Aromatic ring compounds and their uses

Abstract

The present invention relates to an aromatic ring compound and its use. The compound of the present invention has a significantly better therapeutic effect on tumors with low expression, no expression, low activation or inactivation of mitochondrial permeability transition pore, low expression, no expression, low activation or inactivation of peptidylprolyl isomerase F, low expression or no expression of NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide site of NNMT gene and / or hypermethylation of DNA CpG site in NNMT gene region. The present invention provides a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof.

Description

[Technical Field]

[0001] The present invention relates to the field of medicine, and in particular to aromatic ring compounds and their uses. [Background technology]

[0002] Tumors, as a common disease that seriously endangers human health, have been steadily increasing the mortality rate from malignant tumors. Due to the heterogeneity of tumors, simply using the same treatment or drug for each tumor based on its origin and pathological characteristics can easily lead to problems caused by inappropriate treatment, delaying patients' critical treatment time and opportunity. Therefore, there is a great need to adopt precision therapy for various tumor conditions. With the development of biological technology, tumors have a continuous genotype distribution at the molecular level, such as genes and proteins, and changes in the expression and activity of tumor-related genes and proteins have been increasingly discovered. These changes play an important role in the development of malignant tumors. The discovery and application of biomarkers can provide precise guidance for the application of relevant drugs, enabling precision tumor therapy, thereby achieving targeted dosing, significantly improving therapeutic efficacy, and reducing drug dosage and toxic side effects.

[0003] Therefore, there is an urgent need in the art to develop drugs that can precisely treat tumors. Summary of the Invention [Problem to be solved by the invention]

[0004] The present invention aims to provide a compound that has a more refined therapeutic effect on tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidylprolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. [Means for solving the problem]

[0005] A first aspect of the present invention provides a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof; JPEG2025511112000002.jpg1419 I wherein ring A represents a substituted or unsubstituted C6-C14 aryl ring, a substituted or unsubstituted C3-C14 cycloalkyl ring, a substituted or unsubstituted 3- to 14-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 14-membered heteroaryl ring; Ring B represents an unsubstituted or substituted C6-C14 aryl ring, a substituted or unsubstituted C3-C14 cycloalkyl ring, a substituted or unsubstituted 3- to 14-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 14-membered heteroaryl ring; R1 is JPEG2025511112000003.jpg1314, JPEG2025511112000004.jpg1618, a substituted or unsubstituted C6-C16 aryl group-substituted or unsubstituted C1-C6 alkyl group; Ring C represents a substituted or unsubstituted C6-C16 aryl ring, a substituted or unsubstituted C3-C16 cycloalkyl ring, a substituted or unsubstituted 3- to 16-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 16-membered heteroaryl ring; R2 is a hydrogen atom, JPEG2025511112000005.jpg712, a substituted or unsubstituted C6-C12 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C8 alkyl group-, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C8 alkyl group-; R3 is no group, a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group-substituted or unsubstituted C1-C8 alkyl group-, a substituted or unsubstituted C1-C8 alkoxyl group, a substituted or unsubstituted C1-C8 alkylthiol group, a substituted or unsubstituted C2-C8 acyl group, a substituted or unsubstituted C2-C8 acyl group-substituted or unsubstituted C1-C8 alkyl group-, a substituted or unsubstituted C6-C 14 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted C6-C14 aryl group-sulfuryl group-, a substituted or unsubstituted C6-C14 aryl group-C(O)-, a substituted or unsubstituted C6-C14 aryl group-C(O)-substituted or unsubstituted C1-C8 alkyl group-, a substituted or unsubstituted C6-C14 aryl group-substituted or unsubstituted C1-C8 alkyl group-, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C8 alkyl group-; R4 and R5 each independently represent a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C3-C12 cycloalkyl group; R6 represents a substituted or unsubstituted C6-C14 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted C3-C14 cycloalkyl group, or a substituted or unsubstituted 3-14 membered heterocycloalkyl group; R7 represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group; R8 and R9 join to form a substituted or unsubstituted C3-C14 cycloalkyl ring or a substituted or unsubstituted 3- to 14-membered heterocycloalkyl ring; R 10 and R 11each independently represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C2-C10 acyl group, a substituted or unsubstituted C6-C14 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted C6-C14 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C6-C14 aryl group-C(O)-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C6 alkyl group-; or R 10 and R 11 are joined to form a substituted or unsubstituted C3-C12 cycloalkyl ring, a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 12-membered heteroaryl ring; n represents 0, 1, 2, 3, 4 or 5.

[0006] In another preferred example, the optional "substitution" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxy ... The term "substituted" refers to a group substituted by a substituent selected from a thiol group, a halogen atom, a nitro group, -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, a C6-C12 aryl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocycloalkyl group.

[0007] In another preferred example, the optional "substitution" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C6 alkyl group, a C3-C8 cycloalkyl group, a C1-C6 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxy ... It refers to being substituted by a substituent selected from a thiol group, a halogen atom, a nitro group, -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C6 alkoxyl group, a C1-C6 alkylthiol group, a C1-C6 halogenated alkoxyl group, a C1-C6 halogenated alkylthiol group, a C6-C12 aryl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocycloalkyl group.

[0008] In another preferred example, the optional "substitution" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C5 alkyl group, a C3-C7 cycloalkyl group, a C1-C5 halogenated alkyl group, a C3-C7 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkenyl ... It refers to being substituted by a substituent selected from a alkylthiol group, a halogen atom, a nitro group, -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C5 carboxyl group, a C2-C5 ester group, a C2-C5 acylamino group, a C1-C5 alkoxyl group, a C1-C5 alkylthiol group, a C1-C5 halogenated alkoxyl group, a C1-C5 halogenated alkylthiol group, a C6-C8 aryl group, a 5-8 membered heteroaryl group, and a 5-8 membered heterocycloalkyl group.

[0009] In another preferred example, the optional "substitution" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C4 alkyl group, a C3-C8 cycloalkyl group, a C1-C4 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxy ... It refers to being substituted by a substituent selected from a thiol group, a halogen atom, a nitro group, -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C4 alkoxyl group, a C1-C4 alkylthiol group, a C1-C4 halogenated alkoxyl group, a C1-C4 halogenated alkylthiol group, a C6-C12 aryl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocycloalkyl group.

[0010] In another preferred example, the optional "substitution" means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently replaced by a C1-C3 alkyl group, a C3-C7 cycloalkyl group, a C1-C3 halogenated alkyl group, a C3-C7 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkenyl ... It refers to being substituted by a substituent selected from a thiol group, a halogen atom, a nitro group, -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C3 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C3 alkoxyl group, a C1-C3 alkylthiol group, a C1-C3 halogenated alkoxyl group, a C1-C3 halogenated alkylthiol group, a C6-C10 aryl group, a 5-8 membered heteroaryl group, and a 5-8 membered heterocycloalkyl group.

[0011] In another preferred example, the heterocyclic rings of the heterocycloalkyl group, the heteroaryl group, the heterocycloalkyl ring, and the heteroaryl ring each independently contain 1 to 4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S.

[0012] In another preferred example, the heterocycloalkyl group has 1 to 4 (preferably 1, 2, 3, or 4) heteroatoms independently selected from N, O, and S on the heterocycle.

[0013] In another preferred example, the heteroaryl group has 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S on the heterocyclic ring.

[0014] In another preferred example, the heterocycloalkyl ring has 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S on the heterocyclic ring.

[0015] In another preferred example, the heteroaryl ring has 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms independently selected from N, O and S on the heterocyclic ring.

[0016] In another preferred example, the optional "substitution" refers to one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group being each independently replaced by a substituent.

[0017] In another preferred embodiment, the cycloalkyl group has 0, 1 or 2 C=C cyclic double bonds.

[0018] In another preferred example, the halogen atom refers to a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

[0019] In another preferred embodiment, the cycloalkyl ring has one, two or three C=C cyclic double bonds.

[0020] In another preferred embodiment, the heterocycloalkyl ring has one, two, or three C=C cyclic double bonds.

[0021] In another preferred embodiment, ring A represents a substituted or unsubstituted C6-C12 aryl ring, a substituted or unsubstituted C3-C12 cycloalkyl ring, a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 12-membered heteroaryl ring.

[0022] In another preferred example, ring A represents a substituted or unsubstituted C6-C9 aryl ring, a substituted or unsubstituted C3-C9 cycloalkyl ring, a substituted or unsubstituted 3- to 9-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 9-membered heteroaryl ring.

[0023] In another preferred example, ring A represents a substituted or unsubstituted C6-C10 aryl ring, a substituted or unsubstituted C3-C10 cycloalkyl ring, a substituted or unsubstituted 3- to 10-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 12-membered heteroaryl ring.

[0024] In another preferred example, ring A represents a substituted or unsubstituted C6-C8 aryl ring, a substituted or unsubstituted C3-C8 cycloalkyl ring, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 12-membered heteroaryl ring.

[0025] In another preferred example, ring A represents a substituted or unsubstituted C6-C10 aryl ring, a substituted or unsubstituted C3-C10 cycloalkyl ring, a substituted or unsubstituted 3- to 10-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 10-membered heteroaryl ring.

[0026] In another preferred example, ring A represents a substituted or unsubstituted C6-C8 aryl ring, a substituted or unsubstituted C3-C8 cycloalkyl ring, a substituted or unsubstituted 3- to 8-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 8-membered heteroaryl ring.

[0027] In another preferred example, ring A represents a substituted or unsubstituted 5-membered heterocycloalkyl ring, a substituted or unsubstituted 6-membered heterocycloalkyl ring, a substituted or unsubstituted 7-membered heterocycloalkyl ring, a substituted or unsubstituted 8-membered heterocycloalkyl ring, a substituted or unsubstituted 5-membered heteroaryl ring, a substituted or unsubstituted 6-membered heteroaryl ring, a substituted or unsubstituted 7-membered heteroaryl ring, a substituted or unsubstituted 8-membered heteroaryl ring, a substituted or unsubstituted 9-membered heteroaryl ring, a substituted or unsubstituted 10-membered heteroaryl ring, a substituted or unsubstituted 11-membered heteroaryl ring, or a substituted or unsubstituted 12-membered heteroaryl ring.

[0028] In another preferred example, ring A represents a substituted or unsubstituted 5-membered heteroaryl ring, a substituted or unsubstituted 6-membered heteroaryl ring, a substituted or unsubstituted 7-membered heteroaryl ring, a substituted or unsubstituted 8-membered heteroaryl ring, a substituted or unsubstituted 9-membered heteroaryl ring, a substituted or unsubstituted 10-membered heteroaryl ring, a substituted or unsubstituted 11-membered heteroaryl ring, or a substituted or unsubstituted 12-membered heteroaryl ring.

[0029] In another preferred example, ring A represents a substituted or unsubstituted pyridine ring, a substituted or unsubstituted pyrimidine ring, a substituted or unsubstituted quinoline ring, a substituted or unsubstituted pyrazole ring, a substituted or unsubstituted pyrrole ring, a substituted or unsubstituted thiazole ring, or a substituted or unsubstituted imidazole ring.

[0030] In another preferred embodiment, R1 is bonded to a heteroatom on ring A.

[0031] In another preferred example, R1 is bonded to the N atom on ring A.

[0032] In another preferred example, R1 is JPEG2025511112000006.jpg1314, JPEG2025511112000007.jpg1618, a substituted or unsubstituted C6-C12 aryl group - a substituted or unsubstituted C1-C6 alkyl group.

[0033] In another preferred example, R1 is JPEG2025511112000008.jpg1314, JPEG2025511112000009.jpg1618, a substituted or unsubstituted C6-C10 aryl group - a substituted or unsubstituted C1-C6 alkyl group.

[0034] In another preferred example, R1 is JPEG2025511112000010.jpg1314, JPEG2025511112000011.jpg1618, a substituted or unsubstituted C6-C8 aryl group - a substituted or unsubstituted C1-C4 alkyl group.

[0035] In another preferred example, R1 is JPEG2025511112000012.jpg1314, JPEG2025511112000013.jpg1618, a substituted or unsubstituted C6-C8 aryl group - a substituted or unsubstituted C1-C2 alkyl group.

[0036] In another preferred example, R1 is JPEG2025511112000014.jpg1314, JPEG2025511112000015.jpg1618, a substituted or unsubstituted phenyl group - a substituted or unsubstituted methyl group -.

[0037] In another preferred example, R1 is JPEG2025511112000016.jpg1314, JPEG2025511112000017.jpg1618, or a phenyl group-methyl group-.

[0038] In another preferred embodiment, R2 is bonded to a carbon atom on ring A.

[0039] In another preferred embodiment, R2 is bonded to a heteroatom on ring A.

[0040] In another preferred embodiment, R2 is bonded to the N atom on ring A.

[0041] In another preferred embodiment, ring B is an unsubstituted or substituted C6-C12 aryl ring, a substituted or unsubstituted C3-C12 cycloalkyl ring, a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 12-membered heteroaryl ring.

[0042] In another preferred embodiment, ring B represents an unsubstituted or substituted C6-C9 aryl ring, a substituted or unsubstituted C3-C9 cycloalkyl ring, a substituted or unsubstituted 3- to 9-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 9-membered heteroaryl ring.

[0043] In another preferred embodiment, ring B is an unsubstituted or substituted C6-C10 aryl ring, a substituted or unsubstituted C3-C10 cycloalkyl ring, a substituted or unsubstituted 3- to 10-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 10-membered heteroaryl ring.

[0044] In another preferred embodiment, ring B represents an unsubstituted or substituted C6-C8 aryl ring, a substituted or unsubstituted C5-C8 cycloalkyl ring, a substituted or unsubstituted 5-8 membered heterocycloalkyl ring, or a substituted or unsubstituted 5-8 membered heteroaryl ring.

[0045] In another preferred example, ring B represents an unsubstituted or substituted 5-membered heterocycloalkyl ring, a substituted or unsubstituted 6-membered heterocycloalkyl ring, a substituted or unsubstituted 7-membered heterocycloalkyl ring, a substituted or unsubstituted 8-membered heterocycloalkyl ring, a substituted or unsubstituted 5-membered heteroaryl ring, a substituted or unsubstituted 6-membered heteroaryl ring, a substituted or unsubstituted 7-membered heteroaryl ring, or a substituted or unsubstituted 8-membered heteroaryl ring.

[0046] In another preferred embodiment, the cycloalkyl ring has one, two or three C=C cyclic double bonds.

[0047] In another preferred example, ring B represents an unsubstituted or substituted pyridine ring, a substituted or unsubstituted tetrahydropyridine ring, a substituted or unsubstituted pyrrole ring, a substituted or unsubstituted dihydropyrrole ring, a substituted or unsubstituted imidazole ring, or a substituted or unsubstituted pyrazole ring.

[0048] In another preferred embodiment, R2 is a hydrogen atom, JPEG2025511112000018.jpg712, a substituted or unsubstituted C6-C10 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C6 alkyl group-.

[0049] In another preferred embodiment, R2 is a hydrogen atom, JPEG2025511112000019.jpg712, a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-8 membered heteroaryl group, a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-.

[0050] In another preferred embodiment, R2 is a hydrogen atom, JPEG2025511112000020.jpg712, a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-8 membered heteroaryl group, a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, or a substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C2 alkyl group-.

[0051] In another preferred embodiment, R2 is a hydrogen atom, JPEG2025511112000021.jpg712, or a substituted or unsubstituted phenyl group - a substituted or unsubstituted methyl group.

[0052] In another preferred embodiment, R3 is bonded to a carbon atom on ring B.

[0053] In another preferred embodiment, R3 is bonded to a heteroatom on ring B.

[0054] In another preferred example, R3 is bonded to the N atom on ring B.

[0055] In another preferred example, the chemical structural formula in which ring A is fused with ring B is as follows:

[0056] Substituted or unsubstituted JPEG2025511112000022.jpg69, substituted or unsubstituted JPEG2025511112000023.jpg69, substituted or unsubstituted JPEG2025511112000024.jpg69, substituted or unsubstituted JPEG2025511112000025.jpg69, substituted or unsubstituted JPEG2025511112000026.jpg69, substituted or unsubstituted JPEG2025511112000027.jpg69, substituted or unsubstituted JPEG2025511112000028.jpg710, substituted or unsubstituted JPEG2025511112000029.jpg710, substituted or unsubstituted JPEG2025511112000030.jpg108, substituted or unsubstituted JPEG2025511112000031.jpg98, substituted or unsubstituted JPEG2025511112000032.jpg710.

[0057] In another preferred embodiment, the tetrahydropyridine ring is a 1,2,3,4-tetrahydropyridine ring.

[0058] In another preferred example, the pyrrole ring is a 1-hydropyrrole ring.

[0059] In another preferred embodiment, the dihydropyrrole ring is a 2,3-dihydropyrrole ring.

[0060] In another preferred embodiment, ring B is absent.

[0061] In another preferred example, when ring B is absent, the chemical structure of the compound of formula I is as shown in I-1. JPEG2025511112000033.jpg1411 I-1

[0062] In another preferred example, R3 is no group, a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group, a substituted or unsubstituted C3-C10 cycloalkyl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C1-C6 alkoxyl group, a substituted or unsubstituted C1-C6 alkylthiol group, a substituted or unsubstituted C2-C6 acyl group, a substituted or unsubstituted C2-C6 acyl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted It represents a C6-C12 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted C6-C12 aryl group-sulfuryl group-, a substituted or unsubstituted C6-C12 aryl group-C(O)-, a substituted or unsubstituted C6-C12 aryl group-C(O)-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C6 alkyl group-.

[0063] In another preferred example, R3 is no group, a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group, a substituted or unsubstituted C3-C8 cycloalkyl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C1-C4 alkoxyl group, a substituted or unsubstituted C1-C4 alkylthiol group, a substituted or unsubstituted C2-C4 acyl group, a substituted or unsubstituted C2-C4 acyl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C It represents a 6-C10 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted C6-C10 aryl group-sulfuryl group-, a substituted or unsubstituted C6-C10 aryl group-C(O)-, a substituted or unsubstituted C6-C10 aryl group-C(O)-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-.

[0064] In another preferred example, R3 is no group, a hydrogen atom, a halogen atom, a substituted or unsubstituted C3-C6 alkyl group, a substituted or unsubstituted C3-C7 cycloalkyl group, a substituted or unsubstituted C3-C7 cycloalkyl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted C1-C4 alkoxyl group, a substituted or unsubstituted C1-C4 alkylthiol group, a substituted or unsubstituted C2-C4 acyl group, a substituted or unsubstituted C2-C4 acyl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted C12 aryl group, a substituted or unsubstituted It represents a 5-membered heteroaryl group, a substituted or unsubstituted 6-membered heteroaryl group, a substituted or unsubstituted 7-membered heteroaryl group, a substituted or unsubstituted 8-membered heteroaryl group, a substituted or unsubstituted C6-C10 aryl group-sulfuryl group-, a substituted or unsubstituted C6-C10 aryl group-C(O)-, a substituted or unsubstituted C6-C10 aryl group-C(O)-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted 5-10-membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-.

[0065] In another preferred example, R3 is no group, a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C3-C7 cycloalkyl group, a substituted or unsubstituted C3-C7 cycloalkyl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted C1-C4 alkoxyl group, a substituted or unsubstituted C1-C4 alkylthiol group, a substituted or unsubstituted C2 acyl group, a substituted or unsubstituted C2 acyl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted It represents a C6-C8 aryl group, a substituted or unsubstituted 5-8 membered heteroaryl group, a substituted or unsubstituted C6-C8 aryl group-sulfuryl group-, a substituted or unsubstituted C6-C8 aryl group-C(O)-, a substituted or unsubstituted C6-C8 aryl group-C(O)-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, or a substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C2 alkyl group-.

[0066] In another preferred example, R3 is a hydrogen atom, a substituted or unsubstituted methyl group, a substituted or unsubstituted ethyl group, a substituted or unsubstituted propyl group, a substituted or unsubstituted butyl group, a substituted or unsubstituted amyl group, a substituted or unsubstituted cyclopropyl group, a substituted or unsubstituted cyclopropyl group-substituted or unsubstituted methyl group-, a substituted or unsubstituted cycloamyl group-substituted or unsubstituted methyl group-, a substituted or unsubstituted phenyl group, a substituted or unsubstituted phenyl group-substituted or unsubstituted methyl group-, a substituted or unsubstituted phenyl group-substituted or unsubstituted ethyl group-, a substituted or unsubstituted It represents a substituted phenyl group-substituted or unsubstituted propyl group, a substituted or unsubstituted phenyl group-sulfuryl group, a substituted or unsubstituted phenyl group-C(O)-, a substituted or unsubstituted phenyl group-C(O)-substituted or unsubstituted methyl group, a substituted or unsubstituted thiazole-substituted or unsubstituted methyl group, a substituted or unsubstituted acetyl group-substituted or unsubstituted methyl group, a substituted or unsubstituted pyridine group, a substituted or unsubstituted pyridine group-substituted or unsubstituted methyl group, a halogenated phenyl group, or a halogenated phenyl group-substituted or unsubstituted methyl group.

[0067] In another preferred example, R3 represents a hydrogen atom, a halogen atom, a methyl group, an ethyl group, a propyl group, a butyl group, an amyl group, a cyclopropyl group, a cyclopropyl-methyl group, a cycloamyl-methyl group, a phenyl group, a phenyl-methyl group, a methyl-phenyl-methyl group, a methyl-phenyl group, a phenyl-ethyl group, a phenyl-propyl group, a phenylsulfonyl group, a phenyl-C(O)-, a phenyl-C(O)-methyl group, a thiazole-methyl group, an acetyl-methyl group, a pyridine group, a pyridine-methyl group, a halogenated phenyl group, or a halogenated phenyl-methyl group.

[0068] In another preferred example, the substituted or unsubstituted phenyl group refers to a mono-substituted phenyl group, a di-substituted phenyl group, a tri-substituted phenyl group, a tetra-substituted phenyl group, a penta-substituted phenyl group, or an unsubstituted phenyl group.

[0069] In another preferred embodiment, in the substituted or unsubstituted phenyl group, the substituted or unsubstituted phenyl group refers to a mono-substituted or unsubstituted phenyl group, and substitution refers to ortho-, para-, and / or meta-substitution of the phenyl group.

[0070] In another preferred example, the substituted or unsubstituted phenyl group refers to a mono-substituted or unsubstituted phenyl group, and the substitution refers to ortho-, para-, and / or meta-substitution of the phenyl group. The substituent refers to a halogen atom (e.g., a chlorine atom), a nitro group, an amino group, a C1-C4 alkyl group (methyl group), a C1-C4 alkoxyl group, a C1-C4 alkylthiol group, F3C-, or F3C-O-.

[0071] In another preferred example, in the substituted or unsubstituted phenyl group-methyl group, the substituted or unsubstituted phenyl group refers to a monosubstituted or unsubstituted phenyl group.

[0072] In another preferred example, in the substituted or unsubstituted phenyl group-methyl group, the substituted or unsubstituted phenyl group refers to a mono-substituted or unsubstituted phenyl group, and substitution refers to ortho-, para- or meta-substitution of the phenyl group.

[0073] In another preferred example, the substituted or unsubstituted phenyl group-methyl group refers to a mono-substituted or unsubstituted phenyl group, and the substitution refers to ortho-, para-, or meta-substitution of the phenyl group. The substituent refers to a halogen atom (e.g., a chlorine atom), a nitro group, an amino group, a C1-C4 alkyl group (methyl group), a C1-C4 alkoxyl group, a C1-C4 alkylthiol group, F3C-, or F3C-O-.

[0074] In another preferred embodiment, the substituted phenyl group refers to a monosubstituted phenyl group.

[0075] In another preferred example, the substituted or unsubstituted propyl group is a substituted or unsubstituted n-propyl group or a substituted or unsubstituted isopropyl group.

[0076] In another preferred example, the substituted or unsubstituted butyl group is a substituted or unsubstituted n-butyl group.

[0077] In another preferred embodiment, the substituted or unsubstituted amyl group is a substituted or unsubstituted n-amyl group.

[0078] In another preferred embodiment, the chemical structure of the substituted or unsubstituted phenyl group-substituted or unsubstituted ethyl group is JPEG2025511112000034.jpg610.

[0079] JPEG2025511112000035.jpg27165

[0080] In another preferred embodiment, the chemical structure of the substituted or unsubstituted thiazole-substituted or unsubstituted methyl group is: JPEG2025511112000036.jpg69.

[0081] In another preferred embodiment, the chemical structure of the methyl group-phenyl group is JPEG2025511112000037.jpg88.

[0082] In another preferred example, the chemical structure of the methyl group-phenyl group-methyl group is JPEG2025511112000038.jpg612, JPEG2025511112000039.jpg810, or JPEG2025511112000040.jpg610.

[0083] In another preferred embodiment, the chemical structure of the halogenated phenyl group-methyl group is JPEG2025511112000041.jpg810, JPEG2025511112000042.jpg613 or JPEG2025511112000043.jpg710.

[0084] In another preferred example, R4 and R5 each independently represent a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group.

[0085] In another preferred example, R4 and R5 each independently represent a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group.

[0086] In another preferred example, R4 and R5 each independently represent a hydrogen atom, a substituted or unsubstituted C1-C5 alkyl group, or a substituted or unsubstituted C3-C9 cycloalkyl group.

[0087] In another preferred example, R4 and R5 each independently represent a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a substituted or unsubstituted C3-C8 cycloalkyl group.

[0088] In another preferred example, R4 and R5 each independently represent a hydrogen atom, a substituted or unsubstituted C1-C3 alkyl group, or a substituted or unsubstituted C3-C7 cycloalkyl group.

[0089] In another preferred example, R4 and R5 each independently represent a hydrogen atom, a substituted or unsubstituted C1-C2 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0090] In another preferred example, R4 and R5 each independently represent a hydrogen atom, a methyl group, an ethyl group, a propyl group, or a butyl group.

[0091] In another preferred example, R4 and R5 each independently represent a hydrogen atom.

[0092] In another preferred embodiment, n represents 0, 1, 2, 3, 4, or 5.

[0093] In another preferred embodiment, n represents 1 or 2.

[0094] In another preferred embodiment, n represents 1.

[0095] In another preferred example, R6 represents a substituted or unsubstituted C6-C12 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted C3-C12 cycloalkyl group, or a substituted or unsubstituted 3-12 membered heterocycloalkyl group.

[0096] In another preferred example, R6 represents a substituted or unsubstituted C6-C10 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted C3-C8 cycloalkyl group, or a substituted or unsubstituted 3-8 membered heterocycloalkyl group.

[0097] In another preferred example, R6 represents a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-8 membered heteroaryl group, a substituted or unsubstituted C3-C8 cycloalkyl group, or a substituted or unsubstituted 3-8 membered heterocycloalkyl group.

[0098] In another preferred example, R6 represents a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-8 membered heteroaryl group, a substituted or unsubstituted C3-C8 cycloalkyl group, or a substituted or unsubstituted 3-8 membered heterocycloalkyl group.

[0099] In another preferred example, R6 represents a substituted or unsubstituted C6-C7 aryl group, a substituted or unsubstituted 5- to 7-membered heteroaryl group, a substituted or unsubstituted C5-C7 cycloalkyl group, or a substituted or unsubstituted 5- to 7-membered heterocycloalkyl group.

[0100] In another preferred example, R6 represents a substituted or unsubstituted C6 aryl group, a substituted or unsubstituted C7 aryl group, a substituted or unsubstituted C8 aryl group, a substituted or unsubstituted 6-membered heteroaryl group, a substituted or unsubstituted 7-membered heteroaryl group, or a substituted or unsubstituted 8-membered heteroaryl group.

[0101] In another preferred embodiment, R6 is JPEG2025511112000044.jpg1418; where W1 is C or N; R 12 , R 13 , R 14 and R 16 each independently represent a hydrogen atom, a halogen atom, a nitro group, an amino group, a C1-C8 alkyl group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxyl group, or a C1-C8 halogenated alkylthiol group; R 15 represents nothing, a hydrogen atom, a halogen atom, a nitro group, an amino group, a C1-C8 alkyl group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxyl group, or a C1-C8 halogenated alkylthiol group.

[0102] In another preferred embodiment, W1 is C or N.

[0103] In another preferred embodiment, when W1 is N, R 15 is nothing.

[0104] In another preferred embodiment, W1 is N and R 15 becomes null, then R 16 teeth JPEG2025511112000045.jpg1415.

[0105] In another preferred embodiment, when W1 is C, R 15 is not nothing.

[0106] In another preferred embodiment, when W1 is C, R 15 is a hydrogen atom, a halogen atom, a nitro group, an amino group, a C1-C8 alkyl group, a C1-C8 alkoxy group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxy group, or a C1-C8 halogenated alkylthiol group.

[0107] Another good example is R 12 , R 13 , R 14 and R 16 each independently represents a hydrogen atom, a halogen atom, a nitro group, an amino group, a C1-C6 alkyl group, a C1-C6 alkoxyl group, a C1-C6 alkylthiol group, a C1-C6 halogenated alkyl group, a C1-C6 halogenated alkoxyl group, or a C1-C6 halogenated alkylthiol group.

[0108] Another good example is R 12 , R 13 , R 14 and R 16 each independently represents a hydrogen atom, a halogen atom, a nitro group, an amino group, a C1-C4 alkyl group, a C1-C4 alkoxyl group, a C1-C4 alkylthiol group, a C1-C4 halogenated alkyl group, a C1-C4 halogenated alkoxyl group, or a C1-C4 halogenated alkylthiol group.

[0109] Another good example is R 12 , R 13 , R 14 and R 16 each independently represents a hydrogen atom, a halogen atom, a nitro group, an amino group, a C1-C2 alkyl group, a C1-C2 alkoxyl group, a C1-C2 alkylthiol group, a C1-C2 halogenated alkyl group, a C1-C2 halogenated alkoxyl group, or a C1-C2 halogenated alkylthiol group.

