotide encoding the MHC-binding peptide is at least 80% identical to 10 or more nucleobases from a protozoan selected from Plasmodium spp. (e.g. Plasmodium falciparum), Trypanosomes (e.g. Trypanosoma cruzi), Toxoplasma gondii, Leishmania spp. (e.g. Leishmania braziliensis), Leishmania infantum, Leishmania amazonensis, and Leishmania Major. 203. The nucleic acid according to any one of embodiments 116 to 202, wherein the MHC binding peptide has a length of 7 to 20 peptides. 204. The nucleic acid according to any one of embodiments 116 to 203, comprising two or more sequences encoding MHC-binding peptides. 205. A peptide translated from a nucleic acid according to any one of embodiments 116 to 204. 206. A method for inducing an immune response in a subject, comprising administering to the subject a nucleic acid according to any one of embodiments 116 to 204 or a peptide according to embodiment 205. 207. The method of embodiment 206, wherein the nucleic acid is delivered via a lipid nanoparticle, a virus-like particle, or delivered naked.

[0191] Specific Definitions Percent (%) sequence identity with respect to a reference polypeptide or polynucleotide sequence is the percentage of amino acid or nucleotide residues in a candidate sequence that are identical to the amino acid or nucleotide residues in the reference polypeptide or polynucleotide sequence after aligning the sequences to achieve the maximum percent sequence identity and introducing gaps as necessary, without considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be accomplished in a variety of ways known in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Appropriate parameters for aligning sequences can be determined, including the algorithms required to achieve maximum alignment over the entire length of the sequences being compared. However, for purposes herein, % amino acid or polynucleotide sequence identity values ​​are generated using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc., and the source code has been submitted with user documentation to the U.S. Copyright Office, Washington, DC, 20559, and is registered under U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, Calif., or can be compiled from the source code. The ALIGN-2 program should be compiled for use on UNIX operating systems, including Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

[0192] In the context of using ALIGN-2 for amino acid or polynucleotide sequence comparison, the % amino acid or polynucleotide sequence identity of a given sequence A to a given sequence B (or alternatively, a given sequence A can be said to have or contain a certain % sequence identity to a given sequence B) is calculated as 100 x fraction X / Y, where X is the number of residues scored as a match by the ALIGN-2 sequence alignment program in the alignment identity between A and B, and where Y is the total number of residues in B. Note that if the length of sequence A is not equal to the length of sequence B, then the % sequence identity of A to B is not equal to the % sequence identity of B to A to B. Unless otherwise specified, all % sequence identity values ​​used herein are obtained using the ALIGN-2 computer program as described in the immediately preceding paragraph.

[0193] In some embodiments, the term "about" means within 10% of the stated amount. For example, a peptide that contains about 80% identity to a reference peptide may contain 72%-88% identity to the reference peptide sequence. EXAMPLES

[0194] The following examples are illustrative of the embodiments described herein and should not be construed as limiting the scope of this disclosure. Where specific materials are mentioned, this is for illustrative purposes only and is not intended to be limiting. Those skilled in the art may develop equivalent means or reactants without the need to exercise their advanced understanding and without departing from the scope of the present disclosure.

[0195] Example 1: Preparation of mRNA vaccine In a first example, an mRNA construct encoded by the DNA of Table 8 is prepared. The sequence includes from 5' to 3': dengue virus 5'UTR (underlined), internal ribosome entry site / cleavage site P2A (wavy underline), signal peptide for antigen (italics), cathepsin cleavage site (bold), MHC binding peptide p25 (bold underline), cathepsin cleavage site (bold), MHC binding peptide p25 (bold underline), cathepsin cleavage site (bold), MHC binding peptide p25 (bold underline), cathepsin cleavage site (bold), spike antibody from COVID-19 (not underlined or italicized), and dengue virus 3'UTR (underlined). RNA is transcribed in vitro using T7 or SP6 promoters, and the nucleotides used are either natural (A, C, U, G) or synthetic (including Cap analogs and modified nucleotides such as pseudouridine and n-methyl-pseudouridine). The RNA is purified by affinity columns or precipitation reactions. Following purification, the RNA is sequenced by reverse transcriptase-PCR or analyzed by gel electrophoresis to ensure that the RNA is of the appropriate size and that no degradation of the RNA has occurred. The RNA is encapsulated in the delivery method of choice.

