Targeted gene therapy for DM-1 myotonic dystrophy

Abstract

Provided herein is an RNAi molecule for treating myotonic dystrophy type 1 (DM1).Further provided herein is an expression cassette, vector (e.g., rAAV), viral particle and pharmaceutical composition containing RNAi.Further provided herein is a method and kit for using RNAi, for example, for treating DM1.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63 / 328,241, filed April 6, 2022, and U.S. Provisional Patent Application No. 63 / 483,075, filed February 3, 2023, the contents of which are incorporated herein by reference.

[0002] Submission of sequence listing The contents of the following submission in XML file: Sequence Listing in Computer Readable Format (CRF) (Filename: 737870_SA9-363PC_ST26.xml, Created: April 3, 2023, Size: 82,900 bytes) are incorporated herein by reference in their entirety.

[0003] The present invention relates to variant RNAi molecules. In some embodiments, the present invention relates to variant RNAi molecules for treating muscular dystrophy. [Background technology]

[0004] RNA interference (RNAi) has been shown to be a useful tool for gene silencing in basic research into gene function and holds great promise as a therapeutic agent for suppressing genes associated with the development of numerous diseases. In nature, gene regulation by RNAi is mediated through small RNA molecules known as microRNAs (miRNAs) (Ambros, (2004) Nature 431:350-355; Krol et al., (2010) Nat. Rev. Genet. 11:597-610). MicroRNAs have emerged as potent regulators of diverse cellular processes, and when delivered by viral vectors, artificial miRNAs can be continuously expressed, resulting in potent and sustained suppression of target genes. Elucidating the mechanisms involved in miRNA processing has enabled scientists to harness the endogenous cellular RNAi machinery to induce degradation of target gene products by using artificial miRNAs (see, e.g., U.S. Patent Application Publication No. 2014 / 0163214 and Davidson et al., (2012) Cell 150:873-875).

[0005] Myotonic dystrophy type 1 (DM1) is a monogenic, autosomal dominant, progressive disease caused by an expansion of CTG repeats (>50) in the DMPK locus. DMPK with the repeats is transcribed into mRNA, which forms a hairpin that binds to RNA-binding proteins and sequesters them from their normal function. This leads to the appearance of nuclear foci, mis-splicing of mRNA, and ultimately myotonia. DM1 primarily affects skeletal, cardiac, and smooth muscles, resulting in significant physical, cognitive, and behavioral impairments and disability. Currently, there is no approved therapy for DM1. Thus, there is a high unmet medical need for therapies to treat DM1.

[0006] All references cited herein, including patent applications and publications, are incorporated by reference in their entirety. Summary of the Invention [Means for solving the problem]

[0007] In some aspects, the invention provides an RNAi comprising a first strand and a second strand, a) the first strand and the second strand form a duplex, b) the first strand comprises a guide region, the guide region comprises a nucleic acid having the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) or a sequence having about 90% identity to the sequence of SEQ ID NO: 1, and c) the second strand comprises a non-guide region. In some embodiments, the non-guide region comprises a nucleic acid having the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) or a sequence having about 90% identity to the sequence of SEQ ID NO: 2. In some embodiments, the first strand comprises a nucleic acid having the sequence of SEQ ID NO: 1, and the non-guide region comprises a nucleic acid having the sequence of SEQ ID NO: 2. In some embodiments, the first strand and the second strand are linked by an RNA linker capable of forming a loop structure. In some embodiments, the RNA linker comprises about 4 to about 50 nucleotides. In some embodiments, the loop structure comprises about 4 to about 20 nucleotides. In some embodiments, the loop structure comprises a nucleic acid having a sequence of SEQ ID NO: 3 or a sequence having about 90% identity to the sequence of SEQ ID NO: 3. In some embodiments, the RNAi comprises, from 5' to 3', a second strand, an RNA linker, and a first strand. In some embodiments, the RNAi comprises, from 5' to 3', a first strand, an RNA linker, and a second strand. In some embodiments, the RNAi comprises a nucleic acid having a sequence of SEQ ID NO: 7 or a sequence having about 90% identity to the sequence of SEQ ID NO: 7. In some embodiments, the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA), or a small hairpin RNA (shRNA).

[0008] In some embodiments of the present invention, the RNAi further comprises a scaffold. In some embodiments, the scaffold comprises all or a portion of the nucleic acid of SEQ ID NO: 11. In some embodiments, the miRNA is embedded within the scaffold. In some embodiments, the scaffold has a 5' arm located 5' of the nucleic acid encoding the RNAi and a 3' arm located 3' of the nucleic acid encoding the RNAi. In some embodiments, the scaffold is a miR-155 scaffold. In some embodiments, the miR-155 scaffold comprises a nucleic acid of SEQ ID NO: 9 or a sequence having about 90% identity to the sequence of SEQ ID NO: 9 located 5' of the RNAi. In some embodiments, the miR-155 scaffold comprises a nucleic acid of SEQ ID NO: 10 or a sequence having about 90% identity to the sequence of SEQ ID NO: 10 located 3' of the RNAi.

[0009] In some embodiments of the present invention, RNAi targets RNA encoding a polypeptide associated with myotonic dystrophy-1 (DM1). In some embodiments, the polypeptide is myotonic dystrophy protein kinase (DMPK). In some embodiments, the DMPK comprises a mutation associated with DM1. In some embodiments, the gene encoding DMPK comprises five or more CTG trinucleotide repeats.

[0010] In some aspects, the invention provides an expression cassette comprising a nucleic acid encoding any of the RNAi described herein. In some embodiments, the nucleic acid encoding the RNAi is operably linked to a promoter. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the promoter is a desmin promoter or a variant thereof. In some embodiments, the desmin promoter comprises one or more enhancer elements of the human desmin gene and a promoter. In some embodiments, the desmin promoter comprises two enhancer elements of the human desmin gene and a promoter. In some embodiments, the desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence of SEQ ID NO:21 or a nucleotide sequence having about 90% identity to the sequence of SEQ ID NO:21 and / or one or more enhancer elements comprising a nucleotide sequence of SEQ ID NO:22 or a nucleotide sequence having about 90% identity to the sequence of SEQ ID NO:22. In some embodiments, the desmin promoter comprises a nucleotide sequence of SEQ ID NO:12 or a sequence having about 90% identity to the nucleotide sequence of SEQ ID NO:12. In some embodiments, the expression cassette further comprises an intron. In some embodiments, the intron is a rabbit beta globin intron. In some embodiments, the intron comprises a nucleotide sequence of SEQ ID NO: 13 or a sequence having about 90% identity to the sequence of SEQ ID NO: 13. In some embodiments, the nucleic acid encoding the RNAi is embedded in the intron. In some embodiments, the intron comprises a 5' arm and a 3' arm, the 5' arm being located 5' to the nucleic acid encoding the RNAi, and the 3' arm being located 3' to the nucleic acid encoding the RNAi. In some embodiments, the 5' arm of the intron comprises a nucleotide sequence of SEQ ID NO: 14 or a sequence having about 90% identity to the sequence of SEQ ID NO: 14.In some embodiments, the 3' arm of the intron comprises the nucleotide sequence of SEQ ID NO: 15 or a sequence having about 90% identity to the sequence of SEQ ID NO: 15. In some embodiments, the expression cassette further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA. In some embodiments, the polyadenylation signal is a minimal bovine growth hormone polyadenylation signal. In some embodiments, the bovine growth hormone polyadenylation signal comprises the nucleotide sequence of SEQ ID NO: 16 or a sequence having about 90% identity to the sequence of SEQ ID NO: 16. In some embodiments, the expression cassette comprises the nucleotide sequence of SEQ ID NO: 17 or a sequence having about 90% identity to the sequence of SEQ ID NO: 17.

[0011] In some aspects, the invention provides an expression cassette comprising a modified desmin promoter, the modified desmin promoter comprising one or more enhancer elements and a promoter of the human desmin gene. In some embodiments, the modified desmin promoter comprises two enhancer elements and a promoter of the human desmin gene. In some embodiments, the modified desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements. In some embodiments, the modified desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence of SEQ ID NO:21 or a nucleotide sequence having about 90% identity to the sequence of SEQ ID NO:21 and / or one or more enhancer elements comprising a nucleotide sequence of SEQ ID NO:22 or a nucleotide sequence having about 90% identity to the sequence of SEQ ID NO:22. In some embodiments, the desmin promoter comprises a nucleotide sequence of SEQ ID NO:12 or a sequence having about 90% identity to the nucleotide sequence of SEQ ID NO:12. In some embodiments, the expression cassette further comprises an intron. In some embodiments, the intron is a rabbit beta globin intron. In some embodiments, the intron comprises a nucleotide sequence of SEQ ID NO: 13 or a sequence having about 90% identity to the sequence of SEQ ID NO: 13. In some embodiments, the nucleic acid encoding the transgene is embedded in the intron. In some embodiments, the intron comprises a 5' arm and a 3' arm, the 5' arm being located 5' to the nucleic acid encoding the transgene, and the 3' arm being located 3' to the nucleic acid encoding the transgene. In some embodiments, the 5' arm of the intron comprises a nucleotide sequence of SEQ ID NO: 14 or a sequence having about 90% identity to the sequence of SEQ ID NO: 14. In some embodiments, the 3' arm of the intron comprises a nucleotide sequence of SEQ ID NO: 15 or a sequence having about 90% identity to the sequence of SEQ ID NO: 15. In some embodiments, the expression cassette further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA.In some embodiments, the polyadenylation signal is a minimal bovine growth hormone polyadenylation signal. In some embodiments, the bovine growth hormone polyadenylation signal comprises the nucleotide sequence of SEQ ID NO: 16 or a sequence having about 90% identity to the sequence of SEQ ID NO: 16. In some embodiments, the transgene encodes a polypeptide or a nucleic acid. In some embodiments, the transgene encodes an RNAi.

[0012] In some aspects, the invention provides a vector comprising any of the expression cassettes described herein. In some embodiments, the expression cassette is flanked by one or more stuffer nucleic acid sequences. In some embodiments, the one or more stuffer nucleic acid sequences are derived from the human SerpinA1 gene. In some embodiments, the stuffer nucleic acid sequence located 5' of the expression cassette is derived from the human SerpinA1 gene. In some embodiments, the stuffer sequence located 5' of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 18 or a sequence having about 90% identity to the sequence of SEQ ID NO: 18. In some embodiments, the stuffer nucleic acid sequence located 3' of the expression cassette is derived from the human SerpinA1 gene. In some embodiments, the stuffer sequence located 3' of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 19 or a sequence having about 90% identity to the sequence of SEQ ID NO: 19.

[0013] In some embodiments of the invention, the vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the expression cassette is flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the expression cassette is flanked by two AAV ITRs. In some embodiments, the AAV ITRs are ITRs of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV, or mouse AAV serotypes. In some embodiments, the AAV ITRs are AAV2 ITRs. In some embodiments, the rAAV vector comprises the nucleotide sequence of SEQ ID NO:20 or a sequence having about 90% identity to the sequence of SEQ ID NO:20. In some embodiments, the vector is a self-complementary rAAV vector.

[0014] In some embodiments, the invention provides a cell comprising any of the expression cassettes described herein, any of the vectors described herein, or any of the rAAV vectors described herein.

[0015] In some aspects, the present invention provides a viral particle comprising any of the vectors described herein. In some aspects, the present invention provides a recombinant AAV particle comprising any of the rAAV vectors described herein. In some embodiments, the AAV viral particle is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, AAVrh74 N502I, AAVrh74 W505R, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, caprine AAV, AAV1 / AAV2 chimera, bovine AAV, or murine AAV capsid rAAV2 / HBoV1 serotype capsid. In some embodiments, the ITRs and capsid of the rAAV viral particle are from the same AAV serotype. In some embodiments, the ITRs and capsid of the rAAV viral particle are from different AAV serotypes. In some embodiments, the AAV viral particle comprises a capsid of AAVrh74 N502I serotype. In some embodiments, the ITRs are AAV2 ITRs, and the capsid of the rAAV particle is a capsid of AAVrh74 N502I serotype. In some embodiments, the AAV viral particle comprises a capsid of AAVrh74 W505R serotype. In some embodiments, the ITRs are AAV2 ITRs, and the capsid of the rAAV particle is an AAVrh74 W505R serotype capsid. In some embodiments, the invention provides an rAAV particle comprising an rAAV vector and a capsid, the rAAV vector comprising, from 5' to 3', the following nucleic acids: AAV2 ITRs, a nucleic acid encoding a stuffer nucleic acid sequence from the human serpinA1 gene, a Byrne desmin enhancer element, a Paulin desmin enhancer element, a desmin promoter, a 5' arm of a rabbit beta globin intron, a 5' miR155 scaffold sequence, a DMPK 204miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 An rAAV particle is provided, which comprises a nucleic acid encoding a miRNA passenger sequence, a 3' miR155 scaffold sequence, a 3' arm of a rabbit β-globin intron, a minimal bovine growth hormone polyadenylation sequence, a stuffer nucleic acid sequence derived from the human serpinA1 gene, and AAV2 ITRs, and the capsid is an AAVrh74 N502I capsid. In some embodiments, the invention provides an rAAV particle comprising an rAAV vector, the rAAV vector comprising, from 5' to 3', the following nucleic acids: an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO:43; a nucleic acid encoding a stuffer nucleic acid sequence from the human serpinA1 gene comprising the polynucleotide sequence of SEQ ID NO:18; a Byrne desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO:21; a Paulin desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO:22; a desmin promoter comprising the polynucleotide sequence of SEQ ID NO:23; a 5' arm of a rabbit beta globin intron comprising the polynucleotide sequence of SEQ ID NO:14; a 5' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO:40; a DMPK promoter comprising the polynucleotide sequence of SEQ ID NO:40; 204 miRNA guide sequence, miR155 terminal loop sequence comprising the polynucleotide sequence of SEQ ID NO:6, DMPK comprising the polynucleotide sequence of SEQ ID NO:5 204 Provided is an rAAV particle that comprises a miRNA passenger sequence, a 3' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit beta globin intron comprising the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylation sequence comprising the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a stuffer nucleic acid sequence from the human serpinA1 gene comprising the polynucleotide sequence of SEQ ID NO: 19, and an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO: 49, wherein the capsid is an AAVrh74 N502I capsid. In some embodiments, the AAVrh74 N502I capsid comprises a capsid protein comprising the amino acid sequence of SEQ ID NO:50.

[0016] In some embodiments, the invention provides an rAAV particle comprising an rAAV vector and a capsid, the rAAV vector comprising, from 5' to 3', the following nucleic acids: an AAV2 ITR, a nucleic acid encoding a stuffer nucleic acid sequence from the human serpinA1 gene, a Byrne desmin enhancer element, a Paulin desmin enhancer element, a desmin promoter, a 5' arm of a rabbit beta globin intron, a 5' miR155 scaffold sequence, a DMPK 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 An rAAV particle is provided, which comprises a miRNA passenger sequence, a 3' miR155 scaffold sequence, a 3' arm of a rabbit β-globin intron, a minimal bovine growth hormone polyadenylation sequence, a nucleic acid encoding a stuffer nucleic acid sequence derived from the human serpinA1 gene, and AAV2 ITRs, and the capsid is an AAVrh74 W505R capsid. In some embodiments, the invention provides an rAAV particle comprising an rAAV vector, the rAAV vector comprising, from 5' to 3', the following nucleic acids: an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO:43; a nucleic acid encoding a stuffer nucleic acid sequence from the human serpinA1 gene comprising the polynucleotide sequence of SEQ ID NO:18; a Byrne desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO:21; a Paulin desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO:22; a desmin promoter comprising the polynucleotide sequence of SEQ ID NO:23; a 5' arm of a rabbit beta globin intron comprising the polynucleotide sequence of SEQ ID NO:14; a 5' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO:40; a DMPK promoter comprising the polynucleotide sequence of SEQ ID NO:40; 204 miRNA guide sequence, miR155 terminal loop sequence comprising the polynucleotide sequence of SEQ ID NO:6, DMPK comprising the polynucleotide sequence of SEQ ID NO:5 204Provided is an rAAV particle comprising a miRNA passenger sequence, a 3' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit beta globin intron comprising the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylation sequence comprising the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a stuffer nucleic acid sequence from the human serpinA1 gene comprising the polynucleotide sequence of SEQ ID NO: 19, and an AAV ITR comprising the polynucleotide sequence of SEQ ID NO: 49, wherein the capsid is an AAVrh74 W505R capsid. In some embodiments, the AAVrh74 W505R capsid comprises a capsid protein comprising the amino acid sequence of SEQ ID NO: 52.

[0017] In some aspects, the invention provides compositions comprising any of the viral particles or rAAV particles described herein. In some embodiments, the invention provides pharmaceutical compositions comprising any of the viral particles or rAAV particles described herein. In some embodiments, the composition further comprises a pharma- ceutically acceptable carrier.

[0018] In some aspects, the invention provides a modified desmin promoter (e.g., for expressing a transgene in a muscle cell), the modified desmin promoter comprising one or more enhancer elements and a promoter of the human desmin gene. In some embodiments, the modified desmin promoter comprises two enhancer elements and a promoter of the human desmin gene. In some embodiments, the modified desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements. In some embodiments, the modified desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO:21 or a sequence having about 90% identity to the sequence of SEQ ID NO:21 and / or one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO:22 or a sequence having about 90% identity to the sequence of SEQ ID NO:22. In some embodiments, the modified desmin promoter comprises the nucleotide sequence of SEQ ID NO:12 or a sequence having about 90% identity to the sequence of SEQ ID NO:12.

[0019] In some aspects, the invention provides kits comprising one or more of an RNAi as described herein, a viral particle as described herein, an AAV particle as described herein, or a composition as described herein, in some embodiments, the kit further comprises instructions for use.

[0020] In some embodiments, the present invention provides a method of treating myotonic dystrophy-1 (DM1) in a mammal in need thereof, comprising administering to the mammal an effective amount of any of the RNAis described herein. In some embodiments, the present invention provides a method of inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof and having DM-1, comprising administering to the mammal an effective amount of any of the RNAis described herein. In some embodiments, the present invention provides a method of inhibiting accumulation of DMPK RNA in cells of a mammal in need thereof and having DM-1, comprising administering to the mammal an effective amount of any of the RNAis described herein.

[0021] In some embodiments, the present invention provides a method of treating myotonic dystrophy-1 (DM1) in a mammal in need thereof, comprising administering to the mammal an effective amount of any of the viral particles (e.g., rAAV particles) as described herein. In some embodiments, the present invention provides a method of inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof with DM-1, comprising administering to the mammal an effective amount of any of the viral particles (e.g., rAAV particles) as described herein. In some embodiments, the present invention provides a method of inhibiting accumulation of DMPK RNA in cells of a mammal in need thereof with DM-1, comprising administering to the mammal an effective amount of any of the viral particles (e.g., rAAV particles) as described herein.

[0022] In some embodiments of the invention, an effective amount of viral particles (e.g., rAAV particles) is about 1×10 8 ~about 2×10 13 In some embodiments of the invention, the dose is about 5×10 12In some embodiments of the invention, the dose is about 1×10 13 In some embodiments of the invention, the dose is about 2×10 13 Genome copies / mL.

[0023] In some embodiments of the invention, an effective amount of viral particles (e.g., rAAV particles) is about 1×10 8 ~about 2×10 14 In some embodiments of the invention, the dose is about 5×10 13 In some embodiments of the invention, the dose is about 1×10 14 In some embodiments of the invention, the dose is about 2×10 14 Genome copies / kg body weight.

[0024] In some embodiments, the present invention provides a method of treating myotonic dystrophy-1 (DM1) in a mammal in need thereof, comprising administering to the mammal an effective amount of any of the compositions as described herein. In some embodiments, the present invention provides a method of inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof with DM-1, comprising administering to the mammal an effective amount of any of the compositions as described herein. In some embodiments, the present invention provides a method of inhibiting accumulation of DMPK RNA in cells of a mammal in need thereof with DM-1, comprising administering to the mammal an effective amount of any of the compositions as described herein.

[0025] In some embodiments of the invention, the RNAi is administered in combination with an immunosuppressant, and the immunosuppressant is administered before, simultaneously, and / or after administration of the RNAi. In some embodiments, the viral or rAAV particle is administered in combination with an immunosuppressant, and the immunosuppressant is administered before, simultaneously, and / or after administration of the viral or rAAV particle. In some embodiments, the composition is administered in combination with an immunosuppressant, and the immunosuppressant is administered before, simultaneously, and / or after administration of the composition.