[0110] In another preferred example, the halogenated alkyl group is F3C-.

[0111] In another preferred example, the halogenated alkoxyl group is F3C-O-.

[0112] Another good example is R 12 , R 13 , R 14 and R 16 each independently represents a hydrogen atom, a halogen atom, a methyl group, an ethyl group, a propyl group, F3C-, or F3C-O-.

[0113] Another good example is R 15 represents nothing, a hydrogen atom, a halogen atom, a nitro group, an amino group, a C1-C6 alkyl group, a C1-C6 alkoxyl group, a C1-C6 alkylthiol group, a C1-C6 halogenated alkyl group, a C1-C6 halogenated alkoxyl group, or a C1-C6 halogenated alkylthiol group.

[0114] Another good example is R 15 represents nothing, a hydrogen atom, a halogen atom, a nitro group, an amino group, a C1-C4 alkyl group, a C1-C4 alkoxyl group, a C1-C4 alkylthiol group, a C1-C4 halogenated alkyl group, a C1-C4 halogenated alkoxyl group, or a C1-C4 halogenated alkylthiol group.

[0115] Another good example is R 15represents nothing, a hydrogen atom, a halogen atom, a nitro group, an amino group, a C1-C2 alkyl group, a C1-C2 alkoxyl group, a C1-C2 alkylthiol group, a C1-C2 halogenated alkyl group, a C1-C2 halogenated alkoxyl group, or a C1-C2 halogenated alkylthiol group.

[0116] Another good example is R 15 represents nothing, a hydrogen atom, a halogen atom, a methyl group, an ethyl group, a propyl group, F3C-, or F3C-O-.

[0117] In another preferred example, R7 represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a substituted or unsubstituted C3-C8 cycloalkyl group.

[0118] In another preferred example, R7 represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0119] In another preferred example, R7 represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, or a substituted or unsubstituted C3-C6 cycloalkyl group.

[0120] In another preferred example, R7 represents a hydrogen atom, a substituted or unsubstituted C1-C3 alkyl group, or a substituted or unsubstituted C3-C5 cycloalkyl group.

[0121] In another preferred example, R7 represents a hydrogen atom.

[0122] In another preferred example, R8 and R9 are joined to form a substituted or unsubstituted C3-C12 cycloalkyl ring or a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring.

[0123] In another preferred example, R8 and R9 are joined to form a substituted or unsubstituted C3-C10 cycloalkyl ring or a substituted or unsubstituted 3- to 10-membered heterocycloalkyl ring.

[0124] In another preferred example, R8 and R9 are joined to form a substituted or unsubstituted C3-C8 cycloalkyl ring or a substituted or unsubstituted 3- to 8-membered heterocycloalkyl ring.

[0125] In another preferred example, R8 and R9 are joined to form a substituted or unsubstituted C5-C8 cycloalkyl ring or a substituted or unsubstituted 5-8 membered heterocycloalkyl ring.

[0126] In another preferred example, R8 and R9 are joined to form a substituted or unsubstituted C5-C6 cycloalkyl ring or a substituted or unsubstituted 5-6 membered heterocycloalkyl ring.

[0127] In another preferred example, R8 and R9 combine to form a substituted or unsubstituted C5 cycloalkyl ring, a substituted or unsubstituted C6 cycloalkyl ring, a substituted or unsubstituted 5-membered heterocycloalkyl ring, or a substituted or unsubstituted 6-membered heterocycloalkyl ring.

[0128] In another preferred example, R8 and R9 are bonded to form a substituted or unsubstituted Form JPEG2025511112000046.jpg55.

[0129] In another preferred embodiment, the cycloalkyl ring has one, two or three C=C cyclic double bonds.

[0130] In another preferred example, R8 and R9 combine to form a substituted or unsubstituted cyclopentene or cyclohexene ring.

[0131] In another preferred embodiment, ring C represents a substituted or unsubstituted C6-C12 aryl ring, a substituted or unsubstituted C3-C12 cycloalkyl ring, a substituted or unsubstituted 3- to 12-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 12-membered heteroaryl ring.

[0132] In another preferred example, ring C represents a substituted or unsubstituted C6-C10 aryl ring, a substituted or unsubstituted C3-C10 cycloalkyl ring, a substituted or unsubstituted 3- to 10-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 10-membered heteroaryl ring.

[0133] In another preferred example, ring C represents a substituted or unsubstituted C6-C8 aryl ring, a substituted or unsubstituted C5-C10 cycloalkyl ring, a substituted or unsubstituted 5-10 membered heterocycloalkyl ring, or a substituted or unsubstituted 5-8 membered heteroaryl ring.

[0134] In another preferred example, ring C represents a substituted or unsubstituted benzene ring, a substituted or unsubstituted pyridine ring, a substituted or unsubstituted thiophene ring, a substituted or unsubstituted furan ring, or a substituted or unsubstituted thiazole ring.

[0135] In another preferred example, ring C represents a substituted or unsubstituted benzene ring, a substituted or unsubstituted thiophene ring, a substituted or unsubstituted furan ring, or a substituted or unsubstituted thiazole ring.

[0136] In another preferred example, ring C represents a substituted or unsubstituted benzene ring, a substituted or unsubstituted pyridine ring, a substituted or unsubstituted thiophene ring, a substituted or unsubstituted furan ring, or a substituted or unsubstituted thiazole ring. The optional "substitution" mentioned above refers to the replacement of one, two, or three hydrogen atoms on the atomic group with a substituent selected from a halogen atom, a methyl group, an ethyl group, a propyl group, F3C-, and F3C-O-.

[0137] In another preferred example, ring C represents a substituted or unsubstituted benzene ring, a substituted or unsubstituted thiophene ring, a substituted or unsubstituted furan ring, or a substituted or unsubstituted thiazole ring. The optional "substitution" mentioned above refers to the replacement of one, two, or three hydrogen atoms on the atomic group with a substituent selected from a halogen atom, a methyl group, an ethyl group, a propyl group, F3C-, and F3C-O-.

[0138] In another preferred embodiment, ring C is JPEG2025511112000047.jpg1620, where R 17 , R 18 , R 19 and R 20 each independently represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a C1-C6 alkoxyl group, a C1-C6 alkylthiol group, a C1-C6 halogenated alkyl group, a C1-C6 halogenated alkoxyl group, or a C1-C6 halogenated alkylthiol group.

[0139] Another good example is R 17 , R 18 , R 19 and R 20 each independently represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a C1-C6 alkoxyl group, a C1-C6 alkylthiol group, a C1-C6 halogenated alkyl group, a C1-C6 halogenated alkoxyl group, or a C1-C6 halogenated alkylthiol group.

[0140] Another good example is R 17 , R 18 , R 19 and R 20 each independently represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, a C1-C4 alkoxyl group, a C1-C4 alkylthiol group, a C1-C4 halogenated alkyl group, a C1-C4 halogenated alkoxyl group, or a C1-C4 halogenated alkylthiol group.

[0141] Another good example is R 17 , R 18 , R 19 and R 20 each independently represents a hydrogen atom, a halogen atom, a C1-C2 alkyl group, a C1-C2 alkoxyl group, a C1-C2 alkylthiol group, a C1-C2 halogenated alkyl group, a C1-C2 halogenated alkoxyl group, or a C1-C2 halogenated alkylthiol group.

[0142] In another preferred example, the halogenated alkyl group is F3C-.

[0143] In another preferred example, the halogenated alkoxyl group is F3C-O-.

[0144] Another good example is R 17 , R 18 , R 19 and R 20 each independently represents a hydrogen atom, a halogen atom, a methyl group, an ethyl group, a propyl group, F3C-, or F3C-O-.

[0145] In another preferred embodiment, ring C is JPEG2025511112000048.jpg1317, where a or b indicates " JPEG2025511112000049.jpg13" binding site binds to R9.

[0146] In another preferred embodiment, the " JPEG2025511112000050.jpg13" The binding site binds to C attached to -C(O)-.

[0147] Another preferred example is JPEG2025511112000051.jpg1315 is JPEG2025511112000052.jpg1616 or JPEG2025511112000053.jpg1617.

[0148] In another preferred embodiment, ring C is JPEG2025511112000054.jpg1316, where W2 is CH2, NH, O or S; W3 is C or N; R 21 represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group; R 22 represents nothing, a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0149] In another preferred example, W2 is O or S.

[0150] In another preferred example, W3 is C or N.

[0151] In another preferred embodiment, when W3 is N, R 22 is nothing.

[0152] In another preferred embodiment, when W3 is N, R 22 becomes nothing, and the ring C is JPEG2025511112000055.jpg1613.

[0153] In another preferred example, when W3 is C, R 22 is not nothing.

[0154] In another preferred example, when W3 is C, R 22 is a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0155] Another good example is R 21 represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0156] Another good example is R 21 represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0157] Another good example is R 21 represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, or a C3-C6 cycloalkyl group.

[0158] Another good example is R 21 represents a hydrogen atom, a halogen atom, a C1-C2 alkyl group, or a C3-C6 cycloalkyl group.

[0159] Another good example is R 21represents a hydrogen atom, a halogen atom (for example, a fluorine atom or a chlorine atom) or a methyl group.

[0160] Another good example is R 21 represents a hydrogen atom, a fluorine atom, a chlorine atom, or a methyl group.

[0161] Another good example is R 22 represents nothing, a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0162] Another good example is R 22 represents nothing, a hydrogen atom, a halogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0163] Another good example is R 22 represents nothing, a hydrogen atom, a halogen atom, a C1-C4 alkyl group, or a C3-C6 cycloalkyl group.

[0164] Another good example is R 22 represents nothing, a hydrogen atom, a halogen atom, a C1-C2 alkyl group, or a C3-C6 cycloalkyl group.

[0165] Another good example is R 22 represents zero, a hydrogen atom, a halogen atom (for example, a fluorine atom or a chlorine atom), or a methyl group.

[0166] Another good example is R 22 represents zero, a hydrogen atom, a fluorine atom, a chlorine atom or a methyl group.

[0167] In another preferred embodiment, ring C is JPEG2025511112000056.jpg1517, where c or d indicates " JPEG2025511112000057.jpg13" binding site binds to R9.

[0168] In another preferred embodiment, the " JPEG2025511112000058.jpg13" The binding site binds to C attached to -C(O)-.

[0169] Another preferred example is The chemical structure of JPEG2025511112000059.jpg1214 is JPEG2025511112000060.jpg1718 or JPEG2025511112000061.jpg1815.

[0170] Another preferred example is JPEG2025511112000062.jpg1416 JPEG2025511112000063.jpg1618, wherein R7 and ring C are each independently as defined above; R 23 , R 24 , R 25 and R 26 each independently represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0171] Another good example is R 23 , R 24 , R 25 and R 26 each independently represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0172] Another good example is R 23 , R 24 , R 25 and R 26 each independently represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, or a C3-C6 cycloalkyl group.

[0173] Another good example is R 23 , R 24 , R 25 and R 26each independently represents a hydrogen atom, a halogen atom, a C1-C2 alkyl group, or a C3-C6 cycloalkyl group.

[0174] Another good example is R 23 , R 24 , R 25 and R 26 each independently represents a hydrogen atom.

[0175] Another preferred example is JPEG2025511112000064.jpg1618 is JPEG2025511112000065.jpg2018 or JPEG2025511112000066.jpg2119.

[0176] Another preferred example is JPEG2025511112000067.jpg1517 is JPEG2025511112000068.jpg2018 or JPEG2025511112000069.jpg2119, Here, R7, R 17 , R 18 , R 19 , R 20 , R 23 , R 24 , R 25 and R 26 are each independently as defined above.

[0177] Another preferred example is JPEG2025511112000070.jpg1517 is JPEG2025511112000071.jpg1920 or JPEG2025511112000072.jpg1917.

[0178] Another preferred example is JPEG2025511112000073.jpg1517 JPEG2025511112000074.jpg1717 or JPEG2025511112000075.jpg1715, Here, R7, R 21 , R 22 , R 23 , R 24 , R 25 , R 26 , W2 and W3 are each independently as defined above.

[0179] In another preferred embodiment, the chemical structure of ring C is: JPEG2025511112000076.jpg1011, JPEG2025511112000077.jpg117, JPEG2025511112000078.jpg118, JPEG2025511112000079.jpg98, JPEG2025511112000080.jpg116, JPEG2025511112000081.jpg87, JPEG2025511112000082.jpg87, JPEG2025511112000083.jpg117, JPEG2025511112000084.jpg1010, JPEG2025511112000085.jpg107, JPEG2025511112000086.jpg79, JPEG2025511112000087.jpg810

[0180] Another good example is R 10 and R 11each independently represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, a substituted or unsubstituted C2-C7 acyl group, a substituted or unsubstituted C6-C12 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted C6-C12 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C6-C12 aryl group-C(O)-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-; or R 10 and R 11 are joined to form a substituted or unsubstituted C3-C10 cycloalkyl ring, a substituted or unsubstituted 5-12 membered heterocycloalkyl ring, or a substituted or unsubstituted 5-12 membered heteroaryl ring.

[0181] Another good example is R 10 and R 11 each independently represents a hydrogen atom, a substituted or unsubstituted C1-C6 alkyl group, a substituted or unsubstituted C2-C5 acyl group, a substituted or unsubstituted C6-C10 aryl group, a substituted or unsubstituted 5-10 membered heteroaryl group, a substituted or unsubstituted C6-C10 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C6-C10 aryl group-C(O)-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted 5-10 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-; or R 10 and R 11 are joined to form a substituted or unsubstituted C3-C10 cycloalkyl ring, a substituted or unsubstituted 5-12 membered heterocycloalkyl ring, or a substituted or unsubstituted 5-12 membered heteroaryl ring.

[0182] Another good example is R 10 and R 11each independently represents a hydrogen atom, a substituted or unsubstituted C1-C4 alkyl group, a substituted or unsubstituted C2-C5 acyl group, a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-8 membered heteroaryl group, a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C4 alkyl group-, a substituted or unsubstituted C6-C8 aryl group-C(O)-substituted or unsubstituted C1-C4 alkyl group-, or a substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C4 alkyl group-; or R 10 and R 11 are joined to form a substituted or unsubstituted C3-C10 cycloalkyl ring, a substituted or unsubstituted 5-10 membered heterocycloalkyl ring, or a substituted or unsubstituted 5-10 membered heteroaryl ring.

[0183] Another good example is R 10 and R 11 each independently represent a hydrogen atom, a substituted or unsubstituted C1-C2 alkyl group, a substituted or unsubstituted C2-C5 acyl group, a substituted or unsubstituted C6-C8 aryl group, a substituted or unsubstituted 5-8 membered heteroaryl group, a substituted or unsubstituted C6-C8 aryl group-substituted or unsubstituted C1-C2 alkyl group-, a substituted or unsubstituted C6-C8 aryl group-C(O)-substituted or unsubstituted C1-C2 alkyl group-, or a substituted or unsubstituted 5-8 membered heteroaryl group-substituted or unsubstituted C1-C2 alkyl group-; or R 10 and R 11 are linked to form a substituted or unsubstituted C5-C8 cycloalkyl ring, a substituted or unsubstituted 5-10 membered heterocycloalkyl ring, or a substituted or unsubstituted 5-10 membered heteroaryl ring.

[0184] Another good example is R 10 and R 11each independently represents a hydrogen atom, a substituted or unsubstituted methyl group, a substituted or unsubstituted acetyl group, a substituted or unsubstituted propionyl group, a substituted or unsubstituted butyryl group, a substituted or unsubstituted phenyl group-substituted or unsubstituted methyl group-, a substituted or unsubstituted pyridine group-substituted or unsubstituted methyl group-, or a substituted or unsubstituted phenyl group-C(O)-substituted or unsubstituted methyl group-; or R 10 and R 11 are linked to form a substituted or unsubstituted indoli ring, a substituted or unsubstituted indole ring, or a substituted or unsubstituted piperidine ring.

[0185] Another good example is R 10 and R 11 each independently represents a hydrogen atom, methyl, acetyl, propionyl, butyryl, phenyl-methyl, pyridine-methyl, methyl-pyridine-methyl, phenyl-C(O)-methyl, or methyl-phenyl-C(O)-methyl; or R 10 and R 11 are linked to form an indole ring, an indole ring, or a piperidine ring.

[0186] In another preferred embodiment, the butyryl group has the following chemical structure: JPEG2025511112000088.jpg610 or JPEG2025511112000089.jpg66.

[0187] In another preferred example, the substituted or unsubstituted pyridine group-substituted or unsubstituted methyl group- is a pyridine group-methyl group- monosubstituted with a methyl group.

[0188] In another preferred example, the chemical structure of the substituted or unsubstituted pyridine group - substituted or unsubstituted methyl group - is as follows: JPEG2025511112000090.jpg910, JPEG2025511112000091.jpg711, JPEG2025511112000092.jpg710, JPEG2025511112000093.jpg98

[0189] In another preferred example, the chemical structure of the methyl group-phenyl group-C(O)-methyl group- is as follows: JPEG2025511112000094.jpg714

[0190] In another preferred example, the butyl group is an n-butyl group.

[0191] In another preferred example, the butyl group is JPEG2025511112000095.jpg39.

[0192] In another preferred embodiment, the amyl group is an n-amyl group.

[0193] In another preferred embodiment, the amyl group is JPEG2025511112000096.jpg311.

[0194] In another preferred embodiment, the chemical structure of the phenyl group-ethyl group is JPEG2025511112000097.jpg69.

[0195] In another preferred embodiment, the chemical structure of the phenyl group-propyl group is JPEG2025511112000098.jpg79.

[0196] In another preferred example, the halogen atom refers to a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

[0197] In another preferred example, the aryl group is a phenyl group or a naphthoyl group.

[0198] In another preferred example, the halogenation refers to 1-position halogenation, 2-position halogenation, 3-position halogenation or total halogenation.

[0199] In another preferred example, the halogenation refers to fluorination, chlorination, bromination or iodination.

[0200] In another preferred example, the deuteration refers to 1-position deuteration, 2-position deuteration, 3-position deuteration, or total deuteration.

[0201] In another preferred embodiment, the chemical structure of the compound of formula I is as follows: JPEG2025511112000099.jpg1924 I-2

[0202] wherein R1 and R3 are each independently as defined above; R 27 , R 28 , R 29 , R 30 , R 31 , R 32 and R 33 each independently represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0203] Another good example is R 27 , R 28 , R 29 , R 30 , R 31 , R 32 and R 33 each independently represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0204] Another good example is R 27 , R 28 , R 29 , R 30 , R 31 , R 32 and R 33 each independently represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, or a C3-C6 cycloalkyl group.

[0205] Another good example is R 27 , R 28 , R 29 , R30 , R 31 , R 32 and R 33 each independently represents a hydrogen atom.

[0206] In another preferred embodiment, the chemical structure of the compound of formula I is as shown in formula I-3. JPEG2025511112000100.jpg1822 I-3

[0207] wherein R1 and R3 are each independently as defined above; R 34 , R 35 , R 36 , R 37 , R 38 , R 39 and R 40 each independently represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0208] Another good example is R 34 , R 35 , R 36 , R 37 , R 38 , R 39 and R 40 each independently represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0209] Another good example is R 34 , R 35 , R 36 , R 37 , R 38 , R 39 and R 40 each independently represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, or a C3-C8 cycloalkyl group.

[0210] Another good example is R 34 , R 35 , R 36 , R 37 , R 38 , R 39 and R40 each independently represents a hydrogen atom.

[0211] In another preferred embodiment, the chemical structure of the compound of formula I is as follows: I-4-1 or I-4-2. JPEG2025511112000101.jpg1924I-4-1, or JPEG2025511112000102.jpg1924 I-4-2

[0212] wherein R1 and R3 are each independently as defined above; W4 is C or N; R 41 , R 42 , R 44 and R 45 each independently represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group; R 43 represents nothing, a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0213] In another preferred example, W4 is C or N.

[0214] In another preferred embodiment, when W4 is N, R 43 is nothing.

[0215] In another preferred embodiment, when W4 is C, R 43 is not nothing.

[0216] In another preferred embodiment, when W4 is C, R 43 represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0217] In another preferred embodiment, when W4 is N, R 43 is nothing, and the chemical structural formula of formula I-4-1 is as follows: I-4-1-1. JPEG2025511112000103.jpg1924 I-4-1-1

[0218] In another preferred embodiment, when W4 is N, R 43 is nothing, and the chemical structural formula of formula I-4-2 is as follows: formula I-4-2-1. JPEG2025511112000104.jpg1924 I-4-2-1

[0219] Another good example is R 41 , R 42 , R 44 and R 45 each independently represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0220] Another good example is R 41 , R 42 , R 44 and R 45 each independently represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0221] Another good example is R 41 , R 42 , R 44 and R 45 each independently represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, or a C3-C8 cycloalkyl group.

[0222] Another good example is R 41 , R 42 , R 44 and R 45 each independently represents a hydrogen atom, an ethyl group, a halogen atom (for example, a fluorine atom, a chlorine atom, or a bromine atom), or a methyl group.

[0223] Another good example is R 43 represents nothing, a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0224] Another good example is R 43 represents nothing, a hydrogen atom, a halogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0225] Another good example is R 43 represents nothing, a hydrogen atom, a halogen atom, a C1-C4 alkyl group, or a C3-C8 cycloalkyl group.

[0226] Another good example is R 43 represents nothing, a hydrogen atom, an ethyl group, a halogen atom (for example, a fluorine atom, a chlorine atom, or a bromine atom), or a methyl group.

[0227] In another preferred embodiment, the chemical structure of the compound of formula I is as shown in formula I-5. JPEG2025511112000105.jpg2227I-5

[0228] wherein R1 and R3 are each independently as defined above; R 46 , R 47 , R 48 , R 49 and R 50 each independently represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0229] Another good example is R 46 , R 47 , R 48 , R 49 and R 50 each independently represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0230] Another good example is R 46 , R 47 , R 48 , R 49 and R 50 each independently represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, or a C3-C8 cycloalkyl group.

[0231] Another good example is R 46 , R 47 , R 48 , R 49 and R 50 each independently represents a hydrogen atom, a halogen atom, a C1-C2 alkyl group, or a C3-C8 cycloalkyl group.

[0232] Another good example is R 46 , R 47 , R 48 , R 49 and R 50 each independently represents a hydrogen atom, a methyl group, or a halogen atom (for example, a fluorine atom, a chlorine atom).

[0233] In another preferred embodiment, the chemical structure of the compound of formula I is as shown in formula I-6. JPEG2025511112000106.jpg2129 Formula I-6

[0234] wherein R1 and R3 are each independently as defined above; W5 is C or N; R 51 , R 52 , R 54 , R 55 , R 56 , R 57 , R 58 and R 59 each independently represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group; R 53 represents nothing, a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0235] In another preferred example, W5 is C or N.

[0236] In another preferred embodiment, when W5 is N, R 53 is nothing.

[0237] In another preferred embodiment, when W5 is C, R 53 is not nothing.

[0238] In another preferred embodiment, when W5 is C, R 53 represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0239] In another preferred embodiment, when W5 is N, R 53 is nothing, and the chemical structural formula of formula I-6 is as follows: formula I-6-1. JPEG2025511112000107.jpg2231 I-6-1

[0240] Another good example is R 51 , R 52 , R 54 , R 55 , R 56 , R 57 , R 58 and R 59 each independently represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0241] Another good example is R 51 , R 52 , R 54 , R 55 , R 56 , R 57 , R 58 and R 59 each independently represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, or a C3-C8 cycloalkyl group.

[0242] Another good example is R 51 , R 52 , R 54 , R 55 , R 56 , R 57 , R 58 and R 59each independently represents a hydrogen atom, a halogen atom, a C1-C2 alkyl group, or a C3-C8 cycloalkyl group.

[0243] Another good example is R 51 , R 52 , R 54 , R 55 , R 56 , R 57 , R 58 and R 59 each independently represents a hydrogen atom or a methyl group.

[0244] Another good example is R 53 represents nothing, a hydrogen atom, a halogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0245] Another good example is R 53 represents nothing, a hydrogen atom, a halogen atom, a C1-C4 alkyl group, or a C3-C8 cycloalkyl group.

[0246] Another good example is R 53 represents nothing, a hydrogen atom, a halogen atom, a C1-C2 alkyl group, or a C3-C8 cycloalkyl group.

[0247] Another good example is R 53 represents nothing, a hydrogen atom, or a methyl group.

[0248] In another preferred embodiment, the chemical structure of the compound of formula I is as follows: Formula I-7. JPEG2025511112000108.jpg2324 I-7

[0249] wherein R1 and R2 are each independently as defined above; W6 is C or N; R 60 and R 63 each independently represents a hydrogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group; R 61and R 62 each independently represents zero, a hydrogen atom, a halogen atom, a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxy group, or a C1-C8 halogenated alkylthiol group; or R 61 and R 62 is combined JPEG2025511112000109.jpg1415 form; R 64 , R 65 , R 66 and R 67 each independently represents a hydrogen atom, a C1-C8 alkyl group, or a C3-C8 cycloalkyl group.

[0250] In another preferred example, W6 is C or N.

[0251] In another preferred embodiment, when W6 is N, R 62 is nothing.

[0252] In another preferred embodiment, when W6 is C, R 62 is not nothing.

[0253] In another preferred embodiment, when W6 is C, R 62 represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxy group, or a C1-C8 halogenated alkylthiol group; or R 61 and R 62 is combined Form JPEG2025511112000110.jpg1314.

[0254] In another preferred embodiment, when W6 is N, R 62 is nothing, and the chemical structural formula of formula I-7 is as follows: formula I-7-1. JPEG2025511112000111.jpg1519 I-7-1

[0255] In another preferred embodiment, when W6 is C, R 62 The chemical structure of formula I-7 is shown in formula I-7-2 below. JPEG2025511112000112.jpg1717 I-7-2

[0256] Another good example is R 60 and R 63 each independently represents a hydrogen atom, a C1-C6 alkyl group, or a C3-C6 cycloalkyl group.

[0257] Another good example is R 60 and R 63 each independently represents a hydrogen atom, a C1-C4 alkyl group, or a C3-C6 cycloalkyl group.

[0258] Another good example is R 60 and R 63 each independently represents a hydrogen atom, a C1-C2 alkyl group, or a C3-C6 cycloalkyl group.

[0259] Another good example is R 60 and R 63 each independently represents a hydrogen atom or a methyl group.

[0260] Another good example is R 61 and R 62 each independently represents zero, a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a C3-C8 cycloalkyl group, a C1-C6 halogenated alkyl group, a C1-C6 halogenated alkoxyl group, or a C1-C6 halogenated alkylthiol group; or R 61 and R 62 is combined Form JPEG2025511112000113.jpg1415.

[0261] Another good example is R 61 and R 62each independently represents zero, a hydrogen atom, a halogen atom, a C1-C4 alkyl group, a C3-C6 cycloalkyl group, a C1-C4 halogenated alkyl group, a C1-C4 halogenated alkoxy group, or a C1-C4 halogenated alkylthiol group; or R 61 and R 62 is combined Form JPEG2025511112000114.jpg1415.

[0262] Another good example is R 61 and R 62 each independently represents zero, a hydrogen atom, a halogen atom, a C1-C3 alkyl group, a C3-C6 cycloalkyl group, a C1-C3 halogenated alkyl group, a C1-C3 halogenated alkoxyl group, or a C1-C3 halogenated alkylthiol group; or R 61 and R 62 is combined Form JPEG2025511112000115.jpg1415.

[0263] Another good example is R 61 and R 62 each independently represents zero, a hydrogen atom, a methyl group, an ethyl group, a propyl group, or a cyclopropyl group; or R 61 and R 62 is combined Form JPEG2025511112000116.jpg1415.

[0264] Another good example is R 61 and R 62 are combined When forming JPEG2025511112000117.jpg1415, the chemical structure of Formula I-7 is as follows: Formula I-7-3. JPEG2025511112000118.jpg1817 Formula I-7-3

[0265] Another good example is R 64 , R 65 , R 66 and R67 each independently represents a hydrogen atom, a C1-C6 alkyl group, or a C3-C8 cycloalkyl group.

[0266] Another good example is R 64 , R 65 , R 66 and R 67 each independently represents a hydrogen atom, a C1-C4 alkyl group, or a C3-C8 cycloalkyl group.

[0267] Another good example is R 64 , R 65 , R 66 and R 67 each independently represents a hydrogen atom, a C1-C2 alkyl group, or a C3-C8 cycloalkyl group.

[0268] In another preferred example, the propyl group is an n-propyl group or an isopropyl group.

[0269] In another preferred example, the propyl group is JPEG2025511112000119.jpg37 or JPEG2025511112000120.jpg55.

[0270] In another preferred embodiment, the chemical structure of the compound of formula I is as follows: Formula I-8. JPEG2025511112000121.jpg3027 I-8

[0271] wherein R1 and R3 are each independently as defined above; W7 is C or N; W8 is C or N; R 69 , R 70 and R 71each independently represent a hydrogen atom, a halogen atom, a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxyl group, or a C1-C8 halogenated alkylthiol group; R 68 and R 72 each independently represents nothing, a hydrogen atom, a halogen atom, a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxyl group, or a C1-C8 halogenated alkylthiol group.

[0272] In another preferred example, W7 is C or N.

[0273] In another preferred example, W8 is C or N.

[0274] In another preferred embodiment, when W7 is N, R 68 is nothing.

[0275] In another preferred example, when W7 is C, R 68 is not nothing.

[0276] In another preferred example, when W7 is C, R 68 represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxyl group, or a C1-C8 halogenated alkylthiol group.

