Promoter switching for tissue-specific expression

Abstract

Described herein are switchable core promoters that can selectively enhance transcription initiation in the presence of activated response elements (such as activated enhancers). These switchable core promoters can be paired with cell type-specific or cell state-specific response elements to produce engineered promoters that selectively enhance the transcription of payload sequences in target cell types or target cell states. Also described herein are methods of using switchable core promoters and polynucleotides containing switchable core promoters to selectively express payloads in target cell types or target cell states.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 329,211, entitled "PROMOTER SWITCHES FOR TISSUE-SPECIFIC EXPRESSION," filed on April 8, 2022, and U.S. Provisional Application No. 63 / 423,977, entitled "PROMOTER SWITCHES FOR TISSUE-SPECIFIC EXPRESSION," filed on November 9, 2022, each of which is incorporated by reference herein in its entirety and for all purposes. [Background technology]

[0002] A wide variety of diseases and disorders are caused by mutation, deletion, or altered expression of genes. Many of these genes are tightly regulated in healthy individuals, so that overexpression or underexpression of genes can lead to harmful side effects. In addition, some diseases and disorders are characterized by different cell genotypes of healthy and abnormal cells in a subject. As a result, expression of a gene, such as a transgene, can be therapeutic in one cell type, but harmful in another cell type. While substantial progress has been made toward the delivery of transgenes into individuals for the treatment of genetic disorders, there remains a need for gene therapy that can regulate transgene expression in a cell type-dependent or cell state-dependent manner. Summary of the Invention [Means for solving the problem]

[0003] In various aspects, the disclosure provides an engineered core promoter comprising a sequence having at least 80% sequence identity to SEQ ID NO:4 and including the nucleotide substitutions T15G and A40T relative to SEQ ID NO:5.

[0004] In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:4 and comprising the nucleotide substitutions T15G and A40T relative to SEQ ID NO:5. In some embodiments, the engineered core promoter comprises the sequence of SEQ ID NO:4.

[0005] In some embodiments, the engineered core promoter further comprises a transcriptional pause site. In some embodiments, the transcriptional pause site comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:196-SEQ ID NO:198, SEQ ID NO:211, or SEQ ID NO:212. In some embodiments, the transcriptional pause site comprises a sequence of any one of SEQ ID NO:196-SEQ ID NO:198, SEQ ID NO:211, or SEQ ID NO:212. In some embodiments, the engineered core promoter further comprises a YY1 motif. In some embodiments, the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:205-SEQ ID NO:207. In some embodiments, the YY1 motif comprises a sequence having a sequence of any one of SEQ ID NO:205-SEQ ID NO:207. In some embodiments, the engineered core promoter comprises a spacer of 30-34 nucleotides.

[0006] In some embodiments, the transcriptional activity produced by the engineered core promoter paired with an activated response element is higher than the transcriptional activity produced by the core promoter of SEQ ID NO: 6 when paired with an activated response element, or the basal transcriptional activity produced by the engineered core promoter paired with an activated response element is lower than the basal transcriptional activity produced by the core promoter of SEQ ID NO: 6 when paired with an inactive response element, or both. In some embodiments, the transcriptional activity produced by the engineered core promoter paired with an activated response element is higher than the transcriptional activity produced by the core promoter of SEQ ID NO: 9 when paired with an activated response element, or the basal transcriptional activity produced by the engineered core promoter paired with an activated response element is lower than the basal transcriptional activity produced by the core promoter of SEQ ID NO: 9 when paired with an inactive response element, or both.

[0007] In various aspects, the disclosure provides engineered promoters comprising the response elements and engineered core promoters described herein.

[0008] In some embodiments, the response element confers bone marrow-specific, liver-specific, neuron-specific, muscle-specific, or kidney-specific transcription of the payload under the transcriptional control of the engineered promoter. In some embodiments, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. In some embodiments, the response element comprises the sequence of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194.

[0009] In various aspects, the disclosure provides a recombinant polynucleotide comprising an engineered core promoter as described herein or an engineered promoter as described herein, and a payload comprising a coding sequence under the transcriptional control of the engineered core promoter.

[0010] In some embodiments, the payload encodes a protein. In some embodiments, the protein is a neuronal protein, a renal protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. In some embodiments, the protein is associated with a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscle disorder, or cancer. In some embodiments, the protein is progranulin, MeCP2, polycystin-1, or polycystin-2.

[0011] In some embodiments, the payload encodes a therapeutic polynucleotide. In some embodiments, the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. In some embodiments, the therapeutic polynucleotide targets a gene. In some embodiments, the gene is associated with a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscular disorder, or cancer. In some embodiments, the gene is GRN, MECP2, PKD2, or PKD2.

[0012] In various aspects, the disclosure provides engineered viral vectors that include an engineered core promoter described herein, an engineered promoter described herein, or a recombinant polynucleotide described herein in the viral vector.

[0013] In some embodiments, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. In some embodiments, the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP. eB, AAV.PhP.V1, AAV.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy 5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC 5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, and combinations thereof.

[0014] In various aspects, the disclosure provides a pharmaceutical composition comprising an engineered core promoter described herein, an engineered promoter described herein, a recombinant polynucleotide described herein, or a viral vector described herein, and a pharma- ceutically acceptable carrier.

[0015] In various aspects, the disclosure provides a method of treating a disorder in a subject in need of such treatment, comprising administering to the subject a composition comprising a recombinant polynucleotide described herein, a viral vector described herein, or a pharmaceutical composition described herein; and expressing a therapeutic sequence encoded by the payload of the recombinant polynucleotide in a target cell of the subject, thereby treating the disorder.

[0016] In some embodiments, the target cell is a cell type or cell state associated with a disorder. In some embodiments, the disorder is a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscular disorder, or cancer. In some embodiments, the disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic-predominant age-related TDP-43 encephalopathy, or polycystic kidney disease. In some embodiments, the therapeutic sequence encodes a therapeutic protein. In some embodiments, the therapeutic protein is a neuronal protein, a renal protein, a retinal protein, a muscular protein, or an apoptosis-inducing protein. In some embodiments, the therapeutic protein is associated with a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscular disorder, or cancer. In some embodiments, the therapeutic protein is MECP2, progranulin, polycystin-1, or polycystin-2. In some embodiments, the payload encodes a therapeutic polynucleotide. In some embodiments, the therapeutic polynucleotide is a guide RNA or a suppressor tRNA.

[0017] In various aspects, the disclosure provides a method of identifying a switchable core promoter comprising: introducing into a cell population a core promoter library comprising a first sub-library and a second sub-library; wherein the first sub-library comprises a plurality of core promoters, a core promoter of the plurality of core promoters is linked to a first response element and a unique barcode sequence; wherein the second sub-library comprises a plurality of core promoters, a core promoter of the plurality of promoters is linked to a second response element and a unique barcode sequence; and identifying a switchable core promoter as one that promotes higher transcription of the unique barcode when paired with the first response element than when paired with the second response element.

[0018] In some embodiments, the method further comprises activating the first response element. In some embodiments, the second response element is not activated. In some embodiments, the first response element is an activated response element and the second enhancer sequence is an inactive or non-activated response element.

[0019] In various aspects, the disclosure provides a nucleic acid sequence encoding a TATA box, an initiator element, a spacer separating the TATA box and the initiator element, wherein a) the TATA box comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO:199 to SEQ ID NO:201, or SEQ ID NO:213 to SEQ ID NO:215; b) the initiator element comprises a sequence having at least 75% sequence identity to any one of SEQ ID NO:202 to SEQ ID NO:204, SEQ ID NO:216, or SEQ ID NO:217; c) the spacer is a short spacer comprising 25 or more and 29 or less nucleotide residues from the TATA box to the initiator element; d) the spacer is a short spacer comprising 25 or more and 29 or less nucleotide residues from the TATA box to the initiator element; e) the YY1 motif comprises a sequence having at least 80% sequence identity to any one of SEQ ID NO:205 to SEQ ID NO:207; f) the transcription pausing site comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:196 to SEQ ID NO:198, SEQ ID NO:211, or SEQ ID NO:212; g) at least 70% sequence identity and at least one nucleotide substitution compared to SEQ ID NO:5, SEQ ID NO:9, or SEQ ID NO:210; and h) combinations thereof.

[0020] In some embodiments, the engineered core promoter comprises at least 70% sequence identity and the nucleotide substitutions T15G and A40C compared to SEQ ID NO: 5. In some embodiments, the engineered core promoter comprises at least 70% sequence identity and the nucleotide substitutions T15A and A40T compared to SEQ ID NO: 5.

[0021] In some embodiments, the spacer comprises 29-31 nucleotides from the TATA box to the initiator element. In some embodiments, the spacer comprises 30 nucleotides from the TATA box to the initiator element. In some embodiments, the short spacer comprises 28 nucleotide residues from the TATA box to the initiator element. In some embodiments, the long spacer comprises 32 nucleotide residues from the TATA box to the initiator element.

[0022] In some embodiments, the TATA box comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:199-201 or SEQ ID NO:213-215. In some embodiments, the TATA box comprises any one of SEQ ID NO:199-201 or SEQ ID NO:213-215.

[0023] In some embodiments, the initiator element comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO:202-204, SEQ ID NO:216, or SEQ ID NO:217. In some embodiments, the initiator element comprises a sequence of any one of SEQ ID NO:202-204, SEQ ID NO:216, or SEQ ID NO:217.

[0024] In some embodiments, the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 205 to 207. In some embodiments, the YY1 motif comprises a sequence of any one of SEQ ID NOs: 205 to 207.

[0025] In some embodiments, the transcriptional pausing site comprises a sequence having at least 95% sequence identity to any one of SEQ ID NO:196-SEQ ID NO:198, SEQ ID NO:211, or SEQ ID NO:212. In some embodiments, the transcriptional pausing site comprises a sequence of any one of SEQ ID NO:196-SEQ ID NO:198, SEQ ID NO:211, or SEQ ID NO:212.

[0026] In some embodiments, the engineered core promoter comprises two or more of the features. In some embodiments, the engineered core promoter comprises features a) and b). In some embodiments, the engineered core promoter comprises three or more of the features. In some embodiments, the engineered core promoter comprises features a) and b) and at least one more of the features. In some embodiments, the engineered core promoter comprises features a), b), and c). In some embodiments, the engineered core promoter comprises features a), b), and d). In some embodiments, the engineered core promoter comprises features a), b), and e). In some embodiments, the engineered core promoter comprises features a), b), and f).

[0027] In various embodiments, the disclosure provides engineered core promoters comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144.

[0028] In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144. In some embodiments, the engineered core promoter comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO:1-4, SEQ ID NO:7, SEQ ID NO:10-15, or SEQ ID NO:110. In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:1-4, SEQ ID NO:7, SEQ ID NO:10-15, or SEQ ID NO:110.

[0029] In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:7. In some embodiments, the engineered core promoter comprises a sequence of SEQ ID NO:7. In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:1. In some embodiments, the engineered core promoter comprises a sequence of SEQ ID NO:1. In some embodiments, the engineered core promoter comprises a sequence of SEQ ID NO:2. In some embodiments, the engineered core promoter comprises a sequence of SEQ ID NO:2. In some embodiments, the engineered core promoter comprises a sequence of SEQ ID NO:3. In some embodiments, the engineered core promoter comprises a sequence of SEQ ID NO:3. In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:4 and comprising the nucleotide substitutions T15G and A40T relative to SEQ ID NO:5. In some embodiments, the engineered core promoter comprises a sequence of SEQ ID NO:4. In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:10. In some embodiments, the engineered core promoter comprises the sequence of SEQ ID NO: 10. In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 11. In some embodiments, the engineered core promoter comprises the sequence of SEQ ID NO: 11. In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 12. In some embodiments, the engineered core promoter comprises the sequence of SEQ ID NO: 12. In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 13. In some embodiments, the engineered core promoter comprises the sequence of SEQ ID NO: 13. In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 14. In some embodiments, the engineered core promoter comprises the sequence of SEQ ID NO: 14.In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 15 and comprising the nucleotide substitutions T15G and A40C relative to SEQ ID NO: 5. In some embodiments, the engineered core promoter comprises the sequence of SEQ ID NO: 15. In some embodiments, the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 110. In some embodiments, the engineered core promoter comprises the sequence of SEQ ID NO: 110.

[0030] In some embodiments, the engineered core promoter comprises a TATA box, an RNA polymerase binding sequence, a B recognition element, a CCAAT box, or a Pribnow sequence. In some embodiments, the engineered core promoter is capable of recruiting a polymerase. In some embodiments, the polymerase is RNA polymerase II.

[0031] In some embodiments, the engineered core promoter has a higher dynamic range than that of SEQ ID NO: 6. In some embodiments, the engineered core promoter has a higher dynamic range than that of SEQ ID NO: 9. In some embodiments, the engineered core promoter has a higher activity than that of SEQ ID NO: 6. In some embodiments, the engineered core promoter has a higher activity than that of SEQ ID NO: 9. In some embodiments, the transcriptional activity produced by the engineered core promoter paired with an activated response element is higher than the transcriptional activity produced by the core promoter of SEQ ID NO: 6 when paired with an activated response element, or the basal transcriptional activity produced by the engineered core promoter paired with an activated response element is lower than the basal transcriptional activity produced by the core promoter of SEQ ID NO: 6 when paired with an inactive response element, or both. In some embodiments, the transcriptional activity produced by the engineered core promoter paired with an activated response element is higher than the transcriptional activity produced by the core promoter of SEQ ID NO:9 when paired with an activated response element, or the basal transcriptional activity produced by the engineered core promoter paired with an activated response element is lower than the basal transcriptional activity produced by the core promoter of SEQ ID NO:9 when paired with an inactive response element, or both.

[0032] In various embodiments, the disclosure provides engineered response elements comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO:145 or SEQ ID NO:146.

[0033] In some embodiments, the engineered response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 146. In some embodiments, the engineered response element comprises the sequence of SEQ ID NO: 145 or SEQ ID NO: 146. In some embodiments, the engineered response element is capable of binding to a cognate ligand, coactivator, or repressor. In some embodiments, the engineered response element is an enhancer. In some embodiments, binding of a cognate ligand or coactivator to the engineered response element increases transcription of a payload under the transcriptional control of the engineered response element paired with a core promoter in a target cell type, target cell state, or target tissue. In some embodiments, binding of a corepressor to the engineered response element decreases transcription of a payload under the transcriptional control of the engineered response element paired with a core promoter in a non-target cell type, non-target cell state, or non-target tissue. In some embodiments, the engineered response element confers myeloid-specific transcription of a payload under the transcriptional control of the engineered response element paired with a core promoter. In some embodiments, the engineered response element comprises the sequence of SEQ ID NO: 145. In some embodiments, the engineered response element confers liver-specific transcription of the payload under the transcriptional control of the engineered response element paired with the core promoter. In some embodiments, the engineered response element comprises the sequence of SEQ ID NO: 146.

[0034] In various aspects, the disclosure provides an engineered promoter comprising a response element and a core promoter, wherein the response element comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:193, or SEQ ID NO:194, and the core promoter comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:1-144 or SEQ ID NO:210.

[0035] In some embodiments, the core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:1-SEQ ID NO:144 or SEQ ID NO:210. In some embodiments, the core promoter comprises a sequence of SEQ ID NO:1-SEQ ID NO:144 or SEQ ID NO:210. In some embodiments, the engineered promoter comprises a sequence of any one of SEQ ID NO:148-SEQ ID NO:177 or SEQ ID NO:218-SEQ ID NO:255.

[0036] In various aspects, the disclosure provides engineered promoters comprising the response elements and engineered core promoters described herein.

[0037] In some embodiments, the response element is capable of binding to a cognate ligand, coactivator, or corepressor. In some embodiments, the response element is an enhancer. In some embodiments, the binding of a cognate ligand or coactivator to the response element increases transcription of a payload under the transcriptional control of an engineered promoter in a target cell type, target cell state, or target tissue. In some embodiments, the binding of a corepressor to the response element decreases transcription of a payload under the transcriptional control of an engineered promoter in a non-target cell type, non-target cell state, or non-target tissue. In some embodiments, the response element confers bone marrow-specific transcription of a payload under the transcriptional control of an engineered promoter. In some embodiments, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 193. In some embodiments, the response element comprises the sequence of SEQ ID NO: 145 or SEQ ID NO: 193. In some embodiments, the response element confers liver-specific transcription of a payload under the transcriptional control of an engineered promoter. In some embodiments, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 146 or SEQ ID NO: 194. In some embodiments, the response element comprises a sequence of SEQ ID NO: 146 or SEQ ID NO: 194. In some embodiments, the response element confers neuron-specific transcription of a payload under the transcriptional control of an engineered promoter. In some embodiments, the response element confers muscle-specific transcription of a payload under the transcriptional control of an engineered promoter. In some embodiments, the response element confers kidney-specific transcription of a payload under the transcriptional control of an engineered promoter.

[0038] In various aspects, the disclosure provides a recombinant polynucleotide comprising an engineered core promoter as described herein and a payload comprising a coding sequence under the transcriptional control of the engineered core promoter.

[0039] In various aspects, the disclosure provides a recombinant polynucleotide comprising a response element comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:193, or SEQ ID NO:194, and a payload comprising a coding sequence under the transcriptional control of the response element.

[0040] In some embodiments, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. In some embodiments, the response element comprises the sequence of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194.

[0041] In various aspects, the disclosure provides a recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises a response element capable of binding to a cognate ligand, coactivator, or corepressor; and an engineered core promoter of any one of claims 1-60 capable of recruiting a polymerase; and the payload comprises a coding sequence under the transcriptional control of the promoter.

[0042] In some embodiments, the response element is an enhancer. In some embodiments, binding of a cognate ligand or coactivator to the response element increases transcription of the payload in a target cell type, target cell state, or target tissue. In some embodiments, binding of a corepressor to the response element decreases transcription of the payload in a non-target cell type, non-target cell state, or non-target tissue. In some embodiments, the response element confers neuron-specific transcription of the payload. In some embodiments, the response element confers bone marrow-specific transcription of the payload. In some embodiments, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 193. In some embodiments, the response element comprises the sequence of SEQ ID NO: 145 or SEQ ID NO: 193. In some embodiments, the response element confers liver-specific transcription of the payload. In some embodiments, the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 146 or SEQ ID NO: 194. In some embodiments, the response element comprises the sequence of SEQ ID NO: 146 or SEQ ID NO: 194. In some embodiments, the response element confers muscle-specific transcription of the payload. In some embodiments, the response element confers kidney-specific transcription of the payload.

[0043] In various aspects, the disclosure provides a recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises a response element capable of binding to a cognate ligand, coactivator, or corepressor, the response element comprising a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194; and an engineered core promoter capable of recruiting a polymerase; and the payload comprises a coding sequence under the transcriptional control of the promoter.

[0044] In some embodiments, the payload encodes a protein. In some embodiments, the protein is a neuronal protein, a renal protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. In some embodiments, the protein is associated with a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscle disorder, or cancer. In some embodiments, the protein is progranulin, MeCP2, polycystin-1, or polycystin-2.

[0045] In some embodiments, the payload encodes a therapeutic polynucleotide. In some embodiments, the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. In some embodiments, the therapeutic polynucleotide targets a gene. In some embodiments, the gene is associated with a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscular disorder, or cancer. In some embodiments, the gene is GRN, MECP2, PKD2, or PKD2.

[0046] In various aspects, the present disclosure provides an engineered viral vector comprising an engineered core promoter according to any one of claims 1 to 60 in the viral vector.

[0047] In various aspects, the present disclosure provides engineered viral vectors that include an engineered response element as described herein in the viral vector.

[0048] In various aspects, the disclosure provides engineered viral vectors that include an engineered promoter described herein in the viral vector.

[0049] In various aspects, the present disclosure provides engineered viral vectors that include a recombinant polynucleotide described herein in the viral vector.

[0050] In some embodiments, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. In some embodiments, the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP. eB, AAV.PhP.V1, AAV.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy 5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC 5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, and combinations thereof.

[0051] In various aspects, the disclosure provides cells comprising an engineered core promoter as described herein.

[0052] In various aspects, the disclosure provides cells that include the engineered response elements described herein.

[0053] In various aspects, the disclosure provides cells comprising the engineered promoters described herein.

[0054] In various aspects, the present disclosure provides a cell comprising a recombinant polynucleotide described herein.

[0055] In various aspects, the present disclosure provides a cell comprising the engineered viral vector described herein.

[0056] In some embodiments, the cell is a target cell. In some embodiments, the cell is a disease cell. In some embodiments, the cell is a central nervous system cell, a neuron, a kidney cell, a retina cell, a liver cell, an epithelial cell, a muscle cell, a red blood cell, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a stromal cell, an adipocyte, or a fibroblast.

[0057] In various aspects, the present disclosure provides a pharmaceutical composition comprising an engineered core promoter as described herein and a pharma- ceutically acceptable carrier.

[0058] In various aspects, the disclosure provides pharmaceutical compositions comprising an engineered response element described herein and a pharma- ceutically acceptable carrier.

[0059] In various aspects, the disclosure provides a pharmaceutical composition comprising an engineered promoter as described herein and a pharma- ceutically acceptable carrier.

[0060] In various aspects, the present disclosure provides a pharmaceutical composition comprising a recombinant polynucleotide described herein and a pharma- ceutically acceptable carrier.

[0061] In various aspects, the present disclosure provides pharmaceutical compositions comprising an engineered viral vector described herein and a pharma- ceutically acceptable carrier.

[0062] In various aspects, the disclosure provides a method of expressing a payload in a target cell of a subject, the method comprising: administering to the subject a recombinant polynucleotide described herein, a viral vector described herein, or a pharmaceutical composition described herein; binding a cognate ligand, coactivator, or corepressor to the response element of the recombinant polynucleotide, where the cognate ligand or coactivator is specific for the target cell or the corepressor is specific for a non-target cell; initiating transcription of the payload by recruiting a polymerase to the core promoter; and transcribing the payload, thereby expressing the payload in the target cell.

[0063] In some embodiments, the method includes expressing the payload at a higher level in the target cell than in the non-target cell. In some embodiments, the method includes initiating transcription at a higher rate in the target cell than in the non-target cell. In some embodiments, the cognate ligand or coactivator is present at a higher level in the target cell than in the non-target cell. In some embodiments, the cognate ligand is a transcription factor. In some embodiments, the co-repressor is present at a higher level in the non-target cell than in the target cell. In some embodiments, the target cell is a target cell state and the non-target cell is a non-target cell state. In some embodiments, the target cell state is a diseased cell. In some embodiments, the non-target cell state is a healthy cell. In some embodiments, the target cell is a target cell type and the non-target cell is a non-target cell type. In some embodiments, the target cell type is a central nervous system cell, a neuron, a kidney cell, a retina cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a stromal cell, an adipocyte, or a fibroblast. In some embodiments, the non-target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a stromal cell, an adipocyte, a fibroblast, or a combination thereof.

[0064] In various aspects, the disclosure provides a method of treating a disorder in a subject in need of treatment comprising administering to the subject a composition comprising a recombinant polynucleotide described herein, a viral vector described herein, or a pharmaceutical composition described herein; and expressing a therapeutic sequence encoded by the payload of the recombinant polynucleotide in a target cell of the subject, thereby treating the disorder.

[0065] In some embodiments, the target cell is a cell type associated with a disorder. In some embodiments, the target cell is a cellular condition associated with a disorder. In some embodiments, the disorder is a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscular disorder, or a cancer. In some embodiments, the disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic-predominant age-related TDP-43 encephalopathy, or polycystic kidney disease. In some embodiments, the disorder is any one of the disorders provided in Table 5. In some embodiments, the therapeutic sequence encodes a therapeutic protein. In some embodiments, the therapeutic protein is a neuronal protein, a renal protein, a retinal protein, a muscular protein, or an apoptosis-inducing protein. In some embodiments, the therapeutic protein is associated with a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscular disorder, or a cancer. In some embodiments, the therapeutic protein is MECP2, progranulin, polycystin-1, or polycystin-2. In some embodiments, the therapeutic protein is encoded by a gene provided in Table 5. In some embodiments, the payload encodes a therapeutic polynucleotide. In some embodiments, the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. In some embodiments, the therapeutic polynucleotide targets a gene provided in Table 5.

[0066] In various aspects, the disclosure provides a method of identifying a switchable core promoter comprising: introducing into a cell population a core promoter library comprising a first sub-library and a second sub-library; wherein the first sub-library comprises a plurality of core promoters, a core promoter of the plurality of core promoters is linked to a first response element and a unique barcode sequence; wherein the second sub-library comprises a plurality of core promoters, a core promoter of the plurality of promoters is linked to a second response element and a unique barcode sequence; and identifying a switchable core promoter as one that promotes higher transcription of the unique barcode when paired with the first response element than when paired with the second response element.

[0067] In some embodiments, the method further comprises activating the first response element. In some embodiments, the second response element is not activated. In some embodiments, the first response element is an activated response element and the second enhancer sequence is an inactive or non-activated response element. In some embodiments, the first response element is specific for a cell population. In some embodiments, the cell population is a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. In some embodiments, the first response element is specific for a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. In some embodiments, the second response element is specific for a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. In some embodiments, the multiple core promoters include engineered core promoters, synthetic core promoters, wild-type core promoters, variant core promoters, or combinations thereof.

[0068] In various aspects, the disclosure provides a recombinant polynucleotide as described herein, a viral vector as described herein, or a pharmaceutical composition as described herein, for use in a method of treating a disorder, the method comprising administering to a subject a composition comprising the recombinant polynucleotide, viral vector, or pharmaceutical composition, and expressing in target cells of the subject a therapeutic sequence encoded by the payload of the recombinant polynucleotide.

[0069] In some embodiments, the disorder treated is genetic disorder, neurological disorder, kidney disorder, eye disorder, muscle disorder, or cancer.In some embodiments, the disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic-predominant age-related TDP-43 encephalopathy, or polycystic kidney disease.In some embodiments, the disorder is any one of the disorders provided in Table 5.

[0070] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference in this specification.

[0071] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings, in which: [Brief description of the drawings]

[0072] [Figure 1]1 shows a scatter plot of the transcriptional activity of enhancers in a myeloid cancer cell model ("K562 activity") compared to the transcriptional activity in a hepatic cancer cell model ("HepG2 activity"), as determined using a massively parallel reporter assay (MPRA). Enhancer with SEQ ID NO: 194 was identified as an endogenous enhancer with hepatic cell-specific activity. Enhancer with SEQ ID NO: 193 was identified as an endogenous enhancer with myeloid specific activity. Enhancer with SEQ ID NO: 147 was identified as a negative control enhancer with low transcriptional activation in both hepatic and myeloid cells.

[0073] [Diagram 2] Illustrated are engineered polynucleotides used to screen for cell type specific transcription activation. Each polynucleotide construct contained, from 5' to 3', either a cell type specific enhancer ("HepG2 synthetic" (SEQ ID NO: 146), "K562 synthetic" (SEQ ID NO: 145), "HepG2 endogenous" (SEQ ID NO: 194), or "K562 endogenous" (SEQ ID NO: 193), a negative control enhancer ("negative", SEQ ID NO: 147), or a random sequence without enhancer activity ("random"); a core promoter; a barcode sequence; and a reporter open reading frame ("reporter ORF").

[0074] [Diagram 3] FIG. 1 shows a violin plot of the transcriptional activity of 3,649 core promoters screened in hepatocytes when paired with a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), a synthetic bone marrow-specific enhancer (SEQ ID NO: 145), an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194), an endogenous bone marrow-specific enhancer (SEQ ID NO: 193), a random sequence with no enhancer activity ("Random"), or a negative control enhancer (SEQ ID NO: 147).

[0075] [Figure 4]A plot comparing the transcriptional activity of a library of core promoters across two overlaps ("overlap 1" and "overlap 2") of the MPRA core promoter screen is shown.

[0076] [Figure 5A] 1 shows a histogram plot of the transcriptional activity of the ybTATA core promoter (SEQ ID NO: 9) assayed using a dual reporter flow assay in HepG2 cells and quantified by mCherry fluorescence ("mCherry"). Transcriptional activity was assessed with ybTATA alone inserted into the dual reporter construct ("ybTATA" alone) or when paired with a negative control enhancer (SEQ ID NO: 147), a synthetic myeloid-specific enhancer (SEQ ID NO: 145), an endogenous myeloid-specific enhancer (SEQ ID NO: 193), a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), or an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194). Wild-type cells without plasmid ("WT") were used as a negative control.

