Compositions and methods for preventing and treating rabies virus infections

Abstract

The present disclosure relates generally to the field of molecular virology, and in particular to nucleic acid molecules encoding modified alphavirus viral genomes or self-replicating RNA (srRNA) constructs, recombinant cells and pharmaceutical compositions containing the same, and the use of such nucleic acid molecules, recombinant cells, and compositions to produce desired products in cell culture or in vivo. Also provided are methods for inducing an immune response in a subject in need thereof, and methods for preventing and / or treating rabies virus infection.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Patent Application No. 17 / 720,002, filed April 13, 2022, the disclosure of which is incorporated by reference in its entirety, including any drawings.

[0002] Incorporation by reference of sequence listing The material in the attached Sequence Listing is hereby incorporated by reference into this application. 2023-04-06 Sequence_Listing_ST26 The attached Sequence Listing file named 058462-510001WO.xml was created on April 6, 2023 and is 72,426 bytes in size.

[0003] Technical Field The present disclosure relates to the fields of molecular virology and immunology, and in particular to nucleic acid molecules encoding modified alphavirus viral genomes or self-replicating RNAs (srRNAs), recombinant cells, and pharmaceutical compositions containing same, and the use of such nucleic acid molecules, recombinant cells, and compositions to produce desired products in cell culture or in vivo. Also provided are methods for inducing an immune response in a subject in need thereof, and methods for preventing and / or treating rabies virus infection. [Background technology]

[0004] Rabies is a viral zoonotic disease that is endemic in more than 100 countries and territories, threatening more than 3 billion people. The disease is invariably fatal after clinical onset in the absence of post-exposure prophylaxis (WHO epidemiological record 2010. No. 32 (85):309-320. Rabies vaccine: WHO position paper). WHO estimates that 55,000 rabies-related deaths occur annually, and more than 10 million people receive post-exposure treatment (PET).

[0005] Currently available rabies vaccines include either the nerve tissue vaccine, which is the most widely used but is subject to high risk exposure, or the cell culture and embryonated egg vaccine (CCEEV), which is safer but more costly. Risks associated with nerve tissue vaccines include induction of autoimmune central nervous system disease due to the inherent amount of myelin; the need for multiple injections; and uncertain efficacy. The WHO does not recommend the use of nerve tissue vaccines and strongly encourages increased availability of modern and high-quality vaccines to the poor. Avian embryo and cell culture vaccines contain inactivated purified virus and do not contain nerve proteins. Although cell culture production methods are safer and more immunogenic than nerve tissue vaccines, their use is mainly limited to developed countries, despite the current WHO recommendation, due to the time and resource requirements and associated high costs.

[0006] Pre-exposure prophylaxis (PrEP) with cell-culture vaccines is safe and recommended for individuals at high risk (e.g., laboratory staff, veterinarians, animal caretakers, wildlife researchers, and travelers to rabies-endemic areas), but is primarily restricted to developed countries for cost reasons. In addition, anti-rabies vaccines are recommended for travelers to rabies-endemic African and Asian countries.

[0007] The current problem is that these vaccines are scarce and, at any given time, are only available for postexposure prophylaxis, not for preventive vaccination, although preventive vaccination is important for travelers visiting developing countries where rabies virus Ig for postexposure prophylaxis may not be available.

[0008] For these reasons, there is a need for a safe and effective rabies vaccine that can be supplied at any time.

[0009] The disclosure provided herein provides solutions to problems that existed in previous attempts to create rabies vaccines and may result in improved methods of treating and preventing rabies infection. Summary of the Invention

[0010] The present disclosure generally relates to the development of immunotherapeutic agents, such as recombinant nucleic acid constructs and pharmaceutical compositions comprising the same, for use in the prevention and management of rabies virus infection. In particular, as described in more detail below, some embodiments of the present disclosure provide nucleic acid constructs comprising a sequence encoding a modified alphavirus genome or self-replicating RNA (srRNA), wherein at least a portion of the nucleic acid sequence of the modified alphavirus genome or srRNA encoding a viral structural protein is replaced with a coding sequence for a polypeptide construct comprising rabies virus envelope glycoprotein G (RABV-G), a variant thereof, or an antigenic determinant of any thereof. Also disclosed are recombinant cells engineered to include one or more of the nucleic acid constructs disclosed herein, methods for producing a molecule of interest, and pharmaceutical compositions comprising one or more of the following: (a) a nucleic acid construct of the present disclosure, (b) a recombinant cell of the present disclosure, or (c) a pharmaceutical composition of the present disclosure. Furthermore, in certain aspects of the present disclosure, compositions and methods are provided for inducing an immune response in a subject in need thereof and / or for preventing and / or treating rabies virus infection. The above summary is for illustrative purposes only and is not intended to be limiting in any way. In addition to the exemplary embodiments and features described herein, further aspects, embodiments, objects, and features of the present disclosure will become more fully apparent from the drawings and detailed description and claims.

[0011] In one embodiment of the present disclosure, provided herein is a nucleic acid construct comprising a nucleic acid sequence encoding a modified alphavirus genome or self-replicating RNA (srRNA), wherein at least a portion of the nucleic acid sequence of the modified alphavirus genome or srRNA encoding a viral structural protein is replaced with a coding sequence for rabies virus envelope glycoprotein G (RABV-G), a variant thereof, or a polypeptide construct comprising an antigenic determinant of any of these.

[0012] In some embodiments, the antigenic determinant is present in the N-terminal half of RABV-G.

[0013] In some embodiments, the antigenic determinant is present in the C-terminal half of RABV-G.

[0014] In some embodiments, the antigenic determinant comprises RABV-G antigenic site I, antigenic site II, antigenic site III, antigenic site IV, minor antigenic site A, or any combination thereof.

[0015] In some embodiments, the envelope glycoprotein G is the envelope glycoprotein G of a pathogenic rabies virus strain or a non-pathogenic rabies virus strain.