[0196] [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6] [Table 8-7] [Table 8-8] [Table 8-9] [Table 8-10] [Table 8-11] [Table 8-12] FUTR UTR (underlined); P2A (wavy underline); signal peptide for antigen (italics); cathepsin cleavage site (bold); MHC binding peptide p25 (bold underline); linker (dot-dash underline); commercial UTR (italics + underline); Renilla protein (neither underlined nor italics); RBD protein (double underline); spike protein (bold + underline).

[0197] In a second example, constructs of mRNAs were prepared as shown in Figures 4A-4D and Table 8. FUTR-Renilla contains 5 prime CAP, DV-4 UTR, Renilla luciferase gene; FUTR Renilla-Booster contains 5 prime CAP, DV-4 UTR, Renilla luciferase gene, booster (3x cathepsin S cleavage site + mycobacterial MHC-II (p25) epitope); and FUTR RBD-Booster contains 5 prime CAP, FUTR UTR, signal peptide (spike) SARS-CoV2 receptor-binding domain-RBD gene, booster (3x cathepsin S cleavage site + MHC-II (p25) epitope). The commercially available UTR constructs contain 5 prime CAP, UTRs (sequences in Table 8, see SEQ ID NOs: 175-177), a signal peptide, and a Renilla luciferase gene. Unless indicated in the figure, a polyA tail is added to all constructs.

[0198] The mRNA was transcribed in vitro using the T7XX promoter and the nucleotides used were either natural (A, C, U, G) or synthetic (including Cap analogs and modified nucleotides such as pseudouridine and n-methyl-pseudouridine). The RNA was purified by affinity columns or precipitation reactions. After purification, the mRNA was analyzed by gel electrophoresis (Figure 5). As shown in the figure, all of the exemplary mRNA constructs were successfully transcribed. The results were reproducible.

[0199] Example 2: Protein expression in cell-free and mammalian cell systems Cell-free system: Renilla proteins encoded in the in vitro transcribed mRNA constructs shown in Figure 4A (see also Table 8) were translated in a rabbit reticulocyte lysate system (Promega). 2ug of in vitro transcribed (IVT) FUTR-Renilla mRNA was incubated at 30°C for 2 hours and quantified by measuring renilla activity (RLU), as shown in Figure 6A.

[0200] Mammalian cell systems: Renilla proteins encoded in the in vitro transcribed mRNA constructs shown in Figure 4A (see also Table 8) were translated in 293T cells. As shown in Figure 6B, cells were transfected with 0.5 μg of in vitro transcribed FUTR-Renilla mRNA and quantified by measuring Renilla activity (RLU). FUTR-Renilla mRNA constructs were modified to include a 5' cap ("CAP"), polyadenylation ("Poly A"), and / or replacement of uridine bases with pseudouridine ("Pseudouridine"). As shown in Figure 6B, such modifications promoted translation of mRNA in mammalian cells 1000-fold over unmodified FUTR-Renilla molecules.

[0201] Data in Figures 6A-6B are presented as mean ± SEM. Statistical significance between groups was assessed by one-way analysis of variance (ANOVA) followed by post-hoc Dunnett's test. The accepted significance level for the test was P < 0.05. Data were plotted and analyzed using GraphPad Prism software.

[0202] Renilla proteins translated from FUTR-Renilla mRNA were visualized by Western Blot (Figure 6C). Supernatants from 293T cells transfected with FUTR-Renilla mRNA or non-transfected 293T cells were used. 56.63 mg of protein from each sample was applied to an SDS-PAGE gel and transferred to a Nitrocellulose Transfer Membrane. Renilla proteins were detected by Rabbit mAb anti-renilla [EPR17792] (1:5000) from Abcam, and Tubulin protein was used as a loading control and detected by Mouse mAb anti-a-tubulin [DM1A] (1:5000) from Millipore. Respective anti-IgG antibodies conjugated with HRP were used, and SuperSignal™ West Pico PLUS Chemiluminescent Substrate ThermoFisher was used for development.