[0077] [Figure 5B] 1 shows a bar graph comparing the average fold change in geometric mean fluorescence intensity (gMFI) core promoters screened in HepG2 cells using a dual reporter flow assay. The transcriptional activity of the core promoter was assessed with ybTATA alone inserted into the dual reporter construct ("ybTATA" only) or when paired with an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194), a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), an endogenous bone marrow-specific enhancer (SEQ ID NO: 193), a synthetic bone marrow-specific enhancer (SEQ ID NO: 145), or a negative control enhancer (SEQ ID NO: 147).

[0078] [Figure 5C]1 shows a bar graph comparing the average fold change in geometric mean fluorescence intensity (gMFI) core promoters screened in K562 cells using a dual reporter flow assay. The transcriptional activity of the core promoters was assessed with ybTATA alone inserted into the dual reporter construct ("ybTATA" only) or when paired with an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194), a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), an endogenous bone marrow-specific enhancer (SEQ ID NO: 193), a synthetic bone marrow-specific enhancer (SEQ ID NO: 145), or a negative control enhancer (SEQ ID NO: 147).

[0079] [Figure 5D] 1 shows a histogram plot of the transcriptional activity of the ybTATA core promoter (SEQ ID NO: 9) assayed using a dual reporter flow assay in K562 cells and quantified by mCherry fluorescence ("mCherry"). Transcriptional activity was assessed with ybTATA alone inserted into the dual reporter construct ("ybTATA" alone) or when paired with a negative control enhancer (SEQ ID NO: 147), a synthetic myeloid-specific enhancer (SEQ ID NO: 145), an endogenous myeloid-specific enhancer (SEQ ID NO: 193), a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), or an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194). Wild-type cells without plasmid ("WT") were used as a negative control.

[0080] [Figure 6]Scatter plots comparing the fold activation of transcriptional activity in HepG2 cells of a library of core promoters screened using MPRA screening when paired with different enhancers. The fold activation of each core promoter paired with a synthetic HepG2-specific enhancer of SEQ ID NO: 146 compared to a core promoter paired with a negative control enhancer of SEQ ID NO: 147 ("Hep synthetic vs negative") was compared to the fold activation of each core promoter paired with a synthetic K562-specific enhancer of SEQ ID NO: 145 compared to a core promoter paired with no enhancer ("K synthetic vs no enhancer"). The dashed line represents the y=x line, and the outlined points indicate the ybTATA (SEQ ID NO: 9) and minP (SEQ ID NO: 5) core promoters.

[0081] [Figure 7] 1 shows a scatter plot comparing the transcriptional activation in HepG2 cells of two libraries of core promoters with different spacing sequences screened using MPRA (either "background 1" with sequence SEQ ID NO: 208 or "background 2" with sequence SEQ ID NO: 209). The dashed line represents the y=x line.

[0082] [Figure 8] 1 shows a scatter plot comparing the transcriptional activity in HepG2 cells of the de novo designed core promoter sub-library screened using MPRA screening when paired with different synthetic enhancers. The transcriptional activity of each core promoter paired with synthetic HepG2-specific enhancer of SEQ ID NO: 146 ("HepG2 synthetic") is compared to the transcriptional activity when paired with synthetic K562-specific enhancer of SEQ ID NO: 145 ("K562 synthetic"). The dashed line represents the y=x line.

[0083] [Figure 9A]Scatter plots comparing the transcriptional activity of a sub-library of de novo designed core promoters with different lengths of spacing from the TATA sequence to the initiator element (Inr) sequence. The transcriptional activity was measured in HepG2 cells using MPRA screening when paired with a synthetic HepG2 enhancer (SEQ ID NO: 146). The transcriptional activity of each core promoter with a standard TATA to Inr spacing of 30 nucleotides ("Founder Combo") was compared to the transcriptional activity of the corresponding core promoter with a shortened TATA to Inr spacing of 28 nucleotides ("with short spacing"). Highly active core promoters corresponding to SEQ ID NO: 141 with standard spacing or SEQ ID NO: 7 with short spacing are circled in red. The dashed line represents the y=x line.

[0084] [Figure 9B] Figure 1 shows a violin plot of the transcriptional activity of SEQ ID NO: 141 (a core promoter with a standard TATA to Inr spacing of 30 nucleotides) and SEQ ID NO: 7 (a corresponding core promoter with a shorter TATA to Inr spacing of 28 nucleotides). Each bar in the plot contains an activity value for each of the approximately 40 redundant barcodes paired with the corresponding core promoter. Transcriptional activity was measured in HepG2 cells when paired with a synthetic HepG2 enhancer (SEQ ID NO: 146).

[0085] [Figure 10A]Figure 1 shows a scatter plot comparing the transcriptional activity of a library of core promoters with or without a transcription pause site. The transcriptional activity was measured in HepG2 cells using MPRA screening when paired with a synthetic HepG2 enhancer (SEQ ID NO: 146). The transcriptional activity of each core promoter without a transcription pause site ("Founder Combo") was compared to the transcriptional activity of the corresponding core promoter with a transcription pause site ("With Pause Site"). The core promoter containing the pause site of SEQ ID NO: 196 is represented by a black circle. The dashed line represents the y=x line.

[0086] [Figure 10B] Scatter plots comparing the transcription fold activation of a library of core promoters paired with synthetic HepG2 enhancers (SEQ ID NO: 146) with or without a transcription pause site versus a negative control (SEQ ID NO: 147). The fold activation of the core promoters with a transcription pause site versus the negative control (SEQ ID NO: 147) in HepG2 cells was measured using MPRA screening. The fold activation of each core promoter with a transcription pause site ("with pause site") versus the corresponding core promoter without a transcription pause site ("Founder Combo") was measured in HepG2 cells using MPRA screening. The best sequences with pause sites are represented by black circles. The dashed line represents the y=x line.

[0087] [Figure 11A] Figure 1 shows a scatter plot comparing the transcriptional activity in HepG2 cells of a library of core promoters screened using MPRA screening when paired with different synthetic enhancers.The transcriptional activity of each core promoter paired with synthetic HepG2-specific enhancer of SEQ ID NO: 146 ("HepG2 synthetic") is compared to the transcriptional activity when paired with synthetic K562-specific enhancer of SEQ ID NO: 145 ("K562 synthetic").The core promoters containing YY1 motifs are represented by darker circles.The dashed line represents the y=x line.

[0088] [Figure 11B] Scatter plots are shown comparing the transcriptional activity in HepG2 cells of a library of core promoters screened using MPRA screening when paired with different enhancers that are not activated in HepG2 cells.The transcriptional activity of each core promoter paired with the endogenous K562-specific enhancer of SEQ ID NO: 193 ("K562 endogenous") is compared to the transcriptional activity when paired with the negative control enhancer of SEQ ID NO: 147 ("negative control").The core promoters containing YY1 motifs are represented by darker circles.The dashed line represents the line of y=x.

[0089] [Figure 11C] Scatter plots comparing the transcriptional activity of a library of core promoters with or without YY1 motifs. Transcriptional activity was measured in HepG2 cells using MPRA screening when paired with synthetic HepG2 enhancer (SEQ ID NO: 146). Transcriptional activity of each core promoter without YY1 motif ("Founder Combo") was compared to that of the corresponding core promoter with a transcription pause site ("With YY1"). The dashed line represents the y=x line.

[0090] [Figure 11D] Scatter plots comparing the transcriptional activity of a library of core promoters with or without the YY1 motif. Transcriptional activity was measured in HepG2 cells when paired with the synthetic K562 enhancer (SEQ ID NO: 145) using MPRA screening. The transcriptional activity of each core promoter without the YY1 motif ("Founder Combo") was compared to the transcriptional activity of the corresponding core promoter with a transcription pause site ("With YY1"). The dashed line represents the y=x line.

[0091] [Figure 12A]1 shows a scatter plot comparing the transcriptional activity in HepG2 cells of point mutations of the ybTATA core promoter (SEQ ID NO:9) when paired with the synthetic HepG2-specific enhancer of SEQ ID NO: 146. The activity of each possible point mutation at each position in the sequence is shown as a shaded circle, with the darkest shade representing T, the next darkest shade representing A, the lightest shade representing G, and the next lightest shade representing C. The activity of the ybTATA sequence (SEQ ID NO:9) provided at the bottom of the plot is indicated by dashes colored based on the identity of the nucleotide present at that position in SEQ ID NO:9.

[0092] [Figure 12B] 1 shows a scatter plot comparing the transcriptional activity in HepG2 cells of point mutations of the minP core promoter (SEQ ID NO:5) when paired with the synthetic HepG2-specific enhancer of SEQ ID NO: 146. The activity of each possible point mutation at each position in the sequence is shown as a shaded circle, with the darkest shade representing T, the next darkest shade representing A, the lightest shade representing G, and the next lightest shade representing C. The activity of the minP sequence (SEQ ID NO:5) provided at the bottom of the plot is indicated by a shaded dash based on the identity of the nucleotide present at that position in SEQ ID NO:5.

[0093] [Figure 13A] 1 shows a sequence logo plot illustrating the relative enrichment of each possible nucleotide in the TATA sequence and adjacent residues.

[0094] [Figure 13B] 1 shows a sequence logo plot illustrating the relative enrichment of each possible nucleotide in the Inr sequence and adjacent residues.

[0095] [Figure 13C] 1 shows a sequence logo plot illustrating the relative enrichment of each possible nucleotide in the YY1 transcription factor binding motif sequence and adjacent residues.

[0096] [Figure 13D] 1 shows a sequence logo plot illustrating the relative enrichment of each possible nucleotide in the HNF4α transcription factor binding motif sequence and adjacent residues.

[0097] [Figure 14A] 1 shows a heat map showing the activity of the double point mutant of minP (SEQ ID NO: 5) in HepG2 cells when paired with the synthetic HepG2-specific enhancer of SEQ ID NO: 146. Lighter shading indicates higher transcriptional activity. The core promoter with the sequence of SEQ ID NO: 15, which contains the substitutions T15G and A40C compared to SEQ ID NO: 5, is represented by a white box.

[0098] [Figure 14B] 1 shows a heat map showing the activity of the double point mutant of minP (SEQ ID NO: 5) in K562 cells when paired with the synthetic K562-specific enhancer of SEQ ID NO: 145. Lighter shading indicates higher transcriptional activity. The core promoter with the sequence of SEQ ID NO: 15, which contains the substitutions T15G and A40C compared to SEQ ID NO: 5, is represented by a white box.

[0099] [Figure 15A] 1 shows a scatter plot comparing the transcriptional activity in HepG2 cells of a library of core promoters screened using MPRA screening when paired with different synthetic enhancers. The transcriptional activity of each core promoter paired with the synthetic K562-specific enhancer of SEQ ID NO: 145 ("K562 synthetic") was compared to the transcriptional activity when paired with the synthetic HepG2-specific enhancer of SEQ ID NO: 146 ("HepG2 synthetic"). SEQ ID NO: 5 (minP) and SEQ ID NO: 9 (ybTATA) are represented by circles. The dashed line represents the y=x line.

[0100] [Figure 15B]Scatter plots comparing the fold activation of transcriptional activity in HepG2 cells of a library of core promoters screened using MPRA screening when paired with different enhancers. The fold activation of each core promoter paired with the synthetic HepG2-specific enhancer of SEQ ID NO: 146 compared to the core promoter paired with the negative control enhancer of SEQ ID NO: 147 ("HepG2 synthetic vs negative") is compared to the fold activation of each core promoter paired with the synthetic K562-specific enhancer of SEQ ID NO: 145 compared to the core promoter paired with no enhancer ("K562 synthetic vs none"). SEQ ID NO: 5 (minP) and SEQ ID NO: 9 (ybTATA) are represented by circles. The dashed line represents the y=x line.

[0101] [Figure 16A] 1 shows a violin plot of the transcriptional activity in HepG2 cells of selected core promoters when paired with the synthetic HepG2-specific enhancer of SEQ ID NO: 146. Each bar in the plot contains an activity value for each of approximately 40 redundant barcodes paired with the corresponding core promoter. The activities of the core promoters of SEQ ID NO: 7, SEQ ID NO: 6, SEQ ID NO: 5 (minP), and SEQ ID NO: 9 (ybTATA) were compared.

[0102] [Figure 16B] 1 shows a violin plot of the transcriptional activity in HepG2 cells of selected core promoters when paired with the negative control enhancer of SEQ ID NO: 147. Each bar in the plot contains an activity value for each of approximately 40 redundant barcodes paired with the corresponding core promoter. The activities of the core promoters of SEQ ID NO: 7, SEQ ID NO: 6, SEQ ID NO: 5 (minP), and SEQ ID NO: 9 (ybTATA) were compared.

[0103] [Figure 17]Scatter plots comparing the fold activation of transcriptional activity in HepG2 cells of a library of core promoters screened using MPRA screening when paired with different enhancers. The fold activation of each core promoter paired with a synthetic HepG2-specific enhancer of SEQ ID NO:146 compared to a core promoter paired with a negative control enhancer of SEQ ID NO:147 ("Hep synthetic vs negative") was compared to the fold activation of each core promoter paired with a synthetic K562-specific enhancer of SEQ ID NO:145 compared to a core promoter paired with no enhancer ("K synthetic vs no enhancer"). The dashed line represents the y=x line, and the black dots represent the core promoters of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15.

[0104] [Figure 18] 1 shows a scatter plot comparing the transcriptional activity in HepG2 cells of a library of core promoters screened using MPRA screening when paired with different enhancers. The transcriptional activity of each core promoter was compared when paired with a synthetic HepG2-specific enhancer of SEQ ID NO:146 ("HepG2 synthetic") or a synthetic K562-specific enhancer of SEQ ID NO:145 ("K562 synthetic"). The dashed line represents the y=x line, and the black dots represent the core promoters of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15.

[0105] [Figure 19A] Schematic diagrams of the core promoters of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 7 are shown, showing regions corresponding to the TATA box and initiator element (Inr). If present, transcription pause sites and regions corresponding to the YY1 motif are also shown.

[0106] [Figure 19B] Schematic diagrams of the core promoters of SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12 are shown, showing regions corresponding to the TATA box and initiator element (Inr). If present, transcription pause sites and regions corresponding to the YY1 motif are also shown.

[0107] [Figure 19C] Schematic diagrams of the core promoters of SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:4, and SEQ ID NO:110 are shown, showing the regions corresponding to the TATA box and initiator element (Inr). Also shown are the regions corresponding to the transcription pause site and the YY1 motif, if present. In SEQ ID NO:15 and SEQ ID NO:4, which represent variants of the minP core promoter, point mutations compared to the minP sequence (SEQ ID NO:5) are represented by boxes.

[0108] [Figure 20A] 1 shows a comparison of promoter activity determined by MPRA screening ("Screening Activity") and dual reporter qPCR assay ("qPCR Activity") for core promoters paired with K562-specific enhancers in HepG2 cells. Activity was compared for the core promoters of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15.

[0109] [Figure 20B]1 shows a comparison of promoter activity determined by MPRA screening ("screening activity") and dual reporter qPCR assay ("qPCR activity") for core promoters paired with HepG2-specific enhancers in HepG2 cells. Activity was compared for the core promoters of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15.

[0110] [Figure 20C] 1 shows a comparison of promoter activity determined by MPRA screening ("Screening Activity") and dual reporter qPCR assay ("qPCR Activity") for core promoters paired with K562-specific enhancers in K562 cells. Activity was compared for core promoters of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15.

[0111] [Figure 21A] FIG. 1 shows a comparison of the transcriptional activity in H4 cells of the minP variant of SEQ ID NO: 4 ("minP activity") and the ybTATA promoter of SEQ ID NO: 9 ("yb_TATA activity") when paired with either an H4-specific enhancer ("H4-specific enhancer 1" or "H4-specific enhancer 2") or a liver-specific enhancer.

[0112] [Figure 21B] 1 shows a comparison of the transcriptional activity in HepG2 liver cells of the minP variant of SEQ ID NO: 4 ("minP activity") and the ybTATA promoter of SEQ ID NO: 9 ("yb_TATA activity") when paired with either an H4-specific enhancer ("H4-specific enhancer 1" or "H4-specific enhancer 2") or a liver-specific enhancer.

[0113] [Figure 21C] 1 shows a comparison of the cell type specificity of the minP variant of SEQ ID NO: 4 ("minP specificity") and the ybTATA promoter of SEQ ID NO: 9 ("yb_TATA specificity").

[0114] [Figure 22A] Violin plots of the transcriptional activity of screened core promoters in myeloid cells when paired with a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), a synthetic myeloid-specific enhancer (SEQ ID NO: 145), an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194), an endogenous myeloid-specific enhancer (SEQ ID NO: 193), a random sequence with no enhancer activity ("Random"), or a negative control enhancer (SEQ ID NO: 147).

[0115] [Figure 22B] 1 shows a violin plot of the transcriptional activity of the screened core promoters in hepatocytes when paired with a synthetic hepatocyte-specific enhancer (SEQ ID NO: 146), a synthetic bone marrow-specific enhancer (SEQ ID NO: 145), an endogenous hepatocyte-specific enhancer (SEQ ID NO: 194), an endogenous bone marrow-specific enhancer (SEQ ID NO: 193), a random sequence with no enhancer activity ("Random"), or a negative control enhancer (SEQ ID NO: 147).

[0116] [Diagram 23]1 shows a scatter plot comparing the transcriptional activity in HepG2 and K562 cells of a library of core promoter sequences screened using MPRA screening when paired with cell type specific enhancers. The transcriptional activity in HepG2 cells of each core promoter when paired with a synthetic HepG2 specific enhancer of SEQ ID NO: 146 ("HepG2 synthetic") was compared to the transcriptional activity in K562 cells of each core promoter when paired with a synthetic K562 specific enhancer of SEQ ID NO: 145 ("K562 synthetic"). The dashed line represents the y=x line, and the black dots represent the core promoters of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15.

[0117] [Figure 24] Figure 1 shows a hexibin plot comparing the transcriptional activity in HepG2 and K562 cells of a library of 21,849 enhancers:core promoters screened using MPRA screening when paired with different enhancers, including a synthetic HepG2-specific enhancer of SEQ ID NO: 146 and a synthetic K562-specific enhancer of SEQ ID NO: 145. The transcriptional activity of each core promoter paired with different enhancers was compared between HepG2 and K562 cell lines. The cluster of points corresponding to the core promoter paired with the synthetic HepG2-specific enhancer (SEQ ID NO: 146) is indicated by a dashed oval, and the cluster of points corresponding to the core promoter paired with the synthetic K562-specific enhancer (SEQ ID NO: 145) is indicated by a solid oval. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0118] While gene therapy has the potential to treat a wide variety of diseases associated with genetic mutations or altered gene expression, there can be risks associated with such therapy due in part to imprecise targeting of cells or tissues by the therapeutic payload. Restricting payload expression to a target cell type, cell state, or tissue type (such as diseased cells or tissues) can reduce the side effects of gene therapy caused by imprecise targeting. Described herein are polynucleotide sequences that code for cell type-specific or cell state-specific expression of a payload. The polynucleotide sequence can include a payload (such as a transgene or therapeutic polynucleotide) under the transcriptional control of a promoter. The promoter can facilitate cell type-specific or cell state-specific transcription initiation, leading to cell type-specific or cell state-specific expression of the payload. In some embodiments, the promoter can include a response element capable of binding to a cognate ligand, coactivator, or corepressor to regulate payload transcription, and a core promoter capable of recruiting the transcription machinery to initiate transcription of the payload when combined with a response element bound to a cognate ligand, coactivator, or corepressor. As described herein, a core promoter can be a switchable core promoter that promotes high levels of transcription in the presence of an activated response element (such as an enhancer bound to a cognate ligand or coactivator) and low or no transcription in the presence of a non-activated response element (such as an enhancer not bound to a cognate ligand or coactivator or an enhancer bound to a corepressor). The cognate ligand can be a transcription factor or a sequence-specific DNA binding factor.

[0119] The polynucleotides of the present disclosure (e.g., promoters, core promoters, response elements, payloads, or combinations thereof) can comprise recombinant polynucleotide sequences that can be engineered to encode tissue-type-, cell-type-, or cell state-specific transcription of the payload. In some embodiments, the level of transcription of the payload may depend on the cell type (e.g., neuron, kidney cell, hepatocyte, podocyte, retinal cell, epithelial cell, muscle cell, red blood cell, platelet, bone marrow cell, endothelial cell, epidermal cell, lymphocyte, glial cell, stromal cell, adipocyte, or fibroblast), cell state (e.g., diseased cell, healthy cell; activated or non-activated engineered cell (such as activated or non-activated CAR T cell)), tissue type (e.g., diseased tissue, healthy tissue, neural tissue (e.g., central nervous system, peripheral nervous system), kidney tissue, eye tissue, muscle tissue, blood, skin, fat, bone, cancer tissue, thymus tissue, gastrointestinal tissue (e.g., stomach, intestine), spleen tissue, placenta tissue, pancreatic tissue, lung tissue, liver tissue, cardiac tissue, or brain tissue (e.g., cerebrum, cerebellum, adrenal gland)), or combinations thereof. In some embodiments, a recombinant polynucleotide of the disclosure may include a core promoter described herein (e.g., an engineered core promoter), a response element described herein (e.g., an engineered response element), a payload described herein (e.g., a transgene or therapeutic polynucleotide), or a combination thereof.

[0120] Promoters may be selected for enhancing transcription in a cell type, cell state, or tissue type of interest, reducing transcription in other cell types, cell states, or tissue types, or a combination thereof. In some embodiments, promoters may be selected or engineered to modulate the level of payload transcription (e.g., to a therapeutic level (such as a level approximately the same as a wild-type version of the transgene in the target cell type or cell state)). In some embodiments, promoters may be selected or engineered to modulate the cell state dependency of payload transcription. Modulating the transcription level may include modulating transcription to a desired level. The transcription level of the payload may control the expression level of the protein encoded by the payload. For example, high levels of transcription of the transgene may lead to high levels of expression of the protein encoded by the transgene. Core promoters (e.g., engineered core promoters) of the present disclosure may be engineered or selected for both strength (e.g., strong transcriptional activation) and specificity (e.g., specific activation when paired with a response element in a transcriptionally active state compared to when paired with a response element in a transcriptionally inactive state).

[0121] Also described herein is a method of delivering the polynucleotide sequence of the present disclosure to a subject. In some embodiments, the polynucleotide can be part of a viral vector capable of delivering the polynucleotide to cells of a subject. The viral vector can include a viral inverted terminal repeat sequence that includes a viral origin of replication, allowing viral replication of the polynucleotide sequence. The viral vector can further include a viral capsid that encapsulates the polynucleotide and facilitates the delivery of the polynucleotide into cells. The method of delivering a polynucleotide composition to a subject can include administering to the subject a viral vector that includes the polynucleotide. Upon delivery of the polynucleotide to a subject, the payload encoded by the polynucleotide can be transcribed in the cells of the subject in a cell type-dependent, cell state-dependent, or tissue type-dependent manner.

[0122] Further described herein is a method of treating a disease or condition by delivery of a polynucleotide composition of the present disclosure to a subject and expression in the subject of a therapeutic protein or therapeutic polynucleotide encoded by the polynucleotide in a cell type-dependent, cell state-dependent, or tissue type-dependent manner. The therapeutic protein can be a wild-type version of a protein that is mutated or under-expressed in the disease or condition. The therapeutic polynucleotide can be a polynucleotide (e.g., gRNA or tRNA) that targets a gene associated with the disease or condition. The polynucleotide composition can be delivered to the subject as part of a viral vector. The subject can have a disease or condition (e.g., a disease or condition caused by a mutation or altered expression of a protein). In some embodiments, the polynucleotide composition can include a transgene that encodes a wild-type copy of a protein with a mutation or altered expression. The transgene can be selectively transcribed in a target cell type, cell state, or tissue type of the subject upon delivery of the polynucleotide composition to the subject. In some embodiments, the protein encoded by the transgene is expressed in the subject at a level that is dependent on the level of transcription of the transgene. Transcription of the transgene, expression of the protein encoded by the transgene, or both, in a cell-type-, cell state-, or tissue-type-dependent manner can treat a disease or condition in a subject.

[0123] Further described herein is a method for identifying a switchable core promoter disclosed herein. The switchable core promoter can be an engineered core promoter disclosed herein. The method for identifying a switchable core promoter can include: introducing a core promoter library, comprising a first sub-library and a second sub-library, into a cell population; wherein the first sub-library comprises a plurality of core promoters, one core promoter of the plurality of core promoters is linked to a first response element and a unique barcode sequence; wherein the second sub-library comprises a plurality of core promoters, the core promoter of the plurality of promoters is linked to a second response element and a unique barcode sequence; and identifying a switchable core promoter as a core promoter that promotes higher transcription of the unique barcode when paired with the first response element than when paired with the second response element. The method can further include activating the first response element. The second response element can be not activated. The first response element can be an activated response element, and the second enhancer sequence can be an inactive or non-activated response element. The first response element can be specific for a cell population. The cell population can be a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. The first response element can be specific for a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. The second response element can be specific for a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. The multiple core promoters can include engineered core promoters, synthetic core promoters, wild-type core promoters, variant core promoters, or combinations thereof.

[0124] As used herein, "switchable" can refer to the ability of a core promoter to be combined with various response elements (e.g., cell type-, tissue type-, or cell state-specific enhancers) to promote high levels of transcription in the presence of the response element in a transcriptionally active state (e.g., an activated response element), and low or no transcription in the presence of the response element in a transcriptionally inactive or repressed state (e.g., a non-activated or inactive response element).

[0125] As used herein, a "core promoter" or a "core promoter sequence" may refer to a polynucleotide that encodes a sequence that recruits a transcription apparatus (e.g., RNA polymerase) to initiate transcription of a downstream polynucleotide encoding a sequence (e.g., a payload sequence), for example, by binding to a general transcription factor (GTF) that recruits RNA polymerase. As used herein, an "engineered core promoter" or an "engineered core promoter sequence" may refer to a core promoter or a core promoter sequence that does not occur in nature. In some embodiments, an "engineered core promoter" or an "engineered core promoter sequence" may refer to a core promoter that has been mutated, altered, or engineered to have a moderate affinity for molecules (e.g., general transcription factors (GTFs)) that recruit the transcription apparatus (e.g., RNA polymerase). More specifically, the moderate affinity is a concentration of these molecules (e.g., GTFs) in the nucleus that results in little or no recruitment of the transcription apparatus to the engineered core promoter in the absence of an activated response element or in the presence of an inactive response element. However, in the presence of an activated response element, the activated response element causes an increase in the concentration of these molecules (e.g., GTFs) at the core promoter, and the resulting increased local concentration of these molecules (e.g., GTFs) at the core promoter overcomes the moderate affinity and allows for higher recruitment of the transcription machinery (e.g., RNA polymerase) to initiate higher transcription of a downstream polynucleotide encoding sequence (e.g., a payload sequence) compared to the recruitment of the transcription machinery and transcription levels in the absence of the activated response element.

[0126] As used herein, a "response element" may refer to a polynucleotide that encodes a sequence that binds to a cognate ligand (e.g., a transcription factor), a coactivator, a corepressor, or a combination thereof in a sequence-dependent manner. An "active response element" may refer to a polynucleotide that encodes a sequence that is capable of binding to a cognate ligand (e.g., a transcription factor), a coactivator, a corepressor, or a combination thereof in a sequence-dependent manner to facilitate binding of the transcriptional apparatus to a nearby core promoter (e.g., an engineered core promoter). An "inactive response element" may refer to a polynucleotide that encodes a sequence that is not capable of binding to a cognate ligand (e.g., a transcription factor), a coactivator, or a combination thereof in a sequence-dependent manner to facilitate binding of the transcriptional apparatus to a nearby core promoter (e.g., an engineered core promoter). An "activated response element" can be a response element that is bound to a cognate ligand (e.g., a transcription factor) or coactivator, or has decreased binding to a corepressor (compared to when it is not activated), or a combination thereof, and that promotes increased binding of the transcription apparatus to a nearby core promoter (e.g., an engineered core promoter). A "non-activated response element" can be an active response element that is not bound to a cognate ligand (e.g., a transcription factor) or coactivator, or has increased binding to a corepressor (compared to when it is activated), or a combination thereof, and that promotes low or no binding of the transcription apparatus to a nearby core promoter (e.g., an engineered core promoter). For example, an activated response element can promote increased binding of the transcription apparatus to a nearby core promoter over a non-activated response element to the same core promoter.