[0016] In some embodiments, the envelope glycoprotein G is selected from the group consisting of Flury LEP, Flury LEP-C, Flury HEP, 1088, AT6, CQ92, CVS-11, CVS-26, CVS-26(G-N204S), CYN1009D, CYN1026D, CYN1029D, CYN1138D, CYN1140D, CYN1141D, CYN1242H, CYN1243D, CYN1244D, CYN1245D, CYN1247D, CYN1249D, CYN1250D, CYN1251D, CYN1252D, CYN1253D, CYN1255D, CYN1256D, CYN1257D, CYN1258D, CYN1259D, CYN1300D, CYN1301D, CYN1302D, CYN1303D, CYN1304D, CYN1305D, CYN1306D, CYN1307D, CYN1308D, CYN1309D, CYN1310D, CYN1311D, CYN1312D, CYN1313D, CYN1314D, CYN1315D, CYN1316D, CYN1317D, CYN1318D, CYN1319D, CYN1400D, CYN1401D, CYN1402D, CYN1403D, CYN1404D, CYN1405D, CYN1406D, CYN14 N1257D strain, CYN1259D strain, CYN1260D strain, CYN1261D strain, GX4 strain, H-08-1320 strain, H-1413-09 strain, IP1586 / 10 strain, IP2990 / 13 strain, IP2991 / 13 strain, IP2992 / 13 strain, IP3176 / 09 Stock, IP4005 / 12 stock, IP412 / 10 stock, IP542 / 10 stock, IP7941 / 09 stock, J stock, JX-08-47 stock, JX08-48 stock, Kyoto stock, Kyoto (G-S204N) stock, N.HL stock, RC.HL stock, rHEP5.0-CVSG stock, RRV The envelope glycoprotein G of a rabies virus strain selected from ON-99-2, SAD-B19, SH06, SHRBV-18, SNK-CTN, SRV9, Street Alabama Dufferin (HCP-SAD), VRC-RZ2, ZJ-LA, and ZJ-QZ. In some embodiments, the envelope glycoprotein G is the envelope glycoprotein G of the Flury LEP strain.

[0017] In some embodiments, the polypeptide construct comprises molecular alterations that stabilize RABV-G, a variant thereof, or an antigenic determinant of either thereof.

[0018] In some embodiments, the genome or srRNA of the modified alphavirus does not contain nucleic acid sequences encoding viral structural proteins.

[0019] In some embodiments, the nucleic acid sequence encoding the polypeptide construct is operably linked to a promoter sequence. In some embodiments, the promoter sequence is a 26S subgenomic (sg) promoter.

[0020] In some embodiments, the genome or srRNA of the modified alphavirus is of an alphavirus belonging to the VEEV / EEEV / WEEV group, or the SFV group, or the SINV group, hi some embodiments, the alphavirus is Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), Chikungunya virus (CHIKV), Western equine encephalitis virus (WEEV), or Sindbis virus (SINV).

[0021] In some embodiments, the nucleic acid sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 6-11.

[0022] In one aspect, provided herein is a recombinant cell comprising a nucleic acid construct as disclosed herein. In some embodiments, the recombinant cell is a mammalian cell or an insect cell.

[0023] In yet another aspect, provided herein is a pharmaceutical composition comprising a pharma- ceutically acceptable excipient and a nucleic acid construct of the present disclosure.

[0024] In some embodiments, the composition is formulated into a delivery system with a delivery vehicle, the delivery system comprising a liposome, a viral replicon particle (VRP), a lipid nanoparticle (LNP), a polymeric nanoparticle, a physiological buffer, a microsphere, an immune stimulating complex (ISCOM), a conjugate of a bioactive ligand, or any combination thereof. In some embodiments, the lipid is present in a lipid:RNA mass ratio of about 100:1 to about 4:1. In some embodiments, the lipid nanoparticles have an average diameter of about 25 nm to about 1000 nm. In some embodiments, the composition is formulated as a vaccine or adjuvant. In some embodiments, the composition is formulated for intramuscular administration.

[0025] In another aspect, provided herein is a method for inducing an immune response or treating a rabies infection in a subject in need thereof. The method comprises administering to the subject a composition comprising a nucleic acid construct of the present disclosure. In some embodiments, the method is a method for inducing an immune response. In some embodiments, the immune response is a neutralizing antibody response. In some embodiments, the neutralizing antibody response comprises a neutralizing antibody titer of 0.5 IU / mL or greater. In some embodiments, the composition is administered to the subject individually as a single prophylactic or therapeutic method (monotherapy) or in combination with at least one additional therapeutic method as a first line of therapy. [Brief description of the drawings]

[0026] The features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure can be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings, in which: [Figure 1]Figure 1 is a bar graph showing RNA replication from various srRNA vectors encoding rabies virus glycoprotein (RABV-G). 50 ng or 500 ng of srRNA was transfected into 7.7E5 BHK-21 cells by nucleofection, and 15 hours later, cells were harvested and stained with AF488-conjugated anti-dsRNA antibody. The frequency of dsRNA-positive cells was determined by flow cytometry (FC). [Diagram 2] Figure 2 is a bar graph showing the relative expression of rabies virus glycoprotein (RABV-G) from various srRNA vectors. 50 ng or 500 ng of srRNA encoding the RABV-G gene was transfected into 7.7E5 BHK-21 cells by nucleofection, and 15 hours later, the cells were harvested and stained with AF647-conjugated anti-RabG antibody (1c5). The mean fluorescence intensity (MFI) of the transfected cells was determined by flow cytometry (FC). [Diagram 3] Figure 3 shows that srRNA-based rabies vaccines can generate T cell responses in vivo (ELISpot). Shown are T cell responses measured by IFNγ ELISpot 14 days after a single dose of srRNA-RABV-G (0.15ug). Figure 3 shows the results and corresponding statistics (**<0.01) for wild type RABV-G. [Figure 4] Figure 4 shows that srRNA-based rabies vaccines can generate protective antibody responses in vivo. Neutralizing antibody responses measured by the Rapid Fluorescent Foci Inhibition Test (RFFIT) method 14 days after a single dose of srRNA-RABV-G (0.15ug) are shown. The neutralizing antibody titer of 0.5IU / ml, considered protective, is indicated by the blue line. Statistics are shown (**<0.01; *<0.05). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] The present disclosure generally relates to nucleic acid constructs expressing variants or antigenic determinants of RABV-G for both prophylactic and therapeutic treatment of rabies virus infection. These constructs address problems associated with current rabies vaccines due to the need for a regimen of three doses within a short period of time to induce immune protection and the need for periodic boosters due to poor durability of the immune response. In particular, provided herein is a gene expression system with enhanced expression capabilities suitable for expressing coding sequences of polypeptide constructs comprising the envelope glycoprotein G of rabies virus (RABV-G), variants thereof, or antigenic determinants of any thereof in recombinant cells. For example, some embodiments of the present disclosure relate to nucleic acid constructs, such as expression constructs and expression vectors, that contain a modified genome or srRNA of an alphavirus, in which at least a portion of the nucleic acid sequence of said modified alphavirus genome or srRNA that encodes a viral structural protein has been replaced with a coding sequence for a polypeptide construct that comprises the envelope glycoprotein G of rabies virus (RABV-G), a variant thereof, or an antigenic determinant of any thereof. Additionally, recombinant cells are provided that are genetically engineered to contain one or more of the nucleic acid molecules disclosed herein. Biomaterials and recombinant products resulting from such recombinant cells are also within the scope of the present application. Also provided are compositions and methods useful for inducing an immune response or treating a rabies infection in a subject in need thereof.