[0203] Example 3: Canonical and non-canonical antigen translation An mRNA construct is prepared that contains, from 5' to 3', the dengue virus 5'UTR, the nucleic acid encoding the photoprotein, and the dengue virus 3'UTR DNA (see, for example, FIG. 3). The mRNA is transcribed in vitro using T7 or SP6 promoters, and the nucleotides used are both natural (A, C, U, G) or synthetic (including Cap analogs and modified nucleotides such as pseudouridine and n-methyl-pseudouridine). The mRNA is produced with or without a cap. The respective mRNA is delivered to rabbit reticulocytes (RRL), and the translation of the photoprotein is measured in RLU to show that the protein translation occurs in a Cap-1 (canonical) dependent or independent manner.

[0204] Following injection of exogenous mRNA, protein translation encounters a stressful cellular microenvironment. In an exemplary experiment, the non-canonical translation machinery was tested for performance during cellular stress using both FUTR-Renilla (Figure 4A) and commercially available UTRs-Renilla (Figure 4D). Human immune-competent cells (A549) were transfected with 0.5 μg of each construct (FUTR-Renilla or commercially available UTRs-Renilla) using TransIT (Mirus), incubated for 3 h, and then stimulated with poly(I:C) 10 μg / ml for 3 h. Poly(I:C) is a double-stranded RNA analogue that induces translation arrest via phosphorylation of eIF2a. This is a key mechanism of the immune system to control infections and other stressful situations. Renilla protein expression was assessed by measuring Renilla activity (RLU). To calculate the effect of poly(I:C) transfection on Renilla protein expression in A549 cells, cells without poly(I:C) stimulation (100%) were used. Figure 7 shows that FUTR-Renilla mRNA is significantly more resistant to stress than commercial UTR. Data are presented as mean ± SEM statistical significance between groups assessed by one-way analysis of variance (ANOVA) followed by post-hoc Tukey test. The accepted significance level for the test was P<0.05. Data were plotted and analyzed using GraphPadPrism software. Stress-resistant mRNA may result in increased translation in stressed cellular conditions.

[0205] Example 4: mRNA stability: relative RNAse resistance A first nucleic acid, comprising an exogenous polynucleotide encoding an antigen and a flavivirus 5'UTR and / or a flavivirus 3'UTR, is incubated with RNase XRN-1. For example, the first nucleic acid is an mRNA transcribed from the construct of Example 1. Similarly, a second nucleic acid, comprising the above exogenous polynucleotide encoding an antigen and a non-flavivirus 5'UTR and a non-flavivirus 3'UTR, is incubated separately from RNase XRN-1. For example, the second nucleic acid comprises a capped alpha globin 5' and 3'UTR that surrounds a stabilized form of the SARS-CoV-2 spike protein. The second construct is polyadenylated and contains the same nucleotides, synthetic or natural, as the first construct. The degradation rates between the two nucleic acids are compared. Alternatively or additionally, the removal of XRN-1 from the cell is measured. Nucleic acids that include a flavivirus 5'UTR and / or a flavivirus 3'UTR are expected to be subject to less or no degradation as compared to nucleic acids that do not have a flavivirus UTR.

[0206] In an exemplary experiment, the resistance of FUTR-Renilla (Figure 4A) and commercial UTR-Renilla (Figure 4D) to intracellular RNAase XRN-1 was tested. FUTR-Renilla mRNA and commercial UTR-Renilla mRNA (2 μg each) were incubated with 1.5 U of XRN1 (NEB, USA) and 15 U of RppH (NEB, USA) in a 20 ul reaction mixture containing 1x NEB3 buffer and 1 u / μL RNAseout RNase Inhibitor (Invitrogen, USA). Incubation was carried out at 28°C for 15 minutes. The reaction was stopped by adding 20 μL of Gel Loading Buffer II (Invitrogen, USA), heated at 85°C for 10 minutes, and placed on ice. The entire volume was loaded into a 10% polyacrylamide TBE urea gel and electrophoresis was carried out for 180 minutes. 250 ng of undigested FUTR-Renilla mRNA and Commercial-UTRs mRNA were used as negative controls. Gels were stained with SYBR-safe (Invitrogen, USA) and documented using a dual LED blue / white light transilluminator (KASVI). As shown in Figure 8, the 3'UTR of FUTR-Renilla remained intact, whereas the Commercial-UTRs were quickly degraded by XRN-1. Images are representative of three independent experiments that showed similar results.