[0127] As used herein, "enhancer" or "enhancer region" may refer to a response element that binds to a cognate ligand or coactivator, or has low binding to a corepressor, and increases the binding of the transcription machinery to a nearby core promoter, thus increasing the transcription of a nearby polynucleotide encoding a sequence of a payload (such as a transgene or therapeutic polynucleotide), and this binding is cell type-, cell state-, or tissue type-dependent. An "active enhancer" may refer to a polynucleotide that encodes a sequence that is capable of cell type-, cell state-, or tissue type-dependent binding to a cognate ligand (e.g., a transcription factor), a coactivator, or has reduced binding to a corepressor (compared to when not activated), or a combination thereof, and that facilitates the binding of the transcription machinery to a nearby core promoter (e.g., an engineered core promoter) in a sequence-dependent manner, cell type, cell state, or tissue type, respectively. An "inactive enhancer" may refer to a polynucleotide that encodes a sequence that is not capable of cell-type-, cell-state-, or tissue-type-dependent binding to a cognate ligand (e.g., a transcription factor), coactivator, or a combination thereof, but that facilitates the binding of the transcriptional apparatus to a nearby core promoter (e.g., an engineered core promoter) in a sequence-dependent manner in a cell type, cell state, or tissue type, respectively. An "activated enhancer" may be an enhancer in a specific cell type, cell state, or tissue type such that it is bound to a cognate ligand (e.g., a transcription factor) or coactivator, or has reduced binding to a corepressor (compared to not being activated), or a combination thereof, and facilitates the binding of the transcriptional apparatus to a nearby core promoter (e.g., an engineered core promoter) in a specific cell type, cell state, or tissue type.A "non-activated enhancer" can be an active enhancer that is not present in a specific cell type, cell state, or tissue type, such that it is not bound to its cognate ligand (e.g., a transcription factor) or coactivator, or has increased binding to a corepressor (compared to its activated counterpart), or a combination thereof, and exhibits reduced or unfavorable binding of the transcription machinery to a nearby core promoter (e.g., an engineered core promoter).

[0128] promoter A polynucleotide (e.g., an RNA polynucleotide or a DNA polynucleotide) may include a promoter to regulate or promote transcription of a payload (such as a transgene or a therapeutic polynucleotide). The promoter may be an engineered promoter. In some embodiments, the promoter may include a response element (e.g., an enhancer region), a core promoter that serves as a site for preinitiation complex formation, or a combination thereof. The core promoter may be an engineered core promoter. In some embodiments, the sequence of the response element may include a protein binding sequence that binds one or more cognate ligands, coactivators, or corepressors in a sequence-dependent manner. For example, the response element may bind a transcription factor (TF) that promotes transcription of a nearby polynucleotide that encodes the sequence of the payload (such as a transgene or a therapeutic polynucleotide). In some embodiments, the core promoter may include a core promoter that is engineered to promote high levels of transcription in the presence of an active response element (e.g., an active enhancer) when activated, and low or no transcription in the presence of an inactive response element (e.g., an inactive enhancer). In some embodiments, a core promoter can include a core promoter engineered to promote high levels of transcription in the presence of an activated response element (e.g., an activated enhancer) and low or no transcription in the presence of a non-activated response element (e.g., a non-activated enhancer). In some embodiments, a core promoter can include a synthetic promoter engineered to promote high levels of transcription in the presence of an activated response element (e.g., an activated enhancer) and low or no transcription in the presence of an inactive response element (e.g., an inactive enhancer).

[0129] Elements within the promoter (e.g., response elements or core promoters) can be selected or engineered to alter the rate of transcription of a downstream polynucleotide encoding a payload. In some embodiments, a promoter can be selected for ubiquitous transcription. For example, a promoter can be selected to promote high levels of transcription in any cell type, tissue type, or cell state. In some embodiments, a promoter can be selected for cell type specific transcription. In some embodiments, a promoter can be selected for tissue type specific transcription. In some embodiments, a promoter can be selected for cell state specific transcription. For example, a promoter can be selected to promote high levels of transcription in a target cell type or tissue type (e.g., excitatory neurons or kidney tissue) or target cell state (e.g., diseased cell state), and low levels or no transcription in non-target cell types or cell states (e.g., non-neuronal cells, non-kidney tissue, or non-disease cells). In some embodiments, the target tissue can be nerve tissue, kidney tissue, eye tissue, muscle tissue, blood, skin, fat, bone, cancer tissue, thymus tissue, gastrointestinal tissue (e.g. stomach, intestine), spleen tissue, placenta tissue, pancreas tissue, lung tissue, liver tissue, heart tissue, or brain tissue (e.g. cerebrum, cerebellum, adrenal gland). In some embodiments, the target cell type can be a neuron, kidney cell, hepatocyte, podocyte, retina cell, epithelial cell, muscle cell, red blood cell, platelet, bone marrow cell, endothelial cell, epidermal cell, lymphocyte, glial cell, stromal cell, adipocyte, or fibroblast. In some embodiments, the target cell state can be a diseased cell, an actively dividing cell, a quiescent cell, or a mutated cell. In some embodiments, the target cell can be a specific state of a cell. For example, for CAR T cells, the target state of a cell can be activated, and the non-target state can be inactive (e.g. naive).

[0130] In some embodiments, a promoter may enhance cell type specific transcription if it enhances transcription of a polynucleotide encoding a payload (i.e., payload sequence) in a target cell type at a level that is at least about 0.1 fold, at least about 0.25 fold, at least about 0.5 fold, at least about 0.75 fold, at least about 1 fold, at least about 1.1 fold, at least about 1.2 fold, at least about 1.3 fold, at least about 1.4 fold, at least about 1.5 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 10 fold, at least about 20 fold, at least about 30 fold, at least about 40 fold, at least about 50 fold, at least about 100 fold, at least about 150 fold, or at least about 200 fold the level of transcription of the payload sequence in a non-target cell type. In some embodiments, a promoter may enhance cell state specific transcription if it enhances transcription of a payload sequence in a target cell state at a level that is at least about 0.1 fold, at least about 0.25 fold, at least about 0.5 fold, at least about 0.75 fold, at least about 1 fold, at least about 1.1 fold, at least about 1.2 fold, at least about 1.3 fold, at least about 1.4 fold, at least about 1.5 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 10 fold, at least about 20 fold, at least about 30 fold, at least about 40 fold, at least about 50 fold, at least about 100 fold, at least about 150 fold, or at least about 200 fold the level of transcription of the payload sequence in a non-target cell state.

[0131] In some embodiments, a promoter may enhance a desired level of transcription if it enhances transcription of a polynucleotide encoding a payload (i.e., a payload sequence) in a target cell type at a level that is at least about -0.75-fold, at least about -0.5-fold, at least about -0.25-fold, at least about -0.1-fold, at least about 0-fold, at least about 0.1-fold, at least about 0.25-fold, at least about 0.5-fold, at least about 0.75-fold, at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the level of transcription of an endogenous version of the payload sequence in the target cell type. In some embodiments, a promoter may enhance a desired level of transcription if it enhances transcription of a payload sequence in a target cell state at a level that is at least about -0.75-fold, at least about -0.5-fold, at least about -0.25-fold, at least about -0.1-fold, at least about 0-fold, at least about 0.1-fold, at least about 0.25-fold, at least about 0.5-fold, at least about 0.75-fold, at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the level of transcription of an endogenous version of the payload sequence in the target cell state.

[0132] Response elements A promoter for a polynucleotide may contain a response element, such as an enhancer region. A response element may bind a sequence-specific protein, such as a cognate ligand (e.g., a transcription factor), coactivator, and / or corepressor, to regulate transcription. For example, a response element may recruit a cognate ligand (e.g., a transcription factor), coactivator, and / or corepressor that promotes, represses, or alters transcription of a downstream polynucleotide (such as a transgene or therapeutic polynucleotide) that encodes a payload sequence. In some embodiments, a response element may function to promote the rate of transcription upon binding of a cognate ligand or coactivator and / or upon reduced binding of a corepressor. For example, a response element may contain a transcription factor binding site that binds a transcription factor to promote transcription of a nearby polynucleotide that includes a coding sequence. In some embodiments, a response element can be an activated response element or an inactivated response element, where an activated response element is a response element bound to a transcription factor that can promote transcription and promote transcription initiation by a core promoter compared to a response element without transcription factor binding, and an inactivated response element is a response element that is not bound to a transcription factor and therefore does not promote transcription or does not promote transcription initiation by a core promoter. In some embodiments, a response element can function to alter the rate of transcription upon binding of a cognate ligand, coactivator, and / or corepressor. An enhancer region can be a response element that functions to promote the rate of transcription upon binding of a cognate ligand or coactivator or reduced binding of a corepressor, where this binding of a cognate ligand or coactivator or reduced binding of a corepressor and the subsequent promotion of the rate of transcription is cell type-dependent, cell state-dependent, or tissue type-dependent. For example, an enhancer region can contain transcription factor binding sites that bind one or more transcription factors that promote transcription of a nearby polynucleotide that contains a coding sequence, and the presence of the one or more transcription factors can be cell type-dependent, cell state-dependent, or tissue type-dependent.In some embodiments, the transcriptional promotion by the enhancer region is regulated by one or more transcription factors, such as cell type-specific, cell state-specific, or tissue type-specific transcription factors, and thus may be cell type-dependent, cell state-dependent, or tissue type-dependent. For example, the enhancer region may be inactive when unbound and activated upon binding of one or more transcription factors, the binding being dependent on the presence of one or more transcription factors, and the presence of one or more transcription factors being cell type-dependent, cell state-dependent, or tissue type-dependent. Alternatively or in addition, the enhancer region may be inactive when bound to one or more corepressors and activated upon reduced or absent binding of one or more corepressors, the binding being cell type-dependent, cell state-dependent, or tissue type-dependent. An activated enhancer may promote the recruitment of polymerase to a core promoter, compared to an inactivated enhancer. An activated enhancer may promote the recruitment of polymerase to a core promoter, compared to an inactive enhancer.

[0133] A response element (e.g., an enhancer region) can be paired with a core promoter (such as an engineered core promoter described herein) that enhances the transcription of a polynucleotide encoding a payload. The sequence of the response element can be located in the polynucleotide sequence to affect the recruitment of a polymerase to the core promoter. For example, the response element (e.g., an enhancer region) can be located 5' of the core promoter, or the response element can be located 3' of the polynucleotide encoding a payload.

[0134] The response element (e.g., enhancer region) may comprise a sequence that binds to a cognate ligand or coactivator that is expressed at a higher level in a target cell type (e.g., a neuron, a kidney cell, a hepatocyte, a podocyte, a retinal cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a stromal cell, an adipocyte, or a fibroblast) or cell state (e.g., a diseased or normal cell) than in a non-target cell type or cell state. Alternatively or in addition, the response element (e.g., enhancer region) may comprise a sequence that binds to a corepressor that is expressed at a lower level in a target cell type or cell state than in a non-target cell type or cell state. For example, an enhancer region of a promoter for expressing a payload in kidney cells may comprise a transcription factor binding sequence that binds to a kidney-specific transcription factor. The kidney-specific enhancer region may promote transcription initiation when bound to a kidney-specific transcription factor in kidney cells, increasing transcription of the payload in kidney cells compared to non-kidney cells. In another example, the enhancer region of the promoter for expressing the payload in a central nervous system (CNS) cell can include a transcription factor binding sequence that binds to a CNS-specific transcription factor. The CNS-specific enhancer region can promote transcription initiation when bound to a CNS-specific transcription factor in a CNS cell, increasing the transcription of the payload in the CNS cell compared to a non-CNS cell. As a further example, the enhancer region for expressing the payload in a liver cell can include a transcription factor binding sequence that binds to a liver-specific transcription factor. The liver cell-specific enhancer region can promote transcription initiation when bound to a liver-specific transcription factor in a liver cell, increasing the transcription of the payload in the liver cell compared to a non-liver cell. Examples of response elements are provided in Table 1. [Table 1]

[0135] The response element may comprise a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:193, or SEQ ID NO:194. The response element may comprise a sequence having at least 90% sequence identity to SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:193, or SEQ ID NO:194. The response element may comprise a sequence of SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:193, or SEQ ID NO:194. In some embodiments, the response element may be an engineered response element. For example, the engineered response element may comprise a sequence of SEQ ID NO:145 or SEQ ID NO:146. In some embodiments, the response element may be an enhancer region. In some embodiments, the response element may be a liver-specific enhancer region, and the enhancer region is activated in liver cells. For example, the liver-specific enhancer region may comprise a sequence of SEQ ID NO:146 or SEQ ID NO:197. In some embodiments, the liver-specific enhancer / promoter may comprise a sequence of SEQ ID NO: 163 to SEQ ID NO: 177. In some embodiments, the response element may be a bone marrow-specific enhancer, and the enhancer region is activated in bone marrow cells. For example, the bone marrow-specific enhancer region may comprise a sequence of SEQ ID NO: 145 or SEQ ID NO: 193. In some embodiments, the bone marrow-specific enhancer region / promoter may comprise a sequence of SEQ ID NO: 148 to SEQ ID NO: 162.

[0136] Response elements (e.g., response elements of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194) can be added to a core promoter or promoter for expression of a polynucleotide comprising a payload sequence (e.g., a sequence encoding a transgene or a therapeutic polynucleotide) to enhance cell type-specific, tissue type-specific, or cell state-specific transcription of the polynucleotide encoding the payload (i.e., the payload sequence). In some embodiments, response elements can be combined or used in combination with other response elements to modulate the transcription level of the payload sequence. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more response elements can be combined to modulate the transcription level of the payload sequence. The 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more response elements combined can all be the same response element, different response elements, or any combination thereof. For example, a promoter can include a combination of sequences for transcriptional promotion and sequences for transcriptional repression (e.g., via increased binding to a corepressor) to modulate payload expression in a cell type or cell state of interest. A response element (e.g., a response element of SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:193, or SEQ ID NO:194) may be paired with a core promoter (e.g., a core promoter of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) to form an engineered promoter. The engineered promoter may facilitate cell-specific payload expression under the transcriptional control of the engineered promoter.

[0137] Core Promoter The promoter of the polynucleotide may comprise a core promoter that facilitates recruitment of transcription machinery and initiation of transcription. The core promoter may be an engineered core promoter. In some embodiments, the core promoter may be engineered for switchable activity when paired with a cell-specific response element (e.g., a cell-specific enhancer). A switchable core promoter may exhibit low or no activity (low or no transcriptional activation) when paired with a cell-specific response element (e.g. a cell-specific enhancer) in a cell that is not of a specific cell type (e.g. a cell type that is not the specific cell type of the cell-specific response element), and exhibit high activity (high transcriptional activation) when paired with the same cell-specific response element (e.g. the same cell-specific enhancer) in a cell that is of a specific cell type (e.g. a cell type that is the specific cell type of the same cell-specific response element), and then the same switchable core promoter may exhibit low or no activity (low or no transcriptional activation) when paired with a different cell-specific response element (e.g. a different cell-specific enhancer) in a cell that is not of a specific cell type (e.g. a cell type that is not the specific cell type of a different cell-specific response element), and exhibit high activity (high transcriptional activation) when paired with the same different cell-specific response element (e.g. the same different cell-specific enhancer) in a cell that is of a specific cell type (e.g. a cell type that is the specific cell type of the same different cell-specific response element). For example, a switchable core promoter (e.g., any of SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144) paired with a neuron-specific enhancer may exhibit high transcriptional activity in neurons and low transcriptional activity in non-neuronal cells (e.g., kidney cells, liver cells, bone marrow cells, etc.). In another example, the switchable core promoter (e.g., any of SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144) paired with a hepatocyte-specific enhancer may exhibit high transcriptional activity in hepatocytes and low transcriptional activity in non-hepatocytes (e.g., kidney cells, neurons, bone marrow cells, etc.).In some embodiments, a core promoter can be engineered for switchable activity when paired with a tissue-specific response element (eg, a tissue-specific enhancer). A switchable core promoter may exhibit low or no activity (low or no transcriptional activation) when paired with a tissue-specific response element (e.g., a tissue-specific enhancer) in cells that are not of a specific tissue type (e.g., cells that are not of the specific tissue type for the tissue-specific response element), and exhibit high activity (high transcriptional activation) when paired with the same tissue-specific response element (e.g., the same tissue-specific enhancer) in cells that are of a specific tissue type (e.g., cells that are of the specific tissue type for the same tissue-specific response element), and then the same switchable core promoter may exhibit low or no activity (low or no transcriptional activation) when paired with a different tissue-specific response element (e.g., a different tissue-specific enhancer) in cells that are not of a specific tissue type (e.g., cells that are of the specific tissue type for the different tissue-specific response element), and exhibit high activity (high transcriptional activation) when paired with the same different tissue-specific response element (e.g., the same different tissue-specific enhancer) in cells that are of a specific tissue type (e.g., cells that are of the specific tissue type for the same different tissue-specific response element). For example, a switchable core promoter (e.g., any of SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144) paired with a CNS-specific enhancer may exhibit high transcriptional activity in cells of the CNS and low transcriptional activity in non-CNS cells (e.g., cells of the kidney, liver, bone marrow, etc.). In another example, the switchable core promoter (e.g., any of SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144) paired with a liver-specific enhancer may exhibit high transcriptional activity in liver cells and low transcriptional activity in non-liver cells (e.g., cells of the kidney, CNS, bone marrow, etc.).A switchable core promoter exhibits low or no activity (low or no transcriptional activation) when paired with a cell state-specific response element (e.g., a cell state specific enhancer) in a cell in a specific cell state that is not a specific cell state (e.g., a cell that is not a specific cell state of the cell state specific response element), and exhibits high activity (high transcriptional activation) when paired with the same cell state specific response element (e.g., the same cell state specific enhancer) in a cell that is a specific cell state (e.g., a cell that is a specific cell state of the same cell state specific response element), and then exhibits high activity (high transcriptional activation) when paired with the same cell state specific response element (e.g., the same cell state specific enhancer) in a cell that is a specific cell state (e.g., a cell that is a specific cell state of the same cell state specific response element). A promoter may exhibit low or no activity (low or no transcriptional activation) when paired with a different cell state specific response element (e.g., a different cell state specific enhancer) in a cell in a specific cell state that is not a different specific cell state (e.g., a cell that is not a specific cell state of the different cell state specific response element), and may exhibit high activity (high transcriptional activation) when paired with the same different cell state specific response element (e.g., the same different cell state specific enhancer) in a cell that is a specific different cell state (e.g., a cell that is a specific cell state of the same different cell state specific response element). For example, a switchable core promoter (e.g., any of SEQ ID NO: 1-SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 10-SEQ ID NO: 144) paired with a disease-specific enhancer may exhibit high transcriptional activity in cells that exhibit the disease and low transcriptional activity in cells that do not exhibit the disease. In another example, a switchable core promoter (e.g., any of SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144) paired with a Rett-specific enhancer may exhibit high transcriptional activity in neurons expressing mutant MeCP2 associated with Rett syndrome and low transcriptional activity in neurons expressing functional MeCP2 associated with a normal neuronal phenotype. The switchable core promoter may exhibit high activity when paired with a cell type-dependent, cell state-dependent, or tissue type-dependent enhancer and in that specific cell type, cell state, or tissue type.A switchable core promoter, when paired with a cell type-, cell state-, or tissue type-specific enhancer in that cell type, cell state, or tissue type, may exhibit a wider dynamic range of activity than without that cell type, cell state, or tissue type, respectively.

[0138] In some embodiments, the core promoter may be located downstream (i.e., 3') of a response element. In some embodiments, the core promoter may be located upstream (i.e., 5') of a polynucleotide encoding a payload sequence (e.g., a transgene or sequence encoding a therapeutic polynucleotide). The core promoter may recruit a polymerase or a protein that binds to a polymerase to initiate transcription of a sequence downstream of the core promoter. In some embodiments, the core promoter may recruit an RNA polymerase (e.g., RNA polymerase II) or a tata binding protein (TBP) that recruits an RNA polymerase when combined with a response element bound to a cognate ligand, coactivator, or corepressor. For example, the core promoter may bind to a general transcription factor (GTF) that recruits RNA polymerase II (pol II) to initiate transcription. The ability of the core promoter to recruit the transcription machinery (e.g., RNA polymerase) or the affinity of the core promoter for the transcription machinery may affect transcription levels. In some embodiments, a core promoter can be modified to modulate transcription levels by recruiting transcription machinery and / or altering affinity for said transcription machinery. In some embodiments, an engineered core promoter is a mutated or altered core promoter that has a reduced ability to recruit transcription machinery (e.g., RNA polymerase) and / or a reduced affinity for transcription machinery compared to a corresponding unmutated or unaltered core promoter. In some embodiments, an engineered core promoter is a de novo synthesized core promoter that has a reduced ability to recruit transcription machinery (e.g., RNA polymerase) and / or a reduced affinity for transcription machinery compared to other core promoters (such as the core promoter of SEQ ID NO:5 or SEQ ID NO:9).In some embodiments, the ability of this engineered core promoter to initiate transcriptional activity is dependent on pairing with a response element such that initiation of transcriptional activity occurs when the response element binds to its cognate ligand and / or coactivator, and is not initiated or initiated at a low basal level when the response element is not bound to its cognate ligand and / or coactivator or, optionally, bound to a corepressor.

[0139] In some embodiments, the core promoter is a minimal synthetic core promoter, such as the minP core promoter (SEQ ID NO:5) or a variant of the minP core promoter (e.g., SEQ ID NO:4 or SEQ ID NO:15). The core promoter may be selected or engineered for one or more desired transcriptional properties, such as transcription level, cell type specificity, cell state specificity, tissue specificity, or cell genotype specificity. In some embodiments, the core promoter may be engineered to selectively enhance transcription initiation when paired with a cell type-specific, cell state-specific, or tissue type-specific response element (e.g., a cell type-specific, cell state-specific, or tissue type-specific enhancer). Engineering the core promoter may include screening variants of the core promoter for transcription level, cell type specificity, cell state specificity, tissue specificity, or cell genotype specificity.

[0140] The core promoter described herein may comprise engineered sequences that serve as promoter switches that can be selectively activated in target cell types, target tissue types, or target cell states.Switchable core promoters can immediately enhance transcription initiation when paired with cell type-specific, tissue type-specific, or cell state-specific response elements in target cell types, target tissue types, or target cell states, respectively, while exhibiting low background transcription initiation in non-target cell types, non-target tissue types, or non-target cell states, respectively.Switchable core promoters can be used in combination with various response elements or other response elements to enhance cell type-specific, tissue type-specific, or cell state-specific transcription in various cell types, tissue types, or cell states.

[0141] A switchable core promoter, when paired with a response element specific for a target cell type, tissue type, or cell state, may enhance transcription initiation in a target cell type, tissue type, or cell state at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the rate of transcription initiation in a non-target cell type, tissue type, or cell state. In some embodiments, a switchable core promoter, when paired with a response element specific for the target cell type, tissue type, or cell state, may enhance transcription initiation in a target cell type, tissue type, or cell state at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the rate of transcription initiation in a target cell type, tissue type, or cell state when paired with a response element that is not specific for the target cell type, tissue type, or cell state.

[0142] In some embodiments, a switchable core promoter may enhance transcription initiation when paired with an active response element by at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold, relative to the rate of transcription initiation of the switchable core promoter when paired with an inactive response element. In some embodiments, a switchable core promoter, when paired with a response element specific for the target cell type, tissue type, or state, may enhance transcription initiation in a target cell type, tissue type, or state by at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold, relative to the rate of transcription initiation of the switchable core promoter in the target cell type, tissue type, or state when paired with an inactive response element.A switchable core promoter, when paired with a response element bound to a cognate ligand or coactivator (e.g., an enhancer bound to a cognate ligand or coactivator) (an activated response element), may enhance transcription initiation at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the rate of transcription initiation when paired with that response element not bound to a cognate ligand or coactivator (e.g., an enhancer not bound to a cognate ligand or coactivator) (a non-activated response element). An activated response element can be an enhancer that is specific for the target cell type, tissue type, or cell state, respectively. In some embodiments, a non-activated response element can be an enhancer that is not specific for the cell type, tissue type, or cell state in which it is present.

[0143] A switchable core promoter, when paired with a response element bound to a cognate ligand or coactivator (e.g., an enhancer bound to a cognate ligand or coactivator) and / or a response element having reduced binding to a co-repressor, may enhance the rate of transcription initiation by at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold, relative to the rate of transcription initiation when paired with that response element not bound to its cognate ligand or coactivator (e.g., an enhancer not bound to a cognate ligand or coactivator) and / or that response element having increased binding to a co-repressor.

[0144] A switchable core promoter is a response element that is capable of being bound by a cognate ligand or coactivator (e.g., an enhancer bound to a cognate ligand or coactivator) (an active response element) that, when paired with a response element that is bound to a cognate ligand or coactivator (e.g., an enhancer bound to a cognate ligand or coactivator) (an activated response element), is a response element that is not capable of being bound by a cognate ligand or coactivator (e.g., an enhancer that is not capable of being bound to a cognate ligand or coactivator) (an inactive response element) and thus is not capable of binding to a cognate ligand or coactivator. An active response element may enhance transcription initiation at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the rate of transcription initiation when paired with a response element of interest that cannot be bound by a cognate ligand or coactivator (e.g., an enhancer that is not bound by a cognate ligand or coactivator) (a non-activated response element). An active response element may be specific for a target cell type, tissue type, or cell state, and may be an activated response element when that target cell type, tissue type, or cell state, respectively. A response element that is not activated can be specific for a target cell type, tissue type, or cell state, but not that specific target cell type, tissue type, or cell state, respectively. An inactive response element can be a response element that is not capable of activation regardless of the cell type, tissue type, or cell state in which it is present, and thus can be a response element that is not always activated in a cell.

[0145] A switchable core promoter, when paired with an enhancer specific for a target cell type, tissue type, or cell state, may enhance transcription initiation in a target cell type, tissue type, or cell state that is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold faster than the rate of transcription initiation in a non-target cell type, tissue type, or cell state. In some embodiments, a switchable core promoter, when paired with an enhancer specific for the target cell type, tissue type, or cell state, may enhance transcription initiation in a target cell type, tissue type, or cell state at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the rate of transcription initiation in the target cell type, tissue type, or cell state when paired with an enhancer that is not specific for the target cell type, tissue type, or cell state.

[0146] In some embodiments, a switchable core promoter may enhance transcription initiation at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold, when paired with an active enhancer, compared to the rate of transcription initiation of the switchable core promoter when paired with an inactive enhancer. In some embodiments, a switchable core promoter, when paired with an enhancer specific for the target cell type, tissue type, or target cell state, may enhance transcription initiation in a target cell type, tissue type, or target cell state by at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold, relative to the rate of transcription initiation of the switchable core promoter in the target cell type, tissue type, or target cell state when paired with an inactive enhancer.

[0147] A switchable core promoter, when paired with an enhancer bound to a cognate ligand or coactivator (an activated enhancer), may enhance transcription initiation at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold faster than the rate of transcription initiation when paired with that enhancer not bound to a cognate ligand or coactivator (an unactivated enhancer). An activated enhancer may be specific for the target cell type, tissue type, or cell state, respectively, of that target cell type, tissue type, or cell state. In some embodiments, an enhancer that is not activated may not be specific for the cell type, tissue type, or cellular state in which it is present.

[0148] A switchable core promoter, when paired with an enhancer bound to a cognate ligand or coactivator and / or an enhancer having reduced binding to a corepressor, may enhance transcription initiation at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the rate of transcription initiation when paired with that enhancer not bound to its cognate ligand or coactivator and / or an enhancer having increased binding to a corepressor.

[0149] A switchable core promoter is an enhancer that is capable of being bound to a cognate ligand or coactivator (an active enhancer) and that, when paired with said enhancer that is bound to a cognate ligand or coactivator (an activated enhancer), can enhance transcription initiation at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the rate of transcription initiation when paired with said enhancer that is not capable of being bound to a cognate ligand or coactivator (an inactive enhancer) and thus not bound to a cognate ligand or coactivator (an inactivated enhancer). An active enhancer may be specific for a target cell type, tissue type, or cell state, and may be an activated enhancer when that target cell type, tissue type, or cell state, respectively.An inactivated enhancer may be specific for a target cell type, tissue type, or cell state, but may not be that specific target cell type, tissue type, or cell state, respectively.An inactive enhancer may not be capable of activation regardless of the cell type, tissue type, or cell state in which it is present, and may therefore be an enhancer that is not always activated in a cell.

