Methods and compounds for modulating Huntington's disease
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-03-31
- Publication Date
- 2026-04-08
AI Technical Summary
The prior art is difficult to effectively treat Huntington's disease and Huntington's disease-like syndrome caused by CAG trinucleotide repeats, especially inability to effectively regulate the expression of target genes that cause the disease.
By designing a nucleic acid-coupled molecule that contains the DNA binding moiety and the recruitment moiety, specifically, polyamide is used as the DNA binding moiety, and by connecting to the recruitment moiety of the polyamide polysaccharide, the regulatory molecule is directed near the target gene, thereby regulating the expression of the target gene.
This method can effectively inhibit the abnormal expression of target genes caused by CAG trinucleotide repeats, thereby reducing the occurrence, severity and frequency of disease-related symptoms, and provides a potential treatment for Huntington's disease and Huntington's disease-like syndrome.
Smart Images

Figure 2023192642000001 
Figure 2023192642000002 
Figure 2023192642000003
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Patent Application No. 63 / 326,625, filed April 1, 2022, and U.S. Patent Application No. 63 / 482,670, filed February 1, 2023, each of which is incorporated by reference in its entirety.
[0002] Disclosed herein are novel chimeric heterocyclic polyamide compounds and compositions and their applications as pharmaceuticals for the treatment of disease. Methods of regulating the expression of target genes containing CAG trinucleotide repeat sequences in a subject are also provided for the treatment of diseases such as Huntington's disease ("HD"). [Background technology]
[0003] Huntington's disease ("HD") was first identified in the late 19th century as an autosomal dominant neurodegenerative disorder. Symptoms of HD, including a variety of motor, cognitive and psychiatric disorders, typically appear in adulthood. HD is associated with the presence of CAG trinucleotide repeats in the Htt gene, which encodes a protein called huntingtin. Subjects with more than about 36 trinucleotide repeats generally exhibit symptoms of HD, with greater numbers of trinucleotide repeats being associated with earlier onset of symptoms. The pathology results from a cascade of steps involving the generation of polyQ huntingtin, followed by fragmentation of the expanded huntingtin into smaller peptides that bind together and accumulate in neurons. The effects of this cascade are evident in the basal ganglia and cortex of the brain.
[0004] Huntington's disease-like syndrome refers to a group of disorders that resemble the symptoms of Huntington's disease but lack the characteristic mutations in the Htt gene. Huntington's disease-like 2 syndrome ("HDL2") is associated with a number of CAG trinucleotide repeats of approximately 40 or more in the junctophilin 3 (Jph3) gene. HDL2 is a genetic disorder found in subjects of African descent. Age at onset is inversely correlated with the number of trinucleotide repeats. Symptoms of the syndrome include dystonia and chorea (uncontrollable movements), emotional confusion, dysarthria, bradykinesia, inability to take on new learning, and difficulty making decisions. Life expectancy can vary from a few years to more than 10 years after diagnosis. Current theory is that polyQ proteins encoded by the Jph3 gene form aggregates in nerve cells that contribute to the pathology of the disease. However, evidence has also been found suggesting gain-of-function toxicity of mRNA, suggesting a possible dual pathway for pathology.
[0005] In some embodiments, the above mechanism provides an opportunity for effective treatment of diseases or disorders characterized by the presence of an excess number of CAG trinucleotide repeats in a target gene. In some embodiments, the pathology of the disease or disorder is due to the presence of an mRNA that contains an excess number of CAG trinucleotide repeats. In some embodiments, the pathology of the disease or disorder is due to the presence of a translation product that contains an excess number of glutamine amino acid residues. In some embodiments, the pathology of the disease or disorder is due to a loss of function of the translation product. In some embodiments, the pathology of the disease or disorder is due to a gain of function of the translation product. In some embodiments, the pathology of the disease or disorder can be alleviated by increasing the transcription rate of the defective gene. In some embodiments, the pathology of the disease or disorder can be alleviated by decreasing the transcription rate of the defective gene. Summary of the Invention
[0006] The present disclosure utilizes regulatory molecules present in the cell nucleus that control gene expression. Eukaryotic cells provide several mechanisms for controlling gene replication, transcription, and / or translation. Regulatory molecules produced by various biochemical mechanisms within the cell can regulate various processes involved in the conversion of genetic information into cellular components. Some regulatory molecules are known to regulate the production of mRNA, and when directed against a target gene (such as Htt), they regulate the production of target gene mRNA that causes diseases, such as Huntington's disease or Huntington's disease-like syndromes, thereby reversing the progression of these diseases.
[0007] Compounds and methods are provided herein for recruiting regulatory molecules to the vicinity of target genes that contain CAG trinucleotide repeat sequences. The compounds disclosed herein include (a) a DNA-binding moiety that selectively binds to the target gene, and (b) a recruiting moiety that binds to the regulatory molecule linked to the DNA-binding moiety. Without being bound by theory, the compounds may suppress expression of defective target genes in the following ways: (1) the DNA-binding portion is capable of selectively binding to the characteristic CAG trinucleotide repeat sequence of the target gene; (2) It allows the recruitment moiety linked to the DNA-binding moiety to be held in close proximity to the target gene, (3) the recruiting moiety thus proximate to the target gene is capable of recruiting a regulatory molecule to the gene in proximity; and (4) Regulatory molecules can regulate the expression of target genes by direct interaction with these genes, thereby suppressing the expression of the defective mRNA.
[0008] The DNA binding moiety can selectively bind to, for example, the characteristic CAG trinucleotide repeat sequence of Htt. The recruiting moiety linked to the DNA binding moiety is thereby held in close proximity to the target gene, and recruits a regulatory molecule to the gene in close proximity, and the regulatory molecule regulates the expression of the target gene by direct interaction with the target gene, thereby suppressing the production of the defective target gene. This mechanism may provide an effective treatment for HD caused by the expression of defective Htt, and correcting the expression of the defective target gene is an effective method for treating these diseases.
[0009] The disclosure further provides DNA-binding moieties that selectively bind to one or more copies of a CAG trinucleotide repeat characteristic of a defective target gene. Selective binding of the DNA-binding moiety to the target gene, made possible by the high number of CAGs associated with the defective target gene, directs the recruiting moiety to the vicinity of the gene and recruits a regulatory molecule into position to regulate transcription of the gene.
[0010] The DNA binding moiety comprises a polyamide segment that selectively binds to the target CAG sequence. For example, polyamides designed by Dervan (US Pat. Nos. 9,630,950 and 8,524,899) and others can selectively bind to selected DNA sequences. These polyamides are located in the minor groove of double helix DNA and form hydrogen bond interactions with Watson-Crick base pairs. Polyamides that selectively bind to specific DNA sequences can be designed by linking monoamide building blocks according to established chemical rules. One building block is provided for each DNA base pair, and each building block non-covalently and selectively binds to one of the DNA base pairs, i.e., A / T, T / A, G / C, and C / G. Following this guideline, trinucleotides are bound to molecules that have three amide units, i.e., triamides. In general, these polyamides can be oriented in either direction of the DNA sequence.
[0011] In principle, longer DNA sequences can be targeted with higher specificity and / or higher affinity by combining more monoamide building blocks into longer polyamide chains. Ideally, the binding affinity for polyamides is simply equal to the sum of each individual monoamide / DNA base pair interaction. However, in practice, due to rather strong geometric mismatches between polyamide and DNA structures, longer polyamide sequences do not bind as tightly to longer DNA sequences as would be expected from a simple additive contribution. The geometric mismatches between longer polyamide sequences and longer DNA sequences induce unfavorable geometric distortions that subtract from the otherwise expected binding affinity.
[0012] The present disclosure provides transcriptional modulator molecules that include a DNA-binding moiety (e.g., a polyamide containing multiple amine subunits) connected to a protein-binding moiety by a spacer (e.g., a linker moiety or oligomeric backbone). The spacer can relieve geometric distortions that would otherwise reduce the binding affinity of larger polyamide sequences.
[0013] Disclosed herein are compounds that comprise a polyamide moiety that can bind to one or more copies of CAG trinucleotide repeat sequences and regulate the expression of target genes that contain CAG trinucleotide repeat sequences.Treating a subject with these compounds regulates the expression of defective target genes, which can reduce the occurrence, severity, or frequency of symptoms associated with disease.Certain compounds disclosed herein provide higher binding affinity and selectivity than previously observed for this class of compounds.
[0014] It should be understood, however, that the detailed description and specific examples, while indicating specific embodiments, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from the detailed description.
[0015] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0016] The present disclosure provides transcriptional modulator molecules that include a DNA-binding moiety (e.g., a polyamide containing multiple amine subunits) connected to a protein-binding moiety by a spacer (e.g., a linker moiety or oligomeric backbone). The spacer can relieve geometric distortions that would otherwise reduce the binding affinity of larger polyamide sequences.
[0017] Treatment of a subject with these compounds modulates expression of the defective target gene, which can reduce the occurrence, severity, or frequency of symptoms associated with a genetic disease (such as, for example, HD). The compounds described herein recruit regulatory molecules to modulate expression of the defective target gene, effectively treating and alleviating symptoms associated with the disease.
[0018] compound The compounds disclosed herein are transcriptional modulator molecules.These transcriptional modulator molecules have useful activity for regulating the transcription of target genes (e.g., Htt) that have one or more CAG repeats, and can be used to treat or prevent diseases or conditions in which these target genes play an active role.Therefore, in a broad aspect, some embodiments also provide pharmaceutical compositions that include one or more compounds disclosed herein together with pharma- ceutically acceptable carriers, as well as the methods of making and using these compounds and compositions.
[0019] In one aspect, provided herein is a transcription modulator molecule having a first end, a second end, and a linker portion, (a) the first end comprises a DNA-binding moiety capable of binding to a nucleotide repeat comprising CAG; (b) the second end comprises a protein-binding moiety capable of binding to a regulatory molecule that regulates expression of a gene having the nucleotide repeat; and (c) an oligomeric backbone links the first end and the second end.
[0020] First end - DNA binding portion The first end interacts with and binds to the minor groove of the gene, particularly the CAG sequence. In one aspect, the molecules disclosed herein provide a polyamide sequence for the interaction of a single polyamide subunit to each base pair in the CAG repeat sequence. In some embodiments, the molecule provides a curved component (e.g., an aliphatic amino acid portion) to allow hairpin binding of the molecule with CAG, with each nucleotide pair interacting with two subunits of the polyamide. In some embodiments, one or more of the carbonyl groups (C=O) of the polyamide backbone are replaced with oxetane. In some embodiments, at least one of the carbonyl groups of the polyamide backbone is replaced with oxetane.
[0021] In some embodiments, each subunit independently comprises a moiety selected from a heterocycle and an aliphatic chain.
[0022] In some embodiments, the aliphatic chain is a C1-C6 straight aliphatic chain. In some embodiments, the aliphatic chain has the structural formula -(CH2) m - and m is selected from 1, 2, 3, 4, and 5. In some embodiments, the aliphatic chain is -CH2CH2-.
[0023] In some embodiments, the heterocycle is a monocyclic heterocycle. In some embodiments, the heterocycle is a monocyclic 5-membered heterocycle. In some embodiments, each heterocycle contains a heteroatom independently selected from N, O, or S. In some embodiments, each heterocycle is independently selected from pyrrole, imidazole, thiazole, oxazole, thiophene, and furan.
[0024] In some embodiments, the DNA binding moiety comprises -NH-QC(O)-, where Q is an optionally substituted C6-C 10 It is an optionally substituted arylene, an optionally substituted 4-10 membered heterocyclene, an optionally substituted 5-10 membered heteroarylene group, or an optionally substituted alkylene group.
[0025] In some embodiments, the DNA-binding moiety comprises at least three aromatic carboxamide moieties selected to correspond to the nucleotide repeat sequence CAG, and at least one aliphatic amino acid residue selected from the group consisting of glycine, β-alanine, γ-aminobutyric acid, 2,4-diaminobutyric acid, and 5-aminovaleric acid. In some embodiments, the DNA-binding moiety comprises one or more subunits selected from the group consisting of optionally substituted N-methylpyrrole, optionally substituted N-methylimidazole, β-alanine (β), and γ-aminobutyric acid. In some embodiments, the DNA-binding moiety comprises at least one γ-aminobutyric acid.
[0026] In some embodiments, the DNA binding moiety is
[0027] [ka]
[0028] [ka] wherein each R' is independently selected from hydrogen, optionally substituted C-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C-C 20 Haloalkyl or optionally substituted C-C 20 alkylamino, and Z is H, NH2, C1-C6 alkyl, C1-C6 haloalkyl, or C1-C6 alkyl-NH2.
[0029] In some embodiments, the first end has the structure of formula (A-1):
[0030] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Z 1 is absent, -O- or -NH-; each X 1 , X 2 , X 3 , X 4 , X 5 , X 6 , X 7 , and X 8 are independently O, S, or NR 2 and Each Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , Y 6 , Y 7 , and Y 8 is independently CH or N; W 1 is deuterium, hydrogen, optionally substituted C1-C6 alkyl, (azanylidene)methanediamine, (azanylidene)-N,N,N',N'-tetramethylmethanediamine, -C(O)-NR 1A R 1B , -NR 1A -C(O)-NR 1A R 1B , -Z B -P(O)(OR 1A )2, -Z B -(CH2) p3 -PO(OR 1A )2, -Z B -(CH2) p3 -OP(O)(OR 1A )2, wherein Z B is -N- or -O-, p3 is an integer from 1 to 10, W 2 is an optionally substituted C1-C6 alkyl or -C(O)-NR1A R 1B and Each R 1 are independently hydrogen, deuterium, halogen, amino, cyano, or optionally C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, or -NC(O)R 1A or Two R on the same atom or adjacent atoms 1 combine with the atom(s) to which they are attached to form an optionally substituted 3- to 6-membered carbocyclic ring or an optionally substituted 3- to 6-membered heterocyclic ring; Each R 2 are independently hydrogen, deuterium, or optionally substituted C-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C-C 20 Haloalkyl or optionally substituted C-C 20 is alkylamino, Each R 1A are independently hydrogen, deuterium, or optionally substituted C-C 20 is alkyl, Each R 1B are independently hydrogen, deuterium, or optionally substituted C-C 20 Alkyl, optionally substituted C-C 10 heteroalkyl, optionally substituted 5-membered heteroaryl, or (AA) p2 where: Each AA is an amino acid, p2 is an integer from 1 to 10, j1 is 0 or 1, n0 is 1 or 0, m1 and n1 each independently represent an integer of 0 to 3; Z 1 When -O- or -NH-, p1 is 2, Z 1 p1 is 2 or 3, provided that if is not present then p1 is 3; and In the formula, W 1 Or W 2 One of these is attached to the oligomeric backbone.
[0031] In some embodiments, n0 is 1.
[0032] In some embodiments, the first end has the structure of formula (A-2):
[0033] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Z 1 is absent, -O- or -NH-; each X 1 , X 2 , X 3 , X 4 , X 5 , X 6 , X 7 , and X 8 are independently O, S, or NR 2 and Each Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , Y 6 , Y 7 , and Y 8 is independently CH or N; W 1 is deuterium, hydrogen, optionally substituted C1-C6 alkyl, (azanylidene)methanediamine, (azanylidene)-N,N,N',N'-tetramethylmethanediamine, -C(O)-NR 1A R 1B , -NR 1A -C(O)-NR 1A R 1B , -Z B -P(O)(OR 1A )2, -Z B -(CH2) p3 -P(O)(OR 1A )2, -Z B -(CH2) p3 -OP(O)(OR 1A )2, wherein Z Bis -N- or -O-, p3 is an integer from 1 to 10, W 2 is an optionally substituted C1-C6 alkyl or -C(O)-NR 1A R 1B and Each R 1 are independently hydrogen, deuterium, halogen, amino, cyano, or optionally C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, or -NC(O)R 1A or Two R on the same atom or adjacent atoms 1 combine with the atom(s) to which they are attached to form an optionally substituted 3- to 6-membered carbocyclic ring or an optionally substituted 3- to 6-membered heterocyclic ring; Each R 2 are independently hydrogen, deuterium, or optionally substituted C-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C-C 20 Haloalkyl or optionally substituted C-C 20 is alkylamino, Each R 1A are independently hydrogen, deuterium, or optionally substituted C-C 20 is alkyl, Each R 1B are independently hydrogen, deuterium, or optionally substituted C-C 20 Alkyl, optionally substituted C-C 10 heteroalkyl, optionally substituted 5-membered heteroaryl, or (AA) p2 where: Each AA is an amino acid, p2 is an integer from 1 to 10, j1 is 0 or 1, m1 and n1 each independently represent an integer of 0 to 3; Z 1 When -O- or -NH-, p1 is 2, Z 1 p1 is 2 or 3, provided that if is not present then p1 is 3; and In the formula, W 1 Or W 2 One of these is attached to the oligomeric backbone.
[0034] In some embodiments, n0 is 0.
[0035] In some embodiments, the DNA-binding moiety has the structure of formula (A-3), or a pharma- ceutically acceptable salt thereof:
[0036] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Z 1 is absent, -O- or -NH-; each X 1 , X 2 , X 3 , X 4 , X 5 , X 6 , X 7 , and X 8 are independently O, S, or NR 2 and Each Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , Y 6 , Y 7 , and Y 8 is independently CH or N; W 1 is deuterium, hydrogen, optionally substituted C1-C6 alkyl, (azanylidene)methanediamine, (azanylidene)-N,N,N',N'-tetramethylmethanediamine, -C(O)-NR 1A R 1B , -NR 1A -C(O)-NR 1A R 1B , -Z B -P(O)(OR 1A )2, -Z B -(CH2) p3 -P(O)(OR 1A )2, -ZB -(CH2) p3 -OP(O)(OR 1A )2, wherein Z B is -N- or -O-, p3 is an integer from 1 to 10, W 2 is an optionally substituted C1-C6 alkyl or -C(O)-NR 1A R 1B and Each R 1 are independently hydrogen, deuterium, halogen, amino, cyano, or optionally C1-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, or -NC(O)R 1A or Two R on the same atom or adjacent atoms 1 combine with the atom(s) to which they are attached to form an optionally substituted 3- to 6-membered carbocyclic ring or an optionally substituted 3- to 6-membered heterocyclic ring; Each R 2 are independently hydrogen, deuterium, or optionally substituted C-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C-C 20 Haloalkyl or optionally substituted C-C 20 is alkylamino, Each R 1A are independently hydrogen, deuterium, or optionally substituted C-C 20 is alkyl, Each R 1B are independently hydrogen, deuterium, optionally substituted 5-membered heteroaryl, optionally substituted C-C 20 Alkyl, optionally substituted C-C 10 Heteroalkyl, or (AA) p2 where: Each AA is an amino acid, p2 is an integer from 1 to 10, j1 is 0 or 1, m1 is an integer of 0 to 3, p1 is 2 or 3, except Z 1 When -O- or -NH-, p1 is 2, Z 1 if not present, then p1 is 3; and In the formula, W 1 Or W 2 One of these is attached to the oligomeric backbone.
[0037] In some embodiments, Z 1 is absent. In some embodiments, Z 1 is —O— or —NH—.
[0038] In some embodiments, W 2 is -C(O)NR 1A R 1B And W 2 is attached to the oligomer backbone. In some embodiments, R 1A is hydrogen, and R 1B is AA, and AA is beta-alanine. In some embodiments, W 2 is -C(O)NH-(beta alanine)-. In some embodiments, W 2 is -C(O)NR 1A R 1B where R 1A is hydrogen, and R 1B is alkyl optionally substituted with oxo (=O). In some embodiments, W 2 is -C(O)NH(CH2)2C(O)-. In some embodiments, W 2 is -C(O)NH-.
[0039] In some embodiments, the DNA binding moiety is 2 In some embodiments, the oligomeric backbone is a linker moiety. In some embodiments, the DNA binding moiety is connected to the oligomeric backbone via W 2 In some embodiments, W 2 is -C(O)NH(CH2)2C(O)-**, where the linker moiety is attached to **. In some embodiments, W2 is -C(O)O(CH2)2C(O)-**, where the linker moiety is attached to **. In some embodiments, W 2 is -C(O)-NH-**, where the linker moiety is attached to **. In some embodiments, W 2 is -C(O)OH-**, where the linker moiety is attached to **. In some embodiments, W 2 is -C(O)-**, where the linker moiety is attached to **.
[0040] In some embodiments, the DNA-binding moiety has the structure of formula (A-4), or a pharma- ceutically acceptable salt thereof:
[0041] [ka]
[0042] In some embodiments, each R 1 are independently halogen, amino, cyano, or optionally C1-C 20 Alkyl or optionally substituted C-C 20 In some embodiments, R 1 is C1-C 20 Alkyl or C1-C 20 In some embodiments, each R 1 are independently -NHC(O)R 1A where R 1A is alkyl, aryl, or heteroaryl. In some embodiments, each R 1 is independently -NH, -NHCH, or -NHC(O)CH(CH). In some embodiments, each R 1 is hydrogen.
[0043] In some embodiments, two R 1In some embodiments, two R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 9 , R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 21 , R 22 , R 23 , R 24 , R 25 , R 26 , R 27 , R 28 , R 30 , R 31 , R 32 , R 33 , R 34 , R 35 , R 36 , R 37 , R 38 , R 39 , R 40 , R 41 , R 42 , R 43 , R 44 , R 1 In some embodiments, two R 1 combine to form an optionally substituted 3- to 6-membered carbocyclic ring. In some embodiments, the carbocyclic ring is a cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl ring. In some embodiments, two R 1 combine to form an optionally substituted 3-6 membered heterocycle optionally containing 1-2 heteroatoms selected from N, O, or S. In some embodiments, the heterocycle is oxetane, tetrahydrofuran, or tetrahydro-2H-pyran.
[0044] In some embodiments, two R 1 In some embodiments, two R on adjacent atoms combine with the atom(s) to which they are attached to form an optionally substituted 3- to 6-membered carbocyclic or heterocyclic ring. 1 In some embodiments, two R on adjacent atoms combine with the atom(s) to which they are attached to form an optionally substituted 3- to 6-membered carbocyclic ring. 1 combine with the atom(s) to which they are attached to form an optionally substituted 3- to 6-membered heterocycle. In some embodiments, cyclization occurs between the α and β carbon atoms or between the β and δ carbon atoms.
[0045] In some embodiments, the DNA binding moiety has the structure of formula (A-5):
[0046] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Ring A' is an optionally substituted C3-C6 carbocyclic ring or an optionally substituted 3- to 6-membered heterocyclic ring.
[0047] In some embodiments, the DNA-binding moiety comprises the structure of formula (A-6), or a pharma- ceutically acceptable salt thereof:
[0048] [ka]
[0049] In some embodiments, the DNA-binding moiety has the structure of formula (A-7), or a pharma- ceutically acceptable salt thereof:
[0050] [ka]
[0051] In some embodiments, Y 2 , Y 4 , and Y 7 are each independently N; Y 1 and Y 3 are each independently CH.
[0052] In some embodiments, Y 6 is CH. In some embodiments, Y 6 is N.
[0053] In some embodiments, X 1 , X 2 , X 3 , X 4 , X 5 , X 6 , and X 7 are each independently -NR 2 It is.
[0054] In some embodiments, the DNA binding moiety has the structure of formula (A-8):
[0055] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Y 8 is CH or N, and R 2A , R 2B , R 2C , R 2D , R 2E , R 2F , and R 2G each independently represents hydrogen, deuterium, or optionally substituted C-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C-C 20 Haloalkyl or optionally substituted C-C 20 It is an alkylamino.
[0056] In some embodiments, the DNA binding moiety has the structure of formula (A-9):
[0057] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Y 8 is CH or N, and R 2A , R 2B , R 2D , R 2E , R 2F , and R 2G each independently represents hydrogen, deuterium, or optionally substituted C-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C-C 20 Haloalkyl or optionally substituted C-C 20 It is an alkylamino.