[0277] In another preferred embodiment, when W8 is N, R 72 is nothing.

[0278] In another preferred example, when W8 is C, R 72 is not nothing.

[0279] In another preferred example, when W8 is C, R 72represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxyl group, or a C1-C8 halogenated alkylthiol group.

[0280] In another preferred example, W7 is N and W8 is C.

[0281] In another preferred example, when W7 is N and W8 is C, the chemical structure of formula I-8 is as follows: I-8-1. JPEG2025511112000122.jpg2022 I-8-1

[0282] In another preferred example, W7 is C and W8 is N.

[0283] In another preferred example, when W7 is C and W8 is N, the chemical structure of formula I-8 is as follows: I-8-2. JPEG2025511112000123.jpg2422 I-8-2

[0284] Another good example is R 69 , R 70 and R 71 each independently represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a C3-C8 cycloalkyl group, a C1-C6 halogenated alkyl group, a C1-C6 halogenated alkoxyl group, or a C1-C6 halogenated alkylthiol group.

[0285] Another good example is R 69 , R 70 and R 71 each independently represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, a C3-C8 cycloalkyl group, a C1-C4 halogenated alkyl group, a C1-C4 halogenated alkoxyl group, or a C1-C4 halogenated alkylthiol group.

[0286] Another good example is R 69 , R 70 and R 71 each independently represents a hydrogen atom, a halogen atom, a C1-C2 alkyl group, a C3-C8 cycloalkyl group, a C1-C2 halogenated alkyl group, a C1-C2 halogenated alkoxyl group, or a C1-C2 halogenated alkylthiol group.

[0287] Another good example is R 69 , R 70 and R 71 each independently represents a hydrogen atom, a methyl group, or a halogen atom (for example, a chlorine atom, a bromine atom).

[0288] Another good example is R 68 and R 72 each independently represents nothing, a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a C3-C8 cycloalkyl group, a C1-C6 halogenated alkyl group, a C1-C6 halogenated alkoxyl group, or a C1-C6 halogenated alkylthiol group.

[0289] Another good example is R 68 and R 72 each independently represents nothing, a hydrogen atom, a halogen atom, a C1-C4 alkyl group, a C3-C8 cycloalkyl group, a C1-C4 halogenated alkyl group, a C1-C4 halogenated alkoxyl group, or a C1-C4 halogenated alkylthiol group.

[0290] Another good example is R 68 and R 72 each independently represents zero, a hydrogen atom, a halogen atom, a C1-C2 alkyl group, a C3-C8 cycloalkyl group, a C1-C2 halogenated alkyl group, a C1-C2 halogenated alkoxyl group, or a C1-C2 halogenated alkylthiol group.

[0291] Another good example is R 68 and R 72 each independently represents zero, a hydrogen atom, a methyl group, or a halogen atom (for example, a chlorine atom, a bromine atom).

[0292] In another preferred embodiment, the chemical structure of the compound of formula I is as follows: Formula I-9. JPEG2025511112000124.jpg2125 I-9

[0293] wherein R1 and R3 are each independently as defined above; R 73 , R 74 , R 75 , R 76 and R 77 each independently represents a hydrogen atom, a halogen atom, a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C1-C8 halogenated alkoxyl group, or a C1-C8 halogenated alkylthiol group.

[0294] Another good example is R 73 , R 74 , R 75 , R 76 and R 77 each independently represents a hydrogen atom, a halogen atom, a C1-C6 alkyl group, a C3-C8 cycloalkyl group, a C1-C6 halogenated alkyl group, a C1-C6 halogenated alkoxyl group, or a C1-C6 halogenated alkylthiol group.

[0295] Another good example is R 73 , R 74 , R 75 , R 76 and R 77 each independently represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, a C3-C8 cycloalkyl group, a C1-C4 halogenated alkyl group, a C1-C4 halogenated alkoxyl group, or a C1-C4 halogenated alkylthiol group.

[0296] Another good example is R 73 , R 74 , R 75 , R 76 and R 77each independently represents a hydrogen atom, a halogen atom, a C1-C4 alkyl group, a C3-C8 cycloalkyl group, a C1-C2 halogenated alkyl group, a C1-C2 halogenated alkoxyl group, or a C1-C2 halogenated alkylthiol group.

[0297] In another preferred embodiment, the pharmaceutically acceptable salts of the compounds of formula I include salts formed by the compounds of formula I with acids.

[0298] In another preferred example, the acid comprises one or more of hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid.

[0299] In another preferred example, the pharmaceutically acceptable salts of the compounds of formula I include salts formed by the compounds of formula I with one or more of hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, and glutamic acid.

[0300] In another preferred example, the pharmaceutically acceptable salts of the compounds of formula I include salts formed by the compounds of formula I with hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, or glutamic acid.

[0301] In another preferred embodiment, the base of the pharmaceutically acceptable salt of the compound of formula I is a pharmaceutically acceptable salt of the compound of formula I, wherein the acid is one H + This includes bases formed by loss of

[0302] In another preferred example, the base of the pharmaceutically acceptable salt of the compound of formula I comprises a base formed by the loss of one H from hydrochloric acid, galactaric acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, benzenesulfonic acid, aspartic acid, or glutamic acid.

[0303] In another preferred embodiment, the base of the pharmaceutically acceptable salt of the compound of formula I is F - , Cl - , Br - , I - , H.C.O.O. - , CH3COO - , CF3COO - , SO4 2- or NO3 - Includes:

[0304] In another preferred embodiment, the chemical structure of the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, is as follows: JPEG2025511112000125.jpg66166JPEG2025511112000126.jpg233167JPEG2025 511112000127.jpg227155JPEG2025511112000128.jpg236166JPEG20255111120 00129.jpg237167JPEG2025511112000130.jpg225165JPEG2025511112000131.j pg227168JPEG2025511112000132.jpg233168JPEG2025511112000133.jpg238167 JPEG2025511112000134.jpg233166JPEG2025511112000135.jpg236160JPEG202 5511112000136.jpg222167JPEG2025511112000137.jpg227167JPEG20255111120 00138.jpg218164JPEG2025511112000139.jpg235165JPEG2025511112000140.j pg228167JPEG2025511112000141.jpg222166JPEG2025511112000142.jpg216167

[0305] A second aspect of the present invention provides (a) a composition comprising said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0306] In another preferred example, the content of (a) the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, relative to the total weight of the composition is 0.001-99.9 wt%.

[0307] In another preferred embodiment, the composition is a pharmaceutical composition.

[0308] In another preferred embodiment, the composition further comprises (b) a pharmaceutically acceptable carrier.

[0309] In another preferred embodiment, the composition or formulation further comprises a pharmaceutically acceptable carrier.

[0310] In another preferred embodiment, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0311] In another preferred embodiment, the type of the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0312] In another preferred embodiment, the composition or preparation is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill, or a film.

[0313] A third aspect of the present invention provides the use of the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, for the manufacture of a composition or formulation for use in the prevention and / or treatment of tumors.

[0314] In another preferred embodiment, the tumor is of human origin.

[0315] In another preferred embodiment, the tumor is a human tumor.

[0316] In another preferred embodiment, the tumor comprises a tumor in which the mitochondrial permeability transition pore is underexpressed, not expressed, underactivated, or inactivated.

[0317] In another preferred embodiment, the tumor comprises a tumor in which peptidyl prolyl isomerase F is underexpressed, not expressed, underactivated or inactivated.

[0318] In another preferred example, peptidylprolyl isomerase F has the protein number UniProtKB / Swiss-Prot: P30405 and the gene number NCBI Entrez Gene: 10105.

[0319] In another preferred embodiment, the tumor comprises a tumor in which the NNMT gene is underexpressed or not expressed.

[0320] In another preferred embodiment, the tumor comprises a tumor in which DNA methyltransferase is highly expressed.

[0321] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0322] In another preferred embodiment, the tumor comprises a tumor in which DNMT1 is highly expressed.

[0323] In another preferred embodiment, the tumor comprises a tumor in which DNMT3a is highly expressed.

[0324] In another preferred embodiment, the tumor comprises a tumor in which DNMT3b is highly expressed.

[0325] In another preferred embodiment, the tumor comprises a tumor in which UHRF1 is highly expressed.

[0326] In another preferred embodiment, the tumor comprises a tumor with hypermethylation of nucleotide sites in the NNMT gene and / or hypermethylation of DNA CpG sites in the NNMT gene region.

[0327] In another preferred embodiment, the tumor comprises a tumor in which the nucleotide site in the NNMT gene is hypermethylated.

[0328] In another preferred embodiment, said methylation of a nucleotide site in the NNMT gene refers to methylation of a nucleotide site of cytosine in the NNMT gene.

[0329] In another preferred embodiment, said methylation of the nucleotide site in the NNMT gene refers to methylation of cytosine at the nucleotide in the NNMT gene.

[0330] In another preferred embodiment, said methylation of the nucleotide site in the NNMT gene refers to methylation of the carbon atom at position 5 on the cytosine of the nucleotide in the NNMT gene.

[0331] In another preferred embodiment, the tumor comprises a tumor in which DNA CpG sites in the NNMT gene region are hypermethylated.

[0332] In another preferred embodiment, the methylation of the NNMT gene region DNA CpG site refers to the methylation of the cytosine nucleotide site of the NNMT gene region DNA CpG site.

[0333] In another preferred embodiment, the methylation of the NNMT gene region DNA CpG site refers to the methylation of the cytosine of the nucleotide of the NNMT gene region DNA CpG site.

[0334] In another preferred embodiment, the methylation of the NNMT gene region DNA CpG site refers to methylation of the fifth carbon atom on the cytosine of the nucleotide of the NNMT gene region DNA CpG site.

[0335] In another preferred embodiment, the NNMT gene is a human-derived NNMT gene.

[0336] In another preferred embodiment, the NNMT gene is a human NNMT gene.

[0337] In another preferred embodiment, the tumor in which the mitochondrial permeability transition pore is underexpressed or underactivated refers to a tumor in which the expression level or activity of the mitochondrial permeability transition pore in tumor cells is lower than the expression level or activity of the mitochondrial permeability transition pore in similar cells or normal cells (e.g., cancerous bladder tissue cells).

[0338] In another preferred embodiment, the tumor in which the mitochondrial permeability transition pore is underexpressed or underactivated refers to a tumor in which the ratio (H1 / H0) between the expression level or activity H1 of the mitochondrial permeability transition pore in a certain cell (e.g., a tumor cell) and the expression level or activity H0 of the mitochondrial permeability transition pore in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.8, and more preferably ≦0.7, ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001, or ≦0.0000001.

[0339] In another preferred embodiment, the certain cells include tumor cells.

[0340] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0341] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0342] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0343] In another preferred embodiment, the allogeneic cells refer to cells (allogeneic tumor cells) in which the mitochondrial permeability transition pore is normally expressed, highly expressed, normally activated, or highly activated.

[0344] In another preferred embodiment, the homologous cells refer to cells of the same type, but in which the mitochondrial permeability transition pore is normally expressed, highly expressed, or normally activated or highly activated.

[0345] In another preferred example, the normal cells refer to normal tissue cells (for example, cells derived from tumor cells, cells adjacent to tumors, or cancerous bladder tissue cells).

[0346] In another preferred embodiment, the normal cells refer to normal tissue cells (e.g., tumor cell-derived cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which the mitochondrial permeability transition pore is normally expressed or normally activated.

[0347] In another preferred embodiment, H0 represents the expression level or activity of the mitochondrial permeability transition pore of a cell in which the mitochondrial permeability transition pore is normally expressed, highly expressed, normally activated, or highly activated.

[0348] In another preferred embodiment, the cells in which the mitochondrial permeability transition pore is normally expressed, highly expressed, normally activated, or highly activated include cells that are insensitive to the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0349] In another preferred embodiment, the tumor in which peptidylprolyl isomerase F is underexpressed or underactivated refers to a tumor in which the expression level or activity of peptidylprolyl isomerase F in tumor cells is lower than the expression level or activity of peptidylprolyl isomerase F in related cells or normal cells (e.g., cancerous bladder tissue cells).

[0350] In another preferred embodiment, the tumor in which peptidyl prolyl isomerase F is underexpressed or underactivated refers to a tumor in which the ratio (G1 / G0) between the expression level or activity G1 of peptidyl prolyl isomerase F in a certain cell (e.g., a tumor cell) and the expression level or activity G0 of peptidyl prolyl isomerase F in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.8, and more preferably ≦0.7, ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001, or ≦0.0000001.

[0351] In another preferred embodiment, the certain cells include tumor cells.

[0352] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0353] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0354] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0355] In another preferred embodiment, the allogeneic cells refer to cells in which peptidylprolyl isomerase F is normally expressed, highly expressed, normally activated, or highly activated (allogeneic tumor cells).

[0356] In another preferred embodiment, the allogeneic cells refer to cells of the same type, but in which peptidylprolyl isomerase F is normally expressed, highly expressed, normally activated or highly activated.

[0357] In another preferred example, the normal cells refer to normal tissue cells (for example, cells derived from tumor cells, cells adjacent to tumors, or cancerous bladder tissue cells).

[0358] In another preferred embodiment, the normal cells refer to normal tissue cells in which peptidylprolyl isomerase F is normally expressed or activated (e.g., cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0359] In another preferred embodiment, G0 represents the expression level or activity of peptidyl prolyl isomerase F in cells in which peptidyl prolyl isomerase F is normally expressed, highly expressed, normally activated, or highly activated.

[0360] In another preferred embodiment, the cells in which peptidylprolyl isomerase F is normally expressed, highly expressed, normally activated, or highly activated include cells that are insensitive to the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0361] In another preferred example, the tumor in which the NNMT gene is underexpressed or not expressed refers to a tumor in which NNMT protein cannot be detected with an NNMT antibody in 1 μg of protein extracted from the tumor, more preferably a tumor in which NNMT protein cannot be detected with an NNMT antibody in 5 μg of protein extracted from the tumor, more preferably a tumor in which NNMT protein cannot be detected with an NNMT antibody in 10 μg of protein extracted from the tumor, more preferably a tumor in which NNMT protein cannot be detected with an NNMT antibody in 100 μg of protein extracted from the tumor, and more preferably a tumor in which NNMT protein cannot be detected with an NNMT antibody in 1000 μg of protein extracted from the tumor.

[0362] In another preferred example, the tumor in which the NNMT gene is underexpressed or not expressed refers to a tumor in which the expression level of the NNMT gene in tumor cells is lower than the expression level of the NNMT gene in related cells or normal cells (e.g., cancerous bladder tissue cells).

[0363] In another preferred example, the tumor in which the NNMT gene is underexpressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in tumor cells and the expression level E0 of the NNMT gene in related cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0.

[0364] In another preferred embodiment, the tumor in which the NNMT gene is underexpressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0365] In another preferred embodiment, the certain cells include tumor cells.

[0366] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0367] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0368] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0369] In another preferred embodiment, the allogeneic cells refer to cells in which the NNMT gene is normally expressed or highly expressed (allogeneic tumor cells).

[0370] In another preferred embodiment, the allogeneic cells refer to cells of the same type, but in which the NNMT gene is normally or highly expressed.

[0371] In another preferred example, the normal cells refer to normal tissue cells (for example, cells derived from tumor cells, cells adjacent to tumors, or cancerous bladder tissue cells).

[0372] In another preferred embodiment, the normal cells refer to normal tissue cells in which the NNMT gene is normally expressed (for example, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0373] In another preferred embodiment, E0 is the expression level of the NNMT gene in cells in which the NNMT gene is normally expressed or highly expressed.

[0374] In another preferred embodiment, the cells in which the NNMT gene is normally expressed or highly expressed include cells that are insensitive to the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0375] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed refers to a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 5 μg of protein extracted from the tumor, even more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 1 μg of protein extracted from the tumor, even more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.2 μg of protein extracted from the tumor, even more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.05 μg of protein extracted from the tumor, and even more preferably a tumor in which DNA methyltransferase can be detected with a DNA methyltransferase antibody in 0.01 μg of protein extracted from the tumor.

[0376] In another preferred embodiment, the tumor with high expression of DNA methyltransferase refers to a tumor in which the expression level of DNA methyltransferase in tumor cells is greater than the expression level of DNA methyltransferase in related cells or normal cells (e.g., cancerous bladder tissue cells).

[0377] In another preferred embodiment, the tumor with high expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in related cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30, or ≧50, for example, 2-50.

[0378] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0379] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0380] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0381] In another preferred embodiment, the allogeneic cells refer to cells in which DNA methyltransferase is normally expressed or underexpressed (eg, allogeneic tumor cells).

[0382] In another preferred embodiment, the allogeneic cells refer to cells of the same type, but in which DNA methyltransferase is normally or under-expressed.

[0383] In another preferred example, the allogeneic cells refer to normal tissue cells (for example, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0384] In another preferred example, the allogeneic cells refer to normal tissue cells in which DNA methyltransferase is normally expressed (for example, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0385] In another preferred embodiment, A0 is the expression level of DNA methyltransferase in cells in which DNA methyltransferase is normally expressed or under-expressed.

[0386] In another preferred embodiment, the cells in which DNA methyltransferase is normally expressed or under-expressed include cells that are insensitive to the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0387] In another preferred embodiment, the tumor in which DNMT1 is highly expressed refers to a tumor in which DNMT1 protein can be detected with a DNMT1 antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT1 protein can be detected with a DNMT1 antibody in 5 μg of protein extracted from the tumor, even more preferably a tumor in which DNMT1 protein can be detected with a DNMT1 antibody in 1 μg of protein extracted from the tumor, even more preferably a tumor in which DNMT1 protein can be detected with a DNMT1 antibody in 0.2 μg of protein extracted from the tumor, even more preferably a tumor in which DNMT1 protein can be detected with a DNMT1 antibody in 0.05 μg of protein extracted from the tumor, and even more preferably a tumor in which DNMT1 protein can be detected with a DNMT1 antibody in 0.01 μg of protein extracted from the tumor.

[0388] In another preferred embodiment, the tumor with high DNMT1 expression refers to a tumor in which the expression level of DNMT1 in tumor cells is greater than the expression level of DNMT1 in related cells or normal cells (e.g., cancerous bladder tissue cells).

[0389] In another preferred embodiment, the tumor with high DNMT1 expression refers to a tumor in which the ratio (B1 / B0) between the expression level B1 of DNMT1 in tumor cells and the expression level B0 of DNMT1 in related cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0390] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0391] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0392] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0393] In another preferred embodiment, the allogeneic cells refer to cells in which DNMT1 is normally expressed or underexpressed (eg, allogeneic tumor cells).

[0394] In another preferred embodiment, the allogeneic cells refer to cells of the same type, but in which DNMT1 is normally expressed or under-expressed.

[0395] In another preferred example, the normal cells refer to normal tissue cells (for example, cells derived from tumor cells, cells adjacent to tumors, or cancerous bladder tissue cells).

[0396] In another preferred example, the normal cells refer to normal tissue cells in which DNMT1 is normally expressed (for example, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0397] In another preferred embodiment, B0 is the expression level of DNMT1 in cells in which DNMT1 is normally or poorly expressed.

[0398] In another preferred embodiment, the cells in which DNMT1 is normally expressed or under-expressed include cells that are insensitive to the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0399] In another preferred embodiment, a tumor in which DNMT3a is highly expressed refers to a tumor in which DNMT3a protein can be detected with a DNMT3a antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3a protein can be detected with a DNMT3a antibody in 5 μg of protein extracted from the tumor, even more preferably a tumor in which DNMT3a protein can be detected with a DNMT3a antibody in 1 μg of protein extracted from the tumor, even more preferably a tumor in which DNMT3a protein can be detected with a DNMT3a antibody in 0.2 μg of protein extracted from the tumor, even more preferably a tumor in which DNMT3a protein can be detected with a DNMT3a antibody in 0.05 μg of protein extracted from the tumor, and even more preferably a tumor in which DNMT3a protein can be detected with a DNMT3a antibody in 0.01 μg of protein extracted from the tumor.

[0400] In another preferred embodiment, the tumor with high DNMT3a expression refers to a tumor in which the expression level of DNMT3a in tumor cells is greater than that in related cells or normal cells (e.g., cancerous bladder tissue cells).

[0401] In another preferred embodiment, the tumor with high expression of DNMT3a refers to a tumor in which the ratio (C1 / C0) between the expression level C1 of DNMT3a in tumor cells and the expression level C0 of DNMT3a in related cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0402] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0403] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0404] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0405] In another preferred embodiment, the allogeneic cells refer to cells in which DNMT3a is normally expressed or underexpressed (e.g., allogeneic tumor cells).

[0406] In another preferred embodiment, the allogeneic cells refer to cells of the same type, but in which DNMT3a is normally expressed or under-expressed.

[0407] In another preferred example, the normal cells refer to normal tissue cells (for example, cells derived from tumor cells, cells adjacent to tumors, or cancerous bladder tissue cells).

[0408] In another preferred example, the normal cells refer to normal tissue cells in which DNMT3a is normally expressed (for example, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0409] In another preferred embodiment, C0 is the expression level of DNMT3a in cells in which DNMT3a is normally or poorly expressed.

[0410] In another preferred embodiment, the cells in which DNMT3a is normally expressed or under-expressed include cells that are insensitive to the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0411] In another preferred embodiment, the tumor in which DNMT3b is highly expressed refers to a tumor in which DNMT3b protein can be detected with a DNMT3b antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which DNMT3b protein can be detected with a DNMT3b antibody in 5 μg of protein extracted from the tumor, even more preferably a tumor in which DNMT3b protein can be detected with a DNMT3b antibody in 1 μg of protein extracted from the tumor, even more preferably a tumor in which DNMT3b protein can be detected with a DNMT3b antibody in 0.2 μg of protein extracted from the tumor, even more preferably a tumor in which DNMT3b protein can be detected with a DNMT3b antibody in 0.05 μg of protein extracted from the tumor, and even more preferably a tumor in which DNMT3b protein can be detected with a DNMT3b antibody in 0.01 μg of protein extracted from the tumor.

[0412] In another preferred embodiment, the tumor with high DNMT3b expression refers to a tumor in which the expression level of DNMT3b in tumor cells is greater than the expression level of DNMT3b in related cells or normal cells (e.g., cancerous bladder tissue cells).

[0413] In another preferred embodiment, the tumor with high expression of DNMT3b refers to a tumor in which the ratio (D1 / D0) between the expression level D1 of DNMT3b in tumor cells and the expression level D0 of DNMT3b in related cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0414] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0415] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0416] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0417] In another preferred embodiment, the allogeneic cells refer to cells in which DNMT3b is normally expressed or underexpressed (allogeneic tumor cells).

[0418] In another preferred embodiment, the allogeneic cells refer to cells of the same type, but in which DNMT3b is normally expressed or under-expressed.

[0419] In another preferred example, the normal cells refer to normal tissue cells (for example, cells derived from tumor cells, cells adjacent to tumors, or cancerous bladder tissue cells).

[0420] In another preferred example, the normal cells refer to normal tissue cells in which DNMT3b is normally expressed (for example, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0421] In another preferred embodiment, D0 is the expression level of DNMT3b in cells in which DNMT3b is normally or poorly expressed.

[0422] In another preferred embodiment, the cells in which DNMT3b is normally expressed or under-expressed include cells that are insensitive to the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0423] In another preferred example, the tumor in which UHRF1 is highly expressed refers to a tumor in which UHRF1 protein can be detected with a UHRF1 antibody in 20 μg of protein extracted from the tumor, more preferably a tumor in which UHRF1 protein can be detected with a UHRF1 antibody in 5 μg of protein extracted from the tumor, even more preferably a tumor in which UHRF1 protein can be detected with a UHRF1 antibody in 1 μg of protein extracted from the tumor, even more preferably a tumor in which UHRF1 protein can be detected with a UHRF1 antibody in 0.2 μg of protein extracted from the tumor, even more preferably a tumor in which UHRF1 protein can be detected with a UHRF1 antibody in 0.05 μg of protein extracted from the tumor, and even more preferably a tumor in which UHRF1 protein can be detected with a UHRF1 antibody in 0.01 μg of protein extracted from the tumor.

[0424] In another preferred example, the tumor with high UHRF1 expression refers to a tumor in which the expression level of UHRF1 in tumor cells is greater than the expression level of UHRF1 in related cells or normal cells (for example, cancerous bladder tissue cells).

[0425] In another preferred example, the tumor in which UHRF1 is highly expressed refers to a tumor in which the ratio (F1 / F0) between the expression level of UHRF1 in tumor cells F1 and the expression level of UHRF1 in related cells or normal cells (e.g., cancerous bladder tissue cells) F0 is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0426] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0427] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0428] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0429] In another preferred embodiment, the allogeneic cells refer to cells in which UHRF1 is normally expressed or underexpressed (allogeneic tumor cells).

[0430] In another preferred embodiment, the allogeneic cells refer to cells of the same type, but in which UHRF1 is normally expressed or under-expressed.

[0431] In another preferred example, the normal cells refer to normal tissue cells (for example, cells derived from tumor cells, cells adjacent to tumors, or cancerous bladder tissue cells).

[0432] In another preferred example, the normal cells refer to normal tissue cells in which UHRF1 is normally expressed (for example, cells derived from tumor cells, cells adjacent to tumors, or cancerous bladder tissue cells).

[0433] In another preferred embodiment, F0 is the expression level of UHRF1 in cells in which UHRF1 is normally or poorly expressed.

[0434] In another preferred embodiment, the cells in which UHRF1 is normally expressed or underexpressed include cells that are insensitive to the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0435] In another preferred example, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is greater than the methylation level of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell).

[0436] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0437] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level of the nucleotide site of the NNMT gene in a certain cell (e.g., tumor cell) is ≧1%, preferably ≧3%, ≧5%, ≧10%, ≧15% or ≧20%, and more preferably ≧25%, ≧30%, ≧40% or ≧50%.

[0438] In another preferred embodiment, the certain cells include tumor cells.

[0439] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0440] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0441] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0442] In another preferred embodiment, said allogeneic cells refer to cells in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated (allogeneic tumor cells).

[0443] In another preferred embodiment, said related cells refer to cells of the same type, but in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated.

[0444] In another preferred example, the normal cells refer to normal tissue cells (for example, cells derived from tumor cells, cells adjacent to tumors, or cancerous bladder tissue cells).

[0445] In another preferred embodiment, the normal cells refer to normal tissue cells (for example, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells) in which the nucleotide site of the NNMT gene is normally methylated.

[0446] In another preferred embodiment, the cells in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated include cells that are insensitive to a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0447] In another preferred example, the tumor in which the nucleotide site of the NNMT gene is hypermethylated refers to a tumor in which the methylation level (M%) of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) is ≧3% and M1% or less, where M1 is any positive integer between 3 and 100.

[0448] In another preferred example, M1 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95 or 100.

[0449] In another preferred embodiment, said methylation level of a nucleotide site in the NNMT gene refers to the ratio between the number of methylated nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region.

[0450] In another preferred embodiment, the methylation level of a nucleotide site in the NNMT gene comprises a methylation level of a nucleotide site in the promoter region of the NNMT gene.

[0451] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1.

[0452] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site within the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site.

[0453] In another preferred embodiment, the region from 1050 bp before the transcription initiation site of the NNMT gene to 499 bp after the transcription initiation site corresponds to positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0454] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide site within the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site.

[0455] In another preferred example, the region from 1050 bp before the transcription initiation site to 193 bp before the transcription initiation site of the NNMT gene is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0456] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide site within the region from 840 bp before the transcription start site of the NNMT gene to 469 bp before the transcription start site.

[0457] In another preferred example, the region from 840 bp before the transcription initiation site to 469 bp before the transcription initiation site of the NNMT gene is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0458] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site within the region between any two of positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 (including these two positions themselves).

[0459] In another preferred example, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide at one or more (e.g., 2, 3, 4, 5, 6, or 7) of positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11.

[0460] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide at a site selected from position 114165695 on human chromosome 11, position 114165730 on human chromosome 11, position 114165769 on human chromosome 11, position 114165804 on human chromosome 11, position 114165938 on human chromosome 11, position 114166050 on human chromosome 11, position 114166066 on human chromosome 11, or a combination thereof.

[0461] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene includes the methylation level of the nucleotide site within the region between any two of the sites 1161, 1196, 1235, 1270, 1404, 1516 and 1532 of the nucleotide sequence of SEQ ID NO:1 (including these two positions themselves).

[0462] In another preferred embodiment, the methylation level of the nucleotide site of the NNMT gene comprises the methylation level of the nucleotide at one or more (e.g., 2, 3, 4, 5, 6 or 7) of the sites 1161, 1196, 1235, 1270, 1404, 1516 and 1532 of the nucleotide sequence of SEQ ID NO:1.

[0463] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region comprises the methylation level of the nucleotide at a site selected from the group consisting of positions 1161, 1196, 1235, 1270, 1404, 1516, 1532, or a combination thereof, of the nucleotide sequence of SEQ ID NO:1.

[0464] In another preferred example, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the methylation level of the DNA CpG site in the NNMT gene region in a certain cell (e.g., a tumor cell) is greater than the methylation level of the DNA CpG site in the NNMT gene region in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell).

[0465] In another preferred embodiment, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG site in the NNMT gene region of a certain cell (e.g., a tumor cell) and the methylation level W0 of the DNA CpG site in the NNMT gene region of a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0466] In another preferred embodiment, the tumor in which the DNA CpG sites in the NNMT gene region are hypermethylated refers to a tumor in which the methylation level of the DNA CpG sites in the NNMT gene region of a certain cell (e.g., tumor cell) is ≧1%, preferably ≧3%, ≧5%, ≧10%, ≧15% or ≧20%, and more preferably ≧25%, ≧30%, ≧40% or ≧50%.

[0467] In another preferred embodiment, the certain cells include tumor cells.