[0026] The present application can be understood by reference to the following description taken in conjunction with the accompanying drawings. [Brief description of the drawings]

[0027] [Figure 1A] The sequence of the nDes-miR155-amiR-DMPK204 gene cassette is shown. A hybrid muscle promoter is located upstream of the miR155-amiR-DMPK204 sequence. Downstream of the miRNA is the bovine growth hormone polyadenylation sequence (minBGHpA). The cassette is flanked on both sides by stuffer sequences derived from the A1AT intron. All of this is flanked by two AAV2 ITRs, generating a combined vector genome that is 3739 bp in size. [Figure 1B] The ITR plasmid used for cloning the nDes-miR155-amiR-DMPK204 gene cassette is shown. The ITR plasmid contains the A1AT stuffer sequence adjacent to the 5'ITR and 3'ITR of AAV2. The A1AT stuffer sequence contains the NcoI and SphI restriction sites for cloning. [Figure 1C]Figure 1 shows the results of a small-scale packaging assay performed in HEK293 cells to confirm packaging of the DC969-nDes-miR155-amiR-DMPK204 plasmid. Small-scale production was performed using AAV rep / cap plasmids. The y-axis shows the amount of vector produced per HEK293 cell compared to a standard EGFP plasmid gene cassette (CD627-CBA-GFP). DRP: DNase resistant particles. [Figure 2A] Figure 2 shows the evaluation of DMPK knockdown by AAV, nDes-miR155-amiR-DMPK204 (amiR155-204) expression cassette in DMSXL mice after tail vein injection. Figure 2A shows the transduction efficiency and biodistribution of AAV as assessed by quantifying transgene copy number in different organs. qPCR results are expressed as the average ratio of AAV copy number / cell nucleus. Figure 2B shows the levels of amiR-DMPK204 in transduced tissues. MicroRNA input levels were normalized to U6 small nuclear RNA and set relative to BSS (balanced salt solution) treated cells. Figure 2C shows the silencing of DMPK in transduced tissues. Total DMPK was determined by qRT-PCR. mRNA input was normalized to tata box binding protein (TBP) and set relative to BSS treated cells. The dotted line indicates 50% DMPK expression relative to TBP expression. In Figures 2A-2C, data were evaluated using Student's paired T-test: *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. n=13 (BSS), n=12 (amiR155-204). [Figure 2B] Same as above. [Figure 2C] Same as above. [Figure 3A]Figure 3 shows inhibition of human DMPK by AAV nDes-miR155-amiR-DMPK204. DMSXL mice were systemically injected with AAV nDes-miR155-amiR-DMPK204 in a dose-dependent manner. Mice were euthanized after 8 weeks, organs were harvested, and levels of amiR-DMPK204 and DMPK transcripts were measured. Figure 3A shows the abundance of amiR-DMPK204 normalized to U6 in various tissues. Figure 3B shows the abundance of hDMPK transcript normalized to mTBP in various tissues. Data were evaluated using ANOVA multiple comparison test: *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001. (n=10 wild type, 7 BSS, 5 low dose, 13 mid dose, and 7 high dose). [Figure 3B] Same as above. [Figure 4] Correction of splicing abnormalities in DMSXL mice after systemic treatment with AAV nDes-miR155-amiR-DMPK204. Alternative exon 11 splicing of LDB3 was assessed using RT-PCR in gastrocnemius muscle after 8 weeks of treatment. Data were evaluated using ANOVA multiple comparison test: *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. (n=10 wild type, 7 BSS, 5 low dose, 13 mid dose and 7 high dose). [Figure 5A] Figure 5 shows the survival rate and body weight increase of female DMSXL mice treated with AAV nDes-miR155-amiR-DMPK204 in a dose-dependent manner. Figure 5A shows the Kaplan-Meier survival curve, showing the improved survival rate of medium dose compared to low dose or BSS-treated animals after 8 weeks of treatment. Figure 5B shows the improved body weight observed in DMSXL animals treated with AAV nDes-miR155-amiR-DMPK204 compared to BSS-treated or low dose-treated animals. [Figure 5B] Same as above. [Figure 6]Figure 1 shows the reversal of electrophysiological features of DM1 disease upon systemic treatment of the DMSXL DM1 mouse model with AAV nDes-miR155-amiR-DMPK204 in a dose-dependent manner. Data were evaluated using ANOVA multiple comparison test: *p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001. (n=10 wild type, 7 BSS, 5 low dose, 13 mid dose and 7 high dose). [Figure 7-1] FIG. 7A shows a schematic diagram of the experimental protocol. To confirm neutralizing antibodies again, blood (

number

[0028] In some aspects, the invention provides an RNAi comprising a first strand and a second strand, a) the first strand and the second strand form a duplex, b) the first strand comprises a guide region, the guide region comprises a nucleic acid having the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO:1) or a sequence having about 90% identity to the sequence of SEQ ID NO:1, and c) the second strand comprises a non-guide region, the non-guide region comprises a nucleic acid having the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO:2) or a sequence having about 90% identity to the sequence of SEQ ID NO:2. In some embodiments, the invention provides an expression cassette for expressing a nucleic acid encoding the RNAi, for example for expressing the RNAi in mammalian muscle. In some embodiments, the expression cassette is present in a rAAV vector.

[0029] In some aspects, the present invention provides a method of treating myotonic dystrophy 1 (DM-1) in a mammal by administering an RNAi of the present invention to the mammal. In some embodiments, the administered RNAi inhibits expression of myotonic dystrophy protein kinase (DMPK) in the mammal, thereby ameliorating DM-1 in the mammal.

[0030] General Technology The techniques and procedures described or referenced herein are generally well understood and can be readily understood by those of ordinary skill in the art, for example as described in Molecular Cloning: A Laboratory Manual (Sambrook et al., 2003). thed.,Cold Spring Harbor Laboratory Press,Cold Spring Harbor,N.Y.,2012);Current Protocols in Molecular Biology(F.M.Ausubel,et al.eds.,2003);the series Methods in Enzymology(Academic Press,Inc.);PCR 2;A Practical Approach(M.J.MacPherson,B.D.Hames and G.R.Taylor eds.,1995);Antibodies,A Laboratory Manual(Harlow and Lane,eds.,1988);Culture of Animal Cells:A Manual of Basic Technique and Specialized Applications(R.I.Freshney,6 thed.,J.Wiley and Sons,2010); Oligonucleotide Synthesis(M.J.Gait,ed.,1984);Methods in Molecular Biology,Humana Press;Cell Biology:A Laboratory Notebook(J.E.Cellis,ed.,Academic Press,1998);Introduction to Cell and Tissue Culture(J.P.Mather and P.E.Roberts,Plenum Press,1998);Cell and Tissue Culture:Laboratory Procedures(A.Doyle,J.B.Griffiths,and D.G.Newell,eds.,J.Wiley and Sons,1993-8);Handbook of Experimental Immunology(D.M.Weir and C.C.Blackwell,eds.,1996);Gene Transfer Vectors for Mammalian Cells(J.M.Miller and M.P.Calos,eds.,1987);PCR:The Polymerase Chain Reaction,(Mullis et al.,eds.,1994);Current Protocols in Immunology(J.E.Coligan et al.,eds.,1991);Short Protocols in Molecular Biology(Ausubel et al.,eds.,J.Wiley and Sons,2002);Immunobiology(C.A.Janeway et al.,2004);Antibodies(P.Finch,1997);Antibodies:A Practical Approach(D.Catty.,ed.,IRL Press,1988-1989);Monoclonal Antibodies:A Practical Approach(P.Shepherd and C.Dean,eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (VT DeVita et al., eds., JBLippincott Company, 2011), which are widely used methods.

[0031] definition As used herein, a "vector" refers to a recombinant plasmid or virus containing a nucleic acid that is delivered to a host cell either in vitro or in vivo.

[0032] The term "polynucleotide" or "nucleic acid" as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, the term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified non-natural or derivatized nucleotide bases. The backbone of a polynucleotide may contain sugar and phosphate groups (as typically found in RNA or DNA) or modified or substituted sugar or phosphate groups. Alternatively, the backbone of a polynucleotide may contain polymers of synthetic subunits such as phosphoramidates, and thus may be oligodeoxynucleoside phosphoramidates (P-NH2) or mixed phosphoramidate-phosphodiester oligomers. Additionally, double-stranded polynucleotides can be obtained from chemically synthesized single-stranded polynucleotide products by synthesizing the complementary strand and annealing the strands under appropriate conditions or by synthesizing a new complementary strand using DNA polymerase with an appropriate primer.

[0033] The terms "polypeptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues, including, but not limited to, peptides, oligopeptides, dimers, trimers and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by this definition. The term also includes post-expression modifications of the polypeptide, such as glycosylation, sialylation, acetylation, phosphorylation, and the like. Furthermore, for purposes of the present invention, "polypeptide" refers to a protein that includes modifications, such as deletions, additions and substitutions (generally conservative in nature) relative to the native sequence, so long as the protein maintains a desired activity. These modifications may be deliberate, such as by site-directed mutagenesis, or may be accidental, such as by errors due to mutations of the host producing the protein or due to PCR amplification.

[0034] "Recombinant viral vector" refers to a recombinant polynucleotide vector that contains one or more heterologous sequences (i.e., nucleic acid sequences that are not of viral origin). In the case of recombinant AAV vectors, the recombinant nucleic acid is flanked by at least one, and in some embodiments two, inverted terminal repeats (ITRs).

[0035] "Recombinant AAV vector (rAAV vector)" refers to a polynucleotide vector that contains one or more heterologous sequences (i.e., nucleic acid sequences not of AAV origin) flanked by at least one, and in some embodiments, two, AAV inverted terminal repeats (ITRs). Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that is infected with a suitable helper virus (or expresses suitable helper functions) and expresses the AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When the rAAV vector is incorporated into a larger polynucleotide (e.g., a chromosome or another vector such as a plasmid used for cloning or transfection), the rAAV vector may be referred to as a "pro-vector" and can be "rescued" by replicating and encapsidating in the presence of AAV packaging functions and suitable helper functions. rAAV vectors can be in any of several forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated in liposomes, and encapsidated into viral particles, particularly AAV particles. The rAAV vector can be packaged into an AAV viral capsid to generate a "recombinant adeno-associated viral particle (rAAV particle)."

[0036] "Heterologous" means derived from a genotypically distinct entity from the rest of the entity to which it is compared or introduced or incorporated. For example, a polynucleotide that is introduced into a different cell type by genetic engineering techniques is a heterologous polynucleotide (and can encode a heterologous polypeptide when expressed). Similarly, a cellular sequence (e.g., a gene or portion thereof) that is incorporated into a viral vector is a nucleotide sequence heterologous to the vector.

[0037] The term "transgene" refers to a polynucleotide that is introduced into a cell and can be transcribed into RNA and optionally translated and / or expressed under appropriate conditions. In aspects, a transgene confers a desired property to the cell into which it is introduced, or otherwise produces a desired therapeutic or diagnostic outcome. In another aspect, a transgene can be transcribed into a molecule that mediates RNA interference, such as miRNA, siRNA, or shRNA.

[0038] The terms "genome particles (gp)", "genome equivalents" or "genome copies (gc)" used in reference to viral titer refer to the number of virions containing the DNA genome of the recombinant AAV, regardless of infectivity or functionality. The number of genome particles in a particular vector preparation can be measured by procedures such as those described in the Examples herein or, for example, Clark et al. (1999) Hum. Gene Ther., 10:1031-1039; Veldwijk et al. (2002) Mol. Ther., 6:272-278.

[0039] The term "vector genome (vg)" as used herein may refer to one or more polynucleotides that comprise a set of polynucleotide sequences of a vector, e.g., a viral vector. A vector genome may be encapsidated in a viral particle. Depending on the particular viral vector, a vector genome may comprise single-stranded DNA, double-stranded DNA, or single-stranded or double-stranded RNA. A vector genome may comprise endogenous sequences associated with a particular viral vector and / or any heterologous sequences that are recombinantly inserted into a particular viral vector. For example, a recombinant AAV vector genome may comprise at least one ITR sequence flanked by a promoter sequence, a stuffer sequence, a sequence of interest (e.g., RNAi), and a polyadenylation sequence. A complete vector genome may comprise the complete set of polynucleotide sequences of a vector. In some embodiments, the nucleic acid titer of a viral vector may be measured in vg / mL. Suitable methods for measuring this titer are known in the art (e.g., quantitative PCR).

[0040] As used herein, the term "inhibit" may refer to the action of preventing, reducing, eliminating or otherwise antagonizing the presence or activity of a particular target. Inhibition may refer to partial inhibition or complete inhibition. For example, inhibiting the expression of a gene may refer to any action that results in the prevention, reduction, elimination or any other antagonism of the expression of a gene, including a reduction in the abundance of mRNA (e.g., silencing of mRNA transcripts), degradation of mRNA, inhibition of translation of mRNA, etc. In some embodiments, inhibiting the expression of DMPK may refer to the prevention, reduction, elimination or any other antagonism of the expression of DMPK, including a reduction in the abundance of DMPK mRNA (e.g., silencing of DMPK mRNA transcripts), degradation of DMPK mRNA, inhibition of translation of DMPK mRNA, etc. As another example, inhibiting the accumulation of a protein in a cell may refer to any action that results in the prevention, reduction, elimination or any other antagonism of the expression of a protein, including a reduction in the abundance of mRNA (e.g., silencing of mRNA transcripts), degradation of mRNA, inhibition of translation of mRNA, degradation of the protein, etc. In some embodiments, inhibiting accumulation of DMPK protein in a cell refers to preventing, reducing, eliminating, or otherwise antagonizing the accumulation of DMPK protein in a cell, including reducing the abundance of DMPK mRNA (e.g., silencing the DMPK mRNA transcript), degrading DMPK mRNA, inhibiting translation of DMPK mRNA, degrading DMPK protein, etc.

[0041] The terms "infectious unit (iu)," "infectious particle," or "replication unit" as used with respect to viral titer refer to the number of infectious and replication-competent recombinant AAV vector particles as measured by the infectious center assay, also known as the replication center assay, e.g., as described in McLaughlin et al. (1988) J. Virol., 62:1963-1973.

[0042] The term "transducing units (tu)" as used with respect to viral titer refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transgene product as measured in the Examples herein or in a functional assay such as that described, for example, in Xiao et al. (1997) Exp. Neurobiol., 144:113-124; or Fisher et al. (1996) J. Virol., 70:520-532.

[0043] "Inverted terminal repeat" or "ITR" sequences are a term well understood in the art and refer to relatively short sequences found at the ends of inverted viral genomes.

[0044] "AAV inverted terminal repeat (ITR)" sequences are a term well understood in the art and are sequences of approximately 145 nucleotides present at both ends of a naturally occurring single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be in either of two alternative orientations, resulting in heterogeneity between different AAV genomes and between the ends of a single AAV genome. The outermost 125 nucleotides also contain several short self-complementary regions (designated A, A', B, B', C, C', and D regions), allowing intrastrand base pairing to occur within this portion of the ITR.

[0045] A "terminal resolution sequence" or "trs" is a sequence within the D region of an AAV ITR that is cleaved by the AAV rep protein during viral DNA replication. A mutated terminal resolution sequence is refractory to cleavage by the AAV rep protein.

[0046] "AAV helper functions" refers to functions that allow AAV to replicate and be packaged by a host cell. AAV helper functions can be provided in any of a number of forms, including, but not limited to, helper viruses or helper virus genes that assist in the replication and packaging of AAV. Other AAV helper functions are known in the art, such as genotoxic agents.

[0047] "Helper virus" in relation to AAV refers to a virus that can replicate and package AAV (a defective parvovirus) by a host cell. Helper viruses provide "helper functions" that allow AAV to replicate. Many such helper viruses have been identified, including adenoviruses, herpesviruses, and poxviruses, such as vaccinia virus and baculovirus. Adenoviruses encompass many different subgroups, with adenovirus type 5 (Ad5) of subgroup C being the most commonly used. Many adenoviruses of human, non-human mammalian, and avian origin are known and available from depositories such as ATCC. Viruses of the herpes family, also available from depositories such as ATCC, include, for example, herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), and pseudorabies virus (PRV). Examples of adenovirus helper functions for replicating AAV include E1A, E1B, E2A, VA and E4orf6 functions. Baculoviruses available from depositories include Autographa californica nuclear polyhedrosis virus.

[0048] A preparation of rAAV is said to be "substantially free" of helper virus when the ratio of infectious AAV particles to infectious helper virus particles is at least about 102:1; at least about 104:1, at least about 106:1; or at least about 108:1 or more. In some embodiments, the preparation is also free of comparable amounts of helper virus proteins (i.e., proteins that would be present as a result of such levels of helper virus if the above-mentioned helper virus particle impurities were present in disrupted form). Contaminating viral and / or cellular proteins can generally be observed by the presence of Coomassie-stained bands on SDS gels (e.g., the appearance of bands other than those corresponding to the AAV capsid proteins VPL, VP2, and VP3).

[0049] "Percent sequence identity" with respect to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical to those in the reference polypeptide or nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, without considering any conservative substitutions as part of the sequence identity. Alignment to determine percent amino acid or nucleic acid sequence identity can be accomplished in a variety of ways within the skill of the art, for example, using publicly available computer software programs, such as those described in Current Protocols Molecular Biology (Ausubel et al., eds., 1987), Supp. 30, section 7.7.18, Table 7.7.1, including BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. A preferred alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms required to achieve maximum alignment over the entire length of the sequences being compared. For purposes herein, the % amino acid sequence identity of a given amino acid sequence A with, by or to a given amino acid sequence B (which may alternatively be expressed as a given amino acid sequence A having or containing a particular % amino acid sequence identity with, by or to a given amino acid sequence B) is calculated as follows: 100 x fraction X / Y, where X is the number of amino acid residues scored as identical matches by a sequence alignment program in that program's alignment of A and B, and Y is the total number of amino acid residues in B. It will be understood that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, then the % amino acid sequence identity of A to B will not be equal to the % amino acid sequence identity of B to A.For purposes herein, the % nucleic acid sequence identity of a given nucleic acid sequence C with, by or to a given nucleic acid sequence D (which may alternatively be expressed as a given nucleic acid sequence C having or containing a particular % nucleic acid sequence identity with, by or to a given nucleic acid sequence D) is calculated as follows: 100 x fraction W / Z, where W is the number of nucleotides scored as identical matches by a sequence alignment program in that program's alignment of C and D, and Z is the total number of nucleotides in D. It will be understood that if the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, then the % nucleic acid sequence identity of C to D will not be equal to the % nucleic acid sequence identity of D to C.

[0050] An "isolated" molecule (eg, a nucleic acid or protein) or cell means that it has been identified and separated and / or recovered from a component of its natural environment.

[0051] An "effective amount" is an amount sufficient to produce beneficial or desired results, including clinical results (e.g., amelioration of symptoms, achievement of a clinical endpoint, etc.). An effective amount can be administered in one or more administrations. In the context of a disease state, an effective amount is an amount sufficient to ameliorate, stabilize, or delay the onset of the disease.

[0052] An "individual" or "subject" is a mammal. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates, such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.

[0053] As used herein, "treatment" is an approach to obtain beneficial or desired clinical results. For the purposes of the present invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, whether detectable or undetectable, reduction in the extent of disease, a stabilized (e.g., not worsening) state of disease, prevention of the spread (e.g., metastasis) of disease, delay or slowing of disease progression, remission or mitigation and remission (whether partial or total) of a disease state. "Treatment" can also mean prolonging survival compared to the expected survival in the absence of treatment.

[0054] As used herein, the term "prophylactic treatment" refers to treatment in which an individual is known or suspected to be at risk of having a disorder or is at risk of having a disorder, but exhibits no or minimal symptoms of the disorder. An individual receiving prophylactic treatment can be treated before symptoms develop.

[0055] As used herein, the term "myotonic dystrophy type 1" or "DM1" refers to a multisystem disorder affecting skeletal and smooth muscles as well as the eye, heart, endocrine system, and central nervous system. There are three overlapping categories of DM-1 (Bird, TD, Myotonic Dystrophy Type 1. 1999 Sep 17 [Updated March 25, 2021]. In: Adam MP, Ardinger HH, Pagon RA, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2022). Mild DM1 is characterized by cataracts and mild myotonia; classical DM1 is characterized by muscle weakness and wasting, myotonia, cataracts and often cardiac conduction defects; congenital DM1 is characterized by hypotonia and severe generalized weakness at birth, often with respiratory failure and early death; intellectual disability is common.

[0056] As used herein, the terms "myotonic dystrophy protein kinase", "DMPK", "myotonin-protein kinase", "MT-PK", "myotonic dystrophy protein kinase" or "MDPK" may refer to either the gene or its polypeptide product associated with most cases of DM1. The 3' untranslated region of the DMPK gene contains 5-37 copies of a CTG trinucleotide repeat. Expansion of this unstable motif to 50-1,000 copies causes myotonic dystrophy type I, with increasing severity as the copy number of the repetitive element increases.

[0057] As used herein, "RNAi" can refer to any RNA molecule that induces RNA interference in cells. Examples of RNAi include, but are not limited to, small inhibitory RNA (siRNA), microRNA (miRNA) and small hairpin RNA (shRNA).

[0058] "miRNA" may refer to a polynucleotide that contains (i) a double-stranded sequence that targets a gene of interest for knockdown by RNAi, and (ii) an additional sequence that forms a stem-loop structure similar to endogenous miRNA. In some embodiments, the miRNA contains nucleic acids flanking the stem-loop structure. These flanking sequences are known as "miRNA scaffolds." A sequence that targets a gene of interest for RNAi (e.g., a short, approximately 20 nt sequence) may be ligated to a sequence that generates a miRNA-like stem-loop and a sequence that base-pairs with the sequence of interest to form a duplex when the polynucleotide is assembled into a miRNA-like secondary structure. As described herein, this duplex may be incompletely hybridized, for example, may contain one or more unpaired or mismatched bases. When the polynucleotide is cleaved by Dicer, the duplex containing the sequence that targets the gene of interest may unwind and be incorporated into the RISC complex. The miRNA scaffold may refer to the miRNA itself or a DNA polynucleotide that encodes the miRNA. Examples of miRNA scaffolds include the miR-155 sequence (Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9) and the mirGE scaffold (WO 2014016817A2). Commercially available kits for cloning sequences into miRNA scaffolds are known in the art (e.g., Life Technologies, Thermo Fisher Scientific; Invitrogen™ BLOCK-iT™ Pol II miR RNAi Expression Vector Kit from Waltham, MA).