[0028] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0029] Although various features of the disclosure may be described in the context of a single embodiment, these features may also be provided separately or in any suitable combination. Conversely, although the disclosure may be described herein for clarity in the context of separate embodiments, the disclosure may also be implemented in a single embodiment.

[0030] definition Unless otherwise defined, all terms, symbols, and other scientific or technical terms used herein are intended to have the meaning commonly understood by those of ordinary skill in the art to which this application pertains. In some cases, terms having commonly understood meanings are defined herein for clarity and / or ease of reference, but the inclusion of such definitions herein should not necessarily be interpreted as representing a significant departure from what is commonly understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed by those of ordinary skill in the art using conventional methodology.

[0031] The singular forms "a," "an," and "the" include the plural forms unless the context clearly indicates otherwise. For example, the term "a cell" includes a plurality of cells, including a cell or a mixture thereof. "A and / or B" is used herein to include all of the following options: "A," "B," "A or B," and "A and B."

[0032] The terms "administration" and "administering," as used herein, refer to the delivery of a biologically active composition or formulation by a route of administration, including, but not limited to, intranasal, transdermal, intravenous, intraarterial, intramuscular, intralymphatic, intraperitoneal, subcutaneous, intramuscular, oral, intravaginal, and topical administration, or combinations thereof. The terms include, but are not limited to, administration by a healthcare professional and self-administration.

[0033] The terms "cell," "cell culture," and "cell line" refer not only to a particular subject cell, cell culture, or cell line, but also to the progeny or potential progeny of such a cell, cell culture, or cell line, regardless of the number of transplants or passages in culture. It should be understood that not all progeny are exactly identical to the parent cell. This is because certain changes may occur in the progeny due to mutations (e.g., deliberate or inadvertent mutations) or environmental influences (e.g., methylation or other epigenetic modifications), and thus the progeny may not in fact be identical to the parent cell, but are included within the scope of the term as used herein so long as the progeny retains the same functionality as that of the original cell, cell culture, or cell line.

[0034] The term "construct" refers to a recombinant molecule, e.g., a recombinant nucleic acid or recombinant polypeptide, that includes one or more nucleic acid or amino acid sequences from a heterologous source. For example, a polypeptide construct can be a chimeric polypeptide molecule, in which two or more amino acid sequences from different origins are operably linked together in a single polypeptide construct. Similarly, a nucleic acid construct can be a chimeric nucleic acid molecule, in which two or more nucleic acid sequences from different origins are assembled into one nucleic acid molecule. Exemplary nucleic acid constructs can include any recombinant nucleic acid molecule, linear or circular, single-stranded or double-stranded DNA or RNA nucleic acid molecule from any source, such as a plasmid, cosmid, virus, self-replicating polynucleotide molecule, phage, etc., that includes a nucleic acid molecule to which one or more nucleic acid sequences are operably linked, capable of genome integration or autonomous replication. Two or more nucleic acid constructs can be included within one nucleic acid molecule, such as one vector, or can be included within two or more separate nucleic acid molecules, such as two or more separate vectors.

[0035] The terms "effective amount", "therapeutically effective amount", or "pharmaceutical effective amount" of a composition of the present disclosure, e.g., a nucleic acid construct, srRNA, recombinant cell, and / or pharmaceutical composition, generally refer to an amount sufficient for the composition to achieve a stated purpose (e.g., achieve the effect for which it is administered, stimulate an immune response, prevent or treat a disease, or reduce one or more symptoms of a disease, disorder, infection, or condition) compared to the absence of the composition. An example of an "effective amount" is an amount sufficient to contribute to the treatment, prevention, or reduction of one or more symptoms of a disease, which may also be referred to as a "therapeutically effective amount". A "reduction" of a symptom refers to a decrease in the severity or frequency of the symptom, or the elimination of the symptom. The precise amount of the composition, including a "therapeutically effective amount", will depend on the purpose of the treatment and can be ascertained by one of skill in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).

[0036] The term "naked" is used herein to refer to a nucleic acid that is substantially free of other macromolecules, such as lipids, polymers, and proteins. A "naked" nucleic acid, such as a self-replicating RNA, is not formulated with other macromolecules to enhance cellular uptake. Thus, naked nucleic acids are not encapsulated, absorbed into, or bound to liposomes, microparticles, nanoparticles, cationic emulsions, and the like.

[0037] The term "operably linked" as used herein refers to a physical or functional linkage between two or more elements, e.g., between polypeptide sequences or polynucleotide sequences, that allows them to operate in their intended manner. For example, the term "operably linked" when used in the context of a nucleic acid molecule or a coding sequence and a promoter sequence within a nucleic acid molecule described herein means that the coding sequence and the promoter sequence are in frame and appropriately separated in space and distance to allow binding by a transcription factor or RNA polymerase, respectively, to affect transcription. It will be understood that operably linked elements can be contiguous or non-contiguous (e.g., linked to each other via a linker). In the context of a polypeptide construct, "operably linked" refers to a physical linkage (e.g., direct or indirect linkage) between amino acid sequences (e.g., between different segments, portions, regions, or domains) that results in the described activity of the construct. Operably linked segments, portions, regions, and domains of the polypeptides or nucleic acid molecules disclosed herein can be contiguous or non-contiguous (e.g., linked to each other via a linker).