[0058] In some embodiments, the DNA binding moiety has the structure of formula (A-10):
[0059] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Y 8 is CH or N, and R 2A , R 2B , R 2C , R 2D , R 2E , R 2F , and R 2G each independently represents hydrogen, deuterium, or optionally substituted C-C 20 Alkyl, optionally substituted C1-C 20 Heteroalkyl, optionally substituted C-C 20 Haloalkyl or optionally substituted C-C 20 It is an alkylamino.
[0060] In some embodiments, Y 8 is N. In some embodiments, Y 8 is CH.
[0061] In some embodiments, R 2A , R 2B , R 2C , R 2D , R 2E , R 2F , and R 2G each independently represents hydrogen, deuterium, or optionally substituted C-C 20 Alkyl, optionally substituted C1-C 20 Haloalkyl or optionally substituted C-C 20 It is heteroalkyl.
[0062] In some embodiments, R 2A , R 2B , R 2C , R 2D , R 2E , R 2F , and R 2G each independently represents an optionally substituted C-C 20 In some embodiments, R 2A , R 2B , R 2C , R 2D , R 2E, R 2F , and R 2G each independently represents a straight or branched C-C 20 In some embodiments, R 2A , R 2B , R 2C , R 2D , R 2E , R 2F , and R 2G are each independently optionally substituted methyl, ethyl, isopropyl, n-butyl, isobutyl, sec-butyl, or tert-butyl. 2A , R 2B , R 2C , R 2D , R 2E , R 2F , and R 2G are each independently methyl, ethyl, or tert-butyl.
[0063] In some embodiments, the DNA-binding moiety has the structure of formula (A-11), or a salt thereof:
[0064] [ka]
[0065] In some embodiments, the DNA-binding moiety has the structure of formula (A-12), or a salt thereof:
[0066] [ka]
[0067] In some embodiments, the DNA-binding moiety has the structure of formula (A-13), or a salt thereof:
[0068] [ka]
[0069] In some embodiments, W 1is -C(O)-NR 1A R 1B , or -NR 1A -C(O)-NR 1A R 1B It is.
[0070] In some embodiments, W 1 is hydrogen.
[0071] In some embodiments, W 1 -Z B -P(O)(OR 1A )2, -Z B -(CH2) p3 -P(O)(OR 1A )2, -Z B -(CH2) p3 -OP(O)2(OR 1A )2, wherein Z B is O or N, and p3 is an integer of 1 to 10.
[0072] In some embodiments, W 1 is (azanylidene)methanediamine or (azanylidene)-N,N,N',N'-tetramethylmethanediamine. In some embodiments, W 1 teeth,
[0073] [ka] In some embodiments, W 1 teeth,
[0074] [ka] It is.
[0075] In some embodiments, the DNA binding moiety is 1 In some embodiments, the oligomeric backbone is a linker moiety. In some embodiments, the DNA binding moiety is connected to the oligomeric backbone via W 1 is not connected to the oligomeric backbone via
[0076] In some embodiments, m1 is 0. In some embodiments, m1 is 1. In some embodiments, m1 is 2. In some embodiments, m1 is 3.
[0077] In some embodiments, p1 is 2. In some embodiments, p1 is 3.
[0078] In some embodiments, m1 is 0 or 1 and p1 is 2.
[0079] In some embodiments, n1 is 0. In some embodiments, n1 is 1. In some embodiments, n1 is 2. In some embodiments, n1 is 3.
[0080] In some embodiments, j1 is 0. In some embodiments, j1 is 1.
[0081] The binding affinity between the polyamide and the target gene can be adjusted based on the composition of the polyamide. In some embodiments, the polyamide can bind to DNA with an affinity of less than about 600 nM, about 500 nM, about 400 nM, about 300 nM, about 250 nM, about 200 nM, about 150 nM, about 100 nM, or about 50 nM. In some embodiments, the polyamide can bind to DNA with an affinity of less than about 300 nM. In some embodiments, the polyamide can bind to DNA with an affinity of less than about 200 nM. In some embodiments, the polyamide can bind to DNA with an affinity of more than about 200 nM, about 150 nM, about 100 nM, about 50 nM, about 10 nM, or about 1 nM. In some embodiments, the polyamide can bind to DNA with an affinity in the range of about 1-600 nM, 10-500 nM, 20-500 nM, 50-400 nM, or 100-300 nM.
[0082] In some embodiments, the first end is capable of binding DNA with an affinity of less than 500 nM.
[0083] The binding affinity between a polyamide and a target DNA can be determined using quantitative footprint titration experiments, which are carried out at either 24° C. or 37° C. using either standard polyamide assay solution conditions or approximate intracellular solution conditions to determine the dissociation constant, K, of the polyamide for the target sequence. d This involves measuring
[0084] The binding affinity between the control protein and the ligand on the second terminus can be determined using an assay suitable for the particular protein. The experiment can be performed using either standard protein assay solution conditions or approximate intracellular solution conditions to determine the dissociation constant, K, of the ligand for the protein. d This involves measuring
[0085] The DNA binding moiety, which is the first end of the molecules described herein, has a high binding affinity for sequences with multiple repeats of CAG and binds to the target nucleotide repeat preferentially over other nucleotide repeats or other nucleotide sequences. In some embodiments, the first end has a higher binding affinity for sequences with multiple repeats of CAG than sequences with repeats of CGG. In some embodiments, the first end has a higher binding affinity for sequences with multiple repeats of CAG than sequences with repeats of CCG. In some embodiments, the first end has a higher binding affinity for sequences with multiple repeats of CAG than sequences with repeats of CCTG. In some embodiments, the first end has a higher binding affinity for sequences with multiple repeats of CAG than sequences with repeats of TGGAA. In some embodiments, the first end has a higher binding affinity for sequences with multiple repeats of CAG than sequences with repeats of GGGGCC. In some embodiments, the first end has a higher binding affinity for sequences with multiple repeats of CAGCTG than sequences with repeats of GAA.
[0086] The preferential binding between the first end and the target nucleotide repeats causes the transcriptional regulatory molecules described herein to localize around regions with multiple repeats of CAG. In some embodiments, the concentration local of the first end of the molecules described herein is higher near the sequence with multiple repeats of CAG than near the sequence with repeats of CGG. In some embodiments, the concentration local of the first end of the molecules described herein is higher near the sequence with multiple repeats of CAG than near the sequence with repeats of CCG. In some embodiments, the concentration local of the first end of the molecules described herein is higher near the sequence with multiple repeats of CAG than near the sequence with repeats of CCTG. In some embodiments, the concentration local of the first end or molecules described herein is higher near the sequence with multiple repeats of CAG than near the sequence with repeats of TGGAA. In some embodiments, the concentration local of the first end of the molecules described herein is higher near the sequence with multiple repeats of CAG than near the sequence with repeats of GGGGCC. In some embodiments, the local concentration of the first end of a molecule described herein is higher near a sequence with multiple repeats of CAG than near a sequence with repeats of GAA.
[0087] The DNA binding moiety, which is the first end of the molecule described herein, localizes to a sequence having multiple repeats of CAG and binds to the target nucleotide repeat preferentially over other nucleotide repeats. In some embodiments, the sequence has at least 2, 3, 4, 5, 8, 10, 12, 15, 20, 25, 30, 40, 50, 100, 200, 300, 400, or 500 repeats of CAG. In some embodiments, the sequence comprises at least 1000 nucleotide repeats of CAG. In certain embodiments, the sequence comprises at least 500 nucleotide repeats of CAG. In certain embodiments, the sequence comprises at least 200 nucleotide repeats of CAG. In some embodiments, the sequence comprises at least 100 nucleotide repeats of CAG. In some embodiments, the sequence comprises at least 50 nucleotide repeats of CAG. In some embodiments, the sequence comprises at least 20 nucleotide repeats of CAG.
[0088] Polyamides consisting of preselected combinations of subunits can selectively bind DNA in the minor groove. In their hairpin structure, antiparallel juxtaposed pairs of two aromatic amino acids bind to the DNA sequence with the polyamide rings packed specifically for each DNA base. N-methylpyrrole (Py) preferentially binds to T, A, and C bases except G, N-methylimidazole (Im) is the G leader, and 3-hydroxyl-N-methylpyrrole (Hp) is specific for the thymine base. Nucleotide base pairs can be recognized using various pairings of amino acid subunits using the pairing principles shown in Tables 1A and 1B below. For example, Im / Py pairing symmetry reads G·C, Py / Im pairing reads C·G, Hp / Py pairing can distinguish T·A from A·T, G·C, and C·G, and Py / Py pairing nonspecifically distinguishes both A·T and T·A from G·C and C·G.
[0089] In some embodiments, the first end comprises Im corresponding to the nucleotide G, Im or Nt corresponding to the nucleotide pair G, Py corresponding to the nucleotide C, where Im is N-alkylimidazole, Py is N-alkylpyrrole, Hp is 3-hydroxy-N-methylpyrrole, and β-alanine. In some embodiments, the first end comprises Im / Py corresponding to the nucleotide pair G / C, and Py / Im corresponding to the nucleotide pair C / G, where Im is N-alkylimidazole (e.g., N-methylimidazole), Py is N-alkylpyrrole (e.g., N-methylpyrrole), and Hp is 3-hydroxy-N-methylpyrrole.
[0090] [Table 1-1]
[0091] [Table 1-2]
[0092] [Table 1-3]
[0093] [Table 2-1]
[0094] [Table 2-2]
[0095] The monomer subunits of the polyamide can be linked together according to the pairing principles shown in Tables 1A and 1B. The monomer subunits of the polyamide can be linked together according to the pairing principles shown in Table 1C.
[0096] Table 1C shows examples of monomeric subunits that can be linked to a particular nucleotide. The first end can include a polyamide described as having several monomeric subunits linked together, with the monomeric subunits selected from each column. For example, the polyamide can include Py-Py-Im linked to CAG, where Py is selected from the C column, Py is selected from the A column, and Im is selected from the first G column. The polyamide can be any combination of subunits of CAGCAG with subunits selected from each column of Table 1C, where the subunits are linked together according to the CAG linkage order.
[0097] In addition, the polyamide can also include partial or multiple sets of 5 subunits, for example, 1.5, 2, 2.5, 3, 3.5, or 4 sets of 3 subunits. The polyamide can include 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, and 16 monomer subunits.
[0098] The polyamide can include monomer subunits that bind 2, 3, 4, or 5 nucleotides of CAG. For example, the polyamide can bind CA, CAG, AGC, CAGC, CAGCA, CAGCAG. The polyamide can include monomer subunits that bind 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of the CAG repeat.
[0099] When a monomer subunit is located as a terminal unit, it does not have a terminal amine group, a carbonyl group, or a carboxylic acid group. The terminal carboxylic acid group is replaced with a hydrogen. For example, Py, when used as a terminal unit,
[0100] [ka] (for example,
[0101] [ka] ) when Im is arranged as a terminal unit,
[0102] [ka] (for example,
[0103] [ka] ) is understood to have the following structure.
[0104] [Table 3]
[0105] Recognition of a nucleotide repeat or DNA sequence by two antiparallel polyamide strands relies on the coding of parallel aromatic amino acid pairs in the minor groove, usually oriented N to C relative to the 5' to 3' direction of the DNA helix. Enhanced affinity and specificity of polyamide-nucleotide binding is achieved by covalently linking the antiparallel strands. A "hairpin motif" connects the N- and C-termini of the two strands with a gamma-aminobutyric acid unit (gamma turn), forming a folded linear chain. An "H-pin motif" connects the antiparallel strands by a short flexible bridge across a central or near-central ring / ring pair.
[0106] Second end - Regulatory protein binding portion In some embodiments, the second end comprises a protein-binding moiety capable of binding to a regulatory molecule that regulates expression of a gene having the expanded nucleotide repeat.
[0107] In some embodiments, the second end comprises a bromodomain binding moiety.
[0108] In some embodiments, the second end comprises a bromodomain and a moiety capable of binding to a redundant terminal domain (BET) family member.
[0109] In some embodiments, the BET family member is BRD2, BRD3, BRD4, or BRDT. In some embodiments, the BET family member is BRD2. In some embodiments, the BET family member is BRD3. In some embodiments, the BET family member is BRD4. In some embodiments, the BET family member is BRD3. In some embodiments, the BET family member is BRDT.
[0110] In some embodiments, the bromodomain is CBP / p300, PCAF (P300 / CBP associated factor), CECR2 (Cat Eye Syndrome chromosomal region candidate 2), BRPF (bromodomain and PHD finger containing protein), ATAD2 / ATAD2B (chromatin remodeling protein), TRIM24 (Triple Element Motif-Containing 24), BAZ2 (Zinc Finger Adjacent Bromodomain), or TAF1 (TBP associated factor).
[0111] In some embodiments, the bromodomain is CBP / p300.
[0112] In some embodiments, the bromodomain is PCAF (P300 / CBP associated factor).
[0113] In some embodiments, the bromodomain is CECR2 (Cat Eye Syndrome Chromosomal Region Candidate 2).
[0114] In some embodiments, the bromodomain is BRPF (bromodomain and PHD finger containing protein).
[0115] In some embodiments, the bromodomain is an ATAD2 or ATAD2B chromatin remodeling protein.
[0116] In some embodiments, the bromodomain is BAZ2 (zinc finger adjacent bromodomain).
[0117] In some embodiments, the bromodomain is TAF1 (TBP associated factor).
[0118] In some embodiments, the bromodomain is TRIM24 (tripartite motif-containing 24).
[0119] In some embodiments, the regulatory molecule regulates histone rearrangement.
[0120] In some embodiments, the regulatory molecule modulates glycosylation, phosphorylation, alkylation, or acylation of histones.
[0121] In some embodiments, the regulatory molecule is a transcription factor.
[0122] In some embodiments, the regulatory molecule is an RNA polymerase.
[0123] In some embodiments, the regulatory molecule is a moiety that regulates the activity of an RNA polymerase.
[0124] In some embodiments, the recruitment moiety binds to a regulatory molecule but does not inhibit the activity of the regulatory molecule. In some embodiments, the recruitment moiety binds to a regulatory molecule and inhibits the activity of the regulatory molecule. In some embodiments, the recruitment moiety binds to a regulatory molecule and increases the activity of the regulatory molecule.
[0125] In some embodiments, the recruitment moiety binds to an active site of a regulatory molecule, hi certain embodiments, the recruitment moiety binds to a regulatory site of a regulatory molecule.
[0126] The binding affinity between the regulatory protein and the second end can be adjusted based on the composition of the molecule or the type of protein. In some embodiments, the second end binds to the regulatory molecule with an affinity of less than about 600 nM, about 500 nM, about 400 nM, about 300 nM, about 250 nM, about 200 nM, about 150 nM, about 100 nM, or about 50 nM. In some embodiments, the second end binds to the regulatory molecule with an affinity of less than about 300 nM. In some embodiments, the second end binds to the regulatory molecule with an affinity of less than about 200 nM.
[0127] In some embodiments, the second terminus comprises a diazine or diazepine ring, the diazine or diazepine ring being C6-C 10 It is fused to an aryl or 5-10 membered heteroaryl ring containing one or more heteroatoms selected from S, N, and O. In some embodiments, the second terminus comprises an optionally substituted bicyclic or tricyclic structure.
[0128] In some embodiments, the second terminal has a triazolodiazepine structure. In some embodiments, the second terminal has a thiazolodiazepine structure.
[0129] In some embodiments, the second end has the structure of formula (2-A):
[0130] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Ring A is an optionally substituted aryl or an optionally substituted 5- to 6-membered heteroaryl; Ring B is absent or is an optionally substituted 6-membered monocyclic aryl or heteroaryl; D is C or N; E is O or N; Y A is -NH- or -O-, R 5 is hydrogen, deuterium, or C1-C6 alkyl; R 6 is selected from hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, and optionally substituted C1-C6 hydroxyalkyl; R 7 is hydrogen, deuterium, halogen, -NO2, -CN, optionally substituted aryl, optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 selected from heteroalkyl, optionally substituted C1-C6 haloalkyl, and optionally substituted C1-C6 hydroxyalkyl; Or R 7 -NR 7A R 7B where: R 7A and R 7B each independently represents hydrogen, deuterium, or optionally substituted C-C 20 Alkyl or optionally substituted C-C 20 is heteroalkyl, and x1 is an integer from 1 to 6.
[0131] In some embodiments, D is N and E is N. In some embodiments, D is C and E is O.
[0132] In some embodiments, the second end has the structure of formula (2-B):
[0133] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Ring A is an optionally substituted aryl or an optionally substituted 5- to 6-membered heteroaryl; Ring B is absent or is an optionally substituted 6-membered monocyclic aryl or heteroaryl; Y A is -NH- or -O-, R 5 is hydrogen, deuterium, or C1-C6 alkyl; R6 is selected from hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, and optionally substituted C1-C6 hydroxyalkyl; R 7 is hydrogen, deuterium, halogen, -NO2, -CN, optionally substituted aryl, optionally substituted C1-C 20 Alkyl, optionally substituted C1-C 20 selected from heteroalkyl, optionally substituted C1-C6 haloalkyl, and optionally substituted C1-C6 hydroxyalkyl; Or R 7 -NR 7A R 7B where: R 7A and R 7B each independently represents hydrogen, deuterium, or optionally substituted C-C 20 Alkyl or optionally substituted C1-C 20 is heteroalkyl, and x1 is an integer from 1 to 6.
[0134] In some embodiments, ring A is an optionally substituted aryl ring. In some embodiments, ring A is an optionally substituted phenyl. In some embodiments, ring A is an optionally substituted 5-membered heteroaryl. In some embodiments, ring A is an optionally substituted oxazolyl. In some embodiments, ring A is an optionally substituted furanyl. In some embodiments, ring A is an optionally substituted thiophenyl.
[0135] In some embodiments, the second end has the structure of formula (2-C):
[0136] [ka] or a pharma- ceutically acceptable salt thereof, wherein: R 8 and R 9are each independently selected from hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl.
[0137] In some embodiments, R 8 and R 9 are each independently an optionally substituted C-C alkyl, C-C haloalkyl, or C-C hydroxyalkyl. 8 and R 9 are each independently selected from optionally substituted C1-C6 alkyl. 8 and R 9 is, independently at each occurrence, methyl, ethyl, or propyl. In some embodiments, R 8 and R 9 are each independently methyl. In some embodiments, R 8 and R 9 is, independently at each occurrence, ethyl. In some embodiments, R 8 and R 9 is independently propyl.
[0138] In some embodiments, the second end has the structure of formula (2-D):
[0139] [ka] or a pharma- ceutically acceptable salt thereof, wherein: R 10 is selected from hydrogen, deuterium, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl.
[0140] In some embodiments, R 5 is C1-C6 alkyl. In some embodiments, R 5 is methyl or ethyl. In some embodiments, R 5 is methyl. In some embodiments, R5 is ethyl. In some embodiments, R 5 is hydrogen.
[0141] In some embodiments, R 7 is selected from hydrogen, halogen, optionally substituted C1-C6 alkyl, C1-C6 haloalkyl, or C1-C6 hydroxyalkyl. 7 is halogen. In some embodiments, R 7 is Br, Cl, or F. In some embodiments, R 7 is Cl. In some embodiments, R 7 is F. In some embodiments, R 7 is Br.
[0142] In some embodiments, R 7 -NR 7A R 7B where R 7A and R 7B are each independently hydrogen or optionally substituted C1-C6 alkyl.
[0143] In some embodiments, R 10 is selected from optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl. In some embodiments, R 10 is selected from optionally substituted C1-C6 alkyl. In some embodiments, R 10 is methyl, ethyl, or propyl. In some embodiments, R 10 is methyl. In some embodiments, R 10 is an arbitrarily substituted C 1-6 In some embodiments, R 10 is -OMe.
[0144] In some embodiments, R 6is selected from optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl. In some embodiments, R 6 is an optionally substituted C-C alkyl. In some embodiments, R 6 is methyl, ethyl, or propyl. In some embodiments, R 6 is methyl. In some embodiments, R 6 is ethyl. In some embodiments, R 6 is propyl. In some embodiments, R 6 is hydrogen.
[0145] In some embodiments, Y A In some embodiments, Y A is -O-.
[0146] In some embodiments, Y A is NH and x1 is 1.
[0147] In some embodiments, x1 is an integer from 1 to 5, 1 to 4, 1 to 3, or 1 to 2. In some embodiments, x1 is 1. In some embodiments, x1 is 2.
[0148] In some embodiments, Ring B is an optionally substituted 6-membered monocyclic aryl or heteroaryl, each of which is optionally substituted with alkyl, amino, halogen, hydroxy, hydroxyalkyl, or PEG. In some embodiments, Ring B is phenyl. In some embodiments, Ring B is a 6-membered monocyclic heteroaryl. In some embodiments, Ring B is pyridine or pyrimidine. In some embodiments, Ring B is absent.
[0149] In some embodiments, the second end comprises the structure of formula (2-E), or a pharma- ceutically acceptable salt thereof:
[0150] [ka]
[0151] In some embodiments, the second end comprises the structure of formula (2-F), or a pharma- ceutically acceptable salt thereof:
[0152] [ka]
[0153] In some embodiments, the second end comprises the structure of formula (2-G), or a pharma- ceutically acceptable salt thereof:
[0154] [ka]
[0155] In some embodiments, the second end has the structure of formula (3-A):
[0156] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Y B is -CHNH-, -CHO-, -NH-, or -O-, R 11A and R 11B are each independently hydrogen, deuterium, or optionally substituted C1-C6 alkyl; R 12 is hydrogen, halogen, -OH, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl; R 14 and R 15 are each independently hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl; Or R 14 -NR A R B and R 16 is an optionally substituted C1-C6 alkyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C2-C6 alkenyl, an optionally substituted C2-C6 alkynyl, a C1-C6 hydroxyalkyl, -SO2R A , or -NHSO2R A and R Y is hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted 5-6 membered monocyclic aryl or heteroaryl; Each R A and R B are independently hydrogen, deuterium, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl; and y1 is 1 to 3; and The bond to the linker is R 14 or R Y The present invention relates to any of the following:
[0157] In some embodiments, the second end has the structure of formula (3-B):
[0158] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Ring C is absent or an optionally substituted 5- to 6-membered monocyclic aryl or heteroaryl, or a 4- to 8-membered heterocycle; Y B is -NH-, -CHNH-, -CHO-, or -O-, R 11A and R 11B are each independently hydrogen, deuterium, or optionally substituted C1-C6 alkyl; R 12 is hydrogen, deuterium, optionally substituted C1-C6 alkyl, C(O)R A or C(O)NRA R B where: Each R A and R B are independently hydrogen, deuterium, optionally substituted C-C alkyl, or optionally substituted C-C heteroalkyl; R 13 is hydrogen, a substituted aryl, a substituted heteroaryl, or a substituted oxydibenzene; and y2 is an integer from 0 to 2.
[0159] In some embodiments, y2 is 0. In some embodiments, y2 is 1. In some embodiments, y2 is 2.
[0160] In some embodiments, R 13 is substituted aryl or substituted heteroaryl. In some embodiments, R 13 is hydrogen.
[0161] In some embodiments, R 13 is a substituted oxydibenzene.
[0162] In some embodiments, R 13 teeth,
[0163] [ka] where: R 14 and R 15 are each independently hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl; Or R 14 -NR A R B and R 16is an optionally substituted C1-C6 alkyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C2-C6 alkenyl, an optionally substituted C2-C6 alkynyl, a C1-C6 hydroxyalkyl, -SO2R A , or -NHSO2R A and Each R A and R B are independently hydrogen, deuterium, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl; and y1 is 1 to 3.