[0150] The engineered core promoter of the present disclosure provides a high dynamic range (also referred to as fold activation) compared to the endogenous core promoter. In some embodiments, the dynamic range may describe the transcriptional activity of a core promoter when paired with an activated response element compared to the transcriptional activity of the core promoter when paired with a non-activated response element. A core promoter with a high dynamic range may enhance transcription initiation in a cell at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold faster than the rate of transcription initiation in a cell with an endogenous core promoter paired with the same response element. In some embodiments, a core promoter with a high dynamic range may enhance transcription initiation when paired with an activated response element at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the rate of transcription initiation when paired with an inactive response element.

[0151] The engineered core promoters of the present disclosure provide a high dynamic range (also referred to as fold activation) for improved cell-type, tissue-type, or cell state specificity compared to endogenous core promoters. In some embodiments, the dynamic range may describe the transcriptional activity of a core promoter when paired with an activated response element (e.g., an enhancer bound to its cognate ligand or coactivator) compared to the transcriptional activity of the core promoter when paired with an inactive response element. A core promoter with a high dynamic range may enhance transcription initiation in a target cell type, target tissue type, or target cell state at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the rate of transcription initiation in a non-target cell type, non-target tissue type, or non-target cell state. In some embodiments, a core promoter with a high dynamic range may enhance transcription initiation when paired with an activated response element at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the rate of transcription initiation when paired with an inactive response element.In some embodiments, a core promoter with a high dynamic range may enhance transcription initiation when paired with an activated enhancer at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold faster than the rate of transcription initiation when paired with a non-activated enhancer.

[0152] The core promoter may include one or more sequence elements. In some embodiments, the core promoter may include, from 5' to 3', a polynucleotide encoding a TATA box sequence, a spacer sequence, and an initiator element sequence. In some embodiments, the core promoter may include, from 5' to 3', a TATA box, a spacer, and an initiator element. In some embodiments, the core promoter may further include a transcription pause site, a YY1 transcription factor binding motif, or a combination thereof. In some embodiments, the core promoter may include a transcription factor binding motif. For example, the spacer sequence may include a transcription factor binding sequence. In some embodiments, the sequence elements in the core promoter may be configured as shown in Figure 19A, Figure 19B, or Figure 19C. Examples of sequence elements that may be included in the core promoter of the present disclosure are provided in Table 2. [Table 2]

[0153] A core promoter can include one or more sequence elements, such as a TATA box (e.g., TATAAA), an initiator element, an RNA polymerase binding sequence, a B recognition element (BRE, e.g., G / C, G / C, G / A, CGCC), a CCAAT box or CAT box (e.g., GGCCAATCT), or a Pribnow sequence (e.g., TATAAT). In some embodiments, a core promoter can include a TATA box (e.g., an engineered TATA box of SEQ ID NOs:199-201 or SEQ ID NOs:213-215), e.g., as shown in SEQ ID NO:4 and SEQ ID NO:15. In some embodiments, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:199-SEQ ID NO:201 or SEQ ID NO:213-SEQ ID NO:215.

[0154] In some embodiments, a core promoter can include an initiator element (e.g., an engineered initiator element of SEQ ID NO:202-204, SEQ ID NO:216, or SEQ ID NO:217). In some embodiments, a core promoter can include an initiator element having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:202-204, SEQ ID NO:216, or SEQ ID NO:217.

[0155] In some embodiments, the core promoter may include a long spacer (e.g., an engineered long spacer between the TATA box and the initiator element), for example as shown in SEQ ID NO:3 and SEQ ID NO:69-SEQ ID NO:108. The long spacer may have a length of 31 nucleotide residues or more from the TATA box to the initiator element, where the number of nucleotide residues from the TATA box to the initiator element is counted inclusively from the first T in the TATA box to the A in the CAG in the initiator element (or the corresponding CAG in the parent sequence if the initiator element is mutated). In some embodiments, the long spacer may have a length of 31-48 nucleotide residues from the TATA box to the initiator element. In some embodiments, the long spacer may have a length of 31-44 nucleotide residues from the TATA box to the initiator element. In some embodiments, the long spacer may have a length of 31-42 nucleotide residues from the TATA box to the initiator element. In some embodiments, the long spacer may have a length of 31-37 nucleotide residues or 31-35 nucleotide residues from the TATA box to the initiator element. For example, the long spacer may have a length of 32 nucleotide residues from the TATA box to the initiator element. In some embodiments, the core promoter may include an engineered short spacer (e.g., an engineered short spacer) between the TATA box and the initiator element, where the number of nucleotide residues from the TATA box to the initiator element is counted inclusively from the first T in the TATA box to the A in the CAG in the initiator element (or the corresponding CAG in the parent sequence if the initiator element is mutated), e.g., as shown in SEQ ID NO:7, SEQ ID NO:10, and SEQ ID NO:109 to SEQ ID NO:125. The short spacer may have a length of 28 nucleotide residues or less from the TATA box to the initiator element.In some embodiments, the short spacer may have a length of 22-29 nucleotide residues or 24-29 nucleotide residues from the TATA box to the initiator element. For example, the short spacer may have a length of 28 nucleotide residues from the TATA box to the initiator element. In some embodiments, the core promoter may include an engineered spacer between the TATA box and the initiator element, for example, as shown in SEQ ID NO: 13 and SEQ ID NO: 126-SEQ ID NO: 144. The short spacer may have a length of about 30 nucleotide residues from the TATA box to the initiator element. The spacing between the TATA and Inr elements of selected core promoters is illustrated in Figures 19A, 19B, and 19C. In some embodiments, the spacer sequence of the core promoter may include a response element such as a transcription factor binding site (e.g., an HNF4α binding site, a GATA1 binding site, a YY1 binding site, or a CEBPA binding site as provided in Figure 13D). For example, the core promoter may contain a spacer sequence that binds HNF4α, as shown in SEQ ID NO: 22 to SEQ ID NO: 30. Alternatively or in addition, a transcription factor binding site may be included after the Inr element. In some embodiments, the core promoter may be engineered into a background sequence, such as the sequence of SEQ ID NO: 208 or SEQ ID NO: 209.

[0156] In some embodiments, the core promoter can include a transcriptional pausing site (e.g., SEQ ID NO:196-198, SEQ ID NO:211, or SEQ ID NO:212), e.g., as set forth in SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:14, and SEQ ID NO:16-21. In some embodiments, the core promoter can include a transcriptional pausing site having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:196-198, SEQ ID NO:211, or SEQ ID NO:212.

[0157] In some embodiments, the core promoter may include a YY1 motif (e.g., SEQ ID NO:205-207), e.g., as shown in SEQ ID NO:2, SEQ ID NO:12, and SEQ ID NO:68 of SEQ ID NO:31. In some embodiments, the core promoter may include a YY1 motif having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:205-207. In some embodiments, the core promoter may include a YY1 motif (e.g., SEQ ID NO:205-207), e.g., as shown in SEQ ID NO:2, SEQ ID NO:12, and SEQ ID NO:68 of SEQ ID NO:31. In some embodiments, the core promoter may have at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:205-207 and may include a YY1 motif capable of binding to YY1. In some embodiments, the engineered core promoter sequence may include one or more mutations compared to the founder core promoter sequence. In some embodiments, the engineered core promoter sequence may include one or more point mutations (e.g., T15A, T15G, A40T, or A40C) compared to SEQ ID NO:5 (TAGAGGGTATATAATGGAAGCTCGACTTCCAGCTTGGCAATCCGG), for example, as shown in SEQ ID NO:4 and SEQ ID NO:15. In some embodiments, the engineered core promoter sequence may contain one or more point mutations compared to SEQ ID NO:9 (TCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAG).In some embodiments, the engineered core promoter sequence may contain one or more point mutations compared to SEQ ID NO: 210 (AGGACCGGATCAACTAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAATTGGTACCGAGCTCG).

[0158] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:213, a spacer, an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:202, and a pause site having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:198, and optionally the spacer may be 29-33 nucleotides.

[0159] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:213, a spacer of 31 nucleotides, an initiator element having the sequence of SEQ ID NO:202, and a pause site of SEQ ID NO:198.

[0160] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:200, a spacer, an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:203, and a YY1 motif having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:205, and optionally the spacer may be 29-33 nucleotides.

[0161] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:200, a spacer of 31 nucleotides, an initiator element having the sequence of SEQ ID NO:203, and the YY1 motif of SEQ ID NO:205.

[0162] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:201, a spacer, and an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:202, and optionally the spacer may be 31-35 nucleotides.

[0163] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:201, a spacer of 33 nucleotides, and an initiator element having the sequence of SEQ ID NO:202.

[0164] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:214, a spacer, and an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:216, and optionally the spacer may be 30-34 nucleotides.

[0165] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:214, a spacer of 32 nucleotides, and an initiator element having the sequence of SEQ ID NO:216.

[0166] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:213, a spacer, and an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:204, and optionally the spacer may be 27-31 nucleotides.

[0167] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:213, a spacer of 29 nucleotides, and an initiator element having the sequence of SEQ ID NO:204.

[0168] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:201, a spacer, and an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:202, and optionally the spacer may be 27-31 nucleotides.

[0169] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:201, a spacer of 29 nucleotides, and an initiator element having the sequence of SEQ ID NO:202.

[0170] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:213, a spacer, an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:203, and a pause site having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:211, and optionally the spacer may be 29-33 nucleotides.

[0171] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:213, a spacer of 31 nucleotides, an initiator element having the sequence of SEQ ID NO:203, and a pause site having the sequence of SEQ ID NO:211.

[0172] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:200, a spacer, an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:203, and a YY1 motif having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:206, and optionally the spacer may be 29-33 nucleotides.

[0173] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:200, a spacer of 31 nucleotides, an initiator element having the sequence of SEQ ID NO:203, and a YY1 motif having the sequence of SEQ ID NO:206.

[0174] In one embodiment, the core promoter may include a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:201, a spacer, and an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:204, and optionally the spacer may be 27-31 nucleotides.

[0175] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:201, a spacer of 29 nucleotides, and an initiator element having the sequence of SEQ ID NO:204.

[0176] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:200, a spacer, an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:203, and a pause site having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:212, and optionally the spacer may be 29-33 nucleotides.

[0177] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:200, a spacer of 31 nucleotides, an initiator element having the sequence of SEQ ID NO:203, and a pause site having the sequence of SEQ ID NO:212.

[0178] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:215, a spacer, and an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:217, and optionally the spacer may be 30-34 nucleotides.

[0179] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:215, a spacer of 32 nucleotides, and an initiator element having the sequence of SEQ ID NO:217.

[0180] In one embodiment, the core promoter may comprise a TATA box sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:200, a spacer, and an initiator element having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or about 100% sequence identity to SEQ ID NO:202, and optionally the spacer may be 27-31 nucleotides.

[0181] In one embodiment, the core promoter may comprise a TATA box sequence having the sequence of SEQ ID NO:200, a spacer of 29 nucleotides, and an initiator element having the sequence of SEQ ID NO:202.

[0182] In some embodiments, the switchable core promoter sequence may comprise a sequence of SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144. In some embodiments, the switchable core promoter sequence may comprise a sequence having at least about 70%, at least about 72%, at least about 75%, at least about 78%, at least about 80%, at least about 82%, at least about 85%, at least about 87%, at least about 90%, at least about 92%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144. Examples of switchable core promoter sequences are provided in Table 3. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4]

Table 3-5

Table 3-6

[0183] In some embodiments, the core promoters of the present disclosure may function as switchable core promoters in multiple cell types or cell states. Cell type or cell state specificity may be conferred by a response element (e.g., an enhancer sequence that binds to a cell type-specific transcription factor) paired with the switchable core promoter. For example, the switchable core promoters of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144 may be paired with a CNS-specific enhancer to enhance CNS-specific transcription initiation, and with a kidney-specific enhancer to enhance kidney-specific transcription initiation. The core promoters described herein may have low background transcriptional activation (e.g., low levels of transcriptional activation in the absence of an enhancer, in the presence of an inactive enhancer, or in the presence of an inactivated enhancer), and high activity (e.g., high levels of transcriptional activation) when paired with a response element (e.g., when paired with an activated enhancer) in the presence of a cell type-specific, tissue type-specific, or cell state-specific cognate ligand or coactivator. For example, a core promoter may have low transcriptional activation in the presence of an inactive enhancer. A core promoter may have high transcriptional initiation when paired with a cell type-specific, tissue type-specific, or cell state-specific response element in a cell type, tissue type, or cell state of interest (e.g., in the presence or high levels of a transcription factor that binds to the transcription factor binding sequence of the enhancer region sequence). A core promoter may have low transcriptional activation when paired with a cell type-specific, tissue type-specific, or cell state-specific response element in a cell type, tissue type, or cell state of interest (e.g., in the absence or low levels of a transcription factor that binds to the transcription factor binding sequence of the enhancer region sequence). In some embodiments, a core promoter may be engineered to have low background transcriptional activation and high transcriptional activation when paired with a cell type-specific, tissue type-specific, or cell state-specific response element in a cell type, tissue type, or cell state of interest.The sequence of the core promoter can be altered or engineered to adjust transcription levels, tissue specificity, or cell type specificity, or cell state specificity. In some embodiments, the core promoter can include an engineered version of an endogenous core sequence. For example, the switchable core promoter of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144 can be paired with the response element of SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:193, or SEQ ID NO:194.

[0184] Enhancer / promoter A promoter (e.g., enhancer / promoter) may include a switchable core promoter (e.g., SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) paired with a response element (e.g., an enhancer containing a transcription factor binding site or a coactivator binding site). In some embodiments, the response element of the promoter may confer cell type, tissue type, or cell state specificity. For example, an enhancer of SEQ ID NO:146 or SEQ ID NO:194 may confer liver specificity. In some embodiments, an enhancer of SEQ ID NO:145 or SEQ ID NO:193 may confer bone marrow specificity. In some embodiments, the switchable core promoter of the promoter may rapidly enhance transcription initiation in the presence of an activated response element (e.g., an activated enhancer) and exhibit low background transcription initiation in the presence of an inactive response element (e.g., an inactive enhancer). In some embodiments, the switchable core promoter of the promoter may rapidly enhance transcription initiation in the presence of an activated response element (e.g., an activated enhancer) and exhibit low background transcription initiation in the presence of a non-activated response element (e.g., a non-activated enhancer). The switchable core promoters of SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144 may be paired with the response element of SEQ ID NO:145 or SEQ ID NO:146.

[0185] In some embodiments, the liver-specific enhancer / promoter may comprise the sequence of SEQ ID NO: 163 to SEQ ID NO: 166, SEQ ID NO: 169, or SEQ ID NO: 172 to SEQ ID NO: 177. In some embodiments, the bone marrow-specific enhancer / promoter may comprise the sequence of SEQ ID NO: 148 to SEQ ID NO: 151, SEQ ID NO: 154, or SEQ ID NO: 157 to SEQ ID NO: 162. Examples of enhancer / promoter sequences are provided in Table 4. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8]

[0186] payload The payload of the present disclosure may comprise a coding sequence under the transcriptional control of a promoter (e.g., a promoter comprising a response element and a core promoter). In some embodiments, the payload may encode a transgene or therapeutic polynucleotide for delivery to a cell (e.g., a cell of a human or non-human subject). In some embodiments, the payload may comprise a coding sequence that encodes a protein (e.g., a protein without a mutation associated with a disease or condition). In some embodiments, the payload may comprise a coding sequence that encodes a therapeutic polynucleotide (e.g., a gRNA that targets a gene associated with a disease or condition). Upon delivery of the payload to a cell, the coding sequence is transcribed in the cell, thereby expressing the encoded protein or therapeutic polynucleotide. In some embodiments, expression of the protein or therapeutic polynucleotide encoded by the coding sequence may treat, prevent, or alleviate symptoms of a disease or disorder. In some embodiments, the payload may comprise a transgene that encodes a wild-type copy of a protein that is mutated or dysregulated in a disease or condition.

[0187] In some embodiments, cell state specific transcription of the payload sequence (e.g., transgene) is desired. For example, a transgene lacking a mutation can be specifically transcribed in neurons that have a gene containing a mutation or have a phenotype associated with the mutation. In another example, a transgene lacking a mutation can be specifically transcribed in retinal tissues that have a gene containing a mutation or have a phenotype associated with the mutation. In another example, a transgene lacking a genetic variation can be specifically transcribed in cells that have a genetic variation or have a phenotype associated with the genetic variation. In some embodiments, cell specific transcription of the payload sequence (e.g., transgene) is desired. For example, the transgene can be specifically transcribed in neurons of the subject. In another example, the transgene can be specifically transcribed in liver cells of the subject. In some embodiments, tissue specific transcription of the payload sequence (e.g., transgene) is desired. For example, the transgene can be specifically transcribed in cells of the CNS. In another example, the transgene can be specifically transcribed in liver cells. Examples of genes that can be encoded in the payload sequence (e.g., transgene) are provided in Table 5. In some embodiments, the gene can be delivered as a transgene to the cells of a subject to treat a disease or condition in the subject. Alternatively or additionally, the payload can encode a therapeutic polynucleotide (e.g., gRNA or tRNA) that targets a gene associated with a disease or condition. For example, the payload can encode a gRNA for gene editing that targets a gene in a target cell type, tissue type, or cell state. Examples of genes that can be targeted by the therapeutic polynucleotide encoded by the payload are provided in Table 5. [Table 5-1] [Table 5-2] [Table 5-3]

Table 5-4

Table 5-5

Table 5-6

Table 5-7

[0188] Examples of genes that may be encoded by a payload sequence (e.g., a transgene) and delivered to a cell of a subject to treat, prevent, or alleviate the symptoms of a disease or condition include MECP2, GRN, PRPH2, RHO, UBE3A, DYRK1A, MEF2C, NSD1, ATRX, RPS6KA3, TCF4, ZEB2, FOXG1, CDKL5, a partial fragment of chromosome 2, SLC6A1, DMD, SERPINA1, ABCA4, CFTR, HEXA, RAB7A, ATP7B, HFE, LIPA, SCNN1, and the like. A, PKD1, PKD2, PKHD1, ACE, ALB, VHL, EPO, FH, ACE, TNF, SPP1, IL6, MYH9, TSC2, ADIPOQ, IL2, CCL2, TGFB1, UMOD, BCOR, FLCN, FLCN, TP53, CRP, PTEN, IFT88, CLDN14, AGT, MET, MYH9, YWHAE, HAMP, EPO, BAP1, APOE, CYBA, GSTT1, IFNG, IGF1, IL2, ABCB1, SDHB, TSC2, BRAF, CDKN1B, GLA, KR T7, PPARG, RET, TRPC6, NDRG1, GANAB, NOX4, ADIPOR1, GREB1L, ANKS6, NUTM2B, CAT, CYBA, CYBB, EGFR, HMOX1, LRP2, SERPINE1, PAX2, ABCB1, PPARA, PPARG, PTGS2, RELA, RET, TLR4, UMOD, BAP1, RETN, GREB1L, FRAS1, CRB2, APRT, AXL, CCND1, CBR1, CPT1A, CYP1A1, CYP2B6, EDN1, ERBB2 , HMGCR, MME, NFKB1, NGF, MAPK1, MAPK3, PTGS2, PTGS2, HLTF, SOD1, SOD2, SREBF2, HNF1B, TERT, TNFSF10, NDRG1, MBTPS2, WNT4, BCOR, INF2, ALG9, BICC1, TMEM67, IRX2, FREM1, ANKS6, FREM2, CD46, COL4A3, COL4A4, COL4A5, TTC21B, NPHP4, CD2AP, CFI, LAMB2, LMX1B, or MYH9.Alternatively or in addition, the payload sequence may be selected from the group consisting of MECP2, GRN, PRPH2, RHO, UBE3A, DYRK1A, MEF2C, NSD1, ATRX, RPS6KA3, TCF4, ZEB2, FOXG1, CDKL5, partial fragment of chromosome 2, SLC6A1, DMD, SERPINA1, ABCA4, CFTR, HEXA, RAB7A, ATP7B, HFE, LIPA, SCNN1A, PKD1, PKD2, PKHD1, A, B, C, D, D, E, F ... CE, ALB, VHL, EPO, FH, ACE, TNF, SPP1, IL6, MYH9, TSC2, ADIPOQ, IL2, CCL2, TGFB1, UMOD, BCOR, FLCN, FLCN, TP53, CRP, PTEN, IFT88, CLDN14, AGT, MET, MYH9, YWHAE, HAMP, EPO, MUC1, BAP1, APOE, CYBA, GSTT1, IFNG, IGF1, IL2, ABCB1, SDHB, TSC2, BRAF, CDKN1B, GLA, KRT7, PPARG, RET, TRPC6, NDRG1, GANAB, ADIPOR1, GREB1L, ANKS6, NUTM2B, CAT, CYBA, CYBB, EGFR, HMOX1, LRP2, SERPINE1, PAX2, ABCB1, PPARA, PPARG, PTGS2, RELA, RET, TLR4, UMOD, BAP1, RETN, GREB1L, FRAS1, CRB2, APRT, AXL, CCND1, CBR1, CPT1A, CYP1A1, CYP2B6, EDN1, ERBB2, HMGCR, MME, NFKB1, N The therapeutic polynucleotide may encode a gene that targets a gene such as GF, MAPK1, MAPK3, PTGS2, HLTF, SOD1, SOD2, SREBF2, HNF1B, TERT, TNFSF10, NDRG1, MBTPS2, WNT4, BCOR, INF2, ALG9, BICC1, TMEM67, IRX2, FREM1, ANKS6, FREM2, CD46, COL4A3, COL4A4, COL4A5, TTC21B, NPHP4, CD2AP, CFI, LAMB2, LMX1B, or MYH9.

[0189] In some embodiments, a gene may be associated with a disease or disorder, which may be encoded by a payload sequence or may be targeted by a therapeutic polynucleotide encoded by a payload sequence and delivered to a subject's cells to treat, prevent, or alleviate symptoms of a disease or condition. For example, genes and associated conditions include PKD1 or PDK2 associated with autosomal dominant polycystic kidney disease; MECP2 associated with Rett syndrome; CNGA3 or CNGB3 associated with total color blindness; ABCD1 associated with adrenomyeloneuropathy; UBE3A associated with Angelman syndrome; tafazzin associated with Barth syndrome; CLN1, CLN2, CLN3, CLN4, CLN5, or CLN6 associated with Batten disease; ASPA associated with Canavan disease; PKD1 or PDK2 associated with autosomal dominant polycystic kidney disease; CYP21A2 associated with congenital adrenal hyperplasia; PMM2 associated with congenital glycosylation disorder 1a; LAMP2 associated with Danon disease; GLA associated with Fabry disease; GBA associated with Gaucher disease; GLB1 associated with GM1 gangliosidosis; and glycogen SD. G6PC associated with 1a; F9 associated with hemophilia; Serping1 associated with hereditary angioedema; GALC associated with Krabbe disease; GUCY2D, ND1, ND6, ND4, RPE65, or AIPL1 associated with Leber disease; MTM1 associated with myotubular myopathy; I, II, IIA, IIC, IIID, IVA, VI, VII, and IXA associated with mucopolysaccharidoses; OTC associated with ornithine transcarbamylase deficiency; GAA associated with Pompe disease; HEXB associated with Sandhoff disease; SMN1 associated with spinal muscular atrophy; associated with Tay-Sachs disease HEXA associated with Usher syndrome; USH2D-WHRN and USH3A-CLN1 associated with Usher syndrome; SOD1 associated with ALS; HBB associated with β-thalassemia or sickle cell disease; BEST1 associated with bestrophinopathy; CHM associated with choroideremia; FXN associated with Friedreich's ataxia; SLC37A4 associated with GSD1b; IGF1 associated with osteoporosis; RPGR or RHO associated with retinitis pigmentosa; USH1C or CIB2 associated with Usher 1C, 1F; SERPINA1 associated with α1-antitrypsin deficiency;MECP2 associated with Rett syndrome; PP1 associated with AC6, Serca2, VEGF-B, or heart failure; GAD associated with Parkinson's disease; MBTPS2 associated with brain abnormalities, retardation, ectodermal dysplasia, skeletal malformations, Hirschsprung's disease, ear and eye abnormalities, cleft palate-cryptorchidism, and renal dysplasia-hypoplasia; CD46, COL4A3, COL4A4, COL4A5, TTC21B, NPHP4, CD2AP, CFI, LAMB2, LMX1B, or MYH9 associated with chronic kidney disease / injury of monogenic origin; TERT or IRX2 associated with clear cell sarcoma of the kidney; ERBB2 associated with renal collecting duct carcinoma; FREM1 associated with congenital renal aplastic syndrome; TMEM67 associated with cystic kidney disease; SOD1 associated with kidney stones; ED associated with renal failure N1 or MME; CPT1A, CYP2B6, HMGCR, NFKB1, NGF, or SREBF2 associated with chronic renal failure; INF2 associated with renal failure or chronic kidney disease / injury of monogenic origin; PTGS2, HLTF, NDRG1, or BCOR associated with renal neoplasms; CYP1A1, MAPK1, MAPK3, PTGS2, SOD2, or TNFSF10 associated with renal malignant neoplasms; ALG9 associated with polycystic kidney disease Potter type I with microbrachycephaly, hypertelorism, and short limbs; BICC1 or ANKS6 associated with autosomal dominant polycystic kidney disease; WNT4 associated with transsexual women with renal, adrenal, and pulmonary dysgenesis; FREM2 associated with unilateral renal agenesis; or HNF1B associated with unilateral polycystic dysplastic kidney.

[0190] In some embodiments, a gene (e.g., a transgene) or therapeutic polynucleotide encoded by the payload may be transcribed in a target cell type, cell state, or tissue type at a level that is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the transcription level of the payload in a non-target cell type, cell state, or tissue type.

[0191] In some embodiments, a gene (e.g., a transgene) or therapeutic polynucleotide encoded by the payload may be transcribed in a target cell type, cell state or tissue type at a level that is at least about -0.75-fold, at least about -0.5-fold, at least about -0.25-fold, at least about -0.1-fold, at least about 0-fold, at least about 0.1-fold, at least about 0.25-fold, at least about 0.5-fold, at least about 0.75-fold, at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the transcription level of a wild-type version of the payload in the target cell type, cell state, or tissue type.

[0192] In some embodiments, a gene (e.g., a transgene) or therapeutic polynucleotide encoded by a payload can be transcribed in a target cell type, cell state, or tissue type at a level that is at least about 1-fold, at least about 1.1-fold, at least about 1.2-fold, at least about 1.3-fold, at least about 1.4-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 100-fold, at least about 150-fold, or at least about 200-fold the transcription level of the payload in a non-target cell type, cell state, or tissue type using any of the core promoters disclosed herein (e.g., any one of SEQ ID NOs:1-4, SEQ ID NO:7, or SEQ ID NOs:10-144) paired with a response element for the target cell type, cell state, or tissue type.

[0193] In some embodiments, the gene (e.g., transgene) or therapeutic polynucleotide encoded by the payload is expressed using any of the core promoters disclosed herein (e.g., any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) paired with a response element for the target cell type, cell state, or tissue type to increase transcription levels of the wild-type version of the payload in the target cell type, cell state, or tissue type by at least about -0.75-fold, at least about -0.5-fold, at least about -0.25-fold, at least about -0.1-fold, at least about -0.25-fold, at least about -0.3-fold, at least about -0.4-fold, at least about -0.5-fold, at least about -0.6-fold, at least about -0.7-fold, at least about -0.8-fold, at least about -0.9-fold, at least about -0.9-fold, at least about -0.9-fold, at least about -0.1-fold, at least about -0.8-fold, at least about -0.9-fold, at least about -0.1-fold, at least about -0.1-fold, at least about -0.2-fold, at least about -0.3-fold, at least about -0.4-fold, at least about -0.5-fold, at least about -0.6-fold, at least about -0.7-fold, at least about -0.8-fold, at least about -0.9-fold, at least about -0.9-fold, at least about -0.9-fold, at least about -0.1-fold, at least about -0.1-fold, at least about -0.2-fold, at least about -0.3-fold, at least about -0.4-fold, at least about -0.5-fold, at least about -0.5-fold, at least about -0.6-fold, at least about -0.7-fold, The gene may be transcribed in the target cell type, cell state, or tissue type at a level of about 0 fold, at least about 0.1 fold, at least about 0.25 fold, at least about 0.5 fold, at least about 0.75 fold, at least about 1 fold, at least about 1.1 fold, at least about 1.2 fold, at least about 1.3 fold, at least about 1.4 fold, at least about 1.5 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 10 fold, at least about 20 fold, at least about 30 fold, at least about 40 fold, at least about 50 fold, at least about 100 fold, at least about 150 fold, or at least about 200 fold.