[0059] As used herein, the term "sense" nucleic acid is a nucleic acid that comprises a sequence that encodes all or a portion of a transgene. In some instances, the mRNA of the transgene is a sense nucleic acid.

[0060] As used herein, an "antisense" nucleic acid is a sequence of nucleic acid that is complementary to a "sense" nucleic acid. For example, an antisense nucleic acid can be complementary to an mRNA encoding a transgene.

[0061] As used herein, the "guide region" of RNAi is the RNAi strand that typically binds to target mRNA based on complementarity. The complementary region can include all or part of the guide region. Typically, the complementary region includes at least the seed region. In many cases, the antisense region of RNAi is the guide region.

[0062] As used herein, the "passenger region" or "non-guide region" of an RNAi is used interchangeably herein and is a region of an RNAi that is complementary to the guide region. In many cases, the sense region of an RNAi is the passenger region.

[0063] As used herein, the "seed region" of an RNAi (e.g., miRNA) is a region of the microRNA that is about 1-8 nucleotides in length. In some instances, the seed region and the 3'-UTR of its target mRNA may be important determinants in recognizing the RNAi.

[0064] As used herein, "off-target gene silencing" refers to the pairing of the RNAi seed region with sequences within the 3?-UTR of unintended mRNAs, inducing translational repression and destabilization of those transcripts (e.g., reducing expression of the unintended mRNAs).

[0065] Reference herein to "about" a value or parameter includes (and describes) embodiments relating to that value or parameter per se. For example, a description referring to "about X" includes a description of "X."

[0066] As used herein, the singular forms of articles "a," "an," and "the" include the plural forms unless otherwise indicated.

[0067] It will be understood that aspects and embodiments of the invention described in this disclosure include "comprising," "consisting," and "consisting essentially of" aspects and embodiments.

[0068] RNAi In some aspects, the present invention provides improved RNAi targeting DMPK RNA for treating myotonic dystrophy type 1 (DM1). In some embodiments, the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA) or a small hairpin RNA (shRNA). Small inhibitory RNA, i.e., interfering RNA (siRNA), are known in the art as double-stranded RNA molecules of about 19-25 (e.g., 19-23) base pairs in length that induce RNAi in cells. miRNAs are typically smaller than siRNAs and may have multiple targets and functions to suppress translation, degrade mRNA, and in some instances, endonucleolytically cleave mRNA. Small hairpin RNAs (shRNAs) are known in the art as RNA molecules that contain about 19-25 (e.g., 19-23) base pairs of double-stranded RNA linked by a short loop (e.g., about 4-11 nucleotides) that induce RNAi in cells. In some embodiments, the RNAi comprises a first strand and a second strand, a) the first strand and the second strand form a duplex, b) the first strand comprises a guide region, the guide region comprises the nucleic acid sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1), and c) the second strand comprises a non-guide region. In some embodiments, the guide region comprises the nucleic acid sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1), and the non-guide region comprises the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2).

[0069] In some embodiments, the first strand comprises a guide region, the guide region comprises a nucleic acid sequence having greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1). In some embodiments, the first strand comprises a guide region, the guide region comprises a nucleic acid sequence having greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) but maintaining at least one CpG motif. In some embodiments, the second strand comprises a non-guide region, the non-guide region comprises a nucleic acid sequence having greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2). In some embodiments, the second strand comprises a non-guide region, the non-guide region comprises a nucleic acid sequence having greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2) but maintaining at least one CpG motif.

[0070] In some embodiments, the RNAi comprises a nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the RNAi comprises a nucleic acid sequence having greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 7. In some embodiments, the RNAi comprises a nucleic acid sequence having greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 7, but maintaining at least one sequence (e.g., within the seed sequence).

[0071] In some embodiments, the present invention provides a nucleic acid encoding an RNAi comprising a first strand and a second strand, a) the first strand and the second strand form a duplex, b) the first strand comprises a guide region, and c) the second strand comprises a non-guide region. In some embodiments, the nucleic acid encoding the RNAi comprises a nucleic acid sequence of SEQ ID NO: 4 and / or a nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the nucleic acid encoding the RNAi comprises a nucleic acid sequence having more than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 4 and / or a nucleic acid sequence having more than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 5. In some embodiments, the RNAi is encoded by a nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the RNAi is encoded by a nucleic acid sequence having greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO:8.

[0072] MicroRNAs (miRNAs) are known in the art as RNA molecules that induce RNAi in cells, comprising short (e.g., about 19-25 base pairs) sequences of double-stranded RNA linked by loops and containing one or more additional sequences of double-stranded RNA that contain one or more bulges (e.g., mismatched or unpaired base pairs). As used herein, the term "miRNA" encompasses endogenous miRNAs as well as exogenous or heterologous miRNAs. In some embodiments, a "miRNA" may be referred to as a pri-miRNA or pre-miRNA. A pri-miRNA transcript is produced during processing of a miRNA. The pri-miRNA is processed by Drosha-DGCR8 to produce a pre-miRNA by excising one or more sequences to leave a pre-miRNA that includes the 5' flanking region, guide strand, loop region, non-guide strand, and 3' flanking region; or the 5' flanking region, non-guide strand, loop region, guide strand, and 3' flanking region. The pre-miRNA is then transported to the cytoplasm and processed by Dicer to generate siRNAs that include a guide strand and a non-guide (or passenger) strand. The guide strand is then utilized by the RISC complex to cause gene silencing, for example, by recognizing a target RNA sequence that is complementary to the guide strand. Further description of miRNAs can be found, for example, in WO 2008 / 150897. Recognition of a target sequence by a miRNA is determined primarily by pairing between the target sequence and the miRNA seed sequence, e.g., nucleotides 1-8 (5' to 3') of the guide strand (see, for example, Boudreau, RR et al. (2013) Nucleic Acids Res. 41:e9).

[0073] In the pri / pre-miRNA structure, the guide strand:non-guide strand interface is partially formed in the duplex by complementary base pairing (e.g., Watson-Crick base pairing). However, in some embodiments, this complementary base pairing does not extend throughout the entire duplex. In some embodiments, a bulge at the interface may be present at one or more nucleotide positions. As used herein, the term "bulge" may refer to a region of nucleic acid that is non-complementary to the opposing nucleic acid in the duplex. In some embodiments, a bulge is formed when regions of complementary nucleic acid bind to each other, while a region of the central non-complementary region does not bind. In some embodiments, a bulge is formed when the two strands of nucleic acid located between the two complementary regions are of different lengths. As described below, a bulge may include one or more nucleotides.

[0074] During miRNA processing, miRNA is cleaved at the cleavage site adjacent to the interface of guide strand:non-guide strand, thereby releasing the siRNA duplex of guide strand and non-guide strand.In some embodiments, miRNA comprises a bulge in the sense strand or antisense strand adjacent to the cleavage site.In other words, in some embodiments, miRNA comprises a bulge in the guide strand or non-guide strand adjacent to seed sequence.

[0075] In some embodiments, the miRNA comprises a bulge in the guide strand opposite the 5' cleavage site of the mature non-guide strand. In some embodiments, the miRNA comprises a bulge opposite the 5' nucleotide of the non-guide strand. In some embodiments, the miRNA comprises a bulge in the sense strand opposite the 3' cleavage site of the mature guide strand. In some embodiments, the miRNA comprises a bulge opposite the 3' nucleotide of the guide strand.

[0076] The safety of RNAi-based therapeutics can be hampered by the ability of small inhibitory RNAs (siRNAs) to bind to unintended mRNAs and reduce their expression, an effect known as off-target gene silencing. Off-targeting occurs primarily when the seed region (nucleotides 2-8 of a small RNA) pairs with sequences within the 3'-UTR of unintended mRNAs, inducing translational repression and destabilization of these transcripts. RNAi with reduced off-targeting can be designed by substituting bases within the guide and non-guide sequences, for example by generating CpG motifs. Potential substitutions that may result in significantly reduced off-target scores can be evaluated using the SiSPOTR algorithm, a specificity-focused siRNA design algorithm that identifies candidate sequences with minimal off-target potential and strong silencing capacity (Boudreau et al, Nucleic Acids Res. 2013 Jan;41(1)e9. A reduced SiSPOTR score predicts sequences with a reduced number of potential human off-targets compared to the parent RNAi molecule. In some embodiments of the invention, RNAi is modified to reduce off-target gene silencing.

[0077] In some embodiments, the first strand and the second strand are linked by an RNA (e.g., an RNA linker) that can form a loop structure. As is generally known in the art, an RNA loop structure (e.g., a stem-loop or a hairpin) is formed when the RNA molecule comprises two RNA sequences that are separated from each other by RNA sequences that do not base-pair together. For example, a loop structure can be formed in an RNA molecule ABC when sequences A and C are complementary or partially complementary such that they base-pair together, but the bases of sequence B do not base-pair together.

[0078] In some embodiments, the RNA capable of forming a loop structure comprises 4-50 nucleotides. In certain embodiments, the RNA capable of forming a loop structure comprises 13 nucleotides. In some embodiments, the number of nucleotides of the RNA capable of forming a loop is 4-50 nucleotides or any integer in between. In some embodiments, 0-50% of the loop may be complementary to another portion of the loop. As used herein, the term "loop structure" is a sequence that connects two complementary strands of a nucleic acid. In some embodiments, 1-3 nucleotides of the loop structure may be adjacent to the complementary strand of the nucleic acid and complementary to 1-3 nucleotides of the distal portion of the loop structure. For example, 3 nucleotides at the 5' end of the loop structure may be complementary to 3 nucleotides at the 3' end of the loop structure.

[0079] In some embodiments, the nucleic acid encoding the RNAi of the present disclosure comprises a heterologous miRNA scaffold. In some embodiments, the use of a heterologous miRNA scaffold is used to regulate miRNA expression, for example to increase miRNA expression or to decrease miRNA expression. Any miRNA scaffold known in the art can be used. In some embodiments, the miRNA scaffold is derived from the miR-155 scaffold (see, for example, Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9 and Invitrogen™ BLOCK-iT™ Pol II miR RNAi Expression Vector Kit, Life Technologies, Thermo Fisher Scientific; Waltham, MA) or the mirGE scaffold (WO 2014 / 016817).

[0080] Methods for Treating Myotonic Dystrophy Type 1 (DM-1) Myotonic dystrophy type 1 (DM1) is a monogenic, autosomal dominant, progressive disease caused by an expansion of CTG repeats (>50) in the DMPK locus (myotonic dystrophy protein kinase). DMPK containing the repeats is transcribed into mRNA, which forms a hairpin that binds to RNA-binding proteins and sequesters them from their normal function. This leads to the appearance of nuclear foci, mis-splicing and ultimately myotonia. DM1 primarily affects skeletal, cardiac and smooth muscles, leading to significant physical, cognitive and behavioral impairments and disability.

[0081] In some aspects, the present invention provides methods and compositions for treating myotonic dystrophy-1 (DM1) in a mammal, comprising administering to the mammal a pharmaceutical composition of the present disclosure (e.g., a pharmaceutical composition comprising the rAAV particles of the present disclosure). In some aspects, the present invention provides methods and compositions for inhibiting expression of DMPK in a mammal having DM-1, comprising administering to the mammal a pharmaceutical composition of the present disclosure (e.g., a pharmaceutical composition comprising the rAAV particles of the present disclosure). In some aspects, the present invention provides methods and compositions for inhibiting accumulation of DMPK in cells of a mammal having DM1, comprising administering to the mammal a pharmaceutical composition of the present disclosure (e.g., a pharmaceutical composition comprising the rAAV particles of the present disclosure). In some aspects, the present invention provides methods and compositions for ameliorating symptoms of DM1, comprising administering to the mammal a pharmaceutical composition of the present disclosure (e.g., a pharmaceutical composition comprising the rAAV particles of the present disclosure).

[0082] In some aspects, the present invention provides an RNAi for targeting DMPK mRNA in a mammal with DM1. In some embodiments, the RNAi comprises a first strand comprising a first nucleic acid comprising the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO: 1) and a second strand comprising a second nucleic acid comprising the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2). The RNAi described herein (e.g., as part of a rAAV vector) can be particularly utilized for the treatment of DM1.

[0083] In some embodiments, the RNAi is a small inhibitory RNA (siRNA), a microRNA (miRNA), or a small hairpin RNA (shRNA). Small inhibitory RNA, or interfering RNA (siRNA), are known in the art as double-stranded RNA molecules of about 19-25 (e.g., 19-23) base pairs in length that induce RNAi in cells. miRNAs are typically smaller than siRNAs and may have multiple targets and the ability to inhibit translation, degrade mRNA, and in some instances endonucleolytically cleave mRNA. Small hairpin RNAs (shRNAs) are known in the art as RNA molecules that contain about 19-25 (e.g., 19-23) base pairs of double-stranded RNA linked by a short loop (e.g., about 4-11 nucleotides) that induces RNAi in cells.

[0084] In some embodiments, the miRNA comprises a guide sequence that is about 90% identical to SEQ ID NO: 1. In some embodiments, the miRNA comprises a guide sequence that is about 90% identical, 91% identical, 92% identical, 93% identical, 94% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO:1.

[0085] In some embodiments, the miRNA comprises a non-guide sequence (passenger strand) that is about 90% identical to SEQ ID NO: 2. In some embodiments, the miRNA comprises a non-guide sequence that is about 90% identical, 91% identical, 92% identical, 93% identical, 94% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical, or 100% identical to SEQ ID NO: 2.

[0086] In some embodiments, the first strand and the second strand are linked by an RNA that can form a loop structure. As is generally known in the art, an RNA loop structure (e.g., stem-loop or hairpin) is formed when the RNA molecule comprises two RNA sequences that are separated by an RNA sequence that does not base-pair together. For example, a loop structure can be formed in an RNA molecule ABC when sequences A and C are complementary or partially complementary to each other so that they base-pair together, but the bases of sequence B do not base-pair together.

[0087] In some embodiments, the RNA capable of forming a loop structure comprises 4-50 nucleotides. In certain embodiments, the RNA capable of forming a loop structure comprises 13 nucleotides. In certain embodiments, the RNA capable of forming a loop structure comprises the nucleotide sequence GUUUUGGCCACUGACUGAC (SEQ ID NO:3). In some embodiments, the vector genome comprises a nucleotide sequence that is at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO:3.

[0088] In some aspects, the invention provides methods comprising administering to a mammal (e.g., a mammal with DM1) an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO:1) and a second strand comprising a second nucleic acid comprising the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO:2). In some embodiments, the recombinant viral particle comprises the RNAi. In some embodiments, the recombinant viral particle is an AAV particle that encapsidates a rAAV vector, and the rAAV vector encodes the RNAi.

[0089] In some embodiments, delivery of the rAAV particles is by systemic injection of the rAAV particles into a mammal, hi some embodiments, the systemic injection is intravenous, intraarterial, intramuscular, intraperitoneal, intradermal or subcutaneous, into the CSF, and intrathecal (IT).

[0090] In some aspects, the present invention provides a method of treating DM1 in a mammal, comprising administering to the mammal a pharmaceutical composition of the present disclosure. In some aspects, the present invention provides a method of inhibiting accumulation of DMPK in cells of a mammal having DM1, comprising administering to the mammal a pharmaceutical composition of the present disclosure. In some aspects, the present invention provides a method of inhibiting expression of DMPK in a mammal having DM1, comprising administering to the mammal a pharmaceutical composition of the present disclosure. In some embodiments, the DMPK is a mutant DMPK (e.g., a DMPK containing more than 37 or more than 50 CTG repeats).

[0091] In some embodiments, the present invention provides a method of treating a human having DM1 by administering an effective amount of a pharmaceutical composition comprising an rAAV vector encoding an RNAi of the present disclosure to suppress the activity of mutant DMPK. In some embodiments, the pharmaceutical composition comprises one or more pharma- ceutical acceptable excipients.

[0092] In some embodiments, the method comprises administering an effective amount of a pharmaceutical composition comprising an rAAV vector encoding an RNAi of the present disclosure to inhibit the activity of mutant DMPK. In some embodiments, the viral titer of the rAAV particles is at least about 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , 9×10 12 , 10×10 12 , 11×10 12 , 15×10 12 , 20×10 12 , 25×10 12 , 30×10 12 Or 50 x 10 12In some embodiments, the viral titer of the rAAV particles is about 5×10 12 ~6×10 12 , 6×10 12 ~7×10 12 , 7×10 12 ~8×10 12 , 8×10 12 ~9×10 12 , 9×10 12 ~10×10 12 , 10×10 12 ~11×10 12 , 11×10 12 ~15×10 12 , 15×10 12 ~20×10 12 , 20×10 12 ~25×10 12 , 25×10 12 ~30×10 12 , 30×10 12 ~50×10 12 Or 50 x 10 12 ~100×10 12 In some embodiments, the viral titer of the rAAV particles is about 5×10 12 ~10×10 12 , 10×10 12 ~25×10 12 Or 25 x 10 12 ~50×10 12 In some embodiments, the viral titer of the rAAV particles is at least about 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , 10×10 9 , 11×10 9 , 15×10 9 , 20×10 9 , 25×10 9 , 30×10 9 Or 50 x 10 9 In some embodiments, the viral titer of the rAAV particles is about 5×10 9 ~6×109 , 6×10 9 ~7×10 9 , 7×10 9 ~8×10 9 , 8×10 9 ~9×10 9 , 9×10 9 ~10×10 9 , 10×10 9 ~11×10 9 , 11×10 9 ~15×10 9 , 15×10 9 ~20×10 9 , 20×10 9 ~25×10 9 , 25×10 9 ~30×10 9 , 30×10 9 ~50×10 9 Or 50 x 10 9 ~100×10 9 In some embodiments, the viral titer of the rAAV particles is about 5×10 9 ~10×10 9 , 10×10 9 ~15×10 9 , 15×10 9 ~25×10 9 Or 25 x 10 9 ~50×10 9 In some embodiments, the viral titer of the rAAV particles is at least about 5×10 10 , 6×10 10 , 7×10 10 , 8×10 10 , 9×10 10 , 10×10 10 , 11×10 10 , 15×10 10 , 20×10 10 , 25×10 10 , 30×10 10 , 40×10 10 Or 50 x 10 10 In some embodiments, the viral titer of the rAAV particles is at least about 5×10 infectious units / mL. 10 ~6×10 10, 6×10 10 ~7×10 10 , 7×10 10 ~8×10 10 , 8×10 10 ~9×10 10 , 9×10 10 ~10×10 10 , 10×10 10 ~11×10 10 , 11×10 10 ~15×10 10 , 15×10 10 ~20×10 10 , 20×10 10 ~25×10 10 , 25×10 10 ~30×10 10 , 30×10 10 ~40×10 10 , 40×10 10 ~50×10 10 Or 50 x 10 10 ~100×10 10 In some embodiments, the viral titer of the rAAV particles is at least about 5×10 infectious units / mL. 10 ~10×10 10 , 10×10 10 ~15×10 10 , 15×10 10 ~25×10 10 Or 25 x 10 10 ~50×10 10 infectious units / mL.

[0093] In some embodiments, the dose concentration of rAAV particles administered to an individual is about 1×10 8 ~about 2×10 13 In some embodiments, the dose concentration of the rAAV particles administered to an individual is about 1×10 8 ~Approx. 5×10 8 , about 5×10 8 ~About 10×10 8 , about 10×10 8 ~About 20×10 8 , about 20×10 8 ~Approx. 30×10 8 , about 30×10 8~About 40×10 8 , about 40×10 8 ~About 50×10 8 Or about 50 x 10 8 ~About 100×10 8 In some embodiments, the dose concentration of the rAAV particles administered to an individual is about 1×10 9 ~Approx. 5×10 9 , about 5×10 9 ~About 10×10 9 , about 10×10 9 ~About 20×10 9 , about 20×10 9 ~Approx. 30×10 9 , about 30×10 9 ~About 40×10 9 , about 40×10 9 ~About 50×10 9 Or about 50 x 10 9 ~About 100×10 9 In some embodiments, the dose concentration of the rAAV particles administered to an individual is about 1×10 10 ~Approx. 5×10 10 , about 5×10 10 ~About 10×10 10 , about 10×10 10 ~About 20×10 10 , about 20×10 10 ~Approx. 30×10 10 , about 30×10 10 ~About 40×10 10 , about 40×10 10 ~About 50×10 10 Or about 50 x 10 10 ~About 100×10 10 In some embodiments, the dose concentration of the rAAV particles administered to an individual is about 1×10 11 ~Approx. 5×10 11 , about 5×10 11 ~About 10×10 11 , about 10×10 11 ~About 20×10 11 , about 20×10 11 ~Approx. 30×10 11 , about 30×10 11 ~About 40×1011 , about 40×10 11 ~About 50×10 11 Or about 50 x 10 11 ~About 100×10 11 In some embodiments, the dose concentration of the rAAV particles administered to an individual is about 1×10 12 ~Approx. 5×10 12 , about 5×10 12 ~About 10×10 12 , about 10×10 12 ~About 20×10 12 , about 20×10 12 ~Approx. 30×10 12 , about 30×10 12 ~About 40×10 12 , about 40×10 12 ~About 50×10 12 Or about 50 x 10 12 ~About 100×10 12 In some embodiments, the dose concentration of the rAAV particles administered to an individual is about 1×10 13 ~about 2×10 13 In some embodiments, the dose concentration of the rAAV particles administered to an individual is about 1×10 8 , about 5×10 8 , about 1×10 9 , about 5×10 9 , about 1×10 10 , about 5×10 10 , about 1×10 11 , about 5×10 11 , about 1×10 12 , about 5×10 12 , about 1×10 13 Or about 2 x 10 13 In some embodiments, the dose concentration of rAAV particles administered to an individual is about 5×10 genome copies / mL. 12 In some embodiments, the dose concentration of rAAV particles administered to an individual is about 1×10 genome copies / mL. 13 In some embodiments, the dose concentration of rAAV particles administered to an individual is about 2×10 genome copies / mL. 13 Genome copies / mL.

