Neuronal methylation signatures from cell-free DNA as a research diagnostic for presymptomatic neurodegenerative conditions

Abstract

Disclosed herein is a two-part blood-based diagnostic tool designed to diagnose pre-symptomatic neurodegenerative diseases. Part 1 consists of an assay designed to amplify and sequence pre-specified regions of cell-free DNA. Part 2 consists of a Python-derived pipeline that analyzes methylation signatures to identify neuron-derived DNA and provide a diagnosis of pre-symptomatic neurodegenerative diseases.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is an international application claiming priority to U.S. Provisional Application No. 63 / 319,916, filed March 15, 2022, and U.S. Provisional Application No. 63 / 488,268, filed March 3, 2023, each of which is incorporated by reference in its entirety for all purposes.

[0002] Sequence Listing The entire contents of the attached sequence listing are incorporated herein by reference. The attached file with the file name "062097-501001WO_SL_ST26.xml" is 7,113 bytes long and was created on March 14, 2023.

[0003] Disclosed herein is a two-part blood-based diagnostic tool designed to diagnose pre-symptomatic neurodegenerative conditions. Part 1 consists of an assay designed to amplify and sequence pre-specified regions of cell-free DNA. Part 2 consists of a Python-derived pipeline that analyzes methylation signatures to identify neuron-derived DNA and provide a diagnosis of pre-symptomatic neurodegenerative conditions. [Background technology]

[0004] The current standard of care for diagnosing neurodegenerative conditions, such as Alzheimer's and Parkinson's, involves the use of a series of memory tests and physical examinations to identify the onset of symptoms associated with the condition, which, when identified, indicate that neuronal cell death has already progressed to an irreparable stage. There are currently no known methods for diagnosing neurodegenerative conditions prior to the onset of symptoms.

[0005] Important therapeutic breakthroughs in research have occurred, with results providing evidence of promising treatments to slow neuronal cell death, but without predictive diagnosis, treatments cannot be administered before neuronal cell death becomes irreversible.

[0006] This disclosure addresses these and other problems in the art. Summary of the Invention

[0007] The present technology relates generally to pre-screening methods that can identify neurodegenerative conditions prior to the onset of symptoms. The disclosed methods can be used to diagnose pre-symptomatic neurodegenerative diseases and, in combination with appropriate therapeutic agents, prevent or delay the onset of the disease in patients.

[0008] In one aspect, the disclosure provides a method of treating a subject having or at risk of having a neurodegenerative condition, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; (iii) determining the percentage of cell-free DNA that is neuron-derived; (iv) comparing the percentage of cell-free DNA that is neuron-derived to a control; and (v) administering a therapeutic agent to treat or prevent the neurodegenerative condition if the percentage of cell-free DNA that is neuron-derived is higher than the control.

[0009] In some embodiments, step (ii) comprises analyzing the methylation pattern of the entire amplicon of DNA. In some embodiments, the entire amplicon is at least about 50 base pairs (bp) in length. In some embodiments, the entire amplicon is about 50 to about 500 base pairs in length.

[0010] In some embodiments, a therapeutic agent is administered when the percent cell-free DNA derived from neurons is greater than about 5%. In some embodiments, a therapeutic agent is administered when the percent cell-free DNA derived from neurons is greater than about 7%. In some embodiments, a therapeutic agent is administered when the percent cell-free DNA derived from neurons is greater than about 9%.

[0011] In another aspect, the disclosure provides a method of treating a subject having a neurodegenerative condition or at risk of having neurodegeneration, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; (iii) determining the percentage of cell-free DNA that is neuron-derived; and (iv) administering a therapeutic agent to treat or prevent the neurodegenerative condition if the percentage of cell-free DNA that is neuron-derived is greater than about 5%.

[0012] In another aspect, the disclosure provides a method of analyzing a biological sample from a subject, the method including: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing a methylation pattern of the cell-free DNA; (iii) determining the percentage (%) of cell-free DNA that is neuron-derived; and (iv) comparing the percentage (%) of cell-free DNA that is neuron-derived to a control.

[0013] In another aspect, the disclosure provides a method of measuring neuronal cell death in a subject, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; (iii) determining the percentage (%) of cell-free DNA that is neuron-derived; and (iv) comparing the percentage (%) of cell-free DNA that is neuron-derived to a control.

[0014] In another aspect, the disclosure provides a method for selecting a patient for treatment with a therapeutic agent to treat a neurodegenerative condition, the method comprising: (i) obtaining cell-free DNA from a blood sample from a subject; (ii) analyzing a methylation pattern of the cell-free DNA; (iii) determining the percentage (%) of cell-free DNA that is neuronal; and (iv) comparing the percentage (%) of cell-free DNA that is neuronal to a control, wherein the patient is selected for treatment if the percentage (%) of cell-free DNA that is neuronal is higher than the control.

[0015] In some embodiments, step (ii) comprises analyzing the methylation pattern of the entire amplicon of DNA. In some embodiments, the entire amplicon is at least about 50 base pairs (bp) in length. In some embodiments, the entire amplicon is about 50 to about 500 base pairs in length.

[0016] In some embodiments, patients are selected for treatment if the percentage of cell-free DNA derived from neurons is greater than about 5%. In some embodiments, patients are selected for treatment if the percentage of cell-free DNA derived from neurons is greater than about 7%. In some embodiments, patients are selected for treatment if the percentage of cell-free DNA derived from neurons is greater than about 9%.

[0017] In some embodiments, a higher percentage of cell-free DNA derived from neurons than the control indicates an increased risk of a neurodegenerative condition or traumatic brain injury.

[0018] In another aspect, the disclosure provides a computer product including a non-transitory computer readable medium having stored thereon a plurality of instructions that, when executed, control a computer system to analyze a biological sample from a subject comprising cell-free DNA to determine risk of a neurodegenerative condition in the subject, the instructions including: (i) identifying a first DNA methylation pattern that occurs in neurons at a rate above a threshold, the first DNA methylation pattern comprising methylation in one or more methylated regions and optionally no methylation in one or more unmethylated regions; (ii) analyzing a second methylation pattern of the cell-free DNA; (iii) calculating a relative abundance of the one or more methylated regions and optionally one or more unmethylated regions in the cell-free DNA; and (iv) comparing the relative abundance to a control to determine risk of the neurodegenerative condition in the subject.

[0019] In another aspect, the disclosure provides a method for determining the effectiveness of a potential treatment for a neurodegenerative condition, the method comprising: (i) obtaining cell-free DNA from blood samples from a plurality of subjects being administered the potential treatment; (ii) analyzing the methylation pattern of the cell-free DNA; (iii) determining the percentage (%) of cell-free DNA that is neuron-derived; and (iv) comparing the percentage (%) of cell-free DNA that is neuron-derived to a control, wherein the potential treatment is effective if the percentage (%) of cell-free DNA that is neuron-derived is lower than the control.

[0020] In some embodiments, steps (i)-(iv) are repeated at least once. In some embodiments, steps (i)-(iv) are repeated weekly.

[0021] In some embodiments, determining the percentage of cell-free DNA derived from neurons comprises comparing a methylation pattern of the cell-free DNA to a methylation pattern of neuronal DNA, the methylation pattern of the neuronal DNA comprising methylation in one or more methylated regions, and optionally comprising methylation in one or more unmethylated regions.

[0022] In another aspect, the disclosure provides a computer-implemented method of analyzing a biological sample from a subject, the method comprising: (i) identifying a first DNA methylation pattern that occurs in neurons at a rate above a threshold, the first DNA methylation pattern comprising methylation in one or more methylated regions and optionally no methylation in one or more unmethylated regions; (ii) analyzing a second methylation pattern of cell-free DNA; (iii) calculating the relative abundance of the one or more methylated regions and optionally one or more unmethylated regions in the cell-free DNA; and (iv) comparing the relative abundance to a control to determine risk of a neurodegenerative condition in the subject.

[0023] In some embodiments, step (ii) comprises analysing the methylation pattern of the entire amplicon of DNA.

[0024] In some embodiments, the entire amplicon is at least about 50 base pairs (bp) in length, hi some embodiments, the entire amplicon is about 50 to about 500 base pairs in length.

[0025] In some embodiments, the control is a blood sample from an untreated subject, a percentage of cell-free DNA derived from neurons in a blood sample from a subject prior to treatment, or a threshold value. In some embodiments, the threshold value is a percentage of cell-free DNA derived from neurons greater than about 5%. In some embodiments, the threshold value is a percentage of cell-free DNA derived from neurons greater than about 7%. In some embodiments, the threshold value is a percentage of cell-free DNA derived from neurons greater than about 9%.

[0026] In some embodiments, the neurodegenerative disease is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, or concussion.

[0027] In some embodiments, the neuron is a motor neuron, a sensory neuron, an interneuron, a dopaminergic neuron, a cholinergic neuron, a GABAergic neuron, a glutamatergic neuron, or a cortical neuron.In some embodiments, the neuron is derived from the forebrain, the midbrain, or the hindbrain.In some embodiments, the neuron is derived from the frontal lobe, the temporal lobe, the cranial lobe, the occipital lobe, the cerebellum, or the brainstem.

[0028] In some embodiments, analyzing the methylation pattern comprises converting 5-methylcytosine in the cell-free DNA to a different nucleotide. In some embodiments, converting comprises bisulfite conversion or enzymatic conversion.

[0029] In some embodiments, the subject has mild cognitive impairment. In some embodiments, the subject is 45 years old or older. In some embodiments, the subject is selected to be 45 years old or older. In some embodiments, the subject does not have symptoms of a neurodegenerative condition. In some embodiments, the subject is selected to be mild cognitive impairment.

[0030] In another aspect, the disclosure provides a method of treating a subject having mild traumatic brain injury, the method comprising: (i) selecting a subject at risk for mild traumatic brain injury; (ii) obtaining cell-free DNA from a blood sample from the subject; (iii) analyzing the methylation pattern of the cell-free DNA; (iv) determining the percentage (%) of cell-free DNA that is neuronal derived; (v) comparing the percentage (%) of cell-free DNA that is neuronal derived to a control; and (vi) treating the subject for mild traumatic brain injury if the percentage (%) of cell-free DNA that is neuronal derived is higher than the control.

[0031] In some embodiments, treating the subject comprises administering a therapeutic agent to treat one or more symptoms of mild traumatic brain injury. In some embodiments, further comprising repeating steps (ii)-(v) at a time point following treatment. In some embodiments, treatment is discontinued if the percentage of cell-free DNA derived from neurons at that time point is equal to or less than the control. In some embodiments, treatment is continued if the percentage of cell-free DNA derived from neurons at that time point is greater than the control.

[0032] In another aspect, the disclosure provides a kit comprising a first plurality of oligonucleotides, each of the first plurality of oligonucleotides capable of hybridizing to selectively methylated regions in a neuronal cell.

[0033] In some embodiments, the method further comprises the step of: providing a first plurality of oligonucleotides, each of which is capable of hybridizing to a region that is selectively unmethylated in the neuronal cell;

[0034] In some embodiments, the kit is for determining the efficacy of a potential treatment for a neurodegenerative disease or condition. In some embodiments, the neurodegenerative disease or condition is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, or concussion. In some embodiments, the neuron is a motor neuron, a sensory neuron, an interneuron, a dopaminergic neuron, a cholinergic neuron, a GABAergic neuron, a glutamatergic neuron, or a cortical neuron. In some embodiments, the neuron is derived from the forebrain, midbrain, or hindbrain. In some embodiments, the neuron is derived from the frontal lobe, the temporal lobe, the cranial lobe, the occipital lobe, the cerebellum, or the brainstem.

[0035] In some embodiments, the plurality of oligonucleotides comprises one or more oligonucleotides having a nucleotide sequence of any one of SEQ ID NOs:3-6.