[0468] In another preferred embodiment, the allogeneic cells comprise cells of the same type.

[0469] In another preferred embodiment, the allogeneic cells comprise allogeneic tumor cells.

[0470] In another preferred embodiment, the allogeneic cells comprise tumor cells of the same type.

[0471] In another preferred embodiment, the allogeneic cells refer to cells in which the DNA CpG sites in the NNMT gene region are normally methylated or hypomethylated (for example, allogeneic tumor cells).

[0472] In another preferred embodiment, the related cells refer to cells of the same type, but in which the NNMT gene region DNA CpG sites are normally methylated or hypomethylated.

[0473] In another preferred embodiment, the normal cells refer to normal tissue cells in which the DNA CpG sites in the NNMT gene region are normally methylated (for example, cells derived from tumor cells, tumor-adjacent cells, or cancerous bladder tissue cells).

[0474] In another preferred embodiment, the cells in which the NNMT gene region DNA CpG sites are normally methylated or hypomethylated include cells that are insensitive to the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0475] In another preferred example, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated refers to a tumor in which the methylation level (M%) of the DNA CpG site in the NNMT gene region of a certain cell (e.g., tumor cell) is ≧3% and M2% or less, where M2 is any positive integer between 3 and 100.

[0476] In another preferred embodiment, M2 is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, or 100.

[0477] In another preferred embodiment, the methylation level of a CpG site refers to the ratio between the number of methylated CpG nucleotides in a certain gene region and the number of all nucleotides in the gene region.

[0478] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all nucleotides in the NNMT gene region.

[0479] In another preferred embodiment, the methylation level of a CpG site refers to the ratio between the number of methylated CpG nucleotides in a certain gene region and the number of all CpG nucleotides in the gene region.

[0480] In another preferred embodiment, said methylation level of DNA CpG sites in the NNMT gene region refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region and the number of all CpG nucleotides in the NNMT gene region.

[0481] In another preferred embodiment, the methylation level of DNA CpG sites refers to the ratio between the number of methylated CpG sites in a region of DNA and the number of all CpG sites in the region of DNA.

[0482] In another preferred embodiment, the methylation level of a DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in a region of DNA and the number of all nucleotides in the region of DNA.

[0483] In another preferred embodiment, the methylation level of a DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in a region of DNA and the number of all CpG nucleotides in the region of DNA.

[0484] In another preferred embodiment, the methylation level of the NNMT gene region DNA CpG sites refers to the ratio between the number of methylated CpG sites in the NNMT gene region DNA and the number of all CpG sites in the NNMT gene region DNA.

[0485] In another preferred embodiment, the methylation level of the NNMT gene region DNA CpG site refers to the ratio between the number of methylated CpG nucleotides in the NNMT gene region DNA and the number of all CpG nucleotides in the NNMT gene region DNA.

[0486] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites in the NNMT gene promoter region.

[0487] In another preferred embodiment, the nucleotide sequence of the NNMT gene promoter region is shown in SEQ ID NO:1.

[0488] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites in the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site.

[0489] In another preferred embodiment, the region from 1050 bp before the transcription initiation site of the NNMT gene to 499 bp after the transcription initiation site corresponds to positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0490] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites in the region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site.

[0491] In another preferred example, the region from 1050 bp before the transcription initiation site to 193 bp before the transcription initiation site of the NNMT gene is positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0492] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region comprises the methylation level of DNA CpG sites in the region from 840 bp before the transcription start site of the NNMT gene to 469 bp before the transcription start site.

[0493] In another preferred example, the region from 840 bp before the transcription initiation site to 469 bp before the transcription initiation site of the NNMT gene is positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0494] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites within a region between any two of positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11 (including these two positions themselves).

[0495] In another preferred embodiment, the methylation level of the DNA CpG sites in the NNMT gene region includes the methylation level of one or more (e.g., 2, 3, 4, 5, 6, or 7) sites among positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050, and 114166066 on human chromosome 11.

[0496] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region comprises the methylation level of a site selected from position 114165695 on human chromosome 11, position 114165730 on human chromosome 11, position 114165769 on human chromosome 11, position 114165804 on human chromosome 11, position 114165938 on human chromosome 11, position 114166050 on human chromosome 11, position 114166066 on human chromosome 11, or a combination thereof.

[0497] In another preferred embodiment, the methylation level of DNA CpG sites in the NNMT gene region includes the methylation level of DNA CpG sites within the region between any two of positions 1161, 1196, 1235, 1270, 1404, 1516, and 1532 of the nucleotide sequence of SEQ ID NO:1 (including these two positions themselves).

[0498] In another preferred embodiment, the methylation level of the NNMT gene region DNA CpG sites comprises the methylation level of one or more (e.g., 2, 3, 4, 5, 6 or 7) of the following sites in the nucleotide sequence of SEQ ID NO:1: 1161, 1196, 1235, 1270, 1404, 1516 and 1532.

[0499] In another preferred embodiment, the methylation level of the DNA CpG site in the NNMT gene region includes the methylation level of the site selected from the sites at positions 1161, 1196, 1235, 1270, 1404, 1516, 1532, or a combination thereof in the sequence of SEQ ID NO:1.

[0500] In another preferred embodiment, the tumor in which the mitochondrial permeability transition pore is under-expressed, not expressed, hypoactive, or inactivated can be treated by administering an inhibitor of the mitochondrial permeability transition pore.

[0501] In another preferred embodiment, the tumor in which peptidyl prolyl isomerase F is under-expressed, not expressed, hypoactive or inactivated can be treated by administering a peptidyl prolyl isomerase F inhibitor.

[0502] In another preferred embodiment, the inhibitor comprises an inhibitor having specificity.

[0503] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore includes an inhibitor capable of causing the mitochondrial permeability transition pore in tumors to be underexpressed, not expressed, underactivated, or inactivated.

[0504] In another preferred embodiment, the inhibitor of peptidyl prolyl isomerase F includes an inhibitor capable of under-expressing, not expressing, under-activating or inactivating peptidyl prolyl isomerase F in tumors.

[0505] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore is selected from Cyclosporin A, a CyP-D protein inhibitor, a peroxide scavenger, or a combination thereof.

[0506] In another preferred embodiment, said inhibitor of peptidyl prolyl isomerase F comprises shRNA.

[0507] In another preferred example, the nucleotide sequence of the shRNA is GTTCTTCATCTGCACCATAAA.

[0508] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed can be treated by administering an inhibitor of the NNMT gene.

[0509] In another preferred embodiment, the tumor in which DNA methyltransferase is highly expressed can be treated by administering a promoter of DNA methyltransferase.

[0510] In another preferred embodiment, the tumor in which DNMT1 is highly expressed can be produced by administering a promoter of DNMT1.

[0511] In another preferred embodiment, the tumor in which DNMT3a is highly expressed can be produced by administering a promoter of DNMT3a.

[0512] In another preferred embodiment, the tumor in which DNMT3b is highly expressed can be produced by administering a promoter of DNMT3b.

[0513] In another preferred embodiment, the tumor in which UHRF1 is highly expressed can be produced by administering a promoter of UHRF1.

[0514] In another preferred embodiment, the tumor in which the nucleotide site of the NNMT gene is hypermethylated can be treated by administering an agent that promotes methylation of the nucleotide site of the NNMT gene.

[0515] In another preferred embodiment, the tumor in which the DNA CpG site in the NNMT gene region is hypermethylated can be treated by administering an agent that promotes methylation of the DNA CpG site in the NNMT gene region.

[0516] In another preferred embodiment, the inhibitor comprises an inhibitor having specificity.

[0517] In another preferred embodiment, the enhancer comprises an enhancer with specificity.

[0518] In another preferred embodiment, said inhibitor of the NNMT gene comprises an inhibitor capable of under-expressing or not expressing the NNMT gene in tumors.

[0519] In another preferred embodiment, the promoter of DNA methyltransferase comprises a promoter capable of overexpressing DNA methyltransferase in tumors.

[0520] In another preferred embodiment, the promoter of DNMT1 comprises a promoter capable of overexpressing DNMT1 in tumors.

[0521] In another preferred embodiment, the promoter of DNMT3a comprises a promoter capable of increasing the expression of DNMT3a in tumors.

[0522] In another preferred embodiment, the promoter of DNMT3b comprises a promoter capable of increasing the expression of DNMT3b in tumors.

[0523] In another preferred embodiment, the promoter of UHRF1 includes a promoter capable of highly expressing UHRF1 in tumors.

[0524] In another preferred embodiment, said promoter of methylation of a nucleotide site in the NNMT gene comprises a promoter capable of hypermethylating a nucleotide site in the NNMT gene in a tumor.

[0525] In another preferred embodiment, the promoter of methylation of DNA CpG sites in the NNMT gene region comprises a promoter capable of hypermethylating DNA CpG sites in the NNMT gene region of tumors.

[0526] In another preferred embodiment, the tumor is selected from lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain cancer, liver cancer, prostate cancer, or a combination thereof.

[0527] In another preferred embodiment, the lung cancer is selected from non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0528] In another preferred embodiment, the lung cancer cells include NCI-H82 cells.

[0529] In another preferred embodiment, the colon cancer comprises colon adenocarcinoma.

[0530] In another preferred embodiment, the colon cancer cells comprise SW48 cells.

[0531] In another preferred embodiment, the colon cancer cells comprise MDA-MB-453 cells.

[0532] In another preferred embodiment, the breast cancer comprises triple-negative breast cancer.

[0533] In another preferred embodiment, the lymphoma is selected from B-cell lymphoma, T-cell lymphoma, or a combination thereof.

[0534] In another preferred embodiment, the lymphoma comprises diffuse large B-cell lymphoma.

[0535] In another preferred embodiment, the brain tumor is selected from glioblastoma, glioma, medulloblastoma, neuroblastoma, or a combination thereof.

[0536] In another preferred embodiment, the cerebral medulloblastoma comprises a cerebellar medulloblastoma.

[0537] In another preferred embodiment, the glioblastoma comprises glioblastoma multiforme.

[0538] In another preferred embodiment, the brain tumor comprises a medulloblastoma.

[0539] In another preferred embodiment, the brain tumor comprises a glioblastoma.

[0540] In another preferred embodiment, the brain tumor comprises a cranial fossa malignant glioblastoma.

[0541] In another preferred embodiment, the brain tumor comprises a medulloblastoma.

[0542] In another preferred embodiment, the tumor cells of the brain tumor include Daoy cells.

[0543] In another preferred embodiment, the brain tumor cells comprise one or more of GB-1 cells and SF126 cells.

[0544] In another preferred embodiment, the kidney cancer is selected from renal clear cell adenocarcinoma, renal cancer Wilms, or a combination thereof.

[0545] In another preferred embodiment, the kidney cancer comprises renal clear cell adenocarcinoma.

[0546] In another preferred embodiment, the kidney cancer comprises Wilms kidney cancer.

[0547] In another preferred embodiment, the renal cancer cancer cells comprise renal cancer Wilms cells.

[0548] In another preferred embodiment, the renal cancer cells include one or more of G-401 cells and 786-O cells.

[0549] In another preferred embodiment, the pancreatic cancer cells include CFPAC-1 cells.

[0550] In another preferred embodiment, the leukemia is selected from T lymphocytic leukemia, myeloid leukemia, or a combination thereof.

[0551] In another preferred embodiment, the T lymphocytic leukemia comprises acute T lymphocytic leukemia.

[0552] In another preferred embodiment, the myeloid leukemia comprises M4 AML acute myeloid leukemia.

[0553] In another preferred embodiment, the myeloid leukemia comprises FAB M4 AML acute myeloid leukemia.

[0554] In another preferred embodiment, the expression comprises protein expression and / or mRNA expression.

[0555] In another preferred embodiment, the composition is a pharmaceutical composition.

[0556] In another preferred embodiment, the composition or formulation further comprises a pharmaceutically acceptable carrier.

[0557] In another preferred embodiment, the expression is mRNA expression or protein expression.

[0558] In another preferred embodiment, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0559] In another preferred embodiment, the type of the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0560] In another preferred embodiment, the composition or preparation is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill, or a film.

[0561] A fourth aspect of the present invention provides a marker for determining whether the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for the prevention and / or treatment of tumor in a tumor patient, the marker comprising a mitochondrial permeability transition pore, peptidylprolyl isomerase F, the NNMT gene, DNA methyltransferase, UHRF1, methylation of a nucleotide site in the NNMT gene, and / or methylation of a DNA CpG site in the NNMT gene region.

[0562] In another preferred embodiment, the marker comprises the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region.

[0563] In another preferred example, when tumor cells of a tumor patient are under-expressed, under-expressed, under-activated or inactivated of the mitochondrial permeability transition pore, under-expressed, under-activated or inactivated of peptidylprolyl isomerase F, under-expressed or under-expressed of the NNMT gene, over-expressed of DNA methyltransferase, over-expressed of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0564] In another preferred example, when tumor cells of a tumor patient experience high expression or high activation of the mitochondrial permeability transition pore, high expression or high activation of peptidylprolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for the prevention and / or treatment of tumors in the tumor patient.

[0565] In another preferred example, the statement that the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is suitable for the prevention and / or treatment of tumors in tumor patients means that tumor cells in the tumor patient are sensitive to the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0566] In another preferred example, the content that the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is not suitable for the prevention and / or treatment of tumor in a tumor patient means that tumor cells of the tumor patient are insensitive to the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0567] In another preferred embodiment, the tumor in which the mitochondrial permeability transition pore is underexpressed, absent, underactivated or inactivated is a tumor according to the third aspect of the present invention.

[0568] In another preferred embodiment, the tumor in which peptidylprolyl isomerase F is underexpressed, not expressed, underactivated or inactivated is a tumor according to the third aspect of the present invention.

[0569] In another preferred embodiment, the tumor in which the NNMT gene is under-expressed or not expressed is a tumor according to the third aspect of the present invention.

[0570] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0571] In another preferred embodiment, the tumor resulting in high expression of DNA methyltransferases (eg, DNMT1, DNMT3a and / or DNMT3b) is a tumor according to the third aspect of the present invention.

[0572] In another preferred embodiment, the tumor with high expression of UHRF1 is a tumor according to the third aspect of the present invention.

[0573] In another preferred embodiment, the tumor resulting in hypermethylation of the nucleotide site in the NNMT gene is a tumor according to the third aspect of the present invention.

[0574] In another preferred embodiment, the tumor resulting in hypermethylation of DNA CpG sites in the NNMT gene region is a tumor according to the third aspect of the present invention.

[0575] In another preferred embodiment, the tumor exhibiting high expression or activation of the mitochondrial permeability transition pore refers to a tumor in which the ratio (H1 / H0) between the expression level or activity H1 of the mitochondrial permeability transition pore in a certain cell (e.g., a tumor cell) and the expression level or activity H0 of the mitochondrial permeability transition pore in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30, or ≧50, for example, 2-50.

[0576] In another preferred embodiment, the tumor with high expression or activation of peptidyl prolyl isomerase F refers to a tumor in which the ratio (G1 / G0) between the expression level or activity G1 of peptidyl prolyl isomerase F in a certain cell (e.g., a tumor cell) and the expression level or activity G0 of peptidyl prolyl isomerase F in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30, or ≧50, for example, 2-50.

[0577] In another preferred embodiment, the tumor with high expression of the NNMT gene refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

[0578] In another preferred embodiment, the tumor with low expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in related cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001, or ≦0.0000001.

[0579] In another preferred embodiment, the tumor with low expression of DNMT1 refers to a tumor in which the ratio (B1 / B0) between the expression level B1 of DNMT1 in tumor cells and the expression level B0 of DNMT1 in related cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0580] In another preferred embodiment, the tumor with low expression of DNMT3a refers to a tumor in which the ratio (C1 / C0) between the expression level C1 of DNMT3a in tumor cells and the expression level C0 of DNA methyltransferase in related cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0581] In another preferred embodiment, the tumor with low expression of DNMT3b refers to a tumor in which the ratio (D1 / D0) between the expression level D1 of DNMT3b in tumor cells and the expression level D0 of DNA methyltransferase in related cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0582] In another preferred example, the tumor with low expression of UHRF1 refers to a tumor in which the ratio (F1 / F0) between the expression level F1 of UHRF1 in tumor cells and the expression level F0 of UHRF1 in related cells or normal cells (e.g., cancerous bladder tissue cells) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0583] In another preferred embodiment, the tumor having hypomethylation of the nucleotide site of the NNMT gene refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 of the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 of the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0584] In another preferred embodiment, the tumor with hypomethylation of DNA CpG sites in the NNMT gene region refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG sites in the NNMT gene region of a certain cell (e.g., a tumor cell) and the methylation level W0 of the DNA CpG sites in the NMT gene region of the same cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001.

[0585] A fifth aspect of the present invention provides a detection reagent kit, comprising: (i) A detection reagent is provided for detecting the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites in the NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region.

[0586] In another preferred embodiment, the detection sample of the detection reagent kit contains tumor cells.

[0587] In another preferred embodiment, said expression comprises mRNA and / or protein expression.

[0588] A sixth aspect of the present invention provides use of the detection reagent kit according to the fifth aspect of the present invention for the manufacture of a concomitant diagnostic kit for use in determining whether the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for the prevention and / or treatment of tumors in tumor patients.

[0589] In another preferred embodiment, the companion detection reagent kit further comprises an instruction manual or label.

[0590] In another preferred embodiment, the instructions or label include: The present invention provides that, when the tumor cells of a tumor patient are under-expressed, under-expressed, under-activated or inactivated of the mitochondrial permeability transition pore, under-expressed, under-activated or inactivated of peptidylprolyl isomerase F, under-expressed or under-expressed of the NNMT gene, over-expressed of DNA methyltransferase, over-expressed of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0591] In another preferred embodiment, the instructions or label include: The present invention discloses that when there is high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidylprolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region in tumor cells of a tumor patient, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for the prevention and / or treatment of tumors in the tumor patient.

[0592] A seventh aspect of the present invention provides a medical kit.

[0593] The medical kit comprises: (i) a detection reagent used to detect the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region; (ii) the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0594] In another preferred embodiment, the medical kit further comprises an instruction manual or label.

[0595] In another preferred embodiment, the instructions or label include: The present invention provides that, when the tumor cells of a tumor patient are under-expressed, under-expressed, under-activated or inactivated of the mitochondrial permeability transition pore, under-expressed, under-activated or inactivated of peptidylprolyl isomerase F, under-expressed or under-expressed of the NNMT gene, over-expressed of DNA methyltransferase, over-expressed of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0596] In another preferred embodiment, the instructions or label include: The present invention discloses that when there is high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidylprolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region in tumor cells of a tumor patient, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for the prevention and / or treatment of tumors in the tumor patient.

[0597] An eighth aspect of the present invention provides a method for preventing and / or treating tumors by administering to a subject the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, to achieve tumor prevention and / or treatment.

[0598] In another preferred embodiment, the tumor is a tumor according to the third aspect of the invention.

[0599] In another preferred embodiment, the subject to be treated is a human or non-human mammal (eg, rodents, rabbits, monkeys, livestock, dogs, cats).

[0600] In another preferred embodiment, the method comprises: First, the tumor to be treated is made to have underexpression, no expression, underactivation or inactivation of the mitochondrial permeability transition pore, underexpression, no expression, underactivation or inactivation of peptidylprolyl isomerase F, underexpression or no expression of the NNMT gene, overexpression of DNA methyltransferase, overexpression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, and then the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is administered to prevent and / or treat the tumor.

[0601] In another preferred embodiment, the method comprises: First, an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, a promoter of UHRF1, a promoter of methylation of nucleotide sites of the NNMT gene, and / or a promoter of DNA methylation of the NNMT gene region are administered so that the tumor to be treated has low expression, no expression, low activation, or inactivation of the mitochondrial permeability transition pore, low expression, no expression, low activation, or inactivation of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region. The method comprises administering to the subject an agent for promoting methylation of CpG sites, followed by administering the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, to effect prophylaxis and / or treatment.

[0602] In another preferred embodiment, the above-mentioned inhibitors of the mitochondrial permeability transition pore, inhibitors of peptidylprolyl isomerase F, inhibitors of the NNMT gene, promoters of DNA methyltransferase, promoters of UHRF1, promoters of methylation of nucleotide sites in the NNMT gene and / or promoters of methylation of DNA CpG sites in the NNMT gene region have the meanings described in the third aspect of the present invention.

[0603] A ninth aspect of the present invention provides an apparatus or system.

[0604] The device or system comprises: (i) a detection module used to detect the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region; (ii) an output module.

[0605] The output module includes: information that when, in tumor cells of a tumor patient, there is low expression, no expression, low activation or inactivation of the mitochondrial permeability transition pore, there is low expression, no expression, low activation or inactivation of peptidylprolyl isomerase F, there is low expression or no expression of the NNMT gene, there is high expression of DNA methyltransferase, there is high expression of UHRF1, there is hypermethylation of nucleotide sites in the NNMT gene, and / or there is hypermethylation of DNA CpG sites in the NNMT gene region, said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in said tumor patient; and / or When there is high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidylprolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region in tumor cells of a tumor patient, information is output that the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for tumor prevention and / or treatment in the tumor patient.

[0606] In another preferred embodiment, the device comprises a gene detector or a protein detector.

[0607] In another preferred embodiment, the device or system further comprises a sample supply module.

[0608] In another preferred embodiment, the sample supply module is used to supply a tumor cell extract.

[0609] In another preferred embodiment, the device or system further comprises a data processing module.

[0610] In another preferred embodiment, the data processing module processes the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region to obtain their numerical ranges.

[0611] A tenth aspect of the present invention provides the use of an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidylprolyl isomerase F, an inhibitor of the NNMT gene, a promoter of DNA methyltransferase, a promoter of UHRF1, a promoter of methylation of nucleotide sites in the NNMT gene and / or a promoter of methylation of DNA CpG sites in the NNMT gene region, to manufacture a composition or formulation used to enhance the antitumor effect of an antitumor drug.

[0612] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore includes an inhibitor capable of causing the mitochondrial permeability transition pore in tumors to be under-expressed, not expressed, under-activated, or inactivated.

[0613] In another preferred embodiment, the inhibitor of peptidyl prolyl isomerase F includes an inhibitor capable of under-expressing, not expressing, under-activating or inactivating peptidyl prolyl isomerase F in tumors.

[0614] In another preferred embodiment, said inhibitor of the NNMT gene comprises an inhibitor capable of causing low or no expression of the NNMT gene in tumors.

[0615] In another preferred embodiment, the promoter of DNA methyltransferase comprises a promoter that can increase the expression of DNA methyltransferase in tumors.

[0616] In another preferred embodiment, the DNA methyltransferase is selected from DNMT1, DNMT3a, DNMT3b, or a combination thereof.

[0617] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT1.

[0618] In another preferred embodiment, the promoter of DNMT1 comprises a promoter that can increase the expression of DNMT1 in tumors.

[0619] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT3a.

[0620] In another preferred embodiment, the promoter of DNMT3a comprises a promoter that can increase the expression of DNMT3a in tumors.

[0621] In another preferred embodiment, said promoter of a DNA methyltransferase comprises a promoter of DNMT3b.

[0622] In another preferred embodiment, the promoter of DNMT3b comprises a promoter that can increase the expression of DNMT3b in tumors.

[0623] In another preferred embodiment, the promoter of UHRF1 includes a promoter that can increase the expression of UHRF1 in tumors.

[0624] In another preferred embodiment, said promoter of methylation of the nucleotide site of the NNMT gene comprises a promoter capable of hypermethylating the nucleotide site of the NNMT gene in tumors.

[0625] In another preferred embodiment, the promoter of methylation of DNA CpG sites in the NNMT gene region comprises a promoter capable of hypermethylating DNA CpG sites in the NNMT gene region in tumors.

[0626] In another preferred embodiment, the inhibitor comprises an inhibitor having specificity.

[0627] In another preferred embodiment, the enhancer comprises an enhancer with specificity.

[0628] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0629] In another preferred embodiment, the tumor is a tumor according to the third aspect of the invention.

[0630] In another preferred embodiment, the inhibitor of the mitochondrial permeability transition pore is selected from Cyclosporin A, a CyP-D protein inhibitor, a peroxide scavenger, or a combination thereof.

[0631] In another preferred embodiment, said inhibitor of peptidyl prolyl isomerase F comprises shRNA.

[0632] In another preferred example, the nucleotide sequence of the shRNA is GTTCTTCATCTGCACCATAAA.

[0633] In another preferred embodiment, the composition or formulation further comprises a pharmaceutically acceptable carrier.

[0634] In another preferred embodiment, the composition or preparation is in the form of a solid, liquid or semi-solid.

[0635] In another preferred embodiment, the type of the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0636] In another preferred embodiment, the injectable formulation is an intravenous formulation.

[0637] In another preferred embodiment, the composition or preparation is in the form of a tablet, an injection, an infusion, an ointment, a gel, a solution, a pill, or a film.

[0638] An eleventh aspect of the present invention provides a combination of active ingredients comprising:

[0639] (1) a first active ingredient comprising an antitumor drug; and (2) A second active ingredient comprising an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidylprolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, a promoter of methylation of nucleotide sites in the NNMT gene and / or a promoter of methylation of DNA CpG sites in the NNMT gene region.

[0640] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0641] In another preferred embodiment, the above-mentioned inhibitors of the mitochondrial permeability transition pore, inhibitors of peptidylprolyl isomerase F, inhibitors of the NNMT gene, promoters of DNA methyltransferase, promoters of UHRF1, promoters of methylation of nucleotide sites in the NNMT gene and / or promoters of methylation of DNA CpG sites in the NNMT gene region have the meanings described in the tenth aspect of the present invention.

[0642] In another preferred embodiment, the molar ratio between the first active ingredient and the second active ingredient is 0.01-600:1, preferably 0.05-500:1, and more preferably 0.1-400:1, 0.2-200:1, 0.5-100:1, 0.5-80:1 or 1-50:1.

[0643] In another preferred embodiment, the combination of active ingredients includes at least one independent active ingredient.

[0644] In another preferred embodiment, the combination of active ingredients includes a first active ingredient and a second active ingredient that are independent of each other.

[0645] A twelfth aspect of the present invention provides a composition comprising the following components:

[0646] (1) a first active ingredient comprising an antitumor drug; and (2) A second active ingredient comprising an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidylprolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, a promoter of methylation of nucleotide sites in the NNMT gene and / or a promoter of methylation of DNA CpG sites in the NNMT gene region.

[0647] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0648] In another preferred embodiment, the above-mentioned inhibitors of the mitochondrial permeability transition pore, inhibitors of peptidylprolyl isomerase F, inhibitors of the NNMT gene, promoters of DNA methyltransferase, promoters of UHRF1, promoters of methylation of nucleotide sites in the NNMT gene and / or promoters of methylation of DNA CpG sites in the NNMT gene region have the meanings described in the tenth aspect of the present invention.

[0649] In another preferred embodiment, the composition is a pharmaceutical composition.

[0650] In another preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0651] In another preferred embodiment, the content of the first active ingredient relative to the total weight of active ingredients in the composition is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and more preferably 1-99 wt%, 10-99 wt% or 20-99 wt%.

[0652] In another preferred embodiment, the content of the second active ingredient relative to the total weight of the active ingredients of the composition is 0.01-99.99 wt%, preferably 0.1-99.9 wt%, and more preferably 1-99 wt%, 10-99 wt% or 20-99 wt%.

[0653] A thirteenth aspect of the present invention provides a medical kit comprising the following formulation:

[0654] (A) a first formulation having a first active ingredient comprising an anti-tumor drug; and (B) A second formulation having a second active ingredient comprising an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidylprolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, a promoter of methylation of nucleotide sites in the NNMT gene and / or a promoter of methylation of DNA CpG sites in the NNMT gene region.

[0655] In another preferred embodiment, the antitumor medicament comprises the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0656] In another preferred embodiment, the above-mentioned inhibitors of the mitochondrial permeability transition pore, inhibitors of peptidylprolyl isomerase F, inhibitors of the NNMT gene, promoters of DNA methyltransferase, promoters of UHRF1, promoters of methylation of nucleotide sites in the NNMT gene and / or promoters of methylation of DNA CpG sites in the NNMT gene region have the meanings described in the tenth aspect of the present invention.

[0657] In another preferred embodiment, the medical kit further comprises an instruction manual.

[0658] In another preferred embodiment, the first formulation and the second formulation are independent of each other.

[0659] In another preferred embodiment, the first and second formulations are combined.

[0660] In another preferred embodiment, the instructions state that the first formulation and the second formulation are used in combination to enhance the antitumor activity of the antitumor drug.

[0661] In another preferred embodiment, the method of combination is to first administer the second formulation having the second active ingredient, followed by administering the first formulation having the first active ingredient.

[0662] A fourteenth aspect of the present invention provides a method for inhibiting tumor cells, said method comprising contacting tumor cells with the compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, to inhibit said tumor cells.

[0663] In another preferred embodiment, the method is performed ex vivo or is an ex vivo method.

[0664] In another preferred embodiment, the method is an in vitro, non-therapeutic, non-diagnostic method.

[0665] In another preferred embodiment, the contacting is performed in an in vitro culture.

[0666] In another preferred embodiment, the tumor is a tumor according to the third aspect of the invention.

[0667] In another preferred embodiment, the method comprises: First, tumor cells are caused to have low expression, no expression, low activation or inactivation of the mitochondrial permeability transition pore, low expression, no expression, low activation or inactivation of peptidylprolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, and then the tumor cells are contacted with the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, thereby inhibiting the tumor cells.