[0194] Recombinant Vectors In some embodiments, the polynucleotide of the present disclosure is introduced into the subject via a recombinant vector. In some embodiments, the engineered core promoter of the present disclosure (e.g., any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) is introduced into the subject via a recombinant vector. In some embodiments, the engineered core promoter of the present disclosure paired with a response element is introduced into the subject via a recombinant vector. In some embodiments, the engineered core promoter of the present disclosure paired with a response element upstream of a polynucleotide encoding a payload is introduced into the subject via a recombinant vector. In some embodiments, the vector is a plasmid, a viral vector, an expression cassette, or a transformed cell.

[0195] In some embodiments, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. Adeno-associated virus (AAV) vectors include vectors derived from any AAV serotype, including, but not limited to, AAV1 and AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Rh20, AAV.Rh1 ... 10, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AAV.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV .PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC Examples of such variants include, but are not limited to, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, and AAVhu68.

[0196] In some embodiments, the polynucleotide is introduced into the subject by a non-viral vector system. In some embodiments, an engineered core promoter of the present disclosure (e.g., any one of SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144) is introduced into the subject by a non-viral vector system. In some embodiments, an engineered core promoter of the present disclosure paired with a response element is introduced into the subject by a non-viral vector system. In some embodiments, an engineered core promoter of the present disclosure paired with a response element upstream of a polynucleotide encoding a payload is introduced into the subject by a non-viral vector system. In some embodiments, cationic lipids, polymers, hydrodynamic injection, and / or ultrasound may be used in the delivery of a polynucleotide to a subject in the absence of viruses. In some embodiments, cationic lipids, polymers, hydrodynamic injection, and / or ultrasound may be used in the delivery of an engineered core promoter of the present disclosure (e.g., any one of SEQ ID NO:1-4, SEQ ID NO:7, or SEQ ID NO:10-144) to a subject in the absence of viruses. In some embodiments, cationic lipids, polymers, hydrodynamic injection, and / or ultrasound may be used in the delivery to a subject of an engineered core promoter of the present disclosure paired with a response element in the absence of virus. In some embodiments, cationic lipids, polymers, hydrodynamic injection, and / or ultrasound may be used in the delivery to a subject of an engineered core promoter of the present disclosure paired with a response element upstream of a polynucleotide encoding a payload in the absence of virus.

[0197] In some examples, the vector can be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector), a viral vector, or any combination thereof. In some examples, the vector can be a viral vector. In some embodiments, the viral vector can be a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, an alphavirus vector, a lentiviral vector (e.g., human or porcine), a herpes virus vector, an Epstein-Barr virus vector, an SV40 virus vector, a pox virus vector, or any combination thereof. In some embodiments, the viral vector can be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a single-stranded vector, or any combination thereof.

[0198] In some embodiments, the viral vector may be an adeno-associated virus (AAV). In some embodiments, the AAV may be any AAV known in the art. In some embodiments, the viral vector may be a specific serotype. In some embodiments, the viral vector may be an AAV1 serotype, an AAV2 serotype, an AAV3 serotype, an AAV4 serotype, an AAV5 serotype, an AAV6 serotype, an AAV7 serotype, an AAV8 serotype, an AAV9 serotype, an AAV10 serotype, an AAV11 serotype, an AAV 12 serotypes, AAV13 serotypes, AAV14 serotypes, AAV15 serotypes, AAV16 serotypes, AAV-DJ serotypes, AAV-DJ / 8 serotypes, AAV-DJ / 9 serotypes, AAV1 / 2 serotypes, AAV.rh8 serotype, AAV.rh10 serotype, AAV.rh20 serotype, AAV.rh39 serotype, AAV.Rh43 serotype, AAV.Rh74 serotype, AAV.v66 serotype, AAV.O ligo001 serotype, AAV.SCH9 serotype, AAV.r3.45 serotype, AAV.RHM4-1 serotype, AAV.hu37 serotype, AAV.Anc80 serotype, AAV.Anc80L65 Serotype, AAV.7m8 serotype, AAV.PhP.eB serotype, AAV.PhP.V1 serotype, AAV.PHP.B serotype, AAV.PhB.C1 serotype, AAV.PhB.C2 serotype, AAV .PhB.C3 serotype, AAV.PhB.C6 serotype, AAV.cy5 serotype, AAV2.5 serotype, AAV2tYF serotype, AAV3B serotype, AAV.LK03 serotype, AAV.HSC1 Serotype, AAV.HSC2 serotype, AAV.HSC3 serotype, AAV.HSC4 serotype, AAV.HSC5 serotype, AAV.HSC6 serotype, AAV.HSC7 serotype, AAV.HSC8 serotype , AAV.HSC9 serotype, AAV.HSC10 serotype, AAV.HSC11 serotype, AAV.HSC12 serotype, AAV.HSC13 serotype, AAV.HSC14 serotype, AAV.HSC15 serotype, AAV.HSC16 serotype, AAV.HSC17 serotype, or AAVhu68 serotype, derivatives of any of these serotypes, or any combination thereof.

[0199] In some embodiments, the AAV vector can be a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV vector, or any combination thereof.

[0200] In some embodiments, the AAV vector may be a recombinant AAV (rAAV) vector. Methods for producing recombinant AAV vectors may be known in the art and in some cases generally involve introducing into a producer cell line a plasmid construct containing: (1) DNA required for AAV replication and synthesis of AAV capsids; (b) one or more helper constructs containing viral functions missing from the AAV vector; (c) a helper virus; and (d) the genome of the AAV vector (such as ITRs, promoters, and payload sequences). In some examples, the viral vectors described herein may be engineered through synthetic or other suitable means by reference to published sequences (such as those that may be available in the literature). For example, the genome and protein sequences of various serotypes of AAV, and the sequences of native terminal repeats (TRs), Rep proteins, and capsid subunits, may be known in the art and may be found in the literature or in public databases (such as GenBank or Protein Data Bank (PDB)).

[0201] In some examples, the method of producing a delivery vector of the present disclosure includes packaging a polynucleotide of the present disclosure into an AAV vector. In some examples, the method of producing a delivery vector of the present disclosure includes packaging an engineered core promoter of the present disclosure (e.g., any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) into an AAV vector. In some examples, the method of producing a delivery vector of the present disclosure includes packaging an engineered core promoter of the present disclosure paired with a response element into an AAV vector. In some examples, the method of producing a delivery vector of the present disclosure includes packaging an engineered core promoter of the present disclosure paired with a response element upstream of a polynucleotide encoding a payload into an AAV vector. In some examples, a method for producing a delivery vector described herein includes (a) introducing into a cell a viral genome comprising (i) a polynucleotide disclosed herein (e.g., an engineered core promoter of the present disclosure; an engineered core promoter of the present disclosure paired with a response element; or an engineered core promoter of the present disclosure paired with a response element upstream of a polynucleotide encoding a payload); and (ii) a replication (Rep) gene and a capsid (Cap) gene encoding a wild-type AAV capsid protein or a modified version thereof; (b) expressing the wild-type AAV capsid protein or a modified version thereof in the cell; (c) assembling AAV particles; and (d) packaging a polynucleotide disclosed herein into the AAV particle, thereby generating an AAV delivery vector. In some examples, any polynucleotide disclosed herein can be packaged into an AAV vector. In some examples, the recombinant vector comprises one or more inverted terminal repeats, and the inverted terminal repeats comprise a 5' inverted terminal repeat, a 3' inverted terminal repeat, and a mutated inverted terminal repeat. In some instances, the mutated terminal repeat lacks terminal separation sites, thereby allowing the formation of a self-complementary AAV.

[0202] In some instances, a hybrid AAV vector can be produced by transcapsidation, e.g., packaging an inverted terminal repeat (ITR) from a first serotype into a capsid of a second serotype, where the first and second serotypes may not be the same. In some instances, the Rep gene and ITR from a first AAV serotype (e.g., AAV2) can be used in a capsid from a second AAV serotype (e.g., AAV5 or AAV9), where the first and second AAV serotypes may not be the same. As a non-limiting example, a hybrid AAV serotype comprising the ITRs of AAV2 and the capsid proteins of AAV9 may be designated AAV2 / 9. In some instances, the hybrid AAV delivery vector comprises an AAV2 / 1, AAV2 / 2, AAV 2 / 4, AAV2 / 5, AAV2 / 8, or AAV2 / 9 vector.

[0203] In some examples, the AAV vector can be a chimeric AAV vector.In some examples, the chimeric AAV vector comprises foreign amino acids or amino acid substitutions, or capsid proteins from two or more serotypes.In some examples, the chimeric AAV vector can be genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.

[0204] In some instances, the AAV vector comprises a self-complementary AAV genome, which may generally be known in the art and may contain both DNA strands that can anneal together to form double-stranded DNA.

[0205] In some examples, the delivery vector can be a retroviral vector. In some examples, the retroviral vector can be a Moloney murine leukemia virus vector, a spleen necrosis virus vector, or a vector derived from an avian sarcoma virus, a Harvey sarcoma virus, an avian leukemia virus, a human immunodeficiency virus, a myeloproliferative sarcoma virus, or a mammary tumor virus, or a combination thereof. In some examples, the retroviral vector can be transfected such that the sequences encoding the majority of the viral structural genes (e.g., gag, pol, and env) can be deleted and replaced by the gene(s) of interest (e.g., payload).

[0206] In some examples, the delivery vehicle may be a non-viral vector. Examples of non-viral vectors may include plasmids, lipid nanoparticles, lipoplexes, polymersomes, polyplexes, dendrimers, nanoparticles, and cell penetrating peptides. The non-viral vector may include a promoter (e.g., including a cell type-specific or cell state-specific response element and a switchable core promoter) and a polynucleotide (such as a plasmid) encoding a payload sequence. The non-viral vector may include an engineered core promoter of the present disclosure (e.g., any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144). The non-viral vector may include an engineered core promoter of the present disclosure paired with a response element. The non-viral vector may include an engineered core promoter of the present disclosure paired with a response element upstream of the polynucleotide encoding the payload. In some examples, the delivery vehicle may be a plasmid. In some examples, the plasmid may be a minicircle plasmid. In some embodiments, the vector may include naked DNA (e.g., a naked DNA plasmid). In some embodiments, the non-viral vector includes DNA. In some embodiments, the non-viral vector includes RNA. In some examples, the non-viral vector comprises a circular double-stranded DNA. In some examples, the non-viral vector may comprise a linear polynucleotide. In some examples, the non-viral vector comprises a polynucleotide encoding one or more genes of interest and one or more regulatory elements. In some examples, the non-viral vector comprises a bacterial backbone containing an origin of replication, and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria. In some examples, the non-viral vector contains one or more genes that provide a selectable marker that induces target cells to retain the polynucleotide (e.g., plasmid) of the non-viral vector. In some examples, the non-viral vector can be formulated for delivery via injection with a needle syringe.In some instances, non-viral vectors can be formulated for delivery via electroporation. In some instances, the polynucleotides of non-viral vectors can be engineered via synthetic means or other suitable means known in the art. For example, in some instances, genetic elements can be assembled by restriction digesting the desired genetic sequence from a donor plasmid or organism to generate DNA ends, which can then be immediately ligated to another genetic sequence.

[0207] Methods for adjusting payload translation In some embodiments, the disclosure provides a method of inserting a polynucleotide comprising a promoter described herein (e.g., an engineered core promoter such as any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144 paired with a response element) and a payload into a recombinant polynucleotide cassette. The recombinant polynucleotide cassette may further modulate expression of the payload (e.g., by regulating translation). In some embodiments, the recombinant polynucleotide cassette modulates the stability of the payload RNA. In some embodiments, the recombinant polynucleotide cassette comprises a 5'UTR effector region. In some embodiments, the recombinant polynucleotide cassette comprises a 3'UTR effector region. In some embodiments, the payload is codon-optimized in the recombinant polynucleotide cassette. In some embodiments, an intron is inserted into the 5'UTR effector region or into the sequence of the payload. In some embodiments, the intron is a natural intron or a synthetic intron.

[0208] In some embodiments, the recombinant polynucleotide cassette comprises a promoter described herein (e.g., an engineered core promoter such as any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144 paired with a response element), a payload sequence, and one or more of a 5'UTR effector region; a 3'UTR effector region; a codon-optimized sequence of the payload; and an intron in the sequence of the payload. In some embodiments, translation of the payload is increased in a recombinant polynucleotide cassette comprising one or more of a 5'UTR effector region, a 3'UTR effector region, a codon-optimized sequence of the payload, and an intron in the sequence of the payload compared to that from a recombinant polynucleotide cassette lacking one or more of a 5'UTR effector region, a 3'UTR effector region, a codon-optimized sequence of the payload, and an intron in the sequence of the payload. In some embodiments, translation of the payload is reduced from a recombinant polynucleotide cassette that includes one or more of a 5'UTR effector region, a 3'UTR effector region, a codon-optimized sequence of the payload, and an intron in the payload sequence, compared to translation from a recombinant polynucleotide cassette that lacks one or more of a 5'UTR effector region, a 3'UTR effector region, a codon-optimized sequence of the payload, and an intron in the payload sequence.

[0209] In some embodiments, the 5'UTR effector region comprises one or more of: a structural element; a sequence motif; a nucleotide base content that comprises at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or 100% G / C content; and a 5'UTR intron. In some embodiments, the structural element is a site in a conformation with the 5' cap such that the 5' cap is inaccessible or has reduced accessibility to the translational apparatus (e.g., also referred to as a "cap-burying site"), resulting in reduced or no translation compared to a 5'UTR lacking the structural element. In some embodiments, the structural element is an internal ribosome entry site (IRES). In some embodiments, the structural element is an RNA pseudoknot. In some embodiments, the structural element is an iron-responsive element (IRE). In some embodiments, the structural element is a non-coding translational regulatory structure. In some embodiments, the structural element is a hairpin. In some embodiments, the structural element is a sequence (e.g., a cap-embedded site sequence, an IRES, an RNA pseudoknot, an IRE, or a non-coding translational regulatory structure) that changes conformation when the sequence element contacts a target RNA, and the sequence element has at least partial complementarity with the target RNA, such that the rate of translation of a payload downstream of the structural element is increased or decreased compared to the translation of the payload before the sequence element contacts the target RNA. In some embodiments, the 5'UTR effector region further comprises a sequence element, the nucleic acid sequence of the sequence element being at least partially complementary to a sequence of the target RNA, and the conformation of the structural element changes when the sequence element contacts the target RNA, and the sequence element has at least partial complementarity with the target RNA. In some embodiments, the 5'UTR intron is a natural intron, a synthetic intron, or a fragment thereof.

[0210] In some embodiments, the 3'UTR comprises one or more of a site for recruiting the polyA tail apparatus; a miRNA binding site; or a sequence motif. In some embodiments, the poly(A) tail recruitment apparatus comprises an enzyme. In some embodiments, the length of the poly(A) tail regulates protein expression from the polynucleotide. In some embodiments, the 3'UTR effector region comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more miRNA binding sites. In some embodiments, the miRNA binding sites are for the same miRNA. In some embodiments, the miRNA binding sites are for different miRNAs. In some embodiments, the sequence motif is an AC-rich motif. In some embodiments, the sequence motif is an AU-rich element (ARE).

[0211] In some embodiments, the codon-optimized sequence of the therapeutic polynucleotide is at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or 100% codon-optimized. In some embodiments, the intron in the sequence of the therapeutic polynucleotide is a natural intron, a synthetic intron, or a fragment thereof. In some embodiments, the recombinant polynucleotide cassette is encoded by a DNA vector.

[0212] In some embodiments, the combination of a promoter sequence and a payload sequence described herein in a recombinant polynucleotide cassette results in the payload being expressed at a therapeutic level to reduce or alleviate at least one symptom of a disease or disorder, the therapeutic level being greater than -0.25x, -0.5x, 0x, 0.25x, 0.5x, 0.75x, 1x, 1.5x, 2x, or 4x the biological level of the payload.

[0213] Methods of Treatment and Pharmaceutical Compositions Methods for the treatment of diseases or disorders characterized by aberrant gene expression are also encompassed by the present disclosure. The methods include administering a therapeutically effective amount of a payload sequence as part of a recombinant polynucleotide cassette. The recombinant polynucleotide cassettes of the present disclosure may be formulated in pharmaceutical compositions. These compositions may contain, in addition to one or more of the recombinant polynucleotide cassettes (e.g., comprising an engineered core promoter such as any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144), pharma- ceutically acceptable excipients, carriers, buffers, stabilizers, or other materials known to those of skill in the art. Such materials should be non-toxic and not interfere with the efficacy of the active ingredient. The exact nature of the carrier or other materials may depend on the route of administration (e.g., oral, intravenous, transdermal, subcutaneous, nasal, intramuscular, intraperitoneal).

[0214] Pharmaceutical compositions for oral administration may be in tablet, capsule, powder, or liquid form. Tablets may contain a solid carrier, such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally contain a liquid carrier, such as water, petroleum or animal or vegetable oils, mineral oil, or synthetic oil. Saline solution, dextrose or other sugar solution, or glycols, such as ethylene glycol, propylene glycol, or polyethylene glycol, may be included.

[0215] For intravenous, cutaneous or subcutaneous injection, or injection at the affected site, the active ingredient will be in the form of a parenterally acceptable aqueous solution that is pyrogen-free and has suitable pH, isotonicity, and stability. Those skilled in the art are well able to prepare suitable solutions using, for example, isotonic vehicles (sodium chloride injection, Ringer's injection, lactated Ringer's injection, etc.). Preservatives, stabilizing substances, buffers, antioxidants, and / or other additives may be included as required.

[0216] In some embodiments, a polynucleotide of the disclosure, or a recombinant polynucleotide cassette of the disclosure (e.g., a polynucleotide or a cassette of a recombinant polynucleotide comprising an engineered core promoter such as any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) may be administered to a cell via a lipid nanoparticle. In some embodiments, the lipid nanoparticle may be administered at an appropriate concentration according to standard methods appropriate for the target cell.

[0217] In some embodiments, a polynucleotide of the present disclosure, or a recombinant polynucleotide cassette of the present disclosure (e.g., a polynucleotide or a cassette of recombinant polynucleotides comprising an engineered core promoter such as any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) may be administered to a cell via a viral vector. In some embodiments, the viral vector may be administered at an appropriate multiplicity of infection according to standard transduction methods appropriate for the target cells. The titer of the viral vector or capsid to be administered will vary depending on the target cell type or cell condition and number, and can be determined by one of skill in the art. In some embodiments, the titer is at least about 10 2 In some embodiments, at least about 10 infectious units are administered. 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , or 10 13 of infectious units are administered.

[0218] In some embodiments, a polynucleotide or recombinant polynucleotide cassette (e.g., a polynucleotide or recombinant polynucleotide cassette comprising an engineered core promoter such as any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) is introduced into cells of any type or state, including, but not limited to, neural cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), lung cells, epithelial cells, skeletal muscle cells, dendritic cells, liver cells, pancreatic cells, bone cells, hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, and cardiac cells.

[0219] In some embodiments, a polynucleotide of the disclosure, or a recombinant polynucleotide cassette of the disclosure (e.g., a polynucleotide or a cassette of recombinant polynucleotides comprising an engineered core promoter such as any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) may be introduced into a cell in vitro via a viral vector for administration of the modified cell to a subject. In some embodiments, a viral vector encoding a polynucleotide of the disclosure, or a recombinant polynucleotide cassette of the disclosure is introduced into a cell that has been removed from a subject. In some embodiments, the modified cell is returned into the subject following introduction of the viral vector.

[0220] In some embodiments, doses of modified cells are administered to a subject according to the age and species of the subject, the disease or disorder being treated, and the cell type or condition, and the mode of administration. 2 ~10 8 In some embodiments, the cells transduced by the viral vector are administered to the subject in an effective amount.

[0221] In some embodiments, the dose of the viral vector administered to a subject will vary according to the age of the subject, the disease or disorder being treated, and the mode of administration. In some embodiments, the dose to achieve a therapeutic effect is at least about 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , or greater transducing unit viral titers.

[0222] Administration of the pharma- ceutically useful polynucleotides of the present disclosure, or the polynucleotide cassettes of the present disclosure, is preferably a "therapeutically effective amount" or a "prophylactically effective amount" (although in some cases prevention may be considered treatment), which is sufficient to show benefit to the individual. The actual amount administered, as well as the rate and time course of administration, will depend on the nature and severity of the protein aggregation disorder being treated. Prescription of treatment (e.g., decisions regarding dosage, etc.) is within the responsibility of general practitioners and other physicians, and typically takes into account the disorder being treated, the condition of the individual patient, the site of delivery, the method of administration, and other factors known to practitioners. Examples of the techniques and protocols referred to above can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980.

[0223] The compositions may be administered alone or in combination with other treatments, either simultaneously or sequentially, depending on the condition being treated.

[0224] Diseases and Disorders In some embodiments, a recombinant polynucleotide of the disclosure, or a recombinant polynucleotide cassette of the disclosure (e.g., a polynucleotide, recombinant polynucleotide, or recombinant polynucleotide cassette comprising an engineered core promoter, such as any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) is used for the treatment of a disease or disorder associated with aberrant expression of a gene or protein. In some embodiments, the disease or disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, amyotrophic lateral sclerosis (ALS), limbic dominant age-related TDP-43 encephalopathy (LATE), autosomal recessive polycystic kidney disease, chronic renal failure, malignant neoplasms of the kidney, type 2 polycystic kidney disease, renal failure, renal neoplasms, type 2 medullary cystic kidney disease, clear cell sarcoma of the kidney, kidney stones, collecting duct carcinoma of the kidney, polycystic kidney, medullary cystic kidney disease 1, congenital renal agenesis syndrome, cystic kidney, chronic kidney disease / disorders of monogenic origin, unilateral renal agenesis, glomerular cystic kidney disease with hyperuricemia and isotonicity, cystic kidney disease with ventricular enlargement, unilateral polycystic dysplasia Renal, brain anomalies, retardation, ectodermal dysplasia, skeletal anomalies, Hirschsprung's disease, ear and eye anomalies, cleft palate-cryptorchidism, and renal dysplasia-hypoplasia, transsexual females with renal, adrenal, and pulmonary dysgenesis, polycystic kidney disease with microbrachycephaly, hypertelorism, and short limbs, Potter type I retinitis pigmentosa 7, macular degeneration, retinitis pigmentosa pigmentosa 4, Angelman syndrome, DYRK1A haploinsufficiency, MEF2C haploinsufficiency syndrome, Sotos syndrome, reverse Sotos syndrome, α-thalassemia X-linked mental retardation syndrome, Xp22.12 duplication, Coffin-Lowry syndrome, Pitt-Hopkins syndrome, Mowat-Wilson syndrome, FOXG1 syndrome, CDKL5 deficiency disorder, West syndrome, 2q23.1 microdeletion syndrome, Doss syndrome, SLC6A1 epileptic encephalopathy, Duchenne muscular dystrophy, Becker muscular dystrophy, alpha 1-antitrypsin deficiency (AATD), macular degeneration / Stargardt disease, cystic fibrosis, Tay-Sachs disease, Charcot-Marie-Tooth neuropathy, Wilson's disease, hereditary hemochromatosis, Wolman disease, cholesteryl ester storage disease, pseudohypoaldosteronism type 1, autosomal dominant polycystic kidney disease, total color blindness, adrenomyeloneuropathy, Barth syndrome, Batten disease, Canavan disease, congenital adrenal hyperplasia, congenital glycosylation disorder 1a, Danon disease, Fabry disease, Gaucher disease, GM1 gangliosidosis, glycogen SD 1a, hemophilia, hereditary angioedema, Krabbe disease, Leber disease, myotubular myopathy, mucopolysaccharidoses, ornithine transcarbamylase deficiency, Pompe disease, Sandhoff disease, spinal muscular atrophy, Usher syndrome, β-thalassemia, bestrophinopathy, choroideremia, Friedreich's ataxia, GSD1b, osteoporosis, sickle cell disease, heart failure, or Parkinson's disease. In some embodiments, the disease or disorder is Rett syndrome. In some embodiments, the disease or disorder is frontotemporal dementia. In some embodiments, the disease or disorder is a retinal disorder. In some embodiments, the retinal disorder includes retinitis pigmentosa 7, retinitis pigmentosa 4, or macular degeneration.

[0225] In some embodiments, a polynucleotide or a recombinant polynucleotide cassette of the present disclosure (e.g., a polynucleotide or a cassette of a recombinant polynucleotide comprising an engineered core promoter such as any one of SEQ ID NO:1-SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10-SEQ ID NO:144) can be administered to a subject in need of the polynucleotide or the cassette using a viral vector (e.g., an AAV vector) or a non-viral vector. For example, a subject in need of the polynucleotide or the cassette can have or be at risk for frontotemporal dementia. Upon administration of the polynucleotide or the recombinant polynucleotide cassette, a payload sequence (e.g., encoding progranulin, polycystin-1, or polycystin-2) can be expressed in a cell type, cell state, or tissue type of interest (e.g., diseased cells, neural cells, CNS tissue, kidney cells, or kidney tissue). The payload sequence is selectively transcribed in the cell type, cell state, or tissue type of interest, thereby preventing unwanted side effects in the subject due to expression in non-target tissues. The subject can be a human or a non-human animal. Thus, the polynucleotides disclosed herein, or recombinant polynucleotide cassettes disclosed herein, can serve as therapeutically effective vector replacement therapies that sense endogenous nucleic acids to regulate expression of payload sequences and prevent or minimize deleterious side effects from overexpression of the payload sequences.

[0226] As used herein, the term "therapeutic polynucleotide" can refer to a polynucleotide that can be introduced into and expressed in a cell, or a polynucleotide that can have therapeutic activity in itself (such as a gRNA or tRNA).

[0227] As used herein, the term "polynucleotide" refers to a single- or double-stranded polymer of deoxyribonucleotide (DNA) or ribonucleotide (RNA) bases read from the 5' to 3' end. The term "RNA" includes dsRNA (double-stranded RNA), snRNA (small nuclear RNA), lncRNA (long non-coding RNA), mRNA (messenger RNA), miRNA (microRNA), RNAi (inhibitory RNA), siRNA (small interfering RNA), shRNA (short hairpin RNA), tRNA (transfer RNA), rRNA (ribosomal RNA), snoRNA (small nucleolar RNA), and cRNA (complementary RNA). The term DNA includes cDNA, genomic DNA, and DNA-RNA hybrids.

[0228] The term "amelioration" refers to any therapeutically beneficial outcome in the treatment of a disease state (eg, Rett Syndrome), including prevention, reduction in severity, or progression thereof, remission, or cure.

[0229] The term "mammal", as used herein, encompasses both humans and non-humans, including, but not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0230] The term percent "identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a defined percentage of nucleotides or amino acid residues that are the same when compared and aligned for maximum correspondence as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN, or other algorithms available to those of skill in the art) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequences being compared, such as over a functional domain, or alternatively over the entire length of the two sequences being compared.