[0036] In another aspect, the disclosure provides a method for detecting cell-free DNA from neurons in a blood sample, the method comprising: (i) obtaining cell-free DNA from a blood sample from a human subject; and (ii) detecting whether cell-free DNA derived from neurons is present in the blood sample by methylation analysis comprising performing whole DNA amplicon sequencing on the cell-free DNA from the blood sample.

[0037] In some embodiments, the entire amplicon is at least about 50 base pairs (bp) in length, hi some embodiments, the entire amplicon is about 50 to about 500 base pairs in length.

[0038] In some embodiments, the entire amplicon was generated using one or more primers comprising any one of SEQ ID NOs: 3 to 6. In some embodiments, the entire amplicon was generated using one or more primers targeting a region selected from the regions listed in Table 1.

[0039] In another aspect, the disclosure provides a method for determining the methylation status of an amplicon, the method comprising: (i) obtaining cell-free DNA from a blood sample from a human subject; (ii) converting 5-methylcytosines in the cell-free DNA to a different nucleotide, thereby generating converted cell-free DNA; (iii) amplifying the converted cell-free DNA, thereby generating an amplicon; and (iv) sequencing the amplicon, wherein the amplicon is about 50 bp to about 500 bp in length.

[0040] In some embodiments, the entire amplicon was generated using one or more primers comprising any one of SEQ ID NOs: 3 to 6. In some embodiments, the entire amplicon was generated using one or more primers targeting a region selected from the regions listed in Table 1. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0041] After reading this description, it will be clear to a person skilled in the art how the present disclosure can be implemented in various alternative embodiments and alternative applications. However, not all of the various embodiments of the present invention are described herein. It should be understood that the embodiments described herein are provided by way of example only and are not limiting. Therefore, this detailed description of various alternative embodiments should not be interpreted as limiting the scope or breadth of the present invention described below.

[0042] Before the present invention is disclosed and described, it is to be understood that each embodiment described below is not limited to particular compositions, methods of preparing such compositions, or uses thereof, which may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0043] The detailed description of the present disclosure has been divided into different sections for the convenience of the reader only, and the disclosure content found in any section may be combined with the disclosure content of another section. Headings or subheadings may be used in this specification for the convenience of the reader, but are not intended to affect the scope of the present invention.

[0044] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings:

[0045] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0046] The words "optionally" or "optionally" mean that the subsequently described event or circumstance may or may not occur, and the description includes instances when the event or circumstance occurs and instances when the event or circumstance does not occur.

[0047] The term "about" when used prior to the specification of numerical values ​​including ranges, e.g., temperature, time, amounts, concentrations, etc., indicates an approximation that may vary (+) or (-) 10%, 5%, 1%, or any subrange or subvalue therebetween. Preferably, the term "about" used in reference to an amount means that the amount may vary by + / - 10%.

[0048] "Comprising" or "comprise" means that the compositions and methods include the recited elements, but is not intended to exclude other elements. When used to define compositions and methods, "consisting essentially of" means excluding other elements that are essential to the combination for which the description is intended. Thus, a composition consisting essentially of the elements defined herein does not exclude other materials or steps that do not substantially affect the basic and novel feature(s) of the claimed invention. "Consisting of" means excluding more than trace elements and substantial method steps of other components. Embodiments defined by each of these transitional phrases are included within the scope of this disclosure.

[0049] As used herein, the term "cell-free DNA" refers to short fragments of DNA that are released into the bloodstream upon cell death.

[0050] As used herein, the term "neuron" refers to any neuron or neuronal cell type. As non-limiting examples, a neuron can be a motor neuron, a dopaminergic neuron, a cortical neuron, a sensory neuron, an interneuron, or a medium spiny neuron.

[0051] method Due to the problems inherent in biopsies obtained from brain tissue, other tissues must be used when diagnosing diseases in the brain. Previous studies using DNA methylation signatures as a possible neurodegenerative diagnosis have been attempted using cerebrospinal fluid as the primary liquid biopsy. CSF fluid is drawn using a spinal tap. This is a painful and expensive process that requires a qualified physician and involves many potential health risks for the patient. An advantage of the disclosed method is that it can be performed on a blood sample, a tissue that has become the standard liquid biopsy in medicine due to its relative ease and cheapness of extraction and low risk to the patient.

[0052] The present disclosure relates to a two-part blood-based diagnostic tool designed to diagnose pre-symptomatic neurodegenerative diseases or conditions. Part 1 consists of an assay designed to amplify and sequence pre-specified regions of cell-free DNA. Part 2 consists of a computationally implemented (e.g., Python-derived) analysis that analyzes methylation signatures to identify neuronal DNA and provide a diagnosis of pre-symptomatic neurodegenerative diseases or conditions.

[0053] Next, using standard protocols for blood-based cell-free DNA extraction, the DNA is bisulfite converted and amplified at preselected sites in the genome using PCR. The assay used for PCR amplification is a uniquely designed assay intended to target and amplify preselected regions of the bisulfite converted DNA. These preselected regions contain methylation signatures unique to neuronal cells, which allows for easy identification of neuronal-derived DNA from the DNA of all other cell types likely to be found in the cell-free DNA of blood. Following amplification, each region is then sequenced by DNA sequencing.

[0054] The methylation signature of each single read is then analyzed. This is done using pre-established methylation "blueprints" for neuronal cells and whole blood cells. The computer-implemented analysis of the disclosed invention compares each read to these "blueprints" and predicts which cell type each read comes from. Once the neuronal DNA has been identified, the analysis then predicts a pre-symptomatic neurodegenerative disease or condition. This is done by first analyzing the amount of a-neuronal cell DNA present in the blood and secondly comparing the methylation signature to the methylation "blueprints" of patients who have a neurodegenerative disease or condition. The combination of both finally gives a diagnosis of whether the patient has a pre-symptomatic neurodegenerative disease or condition.

[0055] Cell types such as neurons have specific methylation patterns ("blueprints") that can be used to distinguish the cell types from other cell types. Furthermore, methylation patterns can help distinguish individual neuron types from other neuron types, for example, between motor neurons and dopaminergic neurons. Cell-free DNA, such as that found in blood, is the result of cell death throughout the body. The inventors have discovered that analyzing cell-free DNA for neuronal-derived methylation patterns can predict the presence of a neurodegenerative disease or condition in a subject.

[0056] This method can be used to detect neurodegenerative diseases or conditions before symptoms develop or at an early stage when symptoms are mild. This method can also be used to determine the incidence, severity, and / or duration (e.g., recovery) of traumatic brain injuries such as concussion. Still further, this method can be used to distinguish between different types of neurodegenerative diseases or conditions. In a further aspect, this method can be used to evaluate the effectiveness of therapeutic agents for treating neurodegenerative diseases or conditions.

[0057] In some aspects, methods are provided for treating a subject having or at risk of having a neurodegenerative disease or condition. In each embodiment, the method comprises: (i) obtaining cell-free DNA from a blood sample from a subject; (ii) analyzing the methylation patterns of cell-free DNA; (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) comparing the percentage of cell-free DNA derived from neurons to a control; (v) administering a therapeutic agent for treating or preventing the neurodegenerative disease or condition if the percentage (%) of cell-free DNA derived from neurons is higher than the control.

[0058] In each embodiment, step (ii) comprises analyzing the methylation pattern of the entire amplicon of DNA, in each embodiment, the entire amplicon is at least about 50 base pairs (bp) in length.

[0059] In each embodiment, the entire amplicon is about 50 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 60 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 70 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 80 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 90 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 100 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 150 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 200 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 250 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 300 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 350 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 400 to about 500 base pairs in length. In each embodiment, the entire amplicon is about 450 to about 500 base pairs in length.

[0060] In each embodiment, the entire amplicon is about 50 to about 450 base pairs in length. In each embodiment, the entire amplicon is about 50 to about 400 base pairs in length. In each embodiment, the entire amplicon is about 50 to about 350 base pairs in length. In each embodiment, the entire amplicon is about 50 to about 300 base pairs in length. In each embodiment, the entire amplicon is about 50 to about 250 base pairs in length. In each embodiment, the entire amplicon is about 50 to about 200 base pairs in length. In each embodiment, the entire amplicon is about 50 to about 150 base pairs in length. In each embodiment, the entire amplicon is about 50 to about 100 base pairs in length. In each embodiment, the entire amplicon is about 50 to about 90 base pairs in length. In each embodiment, the entire amplicon is about 50 to about 80 base pairs in length. In each embodiment, the entire amplicon is about 50 to about 70 base pairs in length. In various embodiments, the entire amplicon is about 50 to about 60 base pairs in length. The length of the entire amplicon can be any value or subrange within the recited ranges, including the endpoints.

[0061] In some aspects, the disclosure provides a method of treating a subject having or at risk of having a neurodegenerative disease or condition, comprising: (i) obtaining cell-free DNA from a blood sample from a subject; (ii) analyzing the methylation patterns of cell-free DNA; (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) administering a therapeutic agent for treating or preventing a neurodegenerative disease or condition if the percentage of cell-free DNA derived from neurons is greater than about 5%.

[0062] In each embodiment, the therapeutic agent is administered when the percentage (%) of cell-free DNA derived from neurons is about 3% to about 99%. In each embodiment, the therapeutic agent is administered when the percentage (%) of cell-free DNA derived from neurons is about 3% to about 90%. In each embodiment, the therapeutic agent is administered when the percentage (%) of cell-free DNA derived from neurons is about 3% to about 80%. In each embodiment, the therapeutic agent is administered when the percentage (%) of cell-free DNA derived from neurons is about 3% to about 70%. In each embodiment, the therapeutic agent is administered when the percentage (%) of cell-free DNA derived from neurons is about 3% to about 60%. In each embodiment, the therapeutic agent is administered when the percentage (%) of cell-free DNA derived from neurons is about 3% to about 50%. In each embodiment, the therapeutic agent is administered when the percentage (%) of cell-free DNA derived from neurons is about 3% to about 40%. In each embodiment, the therapeutic agent is administered when the percentage (%) of cell-free DNA derived from neurons is about 3% to about 30%. In each embodiment, the therapeutic agent is administered when the percentage of cell-free DNA derived from neurons is between about 3% and about 20%.

[0063] In embodiments, the therapeutic agent is administered when the percentage of cell-free DNA derived from the neuron is greater than about 2%. In embodiments, the therapeutic agent is administered when the percentage of cell-free DNA derived from the neuron is greater than about 3%. In embodiments, the therapeutic agent is administered when the percentage of cell-free DNA derived from the neuron is greater than about 4%. In embodiments, the therapeutic agent is administered when the percentage of cell-free DNA derived from the neuron is greater than about 5%. In embodiments, the therapeutic agent is administered when the percentage of cell-free DNA derived from the neuron is greater than about 6%. In embodiments, the therapeutic agent is administered when the percentage of cell-free DNA derived from the neuron is greater than about 7%. In embodiments, the therapeutic agent is administered when the percentage of cell-free DNA derived from the neuron is greater than about 8%. In embodiments, the therapeutic agent is administered when the percentage of cell-free DNA derived from the neuron is greater than about 9%. In embodiments, the therapeutic agent is administered when the percentage of cell-free DNA derived from the neuron is greater than about 10%. In embodiments, the therapeutic agent is administered when the percentage of cell-free DNA derived from the neuron is greater than about 11%. In embodiments, a therapeutic agent is administered when the percentage of cell-free DNA derived from neurons is greater than about 12%. In embodiments, a therapeutic agent is administered when the percentage of cell-free DNA derived from neurons is greater than about 13%. In embodiments, a therapeutic agent is administered when the percentage of cell-free DNA derived from neurons is greater than about 14%. In embodiments, a therapeutic agent is administered when the percentage of cell-free DNA derived from neurons is greater than about 15%. In embodiments, a therapeutic agent is administered when the percentage of cell-free DNA derived from neurons is greater than about 20%.