[0164] In some embodiments, the second end has the structure of formula (3-C):
[0165] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Ring C is absent or an optionally substituted 5- to 6-membered monocyclic aryl or heteroaryl, or a 4- to 8-membered heterocycle; Y B is -NH-, -CHNH-, -CHO-, or -O-, R 14 and R 15 are each independently hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl; Or R 14 -NR A R B where: Each R A and R B are independently hydrogen, deuterium, optionally substituted C-C alkyl, or optionally substituted C-C heteroalkyl; R 16is an optionally substituted C1-C6 alkyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C2-C6 alkenyl, an optionally substituted C2-C6 alkynyl, a C1-C6 hydroxyalkyl, -SO2R A , or -NHSO2R A and y1 is an integer from 1 to 3.
[0166] In some embodiments, Y B In some embodiments, Y B In some embodiments, Y B In some embodiments, Y B is -O-.
[0167] In some embodiments, Ring C is an optionally substituted 5- or 6-membered monocyclic aryl or heteroaryl, each of which is optionally substituted with alkyl, amino, halogen, hydroxy, hydroxyalkyl, or PEG.
[0168] In some embodiments, ring C is phenyl. In some embodiments, ring C is a 6-membered heteroaryl. In some embodiments, ring C is pyridine, pyrazine, or triazine. In some embodiments, ring C is pyridine. In some embodiments, ring C is pyrazine. In some embodiments, ring C is triazine. In some embodiments, ring C is 5-membered heteroaryl. In some embodiments, ring C is pyrazole. In some embodiments, ring C is triazole, pyrrole, imidazole, oxazole, oxadiazole, thiazole, or thiadiazole. In some embodiments, ring C is triazole. In some embodiments, ring C is imidazole or pyrrole. In some embodiments, oxazole or oxadiazole. In some embodiments, ring C is thiazole or thiadiazole.
[0169] In some embodiments, ring C is absent.
[0170] In some embodiments, the second end comprises the structure of formula (3-D), or a pharma- ceutically acceptable salt thereof:
[0171] [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein: R 11A and R 11B are each independently hydrogen, deuterium, or optionally substituted C1-C6 alkyl; R 12 is hydrogen, deuterium, optionally substituted C1-C6 alkyl, C(O)R A or C(O)NR A R B and Each R 15 are independently hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl; R 16 is an optionally substituted C1-C6 alkyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C2-C6 alkenyl, an optionally substituted C2-C6 alkynyl, an optionally substituted C1-C6 hydroxyalkyl, -SO2R A , or -NHSO2R A where: Each R A and R B are independently hydrogen, deuterium, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl; and y1 is an integer from 1 to 3.
[0172] In some embodiments, R 11A and R 11B are each independently an optionally substituted C-C alkyl. In some embodiments, R 11A and R 11Bare each independently methyl, ethyl, propyl, or tert-butyl. 11A and R 11B are each independently methyl. In some embodiments, R 11A and R 11B are each independently hydrogen.
[0173] In some embodiments, R 11A is C1-C6 alkyl optionally substituted with haloalkyl or phosphorus hydroxide. In some embodiments, R 11A is C1-C6 alkyl substituted with -OP(O)(OH). In some embodiments, R 11A is unsubstituted C1-C6 alkyl. In some embodiments, R 11A is methyl, ethyl, or tert-butyl. In some embodiments, R 11A is methyl. In some embodiments, R 11A is hydrogen.
[0174] In some embodiments, R 12 is an optionally substituted C-C alkyl. In some embodiments, R 12 is hydrogen.
[0175] In some embodiments, R 12 is C(O)R A or C(O)NR A R B In some embodiments, R 12 is C(O)NR A R B where R A and R B are each independently hydrogen or optionally substituted C1-C6 alkyl.
[0176] In some embodiments, R 14 and R 15 are each independently hydrogen, -CN, or -NO. In some embodiments, R 14 and R 15are each independently halogen or optionally substituted C-C alkyl. In some embodiments, R 14 and R 15 are each independently Br, Cl, F, methyl, or ethyl. In some embodiments, R 14 and R 15 are each independently F or methyl.
[0177] In some embodiments, R 16 is an optionally substituted C1-C6 alkyl, an optionally substituted C1-C6 heteroalkyl, an optionally substituted C2-C6 alkenyl, an optionally substituted C2-C6 alkynyl, or an optionally substituted C1-C6 hydroxyalkyl, each of which is optionally substituted with amido, alkyl, alkynyl, azido, amino, halogen, haloalkyl, hydroxy, nitro, oxo (=O), phosphorus hydroxide, or PEG.
[0178] In some embodiments, R 16 is an optionally substituted C-C alkyl, an optionally substituted C-C heteroalkyl, or an optionally substituted C-C hydroxyalkyl. In some embodiments, R 16 is C1-C6 alkyl or C1-C6 heteroalkyl, each or each of which is optionally substituted with -CN, -NH2, -N3, -OH, CF3, or -OP(O)(OH)2.
[0179] In some embodiments, R 16 is -SO2R A where R A is C1-C6 alkyl. In some embodiments, R 16 is -SO2Et. In some embodiments, R 16 is -SO2Me.
[0180] In some embodiments, R 16 is -NHSO2R A where R Ais C1-C6 alkyl. In some embodiments, R 16 is -NHSO2Et. In some embodiments, R 16 is -NHSO2Me.
[0181] In some embodiments, y1 is 1. In some embodiments, y1 is 2. In some embodiments, y1 is 3.
[0182] In some embodiments, the second end comprises the structure of formula (3-E), or a pharma- ceutically acceptable salt thereof:
[0183] [ka]
[0184] In some embodiments, the second end comprises the structure of formula (3-F), or a pharma- ceutically acceptable salt thereof:
[0185] [ka]
[0186] In some embodiments, the second end comprises a structure of formula (3-G) or formula (3-H), or a pharma- ceutically acceptable salt thereof:
[0187] [ka]
[0188] [ka]
[0189] In some embodiments, the second end has the structure of formula (4-A):
[0190] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Ring D is absent, phenyl, or 5- to 6-membered heteroaryl; X 9 and X 10 are each independently C or N, and X 9 Or X 10 One of them is N, L 2 is absent, optionally substituted alkylene, -O-, or -NR D - in which R D is hydrogen, deuterium, or optionally substituted C1-C3 alkyl; R 18 is an optionally substituted 5-6 membered heteroaryl; R 19 is an optionally substituted C3-C8 cycloalkyl or an optionally substituted 4-7 membered heteroaryl; Each R 20 are independently hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl; x3 is an integer from 1 to 3; and y3 is an integer from 1 to 4, and The bond to the linker is R 19 or R 20 It is in one of the following:
[0191] In some embodiments, the bond to the linker is R 19 This is in.
[0192] In some embodiments, the bond to the linker is R 20 This is in one of the following.
[0193] In some embodiments, the second end has the structure of formula (4-B):
[0194] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Ring D is absent, optionally substituted phenyl, or optionally substituted 5- to 6-membered heteroaryl; X 9 and X 10 are each independently C or N, and X 9 Or X 10 One of them is N, L 2 is absent, optionally substituted alkylene, -O-, or -NR D - in which R D is hydrogen, deuterium, or optionally substituted C1-C3 alkyl; R 18 is an optionally substituted 5-6 membered heteroaryl; R 19 is an optionally substituted C3-C8 cycloalkyl or an optionally substituted 4-7 membered heteroaryl, and x3 is an integer from 1 to 3.
[0195] In some embodiments, X 9 is N and X 10 is C. In some embodiments, X 9 is C and X 10 is N.
[0196] In some embodiments, the second end comprises the structure of formula (4-C), or a pharma- ceutically acceptable salt thereof:
[0197] [ka]
[0198] In some embodiments, ring D is an optionally substituted monocyclic 6-membered aryl or 5-6 membered heteroaryl. In some embodiments, ring D is an optionally substituted monocyclic 6-membered aryl. In some embodiments, ring D is an optionally substituted phenyl.
[0199] In some embodiments, R 19 is an optionally substituted C-C cycloalkyl. In some embodiments, R 19 is an optionally substituted 4-7 membered heteroaryl.
[0200] In some embodiments, the second end has the structure of formula (4-D):
[0201] [ka] or a pharma- ceutically acceptable salt thereof, wherein: L 2 is an optionally substituted alkylene, -O-, or -NR D - in which R D is hydrogen, deuterium, or optionally substituted C1-C3 alkyl; R 18 is an optionally substituted 5-6 membered heteroaryl; R 20 is hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl; x3 is an integer from 1 to 3; and y3 is an integer from 1 to 4.
[0202] In some embodiments, L 2 is an optionally substituted alkylene. In some embodiments, L 2 is a C2-C4 alkylene optionally substituted with one or more C1-C3 alkyl. 2 does not exist.
[0203] In some embodiments, L 2 -NR D In some embodiments, L 2 is -NH-.
[0204] In some embodiments, R 18 is an optionally substituted 5-membered heteroaryl. In some embodiments, R 18 is an optionally substituted oxazole, oxadiazole, thiazole, thiadiazole, pyrrole, or pyrazole. In some embodiments, R 18 is an optionally substituted oxazole.
[0205] In some embodiments, R 20 is halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl.
[0206] In some embodiments, x3 is 1. In some embodiments, x3 is 2. In some embodiments, x3 is 3.
[0207] In some embodiments, y4 is 1 or 2. In some embodiments, y4 is 1. In some embodiments, y4 is 2. In some embodiments, y4 is 3. In some embodiments, y4 is 4.
[0208] In some embodiments, the second end comprises a structure of formula (4-E) or formula (4-F), or a pharma- ceutically acceptable salt thereof:
[0209] [ka]
[0210] [ka]
[0211] In some embodiments, the second terminus comprises the structure of formula (4-G), or a pharma- ceutically acceptable salt thereof:
[0212] [ka]
[0213] In some embodiments, the second end has the structure of formula (5-A):
[0214] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Ring E is absent or is an optionally substituted phenyl, or an optionally substituted 5- to 6-membered heteroaryl; X 11 is CH or N, L 3 -NR E -or-CR E R E - in which Each R E are independently hydrogen, deuterium, or optionally substituted C1-C3 alkyl; R 21 is C1-C6 alkyl or C3-C6 cycloalkyl, and R 22 is halogen, CN, NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl.
[0215] In some embodiments, ring E is absent. In some embodiments, ring E is an optionally substituted phenyl. In some embodiments, ring E is an optionally substituted 5-6 membered heteroaryl. In some embodiments, ring E is a 5 membered heteroaryl. In some embodiments, ring E is a 6 membered heteroaryl.
[0216] In some embodiments, X 11 is CH, and L 3 is NR E In some embodiments, X 11 is N and L 3-CR E R E -It is.
[0217] In some embodiments, R 21 is C1-C6 alkyl. In some embodiments, R 21 is methyl.
[0218] In some embodiments, R 22 is halogen, optionally substituted C-C alkyl, optionally substituted C-C haloalkyl, or optionally substituted C-C hydroxyalkyl. In some embodiments, R 22 is CN, F, Cl, Br, or methyl.
[0219] In some embodiments, the second end comprises the structure of formula (5-B), or a pharma- ceutically acceptable salt thereof:
[0220] [ka]
[0221] In some embodiments, the second end has the structure of formula (6-A):
[0222] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Ring G is an optionally substituted C3-C6 cycloalkyl or an optionally substituted 4-6 membered heterocycloalkyl; L 6 is -O-(optionally substituted alkylene); R 28 is an optionally substituted 5-6 membered heteroaryl; R 29 is an optionally substituted C1-C6 alkyl (C6-C 10 aryl) or optionally substituted C1-C6 alkyl (6-10 membered heteroaryl); and R30 is an optionally substituted C1-C6 alkyl, an optionally substituted C1-C6 haloalkyl, or an optionally substituted C1-C6 hydroxyalkyl.
[0223] In some embodiments, the second end has the structure of formula (7-A):
[0224] [ka] or a pharma- ceutically acceptable salt thereof, wherein: A 5 is -O-, -NH-, or -CH2-, Z 1 is CH or N, W is O or S; Each R 31 are independently hydrogen, halogen, -OH, -CN, -NO2, -NH2, optionally substituted C1-C 10 Alkyl, optionally substituted C1-C 10 Haloalkyl, optionally substituted C-C 10 Hydroxyalkyl, optionally substituted C2-C 10 Alkenyl, optionally substituted C-C 10 alkynyl, optionally substituted C3-C8 cycloalkyl, or optionally substituted 3-8 membered heterocycloalkyl; Or two R's 31 are linked together with the atoms to which they are attached to form an optionally substituted C5-C8 cycloalkyl or an optionally substituted 5-8 membered heterocycloalkyl; R 32 is hydrogen or an optionally substituted C-C 10 is alkyl, R 33 is hydrogen, halogen, -OH, -CN, -NO2, -NH2, optionally substituted C1-C 10 Alkyl, optionally substituted C1-C 10 Haloalkyl or optionally substituted C-C 10 is hydroxyalkyl, and q6 is 0 to 4.
[0225] In some embodiments, Z 1 is CH. In some embodiments, Z 1 is N.
[0226] In some embodiments, W is O. In some embodiments, W is S.
[0227] In some embodiments, each R 31 are independently optionally substituted C-C 10 Alkyl, optionally substituted C1-C 10 Haloalkyl or optionally substituted C-C 10 In some embodiments, each R 31 is independently an optionally substituted C-C cycloalkyl or an optionally substituted 3- to 8-membered heterocycloalkyl. 31 is independently hydrogen, halogen, -OH, -CN, -NO, or -NH. In some embodiments, each R 31 is hydrogen.
[0228] In some embodiments, R 32 is an optionally substituted C1-C 10 In some embodiments, R 32 is methyl. In some embodiments, R 32 is hydrogen.
[0229] In some embodiments, R 33 is hydrogen, halogen, -OH, -CN, -NO2, or -NH2. In some embodiments, R 33 is an optionally substituted C1-C 10 Alkyl, optionally substituted C1-C 10 Haloalkyl or optionally substituted C-C 10 It is a hydroxyalkyl.
[0230] In some embodiments, the second terminus comprises the structure of formula (7-B), or a pharma- ceutically acceptable salt thereof:
[0231] [ka]
[0232] In some embodiments, the second end has the structure of formula (8-A):
[0233] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Ring H is optionally substituted phenyl or optionally substituted 6-membered heteroaryl; Or, ring H is
[0234] [ka] and Z B is absent or optionally substituted phenylformamide; X 12 is CH or N, R 34 is an optionally substituted phenyl or an optionally substituted 6-membered heteroaryl; R 34A is hydrogen, halogen, or optionally substituted C1-C3 alkyl; R 33 are independently halogen, optionally substituted C-C 10 alkyl, or an optionally substituted 5-membered heteroaryl; and The bond to the linker is R 35 , Z B , or in ring H.
[0235] In some embodiments, Ring H is an optionally substituted phenyl. In some embodiments, Ring H is an optionally substituted 6-membered heteroaryl.
[0236] In some embodiments, ring H is
[0237] [ka] It is.
[0238] In some embodiments, Z B is absent. In some embodiments, Z B is an optionally substituted phenylformamide. In some embodiments, Z B is -C(O)NH-phenyl.
[0239] In some embodiments, X 12 is CH. In some embodiments, X 12 is N.
[0240] In some embodiments, R 34 is optionally substituted phenyl. In some embodiments, R 34 is an optionally substituted 6-membered heteroaryl.
[0241] In some embodiments, R 34A is hydrogen or halogen. In some embodiments, R 34A is an optionally substituted C-C alkyl. In some embodiments, R 34A is methyl.
[0242] In some embodiments, formula (8-A) is R 35 In some embodiments, formula (8-A) is a bond to a linker at Z B In some embodiments, formula (8-A) is attached to the linker at ring H.
[0243] In some embodiments, the second end comprises a structure of formula (8-B) or formula (8-C), or a pharma- ceutically acceptable salt thereof:
[0244] [ka]
[0245] [ka]
[0246] In some embodiments, the second terminus comprises the structure of formula (8-D), or a pharma- ceutically acceptable salt thereof:
[0247] [ka]
[0248] In some embodiments, the second end comprises the structure of formula (9-A), or a pharma- ceutically acceptable salt thereof:
[0249] [ka]
[0250] In some embodiments, the second end comprises a structure of Formula (10-A) or Formula (10-B), or a pharma- ceutically acceptable salt thereof:
[0251] [ka]
[0252] [ka]
[0253] In some embodiments, the second terminus comprises the structure of formula (11-A), or a pharma- ceutically acceptable salt thereof:
[0254] [ka]
[0255] In some embodiments, the second end is
[0256] [ka] and
[0257] [ka] or a pharma- ceutically acceptable salt thereof.
[0258] In some embodiments, the second terminus is selected from a moiety set forth in Table 2, or a pharma- ceutically acceptable salt thereof.
[0259] [Table 4-1]
[0260] [Table 4-2]
[0261] [Table 4-3]
[0262] Oligomeric backbone - linker portion The oligomeric backbone is a linker connecting the first and second ends, bringing the regulatory molecule into proximity with the target gene to modulate gene expression.
[0263] The length of the linker also depends on the type of regulatory protein and the target gene. In some embodiments, the linker has a length of less than about 50 angstroms. In some embodiments, the linker has a length of about 20-30 angstroms.
[0264] In some embodiments, the oligomeric backbone comprises between 5 and 50 chain atoms.
[0265] In some embodiments, the oligomeric backbone comprises multimers having 2-50 spacing moieties; Each spacing part can be independently -((CR 3a R 3b ) x -O) y -, -((CR 3a R 3b ) x -NR 4a ) y -, -((CR 3a R 3b ) x -CH=CH-(CR 3a R 3b ) x -O) y -, optionally substituted C1-C 12 Alkyl, optionally substituted C-C 10 Alkenyl, optionally substituted C-C 10 Alkynyl, optionally substituted C-C 10 Arylene, optionally substituted C3-C7 cycloalkylene, optionally substituted 5-10 membered heteroarylene, optionally substituted 4-10 membered heterocycloalkylene, amino acid residue, -O-, -C(O)NR 4a -, -NR 4a C(O)-, -C(O)-, -NR 1a -, -C(O)O-, -S-, -S(O)-, -S(O)2-, -S(O)2NR 4a -, -NR 4a S(O)-, -P(O)OH-, and combinations thereof, each x is independently 2 to 4; each y is independently 1 to 10; Each R 1a is independently hydrogen or optionally substituted C1-C6 alkyl; Each R 3a and R 3bis independently selected from hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted amino, carboxyl, carboxyl ester, acyl, acyloxy, acylamino, aminoacyl, optionally substituted alkylamido, sulfonyl, optionally substituted thioalkoxy, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, and optionally substituted heterocyclyl; and Each R 4a is independently hydrogen or optionally substituted C1-C6 alkyl.
[0266] In some embodiments, the oligomer backbone comprises a multimer having 2-50 spacing moieties, each spacing moiety being independently an optionally substituted C-C 12 Alkyl, -((CH2) x -O) y -, -((CH2) x -NH y -, -O-, -C(O)NH-, -NH-, and any combination thereof.
[0267] In some embodiments, the oligomer backbone is -(T 1 -V 1 ) a -(T 2 -V 2 ) b -(T 3 -V 3 ) c -(T 4 -V 4 ) d -(T 5 -V 5 ) e -, wherein a, b, c, d, and e each independently represent 0 or 1, and the sum of a, b, c, d, and e is 1 to 5; T 1 , T 2 , T 3 , T 4 , and T 5each independently represents an optionally substituted C-C 12 Alkylene, optionally substituted alkenylene, optionally substituted alkynylene, (EA) w , (EDA) m , (PEG) n , (modified PEG) n , (AA) p , -(CR 2a OH) h -, optionally substituted C6-C 10 selected from arylene, optionally substituted C3-C7 cycloalkylene, optionally substituted 5-10 membered heteroarylene, optionally substituted 4-10 membered heterocycloalkylene, acetal groups, disulfides, hydrazines, carbohydrates, beta-lactams, and esters; (a) w is an integer from 1 to 20, (b) m is an integer from 1 to 20; (c) n is an integer from 1 to 30, (d) p is an integer from 1 to 20, (e) h is an integer from 1 to 12, (f) EA has the following structure:
[0268] [ka] (g) EDA has the following structure:
[0269] [ka] In the formula, each q is independently an integer from 1 to 6, each x is independently an integer from 1 to 4, and each r is independently 0 or 1; (h)(PEG) n is -(CR 2a R 2b -CR 2a R 2b -O) n -CR 2a R 2b -having the structure (i)(Modified PEG) n is (PEG) nAt least one of -(CR 2a R 2b -CR 2a R 2b -O)-(CH2-CR 2a =CR 2a -CH2-O)- or -(CR 2a R 2b -CR 2a R 2b -S)-, (j) AA is an amino acid residue, (k)V 1 , V 2 , V 3 , V 4 and V 5 each independently represents a bond, C(O)-, or -NR 1a -, -C(O)NR 1a -, -NR 1a C(O)-, -CONR 1a -C1-C4 alkyl-, -NR 1a C(O)-C1-C4 alkyl-, -C(O)O-, -OC(O)-, -O-, -S-, -S(O)-, -S(O)2-, -S(O)2NR 1a -, -NR 1a -S(O)-, -P(O)OH-, (l)Each R 1a is independently hydrogen or / and optionally substituted C1-C6 alkyl, and Each R 2a and R 2b is independently selected from hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, halogen, alkoxy, substituted alkoxy, amino, substituted amino, carboxyl, carboxyl ester, acyl, acyloxy, acylamino, aminoacyl, alkylamido, substituted alkylamido, sulfonyl, thioalkoxy, substituted thioalkoxy, aryl, substituted aryl, heteroaryl, substituted heteroaryl, cycloalkyl, substituted cycloalkyl, heterocyclyl, and substituted heterocyclyl.
[0270] In some embodiments, a, b, c, d, and e are each independently 0 or 1, and the sum of a, b, c, d, and e is 1. In some embodiments, a, b, c, d, and e are each independently 0 or 1, and the sum of a, b, c, d, and e is 2. In some embodiments, a, b, c, d, and e are each independently 0 or 1, and the sum of a, b, c, d, and e is 3. In some embodiments, a, b, c, d, and e are each independently 0 or 1, and the sum of a, b, c, d, and e is 4. In some embodiments, a, b, c, d, and e are each independently 0 or 1, and the sum of a, b, c, d, and e is 5.
[0271] In some embodiments, n is 3 to 9. In some embodiments, n is 4 to 8. In some embodiments, n is 5 or 6.
[0272] In some embodiments, T 1 , T 2 , T 3 , and T 4 , and T 5 are each independently C1-C 12 Alkyl, substituted C1-C 12 Alkyl, (EA) w , (EDA) m , (PEG) n , (modified PEG) n , (AA) p , -(CR 2a OH) h -, phenyl, substituted phenyl, piperidine-4-amino (P4A), para-amino-benzyloxycarbonyl (PABC), meta-amino-benzyloxycarbonyl (MABC), para-amino-benzyloxy (PABO), meta-amino-benzyloxy (MABO), para-aminobenzyl, acetal group, disulfide, hydrazine, carbohydrate, beta-lactam, ester, (AA) p -MABC-(AA) p , (AA) p -MABO-(AA) p , (AA) p-PABO-(AA) p , and (AA) p -PABC-(AA) p In some embodiments, piperidine-4-amino (P4A) is selected from:
[0273] [ka] where R 1a is hydrogen or C1-C6 alkyl.