[0668] In another preferred embodiment, the method comprises: First, an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, a promoter of UHRF1, a promoter of methylation of nucleotide sites of the NNMT gene, and / or a promoter of DNA CpG sites of the NNMT gene region are administered to tumor cells, so that the tumor cells have low expression, no expression, low activation, or inactivation of the mitochondrial permeability transition pore, low expression, no expression, low activation, or inactivation of peptidyl prolyl isomerase F, low expression or no expression of the NNMT gene, high expression of DNA methyltransferase, high expression of UHRF1, hypermethylation of nucleotide sites of the NNMT gene, and / or hypermethylation of DNA CpG sites of the NNMT gene region. providing to the tumor cells an agent that promotes methylation of CpG sites, and then contacting the tumor cells with the compound of formula I according to the first aspect of the invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, to inhibit the tumor cells.

[0669] In another preferred embodiment, the above-mentioned inhibitors of the mitochondrial permeability transition pore, inhibitors of peptidylprolyl isomerase F, inhibitors of the NNMT gene, promoters of DNA methyltransferase, promoters of UHRF1, promoters of methylation of nucleotide sites in the NNMT gene and / or promoters of methylation of DNA CpG sites in the NNMT gene region have the meanings described in the tenth aspect of the present invention.

[0670] A fifteenth aspect of the present invention provides the use of the medical kit according to the seventh aspect of the present invention for the manufacture of a pharmaceutical kit for use in the prevention and / or treatment of tumors.

[0671] In another preferred embodiment, the pharmaceutical kit further comprises an instruction manual or label.

[0672] In another preferred embodiment, the instructions or label include: The present invention provides that, when the tumor cells of a tumor patient are under-expressed, under-expressed, under-activated or inactivated of the mitochondrial permeability transition pore, under-expressed, under-activated or inactivated of peptidylprolyl isomerase F, under-expressed or under-expressed of the NNMT gene, over-expressed of DNA methyltransferase, over-expressed of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, becomes suitable for the prevention and / or treatment of tumors in the tumor patient.

[0673] In another preferred embodiment, the instructions or label include: The present invention discloses that when there is high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidylprolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region in tumor cells of a tumor patient, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof becomes unsuitable for the prevention and / or treatment of tumors in the tumor patient.

[0674] Within the scope of the present invention, each of the above technical features of the present invention may be combined with the following specific technical features (embodiments) to form new or preferred technical solutions, which will not be repeated here due to the limited size of the full text. [Brief explanation of the drawings]

[0675]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

[0676] As a result of long-term and in-depth research, the present inventors have unexpectedly discovered for the first time compounds that have excellent and precise therapeutic effects on tumor cells with low expression, no expression, low activation or inactivation of the mitochondrial permeability transition pore, tumor cells with low expression, no expression, low activation or inactivation of peptidylprolyl isomerase F, tumor cells with low expression or no expression of the NNMT gene, tumor cells with high expression of DNA methyltransferase, tumor cells with high expression of UHRF1, tumor cells with hypermethylation of nucleotide sites in the NNMT gene, and / or tumor cells with hypermethylation of DNA CpG sites in the NNMT gene region. The expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites in the NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region serve as markers for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients. The present inventors have achieved the present invention based on this.

[0677] term As used herein, the terms "including," "comprising," and "having" may be used interchangeably and have closed definitions as well as semi-closed and open definitions. In other words, the terms have the meaning "consisting of" or "consisting essentially of."

[0678] As used herein, the terms "anti-cancer drug" and "anti-tumor drug" may be used interchangeably.

[0679] As used herein, the terms "cancer" and "tumor" may be used interchangeably.

[0680] As used herein, the term "a certain cell" refers to a certain cell (e.g., a single tumor cell) or a group of cells including multiple similar cells (e.g., a certain tumor tissue).

[0681] As used herein, "the compound of the present invention is suitable for tumor patients" means that the tumor of the tumor patient is sensitive to the compound of the present invention.

[0682] As used herein, "the compounds of the present invention are not suitable for tumor patients" means that the tumors of the tumor patients are insensitive to the compounds of the present invention.

[0683] As used herein, "having hypermethylation of a DNA CpG site," "becoming hypermethylated at a DNA CpG site," and "a DNA CpG site being hypermethylated" may be used interchangeably.

[0684] As used herein, "there is hypermethylation at a nucleotide site," "the nucleotide site becomes hypermethylated," and "the nucleotide site is hypermethylated" may be used interchangeably.

[0685] As used herein, "there is hypomethylation at a nucleotide site," "the nucleotide site becomes hypomethylated," and "the nucleotide site is hypomethylated" may be used interchangeably.

[0686] As used herein, "there is hypomethylation of a DNA CpG site," "the DNA CpG site becomes hypomethylated," and "the DNA CpG site is hypomethylated" may be used interchangeably.

[0687] As used herein, "methylation of DNA CpG sites," "methylation of CpG nucleotides," and "CpG methylation" may be used interchangeably.

[0688] As used herein, "IC50" and "IC 50 The terms "50% inhibiting concentration" and "50% inhibitory concentration" may be used interchangeably and refer to the concentration of an inhibitor at which 50% of the inhibitory effect is achieved.

[0689] As used herein, the term "P / S" refers to the addition of penicillin and streptomycin to the relevant medium.

[0690] As used herein, "the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region" refers to one or more of the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and the methylation level of the DNA CpG site in the NNMT gene region.

[0691] As used herein, "resulting in under-expression, under-expression, under-activation or inactivation of the mitochondrial permeability transition pore, under-expression, under-activation or inactivation of peptidyl prolyl isomerase F, under-expression or under-expression of the NNMT gene, over-expression of DNA methyltransferase, over-expression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and / or hypermethylation of DNA CpG sites in the NNMT gene region" refers to one or more of the following: under-expression, under-expression, under-activation or inactivation of the mitochondrial permeability transition pore, under-expression, under-expression, under-activation or inactivation of peptidyl prolyl isomerase F, under-expression or under-expression of the NNMT gene, over-expression of DNA methyltransferase, over-expression of UHRF1, hypermethylation of nucleotide sites in the NNMT gene, and hypermethylation of DNA CpG sites in the NNMT gene region.

[0692] As used herein, "resulting in high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and / or hypomethylation of DNA CpG sites in the NNMT gene region" refers to one or more of high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, hypomethylation of nucleotide sites in the NNMT gene, and hypomethylation of DNA CpG sites in the NNMT gene region.

[0693] As used herein, the English name of the term "NNMT" is Nicotinamide N-Methyltransferase.

[0694] As used herein, the term "bp" refers to a base pair.

[0695] As used herein, the term "SST" refers to the transcription start site.

[0696] As used herein, the term "Chr11" refers to human chromosome 11 as defined according to the human genome version GCF_000001405.25 (GRCh37.p13).

[0697] As used herein, the term "human chromosome 11" refers to human chromosome 11 as defined according to human genome version GCF_000001405.25 (GRCh37.p13).

[0698] As used herein, the terms "before the transcription start site" and "after the transcription start site" do not include the transcription start site itself.

[0699] As used herein, "human chromosome 11 position 114165695" refers to the nucleotide at position 114165695 on human chromosome 11; "human chromosome 11 position 114165730" refers to the nucleotide at position 114165730 on human chromosome 11; "human chromosome 11 position 114165769" refers to the nucleotide at position 114165769 on human chromosome 11; and "human chromosome 11 position 114165804" refers to the nucleotide at position 114165804 on human chromosome 11; "position 114165938 on human chromosome 11" refers to the nucleotide at position 114165938 on human chromosome 11; "position 114166050 on human chromosome 11" refers to the nucleotide at position 114166050 on human chromosome 11; and "position 114166066 on human chromosome 11" refers to the nucleotide at position 114166066 on human chromosome 11.

[0700] As used herein, the term "mitochondria permeability transition pore" is abbreviated as mPTP (mitochondria permeability transition pore).

[0701] As used herein, the term "peptidyl-prolyl isomerase F" is abbreviated as PPIF (Peptidyl-prolyl cis-trans isomerase F).

[0702] As used herein, the term "S-adenosylmethionine" is abbreviated as SAM (S-adenosyl methionine).

[0703] As used herein, gene expression includes protein expression of the gene and / or mRNA expression of the gene, and the like.

[0704] As used herein, the term "DNMT3a" refers to DNA methyltransferase 3a, which may be used interchangeably with "DNMT3A."

[0705] As used herein, the term "DNMT3b" refers to DNA methyltransferase 3b, which may be used interchangeably with "DNMT3B."

[0706] As used herein, the term "DNMT1" refers to DNA methyltransferase 1.

[0707] As used herein, the term "UHRF1" refers to the ubiquitin-related tau protein 1, which contains a PHD and a ring finger domain.

[0708] As used herein, "deuteration" refers to the replacement of one or more hydrogen atoms in a compound or group of atoms by a deuterium atom. The deuteration can be 1-deuteration, 2-deuteration, 3-deuteration, or total deuteration.

[0709] As used herein, the term "solvate" refers to a complex formed by coordination of a compound with solvent molecules in a specific ratio.

[0710] As used herein, the term "MS-ESI" refers to electrospray ionization mass spectrometry.

[0711] As used herein, " 1 The term "H NMR" refers to nuclear magnetic resonance hydrogen spectroscopy.

[0712] It should be understood that those skilled in the art can select the substituents and substitution patterns on the compounds of the present invention to produce chemically stable compounds, and that such compounds can be synthesized using techniques known in the art and the methods described below. When substituted with one or more substituents, it should be understood that these substituents can be located on the same carbon or on different carbons, as long as a stable structure is produced.

[0713] As used herein, the terms "substituted" or "substituted" refer to the replacement of hydrogen atoms on a group of atoms with non-hydrogen atom groups, as needed to satisfy their valences, and which produce chemically stable compounds, i.e., compounds that do not spontaneously undergo transformations such as cyclization or elimination.

[0714] As used herein, "R", "R1" and "R 1 " have the same meaning and may be used interchangeably, and have the same meaning as other similar definitions.

[0715] JPEG2025511112000143.jpg6137

[0716] As used herein, the term "alkyl group" refers to a straight-chain (i.e., unbranched) or branched saturated hydrocarbon group containing only carbon and hydrogen atoms, or a group of atoms that combines straight and branched chains. When the alkyl group is specified by the number of carbon atoms (e.g., a C1-C6 alkyl group), the alkyl group has the specified number of carbon atoms (e.g., 1 to 6). For example, a C1-C4 alkyl group refers to an alkyl group containing 1 to 4 carbon atoms. Representative examples of these alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, s-butyl, t-butyl, or similar groups.

[0717] As used herein, the term "halogen atom" refers to a fluorine atom, chlorine atom, bromine atom, or iodine atom.

[0718] As used herein, the term "halogenated" refers to substitution with a halogen atom.

[0719] As used herein, the term "halogenated alkyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three, or four) hydrogen atoms of an alkyl group with halogen atoms. The alkyl group and halogen atoms are as defined above. When the halogenated alkyl group is specified by the number of carbon atoms (e.g., a C1-C8 halogenated alkyl group), the halogenated alkyl group has the specified number of carbon atoms (e.g., 1 to 8). For example, a C1-C6 halogenated alkyl group refers to a halogenated alkyl group containing 1 to 6 carbon atoms. Representative examples of these halogenated alkyl groups include, but are not limited to, -CF3, -CHF2, a monofluoroisopropyl group, a difluorobutyl group, or similar atomic groups.

[0720] As used herein, the term "cycloalkyl ring" refers to a fully or partially saturated monocyclic, bicyclic, or polycyclic (fused, bridged, or spiro) ring system. A carbon number specification (e.g., C3-C12) before a cycloalkyl ring indicates that the cycloalkyl ring has 3 to 12 ring carbon atoms. The term "C3-C8 cycloalkyl ring" refers to a fully or partially saturated monocycloalkyl or dicycloalkyl ring having 3 to 8 ring carbon atoms, including cyclopropyl, cyclobutyl, cycloamyl, cycloheptyl, or similar rings. A "spirocycloalkyl ring" refers to a bicyclic or polycyclic ring that shares a carbon atom (called a spiro atom) between monocyclic rings; these rings may contain one or more double bonds, but none of the rings has a completely conjugated π-electron system. A "fused cycloalkyl ring" refers to an all-carbon bicyclic or polycyclic ring in which each ring in the system shares an adjacent pair of carbon atoms with another ring in the system, where one or more rings may contain one or more double bonds, but neither ring has a completely conjugated pi-electron system. A "bridged cycloalkyl ring" refers to an all-carbon polycyclic ring in which any two rings share two carbon atoms that are not directly connected, where such rings may contain one or more double bonds, but neither ring has a completely conjugated pi-electron system.

[0721] As used herein, the term "cycloalkyl group" refers to a saturated or partially saturated monocyclic, bicyclic, or polycyclic (fused, bridged, or spiro) ring group. A carbon number specification (e.g., C3-C12) before the cycloalkyl group indicates that the cycloalkyl group has the specified number of ring carbon atoms (e.g., 3 to 12). For example, the term "C3-C8 cycloalkyl group" refers to a saturated or partially saturated monocycloalkyl or dicycloalkyl group having 3 to 8 ring carbon atoms, including cyclopropyl, cyclobutyl, cycloamyl, cycloheptyl, or similar groups. A "spirocycloalkyl group" refers to a bicyclic or polycyclic group sharing a carbon atom (called a spiro atom) between the rings; such groups may contain one or more double bonds, but neither ring has a completely conjugated π-electron system. A "fused cycloalkyl group" refers to a bicyclic or polycyclic group of atoms in which each ring in the system shares an entire pair of adjacent carbon atoms with another ring in the system, where one or more rings may contain one or more double bonds, but neither ring has a completely conjugated π-electron system. A "bridged cycloalkyl group" refers to a polycyclic group of atoms in which any two rings share two carbon atoms that are not directly connected, where such a group may contain one or more double bonds, but neither ring has a completely conjugated π-electron system. Representative examples of these cycloalkyl groups are as follows: JPEG2025511112000144.jpg2152

[0722] As used herein, the term "halogenated cycloalkyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three, or four) hydrogen atoms in a cycloalkyl group with halogen atoms. The cycloalkyl group and halogen atoms are as defined above. When the cycloalkyl group is specified by the number of carbon atoms (e.g., a C3-C8 halogenated cycloalkyl group), the cycloalkyl group has the specified number of ring carbon atoms (e.g., 3 to 8). For example, a C3-C8 halogenated cycloalkyl group refers to a halogenated cycloalkyl group containing 3 to 8 ring carbon atoms. Representative examples of these halogenated cycloalkyl groups include, but are not limited to, a monofluorinated cyclopropyl group, a monochlorinated cyclobutyl group, a monofluorinated cycloamyl group, a difluorinated cycloheptyl group, or similar atomic groups.

[0723] As used herein, the term "alkoxyl group" refers to the R-O-atom group, where R is an alkyl group. Alkyl groups are as defined above. When the alkoxyl group is specified by the number of carbon atoms before it (e.g., a C1-C8 alkoxyl group), the alkyl group in the alkoxyl group has the specified number of carbon atoms (e.g., 1 to 8). Representative examples of these alkoxyl groups include, but are not limited to, methoxy, ethoxy, N-propoxy, isopropoxy, t-butoxy, or similar groups.

[0724] As used herein, the term "alkylthiol group" refers to an R-S atomic group, where R is an alkyl group. The alkyl group is as defined above. An alkylthiol group specified by the number of carbon atoms before the alkylthiol group (e.g., a C1-C8 alkoxyl group) refers to an alkylthiol group in which the alkyl group has the specified number of carbon atoms (e.g., 1 to 8). Representative examples of these alkylthiol groups include, but are not limited to, a methylthio group, an ethylthio group, an N-propylthio group, an isopropylthio group, a t-butylthio group, or similar atomic groups.

[0725] As used herein, the term "halogenated alkoxyl group" refers to a halogenated alkyl group -O-, where the halogenated alkyl group is as defined above. For example, a C1-C6 halogenated alkoxyl group refers to a halogenated alkoxyl group having 1 to 6 carbon atoms. Representative examples of these halogenated alkoxyl groups include, but are not limited to, a monofluorinated methoxy group, a monofluorinated ethoxy group, a difluorinated butoxy group, or similar atomic groups.

[0726] As used herein, the term "halogenated alkylthiol group" refers to a halogenated alkyl group -S-. The halogenated alkyl group is as defined above. For example, a C1-C6 halogenated alkylthiol group refers to a halogenated alkylthiol group having 1 to 6 carbon atoms. Representative examples of these halogenated alkylthiol groups include, but are not limited to, a monofluoromethylthio group, a monofluoroethylthio group, a difluorobutylthiol group, or similar atomic groups.

[0727] As used herein, the term "cycloalkoxyl group" refers to the R-O- group, where R is a cycloalkyl group. Cycloalkyl groups are as defined above. When the cycloalkoxyl group is specified by the number of carbon atoms before the cycloalkoxyl group (e.g., a C3-C8 cycloalkoxyl group), the cycloalkyl group in the cycloalkoxyl group has the specified number of carbon atoms (e.g., 3 to 8). Representative examples of these cycloalkoxyl groups include, but are not limited to, cyclopropoxy, cyclobutoxy, and similar groups.

[0728] As used herein, the term "cycloalkylthiol group" refers to an RS-atom group, where R is a cycloalkyl group. Cycloalkyl groups are as defined above. A cycloalkylthiol group specified by the number of carbon atoms before the cycloalkylthiol group (e.g., a C3-C8 cycloalkoxyl group) refers to a cycloalkylthiol group having the specified number of carbon atoms (e.g., 3 to 8). Representative examples of these cycloalkylthiol groups include, but are not limited to, a cyclopropylthiol group, a cyclobutylthiol group, or similar groups.

[0729] As used herein, the term "halogenated cycloalkoxyl group" refers to an atomic group formed by replacing one or more (preferably one, two, three, or four) hydrogen atoms of a cycloalkoxyl group with halogen atoms. The cycloalkoxyl group and halogen atoms are as defined above. When the halogenated cycloalkoxyl group is specified by the number of carbon atoms before the halogenated cycloalkoxyl group (e.g., a C3-C8 halogenated cycloalkoxyl group), the halogenated cycloalkoxyl group has the specified number of ring carbon atoms (e.g., 3 to 8). For example, a C3-C8 halogenated cycloalkoxyl group refers to a halogenated cycloalkoxyl group containing 3 to 8 ring carbon atoms. Representative examples of these halogenated cycloalkoxyl groups include, but are not limited to, a monofluorinated cyclopropyl group -O-, a monochlorinated cyclobutyl group -O-, a monofluorinated cycloamyl group -O-, a difluorinated cycloheptyl group -O-, or similar atomic groups.

[0730] As used herein, the term "halogenated cycloalkylthiol group" refers to an atomic group formed by replacing one or more (preferably one, two, three, or four) hydrogen atoms in a cycloalkylthiol group with halogen atoms. The cycloalkylthiol group and halogen atoms are as defined above. A halogenated cycloalkylthiol group specified by the number of carbon atoms before the halogenated cycloalkylthiol group (e.g., a C3-C8 halogenated cycloalkoxyl group) refers to a halogenated cycloalkylthiol group having the specified number of ring carbon atoms (e.g., 3 to 8). For example, a C3-C8 halogenated cycloalkylthiol group refers to a halogenated cycloalkylthiol group containing 3 to 8 ring carbon atoms. Representative examples of these halogenated cycloalkylthiol groups include, but are not limited to, a monofluorinated cyclopropyl group -S-, a monochlorinated cyclobutyl group -S-, a monofluorinated cycloamyl group -S-, a difluorinated cycloheptyl group -S-, or similar atomic groups.

[0731] As used herein, the term "heterocycloalkyl ring" refers to a fully saturated or partially unsaturated ring (including, but not limited to, a 3- to 7-membered monocyclic ring, a 7- to 11-membered bicyclic ring, or an 8- to 16-membered tricyclic ring) in which at least one heteroatom is present in a ring having at least one carbon atom. The number of members preceding a heterocycle refers to the number of ring atoms in the heterocycloalkyl ring. For example, a 3- to 16-membered heterocycle refers to a heterocycle having 3 to 16 ring atoms. Each heterocycle having a heteroatom may have one or more (e.g., 1, 2, 3, or 4) heteroatoms, each independently selected from nitrogen, oxygen, or sulfur atoms, where the nitrogen or sulfur atoms may be oxidized and the nitrogen atom may also be quaternized. Representative examples of these monocyclic heterocycloalkyl rings include, but are not limited to, an azetidinyl ring, an oxetane ring, a tetrahydrofuranyl ring, a piperidine ring, and a piperazine ring. Multicyclic heterocycloalkyl rings include spiro, fused, and bridged piperazine rings, where the associated spiro, fused, and bridged heterocycles are optionally connected to other rings by a single bond or are further fused to other cycloalkyl and heterocycles through any two or more atoms on the ring.

[0732] As used herein, the term "heterocycloalkyl group" refers to a fully saturated or partially unsaturated cyclic group (including, but not limited to, a 3- to 7-membered monocyclic group, a 7- to 11-membered bicyclic group, an 8- to 16-membered tricyclic group, etc.) in which at least one heteroatom is present in a ring having at least one carbon atom. The number of members in the heterocycloalkyl group refers to the number of ring atoms in the heterocycloalkyl group. For example, a 3- to 16-membered heterocycloalkyl group refers to a heterocycloalkyl group having 3 to 16 ring atoms. Each heterocyclic ring may have one or more (e.g., 1, 2, 3, or 4) heteroatoms, each independently selected from nitrogen, oxygen, or sulfur atoms, where the nitrogen or sulfur atoms may be oxidized and the nitrogen atom may also be quaternized. Representative examples of these monocyclic heterocycloalkyl groups include, but are not limited to, azetidinyl, oxetane, tetrahydrofuranyl, piperidine, piperazine, etc. Polycyclic heterocycloalkyl groups include spirocyclic, fused-ring, and bridged-ring heterocyclic groups. Related spirocyclic, fused-ring, and bridged-ring heterocycloalkyl groups are optionally connected to other atomic groups through a single bond or are further fused to other cycloalkyl and heterocyclic rings through any two or more atoms on the ring.

[0733] The term "aryl ring" refers to an all-carbon monocyclic or fused polycyclic ring (rings sharing adjacent pairs of carbon atoms) having a conjugated π-electron system, and is an aromatic cyclic hydrocarbon compound. When the aryl ring is specified by the number of carbon atoms (e.g., a C6-C12 aryl group), the aryl ring has the specified number of ring carbon atoms (e.g., 6 to 12). Representative examples of these aryl rings include a phenyl ring and a naphthoyl ring.

[0734] As used herein, the term "aryl group" refers to an all-carbon atom monocyclic or fused polycyclic (rings sharing adjacent pairs of carbon atoms) atomic group having a conjugated π-electron system, and is an atomic group of an aromatic cyclic hydrocarbon compound. An aryl group specified by the number of carbon atoms before the aryl group (e.g., a C6-C12 aryl group) refers to an aryl group having the specified number of ring carbon atoms (e.g., 6 to 12). Representative examples of these aryl groups include a phenyl group and a naphthoyl group.

[0735] The term "heteroaryl ring" refers to an aromatic heterocyclic ring containing one or more (preferably, one, two, three, or four) heteroatoms. The ring may be a single ring (monocyclic) or a fused or covalently linked multiple rings (bicyclic, tricyclic, or polycyclic), and each heteroatom-containing heterocyclic ring may contain one or more (e.g., one, two, three, or four) heteroatoms independently selected from oxygen, sulfur, and nitrogen atoms. The number of members used to qualify a heteroaryl ring refers to the number of ring atoms in the heteroaryl ring. For example, a 5-12-membered heteroaryl ring refers to a heteroaryl ring having 5 to 12 ring atoms. Representative examples of these heteroaryl rings include, but are not limited to, pyrrole, pyrazole, imidazole, thiazole, furan, pyridine, and pyrimidine rings.

[0736] As used herein, the term "heteroaryl group" refers to an aromatic heterocyclic group having one or more (preferably, one, two, three, or four) heteroatoms, where at least one heteroatom is present in a ring containing at least one carbon atom. The group may be a single ring (monocyclic) or multiple fused or covalently linked rings (bicyclic, tricyclic, or polycyclic), and each heteroatom-containing heterocycle may have one or more (e.g., one, two, three, or four) heteroatoms independently selected from oxygen, sulfur, and nitrogen atoms. The number of members used in defining a heteroaryl group refers to the number of ring atoms in the heteroaryl group. For example, a 5-12-membered heteroaryl group refers to a heteroaryl group having 5 to 12 ring atoms. Representative examples of these heteroaryl groups include, but are not limited to, pyrrole, pyrazole, imidazole, thiazole, furan, pyridine, and pyrimidine groups.

[0737] As used herein, the term "carboxyl group" refers to a group of atoms of -COOH or -alkyl-COOH, where alkyl is as defined above. For example, a "C2-C4 carboxyl group" refers to a group of atoms of -C1-C3 alkyl-COOH. Representative examples of these carboxyl groups include, but are not limited to, -COOH, -CH2COOH, or similar groups.

[0738] As used herein, the term "ester group" refers to a group of atoms of the formula -RC(O)-O- or -C(O)-OR, where alkyl (R) is as defined above. For example, a "C2-C4 ester group" refers to a group of atoms of the formula -C1-C3 alkyl group -C(O)-O- or a group of atoms of the formula -C(O)-O-C1-C3 alkyl group. Representative examples of these ester groups include, but are not limited to, CH3C(O)O-, CH5C(O)O-, (CH3)2CHC(O)O-, -C(O)OCH3, -C(O)OC2H5, or similar groups.

[0739] As used herein, the term "acylamino group" refers to the group RC(O)-N- or the group -C(O)-NR, where the alkyl group (R) is as defined above. For example, a "C2-C4 acylamino group" refers to the group -C1-C3 alkyl group -C(O)-N- or the group -C(O)-N-C1-C3 alkyl group. Representative examples of these acylamino groups include, but are not limited to, CH3C(O)-N-, CH5C(O)-N-, (CH3)2CHC(O)-N-, -C(O)-N-CH3, -C(O)-N-C2H5, or similar groups.

[0740] As used herein, the term "acyl group" means JPEG2025511112000145.jpg67. Here, R represents an alkyl group, and the alkyl group is as defined above. When the acyl group is specified by the number of carbon atoms before it (e.g., a C2-C6 acyl group), the acyl group has the specified number of ring carbon atoms (e.g., 2 to 6). For example, a C2-C4 acyl group refers to an atomic group having the structure C1-C3 alkyl group -C(O)-. Representative examples of these acyl groups include, but are not limited to, CH3C(O)-, C2H5C(O)-, or similar atomic groups.

[0741] As used herein, "-C(O)-" and JPEG2025511112000146.jpg88 may be used interchangeably.

[0742] As used herein, an "amino group" refers to -NH2, either alone or as part of another substituent.

[0743] As used herein, a "nitro group" alone or as part of another substituent refers to --NO2.

[0744] As used herein, a "cyano group" alone or as part of another substituent refers to -CN.

[0745] As used herein, a "hydroxyl group" refers to -OH, either alone or as part of another substituent.

[0746] As used herein, a "mercapto group" refers to -SH, either alone or as part of another substituent.

[0747] As used herein, a "sulfuryl group" alone or as part of another substituent means Represents JPEG2025511112000147.jpg77.

[0748] As used herein, a "phenylsulfonyl group," alone or as part of another substituent, includes - Represents JPEG2025511112000148.jpg711.

[0749] As used herein, "CF3COO - " and "CF3COO - " may be used interchangeably.

[0750] In this specification, all substituents are meant to be unsubstituted unless expressly stated as "substituted." The term "substituted" refers to a substituent replacing one or more hydrogen atoms on an atomic group. The substituents are those described above or appearing in each Example. Preferably, the "substituted" refers to one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on a ring or atomic group being replaced with a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a halo and substituted by a substituent selected from a halogen atom, a nitro group, —CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, a C6-C12 aryl group, a 5- to 10-membered heteroaryl group, and a 5- to 10-membered heterocycloalkyl group. Unless otherwise specified, an optionally substituted group may have a substituent selected from a specified group at any substitutable position of the group, and the substituent may be the same or different at each position.

[0751] In the present invention, "prevention" refers to a method of preventing the onset of a disease and / or its associated symptoms or protecting a subject from contracting the disease. As used herein, "prevention" also refers to delaying the onset of a disease and / or its associated symptoms, as well as reducing a subject's risk of contracting the disease.

[0752] "Treatment" according to the present invention means slowing or terminating the progression of a disease or eliminating the disease, but does not require 100% inhibition, elimination, or reversal. In some embodiments, the compound of the present invention reduces, inhibits, and / or reverses the associated disease (e.g., tumor) and its complications by at least about 10%, 30%, 50%, 80%, or 100%, etc., compared to levels observed in the absence of the compound.

[0753] compound As used herein, "a compound of the present invention," "the compound of the present invention," "a compound of Formula I of the present invention," or "a compound of Formula I," may be used interchangeably, and refer to a compound having the chemical structure of Formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof. This term should be understood to include mixtures of the above components. JPEG2025511112000149.jpg1420 I

[0754] In particular, the compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, is described in the first aspect of the present invention.

[0755] It should be understood that the present invention is such that when ring B is absent, the structure of the compound of formula I is as shown in structure I-1. JPEG2025511112000150.jpg119

[0756] In the present invention, when n is 0, JPEG2025511112000151.jpg1111 It should be understood that the image is JPEG2025511112000152.jpg1010.

[0757] Typically, the compounds of formula I of the present invention are the specific compounds (including their salts or free forms free of base ions) prepared by the embodiments of the present invention.

[0758] The compounds of formula I of the present invention may be prepared by organic synthesis methods known in the art.