[0064] In some embodiments, a method of selecting a patient for treatment with a therapeutic agent for treating a neurodegenerative disease or condition is provided, comprising: (i) obtaining cell-free DNA from a blood sample from a subject; (ii) analyzing the methylation patterns of cell-free DNA; (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) comparing the percentage of cell-free DNA derived from neurons to a control; A method is provided in which patients are selected for treatment if the percentage of cell-free DNA derived from neurons is higher than a control.

[0065] In each embodiment, a patient is selected for treatment when the percentage of cell-free DNA derived from neurons is between about 3% and about 99%. In each embodiment, a patient is selected for treatment when the percentage of cell-free DNA derived from neurons is between about 3% and about 90%. In each embodiment, a patient is selected for treatment when the percentage of cell-free DNA derived from neurons is between about 3% and about 80%. In each embodiment, a patient is selected for treatment when the percentage of cell-free DNA derived from neurons is between about 3% and about 70%. In each embodiment, a patient is selected for treatment when the percentage of cell-free DNA derived from neurons is between about 3% and about 60%. In each embodiment, a patient is selected for treatment when the percentage of cell-free DNA derived from neurons is between about 3% and about 50%. In each embodiment, a patient is selected for treatment when the percentage of cell-free DNA derived from neurons is between about 3% and about 40%. In each embodiment, a patient is selected for treatment when the percentage of cell-free DNA derived from neurons is between about 3% and about 30%. In various embodiments, patients are selected for treatment if the percentage of cell-free DNA derived from neurons is between about 3% and about 20%.

[0066] In each embodiment, the patient is selected for treatment when the percentage of cell-free DNA derived from neurons is as high as 3%. In each embodiment, the patient is selected for treatment when the percentage of cell-free DNA derived from neurons is greater than about 5%. In each embodiment, the patient is selected for treatment when the percentage of cell-free DNA derived from neurons is greater than about 6%. In each embodiment, the patient is selected for treatment when the percentage of cell-free DNA derived from neurons is greater than about 7%. In each embodiment, the patient is selected for treatment when the percentage of cell-free DNA derived from neurons is greater than about 8%. In each embodiment, the patient is selected for treatment when the percentage of cell-free DNA derived from neurons is greater than about 9%. In each embodiment, the therapeutic agent is administered when the percentage of cell-free DNA derived from neurons is greater than about 10%. In each embodiment, the patient is selected for treatment when the percentage of cell-free DNA derived from neurons is greater than about 11%. In each embodiment, the patient is selected for treatment when the percentage of cell-free DNA derived from neurons is greater than about 12%. In each embodiment, the patient is selected for treatment when the percentage of cell-free DNA derived from neurons is greater than about 13%. In each embodiment, the patient is selected for treatment if the percentage of cell-free DNA derived from neurons is greater than about 14%. In each embodiment, the patient is selected for treatment if the percentage of cell-free DNA derived from neurons is greater than about 15%. In each embodiment, the patient is selected for treatment if the percentage of cell-free DNA derived from neurons is greater than about 20%.

[0067] In each embodiment, a higher percentage of cell-free DNA derived from neurons than the control indicates an increased risk of neurodegenerative disease or traumatic brain injury.

[0068] In some aspects, the disclosure relates to a method of analyzing a biological sample from a subject, in each embodiment, the subject has or is at risk of having a neurodegenerative disease or condition. In each embodiment, the method comprises: (i) obtaining cell-free DNA from a blood sample from a subject; (ii) analyzing the methylation patterns of cell-free DNA; (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) comparing the percentage of cell-free DNA derived from neurons to a control.

[0069] In some aspects, the present disclosure relates to a computer product comprising a non-transitory computer readable medium having stored thereon instructions that, when executed, control a computer system to analyze a biological sample from a subject comprising cell-free DNA to determine risk of a neurodegenerative disease or condition in the subject. In embodiments, the instructions include: (i) identifying a first DNA methylation pattern that occurs in neurons at a rate above a threshold, the first DNA methylation pattern comprising methylation in one or more methylated regions and, optionally, no methylation in one or more unmethylated regions; (ii) analyzing a second methylation pattern of the cell-free DNA; and (iii) calculating the relative abundance of one or more methylated regions and optionally one or more unmethylated regions in the cell-free DNA; (iv) determining the risk of a neurodegenerative disease or condition in the subject by comparing the relative abundance with a control.

[0070] In some aspects, the present disclosure provides a computer-implemented method for analyzing a biological sample from a subject, comprising: (i) identifying a first DNA methylation pattern that occurs in neurons at a rate above a threshold, the first DNA methylation pattern comprising methylation in one or more methylated regions and, optionally, no methylation in one or more unmethylated regions; (ii) analyzing a second methylation pattern of the cell-free DNA; and (iii) calculating the relative abundance of one or more methylated regions and optionally one or more unmethylated regions in the cell-free DNA; (iv) determining the risk of a neurodegenerative disease or condition in the subject by comparing the relative abundance with a control.

[0071] In each embodiment, a percentage (%) of cell-free DNA derived from neurons of about 3% to about 99% indicates a high risk of neurodegenerative disease or traumatic brain injury. In each embodiment, a percentage (%) of cell-free DNA derived from neurons of about 3% to about 90% indicates a high risk of neurodegenerative disease or traumatic brain injury. In each embodiment, a percentage (%) of cell-free DNA derived from neurons of about 3% to about 80% indicates a high risk of neurodegenerative disease or traumatic brain injury. In each embodiment, a percentage (%) of cell-free DNA derived from neurons of about 3% to about 70% indicates a high risk of neurodegenerative disease or traumatic brain injury. In each embodiment, a percentage (%) of cell-free DNA derived from neurons of about 3% to about 60% indicates a high risk of neurodegenerative disease or traumatic brain injury. In each embodiment, a percentage (%) of cell-free DNA derived from neurons of about 3% to about 50% indicates a high risk of neurodegenerative disease or traumatic brain injury. In each embodiment, a percentage (%) of cell-free DNA derived from neurons of about 3% to about 40% indicates a high risk of neurodegenerative disease or traumatic brain injury. In each embodiment, a percentage (%) of cell-free DNA derived from neurons of about 3% to about 30% indicates a high risk of neurodegenerative disease or traumatic brain injury. In each embodiment, a percentage (%) of cell-free DNA derived from neurons of about 3% to about 20% indicates a high risk of neurodegenerative disease or traumatic brain injury.

[0072] In embodiments, a percentage of cell-free DNA from neurons greater than about 3% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 4% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 5% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 6% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 7% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 8% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 9% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 10% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 11% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 12% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 13% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 14% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 15% indicates an increased risk of neurodegenerative disease or traumatic brain injury. In embodiments, a percentage of cell-free DNA from neurons greater than about 20% indicates an increased risk of neurodegenerative disease or traumatic brain injury.

[0073] In each embodiment, determining the percentage of cell-free DNA derived from neurons comprises comparing a methylation pattern of the cell-free DNA to a methylation pattern of the neuronal DNA, the methylation pattern of the neuronal DNA comprising one or more methylated regions. In each embodiment, the methylation pattern of the neuronal DNA comprises no methylation in one or more unmethylated regions.

[0074] Following sequencing and data processing, the methylation status of each molecule may be assessed.

[0075] In some embodiments, sequences from the sample are aligned with a reference DNA sequence. In some embodiments, the reference DNA sequence comprises the human genome. In some embodiments, the reference DNA sequence comprises a portion of the human genome. In some embodiments, the reference DNA sequence comprises a region amplified by PCR. In some embodiments, the reference DNA sequence comprises a portion of a PCR product. Following alignment, the positions identified as having different methylation states between tissues can be analyzed to determine the estimated methylation fraction in the pool by measuring the relative frequency of base calls at that position. In some embodiments, this fraction methylated at each position can then be analyzed in conjunction with other positions to find the overall methylation state of the sequenced DNA molecule.

[0076] In some embodiments, sequences from a sample are searched to identify specific base sequences of length N within the sequenced DNA molecules, where N is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases in length. In some embodiments, the base sequence flanks the base being evaluated. In some embodiments, the base sequence encompasses the base being evaluated. In some embodiments, two or more versions of the sequence are used to represent the methylation and unmethylation states of the DNA sequence.

[0077] In some embodiments, sequences from the sample are input to a machine learning algorithm. In some embodiments, the machine learning algorithm comprises a neural network. In some embodiments, the machine learning algorithm comprises a multi-layer perceptron. In some embodiments, the machine learning algorithm comprises a convolutional neural network. In some embodiments, the machine learning algorithm uses base-called DNA sequences as input. In some embodiments, the DNA sequences are broken down into k-mers, where k=2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases in length. For example, in one embodiment, the sequencing data is broken down into overlapping hexamers (k=6). These hexamers were counted and input to a multi-layer perceptron that includes 4096 input neurons (one for every possible hexamer sequence), 8 neurons in the hidden layer, and one output neuron that classified each read as methylated or unmethylated. The model was trained using 100,000 reads selected from purified tissue samples containing only methylated or unmethylated DNA at the interrogated loci. Cross-validation using 20% ​​of the data showed a final accuracy of 99.8% and a loss of 0.01.

[0078] The control can be any suitable control. In each embodiment, the control is a percentage of cell-free DNA derived from neurons in a blood sample from an untreated subject. In each embodiment, the control is a percentage of cell-free DNA derived from neurons in a blood sample from a healthy subject. In each embodiment, the control is a blood sample from the subject(s) prior to treatment. In each embodiment, the control is a threshold value. In each embodiment, the threshold value is a percentage of cell-free DNA derived from neurons greater than about 3%. In each embodiment, the threshold value is a percentage of cell-free DNA derived from neurons greater than about 4%. In each embodiment, the threshold value is a percentage of cell-free DNA derived from neurons greater than about 5%. In each embodiment, the threshold value is a percentage of cell-free DNA derived from neurons greater than about 6%. In each embodiment, the threshold value is a percentage of cell-free DNA derived from neurons greater than about 7%. In each embodiment, the threshold value is a percentage of cell-free DNA derived from neurons greater than about 8%. In each embodiment, the threshold value is a percentage of cell-free DNA derived from neurons greater than about 9%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 10%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 11%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 12%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 13%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 14%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 15%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 20%.

[0079] In each embodiment, the neurodegenerative disease is Alzheimer's disease. In each embodiment, the neurodegenerative disease is Huntington's disease. In each embodiment, the neurodegenerative disease is Parkinson's disease. In each embodiment, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS). In each embodiment, the neurodegenerative disease is ataxia. In each embodiment, the neurodegenerative disease is multiple sclerosis. In each embodiment, the neurodegenerative disease or condition is multiple system atrophy. In each embodiment, the neurodegenerative condition is mild traumatic brain injury. In each embodiment, the neurodegenerative condition is concussion. One or more of these diseases or conditions may be expressly excluded.

[0080] The neuron(s) can be any neuron type, or combinations thereof. In each embodiment, the neuron is a motor neuron. In each embodiment, the neuron is a sensory neuron. In each embodiment, the neuron is an interneuron. In each embodiment, the neuron is a dopaminergic neuron. In each embodiment, the neuron is a GABAergic neuron. In each embodiment, the neuron is a glutamatergic neuron. In each embodiment, the neuron is a cortical neuron.

[0081] In each embodiment, the neuron is from the forebrain. In each embodiment, the neuron is from the midbrain. In each embodiment, the neuron is from the hindbrain. In each embodiment, the neuron is from the frontal lobe. In each embodiment, the neuron is from the temporal lobe. In each embodiment, the neuron is from the parietal lobe. In each embodiment, the neuron is from the occipital lobe. In each embodiment, the neuron is from the cerebellum. In each embodiment, the neuron is from the brainstem.