[0094] In some embodiments, the dose of rAAV particles administered to an individual is at least about 1×10 8 ~about 2×10 14 In some embodiments, the dose of rAAV particles administered to an individual is about 1×10 genome copies / kg body weight. 8 ~about 2×10 14 In some embodiments, the dose of rAAV particles administered to an individual is about 1×10 genome copies / kg body weight. 8 ~Approx. 1×10 14 , 5×10 8 ~Approx. 1×10 14 , 1×10 9 ~Approx. 1×10 14 , 5×10 9 ~Approx. 1×10 14 , 1×10 10 ~Approx. 1×10 14 , 5×10 10 ~Approx. 1×10 14 , 1×10 11 ~Approx. 1×10 14 , 5×10 11 ~Approx. 1×10 14 , 1×10 12 ~Approx. 1×10 14 , 5×10 12 ~Approx. 1×10 14 , 1×10 13 ~Approx. 1×10 14 , 5×10 13 ~Approx. 1×10 14 , 1×10 8 ~Approx. 5×10 13 , 5×10 8 ~Approx. 5×10 13 , 1×10 9 ~Approx. 5×10 13 , 5×10 9 ~Approx. 5×10 13 , 1×10 10 ~Approx. 5×10 13 , 5×10 10 ~Approx. 5×10 13 , 1×10 11 ~Approx. 5×10 13 , 5×10 11 ~Approx. 5×10 13 , 1×1012 ~Approx. 5×10 13 , 5×10 12 ~Approx. 5×10 13 , 1×10 13 ~Approx. 5×10 13 , 1×10 8 ~Approx. 1×10 13 , 5×10 8 ~Approx. 1×10 13 , 1×10 9 ~Approx. 1×10 13 , 5×10 9 ~Approx. 1×10 13 , 1×10 10 ~Approx. 1×10 13 , 5×10 10 ~Approx. 1×10 13 , 1×10 11 ~Approx. 1×10 13 , 5×10 11 ~Approx. 1×10 13 , 1×10 12 ~Approx. 1×10 13 , 5×10 12 ~Approx. 1×10 13 , 1×10 8 ~Approx. 5×10 12 , 5×10 8 ~Approx. 5×10 12 , 1×10 9 ~Approx. 5×10 12 , 5×10 9 ~Approx. 5×10 12 , 1×10 10 ~Approx. 5×10 12 , 5×10 10 ~Approx. 5×10 12 , 1×10 11 ~Approx. 5×10 12 , 5×10 11 ~Approx. 5×10 12 , 1×10 12 ~Approx. 5×10 12 , 1×10 8 ~Approx. 1×10 12 , 5×10 8 ~Approx. 1×10 12 , 1×10 9 ~Approx. 1×10 12 , 5×10 9 ~Approx. 1×10 12 , 1×10 10 ~Approx. 1×10 12 , 5×1010 ~Approx. 1×10 12 , 1×10 11 ~Approx. 1×10 12 , 5×10 11 ~Approx. 1×10 12 , 1×10 8 ~Approx. 5×10 11 , 5×10 8 ~Approx. 5×10 11 , 1×10 9 ~Approx. 5×10 11 , 5×10 9 ~Approx. 5×10 11 , 1×10 10 ~Approx. 5×10 11 , 5×10 10 ~Approx. 5×10 11 , 1×10 11 ~Approx. 5×10 11 , 1×10 8 ~Approx. 1×10 11 , 5×10 8 ~Approx. 1×10 11 , 1×10 9 ~Approx. 1×10 11 , 5×10 9 ~Approx. 1×10 11 , 1×10 10 ~Approx. 1×10 11 , 5×10 10 ~Approx. 1×10 11 , 1×10 8 ~Approx. 5×10 10 , 5×10 8 ~Approx. 5×10 10 , 1×10 9 ~Approx. 5×10 10 , 5×10 9 ~Approx. 5×10 10 , 1×10 10 ~Approx. 5×10 10 , 1×10 8 ~Approx. 1×10 10 , 5×10 8 ~Approx. 1×10 10 , 1×10 9 ~Approx. 1×10 10 , 5×10 9 ~Approx. 1×10 10 , 1×10 8 ~Approx. 5×10 9 , 5×10 8 ~Approx. 5×10 9 , 1×109 ~Approx. 5×10 9 , 1×10 8 ~Approx. 1×10 9 , 5×10 8 ~Approx. 1×10 9 Or 1×10 8 ~Approx. 5×10 8 In some embodiments, the dose of rAAV particles administered to an individual is about 1×10 9 , about 5×10 9 , about 1×10 10 , about 5×10 10 , about 1×10 11 , about 5×10 11 , about 1×10 12 , about 5×10 12 , about 1×10 13 , about 5×10 13 , about 1×10 14 Or about 2 x 10 14 In some embodiments, the dose of rAAV particles administered to an individual is about 5×10 genome copies / kg body weight. 13 In some embodiments, the dose of rAAV particles administered to an individual is about 1×10 genome copies / kg body weight. 14 In some embodiments, the dose of rAAV particles administered to an individual is about 2×10 genome copies / kg body weight. 14 Genome copies / kg body weight.

[0095] In some embodiments, the total amount of rAAV particles administered to an individual is at least about 1×10 9 ~about 2×10 14 In some embodiments, the total amount of rAAV particles administered to an individual is about 1×10 9 ~about 2×10 14In some embodiments of the invention, the volume of the composition injected into the striatum is any one of 10 μl, 25 μl, 50 μl, 75 μl, 100 μl, 200 μl, 300 μl, 400 μl, 500 μl, 600 μl, 700 μl, 800 μl, 900 μl, 1 mL, 5 mL, 10 mL, 25 mL, 50 mL, 75 mL, or more than 100 mL, or any amount therebetween.

[0096] The compositions of the invention (e.g., rAAV particles containing a vector encoding an RNAi of the present disclosure) can be used alone or in combination with one or more additional therapeutic agents to treat DM1. The interval between successive administrations can be in units of at least (or alternatively less than) minutes, hours, or days.

[0097] In some embodiments, the RNAi for treating DM1 is administered in combination with an immunosuppressant, for example, to suppress immune response to the RNAi. In some embodiments, the immunosuppressant is administered before administration of the RNAi. In some embodiments, the immunosuppressant is administered simultaneously with administration of the RNAi. In some embodiments, the immunosuppressant is administered after administration of the RNAi. In some embodiments, the immunosuppressant is administered after administration of the RNAi, during or any combination thereafter.

[0098] In some embodiments, rAAV particles for treating DM1 are administered in combination with an immunosuppressant, e.g., to suppress an immune response to the rAAV particles and / or the transgene products of the rAAV particles. In some embodiments, the immunosuppressant is administered prior to administration of the rAAV particles. In some embodiments, the immunosuppressant is administered simultaneously with administration of the rAAV particles. In some embodiments, the immunosuppressant is administered after administration of the rAAV particles. In some embodiments, the immunosuppressant is administered after administration of the rAAV particles, in any combination during or after administration of the rAAV particles.

[0099] In some embodiments, the present invention provides for the use of an effective amount of any of the RNAis described herein in the manufacture of a medicament for treating myotonic dystrophy-1 (DM1) in a mammal in need thereof. In some embodiments, the present invention provides for the use of an effective amount of any of the RNAis described herein in the manufacture of a medicament for inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof and having DM-1. In some embodiments, the present invention provides for the use of an effective amount of any of the RNAis described herein in the manufacture of a medicament for inhibiting accumulation of DMPK RNA in cells of a mammal in need thereof and having DM-1.

[0100] In some embodiments, the present invention provides for the use of an effective amount of any of the RNAis described herein to treat myotonic dystrophy-1 (DM1) in a mammal in need thereof. In some embodiments, the present invention provides for the use of an effective amount of any of the RNAis described herein to inhibit expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof and having DM-1. In some embodiments, the present invention provides for the use of an effective amount of any of the RNAis described herein to inhibit accumulation of DMPK RNA in cells of a mammal in need thereof and having DM-1.

[0101] In some embodiments, the present invention provides any of the RNAis described herein for treating myotonic dystrophy-1 (DM1) in a mammal in need thereof. In some embodiments, the present invention provides any of the RNAis described herein for inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof with DM-1. In some embodiments, the present invention provides any of the RNAis described herein for inhibiting accumulation of DMPK RNA in cells of a mammal in need thereof with DM-1.

[0102] In some embodiments, the present invention provides for the use of an effective amount of any of the viral particles (e.g., AAV particles) described herein in the manufacture of a medicament for treating myotonic dystrophy-1 (DM1) in a mammal in need thereof. In some embodiments, the present invention provides for the use of an effective amount of any of the viral particles (e.g., AAV particles) described herein in the manufacture of a medicament for inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof and having DM-1. In some embodiments, the present invention provides for the use of an effective amount of any of the viral particles (e.g., AAV particles) described herein in the manufacture of a medicament for inhibiting accumulation of DMPK RNA in cells of a mammal in need thereof and having DM-1.

[0103] In some embodiments, the present invention provides for the use of an effective amount of any of the viral particles (e.g., AAV particles) described herein to treat myotonic dystrophy-1 (DM1) in a mammal in need thereof. In some embodiments, the present invention provides for the use of an effective amount of any of the viral particles (e.g., AAV particles) described herein to inhibit expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof and having DM-1. In some embodiments, the present invention provides for the use of an effective amount of any of the viral particles (e.g., AAV particles) described herein to inhibit accumulation of DMPK RNA in cells of a mammal in need thereof and having DM-1.

[0104] In some embodiments, the present invention provides a viral particle (e.g., AAV particle) described herein for treating myotonic dystrophy-1 (DM1) in a mammal in need thereof. In some embodiments, the present invention provides any of the viral particles (e.g., AAV particle) described herein for inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof having DM-1. In some embodiments, the present invention provides any of the viral particles (e.g., AAV particle) described herein for inhibiting accumulation of DMPK RNA in cells of a mammal in need thereof having DM-1.

[0105] In some embodiments, the present invention provides for the use of an effective amount of any of the compositions described herein in the manufacture of a medicament for treating myotonic dystrophy-1 (DM1) in a mammal in need thereof. In some embodiments, the present invention provides for the use of an effective amount of any of the compositions described herein in the manufacture of a medicament for inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof with DM-1. In some embodiments, the present invention provides for the use of an effective amount of any of the compositions described herein in the manufacture of a medicament for inhibiting accumulation of DMPK RNA in cells of a mammal in need thereof with DM-1.

[0106] In some embodiments, the present invention provides for the use of an effective amount of any of the compositions described herein to treat myotonic dystrophy-1 (DM1) in a mammal in need thereof. In some embodiments, the present invention provides for the use of an effective amount of any of the compositions described herein to inhibit expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof and having DM-1. In some embodiments, the present invention provides for the use of an effective amount of any of the compositions described herein to inhibit accumulation of DMPK RNA in cells of a mammal in need thereof and having DM-1.

[0107] In some embodiments, the present invention provides compositions described herein for treating myotonic dystrophy-1 (DM1) in a mammal in need thereof. In some embodiments, the present invention provides any of the compositions described herein for inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal in need thereof with DM-1. In some embodiments, the present invention provides any of the compositions described herein for inhibiting accumulation of DMPK RNA in cells of a mammal in need thereof with DM-1.

[0108] RNAi expression constructs and vectors The present invention provides expression constructs, vectors and rAAV particles for expressing the RNAi described herein.

[0109] In some embodiments, the nucleic acid encoding the RNAi of the present disclosure comprises a heterologous miRNA scaffold. In some embodiments, the use of a heterologous miRNA scaffold is used to regulate miRNA expression, for example to increase miRNA expression or to decrease miRNA expression. Any miRNA scaffold known in the art can be used. In some embodiments, the miRNA scaffold is derived from the miR-155 scaffold (see, for example, Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9 and Invitrogen™ BLOCK-iT™ Pol II miR RNAi Expression Vector Kit, Life Technologies, Thermo Fisher Scientific; Waltham, MA) or the mirGE scaffold (WO 2014 / 016817). In some embodiments, the nucleic acid encoding the RNAi of the present disclosure comprises a miRNA scaffold. In some embodiments, the miRNA scaffold is set forth in SEQ ID NO: 11. In some embodiments, the miRNA scaffold comprises a nucleic acid sequence having greater than 80%, 85%, 90%, 95%, or 99% identity to the nucleic acid sequence of SEQ ID NO:11.

[0110] In some embodiments, RNAi targets RNA encoding a polypeptide associated with DM1 (e.g., mutant DMPK). Without wishing to be bound by theory, it is believed that RNAi can be used to reduce or eliminate expression and / or activity of a polypeptide whose gain of function is associated with DM1 (e.g., mutant DMPK).

[0111] In some embodiments, the transgene (e.g., encoding an RNAi of the present disclosure) is operably linked to a promoter. Exemplary promoters include the cytomegalovirus (CMV) immediate early promoter, the RSV LTR, the MoMLV LTR, the phosphoglycerate kinase-1 (PGK) promoter, the simian virus 40 (SV40) promoter, and the CK6 promoter, the transthyretin promoter (TTR), the TK promoter, the tetracycline responsive promoter (TRE), the HBV promoter, the hAAT promoter, the LSP promoter, the chimeric liver-specific promoter (LSP), the E2F promoter, the telomerase (hTERT) promoter; the cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG promoter; Niwa et al., Gene, 1991, 108(2):193-9), and the elongation factor 1-alpha promoter (EF1-α) promoter (Kim et al., Gene, 1990, 91(2):217-23 and Guo et al., Gene, 1991, 108(2):193-9). Ther., 1996, 3(9):802-10). In some embodiments, the promoter comprises a cytomegalovirus enhancer linked to a human β-glucuronidase promoter or a chicken β-actin (CBA) promoter. The promoter can be a constitutive promoter, an inducible promoter, or a repressible promoter.

[0112] Inducible promoters allow for the regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature or the presence of particular physiological conditions, e.g., acute phase, a particular differentiation state of cells, or only in replicating cells. Examples of inducible promoters regulated by an exogenously supplied promoter include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline repressible system (Gossen et al, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline inducible system (Gossen et al, Science, 268:1766-1769 (1995), Harvey et al. al, Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486 inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)), and the rapamycin inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Yet other types of inducible promoters that may be useful in this context are promoters that are regulated by specific physiological conditions, such as temperature, acute phase, a specific differentiation state of the cell, or only in replicating cells.

[0113] In some embodiments, the regulatory sequence confers tissue-specific gene expression capability. In some cases, the tissue-specific regulatory sequence binds tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. In some embodiments, the promoter is a muscle-specific promoter. In some embodiments, the promoter is a desmin promoter. In some embodiments, the promoter is a human desmin promoter (e.g., −228 to +75 of the human desmin gene; e.g., SEQ ID NO: 23). In some embodiments, the promoter is a modified desmin promoter. In some embodiments, the desmin promoter contains desmin promoter elements important for high-level expression in muscle cells (Li and Paulin, et.al. 1991. Journal of Biol Chem.). In some embodiments, the desmin promoter contains at least one copy of the Byrne desmin enhancer (e.g., SEQ ID NO: 21). In some embodiments, the desmin promoter comprises at least one copy of the Paulin desmin enhancer (-973 to -693) (e.g., SEQ ID NO: 22). In some embodiments, the desmin promoter comprises one copy of the Byrne desmin enhancer and one copy of the Paulin desmin enhancer (-973 to -693). In some embodiments, the desmin promoter comprises one copy of the Byrne desmin enhancer and one copy of the Paulin desmin enhancer (-973 to -693) and the promoter of the human desmin gene (-228 to +75).

[0114] In some aspects, the invention provides an expression cassette (e.g., an expression cassette for expressing a transgene (e.g., a therapeutic transgene) in a muscle cell), the expression cassette comprising a modified desmin promoter, the desmin promoter comprising one or more enhancer elements and a promoter of the human desmin gene. In some embodiments, the desmin promoter comprises two enhancer elements and a promoter of the human desmin gene. In some embodiments, the desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence of SEQ ID NO:21, and in some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence of SEQ ID NO:22. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence of SEQ ID NO:21, and the one or more enhancer elements comprise a nucleotide sequence of SEQ ID NO:22. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 21, and the one or more enhancer elements comprise a nucleotide sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 22.

[0115] In some embodiments, the expression cassette comprising the modified desmin promoter further comprises an intron. In some embodiments, the intron is a rabbit beta globin intron. In some embodiments, the intron comprises the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the intron comprises a nucleotide sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the nucleic acid encoding a transgene (e.g., a therapeutic transgene) is embedded in the intron. In some embodiments, the intron comprises a 5' arm and a 3' arm, the 5' arm being located 5' to the nucleic acid encoding the transgene and the 3' arm being located 3' to the nucleic acid encoding the transgene. In some embodiments, the 5' arm of the intron comprises a nucleic acid having a sequence of SEQ ID NO: 14. In some embodiments, the 5' arm of the intron comprises a nucleic acid having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 14. In some embodiments, the 3' arm of the intron comprises a nucleic acid having a sequence of SEQ ID NO: 15. In some embodiments, the 3' arm of the intron comprises a nucleic acid having a sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the 5' arm of the intron comprises a nucleic acid having a sequence of SEQ ID NO: 14 and the 3' arm of the intron comprises a nucleic acid having a sequence of SEQ ID NO: 15. In some embodiments, the 5' arm of the intron comprises a nucleic acid having a sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 14 and the 3' arm of the intron comprises a nucleic acid having a sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 15.

[0116] In some embodiments, the expression cassette comprising the modified desmin promoter further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA. In some embodiments, the polyadenylation signal is a minimal bovine growth hormone polyadenylation signal. In some embodiments, the bovine growth hormone polyadenylation signal comprises a nucleic acid having a sequence of SEQ ID NO: 16. In some embodiments, the bovine growth hormone polyadenylation signal comprises a nucleic acid having a sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 16.

[0117] In some embodiments, the invention provides an expression cassette comprising a modified desmin promoter to express a transgene (e.g., a therapeutic transgene) in a muscle cell. In some embodiments, the transgene encodes a polypeptide (e.g., a therapeutic polypeptide). In some embodiments, the transgene encodes a nucleic acid (e.g., a therapeutic nucleic acid). In some embodiments, the transgene encodes an RNAi. In some embodiments, the transgene encodes an siRNA, shRNA, or miRNA.

[0118] In some aspects, the invention provides modified desmin promoters, the desmin promoter comprising one or more enhancer elements and a promoter of the human desmin gene. In some embodiments, the desmin promoter comprises two enhancer elements and a promoter of the human desmin gene. In some embodiments, the desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence of SEQ ID NO:21, and in some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence of SEQ ID NO:22. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence of SEQ ID NO:21, and the one or more enhancer elements comprise a nucleotide sequence of SEQ ID NO:22. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO:21. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the desmin promoter comprises one or more enhancer elements comprising a nucleotide sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 21, and the one or more enhancer elements comprise a nucleotide sequence having at least about any of 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO: 22.

[0119] In some aspects, the present invention provides rAAV particles comprising recombinant self-complementary genomes (e.g., self-complementary rAAV vectors). AAV viral particles comprising self-complementary vector genomes and methods of using self-complementary AAV genomes are described in U.S. Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z., et al., (2003) Gene Ther 10:2105-2111, each of which is incorporated herein by reference in its entirety. rAAVs that contain self-complementary genomes rapidly form double-stranded DNA molecules with their partially complementary sequences (e.g., complementary coding and non-coding strands of a heterologous nucleic acid). In some embodiments, the vector comprises a first nucleic acid sequence that encodes a heterologous nucleic acid and a second nucleic acid sequence that encodes the complement of the nucleic acid, where the first nucleic acid sequence is capable of intrastrand base pairing with the second nucleic acid sequence along most or all of its length.

[0120] In some embodiments, a first heterologous nucleic acid sequence encoding an RNAi and a second heterologous nucleic acid sequence encoding the complement of the RNAi are linked by a mutated ITR (e.g., the right ITR). In some embodiments, the ITR is [ka] The mutated ITR comprises a deletion of the D region, which contains a terminal resolution sequence. As a result, during replication of the AAV viral genome, the viral genome is not cleaved at the mutated ITR by the rep protein, and thus a recombinant viral genome is packaged into the viral capsid, which comprises, in 5' to 3' order: an AAV ITR, a first heterologous polynucleotide sequence including a regulatory sequence, the mutated AAV ITR, a second heterologous polynucleotide in an inverted orientation relative to the first heterologous polynucleotide, and a third AAV ITR.