[0207] Example 5: Expression of reporter genes with booster fusions in mammalian cells An mRNA construct was designed containing sequences encoding immune-subject-based MHC-II peptides (FIGS. 4B, 4C). Without being bound by theory, this allows to circumvent steps involved in the induction of an immune response, rescue TCR-specific memory CD4+ T cells, and ultimately induce a faster protective effect.

[0208] Briefly, Renilla translation occurring in 293T cells transfected with 0.5 μg of in vitro transcribed FUTR-Renilla or FUTR-Renilla / booster mRNA was quantified by measuring Renilla activity (RLU) (Figure 9A). Data are presented as mean ± SEM statistical significance between groups assessed by one-way analysis of variance (ANOVA) followed by Dunnett's test. The accepted significance level for the test was P<0.05. Data were plotted and analyzed using GraphPad Prism software. Figure 9B shows detection of Renilla proteins translated from FUTR-Renilla and Renilla + booster proteins by Western Blot. Using supernatants from HEK293T cells transfected with FUTR-Renilla / booster, FUTR-Renilla, or untransfected cells, 25 mL of each sample was applied to SDS-PAGE gels and transferred to Nitrocellulose Transfer Membranes. Renilla proteins were detected by rabbit mAb anti-renilla [EPR17792] from Abcam (1:5000). mAb anti-IgG rabbit HRP-Cell Signal was used as the secondary antibody, and SuperSignal™ West Pico PLUS Chemiluminescent Substrate ThermoFisher was used for development.

[0209] As shown in Figure 9A, the addition of the booster does not result in a significant difference in translation of the mRNA, indicating that a functional polypeptide is produced after incorporation of the booster into the native Renilla mRNA molecule. Figure 9B shows that the expected increase in molecular weight was observed with the FUTR-Renilla / booster construct.

[0210] These results confirmed the mRNA encoding the RBD from SARS-Cov-2 as the antigen and the p25 immune-dominant MHC-II peptide from 3x BCG as the model booster (Figure 10). Briefly, 2.5ug of in vitro transcribed FUTR-RBD / booster mRNA was transfected into 293T cells using Lipofectamine Messenger Max (Thermo Fisher). A SARS-CoV-2 spike detection ELISA kit (Sino Biological) was used to measure RBD protein in cell culture supernatants or lysates. The wells were washed three times and then standard curve, lysates and supernatants of 293T cells transfected with FUTR RBD / booster were added and incubated for 2 hours. Next, the wells were washed three times and incubated with detection antibody for 1 hour. The wells were washed three times and given substrate solution for 6 minutes and the reaction was stopped with acidic solution. OD reading was performed at 450nm in a spectrophotometer. Results are the mean ± SEM of data from three replicates. Experiments shown are representative of three performed. Statistical differences between groups were assessed by one-way analysis of variance (ANOVA) followed by post-hoc Tukey's test. The accepted significance level for the test was P<0.05. Data were plotted and analyzed using GraphPadPrism software. The data show that RBD-booster proteins are secreted by HEK293T cells.

[0211] Example 6: FUTR-RBD / booster induces IFN-gamma by antigen-primed CD4+ T cells in vitro Exemplary boosters were functionally evaluated by in vitro recall assays with FUTR-RBD / booster (Figure 4C). In these assays, in vivo primed P25-specific CD4+ T cells generated following BCG immunization produce IFN-gamma only when these cells are activated in vitro by P25 peptide presented by antigen-presenting cells. For testing, purified CD4+ T cells from control naive C57BL / 6 mice or purified CD4+ T cells from BCG-immunized C57BL / 6 mice were cocultured with antigen-loaded bone marrow-derived dendritic cells (BMDCs). Each BMDC was loaded with either supernatant from FUTR-RBD / booster-transfected HEK293T cells or mock-transfected HEK293T cells generated in Example 5. As a control, DCs were treated with synthetic P25 peptide.