[0082] In each embodiment, analyzing the DNA methylation pattern comprises determining the methylation status of a region of DNA. In each embodiment, the DNA is chromosomal DNA. In each embodiment, the region is a region that is selectively methylated (more likely to be methylated) in a particular neuron or type of neuron compared to one or more other cell types. In each embodiment, the region is a region that is selectively unmethylated (more likely to be unmethylated) in a particular neuron or type of neuron compared to one or more other cell types.

[0083] In each embodiment, the methylation status of one or more regions listed in Table 1 is analyzed. In each embodiment, the methylation status of one or more subregions within one or more regions listed in Table 1 is analyzed. In each embodiment, the methylation status of chr3:42190679,42191148 is analyzed. In each embodiment, a higher percentage (compared to a control) of cfDNA having methylation within one or more regions listed in Table 1 (or one or more subregions within one or more regions listed in Table 1) indicates an increased risk of Alzheimer's disease. In each embodiment, a higher percentage (compared to a control) of cfDNA not having methylation within one or more regions listed in Table 1 (or one or more subregions within one or more regions listed in Table 1) indicates an increased risk of Alzheimer's disease. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9]

[0084] Any method for analyzing DNA methylation patterns can be used, for example, in each embodiment, analyzing the methylation pattern includes bisulfite sequencing.

[0085] In each embodiment, the DNA is sequenced using long-read sequencing.

[0086] In each embodiment, the subject does not have symptoms of a neurodegenerative disease or condition. In each embodiment, the subject does not have symptoms of a neurodegenerative disease or condition. In each embodiment, the subject has mild symptoms of a neurodegenerative disease or condition. In each embodiment, the subject has early symptoms of a neurodegenerative disease or condition. In each embodiment, the subject has mild cognitive impairment.

[0087] In embodiments, the methods described herein can be used for presymptomatic diagnosis of neurodegenerative diseases, for example, subjects can be tested at an outpatient appointment, e.g., annually between the ages of 45-70.

[0088] In each embodiment, the method includes selecting a subject with symptoms of a neurodegenerative disease or condition. In each embodiment, the method includes selecting a subject with mild symptoms of a neurodegenerative disease or condition. In each embodiment, the method includes selecting a subject with early symptoms of a neurodegenerative disease or condition. In each embodiment, the method includes selecting a subject with mild cognitive impairment.

[0089] In one aspect, a method of treating a subject having mild traumatic brain injury comprises: (i) selecting a subject at risk for mild traumatic brain injury; and (ii) obtaining cell-free DNA from a blood sample from the subject; and (iii) analyzing the methylation patterns of cell-free DNA; (iv) determining the percentage of cell-free DNA derived from neurons; and (v) comparing the percentage of cell-free DNA derived from neurons to a control; (vi) treating the subject for mild traumatic brain injury if the percentage (%) of cell-free DNA derived from neurons is higher than the control.

[0090] In various embodiments, treating the subject includes administering a therapeutic agent to treat one or more symptoms of mild traumatic brain injury. In various embodiments, treating the subject includes physical rest and / or mental rest. In various embodiments, treating the subject includes cessation of one or more activities, such as sports.

[0091] In each embodiment, the method further comprises repeating steps (ii)-(v) at a time point following treatment. In each embodiment, treatment is discontinued if the percentage of cell-free DNA derived from neurons at that time point is equal to or less than the control. In each embodiment, treatment is continued if the percentage of cell-free DNA derived from neurons at that time point is greater than the control.

[0092] In one aspect, a method of monitoring a subject having or suspected of having mild traumatic brain injury, comprising: (i) selecting a subject at risk for mild traumatic brain injury; and (ii) obtaining cell-free DNA from a blood sample from the subject; and (iii) analyzing the methylation patterns of cell-free DNA; (iv) determining the percentage of cell-free DNA that is neuron-derived.

[0093] In each embodiment, the method includes comparing the percentage of cell-free DNA derived from neurons to a control. In each embodiment, the subject is determined to have mild traumatic brain injury if the percentage of cell-free DNA derived from neurons is higher than the control.

[0094] In each embodiment, the subject is monitored over time. In each embodiment, the method includes repeating steps (ii)-(iv) at least once. In each embodiment, the method includes monitoring the subject until the percentage of cell-free DNA derived from neurons is equal to or less than the control.

[0095] In each embodiment, a percentage (%) of cell-free DNA derived from neurons equal to or less than a control indicates that the mTBI has been recovered from. In each embodiment, the control is the initial percentage (%) of cell-free DNA derived from neurons (e.g., from the first determination step) of the subject. In each embodiment, a percentage (%) of cell-free DNA derived from neurons equal to or less than a control indicates that the subject's brain has been recovered from the mTBI. In each embodiment, a percentage (%) of cell-free DNA derived from neurons equal to or less than a control indicates a reduction in brain swelling.

[0096] In embodiments, steps (ii)-(iv) are repeated daily. In embodiments, steps (ii)-(iv) are repeated every 2 days. In embodiments, steps (ii)-(iv) are repeated every 3 days. In embodiments, steps (ii)-(iv) are repeated every 4 days. In embodiments, steps (ii)-(iv) are repeated every 5 days. In embodiments, steps (ii)-(iv) are repeated every 6 days. In embodiments, steps (ii)-(iv) are repeated weekly. In embodiments, steps (ii)-(iv) are repeated every other week. In embodiments, steps (ii)-(iv) are repeated at least once a week. In some embodiments, steps (ii)-(iv) are repeated at least twice a week. In some embodiments, steps (ii)-(iv) are repeated at least three times a week. In some embodiments, steps (ii)-(iv) are repeated at least four times a week. In some embodiments, steps (ii)-(iv) are repeated at least five times per week. In some embodiments, steps (ii)-(iv) are repeated at least six times per week.

[0097] Further methods The methods, compositions, and kits described herein can be used to monitor the effectiveness of a therapeutic agent or a potential therapeutic agent. For example, the effectiveness of a potential therapeutic agent can be monitored in a clinical trial. In another example, the effectiveness of a therapeutic agent can be monitored in a subject.

[0098] Currently, over 176 drugs are in clinical trials for neurodegenerative diseases. Without wishing to be bound by theory, it is believed that trials could be significantly expedited by monitoring the effectiveness of the drugs by monitoring the current levels of neuronal DNA in the blood. Tests could be performed periodically (e.g., weekly, monthly) to assess the effectiveness of the drug over time in reducing the levels of neuronal DNA in the blood.

[0099] In some aspects, the present disclosure provides a method for determining the efficacy of a potential treatment for a neurodegenerative disease or condition, comprising: (i) obtaining cell-free DNA from blood samples from a plurality of subjects receiving a potential treatment; (ii) analyzing the methylation pattern of cell-free DNA for each subject; and (iii) determining the percentage of cell-free DNA derived from neurons for each subject; and (iv) comparing the percentage of cell-free DNA derived from neurons in each subject to a control; A potential treatment is provided where the percentage of cell-free DNA derived from neurons is lower than the control, providing a method.

[0100] In each embodiment, the average percentage of cell-free DNA derived from neurons is determined by averaging the percentage of cell-free DNA derived from neurons for each subject. In each embodiment, the average percentage of cell-free DNA derived from neurons is compared to a control. In each embodiment, the potential treatment is effective if the average percentage of cell-free DNA derived from neurons is lower than the control.

[0101] In some aspects, the present disclosure provides a method for determining the efficacy of a treatment for a neurodegenerative disease or condition, comprising: (i) obtaining cell-free DNA from a blood sample from a subject receiving the treatment; (ii) analyzing the methylation patterns of cell-free DNA; (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) comparing the percentage of cell-free DNA derived from neurons to a control; The method relates to a method in which the treatment is effective when the percentage of cell-free DNA derived from neurons is lower than a control.

[0102] In embodiments, steps (ii)-(iv) are repeated daily. In embodiments, steps (ii)-(iv) are repeated every 2 days. In embodiments, steps (ii)-(iv) are repeated every 3 days. In embodiments, steps (ii)-(iv) are repeated every 4 days. In embodiments, steps (ii)-(iv) are repeated every 5 days. In embodiments, steps (ii)-(iv) are repeated every 6 days. In embodiments, steps (ii)-(iv) are repeated weekly. In embodiments, steps (ii)-(iv) are repeated every other week. In embodiments, steps (ii)-(iv) are repeated at least once a week. In some embodiments, steps (ii)-(iv) are repeated at least twice a week. In some embodiments, steps (ii)-(iv) are repeated at least three times a week. In some embodiments, steps (ii)-(iv) are repeated at least four times a week. In some embodiments, steps (ii)-(iv) are repeated at least five times per week. In some embodiments, steps (ii)-(iv) are repeated at least six times per week. In some embodiments, steps (ii)-(iv) are repeated at least once per month. In some embodiments, steps (ii)-(iv) are repeated at least twice per month. In some embodiments, steps (ii)-(iv) are repeated at least three times per month. In some embodiments, steps (ii)-(iv) are repeated at least four times per month. In some embodiments, steps (ii)-(iv) are repeated at least five times per month. In some embodiments, steps (ii)-(iv) are repeated at least six times per month. In some embodiments, steps (ii)-(iv) are repeated at least seven times per month. In some embodiments, steps (ii)-(iv) are repeated at least eight times per month.

[0103] The methods, compositions and kits described herein can be used to verify healthy control samples. Many institutions and companies purchase control samples from tissue banks for research or clinical trial purposes. Statistically, one in nine of these controls has undetected pre-symptomatic neurodegenerative disease. By testing the control sample for pre-symptomatic disease, it can be confirmed that it is actually a healthy control.

[0104] In some aspects, the present disclosure provides a method for validating a control sample, comprising: (i) obtaining cell-free DNA from the control sample or from the subject from whom the control sample was obtained; (ii) analyzing the methylation patterns of cell-free DNA; (iii) determining the percentage of cell-free DNA that is neuron-derived.

[0105] In each embodiment, the method further comprises comparing the percentage of cell-free DNA derived from neurons to a control. In each embodiment, the control sample is validated if the percentage of cell-free DNA derived from neurons is lower than the control.

[0106] The control can be any suitable control. In each embodiment, the control is the percentage of cell-free DNA derived from neurons in a blood sample from an untreated (or placebo-treated) subject or subjects. In each embodiment, the control is the percentage of cell-free DNA derived from neurons in a blood sample from a healthy subject or healthy subjects. In each embodiment, the control is a blood sample from the subject(s) prior to treatment. In each embodiment, the control is a threshold value. In each embodiment, the threshold value is the percentage of cell-free DNA derived from neurons greater than about 3%. In each embodiment, the threshold value is the percentage of cell-free DNA derived from neurons greater than about 4%. In each embodiment, the threshold value is the percentage of cell-free DNA derived from neurons greater than about 5%. In each embodiment, the threshold value is the percentage of cell-free DNA derived from neurons greater than about 6%. In each embodiment, the threshold value is the percentage of cell-free DNA derived from neurons greater than about 7%. In each embodiment, the threshold value is the percentage of cell-free DNA derived from neurons greater than about 8%. In each embodiment, the threshold value is the percentage of cell-free DNA derived from neurons greater than about 9%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 10%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 11%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 12%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 13%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 14%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 15%. In embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 20%.

[0107] Parkinson's disease In each embodiment, the methods described herein can be used to determine whether a subject has Parkinson's disease. In each embodiment, the methods described herein can be used to determine whether a subject is at risk for Parkinson's disease. In each embodiment, the methods described herein can be used to monitor the effectiveness of a treatment or potential treatment for Parkinson's disease.