[0274] In some embodiments, T 1 , T 2 , T 3 , T 4 , and T 5 are each independently (C1-C 12 ) Alkyl, substituted C1-C 12 Alkyl, (EA) w , (EDA) m , (PEG) n , (modified PEG) n , (AA) p , -(CR 2a OH) h -, optionally substituted C6-C 10 arylene, 4-10 membered heterocycloalkene, and optionally substituted 5-10 membered heteroarylene. In some embodiments, EA has the structure:
[0275] [ka] and EDA has the following structure:
[0276] [ka]
[0277] In some embodiments, for EA and EDA, x is 2 to 3 and q is 1 to 3. In some embodiments, R 1a is hydrogen or C1-C6 alkyl.
[0278] In some embodiments, T 4 Or T 5 is an optionally substituted C6-C 10 It is Arylene.
[0279] In some embodiments, T 4 Or T 5 is phenylene or substituted phenylene. In some embodiments, T 4 Or T 5 is phenylene or phenylene substituted with 1-3 substituents selected from C1-C6 alkyl, halogen, OH, or amine. In some embodiments, T 4 Or T 5 is 5-10 membered heteroarylene or substituted heteroarylene. In some embodiments, T 4 Or T 5 is 4-10 membered heterocyclylene or substituted heterocyclylene. In some embodiments, T 4 Or T 5 is heteroarylene or heterocyclene optionally substituted with 1 to 3 substituents selected from C1-C6 alkyl, halogen, OH, or amine.
[0280] In some embodiments, T 1 , T 2 , T 3 , T 4 , and T 5 , and V 1 , V 2 , V 3 , V 4 , and V 5 is selected from Table 3 below.
[0281] [Table 5]
[0282] In some embodiments, the oligomer backbone is N(R 1a )(CH2) x N(R1b )(CH2) x N-, wherein R 1a and R 1b are each independently selected from hydrogen or optionally substituted C1-C6 alkyl, and each x is independently an integer ranging from 1 to 6.
[0283] In some embodiments, the oligomer backbone is -(CH-C(O)N(R 4a )-(CH2) q -N(R 4a )-(CH2) q -N(R 4a )C(O)-(CH2) x -C(O)N(R 4a )-A-, -(CH2) x -C(O)N(R 4a )-(CH2CH2O) y (CH2) x -C(O)N(R 4a )-A- or -C(O)N(R 4a )-(CH2) q -N(R 4a )-(CH2) q -N(R 4a )C(O)-(CH2) x -A-, wherein each q is independently an integer from 2 to 10, each x is independently an integer from 1 to 6, and each A is independently a bond, an optionally substituted C-C 12 Alkyl, optionally substituted C-C 10 It is selected from arylene, optionally substituted C3-C7 cycloalkylene, optionally substituted 5-10 membered heteroarylene, and optionally substituted 4-10 membered heterocycloalkylene.
[0284] In some embodiments, the oligomer backbone is -(CH2CH2-O) x1 -or-(CHCH-O) x2 -A-(CH2CH2-O) x3 wherein A is an optionally substituted 4-10 membered heterocycloalkylene or spirocyclene and each x1, x2, and x3 is independently an integer from 1 to 15.
[0285] In some embodiments, the oligomer backbone is -NR 4a -(CH2CH2O) y (CH2) x -OR-NR 4a -(CH2) q -C(O)NR 4a (CH2CH2O) y (CH2) x wherein q is 2 to 10, x is 1 to 4, and y is 1 to 50; 4a are independently hydrogen or an optionally substituted C1-C6 alkyl. In some embodiments, the oligomer backbone is -NR 4a -(CH2CH2O) y (CH2) x In some embodiments, the oligomer backbone comprises -NR 4a -(CH2) q -C(O)NR 4a (CH2CH2O) y (CH2) x - Including.
[0286] In some embodiments, the oligomer backbone is -(CH2CH2-O) x1 -, -(CH2CH2-O) x1 -(CH2CH2)-NH-, -NH-(CH2CH2-O) x1 -, -NH-(CH2CH2-O) x1 -(CH2CH2)-NH-, -(CH2CH2-O) x1 -(CH2CH2)-NHC(O)- or -NH-(CH2CH2-O) x1 In some embodiments, the oligomer backbone comprises -NH-(CHCH-O)-. x1 - or -NH-(CHCH-O) x1 In some embodiments, the oligomer backbone comprises -NH-(CHCH-O) x1 In some embodiments, the oligomer backbone comprises -NH-(CH2CH2-O) x1 Includes -(CH2CH2)-NH-.
[0287] In some embodiments, the oligomer backbone comprises polyethylene glycol (PEG). In some embodiments, the oligomer backbone comprises 1 to 20 PEG units. In some embodiments, the oligomer backbone comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 PEG units.
[0288] In some embodiments, A is
[0289] [ka]
[0290] [ka] or
[0291] [ka] In some embodiments, A is selected from:
[0292] [ka] In some embodiments, A is
[0293] [ka] In some embodiments, A is
[0294] [ka] It is.
[0295] In some embodiments, A is a moiety having the structure:
[0296] [ka] or a pharma- ceutically acceptable salt thereof, wherein: X 13 is absent or is -C(O)-, and R 27 is an optionally substituted C1-C 50 Alkyl or optionally substituted C-C 50 It is heteroalkyl.
[0297] In some embodiments, X 13 is -C(O)-. In some embodiments, X 13 does not exist.
[0298] In some embodiments, R 27 is C1-C 50 In some embodiments, R 27 is C1-C 40 In some embodiments, R 27 is C1-C 30 In some embodiments, R 27 is C1-C 20 In some embodiments, R 27 is C1-C 10 In some embodiments, R 27 is C1-C 50 In some embodiments, R 26 is C1-C 40 In some embodiments, R 27 is C1-C 30 In some embodiments, R 27 is C1-C 20 In some embodiments, R 27 is C1-C 10 Heteroalkyl. In some embodiments, the heteroalkyl is polyethylene glycol (PEG).
[0299] In some embodiments, the oligomer backbone comprises a moiety having the structure of formula (C-1):
[0300] [ka]
[0301] or a pharma- ceutically acceptable salt thereof, wherein: Ring F is absent, arylene, or heterocycloalkylene; L 5 is absent, optionally substituted alkylene, or optionally substituted alkynylene; Y 9 and Y 10 are each independently CH or N; s1 and s2 are each independently 0 to 3; and ** indicates attachment to the second end.
[0302] In some embodiments, ring F is absent. In some embodiments, ring F is a C4-C7 heterocycloalkylene.
[0303] In some embodiments, Y 9 is N. In some embodiments, Y 9 is CH.
[0304] In some embodiments, Y 10 is N. In some embodiments, Y 10 is CH.
[0305] In some embodiments, L 5 does not exist.
[0306] In some embodiments, L 5 is alkylene or alkynylene.
[0307] In some embodiments, L 5 is -(C R1G R 1G )x -(Alkylene)2-(CR 1G R 1G ) y -, wherein x and y are each independently 0 or 1; 1G is hydrogen or C1-C3 alkyl.
[0308] In some embodiments, the oligomer backbone comprises a moiety having the structure of formula (C-2):
[0309] [ka] or a pharma- ceutically acceptable salt thereof, wherein: Y 10 , Y 11 and Y 12 are each independently N or CH.
[0310] In some embodiments, Y 11 and Y 12 Each of Y is independently N or CH; 10 is N.
[0311] In some embodiments, L 5 is C1-C3 alkylene or C1-C3 alkynylene. In some embodiments, L 5 is C1-C3 alkylene. In some embodiments, L 5 is C1-C3 alkynylene. In some embodiments, L 5 is -CH2-, -CH2CH2-,
[0312] [ka] or
[0313] [ka] In some embodiments, L 5 is -CH- or -CHCH-. In some embodiments, L5 teeth,
[0314] [ka] In some embodiments, L 5 teeth,
[0315] [ka] It is.
[0316] In some embodiments, the oligomeric backbone comprises a moiety having the structure of formula (C-3):
[0317] [ka] or a pharma- ceutically acceptable salt thereof, wherein: s1 and s2 each independently represent 0 to 3; r1 is an integer from 1 to 3; R 26 is an optionally substituted C1-C 20 Alkylene or optionally substituted C-C 20 is heteroalkylene, Each R 1G is independently hydrogen or C1-C3 alkyl; and ** indicates attachment to the second end.
[0318] In some embodiments, R 26 is an optionally substituted C1-C 20 In some embodiments, R 26 is PEG.
[0319] In some embodiments, each R 1G is independently hydrogen. In some embodiments, each R 1G is independently C1-C3 alkyl. In some embodiments, C1-C3 alkyl is methyl, ethyl, or propyl. In some embodiments, each R1G is independently methyl.
[0320] In some embodiments, s1 and s2 are each independently 0, 1, or 2. In some embodiments, s1 and s2 are each independently 0. In some embodiments, s1 and s2 are each independently 1.
[0321] In some embodiments, r1 is 1 or 2. In some embodiments, r1 is 1. In some embodiments, r1 is 2.
[0322] In some embodiments, the oligomeric backbone is
[0323] [ka] Includes.
[0324] In some embodiments, the oligomer backbone is -C(O)-, -NR 1a -, -C(O)NR 1a -, -NR 1a C(O)-, -C(O)NR 1a C1-C4 alkyl-, -NR 1a C(O)-C1-C4 alkyl-, -C(O)O-, -OC(O)-, -O-, -S-, -S(O)-, -S(O)2-, -S(O)2NR 1a -, -NR 1a S(O)2-, -P(O)OH-, -((CH2) x -O)-, -((CH2) y -NR 1a )-, optionally substituted C1-C 12 Alkylene, optionally substituted C-C 10 Alkenylene, optionally substituted C-C 10 Alkynylene, optionally substituted C-C 10attached to the first terminus and / or the second terminus by a group selected from arylene, optionally substituted C3-C7 cycloalkylene, optionally substituted 5-10 membered heteroarylene, and optionally substituted 4-10 membered heterocycloalkylene, wherein each x is independently 1 to 4, each y is independently 1 to 4, and each R 1a is independently hydrogen or optionally substituted C1-C6 alkyl.
[0325] In some embodiments, the oligomer backbone is -O-, -C(O)-, -NR 1a -, C1-C 12 Alkyl, -C(O)NR 1a - and -NR 1a In some embodiments, the oligomer backbone is attached to the first end with a group selected from -O- or -NR 1a - is attached to the first end with a group selected from
[0326] In some embodiments, the oligomer backbone is -C(O)-, -NR 1a -, -C(O)NR 1a -, -NR 1a C(O)-, -((CH2) x -O)-, -((CH2) y -NR 1a )-, -O-, optionally substituted C1-C 12 Alkyl, optionally substituted C-C 10 attached to the second end by a group selected from arylene, optionally substituted C3-C7 cycloalkylene, optionally substituted 5-10 membered heteroarylene, and optionally substituted 4-10 membered heterocycloalkylene, wherein each x is independently 1 to 4, each y is independently 1 to 4, and each R 1a is independently hydrogen or optionally substituted C1-C6 alkyl.
[0327] In some embodiments, the oligomer backbone is -O-, -C(O)-, -NR 1a -, C1-C 12 Alkyl, -C(O)NR 1a - and -NR 1aand a second terminus is attached with a group selected from -C(O)-. In some embodiments, the oligomer backbone is -O- or -NR 1a -. In some embodiments, the oligomer backbone is linked to the second end with a group selected from -O-. In some embodiments, the oligomer backbone is linked to the second end with -NR 1a In some embodiments, the oligomeric backbone is linked to the second terminus through -NH-.
[0328] In some embodiments, non-limiting examples of transcription modulator compounds described herein are shown below in Table 4 (next page).
[0329] [Table 6-1]
[0330] [Table 6-2]
[0331] [Table 6-3]
[0332] [Table 6-4]
[0333] [Table 6-5]
[0334] [Table 6-6]
[0335] [Table 6-7]
[0336]
Table 6-8
[0337]
Table 6-9
[0338]
Table 6-10
[0339]
Table 6-11
[0340]
Table 6-12
[0341]
Table 6-13
[0342]
Table 6-14
[0343]
Table 6-15
[0344]
Table 6-16
[0345]
Table 6-17
[0346] [Table 6-18]
[0347] [Table 6-19]
[0348] [Table 6-20]
[0349] [Table 6-21]
[0350] [Table 6-22]
[0351] [Table 6-23]
[0352] [Table 6-24]
[0353] [Table 6-25]
[0354] As used herein, two embodiments are "mutually exclusive" if one is defined as being different from the other. For example, an embodiment in which two groups are bonded to form a cycloalkyl is mutually exclusive with an embodiment in which one group is ethyl and the other group is hydrogen. Similarly, an embodiment in which one group is CH2 is mutually exclusive with an embodiment in which the same group is NH.
[0355] How to use In another aspect, provided herein is a method of treating an individual having a nucleotide repeat expansion disorder, wherein the nucleotide repeat comprises CAG, the method comprising administering a transcription modulator molecule having a first end, a second end, and an oligomeric backbone; (a) the first end comprises a DNA-binding moiety capable of binding to a nucleotide repeat comprising CAG; (b) the second end comprises a protein-binding portion capable of binding to a regulatory molecule that regulates expression of a gene having an expanded nucleotide repeat; and (c) an oligomeric backbone links the first end and the second end.
[0356] In another aspect, provided herein is a method of decreasing expression of a gene having an expanded nucleotide repeat, such as CAG, in a cell, the method comprising contacting the cell with a transcription modulator molecule having a first end, a second end, and an oligomeric backbone; (a) the first end comprises a DNA-binding moiety capable of binding to a nucleotide repeat comprising CAG; (b) the second end comprises a protein-binding portion capable of binding to a regulatory molecule that regulates expression of a gene having an expanded nucleotide repeat; and (c) an oligomeric backbone links the first end and the second end.
[0357] In some embodiments, the nucleotide repeat expansion disorder is a CAG repeat expansion disorder.
[0358] In some embodiments, the nucleotide repeat expansion disorder is Huntington's disease (HD). In some embodiments, the nucleotide repeat expansion disorder is a Huntington's disease-like syndrome. In some embodiments, the nucleotide repeat expansion disorder is juvenile Huntington's disease.
[0359] In some embodiments, the extended nucleotide repeats have at least about 36, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, or more repeats.
[0360] In some embodiments, the expanded nucleotide repeat comprises CAG.
[0361] In some embodiments, the method results in a decrease in expression of the gene having the expanded nucleotide repeat, hi some embodiments, the decrease in expression is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or more, compared to an untreated individual.
[0362] In some embodiments, the gene is huntingtin (HTT).
[0363] In another aspect, provided herein is a method of treating Huntington's disease (HD) in a patient in need thereof, the method comprising administering to the patient a transcription modulator molecule having a first end, a second end, and an oligomeric backbone; (a) the first end comprises a DNA-binding moiety capable of binding to a nucleotide repeat comprising CAG; (b) the second end comprises a protein-binding portion capable of binding to a regulatory molecule that regulates expression of a gene having an expanded nucleotide repeat; and (c) an oligomeric backbone connecting the first end and the second end; and The DNA binding moiety comprises -NH-QC(O)-, where Q is an optionally substituted C 6-10 It is an optionally substituted arylene, an optionally substituted 4-10 membered heterocyclene, an optionally substituted 5-10 membered heteroarylene group, or an optionally substituted alkylene group.
[0364] In some embodiments, the DNA-binding moiety comprises a polyamide.
[0365] In some embodiments, the DNA binding moiety is
[0366] [ka]
[0367] [ka] wherein each R' is independently selected from hydrogen, optionally substituted C-C 20 Alkyl, C1-C 20 Heteroalkyl, C1-C 20 Haloalkyl, or C1-C 20 alkylamino, and Z is H, NH2, C1-C6 alkyl, C1-C6 haloalkyl, or C1-C6 alkyl-NH2.
[0368] In some embodiments, the DNA-binding moiety comprises a structure according to any one of formulas (A-1) through (A-13).
[0369] In some embodiments, the methods reduce one or more symptoms of Huntington's disease.
[0370] In some embodiments, the one or more symptoms are selected from chorea, cognitive decline, abnormal sexual desire, abnormal eye movements, abnormal smell, aggression, agitation, anxiety, lethargy, bradykinesia, bradypsychia, clumsiness of movement, delusions, depression, difficulty walking, disinhibition, dystonia, unsteady gait, muscle weakness, hallucinations, hostility, hypokinesia, irritability, memory impairment, myoclonus, obsessive-compulsive behavior, decreased fine coordination, seizures, dysarthria, staring, weight loss, abnormal cholesterol metabolism, abnormal cerebral white matter, alcoholism, Babinski sign, caudate atrophy, cerebral atrophy, choking sensation, clonus, striatal degeneration, excessive daytime sleepiness, impaired visuospatial constructional cognition, inability to walk, insomnia, mutism, oropharyngeal dysphagia, rigidity, suicidal ideation, cerebellar atrophy, dementia, gait ataxia, gliosis, hyperreflexia, loss of neurons, or personality changes.
[0371] Pharmaceutical Compositions and Administration In some embodiments, provided herein are compositions comprising a therapeutically effective amount of a transcription modulator molecule (also referred to herein as an "agent") described herein.
[0372] Pharmaceutical compositions can be formulated using one or more physiologically acceptable carriers, including excipients and adjuvants that facilitate the processing of the drug into pharmaceutical preparations. The appropriate formulation depends on the route of administration selected. Overviews of pharmaceutical compositions can be found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa., Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, HA and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980, and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkins, 1999).
[0373] The compositions and methods of the present disclosure may be utilized to treat an individual in need thereof. In certain embodiments, the individual is a mammal, such as a human, or a non-human mammal. When administered to an animal, such as a human, the compositions or agents are preferably administered as a pharmaceutical composition, for example, comprising the agent and a pharma- ceutically acceptable carrier or excipient. Pharmaceutically acceptable carriers are well known in the art and include, for example, aqueous solutions, such as water or physiological buffered saline, or other solvents or vehicles, such as glycols, glycerol, oils, such as olive oil, or injectable organic esters. In preferred embodiments, when such pharmaceutical compositions are administered to humans, particularly when administered via invasive routes of administration, such as injection or implantation, that avoid transport or diffusion across epithelial barriers, the aqueous solution is pyrogen-free or substantially pyrogen-free. The excipient may be selected, for example, to provide delayed release of the agent or to selectively target one or more cells, tissues, or organs. The pharmaceutical composition may be in unit dosage form such as tablets, capsules, granules, lyophilized formulations for reconstitution, powders, liquids, syrups, suppositories, injections, etc. The composition may also be present in a transdermal delivery system, such as a skin patch. The composition may also be present in a solution suitable for topical administration, such as eye drops.
[0374] The pharma- ceutically acceptable excipient may include, for example, a physiologically acceptable agent that acts to stabilize, increase the solubility, or increase the absorption of a compound such as a drug. Such physiologically acceptable agents include, for example, carbohydrates such as glucose, sucrose, or dextran, antioxidants such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins, or other stabilizers or excipients. The choice of a pharma- ceutical acceptable excipient that includes a physiologically acceptable agent depends, for example, on the route of administration of the composition. The formulation or pharmaceutical composition may be a self-emulsifying drug delivery system or a self-microemulsifying drug delivery system. The pharmaceutical composition (formulation) may also be, for example, a liposome or other polymer matrix into which the compound of the invention may be incorporated. For example, liposomes containing phospholipids or other lipids are non-toxic, physiologically acceptable, metabolizable carriers, and are relatively simple to prepare and administer.
[0375] The pharmaceutical composition (formulation) can be administered to a subject by any of several routes of administration, including oral administration, e.g., as a drench, tablet, capsule including sprinkle capsule and gelatin capsule, as an aqueous or non-aqueous solution or suspension, bolus, powder, granule, paste for application to the tongue, absorption through the oral mucosa, e.g., sublingual administration, anal, rectal, or vaginal administration, e.g., as a suppository, cream, or foam, parenteral administration, including intramuscular, intravenous, subcutaneous, or intrathecal administration, e.g., as a sterile solution or suspension, intranasal administration, intraperitoneal administration, subcutaneous administration, transdermal administration, e.g., as a skin patch, and topical administration, e.g., as a cream, ointment, or spray applied to the skin, or as eye drops. The compound may also be formulated for inhalation. In certain embodiments, the compound may simply be dissolved or suspended in sterile water.
[0376] The pharmaceutical composition may be a sterile aqueous or non-aqueous solution, a suspension, or an emulsion, such as a microemulsion. The excipients described herein are examples and are in no way limiting. An effective amount or a therapeutically effective amount refers to an amount of one or more agents administered to a subject, either as a single dose or as part of a series of doses, effective to produce the desired therapeutic effect.
[0377] The subject can usually be monitored for the effectiveness of the treatment using assays and methods suitable for the condition being treated. Assays are well known to those skilled in the art and are described herein. The pharmacokinetics of a drug or one or more metabolites thereof administered to a subject can be monitored by determining the level of the drug or metabolite in the subject's biological fluid, e.g., blood, blood fractions, e.g., serum, and / or urine, and / or other biological samples or biological tissues. Any method implemented in the art and described herein for detecting a drug can be used to measure the level of the drug or metabolite during the course of treatment.
[0378] The dose of the agents described herein for treating a disease or disorder may depend on the condition of the subject, i.e., the stage of the disease, the severity of the symptoms caused by the disease, the general health condition, as well as the age, sex, and weight, and other factors that will be apparent to those skilled in the medical field. The pharmaceutical composition may be administered in a manner appropriate to the disease being treated as determined by those skilled in the medical field. In addition to the factors described herein and above related to the use of the agents for treating a disease or disorder, the appropriate duration and frequency of administration of the agent may also be determined or adjusted by the condition of the patient, the type and severity of the patient's disease, the specific form of the active ingredient, and the method of administration. The optimal dosage of the agent may generally be determined using experimental models and / or clinical trials. The optimal dosage may depend on the subject's size, weight, or blood volume. It is usually preferable to use the minimum dosage sufficient to provide effective treatment. The design and conduct of preclinical and clinical studies of the agents described herein, including when administered for prophylactic benefit, is well within the skill of those skilled in the art. When two or more drugs are administered to treat a disease or disorder, the optimal dose of each drug may be different, e.g., less than when either drug is administered alone as a monotherapy. In certain embodiments, two drugs may be combined to act synergistically or additively, and may be used in amounts less than when either drug is administered alone. The amount of drug that may be administered per day may be, for example, about 0.01 mg / kg to 100 mg / kg body weight, e.g., about 0.1 to 1 mg / kg body weight, about 1 to 10 mg / kg body weight, about 10 to 50 mg / kg body weight, or about 50 to 100 mg / kg body weight. In other embodiments, the amount of drug that may be administered per day may be about 0.01 mg / kg to 1000 mg / kg body weight, about 100 to 500 mg / kg body weight, or about 500 to 1000 mg / kg body weight. The optimal dosage per day or per treatment course may vary depending on the disease or disorder being treated, and may also vary with the route of administration and treatment regimen.
[0379] The pharmaceutical composition containing the agent can be formulated in a manner suitable for the delivery method using techniques routinely practiced in the art.The composition can be in the form of a solid, such as a tablet, capsule, semi-solid, such as a gel, liquid, or gas, such as an aerosol.In other embodiments, the pharmaceutical composition is administered as a bolus injection.
[0380] Pharmaceutically acceptable excipients are well known in the pharmaceutical art and are described, for example, in Rowe et al., Handbook of Pharmaceutical Excipients: A Comprehensive Guide to Uses, Properties, and Safety, 5 th Ed., 2006, and Remington: The Science and Practice of Pharmacy (Gennaro, 21 st Ed. Mack Pub. Co., Easton, PA (2005). Exemplary pharma- ceutically acceptable excipients include sterile saline and phosphate buffered saline at physiological pH. Preservatives, stabilizers, dyes, buffering agents, and the like may be provided in the pharmaceutical composition. In addition, antioxidants and suspending agents may also be used. In general, the type of excipient is selected based on the method of administration and the chemical composition of the active ingredient(s). Alternatively, the compositions described herein may be formulated as a lyophilizate. The compositions described herein may be lyophilized or alternatively formulated as a lyophilized product using one or more suitable excipient solutions to solubilize and / or dilute the drug(s) of the composition upon administration. In other embodiments, the drug may be encapsulated in liposomes using techniques known and practiced in the art. In certain embodiments, the drug is not formulated in liposomes when applied to stents used to treat highly, but not completely, occluded arteries. The pharmaceutical composition may be formulated for any suitable method of administration described herein and in the art.