[0212] Briefly, supernatant from HEK293T cells as described in Example 5 was used to prime in vitro generated bone marrow derived dendritic cells (DCs) (described in Bafica A, Scanga CA et al., TLR9 regulates Th1 responses and cooperates with TLR2 in mediating optimal resistance to Mycobacterium tuberculosis. J Exp Med. 2005 Dec 19;202(12):1715-24. doi: 10.1084 / jem.20051782. PMID: 16365150; PMCID: PMC2212963). The supernatant-primed DCs were then exposed for 72 hours to either CD4+ T cells purified from the spleens of naive C57bl / 6 mice or CD4+ T cells purified from the spleens of BCG-immunized C57bl / 6 mice. IFN-gamma was analyzed by a commercial ELISA kit. As a positive control, cells were exposed to a) synthetic P25 peptide or b) PMA. Means ± SEM of measurements from 2 or 3 replicate wells are presented.

[0213] FIG. 11A shows a significant increase in IFN-gamma production by CD4+ T BCG compared to naive CD4+ T cells, suggesting that DCs cleave the FUTR-RBD / booster at the cathepsin S catalytic site (FIG. 4, pink box) and present the P25 peptide properly via MHC-II. Similar results were found when DCs were loaded with synthetic P25 peptide (FIG. 11A, last two groups). Of note, when cells were treated with PMA (a non-specific stimulant) as a control (FIG. 11B), both naive and BCG-immunized CD4+ T cell groups had the capacity to produce high amounts of IFN-gamma, confirming that IFN-gamma produced by BCG CD4+ T cells is dependent on P25 peptide presentation.

[0214] Brief Summary of Examples 1-6 The data presented herein demonstrates at least the following:

[0215] The exemplary mRNA constructs (Figures 4A-4C (Table 8)) produce stable functional proteins.

[0216] The exemplary UTRs described herein facilitate translation of an exogenous polynucleotide during stress conditions.

[0217] The addition of molecular boosters to the mRNA composition does not impair protein function or cellular secretion.

[0218] The exemplary boosters described herein are precisely cleaved and presented to primed CD4+ T cells.

[0219] Example 7: In vivo antigen translation Groups of C57BL / 6 mice were immunized with 20 μg of naked FUTR-SPIKE (without polyA tail) complexed with 10 μg protamine in Ringer's lactate solution by intramuscular route (im) (Figure 12, top). Uninjected naive mice were used as controls. Spike protein levels in serum (1:20) were measured from days 1 and 2 by SARS-CoV-2 Spike Detection ELISA Kit (Sino Biological) (Figure 12, bottom). Results are the mean ± SEM of data from two mice in each group. Data were plotted using GraphPad Prism software. Results indicate that spike protein was detected in serum from mice, thus indicating that the mRNA composition containing the exemplary DV UTR is translated in vivo.

[0220] Example 8: Induction of immune responses by vaccines containing MHC-binding peptides Groups of mice are immunized with mRNA vaccines disclosed herein, for example, mRNA vaccines as described in Example 1 or Example 2, or control vaccines, where vaccines are constructed with or without booster. At different time points, specific immune responses are evaluated in serum and spleen from immunized animals. qPCR and Western Blot are used to confirm antibodies, such as spike gene and its protein product, in serum and spleen from immunized animals. Specifically, immunoglobulin G (IgG), anti-spike antibodies (ELISA and pseudotype virus serum neutralization assay) and CD4+ / CD+8 T cell activation (flow cytometry) are measured in immunized and control mice.

Claims

1. A nucleic acid composition comprising the 5' untranslated region (5'UTR) of a first flavivirus, the 3' untranslated region (3'UTR) of a second flavivirus, a first polynucleotide encoding a first peptide that is exogenous to the first flavivirus and / or the second flavivirus, and a polynucleotide encoding a major histocompatibility complex (MHC)-binding peptide.

2. A nucleic acid composition for use in a method for expressing a first peptide in cells, wherein the method comprises delivering the nucleic acid composition to the cells, according to claim 1.