[0108] Parkinson's disease (PD) is one of the most common chronic progressive neurodegenerative diseases in older adults. The incidence of PD is reported to be 1%-2% of individuals aged 65 years or older worldwide. The disease also affects a large number of younger people. Patients with Parkinson's disease have motor dysfunction such as bradykinesia, resting tremor, rigidity, postural disturbances, and gait changes including freezing of gait (FOG) and frequent falls. In addition to motor function, patients often have non-motor dysfunction such as cognitive impairment, sleep disorders, and depression. The most prominent signs and symptoms of Parkinson's disease occur when nerve cells in the basal ganglia, the region of the brain that controls movement, fail and / or die. The motor symptoms of Parkinson's disease (PD) are caused by the death of dopaminergic neurons in the substantia nigra pars compacta (SNc).

[0109] Currently, levodopa (e.g., INBRIJA) is the primary treatment for Parkinson's disease. Levodopa is sometimes taken with carbidopa (e.g., SINEMET, SINEMET-CR, PARCOPA, RYTARY), which prevents or reduces some of the side effects of levodopa therapy (e.g., nausea, vomiting, low blood pressure, and restlessness) and reduces the amount of levodopa needed to improve symptoms. Other medications that may be prescribed to treat the symptoms of Parkinson's disease include dopamine agonists (e.g., pramipexole (Mirapex, Mirapex ER), rotigotine (Neupro, Eldepryl), apomorphine (Apoquin, Quinmobile), ropinirole (Requip), piribedil, bromocriptine, abergoline, lisuride, pergolide); enzyme inhibitors (e.g., MAO-B inhibitors (e.g., selegiline (ZELAPAR), rasagiline (Azilect, safinamide (XADAGO)); COMT inhibitors (e.g., Entaca, Entacaine ... anticholinergics (e.g., benztropine (COGENTIN), trihexyphenidyl (ARTANE)) to reduce tremors and muscle stiffness; adenosine receptor antagonists (A2A receptor antagonists) (e.g., istradefylline (NOURIANZ)), and pimavanserin (Nuplazid). Other combination treatments include carbidopa-levodopa-entacapone (DUOPA, STALEVO).

[0110] In each embodiment, the subject having an increased amount of neuron-derived cfDNA is administered one or more therapeutic agents for treating Parkinson's disease. In each embodiment, the subject is administered levodopa. In each embodiment, the subject is administered carbidopa. In each embodiment, the subject is administered a dopamine agonist. In each embodiment, the subject is administered pramipexole. In each embodiment, the subject is administered rotigotine. In each embodiment, the subject is administered apomorphine. In each embodiment, the subject is administered ropinirole. In each embodiment, the subject is administered piribedil. In each embodiment, the subject is administered bromocriptine. In each embodiment, the subject is administered abergoline. In each embodiment, the subject is administered lisuride. In each embodiment, the subject is administered pergolide. In each embodiment, the subject is administered an enzyme inhibitor. In each embodiment, the subject is administered an MAO-B inhibitor. In each embodiment, the subject is administered selegiline. In each embodiment, the subject is administered rasagiline. In each embodiment, the subject is administered safinamide. In each embodiment, the subject is administered an OMT inhibitor. In each embodiment, the subject is administered entacapone. In each embodiment, the subject is administered opicapone. In each embodiment, the subject is administered tolcapone. In each embodiment, the subject is administered amantadine. In each embodiment, the subject is administered an anticholinergic drug. In each embodiment, the subject is administered benztropine. In each embodiment, the subject is administered trihexyphenidyl. In each embodiment, the subject is administered an adenosine receptor antagonist (A2A receptor antagonist). In each embodiment, the subject is administered istradefylline. In each embodiment, the subject is administered pimavanserin. In each embodiment, the subject is administered carbidopa and levodopa. In each embodiment, the subject is administered carbidopa, levodopa, and entacapone. In each embodiment, one or more agents are explicitly excluded.

[0111] Alzheimer's Disease In each embodiment, the methods described herein can be used to determine whether a subject has Alzheimer's disease. In each embodiment, the methods described herein can be used to determine whether a subject is at risk for Alzheimer's disease. In each embodiment, the methods described herein can be used to monitor the effectiveness of a treatment or potential treatment for Alzheimer's disease.

[0112] Alzheimer's disease is a chronic neurodegenerative disease that destroys brain cells, causing brain function to decline over time. Common symptoms of Alzheimer's disease include memory loss, language impairment, and impulsive or unpredictable behavior. The main features of the disease are the presence of senile plaques and neurofibrillary tangles in the brain, as well as the loss of connections between neurons in the brain. Alzheimer's disease accounts for approximately 60-80% of dementia cases in the United States.

[0113] Although there is no known cure for Alzheimer's disease, various medications can be prescribed to reduce or slow the progression of dementia symptoms. Several cholinesterase inhibitors have been approved by the FDA for this purpose, including donepezil (Aricept), galantamine (Razadyne), and rivastigmine (Exelon). Other treatments include memantine (Namenda), aducanumab, and lecanemab (lecanemab-irmb, LEQEMBI).

[0114] In embodiments, the subject is administered a cholinesterase inhibitor. In each embodiment, the subject is administered donepezil. In each embodiment, the subject is administered galantamine. In each embodiment, the subject is administered rivastigmine. In each embodiment, the subject is administered memantine. In each embodiment, the subject is administered aducanumab. In each embodiment, the subject is administered lecanemab.

[0115] Additional therapeutic agents are in clinical trials for the treatment of Alzheimer's disease. These agents include, but are not limited to, aducanumab; AGB101 (low-dose levetiracetam); atuzidinestat (COR388); AVP-786; AXS-05; bracamesine (ANAVEX2-73); BPDO-1603; brexpiprazole; caffeine; donanemab; donanemab and aducanumab; donepezil; escitalopram; gantenerumab; gantenerumab and sonoprofen. Ranezumab;Guanfacine;GV-971;Hydralazine;Ethyl icosapentate (IPE);Losartan, amlodipine and atorvastatin;Metformin;Nabilone;NE3107;Nilotinib BE;Octohydroaminoacridine succinate;Omega-3 (DHA+EPA);Semaglutide;Simfilam (PTI-125);Solanezumab;Tricaprylin;TRx0237;Valyltramiprosate ( ALZ-801), ABvac40;ACI-35;AD-35;AL002;allopregnanolone;APH-1105;baricitinib;bepranemab;BCG vaccine;BPN14770;bromocriptine;bryostatin 1;BXCL-501;canakinumab;CORT108297;crenezumab;CST-2032;curcumin;CY6463;DAOIB;dapagliflozin;daratumumab;dasatinib and quercetin;deferiprone;DHA;dronabinol;E2814;edonerpic (T-817MA);Elayta (CT1812);ExPlas (exercise plasma);fosgonimetone (ATH-1017);brain shuttle gantenerumab (RO7126209);GB301;grape seed extract;GV1001;intranasal insulin;intranasal insulin and empagliflozin;IONIS MAPTRx (BIIB080);JNJ-63733657;lamivudine (3TC);lenalidomide;levetiracetam;L-serine;Lupron (leuprolide acetate depot);LY3372689;memantine;metabolic cofactor supplementation;MIB-626;montelukast;MW150;neflamapimod (VX-745);nicotinamide;nicotine transdermal patch;obicetrapib;omega-3 PUFA;pepinemab (VX15);posiphen;prazosin;PU-AD;Rapamycin (Sirolimus); Sargramotim; Semolinemab (RO7105705); Senicapoc; Sovateltide (PMZ-1620); Simufilam (PTI-125); Suvorexant T3D-959; TB006; Telmisartan and Perindopril; Tdap vaccine; THC-free CBD oil; Thiethylperazine (TEP); Troriluzole (BHV4157); Valacyclovir; Baloglutamstat (PQ912); VGH-AD1; Zanamem; Yangxue Qingnao pills; AAV-Htert; ACU193; ASN51; BEY2153; BMS-984923; BDPP (bioactive dietary polyphenol preparation); contraroid acetate; COR588, dabigatran; edinicotrinib (JNJ-40346527); efavirenz; emtricitabine; IGC AD1; LuAF87908; LX1001; LY3372993; MK-1942 and donepezil; NNI-362; REM0046127; salsalate; SHR-1707; TB006; telmisartan; trehalose; tricaprylin (AC-1202); vorinostat; VT301; XPro1595. Additional treatments under investigation include allogeneic human MSCs; SNK01 (autologous natural killer cells); allogeneic adipose MSC-exosomes; CB-AC-02 (placenta-derived MSCs); human umbilical cord blood-derived MSCs (NEUROSTEM); allogeneic human MSCs; AstroStem (autologous adipose-derived MSCs). In each embodiment, the subject is administered one or more of the described agents. In each embodiment, one or more of the agents is expressly excluded.

[0116] Huntington's disease In each embodiment, the methods described herein can be used to determine whether a subject has Huntington's disease. In each embodiment, the methods described herein can be used to determine whether a subject is at risk for Huntington's disease. In each embodiment, the methods described herein can be used to monitor the effectiveness of a treatment or potential treatment for Huntington's disease.

[0117] Huntington's disease is a genetic disorder that causes the progressive degeneration of nerve cells in the brain. Huntington's disease usually results in movement disorders, thinking (cognitive) problems, and mental disability.

[0118] Currently, there are no treatments that can stop or slow the progression of Huntington's disease. Patients may be prescribed treatments to reduce the effects, including antidepressants (e.g., selective serotonin reuptake inhibitors), antipsychotics, neuroleptics (olanzapine, tetrabenazine, aripiprazole), exercise therapy, etc. Experimental treatments include, but are not limited to, valbenazine, deutetrabenazine, bevantolol hydrochloride, pridopidine, tominersen, WVE-003, and ANX-005.

[0119] In each embodiment, the subject is administered an antidepressant. In each embodiment, the subject is administered an antipsychotic. In each embodiment, the subject is administered a neuroleptic. In each embodiment, the subject is administered olanzapine. In each embodiment, the subject is administered tetrabenazine. In each embodiment, the subject is administered aripiprazole. In each embodiment, the subject is administered exercise therapy. In each embodiment, the subject is administered valbenazine. In each embodiment, the subject is administered deutetrabenazine. In each embodiment, the subject is administered bevantolol hydrochloride. In each embodiment, the subject is administered pridopidine. In each embodiment, the subject is administered tominersen. In each embodiment, the subject is administered WVE-003. In each embodiment, the subject is administered ANX-005.

[0120] Amyotrophic lateral sclerosis (ALS) In each embodiment, the methods described herein can be used to determine whether a subject has ALS.In each embodiment, the methods described herein can be used to determine whether a subject is at risk for ALS.In each embodiment, the methods described herein can be used to monitor the effectiveness of treatment or potential treatment for ALS.

[0121] ALS is a progressive nervous system disease that affects nerve cells in the brain and spinal cord, causing loss of muscle control. Symptoms may include difficulty walking or performing normal daily activities, tripping and falling, weakness in the legs, feet or ankles, weakness or clumsiness in the hands, slurred speech or difficulty swallowing, muscle spasms and twitching in the arms, shoulders and tongue, inappropriate crying, laughing or yawning, and / or changes in cognitive function and behavior.

[0122] Approved medications for treating ALS include riluzole (Rilutek, Exavan, Tiglutik Kit), edaravone (Radicava), and sodium phenylbutyrate and taurursodiol (Relibrio). Dextromethorphan HBr and quinidine sulfate (NeuDexta) may be prescribed to treat PBA, characterized by frequent, involuntary, often exaggerated, and / or sudden episodes of crying and / or laughing that are inconsistent with one's own emotions.

[0123] In each embodiment, the subject is administered riluzole. In each embodiment, the subject is administered edaravone. In each embodiment, the subject is administered sodium phenylbutyrate and taurursodiol. In each embodiment, the subject is administered dextromethorphan. In each embodiment, the subject is administered quinidine sulfate.