[0381] The pharmaceutical composition may be in liquid form, for example, for oral administration or for injection, infusion, subcutaneous delivery, intramuscular delivery, intraperitoneal delivery, or other methods. Liquid pharmaceutical compositions include, for example, one or more of water, saline, preferably saline, Ringer's solution, isotonic sodium chloride, a sterile diluent such as a non-volatile oil that can function as a solvent or suspending medium, polyethylene glycol, glycerin, propylene glycol, or other solvent, an antibacterial agent, an antioxidant, a chelating agent, a buffer, and an agent for adjusting tonicity such as sodium chloride or dextrose. Parenteral compositions can be packaged in glass or plastic ampoules, disposable syringes, or multiple dose vials. The use of saline is preferred, and pharmaceutical compositions for injection are preferably sterile. In another embodiment, liquid pharmaceutical compositions can be applied to the eye in the form of eye drops for the treatment of ophthalmic conditions or diseases. Liquid pharmaceutical compositions can be delivered orally.
[0382] For oral formulations, at least one of the agents described herein can be used alone or in combination with suitable additives to prepare tablets, powders, granules, or capsules, and can be used with diluents, buffers, wetting agents, preservatives, coloring agents, and flavoring agents, if desired. The agent can be formulated with a buffer that protects the compound from the low pH of the stomach environment and / or with an enteric coating. The agent included in the pharmaceutical composition can be formulated for oral delivery with flavoring agents, for example, as a liquid, solid, or semi-solid formulation, and / or with an enteric coating.
[0383] A pharmaceutical composition comprising any one of the agents described herein may be formulated for sustained or extended release, also referred to as timed or controlled release. In general, such compositions may be prepared using well-known techniques and administered, for example, by oral, rectal, intradermal, or subcutaneous implantation, or by implantation at a desired target site. A sustained release formulation may contain the compound dispersed in a carrier matrix and / or contained within a reservoir surrounded by a rate-controlling membrane. Excipients for use within such formulations may also be biocompatible and biodegradable. The formulation preferably provides a relatively constant level of release of the active ingredient. The amount of agent contained in a sustained release formulation depends on the site of implantation, the rate and expected duration of release, and the nature of the condition, disease, or disorder being treated or prevented.
[0384] In certain embodiments, the pharmaceutical composition containing the agent is formulated for transdermal, intradermal, or topical administration. The composition may be administered as a powder / talc, or other solid, liquid, spray, aerosol, ointment, foam, cream, gel, paste, using a syringe, bandage, transdermal patch, insert, or syringe-like applicator. The composition is preferably administered topically or injected directly into the skin adjacent to or within the area to be treated, e.g., intradermally or subcutaneously, in the form of a controlled release or sustained release formulation. The active composition may also be delivered by iontophoresis. Preservatives may be used to prevent the growth of fungi and other microorganisms. Suitable preservatives include, but are not limited to, benzoic acid, butylparaben, ethylparaben, methylparaben, propylparaben, sodium benzoate, sodium propionate, benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetypyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, thimerosal, and combinations thereof.
[0385] The pharmaceutical composition containing the drug may be formulated as an emulsion for topical administration. An emulsion comprises one liquid dispersed throughout a second liquid. The emulsion may be an oil-in-water emulsion or a water-in-oil emulsion. Either or both of the oil and water phases may comprise one or more surfactants, emulsifiers, emulsion stabilizers, buffers, and other excipients. The oil phase may comprise other oil-based pharma- ceutically approved excipients. Suitable surfactants include, but are not limited to, anionic surfactants, nonionic surfactants, cationic surfactants, and amphoteric surfactants. The composition for topical administration may also comprise at least one suitable suspending agent, antioxidant, chelating agent, emollient, or moisturizer.
[0386] Ointments and creams can be formulated, for example, with an aqueous or oily base and a suitable thickening agent and / or gelling agent.Lotions can be formulated with an aqueous or oily base and generally also contain one or more emulsifiers, stabilizers, dispersants, suspending agents, thickening agents, or coloring agents.Liquid sprays can be delivered, for example, from pressurized containers via specially shaped closures.Oil-in-water emulsions can also be used in compositions, patches, dressings, and articles.These systems are semisolid emulsions, microemulsions, or foam emulsion systems.
[0387] definition As used herein, the following terms have the meanings indicated.
[0388] It is understood that certain radical naming conventions can include either monoradicals or diradicals depending on the context. For example, if a substituent requires two points of attachment to the remainder of the molecule, the substituent is understood to be a diradical. For example, a substituent identified as an alkyl requiring two points of attachment includes diradicals such as -CH2-, -CH2CH2-, -CH2CH(CH3)CH2-, etc. Other radical naming conventions clearly indicate that the radical is a diradical such as "alkylene", "alkenylene", "arylene", "heteroarylene", etc.
[0389] When a range of values is disclosed and the notation "n1...n2" or "between n1...n2" is used, n1 and n2 are numbers, and unless otherwise specified, this notation is intended to include the numbers themselves and the range therebetween. The range may be an integer or a continuous one between, and may include the end value. As an example, carbon is an integer unit, so the range "2-6 carbons" is intended to include 2, 3, 4, 5, and 6 carbons. In comparison, as an example, the range "1-3 μM (micromolar)" is intended to include 1 μM, 3 μM, and all in between to any significant figure (e.g., 1.255 μM, 2.1 μM, 2.9999 μM, etc.).
[0390] As used herein, the term "about" is intended to modify the numerical value it modifies, expressing such value as variable within a margin of error. When a specific error, such as a standard deviation to the average value given in a chart or table of data, is not recited, the term "about" should be understood to mean a range that encompasses the recited value, and also by rounding up or down to that numerical value to take into account significant numerical values.
[0391] The term "polyamide" refers to a polymer of linkable units chemically linked by amide (i.e., CONH) bonds, and optionally includes a chemical probe attached thereto. Polyamides can be synthesized by stepwise condensation of carboxylic acids (COOH) with amines (RR'NH) using methods known in the art. Alternatively, polyamides can be formed using in vitro enzymatic reactions or by microbial fermentation.
[0392] The term "linkable unit" refers to methylimidazole, methylpyrrole, and linear and branched aliphatic functional groups, optionally containing nitrogen substituents (e.g., methylene, ethylene, propylene, butylene, etc.), and chemical derivatives thereof. The aliphatic functional groups of the linkable unit can be provided, for example, by condensation of B-alanine or dimethylaminopropylamine during the synthesis of the polyamide by methods well known in the art.
[0393] The term "linker" or "oligomeric backbone" refers to a chain of at least 10 contiguous atoms. In certain embodiments, the linker comprises 20 or fewer non-hydrogen atoms. The terms linker and oligomeric backbone may be used interchangeably. In some embodiments, the linker comprises 40 or fewer non-hydrogen atoms. In some embodiments, the linker comprises 60 or fewer non-hydrogen atoms. In certain embodiments, the linker comprises an atom selected from C, H, N, O, and S. In some embodiments, all non-hydrogen atoms are chemically bonded to either two adjacent atoms in the linker, or one adjacent atom in the linker and the terminus of the linker. In some embodiments, the linker forms an amide bond with at least one of the two other groups to which it is attached. In certain embodiments, the linker forms an ester or ether bond with at least one of the two other groups to which it is attached. In some embodiments, the linker forms a thioester or thioether bond with at least one of the two other groups to which it is attached. In some embodiments, the linker forms a direct carbon-carbon bond with at least one of the two other groups to which it is attached. In some embodiments, the linker forms an amine or amide bond with at least one of the two other groups to which it is attached. In some embodiments, the linker comprises a -(CH2OCH2)- unit. In some embodiments, the linker comprises a -(CH(CH3)OCH2)- unit. In some embodiments, the linker comprises a -(CH2NR N CH2) units, where R N =C 1-4In some embodiments, the linker comprises an arylene, cycloalkylene, or heterocycloalkylene moiety.
[0394] The term "spacer" refers to a chain of at least five contiguous atoms. In some embodiments, the spacer comprises 10 or fewer non-hydrogen atoms. In some embodiments, the spacer comprises an atom selected from C, H, N, O, and S. In some embodiments, the spacer forms an amide bond with the two other groups to which it is attached. In certain embodiments, the spacer comprises a -(CH2OCH2)- unit. In some embodiments, the spacer is a -(CH2NR N CH2)-units, where R N =C 1-4 In some embodiments, the spacer comprises at least one positive charge at physiological pH.
[0395] The term "curve element" refers to a chain of about 4-10 contiguous atoms. In some embodiments, the curve element includes atoms selected from C, H, N, O, and S. In some embodiments, the curve element forms amide bonds with the two other groups to which it is attached. In some embodiments, the curve element includes at least one positive charge at physiological pH.
[0396] The terms "nucleic acid" and "nucleotide" refer to ribonucleotides and deoxyribonucleotides and their analogs well known in the art.
[0397] The term "oligonucleotide sequence" refers to a plurality of nucleic acids having a defined sequence and length (e.g., 2, 3, 4, 5, 6, or more nucleotides). The term "oligonucleotide repeat" refers to a contiguous extension of an oligonucleotide sequence.
[0398] The term "transcription" is well known in the art and refers to the synthesis of RNA (i.e., ribonucleic acid) by DNA-directed RNA polymerase. The term "modulating transcription" refers to a change in the level of transcription, which can be measured by methods well known in the art, for example, by assaying the transcription product, mRNA. In certain embodiments, modulation is an increase in transcription. In other embodiments, modulation is a decrease in transcription.
[0399] The term "acyl", as used herein, alone or in combination, refers to a carbonyl bound to an alkenyl, alkyl, aryl, cycloalkyl, heteroaryl, heterocycle, or any other moiety where the atom bound to the carbonyl is carbon. An "acetyl" group refers to a -C(O)CH3 group. An "alkylcarbonyl" or "alkanoyl" group refers to an alkyl group bound to the parent molecular moiety through a carbonyl group. Examples of such groups include methylcarbonyl and ethylcarbonyl. Examples of acyl groups include formyl, alkanoyl, and aroyl.
[0400] As used herein, the term "alkenyl", alone or in combination, refers to a straight or branched chain hydrocarbon radical having one or more double bonds and containing 2 to 20 carbon atoms. In certain embodiments, the alkenyl will contain 2 to 6 carbon atoms. The term "alkenylene" refers to a carbon-carbon double bond system attached at two or more positions, such as ethenylene [(-CH=CH-), (-C::C-)]. Examples of suitable alkenyl radicals include ethenyl, propenyl, 2-methylpropenyl, 1,4-butadienyl, and the like. Unless otherwise noted, the term "alkenyl" can include "alkenylene" groups.
[0401] The term "alkoxy," as used herein, alone or in combination, refers to an alkyl ether radical, where the term alkyl is as defined below. Examples of suitable alkyl ether radicals include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, iso-butoxy, sec-butoxy, tert-butoxy, and the like.
[0402] The term "alkyl", as used herein, alone or in combination, refers to a straight or branched chain alkyl radical containing 1-20 carbon atoms. In certain embodiments, the alkyl will contain 1-10 carbon atoms. In further embodiments, the alkyl will contain 1-8 carbon atoms. The alkyl group may be optionally substituted as defined herein. Examples of alkyl radicals include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, iso-amyl, hexyl, octyl, noyl, and the like. The term "alkylene", as used herein, alone or in combination, refers to a saturated aliphatic group derived from a straight or branched chain saturated hydrocarbon bonded at two or more positions, such as methylene (-CH2-). Unless otherwise noted, the term "alkyl" may include an "alkylene" group.
[0403] The term "alkylamino," as used herein, alone or in combination, refers to an alkyl group attached to the parent molecular moiety through an amino group. Suitable alkylamino groups can be mono- or di-alkylated to form, for example, N-methylamino, N-ethylamino, N,N-dimethylamino, N,N-ethylmethylamino, and the like groups.
[0404] The term "alkylidene," as used herein, alone or in combination, refers to an alkenyl group in which one carbon atom of the carbon-carbon double bond belongs to the moiety to which the alkenyl group is attached.
[0405] As used herein, the term "alkylthio", alone or in combination, refers to an alkylthioether (RS-) radical, where the term alkyl is as defined above and the sulfur may be singly or doubly oxidized. Examples of suitable alkylthioether radicals include methylthio, ethylthio, n-propylthio, isopropylthio, n-butylthio, iso-butylthio, sec-butylthio, tert-butylthio, methanesulfonyl, ethanesulfinyl, and the like.
[0406] As used herein, the term "alkynyl", alone or in combination, refers to a straight or branched chain hydrocarbon radical having one or more triple bonds and containing 2 to 20 carbon atoms. In certain embodiments, the alkynyl contains 2 to 6 carbon atoms. In further embodiments, the alkynyl contains 2 to 4 carbon atoms. The term "alkynylene" refers to a carbon-carbon triple bond attached at two positions, such as ethynylene (-C:::C-, -C≡C-). Examples of alkynyl radicals include ethynyl, propynyl, hydroxypropynyl, butyn-1-yl, butyn-2-yl, pentyn-1-yl, 3-methylbutyn-1-yl, hexyn-2-yl, and the like. Unless otherwise noted, the term "alkynyl" can include "alkynylene" groups.
[0407] The terms "amido" and "carbamoyl", as used herein, alone or in combination, refer to an amino group, as described below, attached to the parent molecular moiety through a carbonyl group, or vice versa. The term "C-amido", as used herein, alone or in combination, refers to a -C(O)N(RR') group, where R and R' are as defined herein or as defined by the specifically enumerated "R" group designated. The term "N-amido", as used herein, alone or in combination, refers to a RC(O)N(R')- group, where R and R' are as defined herein or as defined by the specifically enumerated "R" group designated. The term "acylamino", as used herein, alone or in combination, encompasses an acyl group attached to the parent moiety through an amino group. An example of an "acylamino" group is acetylamino (CH3C(O)NH-).
[0408] As used herein, the term "amide" refers, alone or in combination, to -C(O)NRR', where R and R' are independently selected from hydrogen, alkyl, acyl, heteroalkyl, aryl, cycloalkyl, heteroaryl, and heterocycloalkyl, any of which may themselves be optionally substituted. Additionally, R and R' may combine to form a heterocycloalkyl, any of which may itself be optionally substituted. Amides may be formed by direct condensation of a carboxylic acid with an amine or by using an acid chloride. In addition, coupling reagents are known in the art, including carbodiimide-based compounds such as DCC and EDCI.
[0409] As used herein, the term "amino", alone or in combination, means -NRR ’wherein R and R' are independently selected from hydrogen, alkyl, acyl, heteroalkyl, aryl, cycloalkyl, heteroaryl, and heterocycloalkyl, any of which may themselves be optionally substituted. Additionally, R and R' may combine to form a heterocycloalkyl, any of which may be optionally substituted.
[0410] As used herein, the term "aryl", alone or in combination, means a carbocyclic aromatic system containing one, two, or three rings, with polycyclic ring systems being fused together. The term "aryl" encompasses aromatic groups such as phenyl, naphthyl, anthracenyl, and phenanthryl. The term "arylene" encompasses aromatic groups such as phenylene, naphthylene, anthracenylene, and phenanthrylene.
[0411] The terms "arylalkenyl" or "aralkenyl," as used herein, alone or in combination, refer to an aryl group attached to the parent molecular moiety through an alkenyl group.
[0412] The terms "arylalkoxy" or "aralkoxy," as used herein, alone or in combination, refer to an aryl group attached to the parent molecular moiety through an alkoxy group.
[0413] The terms "arylalkyl" or "aralkyl," as used herein, alone or in combination, refer to an aryl group attached to the parent molecular moiety through an alkyl group.
[0414] The terms "arylalkynyl" or "aralkynyl," as used herein, alone or in combination, refer to an aryl group attached to the parent molecular moiety through an alkynyl group.
[0415] The terms "arylalkanoyl" or "aralkanoyl" or "aroyl," as used herein, alone or in combination, refer to acyl radicals derived from aryl substituted alkanecarboxylic acids, such as, for example, benzoyl, naphthoyl, phenylacetyl, 3-phenylpropionyl(hydrocinnamoyl), 4-phenylbutyryl, (2-naphthyl)acetyl, 4-chlorohydrocinnamoyl, and the like.
[0416] The term aryloxy, as used herein, alone or in combination, refers to an aryl group attached to the parent molecular moiety through an oxy.
[0417] The terms "benzo" and "benz," as used herein, alone or in combination, refer to the divalent radical CH= derived from benzene. Examples include benzothiophene and benzimidazole.
[0418] The term "carbamate," as used herein, alone or in combination, refers to an ester of carbamic acid (-NHCOO-), which may be attached to the parent molecular moiety through either the nitrogen or the acid terminus, and may be optionally substituted as defined herein.
[0419] The term "O-carbamyl," as used herein, alone or in combination, refers to an --OC(O)NRR'-- group, with R and R' as defined herein.
[0420] The term "N-carbamyl," as used herein, alone or in combination, refers to an ROC(O)NR'- group, with R and R' as defined herein.
[0421] As used herein, the term "carbonyl" alone includes formyl [-C(O)H] and in combination is a -C(O)- group.
[0422] As used herein, the terms "carboxyl" or "carboxy" refer to -C(O)OH or the corresponding "carboxylate" anion, such as in a carboxylate salt. An "O-carboxy" group refers to a RC(O)O- group, where R is as defined herein. A "C-carboxy" group refers to a -C(O)OR group, where R is as defined herein.
[0423] The term "cyano," as used herein, alone or in combination, refers to --CN.
[0424] As used herein, "cycloalkyl" or, alternatively, "carbocycle", alone or in combination, refers to a saturated or partially saturated monocyclic, bicyclic, or tricyclic alkyl group, each cyclic moiety containing 3 to 12 carbon atom ring members, and may be an optionally substituted benzo-fused ring system, as defined herein. In certain embodiments, the cycloalkyl will contain 5 to 7 carbon atoms. Examples of such cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, tetrahydronaphthyl, indanyl, octahydronaphthyl, 2,3-dihydro-1H-indenyl, adamantyl, and the like. As used herein, "bicyclic" and "tricyclic" are intended to include fused ring systems, e.g., decahydronaphthalene, octahydronaphthalene, as well as polycyclic (multi-center) both saturated or partially unsaturated types. The latter type of isomer is commonly exemplified by bicyclo[1,1,1]pentane, camphor, adamantane, and bicyclo[3,2,1]octane.
[0425] The term "ester," as used herein, alone or in combination, refers to a carboxy group bridging two moieties joined at a carbon atom.
[0426] The term "ether," as used herein, alone or in combination, refers to an oxy group bridging two moieties joined at a carbon atom.
[0427] The terms "halo" or "halogen," as used herein, alone or in combination, refer to fluorine, chlorine, bromine, or iodine.
[0428] The term "haloalkoxy," as used herein, alone or in combination, refers to a haloalkyl group attached to the parent molecular moiety through an oxygen atom.
[0429] As used herein, the term "haloalkyl", alone or in combination, refers to an alkyl radical having the meaning defined above, in which one or more hydrogens are replaced by halogen. Specifically, monohaloalkyl, dihaloalkyl, and polyhaloalkyl radicals are included. Monohaloalkyl radicals can have, for example, iodo, bromo, chloro, or fluoro atoms in the radical. Dihalo and polyhaloalkyl radicals can have two or more of the same halo atoms, or a combination of different halo radicals. Examples of haloalkyl radicals include fluoromethyl, difluoromethyl, trifluoromethyl, chloromethyl, dichloromethyl, trichloromethyl, pentafluoroethyl, heptafluoropropyl, difluorochloromethyl, dichlorofluoromethyl, difluoroethyl, difluoropropyl, dichloroethyl, and dichloropropyl. "Haloalkylene" refers to a haloalkyl group attached at two or more positions. For example, it includes fluoromethylene (-CFH-), difluoromethylene (-CF2-), chloromethylene (-CHCl-), and the like.
[0430] As used herein, the term "heteroalkyl", alone or in combination, refers to a stable linear or branched chain, or combinations thereof, that is fully saturated or contains one to three degrees of unsaturation, consisting of the specified number of carbon atoms and one to three heteroatoms selected from N, O, and S, where the N and S atoms can be optionally oxidized and the N heteroatom can be optionally quaternized. The heteroatom can be located at any interior position of the heteroalkyl group. Up to two heteroatoms can be consecutive, for example, -CH2-NH-OCH3.
[0431] As used herein, the term "heteroaryl", alone or in combination, refers to a 3-15 membered unsaturated heteromonocycle or fused monocyclic, bicyclic, or tricyclic ring system in which at least one of the fused rings is aromatic and contains at least one atom selected from N, O, and S. In certain embodiments, the heteroaryl will contain 1-4 heteroatoms as ring members. In further embodiments, the heteroaryl will contain 1-2 heteroatoms as ring members. In certain embodiments, the heteroaryl will contain 5-7 atoms. The term also encompasses fused polycyclic groups in which a heterocycle is fused to an aryl ring, a heteroaryl ring is fused to another heteroaryl ring, a heteroaryl ring is fused to a heterocycloalkyl ring, or a heteroaryl ring is fused to a cycloalkyl ring. Examples of heteroaryl groups include pyrrolyl, pyrrolinyl, imidazolyl, pyrazolyl, pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazolyl, pyranyl, furyl, thienyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, thiadiazolyl, isothiazolyl, indolyl, isoindolyl, indolizinyl, benzimidazolyl, quinolyl, isoquinolyl, quinoxalinyl, quinazolinyl, indazolyl, benzotriazolyl, benzodioxolyl, benzopyranyl, benzoxazolyl, benzoxadiazolyl, benzothiazolyl, benzothiadiazolyl, benzofuryl, benzothienyl, chromonyl, coumarinyl, benzopyranyl, tetrahydroquinolinyl, tetrazolopyridazinyl, tetrahydroisoquinolinyl, thienopyridinyl, furopyridinyl, pyrrolopyridinyl, and the like. Exemplary tricyclic heterocyclic groups include carbazolyl, benzidolyl, phenanthrolinyl, dibenzofuranyl, acridinyl, phenanthridinyl, xanthenyl, and the like.
[0432] As used herein, the terms "heterocycloalkyl" and, interchangeably, "heterocycle", alone or in combination, refer to a saturated, partially unsaturated, or fully unsaturated (but non-aromatic), monocyclic, bicyclic, or tricyclic heterocyclic group, respectively, containing at least one heteroatom as a ring member, where each heteroatom may be independently selected from nitrogen, oxygen, and sulfur. In certain embodiments, the heterocycloalkyl will contain 1-4 heteroatoms as ring members. In further embodiments, the heterocycloalkyl will contain 1-2 heteroatoms as ring members. In certain embodiments, the heterocycloalkyl will contain 3-8 ring members in each ring. In further embodiments, the heterocycloalkyl will contain 3-7 ring members in each ring. In still further embodiments, the heterocycloalkyl will contain 5-6 ring members in each ring. "Heterocycloalkyl" and "heterocycle" are intended to include sulfone, sulfoxide, N-oxide of tertiary nitrogen ring members, and carbocyclic and benzo-fused ring systems. Additionally, both terms include systems in which a heterocycle is fused to an aryl group, as defined herein, or to another heterocyclic group. Examples of heterocyclic groups include tetrahydroisoquinoline, aziridinyl, azetidinyl, 1,3-benzodioxolyl, dihydroisoindolyl, dihydroisoquinolinyl, dihydrocinnolinyl, dihydrobenzodioxinyl, dihydro[1,3]oxazolo[4,5-b]pyridinyl, benzothiazolyl, dihydroindolyl, dihydropyridinyl, 1,3-dioxanyl, 1,4-dioxanyl, 1,3-dioxolanyl, isoindolinyl, morpholinyl, piperazinyl, pyrrolidinyl, tetrahydropyridinyl, piperidinyl, thiomorpholinyl, etc. Heterocyclic groups may be optionally substituted unless specifically prohibited.