[0121] rAAV particles and methods for producing rAAV particles The present invention provides rAAV particles comprising RNAi as disclosed herein. In some embodiments, the present invention provides a method of delivering RNAi using recombinant viral particles to treat DM1. In some embodiments, the rAAV particles comprise a sequence encoding the RNAi of the present disclosure flanked by one or two ITRs. The nucleic acid is encapsidated in the AAV particle. The AAV particle also comprises capsid proteins. In some embodiments, the nucleic acid comprises a control sequence comprising transcription initiation and termination sequences, components to which the coding sequence of interest (e.g., the nucleic acid encoding the RNAi of the present disclosure) is operably linked in the transcriptional direction, thereby forming an expression cassette. The expression cassette is flanked at the 5' and 3' ends by at least one functional AAV ITR sequence. By "functional AAV ITR sequence" it is meant that the ITR sequence functions to direct rescue, replication and packaging of AAV virions. See Davidson et al., PNAS, 2000, 97(7)3428-32; Passini et al., J. Virol., 2003, 77(12):7034-40; and Pechan et al., Gene Ther., 2009, 16:10-16, all of which are incorporated by reference in their entirety. To practice some aspects of the invention, a recombinant vector contains at least all of the sequences of AAV essential for encapsidation and the physical structure for rAAV infection. The AAV ITRs used in the vectors of the invention need not have wild-type nucleotide sequences (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801) and may be modified by nucleotide insertion, deletion or substitution, or the AAV ITRs may be derived from any of several AAV serotypes. More than 40 AAV serotypes are currently known, and new serotypes and variants of existing serotypes are continually being identified (see Gao et al., PNAS, 2002, 99(18);11854-6; Gao et al., PNAS, 2003, 100(10):6081-6; and Bossis et al., J. Virol., 2003, 77(12):6799-810).The use of any AAV serotype is considered within the scope of the present invention. In some embodiments, the rAAV vector is a vector derived from an AAV serotype, such as, but not limited to, the AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAVrh74, AAV DJ, caprine AAV, bovine AAV, or murine AAV capsid serotype ITRs. In some embodiments, the nucleic acid in the AAV comprises an ITR, such as an ITR of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, AAV DJ, caprine AAV, bovine AAV or mouse AAV capsid serotype. In some embodiments, the nucleic acid in the AAV further encodes an RNAi as described herein. For example, the nucleic acid in the AAV can comprise at least one ITR of any AAV serotype envisioned herein, and further encode an RNAi comprising one strand comprising a guide region and another strand comprising a non-guide region. In one embodiment, the nucleic acid in the AAV can include at least one ITR of any AAV serotype and can further encode an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO:1), or a sequence having 80%, 85%, 90% or 95% identity to SEQ ID NO:1, and a second strand comprising a second nucleic acid comprising the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO:2), or a sequence having 80%, 85%, 90% or 95% identity to SEQ ID NO:2.

[0122] In some embodiments, the nucleic acid in the AAV comprises, from 5' to 3', a nucleic acid encoding the following: an ITR (e.g., AAV2 ITR), a promoter, a nucleic acid encoding an RNAi as disclosed herein, a polyadenylation signal, and an AAV ITR (e.g., AAV2 ITR). In some embodiments, the nucleic acid in the AAV comprises, from 5' to 3', a nucleic acid encoding the following: an ITR (e.g., AAV2 ITR), a promoter, a nucleic acid encoding an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO:1) or a sequence having 80%, 85%, 90% or 95% identity to SEQ ID NO:1, and a second strand comprising a second nucleic acid comprising the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO:2) or a sequence having 80%, 85%, 90% or 95% identity to SEQ ID NO:2, a polyadenylation signal, and an AAV ITR (e.g., AAV2 ITR). In some embodiments, the nucleic acid in the AAV includes, from 5' to 3', nucleic acid encoding the following: an ITR (e.g., the AAV2 ITR), a desmin promoter, a nucleic acid encoding an RNAi as disclosed herein, a polyadenylation signal (e.g., bovine growth hormone polyA), and an AAV ITR (e.g., the AAV2 ITR). In some embodiments, the nucleic acid in the AAV includes, from 5' to 3', a nucleic acid encoding the following: an ITR (e.g., AAV2 ITR), a desmin promoter, an intron (e.g., a chimeric intron), a nucleic acid encoding an RNAi including a first strand comprising a first nucleic acid comprising the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO:1) or a sequence having 80%, 85%, 90% or 95% identity to SEQ ID NO:1, and a second strand comprising a second nucleic acid comprising the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO:2) or a sequence having 80%, 85%, 90% or 95% identity to SEQ ID NO:2, a polyadenylation signal (e.g., bovine growth hormone polyA), and all or a functional portion thereof of an AAV ITR (e.g., AAV2 ITR). In some embodiments, the first strand and the second strand form a duplex. In some embodiments, the first strand is linked to the second strand by a linker.In some embodiments, the linker comprises the nucleic acid sequence of SEQ ID NO:3 or a sequence having 80%, 85%, 90% or 95% identity to SEQ ID NO:3.

[0123] In some embodiments, the nucleic acid in the AAV includes, from 5' to 3', nucleic acid encoding: ITRs (e.g., AAV2 and a nucleic acid encoding an RNAi comprising a nucleic acid sequence encoding an RNAi vector ... All or a functional portion of the ITR (e.g., the AAV2 ITR).

[0124] In some embodiments, the nucleic acid in the AAV comprises, from 5' to 3', a nucleic acid encoding the following: an ITR (e.g., AAV2 ITR), a desmin promoter, a nucleic acid encoding an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO:2) or a sequence having 80%, 85%, 90% or 95% identity to SEQ ID NO:2, and a second strand comprising a second nucleic acid comprising the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO:1) or a sequence having 80%, 85%, 90% or 95% identity to SEQ ID NO:1, a polyadenylation signal (e.g., bovine growth hormone polyA) and an AAV ITR (e.g., AAV2 ITR). In some embodiments, the first strand and the second strand form a duplex. In some embodiments, the first strand is linked to the second strand by a linker. In some embodiments, the linker comprises the nucleic acid sequence of SEQ ID NO:6.

[0125] In some embodiments, the nucleic acid in the AAV comprises, from 5' to 3', a nucleic acid encoding the following: an ITR (e.g., AAV2 ITR), a stuffer sequence (e.g., all or a portion of the human alpha-1-antitrypsin (AAT) stuffer sequence), a desmin promoter, a 5' arm of an intron (e.g., rabbit beta globin intron), a nucleic acid encoding an RNAi comprising a first strand comprising a first nucleic acid comprising the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO:2) and a second strand comprising a second nucleic acid comprising the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO:1), a 3' arm of an intron (e.g., rabbit beta globin intron), a polyadenylation signal (e.g., bovine growth hormone polyA), a stuffer sequence (e.g., all or a portion of the human alpha-1-antitrypsin (AAT) stuffer sequence), and all or a functional portion of an AAV ITR (e.g., AAV2 ITR).

[0126] In some embodiments, the vector may include (one or more) stuffer nucleic acids. In some embodiments, the stuffer nucleic acid may include a sequence encoding a reporter polypeptide. As will be appreciated by those of skill in the art, the stuffer nucleic acid may be located in various regions within the vector and may consist of a contiguous sequence (e.g., a single stuffer nucleic acid in a single location) or multiple sequences (e.g., two or more stuffer nucleic acids in two or more locations (e.g., two locations, three locations, etc.)) within the vector. In some embodiments, the stuffer nucleic acid may be located downstream of the RNAi sequence. In embodiments, the stuffer nucleic acid may be located upstream of the RNAi sequence (e.g., between the promoter and the nucleic acid encoding the RNAi). As will also be appreciated by those of skill in the art, various nucleic acids may be used as stuffer nucleic acids. In some embodiments, the stuffer nucleic acid includes all or a portion of the human alpha-1-antitrypsin (AAT) stuffer sequence or the C16 P1, chromosome 16 P1 clone (human C16) stuffer sequence. In some embodiments, the stuffer sequence includes all or a portion of a gene. For example, the stuffer sequence comprises a portion of the human AAT sequence. A person skilled in the art will recognize that different portions of a gene (e.g., the human AAT sequence) can be used as a stuffer fragment. For example, the stuffer fragment can be from the 5' end of the gene, the 3' end of the gene, the middle of the gene, a non-coding portion of the gene (e.g., an intron), a coding region of the gene (e.g., an exon), or a mixture of non-coding and coding portions of the gene. A person skilled in the art will also recognize that all or a portion of the stuffer sequence can be used as a stuffer fragment. In some embodiments, the vector comprises a 5' stuffer sequence comprising a nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence having greater than about 80%, 85%, 90%, 95%, or 99% identity to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the vector comprises a 3' stuffer sequence comprising a nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence having greater than about 80%, 85%, 90%, 95%, or 99% identity to the nucleotide sequence of SEQ ID NO: 19.In some embodiments, the vector comprises a 5' stuffer sequence comprising the nucleotide sequence of SEQ ID NO:18 or a nucleotide sequence having more than about 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO:18, and comprises a 3' stuffer sequence comprising the nucleotide sequence of SEQ ID NO:19 or a nucleotide sequence having more than about 80%, 85%, 90%, 95% or 99% identity to the nucleotide sequence of SEQ ID NO:19.

[0127] In further embodiments, the rAAV particles comprise the capsid proteins of AAV1, AAV2, AAV3, AAV4, AAV5, AA6, AAV7, AAV8, AAV9, AAVrh.8, AAVrh8R, AAVrh.10, AAV11, AAV12, AAVrh74, AAVrh74 N502I, AAVrh74 W505R, or mutants of these capsid proteins. In some embodiments, the mutant capsid proteins maintain the ability to form an AAV capsid. In some embodiments, the rAAV particles comprise an AAV5 tyrosine mutated capsid (Zhong L. et al., (2008) Proc Natl Acad Sci USA 105(22):7827-7832. In further embodiments, the rAAV particles comprise capsid proteins of AAV serotypes from clades A-F (Gao, et al., J. Virol. 2004, 78(12):6381).

[0128] Different AAV serotypes are used to optimize transduction of specific target cells or target specific cell types within a specific target tissue (e.g., diseased tissue). rAAV particles can contain viral proteins and viral nucleic acids of the same serotype or mixed serotypes. For example, in some embodiments, rAAV particles can contain AAV1 capsid protein and at least one AAV2 ITR, or AAV2 capsid protein and at least one AAV1 ITR. Any combination of AAV serotypes for producing rAAV particles is provided herein as if each combination were expressly set forth herein. In some embodiments, the present invention provides rAAV particles (e.g., expression cassettes containing nucleic acids encoding RNAi of the present disclosure) that include an AAV1 capsid flanked by at least one AAV2 ITR and an rAAV vector of the present disclosure. In some embodiments, the present invention provides rAAV particles that include an AAV2 capsid.

[0129] In some aspects, the present invention provides a virus particle comprising a recombinant self-complementary genome. The rAAV particle comprising a self-complementary genome and the method of using the self-complementary AAV genome are described in U.S. Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z., et al., (2003) Gene Ther 10:2105-2111, each of which is incorporated herein by reference in its entirety. The rAAV comprising a self-complementary genome can rapidly form a double-stranded DNA molecule due to its partially complementary sequences (e.g., the complementary coding and non-coding strands of the transgene). In some embodiments, the present invention provides rAAV particles comprising an AAV genome, the rAAV genome comprising a first heterologous polynucleotide sequence (e.g., an RNAi of the present disclosure) and a second heterologous polynucleotide sequence (e.g., an antisense strand of an RNAi of the present disclosure), the first heterologous polynucleotide sequence being capable of intrastrand base pairing with the second polynucleotide sequence along most or all of its length. In some embodiments, the first heterologous polynucleotide sequence and the second heterologous polynucleotide sequence are linked by a sequence that facilitates intrastrand base pairing, e.g., a hairpin DNA structure. Hairpin structures are known in the art, e.g., for miRNA or siRNA molecules. In some embodiments, the first heterologous polynucleotide sequence and the second heterologous polynucleotide sequence are linked by a mutated ITR (e.g., a right ITR). In some embodiments, the ITR is a polynucleotide sequence [ka] The mutant ITR comprises a deletion of the D region that includes a terminal resolution sequence. As a result, during replication of the AAV viral genome, the viral genome is not cleaved at the mutant ITR by the rep protein, and thus a recombinant viral genome is packaged into the viral capsid, comprising, in 5' to 3' order: an AAV ITR, a first heterologous polynucleotide sequence that includes a regulatory sequence, a mutant AAV ITR, a second heterologous polynucleotide in an inverted orientation relative to the first heterologous polynucleotide, and a third AAV ITR. In some embodiments, the present invention provides an AAV viral particle comprising a recombinant viral genome comprising a functional AAV2 ITR, a first polynucleotide sequence encoding an RNAi of the present disclosure, a mutant AAV2 ITR that includes a deletion of the D region and lacks a functional terminal resolution sequence, a second polynucleotide sequence that includes a complementary sequence to a sequence encoding an RNAi of the present disclosure, the first polynucleotide sequence, and a functional AAV2 ITR.

[0130] rAAV particles can be produced using methods known in the art. See, for example, U.S. Patent Nos. 6,566,118; 6,989,264; and 6,995,006. In the practice of the present invention, host cells for producing rAAV particles include mammalian cells, insect cells, plant cells, microorganisms, and yeast. The host cells can also be host cells in which the AAV vector genome is stably maintained or packaging cells in which the AAV rep and cap genes are stably maintained in the producer cells. Exemplary packaging and producer cells are derived from 293 cells, A549 cells, or HeLa cells. AAV vectors are purified and formulated using standard techniques known in the art.

[0131] Methods known in the art for producing rAAV vectors include, but are not limited to, transfection, production of stable expression lines, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, J. E. et al., (1997) J. Virology 71(11):8780-8789), and baculovirus-AAV hybrids. All rAAV production cultures for producing rAAV viral particles require 1) suitable host cells, including, for example, human-derived cell lines such as HeLa, A549, or 293 cells, or insect-derived cell lines such as SF-9 in the case of baculovirus production systems; 2) suitable helper virus functions provided by wild-type or mutant adenovirus (such as temperature-sensitive adenovirus), herpesvirus, baculovirus, or a plasmid construct providing helper functions; 3) AAV rep and cap genes and gene products; 4) nucleic acid (such as a therapeutic nucleic acid) flanking at least one AAV ITR sequence; and 5) appropriate media and media components to support rAAV production. In some embodiments, the AAV rep and cap gene products can be from any AAV serotype. Generally, but not necessarily, the AAV rep gene products are of the same serotype as the ITRs of the rAAV vector genome, provided that the rep gene products are capable of functioning to replicate and package the rAAV genome. Suitable media known in the art can be used to produce rAAV vectors, including, but not limited to, Modified Eagle Medium (MEM), Dulbecco's Modified Eagle Medium (DMEM), custom formulations such as those described in U.S. Patent No. 6,566,118, and media manufactured by Hyclone Laboratories and JRH, including Sf-900 II SFM medium such as those described in U.S. Patent No. 6,723,551, each of which is incorporated herein by reference in its entirety, particularly with respect to the custom media formulations used to produce recombinant AAV vectors.In some embodiments, the AAV helper functions are provided by adenovirus or HSV, hi some embodiments, the AAV helper functions are provided by baculovirus and the host cell is an insect cell (e.g., a Spodoptera frugiperda (Sf9) cell).

[0132] In some embodiments, rAAV particles can be produced by a triple transfection method, such as the exemplary triple transfection method provided below. Briefly, a plasmid containing the rep and capsid genes can be transfected (e.g., using calcium phosphate method) into a cell line (e.g., HEK-293 cells) along with a helper adenovirus plasmid, and the virus can be harvested and optionally purified. Thus, in some embodiments, rAAV particles are produced by triple transfecting a host cell with a nucleic acid encoding the rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding AAV helper virus functions, and transfecting the nucleic acid into the host cell generates a host cell capable of producing rAAV particles.

[0133] In some embodiments, rAAV particles can be produced by a producer cell line method, such as the exemplary producer cell line method provided below (see also those referenced in Martin et al., (2013) Human Gene Therapy Methods 24:253-269). Briefly, a cell line (e.g., a HeLa cell line) can be stably transfected with a plasmid containing the rep gene, the capsid gene, and a promoter-heterologous nucleic acid sequence. The cell line can be screened to select a lead clone for producing rAAV, which can then be expanded into a production bioreactor and infected with adenovirus (e.g., wild-type adenovirus) as a helper to initiate production of rAAV. The virus can then be harvested, the adenovirus inactivated and / or removed (e.g., by heat), and the rAAV particles purified. Thus, in some embodiments, rAAV particles are produced by a producer cell line that contains nucleic acid encoding the rAAV vector, nucleic acid encoding AAV rep and cap, and / or nucleic acid encoding AAV helper virus functions.

[0134] In some aspects, a method of producing any rAAV particle as disclosed herein is provided, comprising: (a) culturing a host cell under conditions in which rAAV particles are produced, the host cell comprising: (i) one or more AAV packaging genes, each said AAV packaging gene encoding an AAV replication and / or encapsidation protein; (ii) an rAAV provector comprising a nucleic acid encoding an RNAi of the present disclosure as described herein flanked by at least one AAV ITR; and (iii) AAV helper functions; and (b) recovering the rAAV particles produced by the host cell. In some embodiments, the RNAi comprises the nucleotide sequence of SEQ ID NO:7. In some embodiments, the at least one AAV ITR is selected from the group consisting of AAV ITRs, such as ITRs of an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, AAVrh74 N502I, AAVrh74 W505R, AAV2R471A, AAV DJ, caprine AAV, bovine AAV, or murine AAV capsid serotype.In some embodiments, the encapsidation protein is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (e.g., a wild-type AAV6 capsid or a variant AAV6 capsid such as ShH10 as described in U.S. Patent Application Publication No. 2012 / 0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (e.g., a wild-type AAV9 capsid or a modified AAV9 capsid as described in U.S. Patent Application Publication No. 2013 / 0323226), AAV10, AAVrh10, AAV11, AAV12, AAVrh74 (e.g., a wild-type AAVrh74 capsid or AAVrh74 N502I or AAVrh74 capsid as described in WO2019178412, which is incorporated by reference in its entirety). AAV2R471A capsid, AAVAAV2 / 2-7m8 capsid, AAV DJ capsid (e.g., AAV-DJ / 8 capsid, AAV-DJ / 9 capsid, or any other capsid described in U.S. Patent Application Publication No. 2012 / 0066783), AAV2 N587A capsid, AAV2 E548A capsid, AAV2 N708A capsid, AAV The rAAV particles are selected from the group consisting of V708K capsid, goat AAV capsid, AAV1 / AAV2 chimeric capsid, bovine AAV capsid, murine AAV capsid, rAAV2 / HBoV1 capsid, or AAV capsids described in U.S. Pat. No. 8,283,151 or WO 2003 / 042397. In some embodiments, the mutant capsid protein maintains the ability to form an AAV capsid. In some embodiments, the encapsidation protein is an AAV5 tyrosine mutant capsid protein. In further embodiments, the rAAV particles comprise capsid proteins of AAV serotypes from clades A-F. In some embodiments, the rAAV particles comprise an AAVrh74 N502I capsid, a recombinant genome comprising AAV2 ITRs, and a nucleic acid encoding an RNAi of the present disclosure.In some embodiments, the rAAV particles comprise an AAVrh74 W505R capsid, a recombinant genome comprising AAV2 ITRs, and a nucleic acid encoding an RNAi of the present disclosure. In further embodiments, the rAAV particles are purified. As used herein, the term "purified" includes preparations of rAAV particles that lack at least some of the other components that may also be present when the rAAV particles are naturally present or initially prepared therefrom. Thus, for example, isolated rAAV particles can be prepared using purification techniques to enrich the rAAV particles from a source mixture, such as a culture lysate or production culture supernatant. Enrichment can be measured in a variety of ways, such as by the proportion of DNase-resistant particles (DRP) or genome copies (gc) present in solution or infectivity, or can be measured from a correlation with a second potential interfering substance present in the source mixture, such as contaminants including production culture contaminants or process contaminants including helper viruses, media components, and the like.

[0135] Also provided herein is a pharmaceutical composition comprising a rAAV particle comprising a transgene encoding the RNAi of the present disclosure and a pharma- ceutically acceptable carrier.The pharmaceutical composition can be suitable for any of the administration methods described herein.The pharmaceutical composition of the rAAV particle comprising the nucleic acid encoding the RNAi of the present disclosure can be introduced systemically.For example, the recombinant viral particle comprising the nucleic acid encoding the RNAi of the present disclosure can be administered intravenously, intraarterially, subcutaneously or intraperitoneally.

[0136] In some embodiments, the pharmaceutical composition comprising the recombinant viral particle comprising the transgene encoding the RNAi of the present disclosure described herein and a pharma- ceutical acceptable carrier is suitable for administration to humans. Such carriers are well known in the art (see, for example, Remington's Pharmaceutical Sciences, 15th Edition, pp. 1035-1038 and 1570-1580). In some embodiments, the pharmaceutical composition comprising the rAAV described herein and a pharma- ceutical acceptable carrier is suitable for systemic injection into mammals.

[0137] Such pharma-ceutically acceptable carriers can be sterile liquids, such as water and oils, such as those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, and the like. Saline and aqueous dextrose, polyethylene glycol (PEG) and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. The pharmaceutical compositions can further include additional ingredients, such as preservatives, buffers, isotonicity agents, antioxidants and stabilizers, non-ionic wetting or clarifying agents, thickeners, and the like. The pharmaceutical compositions described herein can be packaged in single unit dose or multi-dosage form. The compositions are generally formulated as sterile and substantially isotonic solutions.