[0231] For sequence comparison, typically, one sequence serves as a reference sequence (also called subject sequence) to which a test sequence (also called query sequence) is compared. Percent sequence identity is defined as the percent identity of a test sequence to a reference sequence. For example, when it is stated that "sequence A has 50% sequence identity to sequence B", sequence A is the test sequence and sequence B is the reference sequence. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer program, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then aligns the sequences to achieve maximum alignment based on the designated program parameters, and introduces gaps in the alignment if necessary. The percent sequence identity for the test sequence(s) compared to the reference sequence can then be determined from the alignment of the test sequence to the reference sequence. The equation for percent sequence identity from aligned sequences is as follows: [(number of identical positions) / (total number of positions in test sequence)] x 100%

[0232] For purposes herein, percent identity and sequence similarity calculations are performed using the BLAST algorithm described in Altschul et al., J. Mol. Biol. 215:403-410 (1990) for sequence alignment. Software for performing BLAST real-time analysis is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ). The BLAST algorithm searches using a test sequence (also called a query sequence) and a reference sequence (also called a subject sequence), or in some cases, searches using a database of multiple reference sequences. The BLAST algorithm performs sequence alignment by scoring the alignment of short regions (called "words") of the test sequence to the reference sequence, and finding high-scoring alignment regions between the test and reference sequences. The score of each alignment is determined by the BLAST algorithm and takes into account factors such as the number of aligned positions and whether the introduction of gaps between the test and reference sequences improves the alignment. The alignment score for nucleic acids may be scored by a set score of match / mismatch. For protein sequences, the alignment score is scored using a substitution matrix to evaluate the significance of the sequence alignment (e.g., the similarity between aligned amino acids) based on the evolutionary probability of substitution. For purposes herein, the substitution matrix used is the BLOSUM62 matrix. For purposes herein, when using the BLASTN and BLASTP algorithms, the published default values ​​of April 6, 2023 are used. The BLASTN and BLASTP algorithms then output a "percent identity" output value and a "query coverage" output value. The overall percent sequence identity may then be calculated from the BLASTN or BLASTP output value as used herein as follows: Percent sequence identity = ("Percent identity" output value) x ("Query coverage" output value)

[0233] The following non-limiting example illustrates the calculation of percent identity between two nucleic acid sequences. Percent identity is calculated as follows: [(number of identical nucleotide positions) / (total number of nucleotides in test sequence)]×100%. Percent identity is calculated comparing test sequence 1: AAAAAGGGGG (length=10 nucleotides) to reference sequence 2: AAAAAAAAAA (length=10 nucleotides). The percent identity between test sequence 1 and reference sequence 2 would be [(5) / (10)]×100%=50%. Test sequence 1 has 50% sequence identity to reference sequence 2. In another example, percent identity is calculated comparing test sequence 3: CCCCCGGGGGGGGGGCCCCC (length=20 nucleotides) to reference sequence 4: GGGGGGGGGG (length=10 nucleotides). The percent identity between test sequence 3 and reference sequence 4 would be [(10) / (20)]×100%=50%. Test sequence 3 has 50% sequence identity to reference sequence 4. In another example, percent identity is calculated comparing test sequence 5: GGGGGGGGGG (length = 10 nucleotides) to reference sequence 6: CCCCCGGGGGGGGGGCCCCC (length = 20 nucleotides). The percent identity between test sequence 5 and reference sequence 6 would be [(10) / (10)] x 100% = 100%. Test sequence 5 has 100% sequence identity to reference sequence 6.

[0234] The following non-limiting example illustrates the calculation of percent identity between two protein sequences. Percent identity is calculated as follows: [(number of identical amino acid positions) / (total number of amino acids in test sequence)]×100%. Percent identity is calculated comparing test sequence 7: FFFFFYYYYY (length=10 amino acids) to reference sequence 8: YYYYYYYYYY (length=10 amino acids). The percent identity between test sequence 7 and reference sequence 8 would be [(5) / (10)]×100%=50%. Test sequence 7 has 50% sequence identity to reference sequence 8. In another example, percent identity is calculated comparing test sequence 9: LLLLLFFFFFYYYYYLLLLL (length=20 amino acids) to reference sequence 10: FFFFFYYYYY (length=10 amino acids). The percent identity between test sequence 9 and reference sequence 10 would be [(10) / (20)]×100%=50%. Test sequence 9 has 50% sequence identity to reference sequence 10. In another example, percent identity is calculated comparing test sequence 11: FFFFFYYYYY (length=10 amino acids) to reference sequence 12: LLLLLFFFFFYYYYYLLLLL (length=20 amino acids). The percent identity between test sequence 11 and reference sequence 12 would be [(10) / (10)]×100%=100%. Test sequence 11 has 100% sequence identity to reference sequence 12.

[0235] As used herein, the term "subject" refers broadly to any animal, including, but not limited to, humans and non-human animals (e.g., dogs, cats, cows, horses, sheep, pigs, poultry, fish, crustaceans, etc.).

[0236] As used herein, the term "effective amount" refers to an amount of a composition (e.g., a synthetic peptide) sufficient to achieve a beneficial or desired result. An effective amount may be administered in one or more administrations, applications, or dosages, and is not intended to be limited to a particular formulation or route of administration.

[0237] As used herein, the term "therapeutically effective amount" refers to an amount effective for alleviating symptoms of a disease. Since prevention can be considered treatment, a therapeutically effective amount can be a "prophylactically effective amount."

[0238] As used herein, the terms "administration" and "administering" refer to the act of giving a drug, prodrug, or other agent or therapeutic treatment (e.g., a peptide) to a subject, or to cells, tissues, and organs in vivo, in vitro, or ex vivo. Exemplary routes of administration to the human body can be via the brain's interarachnoid or subspinal spaces (intraceutical), eye (ophthalmic), mouth (oral), skin (topical or transdermal), nose (intranasal), lungs (inhalation), oral mucosa (buccal or lingual), ear, rectum, vagina, by injection (e.g., intravenous, subcutaneous, intratumoral, intraperitoneal, etc.), and the like.

[0239] As used herein, the term "treatment" refers to an approach to obtaining a beneficial or intended clinical result. A beneficial or intended clinical result may include alleviating symptoms, reducing the severity of a disease, inhibiting the underlying cause of a disease or condition, stabilizing a disease in a non-progressing state, slowing the progression of a disease, and / or improving or alleviating a disease condition.

[0240] As used herein, the term "pharmaceutical composition" refers to a combination of active ingredients with an inert or active carrier, which combination makes the composition particularly suitable for in vitro, in vivo, or ex vivo therapeutic or diagnostic uses.

[0241] The terms "pharmacologically acceptable" or "pharmacologically acceptable," as used herein, refer to a composition that does not substantially produce an adverse reaction (e.g., a toxic, allergic, or immune response) when administered to a subject.

[0242] As used herein, the term "pharmaceutical acceptable carrier" refers to any of the standard pharmaceutical carriers, including, but not limited to, phosphate buffered saline, water, emulsions (such as oil / water emulsions or water / oil emulsions), glycerol, liquid polyethylene glycols, aprotic solvents (such as dimethylsulfoxide, N-methylpyrrolidone, and mixtures thereof), and various types of wetting agents, solubilizers, antioxidants, fillers, protein carriers (such as albumin), any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonicity and absorption retardants, disintegrants (such as potato starch or sodium starch glycolate), and the like. The composition may also include stabilizing and preservative substances. For examples of carriers, stabilizers, and adjuvants, see, for example, Martin, Remington's Pharmaceutical Sciences, 21st Ed., Mack Publ. Co., Easton, Pa. (2005), which is incorporated herein by reference in its entirety.

[0243] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0244] As used herein, the terms "about" and "approximately" in reference to numbers are used herein to include numbers that fall within a range of 10%, 5%, or 1% in either direction (greater or less than) of the number, unless otherwise stated or apparent from the context (except where such number exceeds 100% of a possible value).

[0245] Numbered embodiments The following embodiments list non-limiting permutations of combinations of features disclosed herein. Other permutations of combinations of features are also contemplated. In particular, each of these numbered embodiments is contemplated as dependent or related to every preceding or succeeding numbered embodiment, regardless of the order listed. 1. A TATA box, an initiator element, a spacer separating the TATA box and the initiator element, and a) the TATA box comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO: 199 to SEQ ID NO: 201; b) the initiator element comprises a sequence having at least 75% sequence identity to any one of SEQ ID NO: 202 to SEQ ID NO: 204; c) the spacer is a short spacer comprising 25 to 29 nucleotide residues between the TATA box and the initiator element; d) the spacer is a short spacer comprising 25 to 29 nucleotide residues between the TATA box and the initiator element; an engineered core promoter sequence comprising one or more features selected from: a) a long spacer comprising 31 or more and 48 or less nucleotide residues between the YY1 motif and the initiator element; e) the YY1 motif comprises a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 205 to 207; f) the transcriptional pause site comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 196 to 198; g) at least 70% sequence identity and at least one nucleotide substitution compared to SEQ ID NO: 5, SEQ ID NO: 9, or SEQ ID NO: 210; and h) a combination thereof. 2. The engineered core promoter sequence of embodiment 1 comprising at least 70% sequence identity and nucleotide substitutions T15G and A40C compared to SEQ ID NO: 5. 3. The engineered core promoter sequence of embodiment 1 comprising at least 70% sequence identity and nucleotide substitutions T15A and A40T compared to SEQ ID NO: 5. 4. The engineered core promoter sequence of any one of embodiments 1 to 3, wherein the spacer comprises 29 to 31 nucleotides between the TATA box and the initiator element. 5. The engineered core promoter sequence of any one of embodiments 1 to 4, wherein the spacer comprises 30 nucleotides between the TATA box and the initiator element. 6. The engineered core promoter sequence of any one of embodiments 1 to 3, wherein the short spacer comprises 28 nucleotide residues between the TATA box and the initiator element.7. The engineered core promoter sequence of any one of embodiments 1 to 3, wherein the long spacer comprises 32 nucleotide residues between the TATA box and the initiator element. 8. The engineered core promoter sequence of any one of embodiments 1 to 7, wherein the TATA box comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO: 199 to SEQ ID NO: 201. 9. The engineered core promoter sequence of any one of embodiments 1 to 8, wherein the TATA box comprises a sequence of any one of SEQ ID NO: 199 to SEQ ID NO: 201. 10. The engineered core promoter sequence of any one of embodiments 1-9, wherein the initiator element comprises a sequence having at least 85% sequence identity to any one of SEQ ID NOs: 202 to 204. 11. The engineered core promoter sequence of any one of embodiments 1-10, wherein the initiator element comprises a sequence having at least 85% sequence identity to any one of SEQ ID NOs: 202 to 204. 12. The engineered core promoter sequence of any one of embodiments 1-11, wherein the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 205 to 207. 13. The engineered core promoter sequence of any one of embodiments 1-12, wherein the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 205 to 207. 14. The engineered core promoter sequence of any one of embodiments 1-11, wherein the transcription pause site comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs: 196 to 198. 15. The engineered core promoter sequence of any one of embodiments 1-11, wherein said transcriptional pause site comprises any one of the sequences of SEQ ID NO: 196 to SEQ ID NO: 198. 16. The engineered core promoter of any one of embodiments 1-15, wherein said engineered core promoter comprises two or more of the features. 17. The engineered core promoter sequence of any one of embodiments 1-16, wherein said engineered core promoter comprises features a) and b). 18. The engineered core promoter of any one of embodiments 1-17, wherein said engineered core promoter comprises three or more of the features. 19. The engineered core promoter sequence of any one of embodiments 1-18, wherein said engineered core promoter comprises features a) and b) and at least one more of the features. 20. The engineered core promoter sequence of any one of embodiments 1-19, wherein the engineered core promoter comprises features a), b), and c). 21. The engineered core promoter sequence of any one of embodiments 1-19, wherein the engineered core promoter comprises features a), b), and d). 22. The engineered core promoter sequence of any one of embodiments 1-19, wherein the engineered core promoter comprises features a), b), and e). 23. The engineered core promoter sequence of any one of embodiments 1-19, wherein the engineered core promoter comprises features a), b), and f). 24. An engineered core promoter sequence comprising a sequence having at least 80%, 85%, 90%, 93%, 95%, 97%, 99%, or 100% sequence identity to any one of SEQ ID NO:1 to SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10 to SEQ ID NO:144. 25. The engineered core promoter sequence of embodiment 23, wherein said engineered core promoter sequence comprises a sequence having at least 80%, 85%, 90%, 93%, 95%, 97%, 99%, or 100% sequence identity to any one of SEQ ID NO:1 to SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10 to SEQ ID NO:15, or SEQ ID NO:110. 26. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO:7. 27. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO:1. 28. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO:2. 29. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO:3. 30. The engineered core promoter sequence according to embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO: 4. 31. The engineered core promoter sequence according to embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO: 10. 32. The engineered core promoter sequence according to embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO: 11. 33. The engineered core promoter sequence according to embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO: 12. 34. The engineered core promoter sequence according to embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO: 13. 35. The engineered core promoter sequence according to embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO: 14. 36. The engineered core promoter sequence according to embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO: 15. 37. The engineered core promoter sequence of embodiment 23 or embodiment 24, wherein said engineered core promoter sequence comprises the sequence of SEQ ID NO: 110. 38. The engineered core promoter sequence of any one of embodiments 1 to 37, wherein said engineered core promoter sequence comprises a TATA box, an RNA polymerase binding sequence, a B recognition element, a CCAAT box, or a Pribnow sequence. 39. The engineered core promoter sequence of any one of embodiments 1 to 38, wherein said engineered core promoter sequence is capable of recruiting a polymerase. 40. The engineered core promoter sequence of embodiment 39, wherein the polymerase is RNA polymerase II. 41. The engineered core promoter sequence of any one of embodiments 1-40, wherein the engineered core promoter has a dynamic range higher than that of SEQ ID NO: 6. 42. The engineered core promoter sequence of any one of embodiments 1-41, wherein the engineered core promoter has a dynamic range higher than that of SEQ ID NO: 9. 43. The engineered core promoter sequence of any one of embodiments 1-42, wherein the engineered core promoter has an activity higher than that of SEQ ID NO: 6. 44. The engineered core promoter sequence of any one of embodiments 1-43, wherein the engineered core promoter has an activity higher than that of SEQ ID NO: 9. 45. The engineered core promoter sequence of any one of embodiments 1-44, wherein the engineered core promoter has an activity higher than that of SEQ ID NO: 6 when paired with an active response element, a basal activity lower than that of SEQ ID NO: 6 when paired with an inactive response element, or both. 46. ​​The engineered core promoter sequence of any one of embodiments 1-45, wherein the engineered core promoter has a basal activity higher than that of SEQ ID NO:9 when paired with an active response element, a basal activity lower than that of SEQ ID NO:9 when paired with an inactive response element, or both. 47. A recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises a response element capable of binding to a cognate ligand, coactivator, or corepressor; and the engineered core promoter sequence of any one of embodiments 1-46 capable of recruiting a polymerase; and the payload comprises a coding sequence. 48. The recombinant polynucleotide of embodiment 47, wherein the response element is an enhancer.49. The recombinant polynucleotide of embodiment 47 or embodiment 48, wherein binding of the cognate ligand or coactivator to the response element increases transcription of the payload in the target cell type, cell state, or tissue. 50. The recombinant polynucleotide of embodiment 47, wherein binding of the corepressor to the response element reduces transcription of the payload in a non-target cell type, cell state, or tissue. 51. The recombinant polynucleotide of any one of embodiments 47-50, wherein the response element confers neuron-specific transcription of the payload. 52. The recombinant polynucleotide of any one of embodiments 47-50, wherein the response element confers muscle-specific transcription of the payload. 53. The recombinant polynucleotide of any one of embodiments 47-50, wherein the response element confers kidney-specific transcription of the payload. 54. The recombinant polynucleotide of any one of embodiments 47-53, wherein the payload encodes a protein. 55. The recombinant polynucleotide of embodiment 54, wherein the protein is a neuronal protein, a renal protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 56. The recombinant polynucleotide of embodiment 54 or embodiment 55, wherein the protein is associated with a genetic disorder, a neurological disorder, a kidney disorder, an eye disorder, a muscle disorder, or cancer. 57. The recombinant polynucleotide of any one of embodiments 54 to 56, wherein the protein is progranulin, MeCP2, polycystin-1, or polycystin-2. 58. The recombinant polynucleotide of any one of embodiments 47 to 53, wherein the payload encodes a therapeutic polynucleotide. 59. The recombinant polynucleotide of embodiment 58, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. 60. The recombinant polynucleotide of embodiment 58 or embodiment 59, wherein said therapeutic polynucleotide targets a gene. 61. The recombinant polynucleotide of embodiment 60, wherein said gene is associated with a genetic disorder, a neurological disorder, a kidney disorder, an eye disorder, a muscle disorder, or cancer. 62. The recombinant polynucleotide of embodiment 60 or embodiment 61, wherein said gene is GRN, MECP2, PKD2, or PKD2. 63. An engineered viral vector comprising the recombinant polynucleotide of any one of embodiments 47 to 62 in the viral vector. 64. The engineered viral vector of embodiment 63, wherein said viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. 65. The adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, and AAV.rh 10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.4 5, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AA 65. The engineered viral vector of embodiment 64, selected from the group consisting of V.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, and combinations thereof.66. A pharmaceutical composition comprising a recombinant polynucleotide according to any one of embodiments 47-62 or a viral vector according to any one of embodiments 63-65 and a pharma- ceutically acceptable carrier. 67. A method for expressing a payload in a target cell of a subject, comprising administering to the subject a recombinant polynucleotide according to any one of embodiments 47-62, a viral vector according to any one of embodiments 63-65 or a pharmaceutical composition according to embodiment 66; binding a cognate ligand, coactivator or corepressor to the response element of the recombinant polynucleotide, where the cognate ligand or coactivator is specific for the target cell or the corepressor is specific for a non-target cell; initiating transcription of the payload by recruiting a polymerase to the core promoter sequence; transcribing the payload, thereby expressing the payload in the target cell. 68. The method according to embodiment 67, comprising expressing the payload at a higher level in a cell type of interest than in the non-target cell. 69. The method of embodiment 67 or embodiment 68, comprising initiating transcription at a higher rate in the cell type of interest than in the non-target cells. 70. The method of any one of embodiments 67-69, wherein the cognate ligand or the coactivator is present at a higher level in the target cell than in the non-target cell. 71. The method of any one of embodiments 67-70, wherein the cognate ligand is a transcription factor. 72. The method of any one of embodiments 67-69, wherein the cognate ligand is present at a higher level in the non-target cell than in the target cell. 73. The method of any one of embodiments 67-72, wherein the target cell is a target cell state and the non-target cell is a non-target cell state. 74. The method of embodiment 73, wherein the target cell state is a diseased cell. 75. The method of embodiment 73 or embodiment 74, wherein the non-target cell state is a healthy cell. 76. The method of any one of embodiments 67-71, wherein the target cell is a target cell type and the non-target cell is a non-target cell type. 77. The method of embodiment 76, wherein the target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a stromal cell, an adipocyte, or a fibroblast. 78. The method of embodiment 76 or embodiment 77, wherein the non-target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a stromal cell, an adipocyte, a fibroblast, or a combination thereof. 79. A method for treating a disorder in a subject in need of such treatment, comprising administering to the subject a composition comprising a recombinant polynucleotide described in any one of embodiments 47-62, a viral vector described in any one of embodiments 63-65, or a pharmaceutical composition described in embodiment 66; and expressing a therapeutic sequence encoded by the payload of the recombinant polynucleotide in target cells of the subject, thereby treating the disorder. 80. The method of embodiment 79, wherein the target cell is a cell type associated with the disorder. 81. The method of embodiment 79, wherein the target cell is a cellular state associated with the disorder. 82. The method of any one of embodiments 79-81, wherein the disorder is a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscular disorder, or cancer. 83. The method of any one of embodiments 79-82, wherein the disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic-predominant age-related TDP-43 encephalopathy, or polycystic kidney disease. 84. The method of any one of embodiments 79-83, wherein the disorder is any one of the disorders provided in Table 5. 85. The method of any one of embodiments 79-84, wherein the therapeutic sequence encodes a therapeutic protein. 86. The method of embodiment 85, wherein the therapeutic protein is a neuronal protein, a renal protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 87. The method of embodiment 85 or embodiment 86, wherein the therapeutic protein is associated with a genetic disorder, a neuronal disorder, a renal disorder, an ocular disorder, a muscle disorder, or cancer. 88. The method of any one of embodiments 85-87, wherein the therapeutic protein is MECP2, progranulin, polycystin-1, or polycystin-2. 89. The method of any one of embodiments 85-88, wherein the therapeutic protein is encoded by a gene provided in Table 5. 90. The method of any one of embodiments 79 to 84, wherein the payload encodes a therapeutic polynucleotide. 91. The method of embodiment 90, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. 92. The method of embodiment 90 or embodiment 91, wherein the therapeutic polynucleotide targets the gene provided in Table 5. 93. A method for identifying a switchable core promoter, comprising: introducing a core promoter library, comprising a first sub-library and a second sub-library, into a cell population; wherein the first sub-library comprises a plurality of core promoter sequences, one of the plurality of core promoter sequences being linked to a first enhancer sequence and a unique barcode sequence; wherein the second sub-library comprises a plurality of core promoter sequences, one of the plurality of core promoter sequences being linked to a second enhancer sequence and a unique barcode sequence; and identifying a switchable core promoter as a core promoter sequence that promotes higher transcription of the unique barcode when paired with the first enhancer sequence than when paired with the second enhancer sequence. 94. The method of embodiment 93, further comprising activating the first enhancer sequence. 95. The method of embodiment 93 or embodiment 94, wherein the second enhancer sequence is not activated. 96. The method of any one of embodiments 93-95, wherein the first enhancer sequence is an active enhancer and the second enhancer sequence is an inactive enhancer. 97. The method of any one of embodiments 93-96, wherein the first enhancer sequence is specific for the cell population. 98. The method of any one of embodiments 93-97, wherein the cell population is a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. 99. The method of any one of embodiments 93-98, wherein the first enhancer sequence is specific for a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. 100. The method of any one of embodiments 93-99, wherein the second enhancer sequence is specific for a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. 101. The method of any one of embodiments 93-100, wherein the multiple core promoter sequences comprise an engineered core promoter sequence, a synthetic core promoter sequence, a wild-type core promoter sequence, a variant core promoter sequence, or a combination thereof.