[0433] The term "hydrazinyl," as used herein, alone or in combination, refers to two amino groups joined by a single bond, ie, --NN--.
[0434] The term "hydroxy," as used herein, alone or in combination, refers to --OH.
[0435] The term "hydroxyalkyl," as used herein, alone or in combination, refers to a hydroxy group attached to the parent molecular moiety through an alkyl group.
[0436] The term "imino," as used herein, alone or in combination, refers to =N-.
[0437] The term "iminohydroxy," as used herein, alone or in combination, refers to =N(OH) and =NO-.
[0438] The phrase "in the backbone" refers to the longest contiguous or adjacent chain of carbon atoms beginning from the point of attachment of a group to a compound or molecule of any one of the formulas disclosed herein.
[0439] The term "isocyanato" refers to a -NCO group.
[0440] The term "isothiocyanato" refers to the group -NCS.
[0441] The term "mercaptyl" as used herein, alone or in combination, refers to an RS-group, where R is as defined herein.
[0442] The term "nitro," as used herein, alone or in combination, refers to --NO.
[0443] The terms "oxy" or "oxa," as used herein, alone or in combination, refer to --O--.
[0444] The term "oxo" as used herein, alone or in combination, refers to =O.
[0445] The term "perhaloalkoxy" refers to an alkoxy group where all of the hydrogen atoms have been replaced with halogen atoms.
[0446] The term "perhaloalkyl," as used herein, alone or in combination, refers to an alkyl group in which all of the hydrogen atoms have been replaced with halogen atoms.
[0447] As used herein, the terms "sulfonate," "sulfonic acid," and "sulfonic," alone or in combination, refer to the -SO3H group and its anion when sulfonic acid is used in salt formation.
[0448] The term "sulfanyl" as used herein, alone or in combination, refers to --S--.
[0449] The term "sulfinyl" as used herein, alone or in combination, refers to -S(O)-.
[0450] The term "sulfonyl," as used herein, alone or in combination, refers to -S(O)2-.
[0451] The term "N-sulfonamido" refers to a RS(=O)2NR'- group, with R and R' as defined herein.
[0452] The term "S-sulfonamido" refers to a -S(=O)2NRR' group, with R and R' as defined herein.
[0453] The terms "thia" and "thio," as used herein, alone or in combination, refer to the -S- group or ethers where the oxygen is replaced with sulfur. The oxidized derivatives of the thio group, namely sulfinyl and sulfonyl, are included in the definition of thia and thio.
[0454] The term "thiol", as used herein, alone or in combination, refers to a -SH group.
[0455] As used herein, the term "thiocarbonyl" alone includes thioformyl-C(S)H and in combination is a -C(S)- group.
[0456] The term "N-thiocarbamyl" refers to a ROC(S)NR'- group, with R and R' as defined herein.
[0457] The term "O-thiocarbamyl" refers to a -OC(S)NRR' group, with R and R' as defined herein.
[0458] The term "thiocyanato" refers to the group -CNS.
[0459] The term "trihalomethanesulfonamide" refers to a X3CS(O)2NR- group, where X is a halogen and R is as defined herein.
[0460] The term "trihalomethanesulfonyl" refers to a X3CS(O)2- group where X is a halogen.
[0461] The term "trihalomethoxy" refers to a X3CO- group where X is a halogen.
[0462] As used herein, the term "trisubstituted silyl", alone or in combination, refers to a silicone group substituted at its three free valences with a group listed herein under the definition of substituted amino. Examples include trimethylsilyl, tert-butyldimethylsilyl, triphenylsilyl, etc.
[0463] Any definition herein can be used in combination with any other definition to describe a composite structural group.By convention, the element following such a definition is the one that is attached to the parent moiety.For example, the composite group alkylamide represents an alkyl group that is attached to the parent molecule via an amide group, and the term alkoxyalkyl represents an alkoxy group that is attached to the parent molecule via an alkyl group.
[0464] When a group is defined as "not present", what is meant is that the group is not present.
[0465] The term "optionally substituted" means that the preceding group may be substituted or unsubstituted. When substituted, the substituents of an "optionally substituted" group may include, but are not limited to, one or more substituents independently selected from the following groups or a specific specified set of groups, alone or in combination: alkyl, alkenyl, alkynyl, alkanoyl, heteroalkyl, heterocycloalkyl, haloalkyl, haloalkenyl, haloalkynyl, perhaloalkyl, perhaloalkoxy, cycloalkyl, phenyl, aryl, aryloxy, alkoxy, haloalkoxy, oxo, acyloxy, carbonyl, carboxyl, alkylcarbonyl, carboxyester, carboxamido, cyano, hydrogen, halogen, hydroxy, amino, lower alkylamino, arylamino, amido, nitro, thiol, alkylthio, haloalkylthio, perhaloalkylthio, arylthio, sulfonate, sulfonic acid, trisubstituted silyl, N, SH, SCH, C(O)CH, COCH, COH, pyridinyl, thiophene, furanyl, carbamate, and urea. When structurally feasible, two substituents may be linked together to form a fused 5-, 6-, or 7-membered carbocyclic or heterocyclic ring consisting of 0-3 heteroatoms, for example, methylenedioxy or ethylenedioxy. An optionally substituted group may be unsubstituted (e.g., -CH2CH3), fully substituted (e.g., -CF2CF3), monosubstituted (e.g., -CH2CH2F), or substituted at a level between fully and monosubstituted (e.g., -CH2CF3). When a substituent is recited without qualification as to substitution, both substituted and unsubstituted forms are encompassed. When a substituent is modified as "substituted," the substituted form is specifically intended. Additionally, a different set of optional substituents for a particular moiety may be defined as necessary. In such cases, the optional substitution is often as defined in the phrase "optionally substituted with."
[0466] As used herein, a substituent is derived from an unsubstituted parent group in which one or more hydrogen atoms have been replaced with another atom or group. Unless otherwise indicated, when a group is considered to be "substituted", the group is independently selected from C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, C1-C6 heteroalkyl, C3-C7 carbocyclyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), C3-C7-carbocyclyl-C1-C6-alkyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy). substituted), 3-10 membered heterocyclyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), 3-10 membered heterocyclyl-C1-C6-alkyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), aryl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), aryl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), C1-C6)alkyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), 5-10 membered heteroaryl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), 5-10 membered heteroaryl(C1-C6)alkyl (optionally substituted with halo, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and C1-C6 haloalkoxy), halo, si Ano, hydroxy, C1-C6 alkoxy, C1-C6 alkoxy(C1-C6)alkyl (i.e., ether), aryloxy, sulfhydryl (mercapto), halo(C1-C6)alkyl (e.g., -CF3), halo(C1-C6)alkoxy (e.g., -OCF3), C1-C6 alkylthio, arylthio, amino, amino(C1-C6)alkyl, nitro, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, C-amido, N-amido, S-sulfonamido, N-sulfonamido,It means that the group is substituted with one or more substituents selected from C-carboxy, O-carboxy, acyl, cyanato, isocyanato, thiocyanato, isothiocyanato, sulfinyl, sulfonyl, and oxo (=O). Whenever a group is described as "optionally substituted," the group can be substituted with the above-mentioned substituents.
[0467] The term R or R', unless otherwise defined, appears alone and without a number designation and refers to a moiety selected from hydrogen, alkyl, cycloalkyl, heteroalkyl, aryl, heteroaryl, and heterocycloalkyl, any of which may be optionally substituted. Such R and R' groups may be optionally substituted as defined herein. All R groups, whether or not an R group has a number designation, are R, R', and R n where n=(1, 2, 3, ... n), and all substituents and all terms should be understood to be independent of all others in terms of selection from groups. When any variable, substituent, or term (e.g., aryl, heterocycle, R, etc.) occurs more than once within a formula or generic structure, its definition at each occurrence is independent of its definition at every other occurrence. One of skill in the art will further recognize that certain groups may be attached to a parent molecule or may occupy a position within a chain of elements from either end as written. For example, an unsymmetrical group such as -C(O)N(R)- may be attached to the parent moiety at either the carbon or the nitrogen.
[0468] Asymmetric centers exist in the compounds or molecules disclosed herein. These centers are designated by the symbols "R" or "S", depending on the arrangement of the substituents around the chiral carbon atom. It is to be understood that the present disclosure encompasses all stereochemical isomeric forms, including diastereomeric, enantiomeric, and epimeric forms, as well as d- and l-isomers, and mixtures thereof. Individual stereoisomers of a compound or molecule can be prepared synthetically from commercially available starting materials containing chiral centers, or by preparation of a mixture of enantiomeric products, followed by conversion to a mixture of diastereomers, followed by separation or recrystallization, chromatographic techniques, direct separation of the enantiomers on a chiral chromatographic column, or any other suitable method known in the art. Starting compounds or molecules of specific stereochemistry are commercially available or can be made and resolved by techniques known in the art. Additionally, compounds or molecules disclosed herein can exist as geometric isomers. The present disclosure includes all cis, trans, syn, anti, entogen (E), and zusanmen (Z) isomers, as well as the appropriate mixtures thereof. Additionally, compounds or molecules may exist as tautomers. All tautomeric isomers are provided by the present disclosure. Additionally, compounds or molecules disclosed herein may exist in unsolvated or solvated forms with pharma- ceutically acceptable solvents, such as water, ethanol, and the like. In general, solvated forms are considered equivalent to unsolvated forms.
[0469] The term "bond" refers to a covalent bond between two atoms, or two moieties where the atoms connected by the bond are considered to be part of a larger substructure. Unless otherwise specified, the bond may be a single bond, a double bond, or a triple bond. A dashed line between two atoms in a drawing of a molecule indicates that an additional bond may or may not be present at that position.
[0470] As used herein, the term "disease" is generally intended to be synonymous with, and used interchangeably with, the terms "disorder," "syndrome," and "condition" (as in medical conditions), all of which reflect an abnormal condition of the human and animal body, or parts thereof, that impairs normal functioning, is typically manifested by characteristic signs and symptoms, and reduces the duration or quality of a human or animal's life.
[0471] The term "combination therapy" refers to the administration of two or more therapeutic agents to treat the therapeutic conditions or disorders described in this disclosure. Such administration includes the co-administration of these therapeutic agents in a substantially simultaneous manner, such as in a single capsule with a fixed ratio of active ingredients, or in multiple separate capsules for each active ingredient. In addition, such administration also includes the use of each type of therapeutic agent in a sequential manner. In either case, the treatment regimen will provide the beneficial effects of the drug combination in the treatment of the conditions or disorders described herein.
[0472] The phrase "therapeutically effective" is intended to qualify the amount of active ingredient used in the treatment of a disease or disorder or for the effect of a clinical endpoint.
[0473] The term "therapeutically acceptable" refers to a compound or molecule (or salt, tautomer, zwitterionic form, etc.) that is suitable for use in contact with the tissues of a patient without undue toxicity, irritation, or allergic response, commensurate with a reasonable benefit / risk ratio, and is effective for its intended use.
[0474] As used herein, reference to "treatment" of a patient is intended to include prevention. Treatment may also be preemptive in nature, i.e., include prevention of disease. Prevention of disease may include complete protection from disease, such as in the case of prevention of infection by a pathogen, or may include prevention of disease progression. For example, prevention of disease may not mean completely eliminating the effects associated with the disease at any level, but instead may mean preventing symptoms of the disease to a clinically significant or detectable level. Prevention of disease may also mean prevention of disease progression to a later stage of the disease.
[0475] The term "patient" is generally synonymous with the term "subject" and includes all mammals, including humans. Examples of patients include humans, domestic animals such as cows, goats, sheep, pigs, and rabbits, and companion animals such as dogs, cats, rabbits, and horses. Preferably, the patient is a human.
[0476] The term "contacting" refers to bringing a compound (e.g., a transcriptional molecular molecule of the present disclosure) into close proximity with a desired target gene. Contacting may result in binding to the target moiety or may result in a conformational change in the target moiety.
[0477] The compounds or molecules disclosed herein can exist as therapeutically acceptable salts. The present disclosure includes the compounds or molecules listed above in the form of salts, including acid addition salts. Suitable salts include those formed with both organic and inorganic acids. Such acid addition salts are usually pharmaceutically acceptable. However, salts of non-pharmaceutically acceptable salts may also be useful in the preparation and purification of the compound or molecule in question. Basic addition salts are also formed and are pharmaceutically acceptable. For a more detailed discussion of salt preparation and selection, see Pharmaceutical Salts: Properties, Selection, and Use (Stahl, P. Heinrich. Wiley-VCHA, Zurich, Switzerland, 2002).
[0478] Basic addition salts can be prepared during the final isolation and purification of a compound or molecule by reacting a carboxyl group with a suitable base, such as a hydroxide, carbonate, bicarbonate of a metal cation, or with ammonia, or with an organic primary, secondary, or tertiary amine. Therapeutically acceptable salt cations include lithium, sodium, potassium, calcium, magnesium, and aluminum, as well as non-toxic quaternary amine cations, such as ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine, N,N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine, N,N-dibenzylphenethylamine, 1-ephenamine, and N,N'-dibenzylethylenediamine. Other representative organic amines useful for the formation of base addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine, and piperazine.
[0479] Other carrier materials and modes of administration known in the pharmaceutical art may also be used. The pharmaceutical compositions of the present disclosure may be prepared by any of the well-known techniques of pharmacy, such as effective formulation and administration procedures. Preferred unit dosage formulations are those that contain an effective dose, as recited herein below, or an appropriate fraction thereof, of active ingredient.
[0480] It will be understood that in addition to the ingredients particularly mentioned above, the above formulations may include other agents conventional in the art having regard to the type of formulation in question, e.g., those suitable for oral administration may include flavoring agents.
[0481] The amount of active ingredient that can be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration.
[0482] The compound or molecule may be administered in various ways, for example, orally, topically, or by injection. The exact amount of compound administered to a patient is the responsibility of the attending physician. The specific dose level for any particular patient will depend on a variety of factors, including the activity of the specific compound used, age, body weight, general health, sex, diet, time of administration, route of administration, excretion rate, drug combination, the exact disease being treated, and the severity of the indication or condition being treated. In addition, the route of administration may vary depending on the symptoms and their severity. The above considerations regarding effective formulations and administration procedures are well known in the art and are described in standard textbooks.
[0483] The present disclosure includes salts of the compounds described herein, particularly pharma-ceutically acceptable salts.Compounds of the present invention that have sufficiently acidic functional groups, sufficiently basic functional groups, or both functional groups can react with some inorganic bases, and inorganic and organic acids to form salts.Alternatively, compounds that are naturally charged, such as those that have quaternary nitrogen, can form salts with suitable counterions, for example halides such as bromide, chloride, or fluoride, particularly bromide.
[0484] Chemical substances having carbon-carbon double bonds or carbon-nitrogen double bonds can exist in Z or E forms (or cis or trans forms). Additionally, some chemical substances can exist in various tautomeric forms. Unless otherwise stated, the compounds described herein are intended to include all Z, E, and tautomeric forms.
[0485] "Tautomer" refers to a molecule capable of proton transfer from one atom of the molecule to another atom of the same molecule. The compounds presented herein, in certain embodiments, exist as tautomers. When tautomerism is possible, a chemical equilibrium of tautomers exists. The exact ratio of tautomers depends on several factors, including physical conditions, temperature, solvent, and pH. Some examples of tautomeric equilibrium include the following:
[0486] [ka]
[0487] The compounds disclosed herein may, in some embodiments, be provided in various isotopically enriched forms, e.g., 2 H, 3 H, 11 C. 13 C and / or 14 The compound is used in a form enriched in C content. In one particular embodiment, the compound is deuterated at at least one position. Such deuterated forms can be prepared by the procedures described in U.S. Patent Nos. 5,846,514 and 6,334,997. As described in U.S. Patent Nos. 5,846,514 and 6,334,997, deuteration can improve metabolic stability and / or efficacy, thereby extending the duration of action of the drug.
[0488] Unless otherwise stated, the compounds described herein are intended to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, a hydrogen is replaced by deuterium or tritium, or a carbon is replaced by 13 C or 14 Compounds having this structure except for the substitution at a C-enriched carbon are within the scope of this disclosure.
[0489] The compounds of the present disclosure may optionally contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may contain, for example, deuterium ( 2 H), tritium ( 3 H), iodine-125( 125 I) or carbon-14( 14 C). 2 H, 11 C. 13 C. 14 C. 15 C. 12 N, 13 N, 15 N, 16 N, 16 O. 17 O.14 F, 15 F, 16 F, 17 F, 18 F, 33 S, 34 S, 35 S, 36 S, 35 Cl, 37 Cl, 79 Br, 81 Br, and 125 All isotopic substitutions with I are contemplated. All isotopic variations of the compounds of the invention, whether radioactive or not, are encompassed within the scope of the invention. In some embodiments where an isotopic variation is indicated, the remaining atoms of the compound may optionally contain a portion of unnatural atomic isotopes.
[0490] In certain embodiments, the compounds disclosed herein comprise: 1 Some or all of the H atoms 2 It is substituted with an H atom. Methods for the synthesis of deuterium-containing compounds are known in the art and include, by way of non-limiting example only, the following synthesis methods:
[0491] Deuterium substituted compounds are synthesized using a variety of methods such as those described in Dean, Dennis C.; Editor. Recent Advances in the Synthesis and Applications of Radiolabeled Compounds for Drug Discovery and Development. [In: Curr., Pharm. Des., 2000; 6(10)] 2000, 110 pp; George W.; Varma, Rajender S. The Synthesis of Radiolabeled Compounds via Organometallic Intermediates, Tetrahedron, 1989, 45(21), 6601-21; and Evans, E. Anthony. Synthesis of radiolabeled compounds, J. Radioanal. Chem., 1981, 64(1-2), 9-32.
[0492] Deuterated starting materials are readily available and the synthesis of deuterated compounds can be accomplished according to the synthetic methods described herein. Many deuterated reagents and building blocks are commercially available from chemical distributors such as Aldrich Chemical Co.
[0493] The compounds described herein may exist as diastereomers, enantiomers, or other stereoisomers in some cases. If the absolute stereochemistry is not specified, the compounds presented herein include all diastereomeric, enantiomeric, and epimeric forms, and the appropriate mixtures thereof. Separation of stereoisomers can be performed by chromatography, or by forming diastereomers and separating them by recrystallization or chromatography, or any combination thereof. (Jean Jacques, Andre Collet, Samuel H. Wilen, "Enantiomers, Racemates and Resolutions", John Wiley and Sons, Inc., 1981, the disclosure of which is incorporated herein by reference). Stereoisomers can also be obtained by stereoselective synthesis.
[0494] The methods and compositions described herein include the use of amorphous and crystalline forms (also known as polymorphs). The compounds described herein may be in the form of pharmaceutically acceptable salts. Similarly, in some embodiments, the active metabolites of these compounds having the same type of activity are included within the scope of the present disclosure. In addition, the compounds described herein may exist in unsolvated or solvated forms with pharmaceutically acceptable solvents such as water, ethanol, etc. The solvated forms of the compounds presented herein are also considered to be disclosed herein. EXAMPLES
[0495] The following examples are presented for the purpose of illustrating various embodiments of the present invention and are not intended to limit the present invention in any manner. The examples, together with the methods described herein, are presently representative of preferred embodiments and are illustrative and do not limit the scope of the present invention. Modifications and other uses encompassed within the spirit of the invention as defined by the claims will be apparent to those skilled in the art.
[0496] Synthesis of compounds The compounds of the present disclosure can be prepared using the methods illustrated in the general synthetic schemes and experimental procedures detailed below. The general synthetic schemes and experimental procedures are illustrative and are not intended to be limiting. The starting materials used to prepare the compounds of the present disclosure are commercially available or can be prepared using routine methods known in the art.
[0497] Synthetic chemistry transformations and methodologies useful in synthesizing the compounds described herein are known in the art and include, for example, those described in R. Larock, Comprehensive Organic Transformations (1989); T. W. Greene and P. G. Muts, Protective Groups in Organic Synthesis, 2d. Ed. (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis (1995).
[0498] The following examples are intended to illustrate, but not limit, the disclosed embodiments. Scheme A describes the steps for preparing a polyamide, attaching the polyamide to an oligomer backbone, and then attaching a ligand to the other end of the oligomer backbone. Transcriptional modulator molecules such as those listed in Table 4 can be prepared using synthesis.
[0499] List of abbreviations Ac2O = acetic anhydride, AcCl = acetyl chloride, AcOH = acetic acid, AIBN = azobisisobutyronitrile, aq. = aqueous, Bu3SnH = tributyltin hydride, CD3OD = deuterated methanol, CDCl3 = deuterated chloroform, CDI = 1,1'-carbonyldiimidazole, DBU = 1,8-diazabicyclo[5.4.0]undec-7-ene, DCM = dichloromethane, DEAD = diethyl azodicarboxylate, DIBAL-H = diisobutylaluminum hydride, DIEA = DIPEA = N,N-diisopropylethylamine, DMAP = 4-dimethylaminopyridine, DMF = N,N-dimethylformamide, DMSO-d6 = deuterated dimethylsulfoxide, DMSO = dimethylsulfoxide, DPPA = diphenylphosphoryl azide, EDC.HCl = EDCI.HCl = 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride, Et2O = diethyl ether, EtOAc = ethyl acetate, EtOH = ethanol, h = hours, HATU = 2-(1H-7-azabenzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate methanaminium, HMDS = hexamethyldisilazane, HOBT = 1-hydroxybenzotriazole, i-PrOH = isopropanol, LAH = lithium aluminum hydride, LiHMDS = lithium bis(trimethylsilyl) Amides, MeCN = acetonitrile, MeOH = methanol, MP-carbonate resin = macroporous triethylammonium methyl polystyrene carbonate resin, MsCl = mesyl chloride, MTBE = methyl tertiary butyl ether, MW = microwave irradiation, n-BuLi = n-butyl lithium, NaHMDS = sodium bis(trimethylsilyl)amide, NaOMe = sodium methoxide, NaOtBu = sodium t-butoxide, NBS = N-bromosuccinimide, NCS = N-chlorosuccinimide, NMP = N-methyl-2-pyrrolidone Don, Pd(Ph3)4 = tetrakis(triphenylphosphine)palladium(0), Pd2(dba)3 = tris(dibenzylideneacetone)dipalladium(0), PdCl2(PPh3)2 = bis(triphenylphosphine)palladium(II) dichloride, PG = protecting group, prep-HPLC = preparative high performance liquid chromatography, PyBop = (benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate, Pyr = pyridine, RT = room temperature, RuPhos = 2-dicyclohexylphosphino-2',6'-diyl isopropoxybiphenyl, sat. = saturated, ss = saturated solution, t-BuOH = tert-butanol, T3P = propylphosphonic anhydride, TBS = TBDMS = tert-butyldimethylsilyl, TBSCl = TBDMSCl = tert-butyldimethylchlorosilane, TEA = Et3N = triethylamine, TFA = trifluoroacetic acid, TFAA = trifluoroacetic anhydride, THF = tetrahydrofuran, Tol = toluene, TsCl = tosyl chloride, XPhos = 2-dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl.
[0500] Synthesis of representative polyamides Example 1. Synthesis of DNA-binding moiety PA-004 Scheme 1.