[0759] According to the research of the present invention, the compounds of the present invention have more obvious therapeutic effects on tumor cells with low expression, no expression, low activation or inactivation of mitochondrial permeability transition pore, tumor cells with low expression, no expression, low activation or inactivation of peptidylprolyl isomerase F, tumor cells with low expression or no expression of NNMT gene, tumor cells with high expression of DNA methyltransferase, tumor cells with high expression of UHRF1, tumor cells with hypermethylation of nucleotide sites in NNMT gene and / or tumor cells with hypermethylation of DNA CpG sites in NNMT gene region. Tumor cells with low expression, no expression, low activation or inactivation of the mitochondrial permeability transition pore, tumor cells with low expression, no expression, low activation or inactivation of peptidylprolyl isomerase F, tumor cells with low expression or no expression of the NNMT gene, tumor cells with high expression of DNA methyltransferase, tumor cells with high expression of UHRF1, tumor cells with hypermethylation of nucleotide sites in the NNMT gene and / or tumor cells with hypermethylation of DNA CpG sites in the NNMT gene region are sensitive to the compounds of the present invention.

[0760] In the present invention, the term "pharmaceutically acceptable salt" refers to a salt formed by a compound of the present invention with an acid or base and suitable for use as a drug. Pharmaceutically acceptable salts include inorganic salts and organic salts. One type of preferred salt is a salt formed by a compound of the present invention with an acid, and acids suitable for forming such salts include, but are not limited to, inorganic acids such as hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, trifluoroacetic acid, trifluoroformic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenemethanesulfonic acid, and benzenesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. One type of preferred salt is a metal salt formed by a compound of the present invention and a base, and bases suitable for forming such salts include, but are not limited to, inorganic bases such as sodium hydroxide, potassium hydroxide, sodium carbonate, sodium bicarbonate, and sodium phosphate, and organic bases such as ammonia, triethylamine, and diethylamine.

[0761] The compounds of formula I of the present invention may be converted into their pharmaceutically acceptable salts by conventional methods, for example, by adding a solution of a suitable acid to a solution of the compound, and removing the solvent after complete salification, the suitable salt of the compound of the present invention can be obtained.

[0762] Preferably, the compounds of the present invention are those prepared in the Examples of the present invention.

[0763] Mitochondrial permeability transition pore In the present invention, the English name of the term "mitochondria permeability transition pore" is mitochondria permeability transition pore, abbreviated as mPTP.

[0764] The significantly superior therapeutic effect of the compounds of the present invention on tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore means that tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore are sensitive to the compounds of the present invention.

[0765] Preferably, the tumor in which the mitochondrial permeability transition pore is under-expressed, unexpressed, under-active or inactive is as described in the third aspect of the present invention.

[0766] In the present invention, the expression level or activity of the mitochondrial permeability transition pore is measured using a conventional method, for example, by measuring the activity of mPTP or measuring the expression level of mPTP at the protein level or mRNA level.

[0767] Peptidylprolyl isomerase F In the present invention, the English name of the term "peptidyl-prolyl isomerase F" is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF.

[0768] The significantly superior therapeutic effect of the compounds of the present invention on tumors with low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F means that tumors with low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F are sensitive to the compounds of the present invention.

[0769] Preferably, the tumor with low expression, no expression, low activity or inactivity of peptidylprolyl isomerase F is as described in the third aspect of the present invention.

[0770] In the present invention, the expression level or activity of peptidylprolyl isomerase F is measured by a conventional method, for example, by measuring the activity of PPIF or measuring the expression level of PPIF at the protein level or mRNA level.

[0771] NNMT gene In the present invention, the English name of NNMT is Nicotinamide N-Methyltransferase. Different databases have different identification numbers for the NNMT gene, such as HGNC: 7861; Entrez Gene: 4837; Ensembl: ENSG00000166741; OMIM: 600008; UniProtKB: P40261.

[0772] According to the human genome version GCF_000001405.25 (GRCh37.p13), the NNMT gene region is located at positions 114,128,528 to 114,184,258 on human chromosome 11, and is a 55,731-bp DNA sequence. This region includes the NNMT gene promoter region, NNMT gene exon region, and NNMT gene intron region, and the NNMT gene transcription start site is at position 114,166,535.

[0773] The NNMT gene promoter region is the nucleotide sequence from bp 114,164,535 to bp 114,167,034 on human chromosome 11, i.e., the sequence from 2,000 bp (bold) before the transcription start site of the NNMT gene to the transcription start site itself and 499 bp (underlined) after it. The NNMT gene promoter region has a total length of 2,500 bp, and its nucleotide sequence is shown in the following SEQ ID NO:1.

[0774] SEQ ID NO: 1: GAGGAGGTGCTTGCCAGACACTGGGTCATGGCAGTGGTCGGTGAAGCTGCAGTTGCCTAGGGCAGGGATGGAGAGAGAGTCTGGGCATGAGGAGAGGGTCTCGGGATGTTTGGCTGGACTAGATTTTACAGAAAGCCTTATCCAGGCTTTTAAAATTACTCTTTCCAGACTTCATCTGAGACTCCTTCTTCAGCCAACATTCCTTAGCCCTGAATACATTTCCTATCCTCATCTTTCCCTTCTTTTTTTTCCTTTCTTTTACATGTTTAAATTTAAACCATTCTTCGTGACCCCTTTTCTTGGGAGATTCATGGCAAGAACGAGAAGAATGATGGTGCTTGTTAGGGGATGTCCTGTCTCTCTGAACTTTGGGGTCCTATGCATTAAATAATTTTCCTGACGAGCTCAAGTGCTCCCTCTGGTCTACAATCCCTGGCGGCTGGCCTTCATCCCTTGGGCAAGCATTGCATACAGCTCATGGCCCTCCCTCTACCATACCC .

[0775] In the present invention, the region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site corresponds to positions 951-2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0776] In the present invention, the region from 1050 bp before the transcription initiation site of the NNMT gene to 193 bp before the transcription initiation site corresponds to positions 951-1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0777] In the present invention, the region from 840 bp before the transcription initiation site of the NNMT gene to 469 bp before the transcription initiation site corresponds to positions 1161-1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0778] In the present invention, the positions of the nucleotide sequence of SEQ ID NO:1 corresponding to positions 114165695, 114165730, 114165769, 114165804, 114165938, 114166050 and 114166066 of human chromosome 11 are shown in Table 1, respectively.

[0779] [Table 1]

[0780] DNA methylation DNA methylation is a form of chemical modification of DNA that alters gene expression without changing the DNA sequence. Many studies have shown that DNA methylation may alter chromatin structure, DNA morphology, DNA stability, and DNA-protein interaction patterns, thereby regulating gene expression.

[0781] DNA methylation is one of the first and most extensively studied epigenetic regulators. Broadly defined, DNA methylation refers to the chemical modification process in which specific bases in DNA sequences acquire a single methyl group via covalent bonding using S-adenosylmethionine as the methyl donor under the catalysis of DNA methyltransferase 1. This DNA methylation modification can occur at positions such as the C-5 position of cytosine, the N-6 position of adenine, and the N-7 position of guanine. In general, DNA methylation refers to the process in which the fifth carbon atom of cytosine in CpG dinucleotides is methylated. The resulting product, called 5-methylcytosine (5-mC), is the predominant form of DNA methylation in eukaryotes, including plants and animals. DNA methylation is a relatively stable modification that can be inherited to new generations of DNA during the DNA replication process under the action of DNA methyltransferases, making it an important regulator of epigenetic inheritance.

[0782] DNA methylation reactions can be divided into two types: the first type, in which DNA with two unmethylated strands is methylated, is called de novo methylation, and the second type, in which double-stranded DNA with one methylated strand is methylated on the other unmethylated strand, is called maintenance methylation.

[0783] Typically, DNA methylation is the methylation of DNA CpG sites. CpG dinucleotides are distributed unevenly throughout the human genome, with some segments of the genome retaining CpGs at higher than normal rates. CpG-enriched regions (also known as CpG islands) are primarily located in gene promoters and exon regions, and over 60% of gene promoters contain CpG islands. Here, CpG stands for cytosine (C)-phosphate (p)-guanine (G).

[0784] Intracellular gene expression is regulated by various mechanisms, including signal transduction pathways, transcription factors, and epigenetic modifications. DNA methylation is an important method by which epigenetic modifications regulate gene expression. The DNA methylation level in a specific gene region always affects the expression level of that gene. DNA methylation, an epigenetic modification, has a more stable effect on gene expression and is less susceptible to the extracellular environment than regulation of gene expression by signal transduction pathways and transcription factors. DNA methylation is an ideal biomarker because it can be easily detected using existing technologies.

[0785] tumor According to the present study, the compounds of the present invention are used for the prevention and / or treatment of tumors.

[0786] In the present invention, the terms "tumor," "carcinosis," "cancer," and "mass" may be used interchangeably.

[0787] In a preferred embodiment of the present invention, the "tumor" described in the present invention includes a tumor in which the mitochondrial permeability transition pore is underexpressed, absent, underactive, or inactive. As a representative example, the tumor in which the mitochondrial permeability transition pore is underexpressed, absent, underactive, or inactive is as described in the third aspect of the present invention.

[0788] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor with low expression, no expression, low activity, or inactivity of peptidyl prolyl isomerase F. As a representative example, a tumor with low expression, no expression, low activity, or inactivity of peptidyl prolyl isomerase F according to the present invention is as described in the third aspect of the present invention.

[0789] In a preferred embodiment of the present invention, the "tumor" described in the present invention includes tumors with low or no expression of the NNMT gene. As a representative example, the tumors with low or no expression of the NNMT gene described in the present invention are as described in the third aspect of the present invention.

[0790] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor with high expression of DNA methyltransferase. As a representative example, the tumor with high expression of DNA methyltransferase according to the present invention is as described in the third aspect of the present invention.

[0791] The DNA methyltransferase according to the present invention includes, but is not limited to, DNMT1, DNMT3a, DNMT3b, or a combination thereof. Preferably, the DNA methyltransferase according to the present invention includes DNMT1.

[0792] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor with high expression of DNMT1. As a representative example, the tumor with high expression of DNMT1 according to the present invention is as described in the third aspect of the present invention.

[0793] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor with high expression of DNMT3a. As a representative example, the tumor with high expression of DNMT3a according to the present invention is as described in the third aspect of the present invention.

[0794] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor with high expression of DNMT3b. As a representative example, the tumor with high expression of DNMT3b according to the present invention is as described in the third aspect of the present invention.

[0795] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor with high expression of UHRF1 (ubiquitin-related tau protein 1 containing PHD and ring finger domains). As a representative example, the tumor with high expression of UHRF1 according to the present invention is as described in the third aspect of the present invention.

[0796] In a preferred embodiment of the present invention, the "tumor" according to the present invention includes a tumor having hypermethylation of the nucleotide site of the NNMT gene. As a representative example, the tumor having hypermethylation of the nucleotide site of the NNMT gene according to the present invention is as described in the third aspect of the present invention.

[0797] In a preferred embodiment of the present invention, the "tumor" described in the present invention includes a tumor having hypermethylation of DNA CpG sites in the NNMT gene region. As a representative example, the tumor having hypermethylation of DNA CpG sites in the NNMT gene region described in the present invention is as described in the third aspect of the present invention.

[0798] In the present invention, representative tumor types corresponding to various tumor cell lines are shown in Table 2 below.

[0799] [Table 2]

[0800] Antitumor drugs In the present invention, the antitumor drug can be the compound of formula I of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof.

[0801] use The present invention provides the use of the compounds of the present invention in the prevention and / or treatment of tumors.

[0802] In particular, the compounds of the present invention have significantly excellent preventive and therapeutic effects on tumors with low expression, no expression, low activity, or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity, or inactivity of peptidyl prolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. In other words, tumors with low expression, no expression, low activity, or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity, or inactivity of peptidyl prolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene, and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region are sensitive to the compounds of the present invention. The expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene, and / or the methylation level of the DNA CpG site in the NNMT gene region can serve as markers for determining whether the compounds of the present invention are suitable for the refinement of tumor cell treatment. These markers can effectively identify tumor patients who are sensitive to the compounds of the present invention and improve their therapeutic effects, and may also avoid administering the compounds of the present invention to tumor patients who are not sensitive to them, thereby realizing the refinement of tumor treatment.

[0803] The present invention provides a method for preventing and / or treating tumors, which comprises administering the compound of the present invention to a subject.

[0804] The compounds of the present invention have significantly excellent therapeutic effects on tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidylprolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. In the process of preventing and / or treating tumors, first, an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, a promoter of methylation at nucleotide sites of the NNMT gene, and / or a promoter of methylation at DNA CpG sites in the NNMT gene region is administered to the subject so that the tumor in the subject becomes under-expressed, non-expressed, underactivated, or inactivated in the mitochondrial permeability transition pore, under-expressed, non-expressed, underactivated, or inactivated in the peptidyl prolyl isomerase F, under-expressed or non-expressed in the NNMT gene, over-expressed in the DNA methyltransferase, over-expressed in the UHRF1, hypermethylated in the nucleotide sites of the NNMT gene, and / or hypermethylated in the DNA CpG sites in the NNMT gene region; and then the compound of the present invention is administered to prevent and / or treat the tumor. Therefore, we have developed compounds that can significantly enhance the antitumor effect when used in combination with an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidylprolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, an promoter of methylation at the nucleotide site of the NNMT gene, and / or an promoter of methylation at the DNA CpG site in the NNMT gene region. The compound of the present invention can be used in combination with an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidylprolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, an promoter of methylation at the nucleotide site of the NNMT gene, and / or an promoter of methylation at the DNA CpG site in the NNMT gene region, thereby significantly enhancing the therapeutic effect of the compound of the present invention against tumors.

[0805] In another preferred embodiment, the subject to be treated is a human or non-human mammal (eg, rodents, rabbits, monkeys, livestock, dogs, cats).

[0806] In the present invention, the method for under-expressing, not expressing, under-activating or inactivating the mitochondrial permeability transition pore, under-expressing, not expressing, under-activating or inactivating peptidyl prolyl isomerase F, under-expressing or not expressing the NNMT gene, over-expressing DNA methyltransferase, over-expressing UHRF1, hypermethylating the nucleotide site of the NNMT gene, and / or hypermethylating the DNA CpG site of the NNMT gene region in a tumor is not particularly limited, and for example, by means of gene insertion, gene knockout, gene suppression (e.g., introducing shRNA), etc., the tumor can be under-expressed, not expressed, under-activated or inactivated the mitochondrial permeability transition pore, under-expressed, not expressed, under-activated or inactivated peptidyl prolyl isomerase F, under-expressing or not expressing the NNMT gene, over-expressing DNA methyltransferase, over-expressing UHRF1, hypermethylating the nucleotide site of the NNMT gene, and / or hypermethylating the DNA CpG site of the NNMT gene region. The specificity is to ensure hypermethylation of CpG sites.

[0807] In another preferred embodiment, said inhibitor of peptidyl prolyl isomerase F comprises shRNA.

[0808] In another preferred example, the nucleotide sequence of the shRNA is GTTCTTCATCTGCACCATAAA.

[0809] marker The present invention provides markers for determining whether the compounds of the present invention are suitable for tumor prevention and / or treatment in tumor patients, and the markers include the expression level or activity level of the mitochondrial permeability transition pore, the expression level or activity level of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of nucleotide sites in the NNMT gene, and / or the methylation level of DNA CpG sites in the NNMT gene region.

[0810] In one embodiment, the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidylprolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of the nucleotide site of the NNMT gene and / or the methylation level of the DNA CpG site in the NNMT gene region serve as markers for determining whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients. and / or when, in tumor cells of a tumor patient, there is low expression, no expression, low activation or inactivation of the mitochondrial permeability transition pore, there is low expression, no expression, low activation or inactivation of peptidylprolyl isomerase F, there is low expression or no expression of the NNMT gene, there is high expression of DNA methyltransferase, there is high expression of UHRF1, there is hypermethylation of nucleotide sites in the NNMT gene, and / or there is hypermethylation of DNA CpG sites in the NNMT gene region, then said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is suitable for the prevention and / or treatment of tumors in said tumor patient; and / or This includes, but is not limited to, the fact that, in tumor cells of a tumor patient, there is high expression or high activation of the mitochondrial permeability transition pore, there is high expression or high activation of peptidylprolyl isomerase F, there is high expression of the NNMT gene, there is low expression of DNA methyltransferase, there is low expression of UHRF1, there is hypomethylation of nucleotide sites in the NNMT gene, and / or there is hypomethylation of DNA CpG sites in the NNMT gene region, making the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, unsuitable for tumor prevention and / or treatment in the tumor patient.

[0811] Specifically, the tumors in which the mitochondrial permeability transition pore is underexpressed, not expressed, low in activity or inactivated, the tumors in which peptidylprolyl isomerase F is underexpressed, not expressed, low in activity or inactivated, the tumors in which the NNMT gene is underexpressed or not expressed, the tumors in which DNA methyltransferase (e.g., DNMT1) is overexpressed, the tumors in which UHRF1 is overexpressed, the tumors in which nucleotide sites in the NNMT gene are hypermethylated, and / or the tumors in which DNA CpG sites in the NNMT gene region are hypermethylated are as described in the third aspect of the present invention.

[0812] Specifically, the tumors with high expression or activation of the mitochondrial permeability transition pore, the tumors with high expression or activation of peptidylprolyl isomerase F, the tumors with high expression of the NNMT gene, the tumors with low expression of DNA methyltransferase (e.g., DNMT1), the tumors with low expression of UHRF1, the tumors with hypomethylation of nucleotide sites in the NNMT gene, and / or the tumors with hypomethylation of DNA CpG sites in the NNMT gene region are as described in the fourth aspect of the present invention.

[0813] The present invention further provides the use of the marker (or its expression level) or detection reagent to prepare a detection reagent kit, which is used to determine whether the compound of the present invention is suitable for tumor prevention and / or treatment in tumor patients.

[0814] Compositions or formulations, combinations of active ingredients and medical kits, and methods of administration Preferably, the composition according to the present invention is a pharmaceutical composition, and the composition according to the present invention may comprise a pharmaceutically acceptable carrier.

[0815] As used herein, "pharmaceutically acceptable carrier" refers to one or more compatible solid, semi-solid, liquid, and gel fillers that are suitable for human or animal use and must be of sufficient purity and sufficiently low toxicity. "Compatibility" refers to the ability of each component in a drug composition to be mixed with the active ingredient of the drug and to prevent significant loss of efficacy when mixed together.

[0816] In the present invention, the pharmaceutically acceptable carrier is not particularly limited and may be selected from materials commonly used in the art, prepared by conventional methods, or purchased from the market. Some representative examples of pharmaceutically acceptable carriers include cellulose and its derivatives (e.g., methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, etc.), gelatin, talc, solid lubricants (e.g., stearic acid and magnesium stearate), calcium sulfate, vegetable oils (e.g., soybean oil, sesame oil, peanut oil, olive oil, etc.), polyhydric alcohols (e.g., propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (e.g., Tween), wetting agents (e.g., sodium lauryl sulfate), buffers, chelating agents, thickeners, pH adjusters, penetration enhancers, colorants, flavorings, stabilizers, antioxidants, preservatives, bacteriostats, heat-free raw water, etc.

[0817] In a preferred embodiment of the present invention, the composition or formulation is in the form of a solid, liquid or semi-solid.

[0818] In a preferred embodiment of the present invention, the composition or preparation is an oral preparation, an external preparation, or an injectable preparation.

[0819] Representative examples of the type of the composition or preparation include tablets, injections, infusions, ointments, gels, solutions, pills, and coatings.

[0820] The drug formulation should be consistent with the dosage regimen. The agents of the present invention may also be used in conjunction with other synergistic therapeutic agents (before, during, or after use). When using a drug composition or formulation, a safe and effective amount of the drug is administered to a subject (e.g., a human or non-human mammal). The safe and effective amount is usually at least about 10 μg / kg of body weight, in most cases less than about 8 mg / kg of body weight, and preferably about 10 μg / kg to about 1 mg / kg of body weight. Of course, the specific dosage must be determined taking into account factors such as the route of administration and the patient's health condition, and these factors are within the scope of a skilled physician.

[0821] The present invention mainly has the following excellent technical effects.

[0822] The present invention has developed compounds that have significantly superior and more precise therapeutic effects on tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidylprolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. Tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region are highly sensitive to the compound of the present invention, i.e., the compound of the present invention has a significantly superior therapeutic effect on tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidyl prolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region. Therefore, the compounds of the present invention can be used to perform precision therapy on tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidylprolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region, thereby improving the therapeutic efficacy and potentially avoiding the administration of the compounds of the present invention to tumor patients who are not sensitive to them.Therefore, the compounds of the present invention, which have significantly superior therapeutic effects on tumors with low expression, no expression, low activity or inactivity of the mitochondrial permeability transition pore, tumors with low expression, no expression, low activity or inactivity of peptidylprolyl isomerase F, tumors with low expression or no expression of the NNMT gene, tumors with high expression of DNA methyltransferase, tumors with high expression of UHRF1, tumors with hypermethylation of nucleotide sites in the NNMT gene and / or tumors with hypermethylation of DNA CpG sites in the NNMT gene region, have advantages such as better preventive and therapeutic effects on tumors, low drug dosage and minimal side effects, and not only improve the preventive and therapeutic effects of the compounds of the present invention on tumors, but also reduce side effects and improve patient compliance.

[0823] We will now further illustrate the present invention in conjunction with specific examples. It should be understood that these embodiments are intended only to illustrate the present invention, without limiting the scope of the present invention. In the following examples, experimental methods that do not specify specific conditions generally follow general conditions or comply with manufacturer recommendations. Unless otherwise specified, percentages and ratios are calculated by weight. [Example]

[0824] The English name for the term "mitochondria permeability transition pore" is mitochondria permeability transition pore, abbreviated as mPTP.

[0825] The English name for the term "peptidyl-prolyl isomerase F" is Peptidyl-prolyl cis-trans isomerase F, abbreviated as PPIF.

[0826] DNMT3a refers to DNA methyltransferase 3a, and its English name is DNA methyltransferase 3a, NCBI entrez gene:1788; Uniprotkb / Swiss-port: Q9Y6K1.

[0827] DNMT3b refers to DNA methyltransferase 3b, and its English name is NDNA methyltransferase 3b, CBI entrez gene:1789; Uniprotkb / Swiss-port: Q9UBC3.

[0828] DNMT1 refers to DNA methyltransferase 1, and its English name is DNA methyltransferase 1, NCBI entrez gene:1786; Uniprotkb / Swiss-port: P26358.

[0829] UHRF1 refers to ubiquitin-related tau protein 1 containing PHD and ring finger domains, and its English name is NCBI entrez gene:29128; Uniprotkb / Swiss-port:Q96T88.

[0830] The English name of the NNMT gene is Nicotinamide N-Methyltransferase.

[0831] The nucleotide sequence of the promoter region of the NNMT gene is shown in SEQ ID NO:1.

[0832] The region from 1050 bp before the transcription start site of the NNMT gene to 499 bp after the transcription start site corresponds to positions 951 to 2500 of the nucleotide sequence shown in SEQ ID NO:1.

[0833] The region from 1050 bp before the transcription start site of the NNMT gene to 193 bp before the transcription start site corresponds to positions 951 to 1808 of the nucleotide sequence shown in SEQ ID NO:1.

[0834] The region from 840 bp before the transcription start site of the NNMT gene to 469 bp before the transcription start site corresponds to positions 1161 to 1532 of the nucleotide sequence shown in SEQ ID NO:1.

[0835] Example 1 Synthesis of compound AB24994 The chemical structure of compound AB24994 is as follows: JPEG2025511112000155.jpg1620 AB24994 Step (1): JPEG2025511112000156.jpg1130

[0836] Compound 1 (300 mg, 2.54 mmol) was dissolved in acetic acid (10 mL), palladium on carbon (30 mg) was added, and the mixture was stirred under hydrogen gas at 80 °C for 16 h. A new compound was detected by thin-layer chromatography, and the solution was filtered and concentrated under reduced pressure to remove the organic solvent. Finally, a purification step was performed to obtain compound 2 (200 mg).

[0837] Step 2): JPEG2025511112000157.jpg1755

[0838] Compound 2 (200 mg, 1.65 mmol) was dissolved in dioxane (10 mL), and compound 3 (337 mg, 1.65 mmol) and cyclohexane-1,2-diamine (40 mg, 0.33 mmol) were added. Potassium phosphate (1.75 g, 8.25 mmol) and copper iodide (7 mg, 0.033 mmol) were then added, followed by stirring at 110 °C for 16 h. A new compound was detected by thin-layer chromatography, and the solution was filtered and concentrated under reduced pressure to remove the organic solvent. Compound 4 (100 mg) was obtained after purification via column chromatography (methanol / dichloromethane = 0-10%).

[0839] Step 3): JPEG2025511112000158.jpg2263

[0840] Compound 4 (100 mg, 0.51 mmol) was dissolved in acetonitrile (10 mL), and compound 5 (160 mg, 0.76 mmol) was added. The mixture was stirred at room temperature for 16 h. After detecting a new compound by thin-layer chromatography, the mixture was filtered and concentrated under reduced pressure to remove the organic solvent. Finally, compound AB24994 (10 mg) was obtained through a purification step (column: Sharpsil-U C18 (250 mm x 30 x 10 μm, 100 Å); mobile phase: 0.1% aqueous trifluoroacetic acid + acetonitrile; gradient elution: ACN content from 5% to 25% from 1 min to 20 min, and from 25% to 35% from 20 min to 50 min).

[0841] MS-ESI of compound AB24994 1 1 H NMR is as follows:

[0842] MS-ESI: calculated value + :329.16, Actual value:329.15 1 H NMR(400 MHz, dmso-d6) δ 8.18(d, J = 6.9 Hz, 1H), 8.13(s, 1H), 7.91(d, J = 7.5 Hz, 2H), 7.52(d, J = 6.6 Hz, 4H), 7.43(d, J = 7.4 Hz, 2H), 7.34(s, 1H), 7.12(d, J = 6.8 Hz, 1H), 5.95(s, 2H), 4.39(s, 2H), 3.31(s, 2H), 2.41(s, 3H).

[0843] Example 2 Synthesis of compound AB24995 The chemical structure of compound AB24995 is as follows: JPEG2025511112000159.jpg1826 AB24995 Step 1): JPEG2025511112000160.jpg1444

[0844] Compound 1 (300 mg, 1.44 mmol) was dissolved in acetic acid (10 mL), palladium on carbon (30 mg) was added, and the mixture was stirred under hydrogen gas at 80 °C for 16 h. When a new compound was detected by thin-layer chromatography, the mixture was filtered and the solution was concentrated under reduced pressure to remove the organic solvent. Compound 2 (160 mg) was obtained after purification via column chromatography (methanol / dichloromethane = 10 / 1).

[0845] Step 2): JPEG2025511112000161.jpg2272

[0846] Compound 2 (100 mg, 0.48 mmol) was dissolved in acetonitrile (10 mL), compound 3 (122 mg, 0.57 mmol) was added, and the mixture was stirred at room temperature for 16 hours. A new compound was detected by thin-layer chromatography, and the mixture was filtered and concentrated under reduced pressure to remove the organic solvent. Compound AB24995 (100 mg) was obtained through a purification step using column chromatography (methanol / dichloromethane = 10 / 1).

[0847] MS-ESI of compound AB24995 1 1 H NMR is as follows:

[0848] MS-ESI: calculated value + :343.44, Actual value:343.30. 1 H NMR(400 MHz, dmso-d6) δ 8.15(d, J = 5.4 Hz, 1H), 7.91(d, J = 7.8 Hz, 3H), 7.39(d, J = 10.4 Hz, 4H), 7.35(s, 3H), 7.08(d, J = 6.3 Hz, 1H), 5.88(s, 2H), 4.71(s, 2H), 3.83(d, J = 7.9 Hz, 2H), 3.16(d, J = 8.0 Hz, 2H), 2.40(s, 3H).

[0849] Example 3 Synthesis of compound AB27101 The chemical structure of compound AB27101 is as follows: JPEG2025511112000162.jpg1927 AB27101 Step 1): JPEG2025511112000163.jpg1573

[0850] Compound 1 (4.4 g, 20 mmol) was dissolved in anhydrous N,N-dimethylformamide (150 mL). Compound 2 (4.28 g, 42 mmol), bistriphenylphosphine palladium dichloride (421 mg, 0.6 mol), N,N-diisopropylethylamine (8.25 g, 64 mmol), and cuprous iodide (190 mg, 1 mmol) were added, and the mixture was stirred overnight at room temperature after flushing with nitrogen three times. Thin-layer chromatography (TLC) revealed a new compound. The product was diluted with water (250 mL), and the organic phase was extracted and combined with ethyl acetate (100 mL x 3). The organic phase was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the organic solvent. Compound 3 (3.5 g) was purified via column chromatography (ethyl acetate:petroleum ether = 0-50%).

[0851] Step 2): JPEG2025511112000164.jpg1763

[0852] Compound 3 (3.5 g, 17.9 mmol) was dissolved in dioxane (100 mL), potassium tert-butoxide (1 mol) in tetrahydrofuran (53.8 mL) was added, and the mixture was purged with nitrogen three times. The mixture was heated to 110 °C and stirred for 16 h. When a new compound was detected by thin-layer chromatography, the product was diluted with water (200 mL), and the organic phase was extracted and combined with ethyl acetate (100 mL x 3). The organic phase was washed with saturated brine (300 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the organic solvent. Compound 4 (2.2 g) was purified by column chromatography (ethanol / dichloromethane = 0-10%).

[0853] Step 3): JPEG2025511112000165.jpg1149

[0854] Compound 4 (800 mg, 4.12 mmol) was dissolved in glacial acetic acid (50 mL), followed by the addition of palladium on carbon (100 mg) and stirring under a hydrogen atmosphere at 80°C for 16 hours. When a new compound was detected by thin-layer chromatography, the product was filtered through diatomaceous earth and the filtrate was centrifuged to give compound 5 (100 mg).