[0246] Further Numbered Embodiments The following embodiments list non-limiting permutations of combinations of features disclosed herein. Other permutations of combinations of features are also contemplated. In particular, each of these numbered embodiments is contemplated as dependent or related to every preceding or succeeding numbered embodiment, regardless of the order listed. 1. A TATA box, an initiator element, a spacer separating the TATA box and the initiator element, and a) the TATA box comprising a sequence having at least 85% sequence identity to any one of SEQ ID NO: 199 to SEQ ID NO: 201 or SEQ ID NO: 213 to SEQ ID NO: 215; b) the initiator element comprising a sequence having at least 75% sequence identity to any one of SEQ ID NO: 202 to SEQ ID NO: 204, SEQ ID NO: 216, or SEQ ID NO: 217; c) the spacer being a short spacer comprising 25 or more and 29 or less nucleotide residues from the TATA box to the initiator element; d) the spacer 1) a YY1 motif comprises a long spacer comprising 31 to 48 nucleotide residues from the TATA box to the initiator element; e) a YY1 motif comprises a sequence having at least 80% sequence identity to any one of SEQ ID NO:205 to SEQ ID NO:207; f) a transcriptional pause site comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:196 to SEQ ID NO:198, SEQ ID NO:211, or SEQ ID NO:212; g) at least 70% sequence identity and at least one nucleotide substitution compared to SEQ ID NO:5, SEQ ID NO:9, or SEQ ID NO:210; and h) one or more features selected from combinations thereof. 2. The engineered core promoter of embodiment 1 comprising at least 70% sequence identity and nucleotide substitutions T15G and A40C compared to SEQ ID NO:5. 3. The engineered core promoter of embodiment 1 comprising at least 70% sequence identity and nucleotide substitutions T15A and A40T compared to SEQ ID NO:5. 4. The engineered core promoter of any one of embodiments 1 to 3, wherein the spacer comprises 29 to 31 nucleotides from the TATA box to the initiator element. 5. The engineered core promoter of any one of embodiments 1 to 4, wherein the spacer comprises 30 nucleotides from the TATA box to the initiator element.6. The engineered core promoter of any one of embodiments 1-3, wherein the short spacer comprises 28 nucleotide residues from the TATA box to the initiator element. 7. The engineered core promoter of any one of embodiments 1-3, wherein the long spacer comprises 32 nucleotide residues from the TATA box to the initiator element. 8. The engineered core promoter of any one of embodiments 1-7, wherein the TATA box comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:199 to SEQ ID NO:201 or SEQ ID NO:213 to SEQ ID NO:215. 9. The engineered core promoter of any one of embodiments 1-8, wherein the TATA box comprises any one of SEQ ID NO:199 to SEQ ID NO:201 or SEQ ID NO:213 to SEQ ID NO:215. 10. The engineered core promoter of any one of embodiments 1-9, wherein the initiator element comprises a sequence having at least 85% sequence identity to any one of SEQ ID NO:202 to SEQ ID NO:204, SEQ ID NO:216, or SEQ ID NO:217. 11. The engineered core promoter of any one of embodiments 1-10, wherein the initiator element comprises a sequence of any one of SEQ ID NO:202 to SEQ ID NO:204, SEQ ID NO:216, or SEQ ID NO:217. 12. The engineered core promoter of any one of embodiments 1-11, wherein the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:205 to SEQ ID NO:207. 13. The engineered core promoter of any one of embodiments 1-12, wherein the YY1 motif comprises a sequence of any one of SEQ ID NO:205 to SEQ ID NO:207. 14. The engineered core promoter according to any one of embodiments 1-11, wherein the transcriptional pausing site comprises a sequence having at least 95% sequence identity to any one of SEQ ID NO:196 to SEQ ID NO:198, SEQ ID NO:211, or SEQ ID NO:212. 15. The engineered core promoter according to any one of embodiments 1-11, wherein the transcriptional pausing site comprises a sequence of any one of SEQ ID NO:196 to SEQ ID NO:198, SEQ ID NO:211, or SEQ ID NO:212. 16. The engineered core promoter according to any one of embodiments 1-15, wherein the engineered core promoter comprises two or more of the features. 17. The engineered core promoter according to any one of embodiments 1-16, wherein the engineered core promoter comprises features a) and b). 18. The engineered core promoter according to any one of embodiments 1-17, wherein the engineered core promoter comprises three or more of the features. 19. The engineered core promoter of any one of the preceding embodiments, wherein said engineered core promoter comprises features a) and b) and at least one more of the features. 20. The engineered core promoter according to any one of the preceding embodiments, wherein the engineered core promoter comprises features a), b), and c). 21. The engineered core promoter according to any one of the preceding embodiments, wherein the engineered core promoter comprises features a), b), and d). 22. The engineered core promoter according to any one of the preceding embodiments, wherein the engineered core promoter comprises features a), b), and e). 23. The engineered core promoter according to any one of the preceding embodiments, wherein the engineered core promoter comprises features a), b), and f). 24. An engineered core promoter comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO:1 to SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10 to SEQ ID NO:144. 25. The engineered core promoter of embodiment 24, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:1 to SEQ ID NO:4, SEQ ID NO:7, or SEQ ID NO:10 to SEQ ID NO:144. 26. The engineered core promoter of embodiment 23, wherein the engineered core promoter comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO:1 to SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10 to SEQ ID NO:15, or SEQ ID NO:110. 27. The engineered core promoter of embodiment 26, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:1 to SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10 to SEQ ID NO:15, or SEQ ID NO:110. 28. The engineered core promoter according to any one of embodiments 23 to 27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 7. 29. The engineered core promoter according to any one of embodiments 23 to 27, wherein said engineered core promoter comprises the sequence of SEQ ID NO: 7. 30. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 1. 31. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence of SEQ ID NO: 1. 32. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 2. 33. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence of SEQ ID NO: 2. 34. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 3. 35. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence of SEQ ID NO: 3. 36. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 4 and comprising the nucleotide substitutions T15G and A40T compared to SEQ ID NO: 5. 37. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises the sequence of SEQ ID NO: 4. 38. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 10. 39. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises the sequence of SEQ ID NO: 10. 40. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 11. 41. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence of SEQ ID NO: 11. 42. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 12. 43. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence of SEQ ID NO: 12. 44. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 13. 45. The engineered core promoter according to any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence of SEQ ID NO: 13. 46. ​​The engineered core promoter according to any one of embodiments 23 to 27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 14. 47. The engineered core promoter according to any one of embodiments 23 to 27, wherein said engineered core promoter comprises the sequence of SEQ ID NO: 14. 48. The engineered core promoter according to any one of embodiments 23 to 27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 15, comprising the nucleotide substitutions T15G and A40C compared to SEQ ID NO: 5. 49. The engineered core promoter according to any one of embodiments 23 to 27, wherein said engineered core promoter comprises the sequence of SEQ ID NO: 15. 50. The engineered core promoter of any one of embodiments 23-27, wherein said engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO: 110. 51. The engineered core promoter of any one of embodiments 23-27, wherein said engineered core promoter comprises the sequence of SEQ ID NO: 110. 52. The engineered core promoter of any one of embodiments 1-51, wherein said engineered core promoter comprises a TATA box, an RNA polymerase binding sequence, a B recognition element, a CCAAT box, or a Pribnow sequence. 53. The engineered core promoter of any one of embodiments 1-52, wherein said engineered core promoter is capable of recruiting a polymerase. 54. The engineered core promoter of embodiment 53, wherein said polymerase is RNA polymerase II. 55. The engineered core promoter of any one of embodiments 1-54, wherein said engineered core promoter has a dynamic range higher than the dynamic range of SEQ ID NO: 6. 56. The engineered core promoter according to any one of the preceding embodiments, wherein said engineered core promoter has a dynamic range higher than that of SEQ ID NO: 9. 57. The engineered core promoter according to any one of the preceding embodiments, wherein said engineered core promoter has an activity higher than that of SEQ ID NO: 6. 58. The engineered core promoter according to any one of the preceding embodiments, wherein said engineered core promoter has an activity higher than that of SEQ ID NO: 9. 59. The engineered core promoter according to any one of the preceding embodiments, wherein the transcriptional activity produced by said engineered core promoter paired with an activated response element is higher than the transcriptional activity produced by the core promoter of SEQ ID NO: 6 when paired with said activated response element, or the basal transcriptional activity produced by said engineered core promoter paired with an activated response element is lower than the basal transcriptional activity produced by the core promoter of SEQ ID NO: 6 when paired with an inactive response element, or both. 60. The engineered core promoter of any one of the preceding embodiments, wherein the transcriptional activity produced by said engineered core promoter paired with an activated response element is higher than the transcriptional activity produced by the core promoter of SEQ ID NO: 9 when paired with said activated response element, or the basal transcriptional activity produced by said engineered core promoter paired with an activated response element is lower than the basal transcriptional activity produced by the core promoter of SEQ ID NO: 9 when paired with an inactive response element, or both. 61. An engineered response element comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 146. 62. The engineered response element of embodiment 61, wherein said engineered response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 146. 63. The engineered response element of embodiment 61 or embodiment 62, wherein said engineered response element comprises the sequence of SEQ ID NO: 145 or SEQ ID NO: 146. 64. The engineered response element of any one of embodiments 61 to 63, wherein said engineered response element is capable of binding to a cognate ligand, coactivator, or complement repressor. 65. The engineered response element of embodiment 64, wherein said engineered response element is an enhancer. 66. The engineered response element of embodiment 64 or embodiment 65, wherein binding of said cognate ligand or said coactivator to said engineered response element increases transcription of a payload under the transcriptional control of said engineered response element paired with a core promoter in a target cell type, target cell state, or target tissue. 67. The engineered response element of embodiment 64, wherein binding of said corepressor to said engineered response element decreases transcription of a payload under the transcriptional control of said engineered response element paired with a core promoter in a non-target cell type, non-target cell state, or non-target tissue.68. The engineered response element of any one of embodiments 61 to 67, wherein said engineered response element confers myeloid-specific transcription of a payload under the transcriptional control of said engineered response element paired with a core promoter. 69. The engineered response element of embodiment 68, comprising the sequence of SEQ ID NO: 145. 70. The engineered response element of any one of embodiments 61-67, wherein the engineered response element confers liver-specific transcription of a payload under the transcriptional control of the engineered response element paired with a core promoter. 71. The engineered response element of embodiment 70, comprising the sequence of SEQ ID NO: 146. 72. An engineered promoter comprising a response element and a core promoter, wherein the response element comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194, and the core promoter comprises a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 1-SEQ ID NO: 144 or SEQ ID NO: 210. 73. The engineered promoter of embodiment 72, wherein the core promoter comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:1 to SEQ ID NO:144 or SEQ ID NO:210. 74. The engineered promoter of embodiment 72 or embodiment 73, wherein the core promoter comprises a sequence of SEQ ID NO:1 to SEQ ID NO:144 or SEQ ID NO:210. 75. The engineered promoter of any one of embodiments 72 to 74, wherein the engineered promoter comprises a sequence of any one of SEQ ID NO:148 to SEQ ID NO:177 or SEQ ID NO:218 to SEQ ID NO:255. 76. An engineered promoter comprising a response element and the engineered core promoter of any one of embodiments 1 to 60. 77. The engineered promoter of any one of embodiments 72 to 76, wherein the response element is capable of binding to a cognate ligand, a coactivator, or a repressor. 78. The engineered promoter of embodiment 77, wherein the response element is an enhancer.79. The engineered promoter of embodiment 77 or embodiment 78, wherein binding of the cognate ligand or coactivator to the response element increases transcription of a payload under the transcriptional control of the engineered promoter in a target cell type, target cell state, or target tissue. 80. The engineered promoter of embodiment 77, wherein binding of the corepressor to the response element reduces transcription of a payload under the transcriptional control of the engineered promoter in a non-target cell type, non-target cell state, or non-target tissue. 81. The engineered promoter of any one of embodiments 72-80, wherein the response element confers bone marrow-specific transcription of a payload under the transcriptional control of the engineered promoter. 82. The engineered promoter of embodiment 81, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 193. 83. The engineered promoter of embodiment 81 or embodiment 82, wherein the response element comprises the sequence of SEQ ID NO: 145 or SEQ ID NO: 193. 84. The engineered promoter of any one of embodiments 72-80, wherein the response element confers liver-specific transcription of a payload under the transcriptional control of the engineered promoter. 85. The engineered promoter of embodiment 84, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 146 or SEQ ID NO: 194. 86. The engineered promoter of embodiment 84 or embodiment 85, wherein the response element comprises a sequence of SEQ ID NO: 146 or SEQ ID NO: 194. 87. The engineered promoter of any one of embodiments 72-80, wherein the response element confers neuron-specific transcription of a payload under the transcriptional control of the engineered promoter. 88. The engineered promoter of any one of embodiments 72-80, wherein the response element confers muscle-specific transcription of a payload under the transcriptional control of the engineered promoter. 89. The engineered promoter of any one of embodiments 72-80, wherein the response element confers kidney-specific transcription of a payload under the transcriptional control of the engineered promoter. 90. A recombinant polynucleotide comprising an engineered core promoter according to any one of embodiments 1 to 60 and a payload comprising a coding sequence under the transcriptional control of said engineered core promoter. 91. A recombinant polynucleotide comprising a response element comprising a sequence having at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194, and a payload comprising a coding sequence under the transcriptional control of said response element. 92. The recombinant polynucleotide according to embodiment 91, wherein said response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. 93. The recombinant polynucleotide according to embodiment 91 or embodiment 92, wherein said response element comprises a sequence of SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194. 94. A recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises a response element capable of binding to a cognate ligand, coactivator, or corepressor; and an engineered core promoter according to any one of embodiments 1 to 60 capable of recruiting a polymerase; and the payload comprises a coding sequence under the transcriptional control of the promoter. 95. The recombinant polynucleotide according to embodiment 94, wherein the response element is an enhancer. 96. The recombinant polynucleotide according to embodiment 94 or embodiment 95, wherein binding of the cognate ligand or the coactivator to the response element increases transcription of the payload in a target cell type, cell state, or tissue. 97. The recombinant polynucleotide according to embodiment 94, wherein binding of the corepressor to the response element decreases transcription of the payload in a non-target cell type, cell state, or tissue. 98. The recombinant polynucleotide of any one of embodiments 94 to 97, wherein the response element confers neuron-specific transcription of the payload.99. The recombinant polynucleotide of any one of embodiments 94 to 97, wherein the response element confers bone marrow-specific transcription of the payload. 100. The recombinant polynucleotide according to embodiment 99, wherein said response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 145 or SEQ ID NO: 193. 101. The recombinant polynucleotide according to embodiment 99 or embodiment 11, wherein said response element comprises a sequence of SEQ ID NO: 145 or SEQ ID NO: 193. 102. The recombinant polynucleotide according to any one of embodiments 94 to 97, wherein said response element confers liver-specific transcription of said payload. 103. The recombinant polynucleotide according to embodiment 102, wherein said response element comprises a sequence having at least 90% sequence identity to SEQ ID NO: 146 or SEQ ID NO: 194. 104. The recombinant polynucleotide according to embodiment 102 or embodiment 103, wherein said response element comprises a sequence of SEQ ID NO: 146 or SEQ ID NO: 194. 105. The recombinant polynucleotide according to any one of embodiments 94 to 97, wherein said response element confers muscle-specific transcription of said payload. 106. The recombinant polynucleotide of any one of embodiments 94-97, wherein the response element confers kidney-specific transcription of the payload. 107. A recombinant polynucleotide comprising a promoter and a payload, wherein the promoter comprises a response element capable of binding to a cognate ligand, coactivator, or corepressor, the response element comprising a sequence having at least 90% sequence identity to SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 193, or SEQ ID NO: 194; and an engineered core promoter capable of recruiting a polymerase; and the payload comprises a coding sequence under the transcriptional control of the promoter. 108. The recombinant polynucleotide of any one of embodiments 90-107, wherein the payload encodes a protein. 109. The recombinant polynucleotide of embodiment 108, wherein the protein is a neuronal protein, a renal protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 110. The recombinant polynucleotide of embodiment 108 or embodiment 109, wherein the protein is associated with a genetic disorder, a neurological disorder, a kidney disorder, an eye disorder, a muscle disorder, or cancer. 111. The recombinant polynucleotide of any one of embodiments 108-110, wherein the protein is progranulin, MeCP2, polycystin-1, or polycystin-2. 112. The recombinant polynucleotide of any one of embodiments 90-107, wherein the payload encodes a therapeutic polynucleotide. 113. The recombinant polynucleotide of embodiment 112, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. 114. The recombinant polynucleotide of embodiment 112 or embodiment 113, wherein the therapeutic polynucleotide targets a gene. 115. The recombinant polynucleotide of embodiment 114, wherein the gene is associated with a genetic disorder, a neurological disorder, a kidney disorder, an eye disorder, a muscle disorder, or cancer. 116. A recombinant polynucleotide according to embodiment 114 or embodiment 115, wherein said gene is GRN, MECP2, PKD2, or PKD2. 117. An engineered viral vector comprising in the viral vector an engineered core promoter according to any one of embodiments 1 to 60. 118. An engineered viral vector comprising in the viral vector an engineered response element according to any one of embodiments 61 to 71. 119. An engineered viral vector comprising in the viral vector an engineered core promoter according to any one of embodiments 72 to 89. 120. An engineered viral vector comprising a recombinant polynucleotide according to any one of embodiments 90 to 116 in a viral vector. 121. An engineered viral vector according to any one of embodiments 117 to 120, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. 122. The adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh 10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.4 5, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AAV.PhP.V1, AA The engineered viral vector of embodiment 121 is selected from the group consisting of V.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, and combinations thereof. 123. A cell comprising an engineered core promoter according to any one of embodiments 1 to 60. 124. A cell comprising an engineered response element according to any one of embodiments 61 to 71. 125. A cell comprising an engineered promoter according to any one of embodiments 72 to 89. 126. A cell comprising a recombinant polynucleotide according to any one of embodiments 90 to 116. 127. A cell comprising an engineered viral vector according to any one of embodiments 117 to 122.128. The cell according to any one of embodiments 123-127, wherein said cell is a target cell. 129. The cell according to any one of embodiments 123-128, wherein said cell is a diseased cell. 130. A cell according to any one of embodiments 123-129, wherein the cell is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a hepatocyte, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a stromal cell, an adipocyte, or a fibroblast. 131. A pharmaceutical composition comprising an engineered core promoter according to any one of embodiments 1-60 and a pharma- ceutically acceptable carrier. 132. A pharmaceutical composition comprising an engineered response element according to any one of embodiments 61-71 and a pharma- ceutically acceptable carrier. 133. A pharmaceutical composition comprising an engineered promoter according to any one of embodiments 72-89 and a pharma- ceutically acceptable carrier. 134. A pharmaceutical composition comprising a recombinant polynucleotide according to any one of embodiments 90-116 and a pharma- ceutically acceptable carrier. 135. A pharmaceutical composition comprising an engineered viral vector according to any one of embodiments 117-122 and a pharma- ceutically acceptable carrier. 136. A method for expressing a payload in a target cell of a subject, comprising administering to the subject a recombinant polynucleotide according to any one of embodiments 90-116, a viral vector according to any one of embodiments 117-122, or a pharmaceutical composition according to embodiment 134 or embodiment 135; binding a cognate ligand, coactivator, or corepressor to the response element of the recombinant polynucleotide, where the cognate ligand or the coactivator is specific for the target cell or the corepressor is specific for a non-target cell; initiating transcription of the payload by recruiting a polymerase to the core promoter; transcribing the payload, thereby expressing the payload in the target cell. 137. The method according to embodiment 136, comprising expressing the payload at a higher level in the target cell than in the non-target cell. 138. The method according to embodiment 136 or embodiment 137, comprising initiating transcription at a higher rate in the target cell than in the non-target cell.139. The method of any one of embodiments 136-138, wherein the cognate ligand or coactivator is present at a higher level in the target cells than in the non-target cells. 140. The method of any one of embodiments 136-139, wherein the cognate ligand is a transcription factor. 141. The method of any one of embodiments 136-140, wherein the corepressor is present at a higher level in the non-target cells than in the target cells. 142. The method of any one of embodiments 136-141, wherein the target cells are a target cell state and the non-target cells are a non-target cell state. 143. The method of embodiment 142, wherein the target cell state is a diseased cell. 144. The method of embodiment 142 or embodiment 143, wherein the non-target cell state is a healthy cell. 145. The method of any one of embodiments 136-140, wherein the target cells are a target cell type and the non-target cells are a non-target cell type. 146. The method of embodiment 145, wherein the target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a stromal cell, an adipocyte, or a fibroblast. 147. The method of embodiment 145 or embodiment 146, wherein the non-target cell type is a central nervous system cell, a neuron, a kidney cell, a retinal cell, a liver cell, an epithelial cell, a muscle cell, an erythrocyte, a platelet, a bone marrow cell, an endothelial cell, an epidermal cell, a lymphocyte, a glial cell, a stromal cell, an adipocyte, a fibroblast, or a combination thereof. 148. A method for treating a disorder in a subject in need of such treatment, comprising administering to the subject a composition comprising a recombinant polynucleotide according to any one of embodiments 90-116, a viral vector according to any one of embodiments 117-122, or a pharmaceutical composition according to embodiment 134 or embodiment 135; and expressing a therapeutic sequence encoded by the payload of the recombinant polynucleotide in a target cell of the subject, thereby treating the disorder. 149. The method according to embodiment 148, wherein the target cell is a cell type associated with the disorder. 150. The method of embodiment 148, wherein the target cell is a cellular state associated with the disorder. 151. The method of any one of embodiments 148-150, wherein the disorder is a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscular disorder, or cancer. 152. The method of any one of embodiments 148-151, wherein the disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic-predominant age-related TDP-43 encephalopathy, or polycystic kidney disease. 153. The method of any one of embodiments 148-152, wherein the disorder is any one of the disorders provided in Table 5. 154. The method of any one of embodiments 148-153, wherein the therapeutic sequence encodes a therapeutic protein. 155. The method of embodiment 154, wherein the therapeutic protein is a neuronal protein, a renal protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein. 156. The method of embodiment 154 or embodiment 155, wherein the therapeutic protein is associated with a genetic disorder, a neuronal disorder, a renal disorder, an ocular disorder, a muscle disorder, or cancer. 157. The method of any one of embodiments 154-156, wherein the therapeutic protein is MECP2, progranulin, polycystin-1, or polycystin-2. 158. The method of any one of embodiments 154-157, wherein the therapeutic protein is encoded by a gene provided in Table 5. 159. The method of any one of embodiments 148-158, wherein the payload encodes a therapeutic polynucleotide. 160. The method of embodiment 159, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA. 161. The method of embodiment 159 or embodiment 160, wherein the therapeutic polynucleotide targets the gene provided in Table 5. 162. A method of identifying a switchable core promoter, comprising: introducing a core promoter library comprising a first sub-library and a second sub-library into a cell population; wherein the first sub-library comprises a plurality of core promoters, one core promoter of the plurality of core promoters is linked to a first response element and a unique barcode sequence; wherein the second sub-library comprises a plurality of core promoters, the core promoter of the plurality of promoters is linked to a second response element and a unique barcode sequence; and identifying a switchable core promoter as a core promoter that promotes higher transcription of the unique barcode when paired with the first response element than when paired with the second response element. 163. The method of embodiment 162, further comprising activating the first response element. 164. The method of embodiment 162 or embodiment 163, wherein the second response element is not activated. 165. The method of any one of embodiments 162-164, wherein the first response element is an activated response element and the second enhancer sequence is an inactive or non-activated response element. 166. The method of any one of embodiments 162-165, wherein the first response element is specific for the cell population. 167. The method of any one of embodiments 162-166, wherein the cell population is a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. 168. The method of any one of embodiments 162-167, wherein the first response element is specific for a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. 169. The method of any one of embodiments 162-168, wherein the second response element is specific for a neuron, a kidney cell, a liver cell, a muscle cell, or a cancer cell. 170. The method of any one of embodiments 162-169, wherein the plurality of core promoters comprises engineered core promoters, synthetic core promoters, wild-type core promoters, variant core promoters, or combinations thereof. 171. A recombinant polynucleotide of any one of embodiments 90-116, a viral vector of any one of embodiments 117-122, or a pharmaceutical composition of embodiment 134 or embodiment 135, for use in a method of treating a disorder, the method comprising administering to a subject a composition comprising the recombinant polynucleotide, viral vector, or pharmaceutical composition, and expressing in a target cell of the subject a therapeutic sequence encoded by the payload of the recombinant polynucleotide. 172. A recombinant polynucleotide, viral vector, or pharmaceutical composition for use according to embodiment 171, wherein the disorder to be treated is a genetic disorder, a neurological disorder, a renal disorder, an ocular disorder, a muscular disorder, or cancer. 173. The recombinant polynucleotide, viral vector, or pharmaceutical composition for use according to any one of embodiments 171-172, wherein the disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic-predominant age-related TDP-43 encephalopathy, or polycystic kidney disease. 174. The recombinant polynucleotide, viral vector, or pharmaceutical composition for use according to any one of embodiments 171-173, wherein the disorder is any one of the disorders provided in Table 5. EXAMPLES

[0247] The present invention is further illustrated by the following non-limiting examples.

[0248] Example 1: Massively parallel reporter assay screening for switchable core promoters This example describes a massively parallel reporter assay (MPRA) screen to identify switchable core promoters. The goal of the screen was to identify core promoters that promote high levels of transcription when paired with activated cell type-specific enhancer sequences, but exhibit low basal transcription initiation.

[0249] A library of 3,649 core promoters was designed, containing variants of existing activatable core promoter sequences and completely de novo synthetic core promoter sequences. Variants of existing core promoters were designed by mutating existing synthetic core promoters, including ybTATA (SEQ ID NO: 9) and minP (SEQ ID NO: 5) from pGL4. Synthetic core promoters were developed by randomly generating matches to the TATA and initiator elements (Inr) across a range of predicted similarity scores. The final library contained 2157 sequence variants and 1484 completely de novo synthetic sequences.

[0250] Enhancer sequences were selected and paired with core promoter library members to screen for high levels of cell state-specific transcriptional activation and low levels of basal transcriptional activation in a hepatoblast cell line (HepG2). Enhancers were selected based on cell type-specific activity in HepG2 cells and a myeloid cell line (K562). Using literature MPRA results, endogenous enhancers with cell type-specific activity were identified by comparing the activity levels of different enhancers in HepG2 cells (a hepatocellular cancer cell model) and K562 cells (a myeloid cancer cell model), as shown in Figure 1. Enhancers with HepG2-specific activity appear in the upper left region of the plot, and enhancers with K562-specific activity appear in the lower right region of the plot. Enhancers with low activity in both cell types appear in the lower left region of the plot. Three enhancers were selected for use in the core promoter library screening: an endogenous enhancer with HepG2-specific activation (SEQ ID NO: 194), an endogenous enhancer with K562-specific activation (SEQ ID NO: 193), and a negative control enhancer that showed no activation in either HepG2 or K562 cells (SEQ ID NO: 147). Additionally, synthetic enhancer sequences were designed based on a sampling of motif matches for transcription factors selected for specific expression in primary hepatoblasts or primary myeloid cells. A synthetic enhancer associated with a transcription factor highly expressed in primary fetal hepatoblasts was selected as the HepG2-specific enhancer (SEQ ID NO: 146), and a synthetic enhancer associated with a transcription factor highly expressed in primary fetal liver myeloid cells was selected as the K562-specific enhancer (SEQ ID NO: 145) for use in the core promoter screening.

[0251] Each member of the core promoter library was cloned into six different constructs containing one of each of the five different enhancer sequences identified in the enhancer screen ("HepG2 synthetic" (SEQ ID NO: 146), "K562 synthetic" (SEQ ID NO: 145), "HepG2 endogenous" (SEQ ID NO: 194), or "K562 endogenous" (SEQ ID NO: 193)), a negative control enhancer ("negative", SEQ ID NO: 147), or a random sequence without enhancer activity ("random"). The resulting constructs generated for each core promoter library member are illustrated in FIG. 2. In addition to the enhancer and core promoter sequences, each construct contained a random barcode sequence that was added during PCR prior to cloning for high-throughput sequence identification, and a reporter open reading frame ("report ORF") for expression readout. The random barcodes were associated with the enhancer:core promoter constructs via a next-generation sequencing run. Since the enhancer:core promoter itself is not transcribed, the barcode in the 5'UTR of the reporter identifies the enhancer:core promoter-driven expression in the reporter. The library complexity was sufficient to represent each of the 21,849 enhancer-core promoter constructs with a median of 20 redundant barcodes. Library members were first cloned with different enhancers and associated with barcodes separately, and then the entire pool was subcloned into the pGL4 reporter backbone.

[0252] The resulting 21,849 enhancer-promoter constructs were screened in HepG2 and K562 cell lines for cell type-specific transcription activation. As shown in Figure 3 and Figure 22B (HepG2) and Figure 22A (K562), the transcription activity of each enhancer-promoter construct was measured in HepG2 and K562 cells using a massively parallel reporter assay. All 21,849 constructs were introduced into HepG2 and K562 cell lines via transfection. The transcription activity of each construct was expressed by the ratio of RNA transcripts per million (tpm) / DNA tpm ("activity") in the amplicons collected from cells transfected with next-generation sequencing libraries prepared from RNA and DNA. As shown in Figure 17, the fold activation of each core promoter paired with the synthetic HepG2-specific enhancer of SEQ ID NO: 146 compared to the core promoter paired with the negative control enhancer of SEQ ID NO: 147 ("Hep synthetic vs negative") was compared to the fold activation of each core promoter paired with the synthetic K562-specific enhancer of SEQ ID NO: 145 compared to the core promoter paired without enhancer ("K synthetic vs no enhancer"). As shown in Figure 18, the transcriptional activity was tested in HepG2 cells for each core promoter paired with the synthetic HepG2-specific enhancer of SEQ ID NO: 146 ("HepG2 synthetic") or the synthetic K562-specific enhancer of SEQ ID NO: 145 ("K562 synthetic"). As shown in Figure 23, the transcriptional activity of each core promoter in HepG2 cells when paired with a synthetic HepG2-specific enhancer of SEQ ID NO: 146 ("HepG2 synthetic") was compared to the transcriptional activity of each core promoter in K562 cells when paired with a synthetic K562-specific enhancer of SEQ ID NO: 145 ("K562 synthetic"). As shown in Figure 24, the switching behavior was observed when comparing the activity between different cell lines of the entire 21,000 member library.The transcriptional activity of each core promoter paired with either the synthetic HepG2 specific enhancer of SEQ ID NO: 146 or the synthetic K562 specific enhancer of SEQ ID NO: 145 was compared between HepG2 and K562 cell lines. As seen in Figure 24, 21,849 designs in MPRA were segregants depending on pairing the core promoter with either the synthetic HepG2 specific enhancer of SEQ ID NO: 146 specific to HepG2 cells or the synthetic K562 specific enhancer of SEQ ID NO: 145 specific to K562 cells. The 3,000 core promoter was more active in HepG2 than in K562 when paired with the HepG2 specific enhancer (SEQ ID NO: 146). Similarly, the 3,000 core promoter showed higher activity in K562 when paired with the K562 enhancer (SEQ ID NO: 145). This is shown in Figure 24 by the cluster of points corresponding to core promoters paired with HepG2-specific enhancers that exhibit higher activity in HepG2 cells (and lower activity in K562 cells), and the cluster of points corresponding to core promoters paired with K562-specific enhancers that exhibit higher activity in K562 cells and lower activity in HepG2 cells. Core promoters paired with negative control enhancers (such as random enhancer sequences) appear in the clusters in the lower left part of the plot in Figure 24, indicating that transcriptional activity was lower in both cell lines for core promoters paired with inactive enhancers. Overall, synthetic (SEQ ID NO: 146) or endogenous (SEQ ID NO: 194) HepG2-specific enhancers promoted higher levels of transcription than the corresponding synthetic (SEQ ID NO: 145) or endogenous (SEQ ID NO: 193) K562-specific enhancers, and synthetic enhancers promoted higher levels of transcription than endogenous enhancers. Background levels of transcription were observed for both the negative control enhancer and the random sequence with no enhancer activity ("random"). As shown in Figure 4, the MPRA screen was performed with six duplicates, and activity levels correlated well between the first duplicate ("Duplicate 1") and the second duplicate ("Duplicate 2").

[0253] Orthogonal measurements of fluorescent marker expression from the dual reporter constructs assessed by flow cytometry in HepG2 cells (as shown in FIG. 5A) or K562 cells (as shown in FIG. 5D) were also performed prior to MPRA screening to verify the activity of the selected enhancers. The dual reporter constructs included an enhancer / core promoter operably linked to a sequence encoding mCherry and a CMV promoter operably linked to a sequence encoding GFP. The transcriptional activity of the core promoter was assessed with ybTATA alone inserted into the dual reporter construct ("ybTATA" alone) or when paired with a negative control enhancer (SEQ ID NO: 147), a synthetic K562-specific enhancer (SEQ ID NO: 145), an endogenous K562-specific enhancer (SEQ ID NO: 193), a synthetic HepG2-specific enhancer (SEQ ID NO: 146), or an endogenous HepG2-specific enhancer (SEQ ID NO: 194). Wild-type cells without plasmid ("WT") were used as a negative control. Transcriptional activity was measured as a function of fluorescence from mCherry under the transcriptional control of the enhancer-promoter construct. The average fold change in geometric mean of fluorescence intensity (gMFI) for each of the enhancers utilized in the dual reporter flow assay is provided in FIG. 5B for HepG2 cells and FIG. 5C for K562 cells. Measurements of enhancer activity were in good agreement between the MPRA screen and the dual reporter flow assay, although the MPRA was found to be more sensitive to small differences in activity levels.

[0254] The cell-specific activation of 3,649 core promoters in HepG2 cells was assessed by comparing the transcriptional activity of each core promoter when paired with a HepG2-specific enhancer (Hep endogenous or Hep synthetic) or a K562-specific enhancer (K ​​endogenous or K synthetic) compared to either a negative control enhancer or no enhancer. The fold activation in HepG2 cells by different synthetic enhancers (K synthetic or Hep synthetic) or a negative control enhancer compared to no enhancer is shown in FIG. 6. As seen in FIG. 6, the fold activation for each core promoter correlated well between the synthetic K562-specific enhancer and the synthetic HepG2-specific enhancer, but activation was higher overall with the HepG2-specific enhancer.

[0255] To further validate the MPRA screen, the core promoter activity was compared for core promoters with different random sequences inserted into the spacing between the TATA and Inr sequences of the core promoter. Figure 7 shows that the transcriptional activity of 1484 fully synthetic core promoters from the two libraries was similar regardless of which spacer sequence ("Background 1 with sequence SEQ ID NO: 208" or "Background 2 with sequence SEQ ID NO: 209) was used. These results indicate that the sequence of the spacer between TATA and Inr does not affect the core promoter activity, suggesting that any sequence with appropriate spacing can be used between TATA and Inr. Furthermore, the core promoter responded similarly to enhancers with different activities, as seen by the correlation in Figure 8 between the activity of the construct with the synthetic enhancer of HepG2 and the activity of the construct with the synthetic enhancer of K562.

[0256] Members of the core promoter library were evaluated based on their level of activation in HepG2 cells when paired with HepG2-specific enhancers (core promoter strength) and their relative activity levels when paired with HepG2-specific enhancers compared to those paired with either no enhancer, negative control enhancers, or different cell type-specific enhancers (core promoter dynamic range). SEQ ID NO:1-SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:10-SEQ ID NO:14, and SEQ ID NO:16-SEQ ID NO:144 were identified as the top core promoter candidates from the MPRA screen based on strength and dynamic range. Core promoters SEQ ID NO:1-SEQ ID NO:3, SEQ ID NO:7, and SEQ ID NO:10-SEQ ID NO:14 were selected for further evaluation. The switchable core promoter candidates retained the ability to act as switches with a wide dynamic range across different enhancers and different cell lines. The switchable core promoter when paired with sequence number 145 will exhibit low activity in HepG2 cells but high activity in K562 cells, and when paired with sequence number 146 will exhibit high activity in HepG2 cells but low activity in K562 cells.