[0501] [ka]
[0502] [ka]
[0503] Step 1: Synthesis of methyl 3-[(4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazol-2-yl)formamido]propanoate To a 1000 ml flask was added 4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazole-2-carboxylic acid (11.00 g, 35.22 mmol, 1.00 equiv), DMF (300.00 mL), the mixture was cooled to 0° C., then HATU (20.09 g, 52.83 mmol, 1.50 equiv), DIEA (18.21 g, 140.88 mmol, 4.00 equiv) were added dropwise, the mixture was stirred for 10 minutes, and methyl 3-aminopropanoate (3.63 g, 35.22 mmol, 1.00 equiv) was added in portions. The reaction was stirred at room temperature for 1.0 hour. The reaction mixture was poured into water / ice (600 mL) and the solid was filtered and dried under vacuum. The aqueous phase was extracted with EA (3×200 mL) and the combined organic phases were washed with H2O (1×200 mL) and NaCl (1×200 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by a silica gel column eluted with pure EA. The fractions were combined and concentrated. Methyl 3-[(4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazol-2-yl)formamido]propanoate (13.00 g, 87.95%) was obtained as a yellow solid. LC / MS: C 17 H 27Calculated mass of N5O6: 397.20, Measured mass: 398.20 [M+H] + .
[0504] Step 2: Synthesis of methyl 3-[[4-(3-aminopropanamido)-1-methylimidazol-2-yl]formamido]propanoate hydrochloride The procedure was the same as for methyl 4-[4-(3-aminopropanamido)-1-methylimidazol-2-amido]-1-methylpyrrole-2-carboxylate hydrochloride, but the reaction time was 1.0 h. Using 11.00 g of methyl 3-[(4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazol-2-yl)formamido]propanoate, 11.00 g of crude desired product was obtained as a yellow oil. LC / MS: C 12 H 19 Calculated mass of N5O4: 297.14, Measured mass: 298.20 [M+H] + .
[0505] Step 3: Synthesis of methyl 1-methyl-4-(1-methylimidazol-2-amido)pyrrole-2-carboxylate To a stirred solution of 1-methylimidazole-2-carboxylic acid (10.00 g, 79.29 mmol, 7.00 equiv) in DMF (150.00 mL) was added TBTU (38.19 g, 118.94 mmol, 1.50 equiv), methyl 4-amino-1-methylpyrrole-2-carboxylate hydrochloride (16.63 g, 87.24 mmol, 1.10 equiv), and DIEA (30.74 g, 237.88 mmol, 3.00 equiv) in small portions at 0° C. The resulting mixture was stirred at room temperature for 17.0 h. The reaction was poured into water / ice (450 mL). The precipitated solid was collected by filtration, washed with H2O (3×50 mL), and dried under vacuum. Methyl 1-methyl-4-(1-methylimidazol-2-amido)pyrrole-2-carboxylate (16.5 g, 78.37%) was obtained as a white solid. LC / MS: 12 H 14 Calculated mass of N4O3: 262.11, Measured mass: 263.15 [M+H] + .
[0506] Step 4: Synthesis of 1-methyl-4-(1-methylimidazol-2-amido)pyrrole-2-carboxylic acid The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazole-2-carboxylic acid. 16.50 g of methyl 1-methyl-4-(1-methylimidazole-2-amido)pyrrole-2-carboxylate was used to obtain 12.00 g of 1-methyl-4-(1-methylimidazole-2-amido)pyrrole-2-carboxylic acid (76.84% yield) as a white solid. LC / MS: C 11 H 12 Calculated mass of N4O3: 248.09, Measured mass: 249.10 [M+H] + .
[0507] Step 5: Synthesis of methyl 1-methyl-4-[1-methyl-4-(3-[[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido]propanamido)imidazol-2-amido]pyrrole-2-carboxylate The procedure was the same as for ethyl 3-[(4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazol-2-yl)formamido]propanoate. 9.00 g of 1-methyl-4-(1-methylimidazol-2-amido)pyrrole-2-carboxylic acid was used to obtain 14.00 g of the desired product (63.54% yield) as a yellow solid. LC / MS: C 26 H 30 N 10 Calculated mass of O6: 578.23, Measured mass: 579.10 [M+H] + .
[0508] Step 6: Synthesis of 1-methyl-4-[1-methyl-4-(3-[[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido]propanamido)imidazole-2-afoldamido]pyrrole-2-carboxylic acid The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propanamide]-1-methylimidazole-2-carboxylic acid. Using 14.00 g of methyl 1-methyl-4-[1-methyl-4-(3-[[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide]propanamide)imidazol-2-amido]pyrrol-2-yl]formamide carboxylate, 12.00 g of the desired product (81.49% yield) was obtained as a yellow solid. LC / MS: C 25 H 28 N 10 Calculated mass of O6: 564.22, Measured mass: 565.15 [M+H] + .
[0509] Step 7: Synthesis of ethyl 4-{4-[(tert-butoxycarbonyl)amino]butanamido}-1-methylimidazole-2-carboxylate The procedure was the same as for ethyl 4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazole-2-carboxylate. 7.80 g of 4-[(tert-butoxycarbonyl)amino]butanoic acid was obtained, and 11.00 g of the desired product was obtained as a pink solid (80.70% yield). LC / MS: C 16 H 26 Calculated mass of N4O5: 354.19, Measured mass: 355.15 [M+H] + .
[0510] Step 8: Synthesis of ethyl 4-(4-aminobutanamido)-1-methylimidazole-2-carboxylate The procedure was the same as for methyl 4-[4-(3-aminopropanamido)-1-methylimidazole-2-amido]-1-methylpyrrole-2-carboxylate hydrochloride. Using 9.40 g of ethyl 4-{4-[(tert-butoxycarbonyl)amino]butanamido}-1-methylimidazole-2-carboxylate, 6.20 g of the desired product was obtained as a white solid (90.89% yield). LCMS: C 11 H 18Calculated mass of N4O3: 254.14, Measured mass: 255.15 [M+H] + .
[0511] Step 9: Synthesis of ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propanamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylate To a stirred solution of 1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propanamido)imidazole-2-amido]pyrrole-2-carboxylic acid (18.20 g, 32.24 mmol, 1.00 equiv.) in DMF (250.00 mL) was added DIEA (12.50 g, 96.71 mmol, 3.00 equiv.), ethyl 4-(4-aminobutanamido)-1-methylimidazole-2-carboxylate (9.02 g, 35.46 mmol, 1.10 equiv.), and PyBOP (20.13 g, 38.68 mmol, 1.20 equiv.) at 0° C. The resulting mixture was stirred at room temperature for 1.0 h. The reaction was poured into ice / water (800 mL). The precipitated solid was collected by filtration, washed with HO (3x200 mL) and dried under vacuum. 24.70 g of ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazole-2-carboxylate was obtained as a yellow solid (95.74% yield). LC / MS: C 36 H 44 N 14 Calculated mass of O8: 800.35, Measured mass: 801.30 [M+H] + .
[0512] Step 10: Synthesis of 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazole-2-carboxylic acid The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazole-2-carboxylic acid. Using 24.00 g of ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propanamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylate, 23.10 g of the desired product was obtained as a yellow solid (99.36% yield). LC / MS: C 34 H 40 N 14 Calculated mass of O8: 772.32, Measured mass: 773.30 [M+H] + .
[0513] Step 11: Synthesis of ethyl 4-[4-[(tert-butoxycarbonyl)amino]-1-methylpyrrol-2-amido]-1-methylimidazole-2-carboxylate To a stirred solution of 4-[(tert-butoxycarbonyl)amino]-1-methylpyrrole-2-carboxylic acid (11.50 g, 47.87 mmol, 1.00 equiv.) in DMF (200.00 mL) was added EDCI (22.94 g, 119.66 mmol, 2.50 equiv.), ethyl 4-amino-1-methylimidazole-2-carboxylate (8.10 g, 47.87 mmol, 1.00 equiv.), and DMAP (14.62 g, 119.66 mmol, 2.50 equiv.) at 0° C. The resulting mixture was stirred at 35° C. for 17.0 h. After reaction, the reaction was poured into 500 mL of ice / water. The precipitated solid was collected by filtration, washed with water (3×50 mL), and dried under vacuum. This gave ethyl 4-{4-[(tert-butoxycarbonyl)amino]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylate (16.00 g, 85.48% yield) as a pale yellow solid. LC / MS: C 18 H 25 Calculated mass of N5O5: 391.19, Measured mass: 392.30 [M+H] + .
[0514] Step 12: Synthesis of ethyl 4-(4-amino-1-methylpyrrol-2-amido)-1-methylimidazole-2-carboxylate To a stirred solution of ethyl 4-{4-[(tert-butoxycarbonyl)amino]-1-methylpyrrole-2-amido}-1-methylimidazole-2-carboxylate (16.00 g, 40.88 mmol, 1.00 equiv) in DCM (135.00 mL) was added TFA (45.00 mL) dropwise at room temperature. The resulting mixture was stirred at room temperature for 2.0 h. The resulting mixture was concentrated under vacuum. The residual brown oil was diluted with Et2O (200 mL). The precipitated solid was collected by filtration and washed with Et2O (2x100 mL). The resulting solid was dried under vacuum. This gave ethyl 4-(4-amino-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylate (16.00 g, crude) as a brown solid. LC / MS: C 13 H 17Calculated mass of N5O3: 291.13, Measured mass: 292.15 [M+H] + .
[0515] Step 13: Synthesis of ethyl 4-(4-{3-[(tert-butoxycarbonyl)amino]propanamido}-1-methylpyrrol-2-amido)-1-methylimidazole-2-carboxylate A solution of ethyl 4-(4-amino-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylate (12.00 g, 41.19 mmol, 1.00 equiv.), 3-[(tert-butoxycarbonyl)amino]propanoic acid (7.50 g, 39.64 mmol, 0.96 equiv.), PyBOP (22.00 g, 42.28 mmol, 1.03 equiv.), DIEA (45.00 g, 348.18 mmol, 8.45 equiv.) in DMF (120.00 mL) was stirred at room temperature for 1.0 h. The reaction was poured into ice water (400 mL) and the mixture was stirred for 15 min. The precipitated solid was collected by filtration, washed with water (3×150 mL), and dried under vacuum. The aqueous phase was extracted with EA (3×150 mL) and the combined organic phases were combined, washed with H2O (200 mL) and dried over anhydrous Na2SO4. The solid was filtered and the filtrate was concentrated. The residue was purified by silica gel column chromatography eluted with PE / EA (1:8). This gave 17.00 g of ethyl 4-(4-{3-[(tert-butoxycarbonyl)amino]propanamido}-1-methylpyrrol-2-amido)-1-methylimidazole-2-carboxylate as a yellow solid (89.28% yield). LC / MS: C 21 H 30 Calculated mass of N6O6: 462.22, Measured mass: 463.35 [M+H] + .
[0516] Step 14: Synthesis of 4-(4-{3-[(tert-butoxycarbonyl)amino]propanamido}-1-methylpyrrol-2-amido)-1-methylimidazole-2-carboxylic acid The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazole-2-carboxylic acid. 12.00 g of ethyl 4-(4-{3-[(tert-butoxycarbonyl)amino]propanamido}-1-methylpyrrol-2-amido)-1-methylimidazole-2-carboxylate was used to obtain 10.00 g of the desired product as a white solid (88.81% yield). LC / MS: C 19 H 26 Calculated mass of N6O6: 434.19, Measured mass: 435.25 [M+H] + .
[0517] Step 15: Synthesis of ethyl 3-{[4-(4-{3-[(tert-butoxycarbonyl)amino]propanamido}-1-methylpyrrol-2-amido)-1-methylimidazol-2-yl]formamido}propanoate A solution of 4-(4-{3-[(tert-butoxycarbonyl)amino]propanamido}-1-methylpyrrole-2-amido)-1-methylimidazole-2-carboxylic acid (10.00 g, 23.02 mmol, 1.00 equiv.), β-alanine ethyl ester hydrochloride (4.90 g, 31.90 mmol, 1.39 equiv.), PyBOP (12.50 g, 24.02 mmol, 1.04 equiv.), DIEA (9.00 g, 69.64 mmol, 3.03 equiv.) in DMF (120.00 mL) was stirred at room temperature for 1.0 h. The reaction was quenched by the addition of water (500 mL) at room temperature. The resulting mixture was extracted with EtOAc (3×400 mL). The combined organic layers were washed with brine (3×200 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1:8) to give ethyl 3-{[4-(4-{3-[(tert-butoxycarbonyl)amino]propanamido}-1-methylpyrrol-2-amido)-1-methylimidazol-2-yl]formamido}propanoate (12.00 g, 93.80%) as a yellow solid. LC / MS: C 24 H 35Calculated mass of N7O7: 533.26, Measured mass: 534.30 [M+H] + .
[0518] Step 16: Synthesis of ethyl 3-({4-[4-(3-aminopropanamido)-1-methylpyrrol-2-amido]-1-methylimidazol-2-yl}formamido)propanoate The procedure was the same as for ethyl 4-(4-amino-1-methylpyrrol-2-amido)-1-methylimidazole-2-carboxylate. Ethyl 3-{[4-(4-{3-[(tert-butoxycarbonyl)amino]propanamido}-1-methylpyrrol-2-amido)-1-methylimidazol-2-yl]formamido}propanoate was used to give 12.00 g of crude desired product as a white solid. LC / MS: C 19 H 27 Calculated mass of N7O5: 433.21, Measured mass: 434.25 [M+H] + .
[0519] Step 17: Synthesis of ethyl 3-[(1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazol-2-yl}formamide)propanamide]pyrrol-2-amido}imidazol-2-yl)formamide]propanoate The procedure was the same as for ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazole-2-carboxylate. Using 10.00 g of 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazole-2-carboxylic acid, 13.60 g of the desired product was obtained as a yellow solid (88.61% yield). After purification by Prep-HPLC, some pure product was obtained as a pale yellow solid. HRMS: C 53 H 65 N 21 O 12 Calculated mass: 1187.5122, Measured mass: 1188.5153 [M+H] + .
[0520] Step 18: Synthesis of 3-[(1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazol-2-yl}formamide)propanamide]pyrrol-2-amido}imidazol-2-yl)formamide]propanoic acid (PA-004) The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazole-2-carboxylic acid, but the reaction temperature was 35° C. Using 10.60 g of ethyl 3-[(1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazole-2-amido)pyrrol-2-yl]formamido}propanamido)imidazole-2-amido]pyrrol-2-yl}formamido)butanamido]imidazol-2-yl}formamido)propanamido]pyrrol-2-amido}imidazol-2-yl)formamido]propanoate, 10.00 g of crude desired product was obtained as a yellow solid. LC / MS: C 51 H 61 N 21 O 12 Calculated mass: 1159.48, measured mass: 581.25 [M / 2+H] + .
[0521] Example 2. Synthesis of DNA-binding moiety (PA-023) Scheme 2.
[0522] [ka]
[0523] Step 1: Synthesis of ethyl 1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propanamido)imidazole-2-carboxylate The procedure was the same as for ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propanamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylate, but the reaction time was 2.0 h. Using 1.50 g of ethyl 4-(3-aminopropanamido)-1-methylimidazole-2-carboxylate, 2.00 g of the desired product was obtained as an off-white solid (68.09% yield). LC / MS: C 21 H 26 Calculated mass of N8O5: 470.20, Measured mass: 471.40 [M+H] + .
[0524] Step 2: Synthesis of 1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazole-2-carboxylic acid The procedure was the same as for 4-[3-[(tert-butoxycarbonyl)amino]propanamido]-1-methylimidazole-2-carboxylic acid, but the reaction temperature was room temperature and the reaction time was 2.0 hours. Using 2.00 g of ethyl 1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propanamido)imidazole-2-carboxylate, 1.80 g of 1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propanamido)imidazole-2-carboxylic acid was obtained as an off-white solid (95.71% yield). LC / MS: C 19 H 22 Calculated mass of N8O5: 442.17, Measured mass: 443.10 [M+H] + .
[0525] Step 3: Synthesis of ethyl 4-{4-[(2S)-2-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propanamido)imidazol-2-yl]formamido}butanamido]-1-methylpyrrol-2-amido}-1-methylimidazole-2-carboxylate The procedure was the same as for ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propanamido)imidazol-2-amido]pyrrol-2-yl}formamido)butanamido]imidazole-2-carboxylate, but the reaction time was 2.0 h. Using 1.60 g of ethyl 4-{4-[(2S)-4-amino-2-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}butanamido]-1-methylpyrrol-2-amido}-1-methylimidazole-2-carboxylate, 1.90 g of the desired product was obtained as a pale yellow solid (70.20% yield). LC / MS: C 51 H 55 N 15 O 10 Calculated mass: 1037.43, Measured mass: 1038.45 [M+H] + .
[0526] Step 4: Synthesis of 4-[4-(4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-yl]formamide}butanamide]-1-methylpyrrol-2-amide}-1-methylimidazol-2-amido)-1-methylpyrrol-2-amide]-1-methylpyrrole-2-carboxylic acid A mixture of ethyl 4-{4-[(2S)-2-{[(9H-fluoren-9-ylmethoxy)carbonyl]amino}-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-yl]formamide}butanamide]-1-methylpyrrol-2-amido}-1-methylimidazole-2-carboxylate (1.90 g, 1.83 mmol, 1.00 equiv.) and LiOH (0.22 g, 9.15 mmol, 5.00 equiv.) in MeOH (5.00 mL), THF (15.00 mL), and HO (18.30 mL) was stirred at room temperature for 2.0 h. The resulting mixture was used directly in the next step without further purification. LC / MS: C 34 H 41 N 15 Calculated mass of O8: 787.33, Measured mass: 788.40 [M+H] + .
[0527] Step 5: Synthesis of 4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamido)imidazol-2-yl]formamide}butanamido]-1-methylpyrrol-2-amido}-1-methylimidazole-2-carboxylic acid To a mixture of 4-{4-[(2S)-2-amino-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-yl]formamide}butanamide]-1-methylpyrrole-2-amido-1-methylimidazole-2-carboxylic acid (1.40 g, 1.78 mmol, 1.00 equiv) in MeOH / THF / HO (5.00 mL / 15.00 mL / 18.30 mL) was added di-tert-butyl dicarbonate (0.78 g, 3.55 mmol, 2.00 equiv), and DMAP (0.02 g, 0.18 mmol, 0.10 equiv). The reaction was stirred at room temperature for 3.0 h. To the mixture was added HO (30 mL). The mixture was filtered through a pad of Celite and the solid was washed with ethyl acetate (3x30 mL) to give 4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-yl]formamide}butanamide]-1-methylpyrrol-2-amide}-1-methylimidazole-2-carboxylic acid (1.20 g, 76.05% yield) as a yellow solid. LC / MS: C 39 H 49 N 15 O 10 Calculated mass: 887.38, Measured mass: 888.45 [M+H] + .
[0528] Step 6: Synthesis of methyl 4-[4-(4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamido)imidazol-2-yl]formamide}butanamido]-1-methylpyrrol-2-amide}-1-methylimidazol-2-amido)-1-methylpyrrol-2-amido]-1-methylpyrrole-2-carboxylate The procedure was the same as for ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazole-2-carboxylate, but the reaction time was 2.0 h. Using 1.20 g of 4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-yl]formamide}butanamide]-1-methylpyrrol-2-amido}-1-methylimidazole-2-carboxylic acid, 1.10 g of the desired product was obtained as a yellow solid (71.01% yield). LC / MS: C 52 H 63 N 19 O 12 Calculated mass: 1145.49, Measured mass: 1146.50 [M+H] + .
[0529] Step 7: Synthesis of 4-[4-(4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-yl]formamide}butanamide]-1-methylpyrrol-2-amide}-1-methylimidazol-2-amido)-1-methylpyrrol-2-amide]-1-methylpyrrole-2-carboxylic acid (PA-023) The procedure was the same as for 4-[4-(4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-[(1-methyl-4-{1-methyl-4-[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-amido]pyrrol-2-amido}imidazol-2-yl)formamido]butanamido]-1-methylpyrrol-2-amido}-1-methylimidazol-2-amido)-1-methylpyrrol-2-amido]-1-methylpyrrole-2-carboxylic acid. Using 1.00 g of methyl 4-[4-(4-{4-[(2S)-2-[(tert-butoxycarbonyl)amino]-4-{[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamido}propanamido)imidazol-2-yl]formamido}butanamido]-1-methylpyrrol-2-amido}-1-methylimidazol-2-amido)-1-methylpyrrol-2-amido]-1-methylpyrrole-2-carboxylate, 400.00 mg of the desired product was obtained as a white solid (39.16% yield). LC / MS: C 51 H 61 N 19 O 12 Calculated mass: 1131.47, Measured mass: 1132.65 [M+H] + .
[0530] Example 3. Synthesis of DNA-binding moiety (PA-040) Scheme 3.
[0531] [ka]
[0532] Step 1: Synthesis of ethyl 4-[4-(3-aminopropanamido)-1-methylpyrrol-2-amido]-1-methylimidazole-2-carboxylate The procedure was the same as for ethyl 4-(4-amino-1-methylpyrrol-2-amido)-1-methylimidazole-2-carboxylate (Intermediate 1-16, Example 1). 2.00 g of ethyl 4-(4-{3-[(tert-butoxycarbonyl)amino]propanamido}-1-methylpyrrol-2-amido)-1-methylimidazole-2-carboxylate was used to obtain 2.00 g of crude desired product as a white solid. LC / MS: C 16 H 22 Calculated mass of N6O4: 362.17, Measured mass: 363.25 [M+H] + .
[0533] Step 2: Synthesis of tert-butyl N-(3-[[3-(1,3-dioxoisoindol-2-yl)propyl](methyl)amino]propyl)-N-methylcarbamate The procedure was the same as for ethyl 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazole-2-carboxylate (Intermediate 1-12), but the solvent was DMA. Using 3.00 g of 1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazole-2-carboxylic acid, 4.30 g of the desired product was obtained as a yellow solid (96.84% yield). LC / MS:C 50 H 60 N 20 O 11 Calculated mass: 1116.48, Measured mass: 1117.60 [M+H] + .
[0534] Step 3: Synthesis of 1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazol-2-yl}formamide)propanamide]pyrrol-2-amido}imidazole-2-carboxylic acid (PA-040-OH) The procedure was the same as in Example 1 (PA-004), except that the reaction temperature was 40° C. and the reaction time was 5.0 hours. Using 4.20 g of ethyl 1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazol-2-yl}formamide)propanamide]pyrrol-2-amido}imidazole-2-carboxylate, 4.00 g of the desired product was obtained as a yellow solid (97.97% yield). LC / MS: C 48 H 56 N 20 O 11 Calculated mass: 1088.44, Measured mass: 1089.55 [M+H] + .
[0535] Example 4. Synthesis of A-27 Scheme 4.
[0536] [ka]
[0537] Step 1. Synthesis of intermediate 4-1 To a stirred solution of (S)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-N-(4-hydroxyphenyl)acetamide (27.00 mg, 0.05 mmol, 1.00 equiv) in CH3CN (1.50 mL) was added tert-butyl N-(86-bromo-3,6 , 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84-Octacosaoxahexaoctacontan-1-yl)carbamate (80.00 mg, 0.05 mmol, 1.00 equiv.), and K2CO3 (22.76 mg, 0.16 mmol, 3.00 equiv.) were added. The resulting mixture was stirred at 70 °C for 17.0 h. The resulting mixture was filtered and the filter cake was washed with EtOAc (3 x 8 mL). The filtrate was concentrated under reduced pressure and purified by TLC plate (CHCl / MeOH=8:1) to give tert-butyl (S)-(86-(4-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetamido)phenoxy)3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84-octacosaoxahexaoctacontyl)carbamate (81.00 mg, 77.40% yield) as a brown solid.