3. A nucleic acid composition for use in a method for inducing an immune response in a subject, wherein the method comprises administering the nucleic acid composition to the subject, according to claim 1.

4. The nucleic acid composition according to claim 1, wherein the 5'UTR is the 5'UTR of dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), Zika virus (ZIKV), or tick-borne encephalitis virus (TBEV), and the 3'UTR is the 3'UTR of dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), Zika virus (ZIKV), or tick-borne encephalitis virus (TBEV), and / or the first flavivirus is the same as the second flavivirus.

5. The nucleic acid composition according to claim 1, wherein the 5'UTR is the 5'UTR of DENV and the 3'UTR is the 3'UTR of DENV.

6. The nucleic acid composition according to claim 1, wherein the 5'UTR is homologous to or at least 80% identical to one sequence in Table 1, and the preceding 3'UTR is homologous to or at least 80% identical to one sequence in Table 2.

7. The nucleic acid composition according to claim 1, wherein the MHC-binding peptide comprises a sequence that is homologous to or at least 80% identical to any one of sequence numbers 136 to 163.

8. The nucleic acid composition according to claim 1, wherein the MHC-binding peptide comprises a sequence that is at least 80% identical to 10 or more nucleic acid bases of the pathogen.

9. The nucleic acid composition according to claim 1, wherein the polynucleotide encoding an MHC-binding peptide encodes a plurality of MHC-binding peptides, and optionally each of the plurality of MHC-binding peptides is the same as or different from another of the plurality of MHC-binding peptides.

10. The nucleic acid composition according to claim 9, wherein the plurality of MHC-binding peptides are about 2, 3, 4, 5, 6, 7, 8, 9, or 10 MHC-binding peptides.

11. The nucleic acid composition according to claim 9 or 10, wherein the nucleic acid composition comprises a polynucleotide linker between two polynucleotides encoding two of the plurality of MHC-binding peptides.

12. The nucleic acid composition according to claim 11, wherein the polynucleotide linker encodes a cleavage site.

13. The nucleic acid composition according to claim 1, wherein the nucleic acid composition is more resistant to RNAse degradation than a control nucleic acid composition comprising a nonflavivirus 5'UTR, a nonflavivirus 3'UTR, and the polynucleotide encoding the first peptide.

14. The nucleic acid composition according to claim 1, wherein the nucleic acid composition comprises a polynucleotide encoding a signal peptide.

15. The nucleic acid composition according to claim 1, wherein the nucleic acid composition comprises a polynucleotide encoding a cleavage site.

16. The nucleic acid composition according to claim 1, wherein the nucleic acid composition does not contain a sequence encoding 10 or more consecutive amino acids of one structural protein of the first flavivirus or the second flavivirus.

17. The nucleic acid composition according to claim 1, wherein the nucleic acid composition does not contain a sequence encoding 10 or more consecutive amino acids of one non-structural protein of the first flavivirus or the second flavivirus.

18. The nucleic acid composition according to claim 1, wherein the first peptide is a pathogen-related antigen.

19. A nucleic acid composition for use in a method for expressing a peptide in cells, the method comprising delivering to the cells a nucleic acid composition comprising a 5' untranslated region (5'UTR) of a first flavivirus, a 3' untranslated region (3'UTR) of a second flavivirus, and a polynucleotide encoding the peptide, wherein the polynucleotide encoding the peptide is exogenous to the first flavivirus and / or the second flavivirus.

20. A nucleic acid composition for use in a method for inducing an immune response in a subject, the method comprising administering to the subject a nucleic acid composition comprising a 5' untranslated region (5'UTR) of a first flavivirus, a 3' untranslated region (3'UTR) of a second flavivirus, and a polynucleotide encoding a peptide, wherein the polynucleotide encoding the peptide is exogenous to the first flavivirus and / or the second flavivirus.

21. The nucleic acid composition according to claim 19 or 20, wherein the polynucleotide is translated into the peptide during cellular stress.

22. The nucleic acid composition according to claim 21, wherein the peptide is expressed in greater quantities from the nucleic acid composition than from the peptide expressed from a control nucleic acid composition comprising a nonflavivirus 5'UTR, a nonflavivirus 3'UTR, and the polynucleotide encoding the peptide.