[0038] The term "portion" as used herein refers to a small portion. With respect to a particular structure, such as a polynucleotide sequence or an amino acid sequence or a protein, the term "portion" may refer to a continuous or non-contiguous portion of the structure. For example, a portion of an amino acid sequence includes at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, and at least 90% of the amino acids of the amino acid sequence. Additionally or alternatively, when the portion is a non-contiguous portion, the non-contiguous portion may be composed of 2, 3, 4, 5, 6, 7, 8, or more portions of the structure (e.g., domains of a protein), each of which is a continuous element of the structure. For example, a non-contiguous portion of an amino acid sequence may consist of 2, 3, 4, 5, 6, 7, 8 or more, e.g., up to 4, portions of the amino acid sequence, each portion including at least 1, at least 2, at least 3, at least 4, at least 5 consecutive amino acids, at least 10 consecutive amino acids, at least 20 consecutive amino acids, or at least 30 consecutive amino acids of the amino acid sequence.

[0039] When a range of values ​​is listed, it is understood that each intervening value between the upper and lower limit of that range, to one-tenth of the unit of the lower limit unless otherwise indicated by context, as well as any other stated or intervening value within that stated range, is also encompassed in the disclosure. If there are specifically excluded limits in the stated range, the upper and lower limits of these smaller ranges may be independently included in each smaller range, which are also encompassed in the disclosure. If the stated range includes one or both of the limits, then ranges excluding either or both of those included limits are also encompassed in the disclosure.

[0040] In this specification, a certain range is indicated by a numerical value preceded by the term "about". The term "about" is used herein to literally support not only the exact numerical value preceded by the term, but also a numerical value close to or approximately the numerical value preceded by the term. When determining whether a numerical value is close to or approximately a numerical value specifically described, the undescribed numerical value that is close or approximately may be a numerical value that is substantially equivalent to the numerical value specifically described in the context in which the numerical value is presented. If the degree of approximation is not clear from the context, "about" means within ±10% of the value provided, or rounded to the nearest significant figure in all cases including the value provided. In some embodiments, the term "about" indicates up to ±10%, up to ±5%, or up to ±1% of the specified value.

[0041] The term "percent identity" as used herein in connection with two or more nucleic acids or proteins refers to two or more sequences or subsequences being identical or having a specified percentage of identical nucleotides or amino acids (e.g., about 60% sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity over a specified region when compared and aligned for maximum correspondence over a comparison window or specified region) when measured using the BLAST or BLAST 2.0 sequence comparison algorithm using the default parameters set forth below, or by manual alignment and visual inspection. See, e.g., the NCBI website at ncbi.nlm.nih.gov / BLAST. Such sequences are said to be "substantially identical." This definition can also refer to or apply to the complementary sequence of a sequence. This definition also includes sequences that have deletions and / or additions, as well as sequences that have substitutions. Sequence identity can be calculated using published procedures and widely available computer programs such as the GCS program package (Devereux et al, Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, FASTA (Atschul et al., J Mol Biol 215:403, 1990). Sequence identity can be measured using sequence analysis software such as the Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705, using its default parameters.

[0042] The term "pharmaceutical acceptable excipient" as used herein refers to any suitable substance that serves as a pharmaceutical acceptable carrier, additive, or diluent for administration of the desired compound to a subject. Thus, "pharmaceutical acceptable excipient" may include substances referred to as pharmaceutical acceptable diluents, substances referred to as pharmaceutical acceptable additives, and substances referred to as pharmaceutical acceptable carriers. As used herein, the term "pharmaceutical acceptable carrier" includes, but is not limited to, saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonicity agents, and absorption delaying agents, etc., that are compatible with pharmaceutical administration. Supplementary active compounds (e.g., antibiotics and additional therapeutic agents) may also be incorporated into the composition.

[0043] As used herein, a "subject" or "individual" includes animals, such as humans (e.g., human individuals), and non-human animals. In some embodiments, a "subject" or "individual" is a patient receiving medical treatment from a physician. That is, a subject may be a human patient or individual who has, is at risk of, or is suspected of having a health condition of interest (e.g., rabies infection) and / or one or more symptoms of the health condition. A subject may also be an individual who has been diagnosed at or after the time of diagnosis as being at risk for a health condition of interest. The term "non-human animal" includes all vertebrates, such as mammals, e.g., rodents, e.g., mice, non-human primates, and other mammals, such as sheep, dogs, cows, chickens, etc., as well as non-mammals, such as amphibians, reptiles, etc.

[0044] Aspects and embodiments of the disclosure described herein are understood to encompass aspects and embodiments "comprising," "consisting of," and "consisting essentially of." As used herein, "comprising" is synonymous with "including," "containing," or "characterized by," and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, "consisting of" excludes any element, step, or ingredient not specified in the claimed composition or method. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method. Any recitation of the term "comprising" herein, particularly in a description of a component of a composition or in a description of a step of a method, is understood to encompass compositions and methods that consist essentially of or consist of the recited components or steps.

[0045] All genes, gene names, and gene products disclosed herein are intended to correspond to homologs from any species to which the compositions and methods disclosed herein are applicable. That is, the above terms include, but are not limited to, genes and gene products from human and mouse origin. Where genes or gene products from a particular species are disclosed, it is understood that the disclosure is intended to be exemplary only and should not be construed as limiting unless the context in which it appears clearly indicates so. That is, for example, the genes or gene products disclosed herein, although in some embodiments directed to mammalian nucleic acid and amino acid sequences, are intended to encompass homologous and / or orthologous genes and gene products from other animals, including but not limited to other mammals, fish, amphibians, reptiles, and birds. In some embodiments, the genes, nucleic acid sequences, amino acid sequences, peptides, polypeptides, and proteins are human. The term "gene" is also intended to encompass variants thereof.

[0046] It should be understood that certain features of the present disclosure, which are described in connection with separate embodiments for clarity, may also be provided in combination in one embodiment. Conversely, various features of the present disclosure, which are described in connection with one embodiment for brevity, may also be provided separately or in any suitable subcombination. All combinations of the embodiments according to the present disclosure are specifically included in the present disclosure and are disclosed herein as if each and every combination were individually and explicitly disclosed herein. In addition, all subcombinations of the various embodiments and elements thereof are also specifically included in the present disclosure and are disclosed herein as if each and every such subcombination were individually and explicitly disclosed herein.