[0257] Example 2: Specific activation of the core promoter This example describes specific transcriptional activation by core promoters identified in the MPRA screen described in Example 1. Specific activation of the core promoters was determined by comparing the transcriptional activation of each core promoter when paired with an active cell type specific enhancer compared to the transcriptional activation when paired with an inactive enhancer (SEQ ID NO: 147; GCCACTGCACTCCGTGCTGGGCAACTGAGTGAGACCCCATCTCAAAAACTCAAAAAAGAGTTAAAATAAATCACTGTCTATTGTGCCAAAGAGCTGTTGAAGTCATCATTCTTAGAAGAATAGACAGATGGTATTTCAAGGCTT) or a random sequence without enhancer activity (SEQ ID NO: 195; AAAACGACGGCCAGTGAATTGACGCGTATTGGGATGGAACGGCCTCCACGGCCACTAGT).Active enhancers were selected from the synthetic K562 cell type specific enhancer (SEQ ID NO: 145; TGCTATTTTTAGCGGGCTTTTTTTGACGGGAGGAAGGAAGGAGGGAGGGACGGGAAGTAAAGAGAAAAAGAGGAAGTGAAAGCTAAGAAGGAAGTGACGGCTGGCGGGGACAGATAAGAGTTGTCTAGTTGTGATAATGGAACTGCTGAGTCATGGATTGCAGAGTCAC), the synthetic HepG2 cell type specific enhancer (SEQ ID NO: 146; GGTTAATGATTAACCGTGTAAATAATTAGCGGATCACGTGATGGTCACGTGTTGGTTCAAGGCCAGAGTCAAGGTCGGGAGTCCAAAGTCCAGAAGTGCAAGGTCCGGTGTTTACTTTGGG TGTTTACCTTCC), the endogenous K562 cell type specific enhancer (SEQ ID NO: 193; GGTTAATGATTAACCGTGTAAATAATTAGCGGATCACGTGATGGTCACGTGTTGGTTCAAGGCCAGAGTCAAGGTCGGGAGTCCAAAGTCCAGAAGTGCAAGGTCCGGTGTTTACTTTGGGTGTTTACCTTCC), or the endogenous HepG2 cell type specific enhancer (SEQ ID NO: 194; AGAAACACGGCACAGATGACGGCTTTAAAAGAAAAGAGTCCATTGACTGGAAAAGCAAACAGTATGATGGTCAAAGGCCAAGAATCAGAAAACAGAGATTTTTCCTCTTCTCTTGTTTCACAAAGTAAACATGAGACATAT).

[0258] Core promoter expression constructs were generated by splicing together an enhancer (e.g., any one of SEQ ID NO:145-SEQ ID NO:147, SEQ ID NO:193, SEQ ID NO:194, or a random sequence with no enhancer activity) and a core promoter (e.g., any one of SEQ ID NO:1-SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:10-SEQ ID NO:13, and SEQ ID NO:16-SEQ ID NO:144) such that the construct sequence comprises, 5' to 3', the enhancer followed by the core promoter. Transcriptional activation for each of the enhancer / promoter constructs was measured in HepG2 cells and fold activation was determined by dividing the measurement of transcriptional activation when paired with an active enhancer by the transcriptional activation when paired with an inactive enhancer or no enhancer.

[0259] Fold activation by selected core promoters identified from the MPRA screen (SEQ ID NO:1 to SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:10 to SEQ ID NO:13, and SEQ ID NO:16 to SEQ ID NO:144) is provided in Table 6. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5]

[0260] As shown in Table 6, the fold activation of transcription was higher with the HepG2 cell type specific enhancer in HepG2 cells than with the K562 cell type specific enhancer in HepG2 cells, suggesting that the identified core promoters selectively initiated transcription in the presence of a given cell type specific enhancer while exhibiting low transcription activation in the presence of specific enhancers for other cell types.

[0261] Example 3: Further analysis of specific activation by the core promoter This example describes further analysis of specific transcriptional activation by the core promoters identified using the MPRA screening method described in Example 1.

[0262] Specific activation of selected core promoters (SEQ ID NO:1-SEQ ID NO:15) was determined by comparing the transcriptional activation of each core promoter when paired with an active cell type specific enhancer compared to the transcriptional activation when paired with an inactive enhancer (SEQ ID NO:147) or no enhancer (SEQ ID NO:195). Active enhancers were selected from synthetic K562 cell type specific enhancer (SEQ ID NO:145), synthetic HepG2 cell type specific enhancer (SEQ ID NO:146), endogenous K562 cell type specific enhancer (SEQ ID NO:193), or endogenous HepG2 cell type specific enhancer (SEQ ID NO:194). Core promoter SEQ ID NO:8 (GGGTACGCCCCTTTTTATGCGCGTGATTACTGCACAGGAATTGG), corresponding to a core promoter exhibiting low transcriptional activation, was included as a negative control.

[0263] Core promoter expression constructs were generated by splicing together an enhancer (e.g., any one of SEQ ID NO:145-SEQ ID NO:147, SEQ ID NO:193, SEQ ID NO:194, or a random sequence without enhancer activity) and a core promoter (e.g., any one of SEQ ID NO:1-SEQ ID NO:15) such that the construct sequence comprises, from 5' to 3', the enhancer followed by the core promoter. The sequences of selected enhancers + core promoters that were assayed are provided in Table 7. [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5] [Table 7-6] [Table 7-7] [Table 7-8]

[0264] Transcriptional activation for each of the enhancer / promoter constructs was measured in HepG2 cells and the fold activation was determined by dividing the measurement of transcriptional activation when paired with an active enhancer by the transcriptional activation when paired with an inactive enhancer or a random sequence with no enhancer activity (no enhancer).

[0265] Fold activation by selected core promoters (SEQ ID NO:1 to SEQ ID NO:15) is provided in Table 8. [Table 8]

[0266] As shown in Table 8, the fold activation of transcription was higher with the HepG2 cell type specific enhancer in HepG2 cells than with the K562 cell type specific enhancer in HepG2 cells, suggesting that the identified core promoters selectively initiated transcription in the presence of a given cell type specific enhancer while exhibiting low transcription activation in the presence of specific enhancers for other cell types.

[0267] Example 4: Effect of spacing between TATA and Inr on transcriptional activation This example describes the effect of spacing between TATA and Inr in the core promoter on transcriptional activation. Transcriptional activation of core promoters with short spacing (corresponding to a deletion of two bases between TATA and Inr) or longer spacing (corresponding to the standard 30 nucleotide spacing from TATA to Inr) is compared, where the number of nucleotide residues from the TATA box to the initiator element is counted inclusively from the first T in the TATA box to the A in the CAG in the initiator element (or the corresponding CAG in the parent sequence if the initiator element is mutated). Examples of core promoters with short 28 nucleotide spacing include SEQ ID NO:7, SEQ ID NO:10, and SEQ ID NO:109 to SEQ ID NO:125. Examples of core promoters with standard 30 nucleotide spacing include SEQ ID NO:13 and SEQ ID NO:126 to SEQ ID NO:144.

[0268] As shown in FIG. 9A, the activity of core promoters with short spacing (having a length of 28 nucleotides) or standard spacing (having a length of 30 nucleotides) was compared when paired with a synthetic HepG2 cell type specific enhancer (SEQ ID NO: 146) in HepG2 cells. Although there was no single spacing that increased the transcription activation for all core promoters, as shown in FIG. 9B, when paired with the enhancer of SEQ ID NO: 146, the shorter spacing increased the transcription activation of SEQ ID NO: 7 (which contains a spacing of 28 nucleotides) compared to SEQ ID NO: 141 (which contains a standard spacing of 30 nucleotides). SEQ ID NO: 7 exhibited higher transcription activation than SEQ ID NO: 141 across the majority of redundant barcodes, indicating that the shorter spacing increased the transcription activation for this core promoter.

[0269] Example 5: Effect of Pause Sites on Transcriptional Activation This example describes the effect of pause sites in the core promoter on transcriptional activation. The transcriptional activity and fold activation of the core promoter with and without a transcription pause site were compared. Ten different transcription pause sites were tested in the context of 20 different core promoters. Examples of core promoter sequences with pause sites include SEQ ID NO:1, SEQ ID NO:11, and SEQ ID NO:16 to SEQ ID NO:21. Examples of pause site sequences include SEQ ID NO:196 to SEQ ID NO:198, SEQ ID NO:211, or SEQ ID NO:212. Examples of core promoter sequences without pause sites include SEQ ID NO:13 and SEQ ID NO:126 to SEQ ID NO:144.

[0270] Figures 10A and 10B show a comparison of activity (Figure 10A) and fold activation (Figure 10B) for the core promoter with or without a pause site ("Founder Combo"). Transcriptional activity when paired with a synthetic HepG2 enhancer (SEQ ID NO: 146) was measured in HepG2 cells using MPRA screening. Fold activation of each core promoter with a transcriptional pause site ("With Pause Site") compared to the corresponding core promoter without a transcriptional pause site ("Founder Combo") was measured in HepG2 cells using MPRA screening. Sequences with the same pause site sequence of SEQ ID NO: 196 are represented by red circles. As can be seen in Figures 10A and 10B, activity and fold activation are highly correlated between sequences with and without pause sites. Additionally, sequences containing pause sites of SEQ ID NO: 196 to SEQ ID NO: 198, SEQ ID NO: 211, or SEQ ID NO: 212 consistently showed increased activity compared to the corresponding sequences lacking a pause site. Taken together, these data suggest that the pause site does not result in a global increase in activity or activation.

[0271] Example 6: Effect of YY1 motif on transcriptional activation This example describes the effect of the YY1 transcription factor motif in the core promoter on transcriptional activation. After transfection into HepG2 cells, the transcriptional activity of the core promoter with and without the YY1 motif was compared. Examples of core promoter sequences with the YY1 motif include SEQ ID NO:2, SEQ ID NO:12, and SEQ ID NO:31-68. Examples of the YY1 transcription factor motif include SEQ ID NO:205-208.

[0272] Orthodoxly, the YY1 motif immediately downstream of Inr in the core promoter sequence is associated with active promoters. To test the effect of the YY1 motif on cell type-specific activation, the transcriptional activity of 288 fully synthetic promoters with the YY1 motif was compared to the core promoter lacking the YY1 motif after transfection into HepG2 cells. As shown in Figure 11A, the core promoter with the YY1 motif exhibited specifically higher transcriptional activity in HepG2 cells than the sequence without the YY1 motif when paired with the K562 synthetic enhancer (SEQ ID NO: 145), but not when paired with the HepG2 synthetic enhancer (SEQ ID NO: 146). This is demonstrated by the fact that the sequences with the YY1 motif (represented by the red circle in Figure 11A) tended to be clustered to the right and slightly below the majority of sequences lacking the YY1 motif. The transcriptional activity of the core promoter with or without the YY1 motif when paired with either the HepG2 synthetic enhancer (SEQ ID NO: 146) or the K562 synthetic enhancer (SEQ ID NO: 145) is shown in Figure 11C and Figure 11D, respectively. The data indicate that the YY1 motif confers enhancer specificity to the core promoter. Additionally, the YY1 motif increases overall activity, especially when paired with the K562 synthetic enhancer (SEQ ID NO: 145), as shown in Figure 11D.

[0273] Furthermore, as shown in FIG. 11B, the core promoter with the YY1 motif exhibited a higher background in HepG2 cells than the sequence without the YY1 motif. This is demonstrated in that the sequence with the YY1 motif, represented by the red circle in FIG. 11B, when paired with an inactive enhancer (SEQ ID NO: 146, "negative control") or an endogenous enhancer for different cell types (SEQ ID NO: 193), showed higher basal transcriptional activity compared to the core promoter lacking the YY1 motif. Taken together, these data suggest that the core promoter with the YY1 motif provides enhancer-specific transcriptional activation with higher overall transcriptional activity than the core promoter without the YY1 motif, albeit with increased background activity.

[0274] Example 7: Transcriptional activation of ybTATA and minP variants This example describes the transcriptional activation of ybTATA and minP variants containing variations in the TATA and Inr sequences. After transfection into HepG2 cells, the transcriptional activity of core promoters with variations in the TATA sequence was compared. Variants of the ybTATA founder sequence (SEQ ID NO: 9) and the minP founder sequence (SEQ ID NO: 5) were paired with a synthetic HepG2 enhancer (SEQ ID NO: 146) that was screened for transcriptional activation in HepG2. The transcriptional activity of the ybTATA and minP variants is shown in Figure 12A and Figure 12B, respectively. The effect of each nucleotide substitution (A (green circle), T (red circle), C (blue circle), or G (orange circle)) at each position in the core promoter sequence on transcriptional activity was compared to the corresponding founder sequence (SEQ ID NO: 9 or SEQ ID NO: 5, dashes). As seen in Figures 12A and 12B, substitutions at positions 7 and 8 of the TATA sequence (corresponding to positions 16 and 17 of ybTATA and positions 14 and 15 of minP) increased transcriptional activation. Figure 13A illustrates the relative transcriptional activity of the TATA sequence with each possible nucleotide substitution. Substitutions at position 4 of Inr (corresponding to position 40 of minP) increased transcriptional activity. Figure 13B illustrates the relative transcriptional activity of the Inr sequence with each possible nucleotide substitution. Figure 13C illustrates the relative transcriptional activity of the YY1 motif sequence with each possible nucleotide substitution. Figure 13D illustrates the relative transcriptional activity of the HNF4α motif sequence with each possible nucleotide substitution.

[0275] As shown in Figures 14A and 14B, double mutants were screened in the context of the minP founder sequence (SEQ ID NO: 5). The activity of the minP double point mutant (SEQ ID NO: 5) was measured in HepG2 cells when paired with a synthetic HepG2-specific enhancer of SEQ ID NO: 146 (Figure 14A) or in K562 cells when paired with a synthetic K562-specific enhancer of SEQ ID NO: 145 (Figure 14B). Lighter shading indicates higher transcriptional activity. Some double mutants with increased transcriptional activation also showed increased background activation. The double mutant sequence (SEQ ID NO: 15) containing the substitutions T15G and A40C showed the greatest increase in transcriptional dynamic range. The effect of the double mutations on transcriptional activation was consistent with different enhancers.

[0276] Example 8: Characterization of candidate switchable core promoters This example describes the characterization of candidate switchable core promoters identified using the assays described in Examples 1-8. Candidate switchable core promoters (corresponding to SEQ ID NOs:1-4, 7, and 10-15) were selected based on high transcriptional activation activity and low background transcriptional activity (corresponding to high fold activation).

[0277] SEQ ID NO:1, SEQ ID NO:11, and SEQ ID NO:14 contain a pause site; SEQ ID NO:2 and SEQ ID NO:12 contain a YY1 motif; SEQ ID NO:3 contains a long spacing between TATA and Inr; SEQ ID NO:4 contains substitutions of T15A and A40T compared to minP (SEQ ID NO:5); SEQ ID NO:6 (GTACTTATATAAGGGGGTGGGGGCGCGTTCGTCCTCAGTCGCGATCGAACACTCGAGCCGAGCAGACGTGCCTACGGACCG) shows high transcriptional activation but also high background; SEQ ID NO:7 and SEQ ID NO:10 contain short spacing between TATA and Inr; SEQ ID NO:13 is a fully synthetic promoter with strong transcriptional activation; SEQ ID NO:15 contained substitutions of T15G and A40C compared to minP. SEQ ID NO:8 showed low transcriptional activation and was included as a negative control. SEQ ID NO:5 (minP) and SEQ ID NO:9 (ybTATA) were included for comparison.

[0278] The transcriptional activation properties of SEQ ID NO:1 to SEQ ID NO:4, SEQ ID NO:7, and SEQ ID NO:10 to SEQ ID NO:15 were evaluated in HepG2 cells. Figure 15A shows the transcriptional activity of the screened core promoters paired with either the synthetic K562 enhancer (SEQ ID NO:145) or the synthetic HepG2 enhancer (SEQ ID NO:146). Figure 15B shows the fold activation of the screened core promoters with the synthetic K562 enhancer (SEQ ID NO:145) compared to no enhancer, or with the synthetic HepG2 enhancer (SEQ ID NO:146) compared to an inactive enhancer (SEQ ID NO:147, "negative"). The core promoters ybTATA (SEQ ID NO:9) and minP (SEQ ID NO:5) are shown as orange circles in Figures 15A and 15B.

[0279] The core promoter of SEQ ID NO:7 was identified as having high transcriptional activation and high dynamic range. As shown in FIG. 16A, SEQ ID NO:7 showed high transcriptional activation when paired with the synthetic HepG2 enhancer (SEQ ID NO:146) in HepG2 cells. Activation by SEQ ID NO:7 was comparable to the highly active SEQ ID NO:6 and higher than either SEQ ID NO:5 (minP) or SEQ ID NO:9 (ybTATA). As shown in FIG. 16B, SEQ ID NO:7 showed low background transcription when paired with an inactive enhancer (SEQ ID NO:147). Background activation by SEQ ID NO:7 was lower than any of SEQ ID NO:6, SEQ ID NO:5, or SEQ ID NO:9. The violin plots in FIG. 16A and FIG. 16B show the redundant barcodes for each enhancer / promoter construct. Taken together, these data demonstrate that the core promoter of SEQ ID NO:7 functions as a switchable core promoter that promotes high levels of transcription when paired with a cell-type specific enhancer in one cell type and exhibits low background transcription when paired with an enhancer of different cell type specificity in the cell type of the cell type specific enhancer or in the absence of an enhancer in the cell type of the cell type specific enhancer.

[0280] Example 9: Verification of core promoter activity This example describes the validation of multiple core promoters in both K562 lymphoblast and HepG2 liver cancer cell lines with either K562-specific or HepG2-specific enhancers ("H synthetic"). The core promoters screened included SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15. Each core promoter was cloned into a construct containing either a synthetic K562-specific or a synthetic HepG2-specific enhancer, and the constructs were tested for transcriptional activity. Core promoter activity was determined using the MPRA screen described in Example 1 and using a dual reporter quantitative PCR (qPCR) assay (dual reporter flow assay as described in Example 1, except that qPCR was used for readout instead of MFI).

[0281] A comparison of promoter activity determined by MPRA screening ("screening activity") and dual reporter qPCR assay ("qPCR activity") for promoters with K562-specific enhancers in HepG2 cells is shown in FIG. 20A. A comparison of promoter activity determined by MPRA screening ("screening activity") and dual reporter qPCR assay ("qPCR activity") for promoters with HepG2-specific enhancers in HepG2 cells is shown in FIG. 20B. A comparison of promoter activity determined by MPRA screening ("screening activity, K562") and dual reporter qPCR assay ("qPCR activity") for promoters with K562-specific enhancers in K562 cells is shown in FIG. 20C. Variants of the minP core promoter (including SEQ ID NO: 4 and SEQ ID NO: 15) performed well in both cell lines and exhibited increased expression when paired with enhancers of the corresponding cell types. When paired with the corresponding cell type enhancers, SEQ ID NO: 4 and SEQ ID NO: 15 were approximately three times more active than the core promoter of SEQ ID NO: 9. The core promoter of SEQ ID NO: 7 worked well in K562 cells when paired with the K562-specific enhancer.

[0282] Example 10: Enhancement of minP variant core promoter activity This example describes the activity of the minP variant core promoter compared to the ybTATA core promoter in both H4 glioma cell line and HepG2 liver cancer cell line. The minP variant core promoter (SEQ ID NO: 4, "minP_T14A_A39T") and the ybTATA core promoter (SEQ ID NO: 9) were each cloned into three constructs containing one of two different H4-specific enhancers ("H4-specific enhancer 1" and "H4-specific enhancer 2") or one liver-specific enhancer. The activity of the core promoter in both H4 and HepG2 cell lines was measured by a dual reporter assay to measure activity. A comparison of the transcriptional activity in H4 cells of the minP variant of SEQ ID NO: 4 ("minP activity") and the ybTATA promoter of SEQ ID NO: 9 ("yb_TATA activity") when paired with either the H4-specific enhancer or the liver-...

Claims

1. 1. An engineered core promoter, wherein the engineered core promoter comprises a sequence having at least 80% sequence identity to SEQ ID NO:4 and comprising the nucleotide substitutions T15G and A40T compared to SEQ ID NO:

5.

2. 2. The engineered core promoter of claim 1, wherein the engineered core promoter comprises a sequence having at least 90% sequence identity to SEQ ID NO:4 and comprising the nucleotide substitutions T15G and A40T compared to SEQ ID NO:

5.

3. 3. The engineered core promoter of claim 1 or claim 2, wherein the engineered core promoter comprises the sequence of SEQ ID NO:

4.

4. 4. The engineered core promoter of any one of claims 1 to 3, wherein the engineered core promoter further comprises a transcriptional pause site.

5. 5. The engineered core promoter of claim 4, wherein the transcriptional pausing site comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs:196-198, SEQ ID NO:211, or SEQ ID NO:

212.

6. 6. The engineered core promoter of claim 4 or claim 5, wherein the transcriptional pausing site comprises the sequence of any one of SEQ ID NOs:196 to 198, SEQ ID NO:211, or SEQ ID NO:

212.

7. 7. The engineered core promoter of any one of claims 1 to 6, wherein the engineered core promoter further comprises a YY1 motif.

8. 8. The engineered core promoter of claim 7, wherein the YY1 motif comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs:205-207.

9. 9. The engineered core promoter of claim 7 or claim 8, wherein the YY1 motif comprises a sequence having any one of SEQ ID NOs:205 to 207.

10. 10. The engineered core promoter of any one of claims 1 to 9, wherein the engineered core promoter comprises a spacer of 30 to 34 nucleotides.

11. 11. The engineered core promoter of any one of claims 1 to 10, wherein the transcriptional activity produced by the engineered core promoter paired with an activated response element is higher than the transcriptional activity produced by the core promoter of SEQ ID NO:6 when paired with the activated response element, or the basal transcriptional activity produced by the engineered core promoter paired with an activated response element is lower than the basal transcriptional activity produced by the core promoter of SEQ ID NO:6 when paired with an inactive response element, or both.

12. 12. The engineered core promoter of any one of claims 1 to 11, wherein the transcriptional activity produced by the engineered core promoter paired with an activated response element is higher than the transcriptional activity produced by the core promoter of SEQ ID NO:9 when paired with the activated response element, or the basal transcriptional activity produced by the engineered core promoter paired with an activated response element is lower than the basal transcriptional activity produced by the core promoter of SEQ ID NO:9 when paired with an inactive response element, or both.

13. 13. An engineered promoter comprising a response element and an engineered core promoter according to any one of claims 1 to 12.

14. 14. The engineered promoter of claim 13, wherein the response element confers bone marrow-specific, liver-specific, neuron-specific, muscle-specific, or kidney-specific transcription of a payload under the transcriptional control of the engineered promoter.

15. 15. The engineered promoter of claim 13 or claim 14, wherein the response element comprises a sequence having at least 90% sequence identity to SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:193, or SEQ ID NO:

194.

16. 16. The engineered promoter of any one of claims 13 to 15, wherein the response element comprises the sequence of SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:193, or SEQ ID NO:

194.

17. 17. A recombinant polynucleotide comprising an engineered core promoter according to any one of claims 1 to 12 or an engineered promoter according to any one of claims 13 to 16, and a payload comprising a coding sequence under the transcriptional control of said engineered core promoter.

18. The recombinant polynucleotide of claim 17 , wherein the payload encodes a protein.

19. 20. The recombinant polynucleotide of claim 18, wherein the protein is a neural protein, a kidney protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein.

20. 20. The recombinant polynucleotide of claim 18 or 19, wherein the protein is associated with a genetic disorder, a neurological disorder, a renal disorder, an eye disorder, a muscular disorder, or cancer.

21. The recombinant polynucleotide of any one of claims 18 to 20, wherein the protein is progranulin, MeCP2, polycystin-1, or polycystin-2.

22. The recombinant polynucleotide of claim 17 , wherein the payload encodes a therapeutic polynucleotide.

23. 23. The recombinant polynucleotide of claim 22, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA.

24. 24. The recombinant polynucleotide of claim 22 or claim 23, wherein the therapeutic polynucleotide targets a gene.

25. 25. The recombinant polynucleotide of claim 24, wherein the gene is associated with a genetic disorder, a neurological disorder, a renal disorder, an eye disorder, a muscular disorder, or cancer.

26. 26. The recombinant polynucleotide of claim 24 or claim 25, wherein the gene is GRN, MECP2, PKD2, or PKD2.

27. 27. An engineered viral vector comprising an engineered core promoter according to any one of claims 1 to 12, an engineered promoter according to any one of claims 13 to 16, or a recombinant polynucleotide according to any one of claims 17 to 26 in a viral vector.

28. 28. The engineered viral vector of claim 27, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector.

29. The adeno-associated virus vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AA V11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV. rh8, AAV. rh10, AAV. rh20, AAV. rh39, AAV. Rh43, AAV. Rh74, AAV. v66, AAV. Oligo001, AAV. SCH9, AAV. r3.45, AAV. RHM4-1, AAV. hu37, AAV. Anc80, AAV. Anc80L65, AAV. 7m8, AAV. PhP. eB, AAV. PhP. V1, AAV. PHP. B. AAV. PhB. C1, AAV. PhB. C2, AAV. PhB. C3, AAV. PhB. C6, AAV. cy5, AAV2.5, AAV2tYF, AAV3B, AAV. LK03, AAV. HSC1, AAV. HSC2, AAV. HSC3, AAV. HSC4, AAV. HSC5, AAV. HSC6, AAV.

29. The engineered viral vector of claim 28, wherein the engineered viral vector is selected from the group consisting of AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, and combinations thereof.

30. 30. A pharmaceutical composition comprising an engineered core promoter according to any one of claims 1 to 12, an engineered promoter according to any one of claims 13 to 16, a recombinant polynucleotide according to any one of claims 17 to 26, or a viral vector according to any one of claims 27 to 29, and a pharma- ceutically acceptable carrier.

31. 1. A method of treating a disorder in a subject in need thereof, comprising: administering to said subject a composition comprising a recombinant polynucleotide according to any one of claims 17 to 26, a viral vector according to any one of claims 27 to 29, or a pharmaceutical composition according to claim 30; expressing a therapeutic sequence encoded by the payload of said recombinant polynucleotide in target cells of said subject, thereby treating said disorder. The method comprising:

32. 32. The method of claim 31 , wherein the target cell is a cell type or cell state associated with the disorder.

33. 33. The method of claim 31 or claim 32, wherein the disorder is a genetic disorder, a neurological disorder, a renal disorder, an eye disorder, a muscular disorder, or cancer.

34. 34. The method of any one of claims 31 to 33, wherein the disorder is Rett syndrome, MECP2 duplication syndrome, frontotemporal dementia, neuronal ceroid lipofuscinosis, cancer, atherosclerosis, Alzheimer's disease, amyotrophic lateral sclerosis, limbic-predominant age-related TDP-43 encephalopathy, or polycystic kidney disease.

35. The method of any one of claims 31 to 34, wherein the therapeutic sequence encodes a therapeutic protein.

36. 36. The method of claim 35, wherein the therapeutic protein is a neural protein, a kidney protein, a retinal protein, a muscle protein, or an apoptosis-inducing protein.

37. 37. The method of claim 35 or claim 36, wherein the therapeutic protein is associated with a genetic disorder, a neurological disorder, a renal disorder, an eye disorder, a muscular disorder, or cancer.

38. The method of any one of claims 35 to 37, wherein the therapeutic protein is MECP2, progranulin, polycystin-1, or polycystin-2.

39. The method of any one of claims 31 to 34, wherein the payload encodes a therapeutic polynucleotide.

40. 40. The method of claim 39, wherein the therapeutic polynucleotide is a guide RNA or a suppressor tRNA.

41. 1. A method for identifying a switchable core promoter, comprising: introducing a core promoter library comprising a first sub-library and a second sub-library into a cell population; wherein the first sub-library comprises a plurality of core promoters, a core promoter of the plurality of core promoters is linked to a first response element and a unique barcode sequence; the second sub-library comprises the plurality of core promoters, the core promoters of the plurality of promoters being linked to a second response element and a unique barcode sequence; identifying a switchable core promoter as a core promoter that promotes higher transcription of the unique barcode when paired with the first response element than when paired with the second response element; The method comprising:

42. 42. The method of claim 41, further comprising activating the first response element.

43. 43. The method of claim 41 or claim 42, wherein the second response element is not activated.

44. 44. The method of any one of claims 41 to 43, wherein the first response element is an activated response element and the second enhancer sequence is an inactive or non-activated response element.

Images