[0124] ataxia In each embodiment, the methods described herein can be used to determine whether a subject has ataxia. In each embodiment, the methods described herein can be used to determine whether a subject is at risk for ataxia. In each embodiment, the methods described herein can be used to monitor the effectiveness of a treatment or potential treatment for ataxia.

[0125] Ataxia is an abnormal lack of coordination that can cause problems with walking, difficulty with fine motor activities, and vision and, in some cases, speech problems. Ataxia can also be a symptom of another health problem, such as a nutritional deficiency or a genetic disorder.

[0126] Multiple sclerosis (MS) In each embodiment, the methods described herein can be used to determine whether a subject has MS. In each embodiment, the methods described herein can be used to determine whether a subject is at risk for MS. In each embodiment, the methods described herein can be used to monitor the effectiveness of a treatment or potential treatment for MS.

[0127] MS is caused when the immune system attacks the myelin sheath that protects nerve fibers. Eventually, the disease can cause permanent damage or deterioration of nerve fibers. Treatment options include corticosteroids (e.g., glucocorticoids such as prednisone, methylprednisolone), adrenocorticotropic hormone (ACTH), plasma apheresis, and interferon beta drugs (Avonex®, REBIF). (Interferon beta-1a), Betaseron®, Extavia® (Interferon beta-1b), PLEGRIDY® (Pegylated interferon beta-1a), glatiramer acetate (COPAXONE, GLATOPA), monoclonal antibodies (ofatumumab (Kesimpta, Arzera), rituximab, alemtuzumab (Lemtrada®), ocrelizumab (Ocrevus), natalizumab (Tysabri)) , teriflunomide (Aubagio), monomethyl fumarate (BAFIERTAM™), dimethyl fumarate (TECFIDERA), diroximel fumarate (VUMERITY), fingolimod (GILENYA), cladribine (MAVENCLAD), siponimod (MAYZENT), ponesimod (PONVORY), ozanimod (ZEPOSIA), and mitoxantrone.

[0128] In each embodiment, the subject is administered a corticosteroid. In some embodiments, the corticosteroid is a glucocorticoid. In each embodiment, the subject is administered prednisone. In each embodiment, the subject is administered methylprednisolone. In each embodiment, the subject is administered ACTH. In each embodiment, the subject is administered plasma apheresis. In each embodiment, the subject is administered an interferon beta drug. In each embodiment, the subject is administered interferon beta-1a. In each embodiment, the subject is administered interferon beta-1b. In each embodiment, the subject is administered pegylated interferon beta-1a. In each embodiment, the subject is administered glatiramer acetate. In each embodiment, the subject is administered a monoclonal antibody. In each embodiment, the subject is administered ofatumumab. In each embodiment, the subject is administered rituximab. In each embodiment, the subject is administered alemtuzumab. In each embodiment, the subject is administered ocrelizumab. In each embodiment, the subject is administered natalizumab. In each embodiment, the subject is administered teriflunomide. In each embodiment, the subject is administered monomethyl fumarate. In each embodiment, the subject is administered dimethyl fumarate. In each embodiment, the subject is administered diroximel fumarate. In each embodiment, the subject is administered fingolimod. In each embodiment, the subject is administered cladribine. In each embodiment, the subject is administered siponimod. In each embodiment, the subject is administered ponesimod. In each embodiment, the subject is administered ozanimod. In each embodiment, the subject is administered mitoxantrone.

[0129] Multiple system atrophy (MSA) In each embodiment, the methods described herein can be used to determine whether a subject has MSA. In each embodiment, the methods described herein can be used to determine whether a subject is at risk for MSA. In each embodiment, the methods described herein can be used to monitor the effectiveness of a treatment or potential treatment for MSA.

[0130] Multiple system atrophy (MSA) is a rare degenerative neurological disorder that affects autonomic function (e.g., blood pressure) and motor control. There are two types of MSA, Parkinson's type and cerebellar type, depending on symptoms. Parkinson's type symptoms can include muscle stiffness, difficulty bending limbs, slow movement, tremor, small voice, and balance and posture disorders. Cerebellar type symptoms can include ataxia, movement and coordination disorders, dysarthria, vision disorders, swallowing disorders, and speech changes.

[0131] There is no known cure for MSA. Symptoms may be treated with medications to increase blood pressure and relieve Parkinson's-like symptoms (see Treatment of Parkinson's Disease).

[0132] Mild traumatic brain injury and other brain injuries In each embodiment, the methods described herein can be used to determine whether a subject has an mTBI. In each embodiment, the methods described herein can be used to determine the severity of an mTBI. In each embodiment, the methods described herein can be used to monitor a subject's recovery from an mTBI. In each embodiment, the methods described herein can be used to monitor the effectiveness of a treatment or potential treatment for an mTBI.

[0133] In each embodiment, the method described herein can be used to determine whether a subject has brain injury. In each embodiment, the method described herein can be used to determine the severity of brain injury. In each embodiment, the method described herein can be used to monitor a subject's recovery from brain injury. In each embodiment, the method described herein can be used to monitor the effectiveness of a treatment or potential treatment for brain injury. In each embodiment, the brain injury comprises brain swelling. In each embodiment, a decrease in cfDNA from neurons indicates a decrease in brain swelling.

[0134] Mild traumatic brain injury (mTBI), typically including concussion, represents an injury to the brain that can cause long-term injury / damage to the brain. mTBI often results from a direct impact to the head, but can also result from indirect injury (e.g., whiplash injury or violent head swings). People who have suffered a single brain injury are at high risk for a second brain injury and therefore again vulnerable to subsequent injury. It is recognized that damage from successive mTBIs is cumulative.

[0135] Long-term damage resulting from mTBI can include, for example, impaired cognitive and motor skills, such as slowed psychomotor, reduced concentration and attention recovery leading to increased variability in performance and overall executive dysfunction, as well as sleep disorders and emotional / behavioral changes. Common examples of the long-term effects of mTBI are seen in soldiers, boxers, football players, soccer players, etc. There are many reported cases of individuals whose cumulative brain damage begins to manifest with the loss of one or more cognitive and / or motor functions long after the occurrence of the mTBI(s).

[0136] There are no approved medications for treating mild traumatic brain injury (e.g., concussion). Generally, patients are prescribed physical and mental rest and may be prescribed painkillers (e.g., anti-inflammatory painkillers). Currently, ghrelin is in clinical trials for the treatment of concussion. In various embodiments, the subject is administered a painkiller. In various embodiments, the subject is administered an anti-inflammatory painkiller. In various embodiments, the subject is administered ghrelin.

[0137] It will be understood that the examples and embodiments described herein are for illustrative purposes only, and that various modifications or changes in light of them will be suggested to those skilled in the art and are within the spirit and scope of this application and the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes. EXAMPLES

[0138] Those skilled in the art will appreciate that the embodiments described herein are for illustrative purposes only, and the present disclosure is not limited by these embodiments.

[0139] Example 1. Analysis of cfDNA methylation cfDNA was extracted from human patient plasma using the QIAamp MinEcute ccfDNA Mini Kit (cat. no. 55204) according to the manufacturer's instructions with some modifications. Briefly, magnetic beads were warmed to 37°C before use. Plasma was incubated with proteinase K, magnetic beads, and buffer for approximately 20 minutes under shaking, then centrifuged twice (200×g for 30 seconds per centrifugation) and the supernatant was removed. Beads were resuspended in elution buffer and incubated at room temperature with shaking for 10 minutes. The supernatant was removed, buffer was added, and the mixture was run through a MinEcute column, and cfDNA was eluted from the column.

[0140] The cfDNA was then subjected to bisulfite conversion (EZ DNA Methylation-Lightning Kit, Zymo Research) or enzymatic conversion (NEBNext Mmethyl-Seq Conversation Module, New England Biolabs) to convert methylated bases.

[0141] After bisulfite conversion, the region of interest was amplified. Briefly, bisulfite converted cfDNA (2 μl), forward primer, reverse primer, and ZymoTaq premix (25 μl, Zymo Research) and RNAse / DNAse-free water were mixed together and run on a thermocycler under the following conditions: one cycle at 95°C for 10 min; 38 cycles of 95°C for 30 s, 55°C for 40 s, and 72°C for 40 s; One cycle of 72°C for 7 min, followed by incubation at 4°C.

[0142] After amplification, the samples were used to prepare libraries that were then sequenced (Nanopore SQK-NBD114.96).

[0143] For Alzheimer's disease, chr3:42190679, 42191148 were targeted for amplification. This region was chosen because it showed a large difference in methylation between purified neurons and plasma. The average signal in plasma was a methylation beta value = .9. The average signal in purified neuronal DNA was a methylation beta value = .04. These values ​​represent complete unmethylation throughout this region of the neuronal molecule.

[0144] The actual nucleotide sequence of this region is as follows: CTGACGTCACCCTCTAGGCGTCTGGATAGGACGATCCTGGCTACTCCCATTCAGGGCTGCTGTCCAGTGCTGCTTTATTGGCAGTGCTGCCAGGGTCTCCGTTAGCTCTCTGCAAATTGCCTTCCTTTCTGCTCCTCCTACTCCCTCCTTCCCCCATAGAATTTTTCTTTTCATTGCCCACTTTACTGTTTTGGCTCCAGACTGTCGTTAAGAATGTACAGCCTAATTCTGGTGTGTT TCGGGATATTCTTCTGTCCAGTATTCTGGAAGGGCGGGGAGGCATGGCAGCGTTTTACTTGACGTTGATGGTGCTGTGAAGTCCATTCTTTCCTCTGCAAGACTACTGACTATGCAGAAATTTATCGAAGCG GATTATTATGAACTAGACTGGTATTATGAAGAATGCTCGGATGGTAATTATGGCCCCTGCAAAACAGAGCCGGGATGTATAGGGGTATTGTCTCCTTCTG (chr3:42190679,42191148) (SEQ ID NO: 1).The bisulfite converted form of this region is: TTGACGTTATTTTTTAGGCGTTTGGATAGGACGATTTTGGTTATTTTTATTTAGGGTTGTTGTTTAGTGTTGTTTTATTGGTAGTGTTGTTAGGGTTTTCGTTAGTTTTTTGTAAATTGTTTTTTTTTTTGTTTTTTTTTTTTTTTTTTTTTTATAGAATTTTTTTTTTTATTTGTTTATTTTTGTTTTGGTTTTAGATTGTCGTTAAGAATGTATAGTTTAATTTTGGTGT TTTCGGGATATTTTTTTGTTTAGTATTTTGGAAGGGCGGGGAGGTATGGTAGCGTTTTATTTGACGTTGATGGTGTTGTGAAGTTTATTTTTTTTTTTGTAAGATTATTGATTATGTAGAAATTTATCGAAGC GGATTATTATGAATTAGATTGGTATTATGAAGAATGTTCGGATGGTAATTATGGTTTTTGTAAAATAGAGTCGGGATGTATAGGGGTATTGTTTTTTTTTG (chr3:42190679,42191148) (SEQ ID NO: 2). These were amplified using TTTTATTGTTTTGGTTTTAGATTGT (chr3: 42190859, 42190884) (SEQ ID NO: 3) and GTTGATGGTGTTGTGAAGTTTATTT (chr3: 42190979, 42191004) (SEQ ID NO: 4) as forward primers and AAATAAACTTCACAACACCATCAAC (chr3: 42190859, 42190884) (SEQ ID NO: 5) and ACAATCTAAAACCAAAACAATAAAA (chr3: 42190979, 42191004) (SEQ ID NO: 6) as reverse primers.

[0145] Embodiment Embodiment 1. A method of treating a subject having or at risk of having a neurodegenerative condition, comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) comparing the percentage of cell-free DNA derived from the neurons to a control; and (v) administering a therapeutic agent for treating or preventing a neurodegenerative disease or condition if the percentage (%) of cell-free DNA derived from the neurons is higher than the control.