[0047] Alphaviruses Alphaviruses are small enveloped RNA viruses with a single-stranded positive-sense RNA genome. The alphavirus genus includes, among others, Sindbis virus (SINV), Semliki Forest virus (SFV), Ross River virus (RRV), Venezuelan equine encephalitis virus (VEEV), Eastern equine encephalitis virus (EEEV), and Western equine encephalitis virus (WEEV), which are all closely related and can infect a variety of vertebrates, such as mammals, rodents, fish, birds, and larger mammals, such as humans and horses, as well as invertebrates, such as insects. In particular, Sindbis virus and Semliki Forest virus have been extensively studied, and the life cycle, replication mode, etc. of these viruses have been well characterized.

[0048] The genome of alphaviruses is approximately 12 Kb long and consists of two open reading frames (ORFs): a 7 Kb frame encoding the nonstructural proteins (nsPs) and a 4 Kb frame encoding the structural polyprotein, which is cleaved into four distinct proteins (nsP1, nsP2, nsP3, and nsP4) required for the transcription and translation of viral mRNA in the cytoplasm of the host cell.

[0049] The nsP1 protein is an mRNA capping enzyme with both guanine-7-methyltransferase (MTase) and guanylyltransferase (GTase) activities that direct the methylation and capping of newly synthesized viral genomic and subgenomic RNAs. An MTase motif in the N-terminal domain of nsP1 catalyzes the transfer of a methyl group from S-adenosylmethionine (AdoMet) to the N7 position of a GTP molecule (m7Gppp). The GTase then binds m7Gppp, forming a covalent bond with the catalytic histidine (m7Gp-GTase) and releasing PPi. The GTase then transfers the m7Gp molecule to the 5'-diphosphate RNA, generating m7GpppNp-RNA. The resulting cap structure is essential for the translation of viral mRNA and protects this mRNA from degradation by cellular 5' exonucleases. Following this N-terminal domain are features that allow the nsP1 protein to bind to cell membranes. The presence of an α-helical amphipathic loop and a palmitoylation site allows the nsP1 protein and nsP1-containing replication complexes to be anchored to the plasma membrane, presumably through interactions of nsP1 with anionic membrane phospholipids.

[0050] The nsP2 protein has multiple enzymatic activities and functional roles. The N-terminal region contains a helicase domain with seven signature motifs of superfamily 1 (SF1) helicases. This helicase domain functions as an RNA triphosphatase, which is responsible for the initiation of the viral RNA capping reaction. This helicase domain also functions as a nucleotide triphosphatase (NTPase) to fuel the RNA helicase activity. The C-terminal region of nsP2 contains a papain-like cysteine ​​protease, which is involved in the processing of the viral nonstructural polyprotein. The protease recognizes conserved motifs within the polyprotein. This proteolytic function is highly regulated and is modulated by other domains of nsP2. The alphavirus nsP2 protein has also been described as a virulence factor involved in the shutoff of transcription and translation in infected host cells, as well as the inhibition of interferon (IFN)-mediated antiviral responses, which contribute to the control of the translation machinery by viral factors.

[0051] The precise role of the alphavirus nsP3 protein in the replication complex is less clear. Three domains have been recognized in the nsP3 protein: a large N-terminal domain with phosphatase activity and nucleic acid binding activity, an alphavirus unique domain (AUD), and a C-terminal hypervariable domain. Deletion of this domain in SFV nsP3 has been shown to result in reduced viral pathogenicity, suggesting its importance in regulating viral RNA transcription.

[0052] The nsP4 polymerase is the most highly conserved protein in alphaviruses, with the most divergent nsP4 sharing >50% amino acid sequence identity with other alphavirus nsP4s. nsP4 contains a core RNA-dependent RNA polymerase (RdRp) domain at its C-terminus that is solely responsible for the RNA synthesis properties of the viral replication complex. This RdRp is involved in negative-strand RNA-mediated replication of genomic RNA and transcription of 26S subgenomic RNA. The N-terminal domain is unique to alphaviruses and may be partially disordered.

[0053] The 5' two-thirds of the alphavirus genome encodes a number of nonstructural proteins (nSPs) required for viral RNA transcription and replication. When these proteins are directly translated from RNA, they combine with cellular proteins to form the RNA-dependent RNA polymerase essential for viral genome replication and sgRNA transcription. The four nsPs (nsP1, nsP2, nsP3, nsP4) are generated as a polyprotein and constitute the viral replication machinery. Processing of this polyprotein occurs in a highly regulated manner, and cleavage of the P2 / 3 junction site affects the use of the RNA template during genome replication. This site is located at the bottom of a narrow cleft and is not easily accessible. Once cleaved, nsP3 generates a ring structure that surrounds nsP2. These two proteins have an extensive interface. Mutations in nsP2 that produce noncytopathic viruses or temperature-sensitive phenotypes are clustered at the P2 / P3 interface region. P3 mutations opposite the location of the nsP2 noncytopathic mutations prevent efficient cleavage of P2 / 3. This in turn may affect RNA infectivity and alter the levels of viral RNA production.

[0054] The 3' third of the genome contains sgRNAs that serve as templates for the translation of all structural proteins required to form viral particles (core nucleocapsid protein C and the envelope proteins P62 and E1, which assemble as heterodimers). These viral membrane-anchored surface glycoproteins are involved in entry into target cells via receptor recognition and membrane fusion. The sgRNAs are transcribed from the p26S subgenomic promoter at the 3' end of the RNA sequence encoding the nsp4 protein. The proteolytic maturation of P62 into E2 and E3 results in changes to the viral surface. Together, E1, E2, and sometimes E3 form glycoprotein "spikes" that form E1 / E2 dimers or E1 / E2 / E3 trimers, with E2 extending from the center to each vertex, E1 filling the space between the vertices, and E3, when present, located at the distal end of the spike. When the virus is exposed to the acidity of the endosome, E1 dissociates from E2 to form the E1 homotrimer, which is required for the fusion step that brings the cellular and viral membranes together. The alphavirus glycoprotein E1 is a class II viral fusion protein, which differs in structure from the class I fusion proteins present in influenza viruses and HIV. The E2 glycoprotein functions to interact with the nucleocapsid through its cytoplasmic domain, while its ectodomain is involved in binding to cellular receptors. Most alphaviruses have lost the peripheral protein E3, but in Semlikivirus, E3 remains associated with the viral surface.