[0855] Step 4): JPEG2025511112000166.jpg1771

[0856] Compound 5 (80 mg, 0.41 mmol) was dissolved in acetone (10 mL), and then compound 6 (379 mg, 1.22 mmol) and sodium acetate (168 mg, 2.05 mmol) were added. The mixture was then purged with nitrogen three times and stirred at 80°C for 16 hours. When a new compound was detected by thin layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27101 (15.8 mg) was obtained through a purification process via thin layer chromatography.

[0857] MS-ESI of compound AB27101 and 1 1 H NMR is as follows:

[0858] MS-ESI: calculated value + :425.42, Actual value:425.55. 1 H NMR(400 MHz, CD3OD) δ 8.14(d, J = 8.1 Hz, 1H), 8.08(d, J = 6.3 Hz, 1H), 7.94(s, 1H), 7.37(d, J = 6.4 Hz, 7H), 6.80(d, J = 6.2 Hz, 1H), 5.50(d, J = 11.5 Hz, 1H), 5.41(s, 1H), 4.84 - 4.79(m, 1H), 3.82 - 3.69(m, 1H), 3.48 - 3.35(m, 1H), 3.10(dd, J = 17.0, 5.6 Hz, 1H), 2.81(d, J = 11.1 Hz, 1H), 2.64(s, 1H).

[0859] Example 4 Synthesis of compound AB24997 The chemical structure of compound AB24997 is as follows: JPEG2025511112000167.jpg1829 AB24997 Step 1): JPEG2025511112000168.jpg2070

[0860] Compound 1 (240 mg, 0.78 mmol) was dissolved in acetonitrile (10 mL), and then compound 2 (150 mg, 0.78 mmol) was added. The mixture was then purged with nitrogen three times and stirred overnight at room temperature. When a new compound was detected by thin-layer chromatography, the solution was immediately concentrated under reduced pressure to remove the organic solvent. Compound AB24997 (30 mg) was obtained through a purification process using column chromatography (ethanol / dichloromethane = 0-30%).

[0861] MS-ESI of compound AB24997 1 1 H NMR is as follows:

[0862] MS-ESI: Calculated value [M-Br - ] + :437.44, Actual value:437.20. 1 H NMR(400 MHz, dmso-d6) δ 9.44(s, 1H), 8.60(s, 1H), 8.38(s, 1H), 8.18(s, 1H), 8.04(s, 1H), 7.53(s, 1H), 7.42(s, 1H), 7.36(s, 5H), 7.16(s, 1H), 6.30(s, 1H), 5.68(s, 2H), 3.04(d, J = 12.4 Hz, 1H), 2.66(s, 1H).

[0863] Example 5 Synthesis of compound AB27171 The chemical structure of compound AB27171 is as follows: JPEG2025511112000169.jpg2124 AB27171 Step 1) JPEG2025511112000170.jpg1669

[0864] Compound 1 (2.5 g, 11.36 mmol) was dissolved in anhydrous N,N-dimethylformamide (50 mL). Compound 2 (4.3 g, 34.08 mmol), dimethylferrocene palladium dichloride (519 g, 0.56 mmol), lithium chloride (481 mg, 11.36 mmol), and sodium carbonate (2.4 g, 22.72 mmol) were added, and the mixture was stirred overnight at room temperature after flushing with nitrogen three times. Thin-layer chromatography (TLC) revealed a new compound. The product was diluted with water (50 mL), and the organic phase was extracted and combined with ethyl acetate (50 mL x 3). The organic phase was washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the organic solvent. Compound 3 (1.25 g) was purified via TLC (ethyl acetate:petroleum ether = 0-50%).

[0865] Step 2): JPEG2025511112000171.jpg1737

[0866] Compound 3 (1.25 g, 5.5 mmol) was dissolved in ethanol (50 mL), sodium hydroxide (6.6 g, 165 mmol) was added, and the mixture was purged with nitrogen three times. The mixture was then heated to 90 °C and stirred overnight. When a new compound was detected by thin-layer chromatography, the product was diluted with water (20 mL). Dichloromethane (30 mL x 3) was added to extract and combine the organic phase. The organic phase was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and the solution was concentrated under reduced pressure to remove the organic solvent. Compound 4 (420 mg) was obtained through a purification process via thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0867] Step 3): JPEG2025511112000172.jpg2253

[0868] Compound 4 (146 mg, 1 mmol) was dissolved in anhydrous N,N-dimethylformamide (5 mL), and then NaH (48 mg, 2 mmol) was added in an ice bath. The mixture was then purged with nitrogen three times and stirred in an ice bath for 30 minutes. Compound 5 (256 mg, 1.5 mmol) was added, and the mixture was then purged with nitrogen three times and stirred in an ice bath for 30 minutes. Thin layer chromatography revealed a new compound. The product was diluted with water (50 mL), and the organic phase was extracted and combined with ethyl acetate (30 mL x 3). The organic phase was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the organic solvent. Compound 6 (96 mg) was purified via thin layer chromatography (ethyl acetate:petroleum ether = 0-50%).

[0869] Step 4): JPEG2025511112000173.jpg2360

[0870] Compound 6 (90 mg, 0.41 mmol) was dissolved in acetonitrile (10 mL), and then compound 7 (258 mg, 1.02 mmol) was added. The mixture was then purged with nitrogen three times and stirred overnight at room temperature. When a new compound was detected by thin layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27171 (20.9 mg) was obtained through a purification process via thin layer chromatography (methanol / dichloromethane = 0-10%).

[0871] MS-ESI of compound AB27171 and 1 1 H NMR is as follows:

[0872] MS-ESI: Calculated value [M-Br - ] + :415.15, Actual value:415.20. 1 H NMR(400 MHz, dmso-d6) δ 9.42(s, 1H), 8.51(s, 1H), 8.29(d, J = 6.4 Hz, 1H), 7.93(s, 1H), 7.86(s, 1H), 7.76(d, J = 7.8 Hz, 1H), 7.55(d, J = 7.9 Hz, 1H), 7.34(s, 5H), 6.13(d, J = 13.4 Hz, 1H), 5.59(s, 2H), 3.29 - 3.25(m, 2H), 3.05(d, J = 11.1 Hz, 1H), 2.78(d, J = 6.9 Hz, 2H), 2.65(s, 1H), 1.27(t, J = 6.7 Hz, 3H).

[0873] Example 6 Synthesis of compound AB27172 The chemical structure of compound AB27172 is as follows: JPEG2025511112000174.jpg2124 AB27172 Step 1): JPEG2025511112000175.jpg1535

[0874] Compound 1 (200 mg, 1.69 mmol) was dissolved in dichloromethane (20 mL), N-chlorosuccinimide (340 mg, 2.50 mmol) was added, and the mixture was purged with nitrogen three times and stirred at room temperature for 5 hours. When a new compound was detected by thin-layer chromatography, the product was diluted with aqueous sodium bicarbonate (20 mL). Dichloromethane (30 mL x 3) was added to extract and combine the organic phase. The organic phase was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and the solution was concentrated under reduced pressure to remove the organic solvent. Compound 2 (50 mg) was obtained through a purification process via thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0875] Step 2): JPEG2025511112000176.jpg1656

[0876] Compound 2 (50 mg, 0.32 mmol) was dissolved in N,N-dimethylformamide (10 mL), and then NaH (39 mg, 0.96 mmol) was added in an ice bath. The mixture was then purged with nitrogen three times and stirred in an ice bath for 30 minutes. Compound 3 (68 mg, 0.39 mmol) was then slowly added in an ice bath and stirred at room temperature for 60 minutes. Thin layer chromatography (TLC) revealed a new compound, which was then quenched with aqueous ammonium chloride (20 mL). The organic phase was extracted and combined with ethyl acetate (30 mL x 3). The organic phase was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the organic solvent. Compound 4 (60 mg) was obtained via thin layer chromatography (methanol / dichloromethane = 0-10%).

[0877] Step 3): JPEG2025511112000177.jpg2170

[0878] Compound 4 (60 mg, 0.24 mmol) was dissolved in acetonitrile (10 mL), and then compound 5 (76 mg, 0.29 mmol) was added. The mixture was then purged with nitrogen three times and stirred overnight at 80 °C. When a new compound was detected by thin-layer chromatography, the solution was immediately concentrated under reduced pressure to remove the organic solvent, and the compound AB27172 (25 mg) was obtained through a purification process via column chromatography (ethanol / dichloromethane = 0-30%).

[0879] MS-ESI of compound AB27172 1 1 H NMR is as follows:

[0880] MS-ESI: Calculated value [M-Br-] + :421.09, Actual value:421.00. 1 H NMR(400 MHz, DMSO) δ 9.52(s, 1H), 8.68(s, 1H), 8.47(d, J = 9.2 Hz, 2H), 7.86(s, 1H), 7.76(d, J = 7.8 Hz, 1H), 7.55(d, J = 7.8 Hz, 1H), 7.38(d, J = 7.4 Hz, 5H), 6.28(d, J = 11.3 Hz, 1H), 5.65(s, 2H), 3.06(d, J = 11.9 Hz, 3H), 2.64(s, 1H).

[0881] Example 7 Synthesis of compound AB27173 The chemical structure of compound AB27173 is as follows: JPEG2025511112000178.jpg2124 AB27173 Step 1): JPEG2025511112000179.jpg1539

[0882] Compound 1 (100 mg, 0.62 mmol) was dissolved in ethyl acetate (4 mL) and water (2 mL), and then lithium carbonate (182 mg, 2.50 mmol) was added. The mixture was then flushed with nitrogen three times and stirred at -20 °C for 1 hour. Select fluor (438 mg, 1.24 mmol) was then slowly added at -20 °C and stirred in an ice bath for 7 hours. When a new compound was detected by thin-layer chromatography, ethyl acetate (30 mL x 3) was added, and the organic phase was extracted and combined. The organic phase was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and the solution was concentrated under reduced pressure to remove the organic solvent. Compound 2 (50 mg) was obtained through a purification process via thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0883] Step 2): JPEG2025511112000180.jpg1655

[0884] Compound 2 (200 mg, 1.47 mmol) was dissolved in N,N-dimethylformamide (10 mL), NaH (118 mg, 2.94 mmol) was added in an ice bath, and the mixture was purged with nitrogen three times. The mixture was stirred in an ice bath for 30 minutes. Compound 3 (252 mg, 1.47 mmol) was slowly added in an ice bath and stirred at room temperature for 60 minutes. When a new compound was detected by thin-layer chromatography, it was quenched with ammonium chloride (20 mL). Ethyl acetate (30 mL x 3) was added to extract and combine the organic phase. The organic phase was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the organic solvent. Compound 4 (70 mg) was obtained via thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0885] Step 3): JPEG2025511112000181.jpg2369

[0886] Compound 4 (70 mg, 0.34 mmol) was dissolved in acetonitrile (10 mL), followed by the addition of compound 5 (87 mg, 0.34 mmol). The mixture was then purged with nitrogen three times and stirred overnight at 80°C. When a new compound was detected by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the product was purified by column chromatography (methanol / dichloromethane = 0-30%) to obtain compound AB27173 (16 mg).

[0887] MS-ESI of compound AB27173 1 1 H NMR is as follows:

[0888] MS-ESI: Calculated value [M-Br-] + :405.87, Actual value:405. 1 H NMR(400 MHz, DMSO) δ 9.57(s, 1H), 8.59(d, J = 6.0 Hz, 0H), 8.43(d, J = 6.3 Hz, 0H), 8.26(s, 0H), 7.86(s, 0H), 7.77(d, J = 7.5 Hz, 0H), 7.55(d, J = 8.3 Hz, 0H), 7.36(s, 3H), 6.14(d, J = 14.4 Hz, 1H), 5.60(s, 2H), 3.03(d, J = 13.7 Hz, 2H), 2.64(s, 2H).

[0889] Example 8 Synthesis of compound AB27175 The chemical structure of the compound AB27175 is as follows: JPEG2025511112000182.jpg1821 AB27175 Step 1): JPEG2025511112000183.jpg1439

[0890] Compound 1 (2.6 g, 20.0 mmol) was dissolved in acetonitrile (50 mL), NaH (960 mg, 40 mmol) was added at 0 °C, and then benzyl bromide (3.6 g, 21 mmol) was added and stirred at room temperature for 2 hours. When a new compound was detected by thin layer chromatography, the reaction mixture was centrifuged and purified by thin layer chromatography to obtain compound 2 (3.6 g).

[0891] Step 2): JPEG2025511112000184.jpg1759

[0892] Compound 2 (2.1 g, 9.4 mmol) was dissolved in acetonitrile (50 mL), compound 2-1 (2.8 g, 10 mmol) was added, and the mixture was stirred overnight at 80 °C. When a new compound was detected by thin layer chromatography, the reaction mixture was centrifuged and purified by thin layer chromatography to obtain compound AB27175.

[0893] MS-ESI of compound AB27175 1 1 H NMR is as follows:

[0894] MS-ESI: Calculated value [M-Br-] + 451.46, Actual value: 451.15. 1 H NMR(400 MHz, DMSO-d6) δ 9.43(s, 1H), 8.54(d, J = 6.2 Hz, 1H), 8.31(d, J = 6.3 Hz, 1H), 7.90(s, 1H), 7.80 - 7.71(m, 2H), 7.67(d, J = 8.0 Hz, 1H), 7.34(s, 5H), 6.20(d, J = 12.1 Hz, 1H), 5.60(s, 2H), 3.31 - 3.25(m, 2H), 3.14 - 3.04(m, 1H), 2.65(d, J = 7.4 Hz, 1H), 2.35(s, 3H).

[0895] Example 9 Synthesis of compound AB27177 The chemical structure of the compound AB27177 is as follows: JPEG2025511112000185.jpg1825 AB27177 Step 1): JPEG2025511112000186.jpg1567

[0896] Compound 1 (508 mg, 4 mmol) was dissolved in anhydrous N,N-dimethylformamide (30 mL), NaH (288 mg, 12 mmol) was added, and the mixture was stirred in an ice bath for 30 minutes. Compound 2 (547 mg, 3.2 mmol) was then added, and the mixture was purged with nitrogen three times and allowed to react at room temperature for 5 hours. When a new compound was detected by thin-layer chromatography, the product was diluted with water, and the organic phase was extracted with ethyl acetate. The organic phase was then combined and washed with saturated brine, dried over anhydrous sodium sulfate, and filtered. The solution was concentrated under reduced pressure to remove the organic solvent. Compound 3 (524 mg) was obtained through a purification process via thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0897] Step 2): JPEG2025511112000187.jpg2072

[0898] Compound 3 (111 mg, 0.5 mmol) was dissolved in acetonitrile (10 mL), and then compound 4 (119 mg, 0.5 mmol) was added. The mixture was then purged with nitrogen three times and stirred overnight at room temperature. When a new compound was detected by thin layer chromatography, it was filtered, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27177 (20 mg) was obtained through a purification process via thin layer chromatography (methanol / dichloromethane = 0-10%).

[0899] MS-ESI of compound AB27177 1 1 H NMR is as follows:

[0900] MS-ESI: Calculated value [M-Br-] +381.50, Actual value: 381.90. 1 H NMR(400 MHz, CD3OD) δ 9.23(s, 1H), 8.36(d, J = 6.8 Hz, 1H), 8.01(d, J = 6.5 Hz, 1H), 7.93(d, J = 7.6 Hz, 1H), 7.67(s, 1H), 7.35(d, J = 7.1 Hz, 3H), 7.27(d, J = 16.9 Hz, 4H), 5.57(s, 2H), 3.43(d, J = 15.2 Hz, 1H), 3.28 - 3.22(m, 2H), 3.00(d, J = 10.9 Hz, 1H), 2.72(d, J = 10.4 Hz, 1H), 2.44(s, 6H).

[0901] Example 10 Synthesis of compound AB27150 The chemical structure of compound AB27150 is as follows: JPEG2025511112000188.jpg2120 AB27150 Step 1): JPEG2025511112000189.jpg1553

[0902] Compound 1 (200 mg, 1.69 mmol) was dissolved in N,N-dimethylformamide (10 mL), NaH (202.8 mg, 5.07 mmol) was added in an ice bath, and the mixture was purged with nitrogen three times. The mixture was stirred in an ice bath for 30 minutes. Compound 2 (310 mg, 2.54 mmol) was slowly added in an ice bath and stirred at room temperature for 60 minutes. When a new compound was detected by thin-layer chromatography, the mixture was quenched with aqueous ammonium chloride. Ethyl acetate was added to extract and combine the organic phase. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and filtered. The solution was concentrated under reduced pressure to remove the organic solvent. Compound 3 (100 mg) was obtained via thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0903] Step 2): JPEG2025511112000190.jpg2064

[0904] Compound 3 (100 mg, 0.62 mmol) was dissolved in acetonitrile (5 mL), followed by the addition of compound 4 (183 mg, 0.62 mmol). The mixture was then purged with nitrogen three times and stirred overnight at 80°C. When a new compound was detected by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the product was purified by column chromatography (methanol / dichloromethane = 0-30%) to obtain compound AB27150 (30 mg).

[0905] MS-ESI of compound AB27150 1 1 H NMR is as follows:

[0906] MS-ESI: Calculated value [M-Br-] + 373.39, Actual value: 373.05. 1 H NMR(400 MHz,DMSO-d6) δ 9.36(s, 1H), 8.56(d, J = 6.4 Hz, 1H), 8.34(d, J = 6.5 Hz, 1H), 8.11(d, J = 27.0 Hz, 3H), 7.76(d, J = 7.8 Hz, 1H), 7.13(s, 1H), 6.21(d, J = 12.1 Hz, 1H), 4.37(s, 2H), 3.39(s, 2H), 3.05(s, 1H), 2.71(s, 1H), 1.84(d, J = 6.4 Hz, 2H), 0.83(s, 3H).

[0907] Example 11 Synthesis of compound AB27151 The chemical structure of compound AB27151 is as follows: JPEG2025511112000191.jpg2019 AB27151 Step 1): JPEG2025511112000192.jpg2371

[0908] Compound 1 (60 mg, 0.37 mmol) was dissolved in acetonitrile (10 mL), followed by the addition of compound 2 (110 mg, 0.37 mmol), followed by three nitrogen flushes and stirring overnight at 60°C. When a new compound was detected by thin layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27151 (20 mg) was obtained through a purification process via thin layer chromatography.

[0909] MS-ESI of compound AB27151 and 1 1 H NMR is as follows:

[0910] MS-ESI: Calculated value [M-Br-] + 373.40, Actual value: 373.30. 1 H NMR(400 MHz, DMSO -d6) δ 9.37(s, 1H), 8.57(d, J = 6.8 Hz, 1H), 8.35(d, J = 6.7 Hz, 1H), 8.23(s, 1H), 8.14(s, 1H), 8.07(d, J = 7.8 Hz, 1H), 7.77(d, J = 7.9 Hz, 1H), 7.17(s, 1H), 6.22(s, 1H), 5.19 - 4.90(m, 1H), 3.41(d, J = 13.6 Hz, 2H), 3.07(d, J = 9.2 Hz, 1H), 2.70(s, 1H), 1.52(s, 6H).

[0911] Example 12 Synthesis of compound AB27157 The chemical structure of compound AB27157 is as follows: JPEG2025511112000193.jpg2020 AB27157 Step 1): JPEG2025511112000194.jpg1560

[0912] Compound 2 (500 mg, 4.23 mmol) was dissolved in N,N-dimethylformamide (10 mL) and At 0°C, NaH (507.6 mg, 12.69 mmol) was added and stirred for 30 minutes. Add compound 1 (1.07 g, 6.34 mmol) at 2°C and stir at room temperature for 2 hours. When a new compound is detected by thin-layer chromatography, add water and ethyl acetate to extract the organic phase from the reaction mixture. The organic phase is centrifuged and purified by column chromatography to obtain compound 3 (300 mg).

[0913] Step 2): JPEG2025511112000195.jpg1765

[0914] Compound 3 (60 mg, 0.31 mmol) was dissolved in acetonitrile (10 mL), followed by the addition of compound 4 (100 mg, 0.31 mmol), followed by three nitrogen flushes and stirring overnight at 60°C. When a new compound was detected by thin layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27157 (20 mg) was obtained through a purification process via thin layer chromatography.

[0915] MS-ESI of compound AB27157 1 1 H NMR is as follows:

[0916] MS-ESI: Calculated value [M-Br-] + 389.15, Actual value: 389.25. 1 H NMR(400 MHz, dmso-d6) δ 9.36(s, 1H), 8.56(d, J = 6.0 Hz, 1H), 8.34(d, J = 6.7 Hz, 1H), 8.23(s, 1H), 7.71(dd, J = 35.0, 15.1 Hz, 3H), 7.16(s, 1H), 6.19(d, J = 14.1 Hz, 1H), 5.06(s, 1H), 3.33(s, 2H), 3.07(s, 1H), 2.65(s, 1H), 1.52(d, J = 3.9 Hz, 6H).

[0917] Example 13 Synthesis of compound AB27200 The chemical structure of compound AB27200 is as follows: JPEG2025511112000196.jpg2017 AB27200 Step 1): JPEG2025511112000197.jpg1433

[0918] Compound 1 (100 mg, 0.65 mmol) was dissolved in dichloromethane (20 mL), two drops of methanol were added, and then bis(N,N-dimethylformamide) dibromide hydrobromide (273 mg, 0.65 mmol) was added and the mixture was stirred overnight at 40 ° C. A new compound was detected by thin layer chromatography, and the reaction mixture was centrifuged and purified by thin layer chromatography to obtain compound 3 (106 mg).

[0919] Step 2): JPEG2025511112000198.jpg2063

[0920] Compound 3 (106 mg, 0.46 mmol) was dissolved in acetonitrile (20 mL), and then compound 4 (80 mg, 0.38 mmol) was added and stirred overnight at 80° C. A new compound was detected by thin-layer chromatography, and the reaction mixture was centrifuged to obtain compound AB27200 (15 mg) via thin-layer chromatography.

[0921] MS-ESI of compound AB27200 1 1 H NMR is as follows:

[0922] MS-ESI: Calculated value [M-Br-] + 359.12, Actual value: 359.20. 1H NMR(400 MHz, DMSO) δ 9.42(s, 1H), 8.59(s, 1H), 8.34(s, 1H), 8.18(d, J = 10.1 Hz, 2H), 7.35(s, 4H), 7.26(s, 2H), 7.14(s, 1H), 6.15(d, J = 9.0 Hz, 1H), 5.67(s, 2H), 3.09(d, J = 49.0 Hz, 3H), 2.68(s, 1H).

[0923] Example 14 Synthesis of compound AB27206 The chemical structure of compound AB27206 is as follows: JPEG2025511112000199.jpg2017 AB27206 Step 1): JPEG2025511112000200.jpg1341

[0924] Compound 1 (120 mg, 0.88 mmol) was dissolved in dichloromethane (10 mL), two drops of methanol were added, and then bis(N,N-dimethylformamide) dibromohydrobromide (365 mg, 0.88 mmol) was added and the mixture was stirred overnight at 50 °C. When a new compound was detected by thin layer chromatography, the reaction mixture was centrifuged and purified by thin layer chromatography to obtain compound 3 (100 mg).

[0925] Step 2): JPEG2025511112000201.jpg2369

[0926] Compound 3 (100 mg, 0.47 mmol) was dissolved in acetonitrile (10 mL), followed by the addition of compound 4 (98 mg, 0.47 mmol), followed by three nitrogen flushes and stirring overnight at 80°C. When a new compound was detected by thin layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27206 was obtained through a purification step via thin layer chromatography.

[0927] MS-ESI of compound AB27206 1 1 H NMR is as follows:

[0928] MS-ESI: Calculated value [M-Br-] + 343.14, Actual value: 343.00. 1 H NMR(400 MHz, dmso-d6) δ 9.41(s, 1H), 8.59(d, J = 7.1 Hz, 1H), 8.35(d, J = 7.0 Hz, 1H), 8.16(s, 2H), 7.34(s, 5H), 7.14(s, 1H), 6.80(s, 1H), 6.07(d, J = 9.6 Hz, 1H), 5.66(s, 2H), 3.03(s, 2H), 2.95(d, J = 9.5 Hz, 1H), 2.64(s, 1H).

[0929] Example 15 Synthesis of compound AB27215 The chemical structure of compound AB27215 is as follows: JPEG2025511112000202.jpg1926 AB27215 Step 1): JPEG2025511112000203.jpg1954

[0930] Compound 1 (353 mg, 2 mmol) was dissolved in acetonitrile (10 mL), compound 2 (236 mg, 2 mmol) was added, and then triethylamine (401.76 mg, 4 mmol) was added. The mixture was then purged with nitrogen three times and stirred overnight at room temperature. When a new compound was detected by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and compound 3 (500 mg) was obtained through a purification step via thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0931] Step 2): JPEG2025511112000204.jpg2370

[0932] Compound 3 (200 mg, 0.77 mmol) was dissolved in acetonitrile (10 mL), followed by the addition of compound 4 (200 mg, 0.8 mmol), followed by three nitrogen flushes and stirring overnight at 80°C. When a new compound was detected by thin layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27215 was obtained through a purification step via thin layer chromatography.

[0933] MS-ESI of compound AB27215 1 1 H NMR is as follows:

[0934] MS-ESI: Calculated value [M-Br-] + 437.92, Actual value: 437.05. 1 H NMR(400 MHz, cd3od) δ 9.38(s, 1H), 8.69(d, J = 16.5 Hz, 2H), 8.37(s, 1H), 8.23(d, J = 4.9 Hz, 2H), 7.97(s, 1H), 7.80(s, 1H), 7.68(s, 3H), 7.49(s, 1H), 7.26(s, 1H), 3.41(s, 3H), 2.99(s, 1H), 2.77(s, 1H).

[0935] Example 16 Synthesis of compound AB27219 The chemical structure of compound AB27219 is as follows: JPEG2025511112000205.jpg2124 AB27219 Step 1): JPEG2025511112000206.jpg1236

[0936] Compound 1 (5 g, 46.2 mmol) was dissolved in acetonitrile (100 mL), N-bromosuccinimide (9.07 g, 50.9 mmol) was added, and the mixture was stirred at room temperature for 2 hours after flushing with nitrogen three times. When a new compound was detected by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and compound 2 (3.5 g) was obtained through a purification step via thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0937] Step 2): JPEG2025511112000207.jpg1351

[0938] Compound 1 (1.87 g, 10 mmol) was dissolved in anhydrous N,N-dimethylformamide (50 mL). Compound 3 (2.94 g, 10 mmol), dimethylferrocene palladium dichloride (404 mg, 0.5 mmol), lithium chloride (429 mg, 20 mmol), and sodium carbonate (3.18 g, 30 mmol) were added, and the mixture was stirred overnight at room temperature after flushing with nitrogen three times. Thin-layer chromatography (TLC) revealed a new compound. The product was diluted with water (50 mL), and the organic phase was extracted and combined with ethyl acetate (50 mL x 3). The organic phase was washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the organic solvent. Compound 4 (500 mg) was obtained via thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0939] Step 3): JPEG2025511112000208.jpg1236

[0940] Compound 4 (300 mg, 1.47 mmol) was dissolved in ethanol (20 mL), sodium hydroxide (1.76 g, 44.11 mmol) was added, and the mixture was stirred at 90 °C overnight after purging with nitrogen three times. When a new compound was detected by thin-layer chromatography, the organic solvent was removed under reduced pressure, the product was diluted with water (50 mL), and the organic phase was extracted and combined with ethyl acetate (50 mL x 3). The organic phase was washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, and filtered. The solution was concentrated under reduced pressure to remove the organic solvent. Compound 5 (130 mg) was purified via thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0941] Step 4): JPEG2025511112000209.jpg1459

[0942] Compound 5 (130 mg, 0.98 mmol) was dissolved in N,N-dimethylformamide (20 mL), NaH (118 mg, 2.93 mmol) was added in an ice bath, and the mixture was purged with nitrogen three times. The mixture was stirred in an ice bath for 30 minutes. Compound 6 (167 mg, 0.98 mmol) was then slowly added in an ice bath and stirred at room temperature for 60 minutes. Upon detecting a new compound by thin-layer chromatography, the product was diluted with water (10 mL). The organic phase was extracted and combined with ethyl acetate (10 mL x 3). The organic phase was washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to remove the organic solvent. Finally, compound 7 (100 mg) was obtained by purification via column chromatography (methanol / dichloromethane = 10%).

[0943] Step 5): JPEG2025511112000210.jpg2061

[0944] Compound 7 (100 mg, 0.45 mmol) was dissolved in acetonitrile (10 mL), followed by the addition of compound 8 (174 mg, 0.67 mmol), followed by three nitrogen flushes and stirring overnight at 80°C. When a new compound was detected by thin layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27219 (9.5 mg) was obtained through a purification process via thin layer chromatography.

[0945] MS-ESI of compound AB27219 1 1 H NMR is as follows:

[0946] MS-ESI: Calculated value [M-Br-] + 401.14, Actual value: 401.30. 1 H NMR(400 MHz, DMSO) δ 8.51(d, J = 6.7 Hz, 1H), 8.17(d, J = 6.4 Hz, 1H), 8.09(s, 1H), 7.85(s, 1H), 7.75(d, J = 7.6 Hz, 1H), 7.54(d, J = 7.9 Hz, 1H), 7.32(s, 6H), 6.20(d, J = 11.1 Hz, 1H), 5.63(s, 2H), 3.20(s, 2H), 3.01(s, 3H), 2.63(s, 2H).