[0146] Embodiment 2. The method of embodiment 1, wherein step (ii) comprises analyzing the methylation pattern of the entire amplicon of DNA.

[0147] Embodiment 3. The method of embodiment 2, wherein the entire amplicon is at least about 50 base pairs (bp) in length.

[0148] Embodiment 4. The method of embodiment 3, wherein the entire amplicon is about 50 to about 500 base pairs in length.

[0149] Embodiment 5. The method of any one of embodiments 1-4, wherein the therapeutic agent is administered if the percentage of cell-free DNA derived from the neurons is greater than about 5%.

[0150] Embodiment 6. The method of any one of embodiments 1-4, wherein the therapeutic agent is administered if the percentage of cell-free DNA derived from the neurons is greater than about 7%.

[0151] Embodiment 7. The method of any one of embodiments 1-4, wherein the therapeutic agent is administered if the percentage of cell-free DNA derived from the neurons is greater than about 9%.

[0152] Embodiment 8. A method of treating a subject having or at risk of having a neurodegenerative condition, comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) administering a therapeutic agent for treating or preventing a neurodegenerative condition if the percentage of cell-free DNA derived from the neurons is greater than about 5%.

[0153] Embodiment 9. A method of analyzing a biological sample from a subject, comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) comparing the percentage of cell-free DNA derived from the neurons with a control.

[0154] Embodiment 10. A method for measuring neuronal cell death in a subject, comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) comparing the percentage of cell-free DNA derived from the neurons with a control.

[0155] Embodiment 11. A method for selecting a patient for treatment with a therapeutic agent for treating a neurodegenerative condition, comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) comparing the percentage of cell-free DNA derived from neurons to a control; A method is provided in which patients are selected for treatment if the percentage of cell-free DNA derived from neurons is higher than a control.

[0156] Embodiment 12. The method of any one of embodiments 8 to 11, wherein step (ii) comprises analyzing the methylation pattern of the entire amplicon of DNA.

[0157] Embodiment 13. The method of embodiment 12, wherein the entire amplicon is at least about 50 base pairs (bp) in length.

[0158] Embodiment 14. The method of embodiment 13, wherein the entire amplicon is about 50 to about 500 base pairs in length.

[0159] Embodiment 15. The method of any one of embodiments 10 to 14, wherein the patient is selected for treatment if the percentage of cell-free DNA derived from the neurons is greater than about 5%.

[0160] Embodiment 16. The method of embodiment 15, wherein the patient is selected for treatment if the percentage of cell-free DNA derived from the neurons is greater than about 7%.

[0161] Embodiment 17. The method of embodiment 15, wherein the patient is selected for treatment if the percentage of cell-free DNA derived from the neurons is greater than about 9%.

[0162] Embodiment 18. The method of any one of embodiments 1 to 17, wherein a higher percentage of cell-free DNA derived from neurons than the control indicates an increased risk of a neurodegenerative condition or traumatic brain injury.

[0163]

[0031] Embodiment 19. A computer product comprising a non-transitory computer readable medium having stored thereon a plurality of instructions which, when executed, control a computer system to analyze a biological sample from a subject comprising cell-free DNA to determine risk of a neurodegenerative condition in the subject, the instructions comprising: (i) identifying a first DNA methylation pattern that occurs in neurons at a rate above a threshold, the first DNA methylation pattern comprising methylation in one or more methylated regions and, optionally, no methylation in one or more unmethylated regions; (ii) analyzing a second methylation pattern of the cell-free DNA; and (iii) calculating the relative abundance of said one or more methylated regions and optionally said one or more unmethylated regions in said cell-free DNA; (iv) determining a risk of a neurodegenerative condition in the subject by comparing the relative abundance to a control.

[0164] Embodiment 20. A method for determining the efficacy of a potential treatment for a neurodegenerative condition, comprising: (i) obtaining cell-free DNA from blood samples from a plurality of subjects to which the potential treatment has been administered; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA derived from neurons; and (iv) comparing the percentage of cell-free DNA derived from the neurons to a control; A potential treatment is provided where the percentage of cell-free DNA derived from neurons is lower than the control, providing a method.

[0165] Embodiment 21. The method of embodiment 20, wherein steps (i) to (iv) are repeated at least one time.

[0166] Embodiment 22. The method of embodiment 21, wherein steps (i)-(iv) are repeated weekly.

[0167] Embodiment 23. The method of any one of the above embodiments, wherein determining the percentage of cell-free DNA derived from neurons comprises comparing the methylation pattern of the cell-free DNA to a methylation pattern of neuronal DNA, wherein the methylation pattern of the neuronal DNA comprises methylation in one or more methylated regions, and optionally no methylation in one or more unmethylated regions.

[0168] Embodiment 24. A computer-implemented method for analyzing a biological sample, comprising: (i) identifying a first DNA methylation pattern that occurs in neurons at a rate above a threshold, the first DNA methylation pattern comprising methylation in one or more methylated regions and, optionally, no methylation in one or more unmethylated regions; (ii) analyzing a second methylation pattern of the cell-free DNA; and (iii) calculating the relative abundance of said one or more methylated regions and optionally said one or more unmethylated regions in said cell-free DNA; (iv) determining the risk of a neurodegenerative condition in the subject by comparing the relative abundance with a control.

[0169] Embodiment 25. The method of any one of embodiments 20 to 24, wherein step (ii) comprises analyzing the methylation pattern of the entire amplicon of DNA.

[0170] Embodiment 26 The method of embodiment 25, wherein the entire amplicon is at least about 50 base pairs (bp) in length.

[0171] Embodiment 27. The method of embodiment 26, wherein the entire amplicon is about 50 to about 500 base pairs in length.

[0172] Embodiment 28. The method of any one of the above embodiments, wherein the control is a blood sample from an untreated subject, a percentage of cell-free DNA derived from neurons in a blood sample from the subject before treatment, or a threshold value.

[0173] Embodiment 29. The method of embodiment 28, wherein the threshold is a percentage of cell-free DNA derived from neurons that is greater than about 5%.

[0174] Embodiment 30. The method of embodiment 28, wherein the threshold is a percentage of cell-free DNA derived from neurons that is greater than about 7%.

[0175] Embodiment 31. The method of embodiment 28, wherein the threshold is a percentage of cell-free DNA derived from neurons that is greater than about 9%.

[0176] Embodiment 32. The method of any one of the above embodiments, wherein the neurodegenerative disease is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, or concussion.

[0177] Embodiment 33. The method of any one of the above embodiments, wherein the neuron is a motor neuron, a sensory neuron, an interneuron, a dopaminergic neuron, a cholinergic neuron, a GABAergic neuron, a glutamatergic neuron, or a cortical neuron.

[0178] Embodiment 34 The method of any one of the above embodiments, wherein the neurons are derived from the forebrain, midbrain, or hindbrain.

[0179] Embodiment 35. The method of any one of the above embodiments, wherein the neuron is derived from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.

[0180] Embodiment 36 The method of any one of the above embodiments, wherein analyzing the methylation pattern comprises converting 5-methylcytosines in the cell-free DNA to a different nucleotide.

[0181] Embodiment 37. The method of embodiment 36, wherein converting comprises bisulfite conversion or enzymatic conversion.

[0182] Embodiment 38. The method of any one of the above embodiments, wherein the subject has mild cognitive impairment.

[0183] Embodiment 39. The method of any one of the above embodiments, wherein the subject is 45 years of age or older.

[0184] Embodiment 40. The method of any one of the above embodiments, comprising selecting a subject who is 45 years of age or older.

[0185] Embodiment 41 The method of embodiment 40, wherein the subject does not have symptoms of the neurodegenerative condition.

[0186] Embodiment 42. The method of any one of the above embodiments, comprising selecting a subject with mild cognitive impairment.

[0187] Embodiment 43. A method of treating a subject having a mild traumatic brain injury, comprising: (i) selecting a subject at risk for mild traumatic brain injury; and (ii) obtaining cell-free DNA from a blood sample from the subject; and (iii) analyzing the methylation pattern of the cell-free DNA; and (iv) determining the percentage of cell-free DNA derived from neurons; and (v) comparing the percentage of cell-free DNA derived from the neurons to a control; and (vi) treating the subject for mild traumatic brain injury if the percentage of cell-free DNA derived from neurons is higher than the control.

[0188] Embodiment 44. The method of embodiment 43, wherein treating the subject comprises administering a therapeutic agent that treats one or more symptoms of mild traumatic brain injury.

[0189] Embodiment 45. The method of embodiment 43 or 44, further comprising repeating steps (ii)-(v) at some point after treatment.

[0190] Embodiment 46. The method of embodiment 45, wherein treatment is discontinued if the percentage of cell-free DNA derived from said neurons at said time point is equal to or less than said control.

[0191] Embodiment 47. The method of embodiment 46, wherein treatment is continued if the percentage of cell-free DNA derived from said neurons at said time point is higher than a control.

[0192] Embodiment 48. A kit comprising a first plurality of oligonucleotides, each of which is capable of hybridizing to a selectively methylated region in a neuronal cell.

[0193] Embodiment 49. The kit of embodiment 48, further comprising a second plurality of oligonucleotides, each of said second plurality of oligonucleotides capable of hybridizing to selectively unmethylated regions in neuronal cells.

[0194] Embodiment 50. A kit according to embodiment 48 or 49 for determining the efficacy of a potential treatment for a neurodegenerative disease or condition.

[0195] Embodiment 51. The kit of embodiment 50, wherein the neurodegenerative disease or condition is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, or concussion.

[0196] Embodiment 52. The kit of any one of embodiments 48 to 51, wherein the neuron is a motor neuron, a sensory neuron, an interneuron, a dopaminergic neuron, a cholinergic neuron, a GABAergic neuron, a glutamatergic neuron, or a cortical neuron.

[0197] Embodiment 53. A kit according to any one of embodiments 48 to 52, wherein the neurons are derived from the forebrain, midbrain, or hindbrain.

[0198] Embodiment 54. A kit according to any one of embodiments 48 to 53, wherein the neurons are derived from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.

[0199] Embodiment 55. A kit described in any one of embodiments 48 to 54, wherein the plurality of oligonucleotides comprises one or more oligonucleotides having a nucleotide sequence of any one of SEQ ID NOs: 3 to 6.

[0200] Embodiment 56. A method for detecting neuronal-derived cell-free DNA in a blood sample, comprising: (i) obtaining cell-free DNA from a blood sample from a human subject; (ii) detecting whether neuron-derived cell-free DNA is present in the blood sample by methylation analysis comprising sequencing the entire DNA amplicon of the cell-free DNA from the blood sample.

[0201] Embodiment 57. The method of embodiment 56, wherein the entire amplicon is at least about 50 base pairs (bp) in length.

[0202] Embodiment 58. The method of embodiment 57, wherein the entire amplicon is about 50 to about 500 base pairs in length.

[0203] Embodiment 59. The method of any one of embodiments 56 to 58, wherein the entire amplicon was generated using one or more primers comprising any one of SEQ ID NOs: 3 to 6.

[0204] Embodiment 60. The method of any one of embodiments 56 to 59, wherein the entire amplicon was generated using one or more primers targeting a region selected from the regions listed in Table 1.

[0205] Embodiment 61. A method for determining the methylation status of an amplicon, comprising: (i) obtaining cell-free DNA from a blood sample from a human subject; (ii) converting 5-methylcytosines in the cell-free DNA to a different nucleotide, thereby generating converted cell-free DNA; and (iii) amplifying the converted cell-free DNA, thereby generating amplicons; and (iv) sequencing the amplicon, wherein the amplicon is about 50 bp to about 500 bp in length.

[0206] Embodiment 62. The method of embodiment 61, wherein the entire amplicon was generated using one or more primers comprising any one of SEQ ID NOs: 3 to 6.