[0138] Manufactured Products and Kits Kits or articles of manufacture for use in the methods described herein are also provided. In an embodiment, the kits include the compositions described herein (e.g., the rAAV particles of the present disclosure that include a nucleic acid encoding an RNAi of the present disclosure) in suitable packaging. Suitable packaging for the compositions described herein is known in the art and includes, for example, vials (such as sealed vials), containers, ampoules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may be further sterilized and / or sealed.

[0139] The present invention also provides kits that include the compositions described herein and may further include instructions on how to use the compositions, such as the uses described herein. The kits described herein may further include other materials that are desirable from a commercial and user perspective, such as other buffers, diluents, filters, needles, syringes, and a package insert that includes instructions for carrying out any of the methods described herein. For example, in some embodiments, the kit includes a composition of recombinant viral particles that includes a transgene encoding an RNAi of the present disclosure for delivering an effective amount of the rAAV particles to a mammal, a pharma- ceutically acceptable carrier suitable for injection into a mammal, and one or more of the following: buffers, diluents, filters, needles, syringes, and a package insert that includes instructions for injecting into a mammal. In some embodiments, kits are described herein that include instructions for treating DM-1 with rAAV particles. In some embodiments, kits are described herein that include instructions for using the rAAV particles according to any one of the methods described herein.

[0140] Exemplary embodiments The present invention includes the exemplary embodiments listed below.

[0141] 1. An RNAi comprising a first strand and a second strand, a) the first strand and the second strand form a duplex, b) the first strand comprises a guide region, the guide region comprising a nucleic acid having the sequence 5'-AGUCGAAGACAGUUCUAGGGU-3' (SEQ ID NO:1) or a sequence having about 90% identity to the sequence of SEQ ID NO:1, and c) the second strand comprises a non-guide region.

[0142] 2. The RNAi of embodiment 1, wherein the non-guide region comprises a nucleic acid having the sequence 5'ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO:2) or a sequence having about 90% identity to the sequence of SEQ ID NO:2.

[0143] 3. The RNAi of embodiment 1 or 2, wherein the first strand comprises a nucleic acid having a sequence of SEQ ID NO:1, and the non-guide region comprises a nucleic acid having a sequence of SEQ ID NO:2.

[0144] 4. The RNAi according to any one of embodiments 1 to 3, wherein the first strand and the second strand are linked by an RNA linker capable of forming a loop structure.

[0145] 5. The RNAi of embodiment 4, wherein the RNA linker comprises from about 4 to about 50 nucleotides.

[0146] 6. The RNAi according to embodiment 4 or 5, wherein the loop structure comprises about 4 to about 20 nucleotides.

[0147] 7. The RNAi according to any one of embodiments 4 to 6, wherein the loop structure comprises a nucleic acid having the sequence of SEQ ID NO:3 or a sequence having about 90% identity to the sequence of SEQ ID NO:3.

[0148] 8. The RNAi according to any one of embodiments 4 to 7, comprising, from 5' to 3', a second strand, an RNA linker and a first strand.

[0149] 9. The RNAi according to any one of embodiments 4 to 7, comprising, from 5' to 3', a first strand, an RNA linker and a second strand.

[0150] 10. An RNAi according to any one of embodiments 1 to 8, comprising a nucleic acid having the sequence of SEQ ID NO: 7 or a sequence having about 90% identity to the sequence of SEQ ID NO: 7.

[0151] 11. The RNAi according to any one of embodiments 1 to 10, which is a small inhibitory RNA (siRNA), a microRNA (miRNA) or a small hairpin RNA (shRNA).

[0152] 12. The RNAi of any one of embodiments 1 to 11, further comprising a scaffold.

[0153] 13. The RNAi of embodiment 12, wherein the scaffold comprises all or part of the nucleic acid of SEQ ID NO:11.

[0154] 14. The RNAi of embodiment 13, wherein the miRNA is embedded within a scaffold.

[0155] 15. The RNAi of embodiment 14, wherein the scaffold has a 5' arm located 5' to the nucleic acid encoding the RNAi and a 3' arm located 3' to the nucleic acid encoding the RNAi.

[0156] 16. The RNAi according to any one of embodiments 12 to 15, wherein the scaffold is a miR-155 scaffold.

[0157] 17. The RNAi according to any one of embodiments 12 to 16, wherein the miR-155 scaffold comprises a nucleic acid of SEQ ID NO: 9 or an sequence having approximately 90% identity to the sequence of SEQ ID NO: 9, located on the 5' side of the RNAi.

[0158] 18. An RNAi according to any one of embodiments 12 to 17, wherein the miR-155 scaffold comprises a nucleic acid of sequence number 10 or a sequence having about 90% identity to the sequence of sequence number 10, located on the 3' side of the RNAi.

[0159] 19. The RNAi of any one of embodiments 1 to 18, which targets an RNA encoding a polypeptide associated with Myotonic Dystrophy-1 (DM1).

[0160] 20. The RNAi of embodiment 19, wherein the polypeptide is myotonic dystrophy protein kinase (DMPK).

[0161] 21. The RNAi of embodiment 20, wherein DMPK comprises a mutation associated with DM 1.

[0162] 22. The RNAi of embodiment 20 or 21, wherein the gene encoding DMPK comprises five or more CTG trinucleotide repeats.

[0163] 23. An expression cassette comprising a nucleic acid encoding an RNAi according to any one of embodiments 1 to 22.

[0164] 24. The expression cassette of embodiment 23, wherein the nucleic acid encoding the RNAi is operably linked to a promoter.

[0165] 25. The expression cassette of embodiment 24, wherein the promoter is a muscle-specific promoter.

[0166] 26. An expression cassette according to embodiment 24 or 25, wherein the promoter is a desmin promoter or a variant thereof.

[0167] 27. The expression cassette of embodiment 26, wherein the desmin promoter comprises one or more enhancer elements and a promoter of the human desmin gene.

[0168] 28. An expression cassette according to embodiment 26 or 27, wherein the desmin promoter comprises two enhancer elements and a promoter of the human desmin gene.

[0169] 29. An expression cassette according to any one of embodiments 26 to 28, wherein the desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements.

[0170] 30. An expression cassette according to any one of embodiments 26 to 29, wherein the desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO: 21 and / or one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having about 90% identity with the sequence of SEQ ID NO: 22.

[0171] 31. An expression cassette according to any one of embodiments 26 to 30, wherein the desmin promoter comprises the nucleotide sequence of SEQ ID NO: 12 or a sequence having approximately 90% identity to the nucleotide sequence of SEQ ID NO: 12.

[0172] 32. An expression cassette according to any one of embodiments 23 to 31, further comprising an intron.

[0173] 33. The expression cassette of embodiment 32, wherein the intron is a rabbit beta globin intron.

[0174] 34. The expression cassette of embodiment 32 or 33, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 13 or a sequence having about 90% identity to the sequence of SEQ ID NO: 13.

[0175] 35. An expression cassette according to any one of embodiments 32 to 34, wherein the nucleic acid encoding the RNAi is embedded in an intron.

[0176] 36. The expression cassette of embodiment 35, wherein the intron comprises a 5' arm and a 3' arm, the 5' arm being located 5' to the nucleic acid encoding the RNAi, and the 3' arm being located 3' to the nucleic acid encoding the RNAi.

[0177] 37. The expression cassette of embodiment 36, wherein the 5' arm of the intron comprises the nucleotide sequence of SEQ ID NO:14 or a sequence having about 90% identity to the sequence of SEQ ID NO:14.

[0178] 38. The expression cassette of embodiment 36 or 37, wherein the 3' arm of the intron comprises the nucleotide sequence of SEQ ID NO: 15 or a sequence having about 90% identity to the sequence of SEQ ID NO: 15.

[0179] 39. An expression cassette according to any one of embodiments 23 to 38, further comprising a polyadenylation signal.

[0180] 40. The expression cassette according to embodiment 39, wherein the polyadenylation signal is the bovine growth hormone polyadenylation signal, the SV40 polyadenylation signal or HSV TK pA.

[0181] 41. The expression cassette of embodiment 40, wherein the polyadenylation signal is a minimal bovine growth hormone polyadenylation signal.

[0182] 42. An expression cassette according to any one of embodiments 39 to 41, wherein the bovine growth hormone polyadenylation signal comprises the nucleotide sequence of SEQ ID NO: 16 or a sequence having approximately 90% identity to the sequence of SEQ ID NO: 16.

[0183] 43. An expression cassette according to any one of embodiments 23 to 42, comprising the nucleotide sequence of SEQ ID NO: 17 or a sequence having about 90% identity to the sequence of SEQ ID NO: 17.

[0184] 44. An expression cassette comprising a modified desmin promoter, the modified desmin promoter comprising one or more enhancer elements and the promoter of the human desmin gene.

[0185] 45. The expression cassette described in embodiment 44, wherein the modified desmin promoter comprises two enhancer elements and a promoter of the human desmin gene.

[0186] 46. ​​An expression cassette according to embodiment 44 or 45, wherein the modified desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements.

[0187] 47. An expression cassette according to any one of embodiments 44 to 46, wherein the modified desmin promoter comprises one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having about 90% identity to the sequence of SEQ ID NO: 21 and / or one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having about 90% identity to the sequence of SEQ ID NO: 22.

[0188] 48. An expression cassette according to any one of embodiments 44 to 47, wherein the desmin promoter comprises the nucleotide sequence of SEQ ID NO: 12 or a sequence having approximately 90% identity to the nucleotide sequence of SEQ ID NO: 12.

[0189] 49. An expression cassette according to any one of embodiments 44 to 48, further comprising an intron.

[0190] 50. The expression cassette of embodiment 49, wherein the intron is a rabbit beta globin intron.

[0191] 51. An expression cassette according to embodiment 49 or 50, wherein the intron comprises the nucleotide sequence of SEQ ID NO: 13 or a sequence having about 90% identity to the sequence of SEQ ID NO: 13.

[0192] 52. An expression cassette according to any one of embodiments 44 to 51, wherein the nucleic acid encoding the transgene is embedded in an intron.

[0193] 53. The expression cassette of embodiment 52, wherein the intron comprises a 5' arm and a 3' arm, the 5' arm being located 5' to the nucleic acid encoding the transgene, and the 3' arm being located 3' to the nucleic acid encoding the transgene.

[0194] 54. The expression cassette of embodiment 53, wherein the 5' arm of the intron comprises the nucleotide sequence of SEQ ID NO:14 or a sequence having about 90% identity to the sequence of SEQ ID NO:14.

[0195] 55. The expression cassette of embodiment 53 or 54, wherein the 3' arm of the intron comprises the nucleotide sequence of SEQ ID NO: 15 or a sequence having about 90% identity to the sequence of SEQ ID NO: 15.

[0196] 56. An expression cassette according to any one of embodiments 44 to 55, further comprising a polyadenylation signal.

[0197] 57. The expression cassette according to embodiment 56, wherein the polyadenylation signal is the bovine growth hormone polyadenylation signal, the SV40 polyadenylation signal or HSV TK pA.

[0198] 58. The expression cassette of embodiment 57, wherein the polyadenylation signal is a minimal bovine growth hormone polyadenylation signal.

[0199] 59. An expression cassette according to any one of embodiments 56 to 58, wherein the bovine growth hormone polyadenylation signal comprises the nucleotide sequence of SEQ ID NO: 16 or a sequence having approximately 90% identity to the sequence of SEQ ID NO: 16.

[0200] 60. An expression cassette according to any one of embodiments 44 to 59, wherein the transgene encodes a polypeptide or a nucleic acid.

[0201] 61. An expression cassette according to any one of embodiments 44 to 60, wherein the transgene encodes an RNAi.

[0202] 62. A vector comprising an expression cassette according to any one of embodiments 23 to 61.

[0203] 63. The vector of embodiment 62, wherein the expression cassette is flanked by one or more stuffer nucleic acid sequences.

[0204] 64. The vector of embodiment 63, wherein the one or more stuffer nucleic acid sequences are derived from the human SerpinA1 gene.

[0205] 65. A vector according to embodiment 63 or 64, wherein the stuffer nucleic acid sequence located 5' of the expression cassette is derived from the human SerpinA1 gene.

[0206] 66. A vector described in any one of embodiments 63 to 65, wherein the stuffer sequence located on the 5' side of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 18 or a sequence having approximately 90% identity to the sequence of SEQ ID NO: 18.

[0207] 67. A vector according to any one of embodiments 63 to 66, wherein the stuffer nucleic acid sequence located 3' of the expression cassette is derived from the human SerpinA1 gene.

[0208] 68. A vector described in any one of embodiments 63 to 67, wherein the stuffer sequence located on the 3' side of the expression cassette comprises the nucleotide sequence of SEQ ID NO: 19 or a sequence having approximately 90% identity to the sequence of SEQ ID NO: 19.

[0209] 69. The vector according to any one of embodiments 62 to 68, which is a recombinant adeno-associated virus (rAAV) vector.

[0210] 70. The rAAV vector of embodiment 69, wherein the expression cassette is flanked by one or more AAV inverted terminal repeat (ITR) sequences.

[0211] 71. The rAAV vector of embodiment 70, wherein the expression cassette is flanked by two AAV ITRs.

[0212] 72. The rAAV vector of embodiment 70 or 71, wherein the AAV ITRs are ITRs of an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV or murine AAV serotype.

[0213] 73. The rAAV vector of any one of embodiments 70 to 72, wherein the AAV ITRs are AAV2 ITRs.

[0214] 74. An rAAV vector described in any one of embodiments 69 to 73, comprising a nucleotide sequence of SEQ ID NO: 20 or a sequence having about 90% identity to the sequence of SEQ ID NO: 20.

[0215] 75. A rAAV vector described in any one of embodiments 69 to 74, which is a self-complementary rAAV vector.

[0216] 76. A cell comprising an expression cassette according to any one of embodiments 23 to 61, a vector according to any one of embodiments 62 to 68, or a rAAV vector according to any one of embodiments 69 to 75.

[0217] 77. A viral particle comprising a vector according to any one of embodiments 62 to 68.

[0218] 78. A recombinant AAV particle comprising a rAAV vector described in any one of embodiments 69 to 75.

[0219] 79. AAV virus particles include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, AAVrh74 N502I, AAVrh74 W505R, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV The rAAV particle of embodiment 78, comprising a capsid of V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, caprine AAV, AAV1 / AAV2 chimera, bovine AAV or murine AAV capsid rAAV2 / HBoV1 serotype.

[0220] 80. The rAAV particle of embodiment 78 or 79, wherein the ITRs and capsid of the rAAV viral particle are derived from the same AAV serotype.

[0221] 81. The rAAV particle of embodiment 78 or 79, wherein the ITRs and capsid of the rAAV viral particle are derived from different AAV serotypes.

[0222] 82. The rAAV particle of embodiment 78, 79 or 81, comprising a capsid of the AAVrh74 N502I serotype.

[0223] 83. The rAAV particle of embodiment 82, wherein the ITR is an AAV2 ITR and the capsid of the rAAV particle is the capsid of the AAVrh74 N502I serotype.

[0224] 84. The rAAV particle of embodiment 78, 79 or 81, comprising a capsid of the AAVrh74 W505R serotype.

[0225] 85. The rAAV particle of embodiment 84, wherein the ITR is an AAV2 ITR and the capsid of the rAAV particle is the capsid of the AAVrh74 W505R serotype.

[0226] 86. An rAAV particle comprising an rAAV vector and a capsid, the rAAV vector comprising, from 5' to 3', the following nucleic acids: AAV2 ITR, a nucleic acid encoding a stuffer nucleic acid sequence from the human serpinA1 gene, a Byrne desmin enhancer element, a Paulin desmin enhancer element, a desmin promoter, a 5' arm of a rabbit beta globin intron, a 5' miR155 scaffold sequence, a DMPK 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204An rAAV particle comprising a nucleic acid encoding a miRNA passenger sequence, a 3' miR155 scaffold sequence, a 3' arm of a rabbit beta globin intron, a minimal bovine growth hormone polyadenylation sequence, a stuffer nucleic acid sequence derived from the human serpinA1 gene, and AAV2 ITRs, wherein the capsid is an AAVrh74 N502I capsid. 87. An rAAV particle comprising an rAAV vector, the rAAV vector comprising, from 5' to 3', the following nucleic acids: an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO: 43; a nucleic acid encoding a stuffer nucleic acid sequence from a human serpinA1 gene comprising the polynucleotide sequence of SEQ ID NO: 18; a Byrne desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 21; a Paulin desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 22; a desmin promoter comprising the polynucleotide sequence of SEQ ID NO: 23; a 5' arm of a rabbit beta globin intron comprising the polynucleotide sequence of SEQ ID NO: 14; a 5' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 40; a DMPK promoter comprising the polynucleotide sequence of SEQ ID NO: 41; 204 miRNA guide sequence, miR155 terminal loop sequence comprising the polynucleotide sequence of SEQ ID NO:6, DMPK comprising the polynucleotide sequence of SEQ ID NO:5 204 An rAAV particle comprising a miRNA passenger sequence, a 3' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit beta globin intron comprising the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylation sequence comprising the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a stuffer nucleic acid sequence derived from the human serpinA1 gene comprising the polynucleotide sequence of SEQ ID NO: 19, and an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO: 49, wherein the capsid is an AAVrh74 N502I capsid.

[0227] 88. The rAAV particle of embodiment 86 or 87, wherein the AAVrh74 N502I capsid comprises a capsid protein comprising the amino acid sequence of SEQ ID NO: 50.

[0228] 89. An rAAV particle comprising an rAAV vector and a capsid, the rAAV vector comprising, from 5' to 3', the following nucleic acids: AAV2 ITR, a nucleic acid encoding a stuffer nucleic acid sequence derived from the human serpinA1 gene, a Byrne desmin enhancer element, a Paulin desmin enhancer element, a desmin promoter, a 5' arm of a rabbit beta globin intron, a 5' miR155 scaffold sequence, a DMPK 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 An rAAV particle comprising a nucleic acid encoding a miRNA passenger sequence, a 3' miR155 scaffold sequence, a 3' arm of a rabbit beta globin intron, a minimal bovine growth hormone polyadenylation sequence, a stuffer nucleic acid sequence derived from the human serpinA1 gene, and AAV2 ITRs, wherein the capsid is an AAVrh74 W505R capsid.

[0229] 90. An rAAV particle comprising an rAAV vector, the rAAV vector comprising, from 5' to 3', the following nucleic acids: an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO: 43; a nucleic acid encoding a stuffer nucleic acid sequence from a human serpinA1 gene comprising the polynucleotide sequence of SEQ ID NO: 18; a Byrne desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 21; a Paulin desmin enhancer element comprising the polynucleotide sequence of SEQ ID NO: 22; a desmin promoter comprising the polynucleotide sequence of SEQ ID NO: 23; a 5' arm of a rabbit beta globin intron comprising the polynucleotide sequence of SEQ ID NO: 14; a 5' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 40; a DMPK promoter comprising the polynucleotide sequence of SEQ ID NO: 41; 204 miRNA guide sequence, miR155 terminal loop sequence comprising the polynucleotide sequence of SEQ ID NO:6, DMPK comprising the polynucleotide sequence of SEQ ID NO:5 204An rAAV particle comprising a miRNA passenger sequence, a 3' miR155 scaffold sequence comprising the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit beta globin intron comprising the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylation sequence comprising the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a stuffer nucleic acid sequence derived from the human serpinA1 gene comprising the polynucleotide sequence of SEQ ID NO: 19, and an AAV2 ITR comprising the polynucleotide sequence of SEQ ID NO: 49, wherein the capsid is an AAVrh74 W505R capsid.

[0230] 91. The rAAV particle of embodiment 89 or 90, wherein the AAVrh74 W505R capsid comprises a capsid protein comprising the amino acid sequence of SEQ ID NO: 52.

[0231] 92. A composition comprising a viral particle according to embodiment 77 or a rAAV particle according to any one of embodiments 78 to 91.

[0232] 93. A pharmaceutical composition comprising a viral particle according to embodiment 77 or a rAAV particle according to any one of embodiments 78 to 91.

[0233] 94. The composition of embodiment 92 or 93, further comprising a pharma- ceutically acceptable carrier.

[0234] 95. A modified desmin promoter comprising one or more enhancer elements and the promoter of the human desmin gene.

[0235] 96. A modified desmin promoter according to embodiment 95, comprising two enhancer elements and a promoter of the human desmin gene.

[0236] 97. The modified desmin promoter according to embodiment 95 or 96, comprising one or more Byrne enhancer elements and / or one or more Paulin enhancer elements.

[0237] 98. A modified desmin promoter according to any one of embodiments 95 to 97, comprising one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 21 or a sequence having about 90% identity with the sequence of SEQ ID NO: 21 and / or one or more enhancer elements comprising the nucleotide sequence of SEQ ID NO: 22 or a sequence having about 90% identity with the sequence of SEQ ID NO: 22.

[0238] 99. A modified desmin promoter according to any one of embodiments 95 to 98, comprising the nucleotide sequence of SEQ ID NO: 12 or a sequence having about 90% identity to the sequence of SEQ ID NO: 12.

[0239] 100. A kit comprising an RNAi according to any one of embodiments 1 to 22.

[0240] 101. A kit comprising a viral particle according to embodiment 77 or an AAV particle according to any one of embodiments 78 to 91.

[0241] 102. A kit comprising a composition according to any one of embodiments 92 to 94.

[0242] 103. The kit of any one of embodiments 100-102, further comprising instructions for use.

[0243] 104. A method for treating myotonic dystrophy-1 (DM1) in a mammal in need thereof, comprising administering to the mammal an effective amount of an RNAi according to any one of embodiments 1 to 22.