23. A nucleic acid composition comprising a 5' untranslated region (5'UTR) of a first flavivirus, a 3' untranslated region (3'UTR) of a second flavivirus, and a polynucleotide encoding a peptide, wherein the polynucleotide is exogenous to the first flavivirus and / or the second flavivirus.

24. The nucleic acid composition according to claim 19, 20, or 23, wherein the nucleic acid composition is more resistant to RNAse degradation than a control nucleic acid composition comprising a nonflavivirus 5'UTR, a nonflavivirus 3'UTR, and the polynucleotide encoding the peptide.

25. The nucleic acid composition according to claim 19, 20, or 23, wherein the nucleic acid composition comprises a polynucleotide encoding a signal peptide.

26. The nucleic acid composition according to claim 19, 20, or 23, wherein the nucleic acid composition comprises a polynucleotide encoding a cleavage site.

27. ​​The nucleic acid composition according to claim 19, 20, or 23, wherein the 5'UTR is the 5'UTR of dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), Zika virus (ZIKV), or tick-borne encephalitis virus (TBEV).

28. The nucleic acid composition according to claim 19, 20, or 23, wherein the 3'UTR is the 3'UTR of dengue virus (DENV), West Nile virus (WNV), Japanese encephalitis virus (JEV), yellow fever virus (YFV), Zika virus (ZIKV), or tick-borne encephalitis virus (TBEV).

29. The nucleic acid composition according to claim 19, 20, or 23, wherein the 5'UTR is the 5'UTR of DENV and the 3'UTR is the 3'UTR of DENV.

30. The nucleic acid composition according to claim 19, 20, or 23, wherein the 5'UTR is homologous to or at least 80% identical to one sequence in Table 1, and the preceding 3'UTR is homologous to or at least 80% identical to one sequence in Table 2.

31. The nucleic acid composition according to claim 19, 20, or 23, wherein the nucleic acid composition does not contain a sequence encoding 10 or more consecutive amino acids of one structural protein of the first flavivirus or the second flavivirus.

32. The nucleic acid composition according to claim 19, 20, or 23, wherein the nucleic acid composition does not contain a sequence encoding 10 or more consecutive amino acids of one non-structural protein of the first flavivirus or the second flavivirus.

33. The nucleic acid composition according to claim 19, 20, or 23, wherein the peptide is a pathogen-related antigen.

34. A nucleic acid composition for use in a method for inducing an immune response in a subject, the method comprising administering the nucleic acid composition to the subject, wherein the nucleic acid composition comprises a polynucleotide encoding a first peptide and a polynucleotide encoding a major histocompatibility complex (MHC)-binding peptide.

35. A nucleic acid composition comprising a polynucleotide encoding a first peptide and a polynucleotide encoding an MHC-binding peptide.

36. The nucleic acid composition according to claim 34 or 35, wherein the polynucleotide encoding an MHC-binding peptide encodes a plurality of MHC-binding peptides, and optionally each of the plurality of MHC-binding peptides is the same as or different from another of the plurality of MHC-binding peptides.

37. The nucleic acid composition according to claim 36, wherein the plurality of MHC-binding peptides are about 2, 3, 4, 5, 6, 7, 8, 9, or 10 MHC-binding peptides.

38. The nucleic acid composition according to claim 36, comprising a polynucleotide linker between two of the polynucleotides encoding two of the plurality of MHC-binding peptides.

39. The nucleic acid composition according to claim 38, wherein the polynucleotide linker encodes a cleavage site.

40. The nucleic acid composition according to claim 34 or 35, wherein the MHC-binding peptide comprises a sequence that is homologous to or at least 80% identical to any one of SEQ ID NOs. 136 to 163.

41. The nucleic acid composition according to claim 34 or 35, wherein the MHC-binding peptide contains at least 80% of the same sequence as 10 or more nucleic acid bases of the pathogen.

42. The nucleic acid composition according to claim 34 or 35, wherein the first peptide is a pathogen-related antigen.

43. The nucleic acid composition according to claim 35 for use in a method for expressing the first peptide in cells, comprising delivering the nucleic acid composition to the cells.

Images