[0538] LC / MS:C 88 H 147 ClNO 32 Calculated mass of S: 1866.95, Measured mass: 623.90 [M+H] + .
[0539] Step 2. Synthesis of intermediate 4-2 A solution of tert-butyl (S)-(86-(4-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetamido)phenoxy)-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84-octacosaoxahexaoctacontyl)carbamate (70.00 mg, 0.04 mmol, 1.00 equiv) in DCM (1.00 mL) and TFA (0.20 mL) was stirred at room temperature for 1.0 h. The resulting mixture was concentrated under reduced pressure. This gave (S)—N-(4-((86-amino-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84-octacosaoxahexaoctacontyl)oxy)phenyl)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetamide (70.00 mg, crude) as a yellow oil.
[0540] LC / MS:C 83 H 139 ClNO 30 Calculated mass of S: 1766.89, measured mass: 590.60 [M / 3+H] + .
[0541] Step 3. Synthesis of A-26 To a stirred solution of 3-[(1-methyl-4-{1-methyl-4-[3-({1-methyl-4-[4-({1-methyl-4-[1-methyl-4-(3-{[1-methyl-4-(1-methylimidazol-2-amido)pyrrol-2-yl]formamide}propanamide)imidazol-2-amido]pyrrol-2-yl}formamide)butanamide]imidazol-2-yl}formamide)propanamide]pyrrol-2-amido}imidazol-2-yl)formamide]propanoic acid (37.80 mg, 0.03 mmol, 1.00 equiv) in DMF (1.00 mL) was added DIEA (25.27 mg, 0.19 mmol, 6.0 0 equiv), (S)-N-(4-((86-amino-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84-octacosaoxahexaoctacontyl)oxy)phenyl)-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetamide (57.62 mg, 0.03 mmol, 1.00 equiv), and PyBOP (25.43 mg, 0.05 mmol, 1.50 equiv) were added at 0 °C. The resulting mixture was stirred at room temperature for 1.0 h. The resulting mixture was filtered and purified by Perp-HPLC with the following conditions: Column: XBridge Prep C18 OBD Column, 19*150mm, 5μm, Mobile phase A: Water (10mmol / L NH4HCO3), Mobile phase B: ACN, Flow rate: 25mL / min, Gradient: 45%B to 65%B to 65%B in 11 min, Wavelength: 254nm, RT1(min): 3.05, Run number: 0.The fractions were combined and lyophilized to give (S)-N-(3-((5-((2-((1-(4-(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)acetamido)phenoxy)-88-oxo-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57,60,63,66,69,72,75,78,81,84-octacosoxa-87-azanonacontan-90-yl)carbamoyl)- Obtained 1-methyl-1H-imidazol-4-yl)carbamoyl)-1-methyl-1H-pyrrol-3-yl)amino)-3-oxopropyl)-1-methyl 4-(4-(1-methyl-4-(1-methyl-4-(3-(1-methyl-4-(1-methyl-1H-imidazole-2-carboxamide)-1H-pyrrole-2-carboxamide)propanamide)-1H-imidazole-2-carboxamide)-1H-pyrrole-2-carboxamide)butanamide)-1H-imidazole-2-carboxamide (13.80 mg, 14.46%) as a white solid.
[0542] HRMS:C 134 H 198 ClN 27 O 41 Calculated mass of S: 2908.3648, Measured mass: 2909.3729 [M+H] + .
[0543] HPLC: Purity 99.401%.
[0544] Example 9. General synthesis and purification of compounds of the present disclosure The compounds of the present disclosure were made in a similar manner to Example 4. The compounds were then purified by HRMS Methods A or B.
[0545] Method A: Instrument: Waters Acquity I Class UPLC coupled with Xevo G2-XSQ Tof HRMS; Column: ACQUITY UPLC BEH-C18, 2.1×50 mm, 2.7 μm; Mobile phase A: HO (0.1% HCOOH); Mobile phase B, CAN (0.1% HCOOH); Flow rate: 0.4 mL / min; Gradient: 10% B to 95% B in 1.5 min, hold 95% for another 0.5 min, then ramp down to 10% B in 0.3 min, hold 10% B for another 0.7 min; Detector: 254 nm.
[0546] Method B: Instrument: Waters Acquity I Class UPLC coupled with Xevo G2-XS Q Tof HRMS; Column: ACQUITY UPLC BEH-C18, 2.1×50 mm, 2.7 μm; Mobile phase A: HO (0.1% HCOOH); Mobile phase B, CAN (0.1% HCOOH); Flow rate: 0.4 mL / min; Gradient: 5% B to 40% B in 2.0 min, 95% in 1.5 min, hold at 95% for another 1.5 min, then ramp down to 5% B in 0.3 min, hold at 5% B for another 0.7 min; Detector: 254 nm.
[0547] Experimental data for compounds of the present disclosure purified by Method A are shown in Table 5.
[0548] [Table 7-1]
[0549] [Table 7-2]
[0550] [Table 7-3]
[0551] Biological Examples Example B1. Activity Fibroblasts: A cell type obtained from a skin biopsy from a patient. These cells have not been genetically modified and therefore serve as a primary cell culture model of the disease.
[0552] iPSC: induced pluripotent stem cell, a cell type that results from reprogramming another cell type (usually a skin or blood cell) into a more embryonic-like state that allows for the development of other cell types and for modeling the therapeutic effects of drugs in vitro.
[0553] SNP: Single Nucleotide Polymorphism, a single base pair variation in a DNA sequence
[0554] Molecular Biology Toolkit: qPCR primer-probe set: Normalization of RNA input was assessed using the human glyceraldehyde 3-phosphate dehydrogenase (hGAPDH) TaqMan assay (ThermoFisher Cat. No. 4351370) or the human cyclophilin (IAPP) TaqMan assay (ThermoFisher Cat. No. 4351372). Detection of total HTT was assessed using the human Htt TaqMan assay (ThermoFisher Cat. No. 4331182). Allele-specific detection of human HTT expression in HD cells containing SNP rs362331C / T (exon 50): In each assay, the allele-specific probe for detecting the SNP variant contained a locked nucleobase to improve allele discrimination compared to unmodified DNA probes. 362331-F (331 forward primer): TCTCCTCCACAGAGTTTGTGA 362331-R (331 reverse primer): CCTTCTTTCTGGACTAAGAAGCTG 362331-C Probe: TCC CTC ATC+C+AC TGT GT 362331-T Probe: CTC+A+T+C+T+A+C TGT GT qPCR was performed using Agpath ID one-step reverse transcriptase polymerase chain reaction (RT-PCR) reagents.
[0555] Protein measurements were performed by Western blots probing with antibody MW1 (polyQ specific) to assess the reduction of mtHTT only. D7F7 (amino acids around proline 1218) was used to visualize both wtHTT and mtHTT. Lysates were normalized with DC and then resolved on 3-8% Tris-acetate gels and transferred to nitrocellulose membranes by wet transfer. Blots were probed with the aforementioned antibodies and complementary fluorescent secondary antibodies and imaged on a Li-Cor Odyssey® DLx Imaging System.
[0556] The antibody pair 2B7 (amino acids 1-17) and MW1 (polyQ-specific) are used to monitor mtHTT levels, and the pair MAB2166 (amino acids 181-810) and MAB5490 (amino acids 115-129) are used to monitor full-length HTT.
[0557] Screening method for HD molecules: GM09197 and / or GM04022 fibroblasts were cultured in T175 flasks and incubated at 37°C, 5% CO2. After reaching confluence, the medium was removed, the cells were washed with 1x PBS, and the cells were dissociated using TrypLE™ Express Enzyme. The medium was added to the enzyme, collected in a 15mL conical tube, and centrifuged at 500xg for 5 minutes to pellet the cells. The medium and enzyme were aspirated using a serological pipette. The cells were resuspended in fresh medium and counted using a Countess3 automated cell counter. The cells were seeded at a density of 15,000 cells / well in tissue culture treated polystyrene 96 well dishes and incubated overnight at 37°C, 5% CO2. The next day, the medium was removed using an 8 channel aspirator. 200μL of medium / well was added back to the plate. The molecules were prepared to 1mM and dispensed using a Multidrop™ Pico 8 Digital Dispenser. After 48 hours of incubation with compounds, the medium was removed from the plate, the cells were washed with 1x PBS, and the cells were lysed with 40 μL of guanidine thiocyanate buffer per well. RNA was isolated and purified in 382-well glass fiber column plates using chaotropic salts. Human mtHTT, wtHTT, and GAPDH mRNA were measured by RT-PCR in a 384-well format using the ThermoFisher QuantStudio™ 7Flex System. HTT level results were normalized to GAPDH mRNA levels. Normalized HTT mRNA levels were expressed relative to vehicle-treated samples to assess fold changes after molecular treatment.
[0558] Methods for duration of action of HD molecules on iPSC-neurons: Fibroblasts isolated from HD patients were grown in the presence of cytokines and transduced with Sendai virus, a cytoplasmic RNA vector, to reprogram them into iPSCs. These iPSCs express stem cell markers, have normal karyotypes, and express pluripotency markers Nanog, Tra-1-60, and SSeA-44. The iPSC-derived neuron differentiation method followed the standard protocol for mixed cortical neuron differentiation. This resulted in immunohistochemical staining of Tuj1 and Map2 in iPS-neurons. iPSC-derived neuronal progenitor cells were seeded at 300,000 cells / well on PLO / laminin 521-coated culture-treated polystyrene 96-well dishes and incubated at 37°C, 5% CO2. The medium was changed the next day to allow the neuronal progenitor cells to continue maturing into neurons. After 4 days, the medium was replaced with fresh medium and the cells were treated with mitotic inhibitors to remove remaining dividing cells and obtain pure neuronal cultures. After 3 days, the medium was removed. 200 μL of medium / well was returned to the plate. Molecules were prepared at 1 mM and dispensed using a Multidrop™ Pico 8 Digital Dispenser. After 96 hours of incubation with compounds, the medium was removed and replaced with fresh medium and the cells were treated again. After 7 days of exposure to compounds, the medium was removed from the plate and the cells were lysed with 60 μL of Ambion Lysis buffer. RNA was isolated using the PureLink™ RNA Isolation Kit. cDNA was synthesized using the Agilent Superscript II kit. Human mtHTT, wtHTT and GAPDH mRNA were measured by RT-PCR in a 384-well format using a ThermoFisher QuantStudio™ 7Flex System. HTT level results were normalized to GAPDH mRNA levels. Normalized HTT mRNA levels were expressed relative to vehicle-treated samples to assess fold change following treatment with HD compounds.
[0559] E of each compound minis the lowest % HTT concentration observed within the compound concentrations of 0.5 nM to 1000 nM.
[0560] Representative in vitro biochemical data are shown in Tables 6 and 7, where A>90%, B is 90%-80%, and C<80%.
[0561] [Table 8-1]
[0562] [Table 8-2]
[0563] [Table 9]
[0564] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It is understood that various alternatives to the embodiments of the invention described herein may be used in carrying out the invention. The following claims define the scope of the invention, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.
Claims
1. A transcription modulator molecule having a first terminal, a second terminal, and an oligomeric skeleton, or a pharmaceutically acceptable salt thereof, a) The first end includes a portion having the structure of formula (A-1): 【Chemistry 1】 During the ceremony, Z1 is either nonexistent, -O-, or -NH-. Each of X1, X2, X3, X4, X5, X6, X7, and X8 is independently O, S, or NR2. Each of Y1, Y2, Y3, Y4, Y5, Y6, Y7, and Y8 is independently CH or N. W1 is deuterium, hydrogen, optionally substituted C1-C6 alkyl, (azanylidene)methanediamine, (azanylidene)-N,N,N',N'-tetramethylmethanediamine, -C(O)-NR1A R1B, -NR1A-C(O)-NR1A R1B, -Z B-P(O)(OR1A)2, -Z B-(CH2)p-P(O)(OR1A)2, -Z B-(CH2)p3-O-P(O)(OR1A)2, where, Z B is -N- or -O-, p3 is an integer between 1 and 10. W2 is an optionally substituted C1-C6 alkyl or -C(O)-NR1A R1B, Each R1 is independently hydrogen, deuterium, halogen, amino, cyano, optionally substituted C1-C20 alkyl, optionally substituted C1-C20 heteroalkyl, or -NHC(O)R1A, Two R1 atoms, located on the same atom or adjacent atoms, combine with the atom(s) to which they are bonded to form an arbitrarily substituted 3- to 6-membered carbon ring or an arbitrarily substituted 3- to 6-membered heteroring. Each R2 is independently hydrogen, deuterium, optionally substituted C1-C20 alkyl, optionally substituted C1-C20 heteroalkyl, optionally substituted C1-C20 haloalkyl, or optionally substituted C1-C20 alkylamino. Each R1A is independently hydrogen, deuterium, or an optionally substituted C1-C20 alkyl group. Each R1B is independently hydrogen, deuterium, an optionally substituted five-membered heteroaryl, an optionally substituted C1-C20 alkyl, an optionally substituted C2-C10 heteroalkyl, or (AA)p2, where, Each AA is an amino acid, p² is an integer between 1 and 10. j 1 is 0 or 1, n 0 is either 0 or 1, m1 and n1 are each independent integers between 0 and 3. Given that p1 is 2 if Z1 is O or NH, and p1 is 3 if Z1 does not exist, p1 is 2 or 3. One of W1 or W2 is bonded to the oligomer skeleton. b) The second end includes a portion that can bind to a regulatory molecule that modulates gene expression by binding to a target selected from BET (bromodomain and extra end) family member, CBP / p300, PCAF (P300 / CBP-related factor), CECR2 (candidate chromosomal region 2 for cat eye syndrome), BRPF (bromodomain and PHD finger-containing protein), ATAD2 / ATAD2B (chromatin remodeling protein), TRIM24 (three-element motif-containing 24), BAZ2 (zinc finger-adjacent bromodomain), or TAF1 (TBP-related factor), c) A transcription modulator molecule, or a pharmaceutically acceptable salt thereof, wherein the oligomeric skeleton links the first and second ends.
2. The transcription modulator molecule according to claim 1, wherein the first terminus of formula (A-1) has the structure of formula (A-4), or a pharmaceutically acceptable salt thereof: 【Chemistry 2】
3. The transcription modulator molecule according to claim 1, wherein the first terminus of formula (A-1) has the structure of formula (A-6), or a pharmaceutically acceptable salt thereof: 【Transformation 3】
4. The transcription modulator molecule according to Claim 1, or a pharmaceutically acceptable salt thereof, wherein Y2, Y4, and Y7 are each independently N, and Y1 and Y3 are each independently CH.
5. The transcription modulator molecule according to Claim 1, or a pharmaceutically acceptable salt thereof, wherein j1 is 1 and m1 is 0.
6. The transcription modulator molecule according to claim 1, or a pharmaceutically acceptable salt thereof, wherein n 1 is 1 and Y 6 is CH.
7. The transcription modulator molecule according to claim 1, or a pharmaceutically acceptable salt thereof, wherein X1, X2, X3, X4, X5, X6, and X7 are each independently -NR2.
8. The transcription modulator molecule according to claim 1, or a pharmaceutically acceptable salt thereof, wherein Y8 is N.
9. The oligomer skeleton comprises a polymer having 2 to 50 spacing portions, Each spacing portion is independently -((CR 3a R 3b) x -O) y-, -((CR 3a R 3b) x -NR 4a) y-, -((CR 3a R 3b) x -CH=CH-(CR 3a R 3b) x -O) y-, optionally substituted C1-C12 alkyl, optionally substituted C2-C10 alkenyl, optionally substituted C2-C10 alkynyl, optionally substituted C6-C10 arylene, optionally substituted C3-C7 cycloalkylene, optionally substituted 5-10 membered heteroarylene, optionally substituted 4-10 membered heterocycloalkylene, amino acid residue, -O-, -C(O)NR 4a -, -NR 4a C(O)-, -C(O)-, -NR 1a-, -C(O)O-, -S-, -S(O)-, -S(O) 2-, -S(O) 2 NR 4a-, -NR 4a S(O) 2-, and -P(O)OH-, and any combination thereof, selected from the group, in the formula, Each x is independently between 2 and 4. Each y is independently between 1 and 10. Each R1a is independently a hydrogen atom or an optionally substituted C1-C6 alkyl group. Each R3a and R3b is independently selected from hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted amino, carboxyl, carboxyl ester, acyl, acyloxy, acylamino, aminoacyl, optionally substituted alkylamide, sulfonyl, optionally substituted thioalkoxy, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted cycloalkyl, and optionally substituted heterocyclyl. The transcription modulator molecule according to claim 1, or a pharmaceutically acceptable salt thereof, wherein each R 4a is independently hydrogen or an optionally substituted C1-C6 alkyl group.
10. The second end has the structure of formula (2-A): 【Chemistry 4】 Including, in the formula, Ring A is an optionally substituted aryl or an optionally substituted 5-6 member heteroaryl. Ring B is either absent or optionally substituted, a six-membered monocyclic aryl or heteroaryl compound. D is either C or N, E is either O or N, Y A is -NH- or -O-, R5 is hydrogen, deuterium, or C1-C6 alkyl. R6 is selected from hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, and optionally substituted C1-C6 hydroxyalkyl. R7 is selected from hydrogen, deuterium, halogen, -NO2, -CN, optionally substituted aryl, optionally substituted C1-C20 alkyl, optionally substituted C1-C20 heteroalkyl, optionally substituted C1-C6 haloalkyl, and optionally substituted C1-C6 hydroxyalkyl. Alternatively, R 7 is -NR 7A R 7B, in the formula, R7A and R7B are, independently, hydrogen, deuterium, an optionally substituted C1-C20 alkyl, or an optionally substituted C1-C20 heteroalkyl. x1 is an integer from 1 to 6, the transcription modulator molecule according to claim 1, or a pharmaceutically acceptable salt thereof.
11. (i) The second end has the structure of formula (3-A): 【Transformation 5】 Including, in the formula, Y B is -CH₂NH-, -CH₂O-, -NH-, or -O-, R11A and R11B are each independently hydrogen, deuterium, or optionally substituted C1-C6 alkyl groups. R12 is hydrogen, halogen, -OH, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl. R14 and R15 are independently hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl. Alternatively, R 14 is -NR A R B, R16 is an optionally substituted C1-C6 alkyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, C1-C6 hydroxyalkyl, -SO2RA, or -NHSO2RA. R Y is hydrogen, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted 5-6 membered monocyclic aryl or heteroaryl. Each R A and R B is independently hydrogen, deuterium, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl. y1 is between 1 and 3. The linkage to the linker is either at R14 or RY, or (ii) the second end has the structure of formula (3-B): 【Transformation 6】 Including, in the formula, Ring C is either absent or optionally substituted, a 5-6 member monocyclic aryl or heteroaryl ring, or a 4-8 member heterocyclic ring. Y B is -CH₂NH-, -CH₂OH-, -NH-, or -O-, R11A and R11B are each independently hydrogen, deuterium, or optionally substituted C1-C6 alkyl groups. R12 is hydrogen, deuterium, optionally substituted C1-C6 alkyl, C(O)RA, or C(O)NRARB, where, Each R A and R B is independently hydrogen, deuterium, optionally substituted C1-C6 alkyl, or optionally substituted C1-C6 heteroalkyl. R 13 is hydrogen, a substituted aryl, a substituted heteroaryl, or a substituted oxydibenzene. The transcription modulator molecule according to claim 1, or a pharmaceutically acceptable salt thereof, wherein y² is an integer between 0 and 2.
12. The second end has the structure of formula (4-A): 【Transformation 7】 Including, in the formula, Ring D is either absent, phenyl, or a 5-6 member heteroaryl. X9 and X10 are independently C or N, and one of X9 or X10 is N. L2 is absent or optionally substituted alkylene, -O-, or -NRD-, where RD is hydrogen, deuterium, or optionally substituted C1-C3 alkyl. R18 is a 5-6 member heteroaryl that can be optionally substituted. R19 is an optionally substituted C3-C8 cycloalkyl or an optionally substituted 4- to 7-membered heteroaryl. Each R 20 is independently hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl. x 3 is an integer between 1 and 3. y 4 is an integer from 1 to 4, and The transcription modulator molecule according to claim 1, or a pharmaceutically acceptable salt thereof, wherein the linkage to the linker is at either R 19 or R 20.
13. The second end has the structure of formula (4-B): 【Transformation 8】 Including, in the formula, Ring D is either absent, optionally substituted with phenyl, or optionally substituted with a 5-6 member heteroaryl. X9 and X10 are independently C or N, and one of X9 or X10 is N. L2 is absent or optionally substituted alkylene, -O-, or -NRD-, where RD is hydrogen, deuterium, or optionally substituted C1-C3 alkyl. R18 is a 5-6 member heteroaryl that can be optionally substituted. R19 is an optionally substituted C3-C8 cycloalkyl or an optionally substituted 4- to 7-membered heteroaryl, and x 3 is an integer from 1 to 3, the transcription modulator molecule according to claim 12, or a pharmaceutically acceptable salt thereof.
14. The second end has the structure of formula (4-D): 【Chemistry 9】 Including, in the formula, L2 is an optionally substituted alkylene, -O-, or -NRD-, where RD is hydrogen, deuterium, or an optionally substituted C1-C3 alkyl. R18 is a 5-6 member heteroaryl that can be optionally substituted. R 20 is hydrogen, deuterium, halogen, -CN, -NO2, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 haloalkyl, or optionally substituted C1-C6 hydroxyalkyl. x 3 is an integer between 1 and 3, and The transcription modulator molecule according to claim 12, or a pharmaceutically acceptable salt thereof, wherein y4 is an integer from 1 to 4.
15. The second end has the structure of formula (7-A): 【Chemistry 10】 Including, in the formula, A5 is -O-, -NH-, or -CH2-, Z1 is CH or N, W is either O or S. Each R 31 is independently hydrogen, halogen, -OH, -CN, -NO₂, -NH₂, optionally substituted C1-C10 alkyl, optionally substituted C1-C10 haloalkyl, optionally substituted C1-C10 hydroxyalkyl, optionally substituted C2-C10 alkenyl, optionally substituted C2-C10 alkynyl, optionally substituted C3-C8 cycloalkyl, or optionally substituted 3- to 8-membered heterocycloalkyl. Alternatively, two R 31 atoms may link with each other to the atom to which they are bonded, forming an optionally substituted C5-C8 cycloalkyl group or an optionally substituted 5-8 member heterocycloalkyl group. R 32 is a hydrogen atom or an optionally substituted C1-C10 alkyl group. R 33 is hydrogen, halogen, -OH, -CN, -NO₂, -NH₂, optionally substituted C1-C10 alkyl, optionally substituted C1-C10 haloalkyl, or optionally substituted C1-C10 hydroxyalkyl, and The transcription modulator molecule according to claim 1, or a pharmaceutically acceptable salt thereof, wherein q6 is 0 to 4.
16. The second end is as follows: 【Chemistry 11】 The transcription modulator molecule according to claim 1, or a pharmaceutically acceptable salt thereof.
17. The second end is as follows: 【Chemistry 12】 【Chemistry 13】 The transcription modulator molecule according to claim 1, or a pharmaceutically acceptable salt thereof.
18. The transcription modulator molecule or a pharmaceutically acceptable salt thereof according to claim 1, wherein the transcription modulator molecule or a pharmaceutically acceptable salt thereof is listed in Table 4.
19. A pharmaceutical composition comprising a transcription modulator molecule according to any one of claims 1 to 18, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.
20. A pharmaceutical composition for use in the manufacture of a pharmacopoeia for the treatment of Huntington's disease (HD), comprising a transcription modulator molecule according to any one of claims 1 to 18, or a pharmaceutically acceptable salt thereof.