[0244] 105. A method for inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 in need thereof, comprising administering to the mammal an effective amount of an RNAi according to any one of embodiments 1 to 22.

[0245] 106. A method for inhibiting accumulation of DMPK RNA in a mammalian cell having DM-1 in need thereof, comprising administering to the mammal an effective amount of an RNAi according to any one of embodiments 1 to 22.

[0246] 107. A method for treating myotonic dystrophy-1 (DM1) in a mammal in need thereof, comprising administering to the mammal an effective amount of a viral particle described in embodiment 77 or an effective amount of a rAAV particle described in any one of embodiments 78 to 91.

[0247] 108. A method for inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 in need thereof, comprising administering to the mammal an effective amount of a viral particle described in embodiment 77 or an effective amount of a rAAV particle described in any one of embodiments 78 to 91.

[0248] 109. A method for inhibiting accumulation of DMPK RNA in a mammalian cell having DM-1 in need thereof, comprising administering to the mammal an effective amount of a viral particle described in embodiment 77 or an effective amount of a rAAV particle described in any one of embodiments 78 to 91.

[0249] 110. An effective dose of viral particles or rAAV particles is about 1 × 10 8 ~about 2×10 13 The method of any one of embodiments 102 to 104, wherein the dose is in genome copies / mL.

[0250] 111. The dose is approximately 5 x 10 12 The method of embodiment 110, wherein the genomic copies / mL.

[0251] 112. The dose is approximately 1 × 10 13 The method of embodiment 110, wherein the genomic copies / mL.

[0252] 113. The dose is approximately 2 x 1013 The method of embodiment 110, wherein the genomic copies / mL.

[0253] 114. An effective dose of viral particles or rAAV particles is about 1 × 10 8 ~about 2×10 14 The method of any one of embodiments 107 to 109, wherein the dose is genome copies / kg body weight.

[0254] 115. The dose is approximately 5 × 10 13 The method of embodiment 114, wherein the genome copies / kg body weight.

[0255] 116. The dose is approximately 1 x 10 14 The method of embodiment 114, wherein the genome copies / kg body weight.

[0256] 117. The dose is approximately 2 x 10 14 The method of embodiment 114, wherein the genome copies / kg body weight.

[0257] 118. A method for treating myotonic dystrophy-1 (DM1) in a mammal in need thereof, comprising administering to the mammal an effective amount of a composition described in any one of embodiments 92-94.

[0258] 119. A method for inhibiting expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 in need thereof, comprising administering to the mammal an effective amount of a composition described in any one of embodiments 92 to 94.

[0259] 120. A method for inhibiting accumulation of DMPK RNA in a mammalian cell having DM-1 in need thereof, comprising administering to the mammal an effective amount of a composition described in any one of embodiments 92 to 94.

[0260] 121. The method according to any one of embodiments 104 to 106, wherein the RNAi is administered in combination with an immunosuppressant, the immunosuppressant being administered before, simultaneously with and / or after administration of the RNAi.

[0261] 122. The method of any one of embodiments 107 to 109, wherein the viral particles or rAAV particles are administered in combination with an immunosuppressant, and the immunosuppressant is administered before, simultaneously with and / or after administration of the viral particles or rAAV particles.

[0262] 123. The method according to any one of embodiments 118 to 120, wherein the composition is administered in combination with an immunosuppressant, the immunosuppressant being administered before, simultaneously with and / or after administration of the composition. EXAMPLES

[0263] The subject matter of the present disclosure will be better understood by reference to the following examples, which are provided as illustrations of the invention and are not intended to be limiting.

[0264] Example 1: amiR-DMPK 204 Generation of expression cassettes A microRNA designed to target the DMPK gene (amiR-DMPK 204 We generated single-stranded AAV viral vectors encoding the amiR-DMPK gene (Figure 1A). The constructs were engineered to incorporate the amiR-DMPK gene into an optimized microRNA scaffold, miR155 (BLOCK-iT; Sermofisher catalog numbers K4935-00, K4936-00, K4937-00, K4938-00). 204 The microRNA was designed to be embedded in the miR155 amiR-DMPK 204 " or "amiR155-DMPK 204 " miR155 amiR-DMPK 204 was flanked by rabbit β-globin intron sequences and placed under the control of a hybrid muscle promoter (nDes).

[0265] The nDesmin promoter, which contains the Byrne desmin enhancer and one copy of the Paulin desmin enhancer (−973 to −693) and the promoter of the human desmin gene (−228 to +75), was synthesized by conventional oligonucleotide synthesis (Genscript, USA).

[0266] The bovine growth hormone polyadenylation sequence was cloned into amiR-DMPK 204 The 5'-nucleotide sequence was placed 3' of an intron adjacent to the microRNA of (minBGHpA). A filler sequence ("stuffer") was included. The entire gene cassette is flanked by wild-type AAV serotype 2 inverted terminal repeat (ITR) sequences for DNA rescue and replication, as well as packaging into AAV capsids. The sequences were engineered into an ITR plasmid used to generate vectors for in vivo efficacy testing.

[0267] 5' and 3' ITR sequences The ITR sequence was the wild-type sequence of AAV2 of 145 bp. The 3'ITR (downstream of the expression cassette) was in flip orientation (GenBank: LQ493091.1). The 5'ITR (upstream of the expression cassette) was in flop orientation (145 bp) (Miller et al., 2004, Nature Genetics 36.7 (2004); 767-773). The accuracy of the sequence was confirmed by Sanger sequencing.

[0268] nDes promoter The nDes promoter was constructed using the desmin promoter elements described in the literature (Li and Paulin, et. al. 1991, J. Biol. Chem. 266.10; 6562-6570). The nDes promoter contains one copy of the Byrne desmin enhancer, one copy of the Paulin desmin enhancer (-973 to -693), and the promoter of the human desmin gene (-228 to +75).

[0269] The 5' and 3' arms of the rabbit β-globin intron Since intronic expression of miRNAs is known to enhance target knockdown, we used this intron as the amiR-DMPK 204 It was used adjacent to the cassette.

[0270] amiR-DMPK containing the miR155 scaffold 204 (miR155-amiRDMPK 204 ) Endogenous miRNAs are hairpin-like secondary structures found in many primary RNA transcripts (pri-miRNAs). In the nucleus, the microprocessor Drosha / DGCR8 complex binds to and cleaves the proximal stem of the pri-miRNA, liberating a stem-loop precursor miRNA (pre-miRNA). The pre-miRNA is then exported from the nucleus, where the loop is cleaved by Dicer / TRBP to form a mature RNA duplex. The guide strand, also known as the target strand, separates from the passenger strand and is loaded into the Argonaute proteins of the RNA-induced silencing complex (RISC), which then target complementary mRNA transcripts for degradation or translational repression.

[0271] amiR-DMPK 204 The sequence has been identified as a target for DM1 therapy. amiR-DMPK 204 The target sequence of amiR-DMPK is located upstream of the "CUG" repeat sequence in the 3'UTR of the DMPK nucleotide sequence. 204 can repress both wild-type and mutant DMPK transcripts.

[0272] In addition, amiR-DMPK 204 The target region of amiR is conserved in non-human primates (NHP-cynomolgus monkeys) and humans, allowing preclinical evaluation of DMPK knockdown in NHPs (Figure 11). 204Evaluation of the microRNAs demonstrated that the miR155 scaffold has efficient guide processing while minimizing passenger strand processing, reducing the potential for off-target effects (see Example 2 below).

[0273] The final construct selected for development was the amiR-DMPK construct containing the miR155 scaffold. 204 (amiR155-DMPK 204 ), and the guide strand targets the DMPK mRNA for degradation once processed. The engineered pre-miRNA sequence structure was based on the mouse miR-155 sequence (Lagos-Quintana et al., 2002, Current Biology, 12:9, 735-739). The 5' and 3' flanking regions from the miR-155 transcript were inserted into the vector, preserving as much of the miR-155 structure as possible. The stem-loop structure was optimized, with a two nucleotide internal loop resulting in a higher knockdown rate than the five nucleotide / three nucleotide internal loop found in the native miR-155 molecule (Source: BLOCK-iT™ Pol II miR RNAi Expression Vector (Invitrogen)). In the context of the AAV capsid, the vector nDes-miR155-amiR-DMPK 204 was shown to have potent in vivo activity in the DMSXL mouse model of DM1 (see Example 3 below).

[0274] minBGH PolyA A minimal BGH polyA site of 186 bp was inserted into amiR-DMPK to allow for mRNA transcription termination and polyadenylation. 204 It was inserted downstream of the sequence.

[0275] Stuffer sequence derived from the A1AT intron A stuffer sequence from the α1-antitrypsin gene intron sequence 4 was used to bring the gene cassette up to the packaging limit of the rAAV vector.

[0276] nDes-miR155-amiR-DMPK 204 An ITR plasmid containing the cassette (nDes-miR155-amiR-DMPK 204 Cloning of We designed an expression construct, nDes-miR155-amiR-DMPK204-minBGH polyA cassette, which expresses a 1938 bp ITR-ITR sequence. 204 Cloning of the -minBGH polyA cassette was performed. The synthesized nDes-miR155-amiR-DMPK204-minBGH polyA contained a 5'Nco1 site and a 3'Sph1 site for cloning into the ITR plasmid (Figure 1B). Briefly, the synthesized nDes-miR155-amiR-DMPK 204 The plasmid containing the -minBGH polyA sequence was digested with NcoI and SphI, and the 1.9 kB fragment was gel purified. The ITR plasmid was digested with NcoI and SphI, dephosphorylated using calf intestinal alkaline phosphatase (New England Biolabs; catalog number M0290), and the 8.2 kB vector backbone fragment was gel purified. The digested 1.9 kB fragment containing the expression cassette and the digested ITR plasmid were ligated to produce the plasmid ITR-nDes-miR155-amiR-DMPK. 204 was generated.

[0277] Small-scale rAAV vector production ITR-nDes-miR155-amiR-DMPK 204 To confirm plasmid packaging, a small-scale packaging assay was performed in HEK293 cells. Small-scale production was performed using AAV rep / cap plasmids. Figure 1C shows the amount of vector produced per HEK293 cell compared to a standard EGFP plasmid gene cassette.

[0278] amiR-DMPK 204To determine its potential to correct the DM1 phenotype, we silenced human DMPK transcripts in skeletal myoblast cultures derived from DM1 patients and tested its ability to correct the splicing defect. A CTG expansion in the 3'UTR of the DMPK gene leads to the aggregation of hairpin structures of DMPK mRNA into insoluble ribonuclear foci that sequester several RNA-binding proteins. The resulting redistribution of essential splicing factors, such as muscleblind-like 1 (MBNL1), leads to the missplicing of downstream effectors involved in muscle tissue differentiation. amiR-DMPK 204 Treatment of DM1 patient cells with caused greater than 50% silencing and splice correction of DMPK mRNA, as measured by exon 7 inclusion of MBNL1.

[0279] Example 2: miR155 amiR-DMPK 204 Processing amiR-DMPK 204 nDes-miR155-amiR-DMPK was packaged into AAV capsids and the efficacy of DMPK knockdown, passenger strand activity and processing pattern were analyzed in vivo. 204 The construct carrying the DMPK gene was packaged into an AAV. This vector was injected intravenously into the DMSXL adult humanized DM1 mouse model, which expresses human DMPK containing more than 1,000 CTG repeats. After 8 weeks, the animals were euthanized and multiple tissues were collected to measure the efficacy of DMPK knockdown, with cardiac tissue selected to measure passenger chain activity and processing patterns.

[0280] RT-PCR analysis revealed that amiR-DMPK was expressed in multiple muscle tissues. 204 Strong expression of amiR-DMPK was observed, with higher expression in the heart (Figure 2B). 204Together with expression of nDesmin, RT PCR analysis confirmed strong DMPK suppression in the heart and, on average, more than 70% and about 30% in different skeletal muscles (Figure 2C). In cardiac tissue, DMPK expression is less than 50% compared to TBP (TATA binding protein) expression. Notably, DSMXL mice expressing low levels of DMPK compared to TBP (about 50%, indicated by dotted line in Figure 2C) are devoid of obvious DM1 phenotype. Interestingly, the nDesmin promoter showed strong activity in cardiac tissue and similar levels in skeletal muscle (Figure 2B), although higher transduction was observed in the liver (Figure 2A). This suggests that expression is mainly restricted to cardiac and skeletal muscles that developed DM1 pathology.

[0281] amiR-DMPK 204 To assess the processing of mature amiR-DMPK, we performed next-generation sequencing (NGS) for small molecule transcriptome analysis. 204 Heart tissue was analyzed for length and sequence composition of the guide and passenger strands. amiR-DMPK 204 No passenger strand was generated by processing of amiR-DMPK. 204 was processed exclusively to the guide strand in mouse cardiomyocytes (>99%), but often produced strands longer than predicted by the miRBase database (Table 1). Processing of miR155 mostly produced mature lengths between 22 nt and 26 nt in length, but was precisely processed at the 5' end (Table 1). miR155 amiR-DMPK 204 The sequence distribution of different guide strand lengths (nt) mapped to the predicted amiR-DMPK was calculated as a percentage (reads%). 204 The guide strand of is underlined and the seed sequence is in bold. The asterisk indicates the amiR-DMPK 204 The reads corresponding to the predicted length of the guide strand are shown.

[0282] [Table 1]

[0283] Overall, the passenger strand is amiR-DMPK, including miR155. 204 (Guide% was >99%). Therefore, miR155 was selected as a lead for preclinical trials because its miRNA scaffold is well validated for RNAi.

[0284] Example 3: miR155-amiRDMPK in transgenic mice 204 Dose-dependent inhibition of human DMPK by systemic injection of AAV encoding To determine the most effective dose, we investigated the delivery of three separate doses of myotropic AAV (WO 2019 / 207132) capsids containing the miR155 scaffold, amiR-DMPK. 204 (amiR155-DMPK 204 An AAV encoding an expression cassette for ) was evaluated in a dose escalation study. Eight-week-old DMSXL mice were administered 5.0 × 10 11 Vector genome (vg) / kg, 5 × 10 12 vg / kg and 1.0×10 13 vg / kg were injected intravenously. Mice were analyzed for clinical symptoms including body weight, survival rate, muscle rigidity, and cardiac function 8 weeks after AAV injection. Mice were euthanized 8 weeks after gene transfer and DMPK inhibition and splicing correction were measured. miR155-amiRDMPK 204 Expression levels of were measured by small RNA TaqMan and mRNA input levels were normalized to u6 small nuclear RNA.

[0285] amiR155-DMPK 204 We observed a dose-dependent increase in amiR155-DMPK expression (Figure 3A), which resulted in a dose-dependent decrease in total DMPK expression in multiple tissues (Figure 3B). Overall, approximately 10 copies / U6 of amiR155-DMPK 204was observed to be sufficient to reduce DMPK in the heart and diaphragm by more than 50%, an amount that may be sufficient to treat DM1 patients.

[0286] Next, we investigated the consequences of DMPK inhibition in specific DM1 phenotypes, such as splicing abnormalities. Aberrant splicing of LIM domain binding 3 (Ldb3) resulting in the inclusion of exon 11 in the Ldb3 transcript has been demonstrated as a DM1-specific phenotype resulting from sequestration of the RNA splicing machinery by CUG repeat RNA (Yamashita et al. 2014. Neurobiol Dis. 69:200-5). Medium or high doses of AAV nDes-miR155-amiR-DMPK 204 In mice treated with amiR155-DMPK, a significant decrease in Ldb3 transcripts containing exon 11 inclusion was observed in the gastrocnemius muscle. 204 It was confirmed that the splicing defect in muscle treated with was effectively corrected (Figure 4).

[0287] In addition to modifying these molecules, AAV nDes-miR155-amiR-DMPK was then assessed in terms of the physiological and functional manifestations of the disease. 204 The effectiveness of was measured.

[0288] To determine whether treatment could improve survival and reduce weight loss, DMSXL mice were treated with three different doses of AAV nDes-miR155-amiR-DMPK. 204 After 8 weeks of treatment with the medium and high doses, improvements in body weight and survival were observed, whereas no improvements were observed with the low dose or the balanced salt solution (BSS) control (Figures 5A and 5B).

[0289] Next, in terms of functional symptoms of the disease, such as prevention of myotonia and cardiac abnormalities, AAV nDes-miR155-amiR-DMPK 204 The efficacy of AAV nDes-miR155-amiR-DMPK was measured by electromyography. 204It was found that myotonia was significantly reduced in mice treated with BSS (Table 2). Notably, after treatment, only 7.6% of animals treated with the medium dose were myotonic, whereas more than 50% of mice in the control group (treated with BSS) or the low dose group had persistent myotonia (score 1).

[0290] [Table 2]

[0291] Myotonic discharges were graded on a 4-point scale: 0, no myotonia; 1, occasional myotonic discharges in less than 50% of needle insertions; 2, myotonic discharges in more than 50% of needle insertions; 3, myotonic discharges with almost every insertion.

[0292] Cardiac function in DMSXL mice was also monitored using surface echocardiograms after 8 weeks of treatment, along with skeletal muscle function. 204 improved cardiac output compared to BSS-treated controls. A significant improvement in cardiac output was observed in the mid-dose group (5e12vg / kg) after 8 weeks of treatment (Figure 6).

[0293] Example 4: AAVrh74N502I capsid improves muscle transduction and reduces liver transduction Experiments were conducted to verify the transduction efficiency of AAV capsids containing the AAVrh74N502I VP1 capsid protein (WO2019178412; SEQ ID NO: 50) in various tissues of non-human primates. A schematic of the experiment is shown in Figure 7A. Non-human primates were treated with 1 x 10 13 Animals were treated intravenously with either AAV9, AAVrh74, or AAVrh74N502I capsid at 1000 ng / kg of AAV9 vg / kg. Twenty-one days after treatment, animals were sacrificed and eGFP expression levels were measured in the tibialis anterior (TA), biceps femoris, quadriceps, heart, and liver.

[0294] Capsids containing the AAVrh74N502I capsid protein improved muscle transduction (Figures 7B-7E) and reduced liver transduction (Figure 7F) in non-human primates compared to control capsids (Table 3).

[0295] [Table 3]

[0296] Example 5: AAVrh74N502I nDes-miR155-amiR-DMPK in the DMSXL mouse model 204 Assessment of target binding To determine the most effective dose, delivery of two separate doses of AAVrh74N502I capsids was investigated. 204 (miR155-amiR-DMPK 204 An AAV encoding an expression cassette for ) was evaluated in a dose escalation study. Eight-week-old DMSXL mice were administered 9 × 10 13 Vector genome (vg) / kg and 1.8 × 10 14 vg / kg was intravenously injected into the mice. Eight weeks after gene transfer, the mice were euthanized and DMPK inhibition and amiR-DMPK were analyzed. 204 Expression levels of were measured by small RNA TaqMan and mRNA input levels were normalized to u6 small nuclear RNA.

[0297] amiR-DMPK 204 We observed a dose-dependent increase in amiR-DMPK expression (Figure 8A), which resulted in a dose-dependent decrease in total DMPK expression in multiple tissues (Figure 8B). Overall, approximately 10 copies / U6 of amiR-DMPK 204 was observed to be sufficient to reduce DMPK in the heart and diaphragm by more than 50%, which may be sufficient to treat DM1 patients.

[0298] Finally, the lead vector nDes-miR155-amiR-DMPK was synthesized in the context of the myotropic capsid AAVrh74N502I (SEQ ID NO: 50).204 was shown to have potent in vivo activity in DM1 iPSC-derived cardiomyocytes (Figure 9).

[0299] Example 6: AAVrh74N502I nDes-miR155-amiR-DMPK in the transcriptome 204 Evaluation amiR-DMPK 204 To determine whether treatment with CBA had any significant effect on the transcriptome, genome-wide RNA sequencing (RNA-seq) was performed to determine whether treatment with CBA miR155-amiR-DMPK had any significant effect on the transcriptome. 204 amiR-DMPK was expressed by transfecting the plasmid into HEK293 cell lines. 204 Treatment with amiR-DMPK was compared with CTL3 (scrambled miRNA). 204 To assess whether this was due to off-target effects of amiR, we assessed whether seed complementation was enriched in significantly downregulated targets. Using a significance threshold of 5% false discovery rate (FDR), there were four differentially expressed genes that contained the TTCGAC seed complement in their 3'UTR: OPN4 (12.5-fold), DMPK (1.7-fold), KRTAP21-2 (1.7-fold), and C8ORF44-SGK3 (1.7-fold) (Table 4). At a 1% FDR, only OPN4 (12.5-fold) and DMPK (1.7-fold) showed differential expression (Figure 10). As expected, DMPK was one of the most heavily affected mRNA levels (44% silencing). Overall, amiR-DMPK in HEK293 cells was significantly downregulated in amiR-DMPK. 204 Minimal off-target effects were observed after overexpression of

[0300] [Table 4]

[0301] Example 7: AAVrh74N502I nDes-miR155-amiR-DMPK in non-human primates 204Dose-ranging study to investigate the biodistribution and activity of AAVrh74MN502I nDes-miR155-amiR-DMPK 204 A single intravenous (IV) dose was administered to cynomolgus monkeys to determine the biodistribution and activity of. The study period was 12 weeks after the single injection.