[0947] Example 17 Synthesis of compound AB27247 The chemical structure of compound AB27247 is as follows: JPEG2025511112000211.jpg2123 AB27247 Step 1): JPEG2025511112000212.jpg1254

[0948] Compound 1 (600 mg, 5.08 mmol) was dissolved in N,N-dimethylformamide (10 mL), NaH (610 mg, 15.25 mmol) was added in an ice bath, and the mixture was purged with nitrogen three times. The mixture was stirred in an ice bath for 30 minutes. Compound 2 (1.0 g, 7.26 mmol) was slowly added in an ice bath and stirred at room temperature for 60 minutes. When a new compound was detected by thin-layer chromatography, the mixture was quenched with aqueous ammonium chloride. Ethyl acetate was added to extract and combine the organic phase. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the solution was concentrated under reduced pressure to remove the organic solvent. Compound 3 (500 mg) was obtained through a purification process using thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0949] Step 2): JPEG2025511112000213.jpg2373

[0950] Compound 3 (100 mg, 0.62 mmol) was dissolved in acetonitrile (5 mL), followed by the addition of compound 4 (183 mg, 0.62 mmol). The mixture was then purged with nitrogen three times and stirred overnight at 80°C. When a new compound was detected by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27247 was obtained through a purification step via column chromatography (methanol / dichloromethane = 0-30%).

[0951] MS-ESI of compound AB27247 1 1 H NMR is as follows:

[0952] MS-ESI: Calculated value [M-Br-] + 401.15, Actual value: 401.25. 1H NMR(400 MHz, DMSO) δ 9.36(s, 1H), 8.56(d, J = 5.6 Hz, 1H), 8.35(d, J = 5.8 Hz, 1H), 8.12(s, 1H), 7.77(s, 1H), 7.72(s, 1H), 7.66(d, J = 7.3 Hz, 1H), 7.13(s, 1H), 6.19(d, J = 13.4 Hz, 1H), 4.29(d, J = 5.8 Hz, 2H), 3.32(s, 2H), 3.06(d, J = 8.4 Hz, 1H), 2.69(s, 1H), 1.32(s, 1H), 0.54(d, J = 5.3 Hz, 2H), 0.47(s, 2H).

[0953] Example 18 Synthesis of compound AB27248 The chemical structure of compound AB27248 is as follows: JPEG2025511112000214.jpg2123 AB27248 Step 1): JPEG2025511112000215.jpg1256

[0954] Compound 1 (1.18 g, 10 mmol) was dissolved in N,N-dimethylformamide (50 mL), NaH (1.2 mg, 30 mmol) was added in an ice bath, and the mixture was purged with nitrogen three times. The mixture was stirred in an ice bath for 30 minutes. Compound 2 (2.05 g, 7.26 mmol) was slowly added in an ice bath and stirred at room temperature for 60 minutes. When a new compound was detected by thin-layer chromatography, the mixture was quenched with aqueous ammonium chloride. Ethyl acetate was added to extract and combine the organic phase. The organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and the solution was concentrated under reduced pressure to remove the organic solvent. Compound 3 (870 mg) was obtained through a purification process using thin-layer chromatography (methanol / dichloromethane = 0-10%).

[0955] Step 2): JPEG2025511112000216.jpg1959

[0956] Compound 3 (100 mg, 0.57 mmol) was dissolved in acetonitrile (5 mL), followed by the addition of compound 4 (177 mg, 0.57 mmol). The mixture was then flushed with nitrogen three times and stirred at 80 °C overnight. When a new compound was detected by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the product was purified by column chromatography (methanol / dichloromethane = 0-30%) to give compound AB27248 (15 mg; yield: 6.53%).

[0957] MS-ESI of compound AB27248 1 1 H NMR is as follows:

[0958] MS-ESI: Calculated value [M-Br-] + 403.16, Actual value: 403. 1 H NMR(400 MHz, DMSO) δ 9.34(s, 1H), 8.55(s, 1H), 8.32(s, 1H), 8.06(s, 1H), 7.77(s, 1H), 7.72(s, 1H), 7.66(s, 1H), 7.12(s, 1H), 6.16(d, J = 12.7 Hz, 1H), 4.39(s, 2H), 3.06(s, 1H), 2.68(s, 1H), 2.50(s, 2H), 1.78(s, 2H), 1.23(d, J = 6.2 Hz, 2H), 0.88(d, J = 6.0 Hz, 3H).

[0959] Example 19 Synthesis of compound AB27249 The chemical structure of compound AB27249 is as follows: JPEG2025511112000217.jpg2424 AB27249 Step 1): JPEG2025511112000218.jpg1460

[0960] Compound 1 (1.06 g, 9 mmol) was dissolved in N,N-dimethylformamide (20 mL), NaH (648 mg, 27 mmol) was added in an ice bath, and the mixture was then purged with nitrogen three times. The mixture was stirred in an ice bath for 30 minutes. Compound 1-1 (1.5 g, 9 mmol) was then slowly added in an ice bath and stirred at room temperature for 90 minutes. Upon detecting a new compound by thin-layer chromatography, the product was diluted with water (20 mL), and the solution was concentrated under reduced pressure to remove the organic solvent, yielding the crude product. The crude product was then filtered with methanol, and the filtrate was concentrated under reduced pressure to remove the organic solvent. Compound 2 (1.2 g) was obtained from the crude product via thin-layer chromatography (methanol / dichloromethane = 10%).

[0961] Step 2): JPEG2025511112000219.jpg1852

[0962] Compound 2 (100 mg, 0.57 mmol) was dissolved in acetonitrile (10 mL), and then compound 3 (176 mg, 0.57 mmol) was added and stirred overnight at 80° C. When a new compound was detected by thin layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27249 was obtained through a purification step via thin layer chromatography (methanol / dichloromethane = 10%).

[0963] MS-ESI of compound AB27249 1 1 H NMR is as follows:

[0964] MS-ESI: Calculated value [M-Br-] + 417.44, Actual value: 417. 1H NMR(400 MHz, CD3OD) δ 9.35(s, 1H), 8.56(d, J = 6.7 Hz, 1H), 8.32(d, J = 6.7 Hz, 1H), 8.07(s, 1H), 7.77(s, 2H), 7.72(s, 1H), 7.66(d, J = 8.3 Hz, 1H), 7.12(s, 1H), 6.18(d, J = 10.3 Hz, 1H), 4.38(d, J = 6.4 Hz, 2H), 3.37(s, 1H), 3.29 - 3.26(m, 1H), 3.08 - 2.99(m, 1H), 2.67(d, J = 9.5 Hz, 1H), 1.86 - 1.73(m, 2H), 1.36 - 1.24(m, 2H), 1.19(d, J = 5.4 Hz, 3H), 0.81(t, J = 6.9 Hz, 3H).

[0965] Example 20 Synthesis of compound AB27250 The chemical structure of compound AB27250 is as follows: JPEG2025511112000220.jpg2423 AB27250 Step 1): JPEG2025511112000221.jpg1851

[0966] Compound 2 (100 mg, 0.57 mmol) was dissolved in acetonitrile (10 mL), and then compound 3 (147 mg, 0.57 mmol) was added and stirred overnight at 80° C. When a new compound was detected by thin layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent, and the compound AB27250 was obtained through a purification step via thin layer chromatography (methanol / dichloromethane = 10%).

[0967] MS-ESI of compound AB27250 1 1 H NMR is as follows:

[0968] MS-ESI: Calculated value [M-Br-] +367.89, Measured value: 367.30. 1 H NMR (400 MHz, DMSO) δ 9.35 (s, 1H), 8.55 (d, J = 6.9 Hz, 1H), 8.32 (d, J = 7.0 Hz, 1H), 8.08 (d, J = 2.7 Hz, 1H), 7.86 (s, 1H), 7.77 (d, J = 6.9 Hz, 1H), 7.55 (d, J = 8.3 Hz, 1H), 7.12 (d, J = 2.5 Hz, 1H), 6.21 - 6.11 (m, 1H), 4.39 (t, J = 6.6 Hz, 2H), 3.28 (s, 2H), 3.06 - 2.97 (m, 1H), 2.66 (d, J = 10.2 Hz, 1H), 1.85 - 1.74 (m, 2H), 1.29 (dd, J = 14.1, 7.0 Hz, 2H), 1.20 (d, J = 7.0 Hz, 2H), 0.82 (t, J = 7.0 Hz, 3H).

[0969] Example 21 Synthesis of Compound AB27251 The chemical structural formula of Compound AB27251 is as follows. JPEG2025511112000222.jpg2122 AB27251 Step 1): JPEG2025511112000223.jpg1355

[0970] Compound 1 (1.06 mg, 9 mmol) was dissolved in N,N-dimethylformamide (20 mL), NaH (648 mg, 27 mmol) was added in an ice bath, and the mixture was then purged with nitrogen three times. The mixture was stirred in an ice bath for 30 minutes, and compound 1-1 (986 mg, 7.2 mmol) was slowly added in an ice bath and stirred at room temperature for 90 minutes. Upon detecting a new compound by thin-layer chromatography, the product was diluted with water (20 mL), and the solution was concentrated under reduced pressure to remove the organic solvent, yielding the crude product. The crude product was then triturated with methanol, filtered, and the filtrate was concentrated under reduced pressure to yield the crude product. Compound 2 (870 mg) was obtained from the crude product via thin-layer chromatography (methanol / dichloromethane = 10%).

[0971] Step 2): JPEG2025511112000224.jpg1651

[0972] Compound 2 (100 mg, 0.57 mmol) was dissolved in acetonitrile (10 mL), followed by the addition of compound 3 (147 mg, 0.57 mmol) and stirring overnight at 80 °C. When a new compound was detected by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent and obtain the crude product. The crude product was then triturated with methanol and filtered. The filtrate was concentrated under reduced pressure to remove the organic solvent and purified via thin-layer chromatography (methanol / dichloromethane = 10%) to obtain compound AB27251.

[0973] MS-ESI of compound AB27251 and 1 1 H NMR is as follows:

[0974] MS-ESI: Calculated value [M-Br-] + 353.86, Actual value: 353.05. 1H NMR(400 MHz, DMSO) δ 9.34(s, 1H), 8.53(s, 1H), 8.32(s, 1H), 8.07(s, 1H), 7.86(s, 1H), 7.76(d, J = 8.3 Hz, 1H), 7.55(d, J = 7.3 Hz, 1H), 7.12(s, 1H), 6.12(d, J = 10.3 Hz, 1H), 4.40(s, 2H), 3.02(d, J = 14.0 Hz, 2H), 2.66(d, J = 13.5 Hz, 2H), 1.84 - 1.71(m, 2H), 1.22(s, 2H), 0.88(s, 3H).

[0975] Example 22 Synthesis of compound AB27252 The chemical structure of compound AB27252 is as follows: JPEG2025511112000225.jpg2121 AB27252 Step 1): JPEG2025511112000226.jpg2568

[0976] Compound 1 (100 mg, 0.58 mmol) was dissolved in acetonitrile (10 mL), compound 2 (150 mg, 0.58 mmol) was added, and the mixture was stirred at 80 °C overnight. When a new compound was detected by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent and obtain the crude product. The crude product was then triturated with methanol and filtered. The filtrate was concentrated under reduced pressure to remove the organic solvent and purified via thin-layer chromatography (methanol / dichloromethane = 10%) to obtain compound AB27252.

[0977] MS-ESI of compound AB27252 1 1 H NMR is as follows:

[0978] MS-ESI: Calculated value [M-Br-] + 351.85, Actual value: 351.25. 1H NMR(400 MHz, DMSO) δ 9.36(s, 1H), 8.55(d, J = 5.6 Hz, 1H), 8.35(d, J = 5.6 Hz, 1H), 8.12(s, 1H), 7.86(s, 1H), 7.76(d, J = 7.4 Hz, 1H), 7.55(d, J = 7.6 Hz, 1H), 7.13(s, 1H), 6.18(d, J = 13.2 Hz, 1H), 4.29(d, J = 5.8 Hz, 2H), 3.18(s, 2H), 3.04(s, 1H), 2.68(s, 1H), 1.32(s, 1H), 0.54(d, J = 5.2 Hz, 2H), 0.47(s, 2H).

[0979] Example 23 Synthesis of compound AB27253 The chemical structure of compound AB27253 is as follows: JPEG2025511112000227.jpg2120 AB27253 Step 1): JPEG2025511112000228.jpg1453

[0980] Compound 1 (106 mg, 0.9 mmol) was dissolved in N,N-dimethylformamide (5 mL), NaH (65 mg, 2.7 mmol) was added in an ice bath, and the mixture was then purged with nitrogen three times. The mixture was stirred in an ice bath for 30 minutes. Compound 2 (98 mg, 0.72 mmol) was then slowly added in an ice bath and stirred at room temperature for 90 minutes. Upon detecting a new compound by thin-layer chromatography, the product was diluted with water (20 mL), and the solution was concentrated under reduced pressure to remove the organic solvent, yielding the crude product. The crude product was then filtered with methanol, and the filtrate was concentrated under reduced pressure to remove the organic solvent. Compound 3 (87 mg) was then purified via thin-layer chromatography (methanol / dichloromethane = 10%).

[0981] Step 2): JPEG2025511112000229.jpg2266

[0982] Compound 3 (87 mg, 0.54 mmol) was dissolved in acetonitrile (10 mL), followed by the addition of compound 4 (140 mg, 0.54 mmol) and stirring overnight at 80 °C. Upon detecting a new compound by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent and obtain the crude product. Purification was performed via thin-layer chromatography (methanol / dichloromethane = 10%) to obtain compound AB27253 (80 mg).

[0983] MS-ESI of compound AB27253 1 1 H NMR is as follows:

[0984] MS-ESI: Calculated value [M-Br - ] + 339.84, Actual value: 339.25. 1 H NMR(400 MHz, dmso) δ 9.37(s, 1H), 8.56(d, J = 6.9 Hz, 1H), 8.34(d, J = 7.0 Hz, 1H), 8.07(d, J = 3.1 Hz, 1H), 7.86(d, J = 1.7 Hz, 1H), 7.79 - 7.73(m, 1H), 7.55(d, J = 8.3 Hz, 1H), 7.13(d, J = 2.9 Hz, 1H), 6.19(dd, J = 13.7, 4.0 Hz, 1H), 4.37(t, J = 6.8 Hz, 2H), 3.37(s, 1H), 3.25(s, 1H), 3.03(d, J = 8.8 Hz, 1H), 2.66(d, J = 9.6 Hz, 1H), 1.83(dd, J = 14.2, 7.1 Hz, 2H), 0.83(t, J = 7.3 Hz, 3H).

[0985] Example 24 Synthesis of compound AB27356 The chemical structure of compound AB27356 is as follows: JPEG2025511112000230.jpg2124 AB27356 Step 1): JPEG2025511112000231.jpg1539

[0986] Compound 1 (1.6 g, 10 mmol) was dissolved in dichloromethane (50 mL), three drops of methanol were added, and then bis(N,N-dimethylformamide) dibromohydrobromide (4.5 g, 10 mmol) was added and the mixture was stirred overnight at 50° C. A new compound was detected by thin-layer chromatography, and the reaction mixture was centrifuged and purified by thin-layer chromatography to obtain compound 3 (2.2 g).

[0987] Step 2): JPEG2025511112000232.jpg1963

[0988] Compound 4 (209 mg, 1 mmol) was dissolved in acetonitrile (10 mL), and compound 3 (243 mg, 1 mmol) was added. Then, triethylamine (303 mg, 3 mmol) was added. The mixture was then flushed with nitrogen three times and stirred at 80 °C overnight. After detecting a new compound by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent. Finally, compound AB27356 was obtained through a purification step (column: Sharpsil-U C18 (250 mm x 30 x 10 μm, 100 Å); mobile phase: 0.1% aqueous trifluoroacetic acid + acetonitrile; gradient elution: ACN content from 5% to 25% from 1 min to 20 min, and ACN content from 25% to 35% from 20 min to 50 min).

[0989] MS-ESI of compound AB27356 1 1 H NMR is as follows:

[0990] MS-ESI: Calculated value [M-CF3COO - ] + 371.43, Actual value: 371.00. 1H NMR(400 MHz, DMSO) δ 9.37(s, 1H), 8.55(d, J = 7.0 Hz, 1H), 8.35(d, J = 7.0 Hz, 1H), 8.16(d, J = 2.9 Hz, 1H), 7.58(dd, J = 17.4, 7.0 Hz, 3H), 7.38 - 7.24(m, 5H), 7.15(d, J = 2.7 Hz, 1H), 6.13(dd, J = 13.7, 3.9 Hz, 1H), 5.66(s, 2H), 3.28(d, J = 12.2 Hz, 2H), 3.00(d, J = 8.2 Hz, 1H), 2.65(d, J = 9.5 Hz, 1H).

[0991] Example 25 Synthesis of compound AB27470 The chemical structure of compound AB27470 is as follows: JPEG2025511112000233.jpg2124 AB27470 Step 1): JPEG2025511112000234.jpg2168

[0992] Compound 1 (100 mg, 0.448 mmol) was dissolved in acetonitrile (20 mL), compound 2 (125 mg, 0.448 mol) was added, and the mixture was then purged with nitrogen three times and stirred at 80 °C overnight. When a new compound was detected by thin-layer chromatography, the solution was concentrated under reduced pressure to remove the organic solvent. Finally, compound AB27470 was obtained through a purification step (column: Sharpsil-U C18 (250 mm x 30 x 10 μm, 100 Å); mobile phase: 0.1% aqueous trifluoroacetic acid + acetonitrile; gradient elution: ACN content from 5% to 25% from 1 min to 20 min, an...

Claims

1. A compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof. (Ring A represents a substituted or unsubstituted C6-C14 aryl ring, a substituted or unsubstituted C3-C14 cycloalkyl ring, a substituted or unsubstituted 3- to 14-membered heterocycloalkyl ring, or a substituted or unsubstituted 5- to 14-membered heteroaryl ring; Ring B represents an unsubstituted or substituted C6-C14 aryl ring, a substituted or unsubstituted C3-C14 cycloalkyl ring, a substituted or unsubstituted 3-14 membered heterocycloalkyl ring, or a substituted or unsubstituted 5-14 membered heteroaryl ring; R ３ is nothing, a hydrogen atom, a halogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group, a substituted or unsubstituted C3-C12 cycloalkyl group-substituted or unsubstituted C1-C8 alkyl group-, a substituted or unsubstituted C1-C8 alkoxyl group, a substituted or unsubstituted C1-C8 alkylthiol group, a substituted or unsubstituted C2-C8 acyl group, a substituted or unsubstituted C2-C8 acyl group-substituted or unsubstituted C1-C8 alkyl group-, a substituted or unsubstituted C6-C1 4 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted C6-C14 aryl group-sulfuryl group-, a substituted or unsubstituted C6-C14 aryl group-C(O)-, a substituted or unsubstituted C6-C14 aryl group-C(O)-substituted or unsubstituted C1-C8 alkyl group-, a substituted or unsubstituted C6-C14 aryl group-substituted or unsubstituted C1-C8 alkyl group-, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C8 alkyl group-; R ４ and R ５ each independently represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, or a substituted or unsubstituted C3-C12 cycloalkyl group; R ６ represents a substituted or unsubstituted C6-C14 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted C3-C14 cycloalkyl group, or a substituted or unsubstituted 3-14 membered heterocycloalkyl group; R ７ represents a hydrogen atom, a substituted or unsubstituted C1-C8 alkyl group, or a substituted or unsubstituted C3-C10 cycloalkyl group; R ８ and R ９ are linked to form a substituted or unsubstituted C3-C14 cycloalkyl ring or a substituted or unsubstituted 3- to 14-membered heterocycloalkyl ring; R １０ and R １１ each independently represents a hydrogen atom, a substituted or unsubstituted C1-C10 alkyl group, a substituted or unsubstituted C2-C10 acyl group, a substituted or unsubstituted C6-C14 aryl group, a substituted or unsubstituted 5-12 membered heteroaryl group, a substituted or unsubstituted C6-C14 aryl group-substituted or unsubstituted C1-C6 alkyl group-, a substituted or unsubstituted C6-C14 aryl group-C(O)-substituted or unsubstituted C1-C6 alkyl group-, or a substituted or unsubstituted 5-12 membered heteroaryl group-substituted or unsubstituted C1-C6 alkyl group-; or R １０ and R １１ are linked to form a substituted or unsubstituted C3-C12 cycloalkyl ring, a substituted or unsubstituted 3-12 membered heterocycloalkyl ring, or a substituted or unsubstituted 5-12 membered heteroaryl ring; n represents 0, 1, 2, 3, 4 or 5; The optional "substitution" mentioned above means that one or more (preferably 1, 2, 3, 4, 5, 6, 7, or 8) hydrogen atoms on the ring or atomic group are each independently substituted with a C1-C8 alkyl group, a C3-C8 cycloalkyl group, a C1-C8 halogenated alkyl group, a C3-C8 halogenated cycloalkyl group, a C3-C8 cycloalkoxyl group, a C3-C8 cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated ...alkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cycloalkylthiol group, a C3-C8 halogenated cycloalkylthiol group, a C3-C8 halogenated cycloalkylthiol group, a C3-C8 halogenated cycloalkoxyl group, a C3-C8 halogenated cyclo a halogen atom, a nitro group, -CN, a hydroxyl group, a mercapto group, an amino group, a C1-C4 carboxyl group, a C2-C4 ester group, a C2-C4 acylamino group, a C1-C8 alkoxyl group, a C1-C8 alkylthiol group, a C1-C8 halogenated alkoxyl group, a C1-C8 halogenated alkylthiol group, a C6-C12 aryl group, a 5-10 membered heteroaryl group, and a 5-10 membered heterocycloalkyl group; The heterocyclic rings of the heterocycloalkyl group, the heteroaryl group, the heterocycloalkyl ring and the heteroaryl ring each independently have from 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms selected from N, O and S.

2. 2. The compound of formula I according to claim 1, characterized in that it has the following chemical structure:

3. (a) comprising said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, A composition comprising:

4. Use of a compound of formula I, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, as claimed in claim 1, for the preparation of a composition or formulation for use in the prevention and / or treatment of tumors.

5. The tumor is Tumors in which the mitochondrial permeability transition pore is underexpressed, absent, underactivated, or inactivated; Tumors in which peptidyl prolyl isomerase F is underexpressed, not expressed, underactivated or inactivated; Tumors in which the NNMT gene is underexpressed or not expressed; Tumors with high expression of DNA methyltransferases, Tumors in which UHRF1 is highly expressed, Tumors in which the nucleotide site of the NNMT gene is hypermethylated, and / or tumors in which DNA CpG sites in the NNMT gene region are hypermethylated; 5. The use according to claim 4.

6. The tumor with low expression or low activation of mitochondrial permeability transition pore refers to a tumor in which the ratio (H1 / H0) between the expression level or activity H1 of mitochondrial permeability transition pore in a certain cell (e.g., tumor cell) and the expression level or activity H0 of mitochondrial permeability transition pore in the same cell or normal cell (e.g., cancerous bladder tissue cell) is <1.0, preferably ≦0.8, and more preferably ≦0.7, ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001, or ≦0.0000001; The tumor with low expression or low activity of peptidyl prolyl isomerase F refers to a tumor in which the ratio (G1 / G0) between the expression amount or activity G1 of peptidyl prolyl isomerase F in a certain cell (e.g., tumor cell) and the expression amount or activity G0 of peptidyl prolyl isomerase F in the same cell or normal cell (e.g., cancerous bladder tissue cell) is <1.0, preferably ≦0.8, and more preferably ≦0.7, ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001; The tumor in which the NNMT gene is under-expressed or not expressed refers to a tumor in which the ratio (E1 / E0) between the expression level E1 of the NNMT gene in a certain cell (e.g., a tumor cell) and the expression level E0 of the NNMT gene in the same type of cell or a normal cell (e.g., a cancerous bladder tissue cell) is <1.0, preferably ≦0.7, and more preferably ≦0.6, ≦0.5, ≦0.4, ≦0.3, ≦0.2, ≦0.1, ≦0.05, ≦0.01, ≦0.005, ≦0.001, ≦0.0001, ≦0.00001, ≦0.000001 or ≦0.0000001; The tumor with high expression of DNA methyltransferase refers to a tumor in which the ratio (A1 / A0) between the expression level A1 of DNA methyltransferase in tumor cells and the expression level A0 of DNA methyltransferase in similar cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50; The tumor with high expression of UHRF1 refers to a tumor in which the ratio (F1 / F0) between the expression level F1 of UHRF1 in tumor cells and the expression level F0 of UHRF1 in similar cells or normal cells (e.g., cancerous bladder tissue cells) is >1.0, preferably ≧1.2 or ≧1.5, more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50; said tumor having hypermethylation at the nucleotide site of the NNMT gene refers to a tumor in which the ratio (L1 / L0) between the methylation level L1 at the nucleotide site of the NNMT gene in a certain cell (e.g., a tumor cell) and the methylation level L0 at the nucleotide site of the NNMT gene in a similar cell or a normal cell (e.g., a cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example 2-50; and / or The tumor in which the DNA CpG site of the NNMT gene region is hypermethylated refers to a tumor in which the ratio (W1 / W0) between the methylation level W1 of the DNA CpG site of the NNMT gene region of a certain cell (e.g., tumor cell) and the methylation level W0 of the DNA CpG site of the NNMT gene region of a similar cell or a normal cell (e.g., cancerous bladder tissue cell) is >1.0, preferably ≧1.2 or ≧1.5, and more preferably ≧2, ≧3, ≧5, ≧8, ≧10, ≧15, ≧20, ≧30 or ≧50, for example, 2-50.

6. Use according to claim 5.

7. The allogeneic cells are Cells in which the mitochondrial permeability transition pore is normally expressed or overexpressed or normally activated or overactivated (e.g., tumor cells of the same species), Cells in which peptidyl prolyl isomerase F is normally expressed, highly expressed, normally activated, or highly activated (e.g., tumor cells of the same species), Cells in which the NNMT gene is normally or highly expressed (e.g., related tumor cells); Cells in which DNA methyltransferases are normally expressed or under-expressed (e.g., related tumor cells), Cells in which UHRF1 is normally expressed or under-expressed (e.g., related tumor cells), Cells (e.g., related tumor cells) in which the nucleotide site of the NNMT gene is normally methylated or hypomethylated, and / or Cells in which the DNA CpG sites in the NNMT gene region are normally methylated or hypomethylated (e.g., related tumor cells); 7. Use according to claim 6.

8. The tumor is selected from lung cancer, kidney cancer, breast cancer, colon cancer, lymphoma, leukemia, pancreatic cancer, brain cancer, liver cancer, prostate cancer, or a combination thereof; 5. The use according to claim 4.

9. A marker used to determine whether a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, is suitable for tumor prevention and / or treatment in a tumor patient, comprising: having a mitochondrial permeability transition pore, peptidyl prolyl isomerase F, the NNMT gene, DNA methyltransferase, UHRF1, methylation of nucleotide sites in the NNMT gene and / or methylation of DNA CpG sites in the NNMT gene region; A marker characterized by:

10. 2. The compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, for use in the manufacture of a companion diagnostic kit for determining whether a tumor patient is suitable for the prevention and / or treatment of a tumor, (i) comprising a detection reagent for detecting the expression level or activity of the mitochondrial membrane permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region; Use of a detection reagent kit comprising:

11. The accompanying diagnostic kit in tumor cells of a tumor patient, the under-expression, non-expression, under-activation or inactivation of the mitochondrial permeability transition pore, the under-expression, non-expression, under-activation or inactivation of peptidyl prolyl isomerase F, the under-expression or non-expression of the NNMT gene, the over-expression of DNA methyltransferase, the over-expression of UHRF1, the hypermethylation of nucleotide sites of the NNMT gene, and / or the hypermethylation of DNA CpG sites in the NNMT gene region, render said compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, suitable for the prevention and / or treatment of tumors in said tumor patient; and / or and further comprising an instruction manual or label stating that, in tumor cells of a tumor patient, there is high expression or activation of the mitochondrial permeability transition pore, high expression or activation of peptidyl prolyl isomerase F, high expression of the NNMT gene, low expression of DNA methyltransferase, low expression of UHRF1, low methylation of nucleotide sites of the NNMT gene, and / or low methylation of DNA CpG sites in the NNMT gene region, the compound of formula I according to the first aspect of the present invention, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof, becomes unsuitable for the prevention and / or treatment of tumors in said tumor patient. Use of the detection reagent kit according to claim 10.

12. (i) a detection agent for detecting the expression level or activity of the mitochondrial permeability transition pore, the expression level or activity of peptidyl prolyl isomerase F, the expression level of the NNMT gene, the expression level of DNA methyltransferase, the expression level of UHRF1, the methylation level of a nucleotide site in the NNMT gene, and / or the methylation level of a DNA CpG site in the NNMT gene region; (ii) a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof; A medical kit comprising:

13. Used for producing a composition or formulation for enhancing the antitumor effect of an antitumor drug; The antitumor drug comprises a compound of formula I according to claim 1, or an optical isomer or racemate thereof, or a solvate thereof, or a pharma- ceutically acceptable salt thereof, or a deuterated compound thereof; Use of an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an promoter of DNA methyltransferase, an promoter of UHRF1, a promoter of methylation of nucleotide sites in the NNMT gene and / or a promoter of methylation of DNA CpG sites in the NNMT gene region, characterized by the above.

14. The use according to claim 13, characterized in that the tumor is a tumor according to any one of claims 5 to 8.

15. (1) a first active ingredient comprising an antitumor drug; (2) a second active ingredient comprising an inhibitor of the mitochondrial permeability transition pore, an inhibitor of peptidyl prolyl isomerase F, an inhibitor of the NNMT gene, an enhancer of DNA methyltransferase, an enhancer of UHRF1, an enhancer of methylation of nucleotide sites in the NNMT gene, and / or an enhancer of methylation of DNA CpG sites in the NNMT gene region; A composition comprising:

Images