[0207] Embodiment 63. The method of embodiment 61, wherein said entire amplicon was generated using one or more primers targeting a region selected from the regions listed in Table 1. [Table 2-1] [Table 2-2]

Table 2-3

Table 2-4

Table 2-5

Table 2-6

Table 2-7

Table 2-8

Table 2-9

Table 2-10

Table 2-11

Table 2-12

Table 2-13

Table 2-14

Table 2-15

Table 2-16

Table 2-17

Table 2-18

Table 2-19

Table 2-20

Table 2-21

Table 2-22

Table 2-23

Table 2-24

Claims

1. 1. A method of treating a subject having or at risk of having a neurodegenerative condition, comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA that is neuron-derived; and (iv) comparing the percentage of cell-free DNA derived from said neurons to a control; and (v) administering a therapeutic agent for treating or preventing a neurodegenerative disease or condition if the percentage of cell-free DNA derived from the neurons is higher than the control.

2. 2. The method of claim 1, wherein step (ii) comprises analyzing the methylation pattern of the entire amplicon of DNA.

3. 3. The method of claim 2, wherein the entire amplicon is at least about 50 base pairs (bp) in length.

4. The method of claim 3, wherein the entire amplicon is from about 50 to about 500 base pairs in length.

5. The method of any one of claims 1 to 4, wherein the therapeutic agent is administered if the percentage of cell-free DNA derived from the neurons is greater than about 5%.

6. 5. The method of any one of claims 1 to 4, wherein the therapeutic agent is administered if the percentage of cell-free DNA derived from the neurons is greater than about 7%.

7. 5. The method of any one of claims 1 to 4, wherein the therapeutic agent is administered if the percentage of cell-free DNA derived from the neurons is greater than about 9%.

8. 1. A method of treating a subject having or at risk of having a neurodegenerative condition, comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA that is neuron-derived; and (iv) administering a therapeutic agent for treating or preventing a neurodegenerative condition if the percentage of cell-free DNA derived from the neurons is greater than about 5%.

9. 1. A method for analyzing a biological sample from a subject, comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA that is neuron-derived; and (iv) comparing the percentage of cell-free DNA derived from the neurons with a control.

10. 1. A method for measuring neuronal cell death in a subject, comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA that is neuron-derived; and (iv) comparing the percentage of cell-free DNA derived from the neurons with a control.

11. 1. A method for selecting a patient for treatment with a therapeutic agent for treating a neurodegenerative condition, comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA that is neuron-derived; and (iv) comparing the percentage of cell-free DNA derived from the neurons with a control; The method, wherein the patient is selected for treatment if the percentage of cell-free DNA derived from neurons is higher than a control.

12. The method of any one of claims 8 to 11, wherein step (ii) comprises analysing the methylation pattern of the entire amplicon of DNA.

13. 13. The method of claim 12, wherein the entire amplicon is at least about 50 base pairs (bp) in length.

14. The method of claim 13, wherein the entire amplicon is about 50 to about 500 base pairs in length.

15. The method of any one of claims 10 to 14, wherein the patient is selected for treatment if the percentage of cell-free DNA derived from neurons is higher than about 5%.

16. 16. The method of claim 15, wherein the patient is selected for treatment if the percentage of cell-free DNA derived from neurons is greater than about 7%.

17. 16. The method of claim 15, wherein the patient is selected for treatment if the percentage of cell-free DNA derived from neurons is greater than about 9%.

18. 18. The method of any one of claims 1 to 17, wherein a higher percentage of cell-free DNA derived from neurons than the control is indicative of an increased risk of a neurodegenerative condition or traumatic brain injury.

19. 1. A computer product comprising a non-transitory computer readable medium having stored thereon a plurality of instructions which, when executed, control a computer system to analyze a biological sample from a subject comprising cell-free DNA to determine a risk of a neurodegenerative condition in the subject, the instructions comprising: (i) identifying a first DNA methylation pattern that occurs in neurons at a rate above a threshold, the first DNA methylation pattern comprising methylation in one or more methylated regions and, optionally, no methylation in one or more unmethylated regions; (ii) analyzing a second methylation pattern of the cell-free DNA; and (iii) calculating the relative abundance of said one or more methylated regions and optionally said one or more unmethylated regions in said cell-free DNA; (iv) determining a risk of a neurodegenerative condition in the subject by comparing the relative abundance to a control.

20. 1. A method for determining the efficacy of a potential treatment for a neurodegenerative condition, comprising: (i) obtaining cell-free DNA from blood samples from a plurality of subjects to whom the potential treatment has been administered; (ii) analyzing the methylation pattern of the cell-free DNA; and (iii) determining the percentage of cell-free DNA that is neuron-derived; and (iv) comparing the percentage of cell-free DNA derived from the neurons with a control; The method, wherein the potential treatment is effective when the percentage of cell-free DNA derived from neurons is lower than a control.

21. 21. The method of claim 20, wherein steps (i) to (iv) are repeated at least one time.

22. 22. The method of claim 21, wherein steps (i)-(iv) are repeated weekly.

23. 2. The method of claim 1, wherein determining the percentage of cell-free DNA derived from neurons comprises comparing the methylation pattern of the cell-free DNA to a methylation pattern of neuronal DNA, the methylation pattern of the neuronal DNA comprising methylation in one or more methylated regions and optionally no methylation in one or more unmethylated regions.

24. 1. A computer-implemented method for analyzing a biological sample, comprising: (i) identifying a first DNA methylation pattern that occurs in neurons at a rate above a threshold, the first DNA methylation pattern comprising methylation in one or more methylated regions and, optionally, no methylation in one or more unmethylated regions; (ii) analyzing a second methylation pattern of the cell-free DNA; and (iii) calculating the relative abundance of said one or more methylated regions and optionally said one or more unmethylated regions in said cell-free DNA; (iv) determining the risk of a neurodegenerative condition in the subject by comparing the relative abundance with a control.

25. The method of any one of claims 20 to 24, wherein step (ii) comprises analysing the methylation pattern of the entire amplicon of DNA.

26. 26. The method of claim 25, wherein the entire amplicon is at least about 50 base pairs (bp) in length.

27. 27. The method of claim 26, wherein the entire amplicon is from about 50 to about 500 base pairs in length.

28. 2. The method of any one of the above claims, wherein the control is a blood sample from an untreated subject, a percentage of cell-free DNA derived from neurons in a blood sample from the subject before treatment, or a threshold value.

29. 29. The method of claim 28, wherein the threshold is a percentage of cell-free DNA derived from neurons that is greater than about 5%.

30. 29. The method of claim 28, wherein the threshold is a percentage of cell-free DNA derived from neurons that is greater than about 7%.

31. 29. The method of claim 28, wherein the threshold is a percentage of cell-free DNA derived from neurons that is greater than about 9%.

32. 10. The method of any one of the above claims, wherein the neurodegenerative disease is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, or concussion.

33. 2. The method of any one of the above claims, wherein the neuron is a motor neuron, a sensory neuron, an interneuron, a dopaminergic neuron, a cholinergic neuron, a GABAergic neuron, a glutamatergic neuron, or a cortical neuron.

34. 2. The method of any one of the preceding claims, wherein the neuron is derived from the forebrain, midbrain, or hindbrain.

35. 2. The method of any one of the preceding claims, wherein the neurons originate from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.

36. 2. The method of claim 1, wherein analyzing the methylation pattern comprises converting 5-methylcytosines in the cell-free DNA to a different nucleotide.

37. 37. The method of claim 36, wherein the converting comprises bisulfite conversion or enzymatic conversion.

38. 2. The method of any one of the above claims, wherein the subject has mild cognitive impairment.

39. 2. The method of any one of the above claims, wherein the subject is 45 years of age or older.

40. 10. The method of any one of the preceding claims, comprising selecting subjects aged 45 years or older.

41. 41. The method of claim 40, wherein the subject has no symptoms of the neurodegenerative condition.

42. 10. The method of any one of the preceding claims, comprising selecting a subject with mild cognitive impairment.

43. 1. A method of treating a subject having a mild traumatic brain injury, comprising: (i) selecting a subject at risk for mild traumatic brain injury; (ii) obtaining cell-free DNA from a blood sample from the subject; and (iii) analyzing the methylation pattern of the cell-free DNA; and (iv) determining the percentage of cell-free DNA derived from neurons; and (v) comparing the percentage of cell-free DNA derived from said neurons to a control; and (vi) treating the subject for mild traumatic brain injury if the percentage of cell-free DNA derived from the neurons is higher than the control.

44. 44. The method of claim 43, wherein treating the subject comprises administering a therapeutic agent to treat one or more symptoms of mild traumatic brain injury.

45. 45. The method of claim 43 or 44, further comprising repeating steps (ii)-(v) at some point after treatment.

46. 46. ​​The method of claim 45, wherein treatment is discontinued if the percentage of cell-free DNA derived from said neurons at said time point is less than or equal to said control.

47. 47. The method of claim 46, wherein treatment is continued if the percentage of cell-free DNA derived from said neurons at said time point is higher than the control.

48. 1. A kit comprising a first plurality of oligonucleotides, each of the first plurality of oligonucleotides capable of hybridizing to a selectively methylated region in a neuronal cell.

49. 49. The kit of claim 48, further comprising a second plurality of oligonucleotides, each of the second plurality of oligonucleotides capable of hybridizing to a region that is selectively unmethylated in a neuronal cell.

50. 50. A kit according to claim 48 or 49 for determining the efficacy of a potential treatment for a neurodegenerative disease or condition.

51. 51. The kit of claim 50, wherein the neurodegenerative disease or condition is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, or concussion.

52. 52. The kit of any one of claims 48 to 51, wherein the neuron is a motor neuron, a sensory neuron, an interneuron, a dopaminergic neuron, a cholinergic neuron, a GABAergic neuron, a glutamatergic neuron, or a cortical neuron.

53. The kit of any one of claims 48 to 52, wherein the neuron is derived from the forebrain, midbrain, or hindbrain.

54. The kit of any one of claims 48 to 53, wherein the neuron is derived from the frontal lobe, the temporal lobe, the parietal lobe, the occipital lobe, the cerebellum, or the brain stem.

55. The kit of any one of claims 48 to 54, wherein the plurality of oligonucleotides comprises one or more oligonucleotides having a nucleotide sequence of any one of SEQ ID NOs: 3 to 6.

56. 1. A method for detecting neuronal-derived cell-free DNA in a blood sample, comprising: (i) obtaining cell-free DNA from a blood sample from a human subject; (ii) detecting whether neuron-derived cell-free DNA is present in the blood sample by methylation analysis comprising sequencing the entire DNA amplicon of the cell-free DNA from the blood sample.

57. 57. The method of claim 56, wherein the entire amplicon is at least about 50 base pairs (bp) in length.

58. 58. The method of claim 57, wherein the entire amplicon is from about 50 to about 500 base pairs in length.

59. 59. The method of any one of claims 56 to 58, wherein the entire amplicon was generated using one or more primers comprising the sequence of any one of SEQ ID NOs: 3 to 6.

60. 60. The method of any one of claims 56 to 59, wherein the entire amplicon was generated using one or more primers targeting a region selected from the regions listed in Table 1.

61. 1. A method for determining the methylation status of an amplicon, comprising: (i) obtaining cell-free DNA from a blood sample from a human subject; (ii) converting 5-methylcytosines in the cell-free DNA to a different nucleotide, thereby producing converted cell-free DNA; and (iii) amplifying the converted cell-free DNA, thereby generating an amplicon; and (iv) sequencing the amplicon, wherein the amplicon is about 50 bp to about 500 bp in length.

62. 62. The method of claim 61, wherein the entire amplicon was generated using one or more primers comprising the sequence of any one of SEQ ID NOs: 3-6.

63. 62. The method of claim 61 , wherein the entire amplicon was generated using one or more primers targeting a region selected from those listed in Table 1.

Images