[0055] Alphavirus replication has been reported to occur on the membrane surface within the host cell. In the first step of the infection cycle, the 5' end of the genomic RNA is translated into polyproteins (nsP1-4) with RNA polymerase activity, which generate a minus strand complementary to the genomic RNA. The sequence at the 3' end of the genomic RNA plays a key role in initiating minus strand synthesis, and a minimum number of adenylate residues has been identified as essential for replication to occur. In particular, as previously reported, for alphavirus genome replication, a polyA tail of at least 11 residues following the 3'UTR must be present for efficient initiation of minus strand synthesis and, therefore, replication. Also, as previously reported, extending the polyA tail to 25 residues resulted in enhanced replication, but further extension of the polyA to 34 residues did not result in further enhancement of replication. In addition, in most cases, residues other than A within the polyA are detrimental to replication, suggesting that enzymatic polyA tail extension does not favor srRNA that do not only contain 3' adenylate residues after the 3'UTR. As previously reported, no enhancement of minus strand synthesis is observed with RNA templates with more than 25 adenylate residues in the polyA tail. In the second step of replication, this minus strand is used as a template for the production of two RNAs: (1) a positive strand genomic RNA, which corresponds to the genome of the secondary virus, which translates to produce other nsPs and serves as the genome of this virus; and (2) an sgRNA, which codes for the structural proteins of the virus that form the infectious particles. The ratio of positive strand genomic RNA / sgRNA is controlled by the proteolytic autocleavage of the polyprotein into nsP1, nsP2, nsP3, and nsP4. In fact, viral gene expression occurs in two stages. In the first stage, there is the primary synthesis of the positive strand genome and the minus strand. In the second stage, the synthesis of sgRNAs is virtually exclusive, which results in the production of a large amount of structural proteins.

[0056] self-replicating RNA As will be understood by those skilled in the art, the term "self-replicating RNA" refers to an RNA molecule that contains all of the genetic information required to direct its own self-amplification or replication in a permissive cell. To direct its own replication, srRNA typically 1) encodes a polymerase, replicase, or other protein that can catalyze the RNA amplification process by interacting with viral or host cell-derived proteins, nucleic acids, or ribonucleoproteins; and 2) contains cis-acting RNA sequences required for the replication and transcription of the subgenomic RNA (sgRNA). These sequences may be bound to its self-encoded proteins, or to non-self-encoded cell-derived proteins, nucleic acids, or ribonucleoproteins, or to a complex of any of these components during the replication process. In some embodiments of the present disclosure, alphavirus srRNA constructs typically contain the following elements: 5' viral RNA or defective interfering RNA sequences required in cis for replication, sequences encoding biologically active alphavirus nonstructural proteins (e.g., nsP1, nsP2, nsP3, and nsP4), a subgenomic promoter (sg) for the sgRNA, 3' viral sequences required in cis for replication, and, optionally, a polyadenylate tract (polyA). Optionally, a subgenomic promoter (sg) directing expression of a heterologous sequence may be included in the srRNA constructs of the present disclosure.

[0057] Furthermore, the term srRNA generally refers to a molecule of positive polarity, or "message" sense, and the srRNA may have a length that differs from that of any known naturally occurring alphavirus. In some embodiments of the present disclosure, the srRNA does not include at least a portion of the coding sequence for one or more of the alphavirus structural proteins; and / or the sequence encoding the structural gene may be replaced with a heterologous sequence. If the srRNA is to be packaged into recombinant alphavirus particles, the srRNA may include one or more sequences, so-called packaging signals, that serve to initiate interactions with alphavirus structural proteins resulting in particle formation.

[0058] The srRNA constructs of the present disclosure typically have a length of at least about 2 kb. For example, the srRNA may have a length of at least about 2 kb, at least about 3 kb, at least about 4 kb, at least about 5 kb, at least about 6 kb, at least about 7 kb, at least about 8 kb, at least about 9 kb, at least about 10 kb, at least about 11 kb, at least about 12 kb, or greater than 12 kb. In some embodiments, the srRNA is about 4 kb to about 20 kb, about 4 kb to about 18 kb, about 5 kb to about 16 kb, about 6 kb to about 14 kb, about 7 kb to about 12 kb, about 8 kb to about 16 kb, about 9 kb to about 14 kb, about 10 kb to about 18 kb, about 11 kb to about 16 kb, about 5 kb to about 18 kb, about 6 kb to about 20 kb, about 5 kb to about 10 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, The length may be about 6 kb to about 12 kb, about 6 kb to about 11 kb, about 6 kb to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 11 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 11 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, about 9 kb to about 11 kb, about 9 kb to about 10 kb, or about 10 kb to about 11 kb. In some embodiments, the srRNA may have a length of about 6 kb to about 14 kb. In some embodiments, the srRNA may have a length of about 6 kb to about 16 kb.

[0059] Rabies virus envelope glycoprotein G (RABV-G) Rabies virus is bullet-shaped, approximately 180 nm long and 75 nm in diameter. Its genome is a nonsegmented, negative-sense, single-stranded RNA. The genome encodes five structural proteins, 3'NPMG-L5'; N (nucleoprotein), P (phosphoprotein), M (matrix protein), G (glycoprotein), and L (RNA-dependent RNA polymerase). Leader and trailer untranslated regions at the 3' and 5' ends of the genome flank these structural genes, and between these protein-coding regions are noncoding intergenic sequences; NP, PM, MG, and GL.

[0060] Of these five structural proteins, G is the only protein present on the envelope and exposed to the outside. A glycoprotein is a protein that is covalently linked to sugar units. Rabies virus glycoprotein (RABV-G) is a trimeric type I transmembrane protein with a single pass, with its N-terminus extracellular to the cell membrane and its C-terminus cytoplasmic. The RABV-G precursor is 524 amino acids (aa) long (522 aa in Mokolavirus) and contains a 19 aa signal peptide at its N-terminus. The mature protein has an N-terminal ectodomain (439 aa), a transmembrane segment (22 aa), and a cytoplasmic tail / endodomain / ENDO (44 aa). The G protein covers the outer surface of the virion envelope and is therefore the only target antigen that can induce virus-neutralizing antibodies.