[0302] A total of 16 cynomolgus monkeys (8 males, 8 females; 24-48 months old) were dosed IV into the saphenous vein once on study day 1. Doses are shown in Table 5 below. Animals were divided into four different categories based on dose level (vg / kg) (2 males and 2 females in each group): formulation buffer (group 1); 5×10 13 vg / kg (2nd group); 1×10 14 vg / kg (Group 3); and 2 × 10 14 vg / kg (Group 4). After 12 weeks, the animals were sacrificed and tissues were taken for analysis.

[0303] [Table 5]

[0304] Harvested tissues were mechanically homogenized to extract RNA and DNA, and samples were analyzed by digital PCR (dPCR).

[0305] Dose-dependent biodistribution and activity of AAVrh74N502I nDes-miR155-amiR-DMPK204 was demonstrated in several muscle and non-muscle tissues. Several skeletal muscles (tibialis anterior (TA); gastrocnemius; quadriceps; biceps femoris; soleus; extensor digitorum longus (EDL); diaphragm) as well as cardiac and liver tissues were analyzed. Viral genome copies were found in all tissues examined, and the copy number / cell in each tissue was dose-dependent (Figure 12). Expression of amiR-DMPK (Figure 13) and downregulation of DMPK (Figure 14) were also dose-dependent in various muscle, cardiac and liver tissues. A dose-dependent decrease in DMPK expression was found to be up to 90% compared to the control group. All doses examined in animals were found to be safe and well tolerated in animals.

[0306] array All polypeptide sequences are presented as N-terminus to C-terminus unless otherwise indicated. All nucleic acid sequences are presented as 5' to 3' unless otherwise indicated.

[0307] Byrne desmin enhancer sequence [ka] Source: Li and Paulin,et.al.1991.“High level desmin expression depends on a muscle-specific enhancer.”Journal of Biol Chem.266.10;6562-6570. Homo sapiens desmin locus control region (DES-LCR) on chromosome 2 (NCBI reference sequence: NG_046330.1) The Byrne enhancer sequence corresponds to positions 17767 to 18125 of the reference sequence.

[0308] Paulin desmin enhancer sequence [ka] Source: Li and Paulin,et.al.1991.“High level desmin expression depends on a muscle-specific enhancer.”Journal of Biol Chem.266.10;6562-6570. Homo sapiens desmin locus control region (DES-LCR) on chromosome 2 (NCBI reference sequence: NG_046330.1) The Paulin enhancer sequence corresponds to 17787 to 18063 of the reference sequence.

[0309] Paulin desmin promoter sequence (-228 to +75) [ka] There is one base pair that differs from the published sequence (a C instead of an A, shown in bold and underlined). Source: Li and Paulin,et.al.1991.“High level desmin expression depends on a muscle-specific enhancer.”Journal of Biol Chem.266.10;6562-6570. Homo sapiens desmin locus control region (DES-LCR) on chromosome 2 (NCBI reference sequence: NG_046330.1) The Paulin promoter sequence corresponds to 18535 to 18844 of the reference sequence.

[0310] Complete nDes promoter sequence [ka] Source: Li and Paulin,et.al.1991.“High level desmin expression depends on a muscle-specific enhancer.”Journal of Biol Chem.266.10;6562-6570.

[0311] Rabbit β-globin intron [ka]

[0312] 5' arm of rabbit β-globin intron [ka] Source: Oryctolagus cuninculus hemoglobin, beta (HBB2) Gene ID 100009084 The instant sequence has an additional CATG (shown in bold and underlined) that is not present in gene ID 100009084.

[0313] 3' arm of rabbit β-globin intron [ka] Source: Oryctolagus cuninculus hemoglobin, beta (HBB2) Gene ID 100009084 The instant sequence has two T residues (shown above in bold and underlined) in place of the two C residues of gene ID 100009084.

[0314] miR155-DMPK 204 array: 5'miR155 flanking sequence RNA sequencing CUGGAGGCUUGCUGAAGGCUGUAUGCU (SEQ ID NO: 9) DNA sequence CTGGAGGCTTGCTGAAGGCTGTATGCT (SEQ ID NO: 40) Source: BLOCK-iT™ Pol II miR RNAi Expression Vector Kit Catalog No. K493500 The engineered pre-miRNA sequence structure was based on the mouse miR-155 sequence (Lagos-Quintana et al., 2002, Current Biology, 12:9, 735-739). amiR-DMPK 204 Guide-DNA AGTCGAAGACAGTTCTAGGGT (SEQ ID NO: 4) miR155 terminal loop-DNA GTTTTGGCCACTGACTGAC (SEQ ID NO: 6) Source: BLOCK-iT™ Pol II miR RNAi Expression Vector Kit Catalog No. K493500 The engineered pre-miRNA sequence structure was based on the mouse miR-155 sequence (Lagos-Quintana et al., 2002, Current Biology, 12:9, 735-739). amiR-DMPK204 Passenger-DNA ACCCTAGATGTCTTCGATT (SEQ ID NO: 5) amiR-DMPK 204 Guide-RNA-miR155 terminal loop-amiR-DMPK 204 Passenger-RNA AGUCGAAGACAGUUCUAGGGUUGUUUUGGCCACUGACUGACACCCUAGAUGUCUUCGAUU (SEQ ID NO: 7) amiR-DMPK 204 Guide-DNA-miR155 terminal loop-amiR-DMPK 204 Passenger-DNA AGTCGAAGACAGTTCTAGGGTTGTTTTGGCCACTGACTGACACCCTAGATGTCTTCGATT (SEQ ID NO: 8) 3'miR155 flanking sequence RNA sequencing GACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 10) DNA sequence GACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC (SEQ ID NO: 41) Source: BLOCK-iT™ Pol II miR RNAi Expression Vector Kit Catalog No. K493500 The engineered pre-miRNA sequence structure was based on the mouse miR-155 sequence (Lagos-Quintana et al., 2002, Current Biology, 12:9, 735-739). miR155 RNA CUGGAGGCUUGCUGAAGGCUGUAUGCUGACACAAGGCCUGUUACUAGCACUCACAUGGAACAAAUGGCC (SEQ ID NO: 11) DNA CTGGAGGCTTGCTGAAGGCTGTATGCTGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCC (SEQ ID NO: 42) Total miR155-DMPK 204 Double-stranded sequence - RNA [ka] Total miR155-DMPK 204 Double-stranded sequence - DNA [ka]

[0315] Minimal BGHpA sequence [ka] Source: Bos taurus growth hormone 1 (GH1) mRNA NCBI reference sequence NM_180996.1

[0316] 1138 bp of A1AT intron stuffer sequence (upstream of the expression cassette) [ka] Source: Plasmid DC 969 (SerpinA1=A1AT) chromosome 14 NG_008290.1

[0317] 398 bp of A1AT intron stuffer sequence (downstream of the expression cassette) [ka] Source: Plasmid DC 969 (SerpinA1=A1AT) chromosome 14 NG_008290.1

[0318] ITR-nDes-miR155-amiR-DMPK 204 -BGHpA-stuffer-ITR(3739bp) [ka] [ka] [ka]

[0319] [Table 6]

[0320] The sequence of the synthesized nDes-miR155-204 fragment: [ka]

[0321] nDes-miR155-204 promoter to polyA [ka]

[0322] Amino acid sequence of AAVrh74 variant (International Publication No. 2019178412) [ka] [ka]

[0323] Amino acid sequence of AAVrh74N502I [ka]

[0324] Nucleotide sequence encoding the AAVrh74 N502I capsid [ka]

[0325] Amino acid sequence of AAVrh74W505R [ka]

[0326] Nucleotide sequence encoding AAVrh74W505R [ka]

Claims

1. RNAi comprising a first strand and a second strand, a) The first chain and the second chain form a double chain, b) The first strand includes a guide region, the guide region includes a nucleic acid having the sequence 5'-AGUCGAAGACAGUUCUAGGU-3' (SEQ ID NO: 1), and c) The second strand includes a non-guide region, and is an RNAi.

2. The RNAi according to claim 1, wherein the non-guide region comprises a nucleic acid having the sequence 5'-ACCCUAGAUGUCUUCGAUU-3' (SEQ ID NO: 2).

3. The first and second strands are linked by an RNA linker capable of forming a loop structure, and optionally, The RNA linker comprises approximately 4 to approximately 50 nucleotides, and / or The aforementioned loop structure contains approximately 4 to approximately 20 nucleotides, and / or The loop structure includes a nucleic acid sequence having approximately 90% identity with sequence number 3 or sequence number 3. The RNAi comprises the second strand, the RNA linker and the first strand in its 5' to 3' portion, or the RNAi comprises the first strand, the RNA linker and the second strand in its 5' to 3' portion. The RNAi comprises a nucleic acid having the sequence of Sequence ID No. 7 or a sequence having approximately 90% identity with the sequence of Sequence ID No. 7, and / or The RNAi according to claim 1, wherein the RNAi is a small molecule inhibitory RNA (siRNA), a microRNA (miRNA), or a small molecule hairpin RNA (shRNA).

4. The RNAi further includes a scaffold, which can be optionally selected as follows: The scaffold comprises all or part of the nucleic acid of Sequence ID No. 11, preferably the miRNA is embedded within the scaffold, and more preferably the scaffold has a 5' arm located on the 5' side of the nucleic acid encoding the RNAi and a 3' arm located on the 3' side of the nucleic acid encoding the RNAi, and / or The scaffolding is a miR-155 scaffolding, and / or The miR-155 scaffold comprises a nucleic acid located at the 5' end of the RNAi, having approximately 90% identity with sequence number 9 or sequence number 9, and / or The RNAi according to claim 1, wherein the miR-155 scaffold comprises a nucleic acid located at the 3' end of the RNAi, having approximately 90% identity with sequence number 10 or sequence number 10.

5. The RNAi targets RNA encoding polypeptides associated with myotonic dystrophy-1 (DM1), By optional selection, the polypeptide is myotonic dystrophy protein kinase (DMPK), preferably, The DMPK comprises a mutation related to DM-1, and / or The RNAi according to claim 1, wherein the gene encoding DMPK contains five or more CTG trinucleotide repeats.

6. An expression cassette comprising a nucleic acid encoding an RNAi according to any one of claims 1 to 5, wherein the nucleic acid encoding the RNAi is optionally operably linked to a promoter, preferably The promoter is a muscle-specific promoter, and / or The promoter is a desmin promoter or a variant thereof, more preferably, The desmin promoter comprises one or more enhancer elements of the human desmin gene and a promoter, and / or The desmin promoter comprises two enhancer elements of the human desmin gene and a promoter, and / or The desmin promoter is an expression cassette comprising one or more Byrne enhancer elements and / or one or more Paulin enhancer elements.

7. The desmin promoter includes one or more enhancer elements containing the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having approximately 90% identity with the sequence of SEQ ID NO: 21 and / or one or more enhancer elements containing the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having approximately 90% identity with the sequence of SEQ ID NO: 22, optionally selected by: The desmin promoter contains the nucleotide sequence of SEQ ID NO: 12 or a sequence having approximately 90% identity with the nucleotide sequence of SEQ ID NO: 12, or The expression cassette further comprises an intron, preferably the intron being a rabbit β-globin intron, and / or the intron comprising the nucleotide sequence of SEQ ID NO: 13 or a sequence having about 90% identity with the sequence of SEQ ID NO: 13, and / or the nucleic acid encoding the RNAi is embedded in the intron, most preferably the intron comprising a 5' arm and a 3' arm, the 5' arm being located on the 5' side of the nucleic acid encoding the RNAi, and the 3' arm being located on the 3' side of the nucleic acid encoding the RNAi, the 5' arm of the intron comprising the nucleotide sequence of SEQ ID NO: 14 or a sequence having about 90% identity with the sequence of SEQ ID NO: 14, and / or the 3' arm of the intron comprising the nucleotide sequence of SEQ ID NO: 15 or a sequence having about 90% identity with the sequence of SEQ ID NO: 15, and / or The expression cassette further comprises a polyadenylation signal, optionally the polyadenylation signal being a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA signal, preferably the polyadenylation signal being a minimal bovine growth hormone polyadenylation signal, and / or The bovine growth hormone polyadenylation signal comprises the nucleotide sequence of SEQ ID NO: 16 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 16, and / or The expression cassette according to claim 6, comprising the nucleotide sequence of SEQ ID NO: 17 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:

17.

8. An expression cassette comprising a modified desmin promoter, wherein the modified desmin promoter comprises one or more enhancer elements and a promoter of the human desmin gene.

9. The modified desmin promoter comprises two enhancer elements and a promoter of the human desmin gene. The modified desmin promoter comprises one or more Byrne enhancer elements and / or one or more Paulin enhancer elements. The modified desmin promoter includes one or more enhancer elements containing the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having approximately 90% identity with the sequence of SEQ ID NO: 21, and / or one or more enhancer elements containing the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having approximately 90% identity with the sequence of SEQ ID NO:

22. The desmin promoter includes the nucleotide sequence of SEQ ID NO: 12 or a sequence having approximately 90% identity with the nucleotide sequence of SEQ ID NO:

12. The expression cassette further comprises an intron, optionally the intron being a rabbit β-globin intron, optionally the intron comprising the nucleotide sequence of SEQ ID NO: 13 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:

13. The expression cassette further comprises a polyadenylation signal, optionally the polyadenylation signal being a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA, optionally the bovine growth hormone polyadenylation signal comprising the nucleotide sequence of SEQ ID NO: 16 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 16, and / or The expression cassette according to claim 8, wherein the introduced gene encodes a polypeptide or nucleic acid, and optionally, the introduced gene encodes RNAi.

10. The expression cassette according to claim 8, wherein the nucleic acid encoding the introduced gene is embedded in the intron, and optionally the intron comprises a 5' arm and a 3' arm, the 5' arm being located on the 5' side of the nucleic acid encoding the introduced gene, and the 3' arm being located on the 3' side of the nucleic acid encoding the introduced gene, and optionally the 5' arm of the intron comprises the nucleotide sequence of SEQ ID NO: 14 or a sequence having about 90% identity with the sequence of SEQ ID NO: 14, and / or the 3' arm of the intron comprises the nucleotide sequence of SEQ ID NO: 15 or a sequence having about 90% identity with the sequence of SEQ ID NO:

15.

11. A vector comprising the expression cassette described in claim 6, wherein the vector is a recombinant adeno-associated virus (rAAV) vector, and optionally, The expression cassette is adjacent to one or more Staffor nucleic acid sequences, preferably, The one or more Stuffer nucleic acid sequences are derived from the human SerpinA1 gene and / or The Staffor nucleic acid sequence located at the 5' end of the expression cassette is derived from the human SerpinA1 gene, and / or The stuffer sequence located at the 5' end of the expression cassette includes the nucleotide sequence of SEQ ID NO: 18 or a sequence having approximately 90% identity with the sequence of SEQ ID NO:

18. The Staffor nucleic acid sequence located at the 3' end of the expression cassette is derived from the human SerpinA1 gene, and / or The stuffer sequence located at the 3' end of the expression cassette is the nucleotypography of sequence number 19. It includes a sequence that has approximately 90% identity with the sequence of sequence number 19, or The expression cassette is adjacent to one or more AAV inverted terminal repeats (ITRs), preferably, The expression cassette is adjacent to two AAV ITRs, and / or The AAV ITR is an ITR of an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV serotype, and / or The AAV ITR is an AAV2 ITR, and / or The rAAV vector comprises the nucleotide sequence of SEQ ID NO: 20 or a sequence having approximately 90% identity with the sequence of SEQ ID NO: 20, and / or By arbitrary selection, the rAAV vector is a self-complementary rAAV vector.

12. Recombinant AAV particles comprising the rAAV vector described in claim 11, By arbitrary selection, the AAV virus particles are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAVrh74, AAVrh74 N502I, AAVrh74 W505R, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2-HBKO, AAVDJ8, AAVPHP. B, AAVPHP. eB, AAVBR1, AAVHSC15, AAVHSC17, goat AAV, AAV1 / AAV2 chimera, bovine AAV or mouse AAV capsid, including and / or AAV2 / HBoV1 serotype capsids. The ITR and capsid of the rAAV virus particle are derived from the same AAV serotype. The ITR and capsid of the rAAV virus particle are derived from different AAV serotypes, or The AAV virus particle contains a capsid of the AAVrh74 N502I serotype, preferably the ITR is an AAV2 ITR, and the capsid of the rAAV particle is a capsid of the AAVrh74 N502I serotype, or The AAV particles contain a capsid of the AAVrh74 W505R serotype, or Recombinant AAV particles, wherein the ITR is an AAV2 ITR, and the capsid of the rAAV particle is a capsid of the AAVrh74 W505R serotype.

13. rAAV particles comprising an rAAV vector and a capsid, wherein the rAAV vector has the following nucleic acids in its 5' to 3' region: AAV2 ITR, Nucleic acid encoding the Staffor nucleic acid sequence derived from the human serpinA1 gene, Byrne Desmin Enhancer Element, Paulin Desmin Enhancer Element, Desmin promoter, 5' arm of rabbit β-globin intron, 5'miR155 scaffolding arrangement, DMPK 204 miRNA guide sequence, miR155 terminal loop sequence, DMPK 204 miRNA passenger sequence, 3'miR155 scaffolding arrangement, The 3' arm of the rabbit β-globin intron, Minimal bovine growth hormone polyadenylated sequence, nucleic acids encoding the Staffor nucleic acid sequence derived from the human serpinA1 gene, and AAV2 ITR rAAV particles comprising, wherein the capsid is AAVrh74 N502I capsid.

14. rAAV particles containing an rAAV vector, wherein the rAAV vector has the following nucleic acids in its 5' to 3' region. AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 43, A nucleic acid encoding a Staffor nucleic acid sequence derived from the human serpinA1 gene, including the polynucleotide sequence of sequence number 18. Byrne desmin enhancer element containing the polynucleotide sequence of SEQ ID NO: 21, Paulin desmin enhancer element containing the polynucleotide sequence of sequence number 22, Desmin promoter containing the polynucleotide sequence of SEQ ID NO: 23, The 5' arm of the rabbit β-globin intron containing the polynucleotide sequence of sequence number 14, A 5'miR155 scaffold sequence containing the polynucleotide sequence of sequence number 40, DMPK containing the polynucleotide sequence of Sequence ID No. 4 204 miRNA guide sequence, miR155 terminal loop sequence containing the polynucleotide sequence of SEQ ID NO: 6, DMPK containing the polynucleotide sequence of Sequence ID No. 5 204 miRNA passenger sequence, A 3'miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 41, The 3' arm of the rabbit β-globin intron containing the polynucleotide sequence of sequence number 15, Minimal bovine growth hormone polyadenylated sequence containing the polynucleotide sequence of SEQ ID NO: 16, A nucleic acid encoding a Staffor nucleic acid sequence derived from the human serpinA1 gene, which includes the polynucleotide sequence of SEQ ID NO: 19, and AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 49 The capsid is the AAVrh74 N502I capsid, which is an rAAV particle.

15. rAAV particles containing an rAAV vector, wherein the rAAV vector comprises the following nucleic acids in its 5' to 3' positions: an AAV2 ITR containing the polynucleotide sequence of SEQ ID NO: 43, a nucleic acid encoding a human serpin A1 gene-derived Stuffer nucleic acid sequence containing the polynucleotide sequence of SEQ ID NO: 18, a Byrne desmin enhancer element containing the polynucleotide sequence of SEQ ID NO: 21, a Paulin desmin enhancer element containing the polynucleotide sequence of SEQ ID NO: 22, a desmin promoter containing the polynucleotide sequence of SEQ ID NO: 23, a 5' arm of a rabbit β-globin intron containing the polynucleotide sequence of SEQ ID NO: 14, a 5' miR155 scaffold sequence containing the polynucleotide sequence of SEQ ID NO: 40, and a DMPK containing the polynucleotide sequence of SEQ ID NO:

4. 204 DMPK containing the miRNA guide sequence, the miR155 terminal loop sequence including the polynucleotide sequence of SEQ ID NO: 6, and the polynucleotide sequence of SEQ ID NO:

5. 204 rAAV particles comprising an AAV2 ITR containing a miRNA passenger sequence, a 3'miR155 scaffold sequence including the polynucleotide sequence of SEQ ID NO: 41, a 3' arm of a rabbit β-globin intron including the polynucleotide sequence of SEQ ID NO: 15, a minimal bovine growth hormone polyadenylated sequence including the polynucleotide sequence of SEQ ID NO: 16, a nucleic acid encoding a staffer nucleic acid sequence derived from the human serpinA1 gene including the polynucleotide sequence of SEQ ID NO: 19, and the polynucleotide sequence of SEQ ID NO: 49, wherein the capsid is the AAVrh74 W505R capsid.

16. The AAVrh74 W505R capsid contains the amino acid sequence of SEQ ID NO:

52. rAAV particles according to claim 15, comprising a side protein.

17. A pharmaceutical composition comprising rAAV particles according to any one of claims 9 to 14, further comprising optionally a pharmaceutically acceptable carrier.

18. A kit comprising RNAi according to any one of claims 1 to 5.

19. RNAi according to any one of claims 1 to 5, or rAAV particles according to claim 12, for use in mammals requiring treatment for myotonic dystrophy-1 (DM1).

20. A method for inhibiting the expression of myotonic dystrophy protein kinase (DMPK) in a mammal having DM-1 that requires such inhibition, comprising administering an effective amount of the viral particles described in claim 12 to the mammal, and / or A method for inhibiting the accumulation of DMPK RNA in mammalian cells having DM-1, which require such inhibition, comprising administering an effective amount of the viral particles described in claim 12 to the mammal.

Images