[0061] Compositions of the Disclosure As described in more detail below, one aspect of the disclosure relates to a nucleic acid construct comprising a modified alphavirus genome or srRNA coding sequence, wherein at least a portion of the nucleic acid sequence of said modified alphavirus genome or srRNA encoding a viral structural protein has been replaced with a coding sequence for rabies virus envelope glycoprotein G (RABV-G), a variant thereof, or a polypeptide construct comprising an antigenic determinant of any thereof. Also provided are recombinant cells and cell cultures engineered to contain the nucleic acid constructs as disclosed herein.

[0062] nucleic acid construct As described in more detail below, one aspect of the disclosure relates to a nucleic acid construct comprising a nucleic acid sequence encoding a modified genome or srRNA of an alphavirus, wherein at least a portion of the nucleic acid sequence of said modified genome or srRNA encoding a viral structural protein has been replaced with a coding sequence for rabies virus envelope glycoprotein G (RABV-G), a variant thereof, or a polypeptide construct comprising an antigenic determinant of any thereof. In some embodiments, the coding sequence of the nucleic acid construct may be operably linked, e.g., under the control of elements required for expression (e.g., promoter sequences) that allow expression of the srRNA construct in a host cell, a subject, or an ex vivo cell-free expression system.

[0063] The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably herein and refer to both RNA and DNA molecules, including cDNA, genomic DNA, synthetic DNA, and DNA or RNA molecules including nucleic acid analogs. Nucleic acid molecules can be double-stranded or single-stranded (e.g., sense or antisense). Nucleic acid molecules can contain non-conventional or modified nucleotides. The terms "polynucleotide sequence" and "nucleic acid sequence" as used herein are used interchangeably to refer to a sequence of a polynucleotide molecule. The nomenclature of nucleotide bases as set forth in 37 CFR §1.822 is used herein.

[0064] The nucleic acid molecule of the present disclosure can be of any length, for example, about 1.5 Kb to about 50 Kb, about 5 Kb to about 40 Kb, about 5 Kb to about 30 Kb, about 5 Kb to about 20 Kb, or about 10 Kb to about 50 Kb, for example, about 15 Kb to 30 Kb, about 20 Kb to about 50 Kb, about 20 Kb to about 40 Kb, about 5 Kb to about 25 Kb, or about 30 Kb to about 50 Kb.

[0065] Non-limiting and preferred embodiments of the disclosed methods may include one or more of the following features: In some embodiments, the alphavirus srRNA vector does not include at least a portion of the nucleic acid sequence encoding one or more of the viral structural proteins, CP, E1, E2, E3, and 6K of the alphavirus srRNA vector. In some embodiments, the alphavirus srRNA vector does not include a portion or all of the sequence encoding the CP. In some embodiments, the alphavirus srRNA vector does not include a portion or all of the sequence encoding E1. In some embodiments, the alphavirus srRNA vector does not include a portion or all of the sequence encoding E2. In some embodiments, the alphavirus srRNA vector does not include a portion or all of the sequence encoding E3. In some embodiments, the alphavirus srRNA vector does not include a portion or all of the sequence encoding 6K. In some embodiments, the alphavirus srRNA vector does not include a portion or all of the sequence encoding a combination of CP, E1, E2, E3, and 6K. In some embodiments of the present disclosure, the coding sequences for the nonstructural proteins nsP1, nsP2, nsP3, and nsP4 of the alphavirus srRNA vector are present, but at least a portion or all of the sequences encoding one or more structural proteins of the alphavirus srRNA vector (e.g., CP, E1, E2, E3, and 6K) are absent.

[0066] In some embodiments, the alphavirus srRNA vector does not include a substantial portion of the nucleic acid sequence encoding one or more viral structural proteins. It will be understood by those skilled in the art that a substantial portion of the nucleic acid sequence encoding a viral structural polypeptide may include sufficient nucleic acid sequence encoding a viral structural polypeptide to obtain a putative identification of the polypeptide by manual evaluation of the sequence by one of skill in the art or by computer-automated sequence comparison and identification using algorithms such as BLAST (see, e.g., "Basic Local Alignment Search Tool"; Altschul SF et al., J. Mol. Biol. 215:403-410, 1993). Thus, a substantial portion of a nucleotide sequence includes sufficient sequence to obtain specific identification and / or isolation of a nucleic acid fragment comprising the sequence. For example, a substantial portion of a nucleic acid sequence may include at least about 20%, e.g., about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% of the full-length nucleic acid sequence.

[0067] In some embodiments, the alphavirus srRNA vector does not include the entire sequences encoding viral structural proteins, eg, the alphavirus srRNA vector does not include nucleic acid sequences encoding viral structural proteins.

[0068] In some embodiments, the alphavirus srRNA vector comprises a sequence that includes CTGGAGACGTGGAGGAGAACCCTGGACCT (SEQ ID NO: 2). In some embodiments, the alphavirus vector comprises a sequence that includes GACCGCTACGCCCCAATGACCCGACCAGC (SEQ ID NO: 3). In some embodiments, the alphavirus srRNA vector comprises a sequence that includes CTGGAGACGTGGAGGAGAACCCTGGACCT (SEQ ID NO: 2) and a sequence that includes GACCGCTACGCCCCAATGACCCGACCAGC (SEQ ID NO: 3).

[0069] The nucleic acid construct of the present disclosure further comprises a coding sequence for a polypeptide construct that replaces at least a portion of the nucleic acid sequence of the modified alphavirus genome or srRNA that encodes a viral structural protein. In principle, the nucleic acid construct disclosed herein can generally comprise any number of coding sequences for a polypeptide construct. In some embodiments, the nucleic acid construct disclosed herein may comprise at least one, at least two, at least three, at least four, at least five, or at least six coding sequences for a polypeptide construct. A coding sequence for a polypeptide construct can be a construct of genetic material that contains a coding sequence and sufficient control information to direct the proper transcription and / or translation of the coding sequence in a cell in vivo and / or ex vivo. A coding sequence for a polypeptide construct can be inserted into a vector and / or into a subject to target a desired host cell. Thus, in some embodiments, the term "coding sequence for a polypeptide construct" can be used synonymously with the term "expression construct." In some embodiments, the coding sequence of a polypeptide construct may be a nucleic acid construct comprising a gene encoding a protein or functional RNA operably linked to regulatory elements, e.g., a promoter and / or a termination signal, and, optionally, any or a combination of other nucleic acid sequences that affect the transcription or translation of the gene.

[0070] The nucleic acid constructs described herein include coding sequences for the envelope glycoprotein G of rabies virus (RABV-G), variants thereof, or antigenic determinants of any thereof, encoding a polypeptide containing an epitope capable of eliciting an immune response. A variant of RABV-G may include coding sequences for a polypeptide having the same or essentially the same amino acid sequence as that of a reference protein (e.g., RABV-G), except that at least one amino acid has been modified, e.g., deleted, inserted, or substituted, respectively. The amino acid substitutions may be conservative amino acid substitutions, preferably at non-essential amino acid residues of the protein. A "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are known in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). A variant of a protein may have an amino acid sequence that is at least about 80%, at least about 90%, at least about 95%, or at least about 99%, preferably at least about 90%, more preferably at least about 95%, identical to the amino acid sequence of the protein. Preferably, a variant is a functional variant of a protein that retains the same function as the protein. The term "variant", when used in reference to a nucleic acid sequence, refers to a nucleic acid sequence that differs from another, usually related, nucleotide sequence by one or more nucleotides.Thus, the term "variant" may refer to a change in one or more nucleotides of a reference nucleic acid, including an insertion of one or more new nucleotides, a deletion of one or more nucleotides, and a substitution of one or more existing nucleotides. Variants may also include point mutations, multiple mutations, single nucleotide polymorphisms (SNPs), deletions, insertions, and translocations. Thus, variants of the coding sequences described herein include nucleic acids that encode polypeptides that may be, for example, full-length, mutated, truncated, inactivated, peptides / epitopes, or combinations thereof, of RABV-G.

[0071] The nucleic acid constructs described herein may also comprise a coding sequence for the rabies virus envelope glycoprotein G (RABV-G), or an antigenic determinant thereof. In some embodiments, the antigenic determinant is present in the N-terminal half of the rabies virus glycoprotein G. Other particular antigenic determinants are present in the C-terminal half of the rabies virus. Such antigenic determinants may be present within, for example, amino acids 1-50, 50-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-524 of the rabies virus glycoprotein G, or any interval, portion, or range thereof. In one embodiment, the antigenic determinant is located in the N-terminal half of rabies virus glycoprotein G, i.e., between about amino acid residues 19 and 422. In another embodiment, the antigenic determinant is located in the C-terminal half of rabies virus glycoprotein G, i.e., between about amino acid residues 1 and 19. In another embodiment, the rabies glycoprotein G antigenic determinant comprises amino acid residues 336 to 442. In one embodiment, the rabies glycoprotein G comprises amino acid residue 336 and alterations thereof, such as substitutions or deletions.

[0072] In some embodiments, the antigenic determinant of rabies glycoprotein G comprises one or more epitopes. Non-limiting examples of epitopes include linear epitopes, conformational epitopes, discontinuous epitopes, or combinations of such epitopes. It will be understood by those skilled in the art that the term "epitope" refers to an antigenic determinant that interacts with a specific antigen-binding site of an antigen-binding polypeptide, known as a paratope, such as the variable region of an antibody molecule. A single antigen may have more than one epitope. That is, different antibodies may bind to different regions on the antigen and may exert different biological effects. The term "epitope" also refers to a site on an antigen to which B cells respond. The term also refers to the region of an antigen to which an antibody binds. An epitope can be defined as a structural epitope or a functional epitope. A functional epitope is usually a set of structural epitopes, with residues that directly contribute to the affinity of the interaction. Epitopes can be linear or conformational, i.e., composed of non-linear amino acids, hi some embodiments, epitopes can include determinants that are chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl groups, or sulfonyl groups, and in some embodiments can have specific three dimensional structural characteristics, and / or specific charge characteristics.

[0073] In another related embodiment, the antigenic determinant of rabies glycoprotein G comprises or consists of antigenic site I, antigenic site II, antigenic site III, antigenic site IV, minor antigenic site A, or a combination of such antigenic sites, such as antigenic site III and minor antigenic site A. The antigenic sites of rabies virus were identified using a panel of monoclonal antibodies and their respective monoclonal antibody resistant virus mutants. The majority of rabies virus-neutralizing monoclonal antibodies are directed against antigenic site II (Benmansour et al., "Antigenicity of Rabies Virus Glycoprotein," J. Virol. 65:4198-4203 (1991), incorporated herein by reference), a discontinuous conformational epitope that includes aa 34-42 and aa 198-200 (Prosniak, et al. 2003. Development of a cocktail of recombinant-expressed human rabies virus-neutralizing monoclonal antibodies for postexposure prophylaxis of rabies. J. Infect. Dis. 188:53-56).Antigenic site III is a continuous conformational epitope at aa 330-338, which contains two charged residues K330 and R333 that affect viral pathogenicity (Coulon et al 1998. An avirulent mutant of rabies virus is unable to infect motoneurons in vivo and in vitro. J. Virol. 72:273-278; Dietzschold et al. 1983. Characterization of an antigenic determinant of the glycoprotein that correlates with pathogenicity of rabies virus. Proc. Natl. Acad. Sci. USA 80:70-74; Seif et al. 1985. Rabies virulence: effect on pathogenicity and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein. J. Virol. 53:926-934). Conformational antigenic site I has been defined by only one monoclonal antibody, 509-6, and is located at aa 231 (Benmansour et al., "Antigenicity of Rabies Virus Glycoprotein," J. Virol. 65:4198-4203 (1991); Lafon et al. 1983. Antigenic sites on the CVS rabies virus glycoprotein: analysis with monoclonal antibodies. J. Gen. Virol. 64:843-8451).Antigenic site IV is known to have overlapping linear epitopes (Bunschoten et al., 1989. Characterization of a new virus-neutralizing epitope that denotes a sequential determinant on the rabies virus glycoprotein. J. Gen. Virol. 70:291-298; Luo et al., 1997. A virus-neutralizing epitope on the glycoprotein of rabies virus that contains Trp251 is a linear epitope. Virus Res. 51:35-41; Ni et al., 1995. Mapping and characterization of a sequential epitope on the rabies virus glycoprotein which is recognized by a neutralizing monoclonal antibody, RG719. Microbiol. Immunol. 39:693-702). Benmansour et al. also described the presence of a minor site located at positions 342-343, which is adjacent to but distinct from antigenic site III.

[0074] The RABV-G of the nucleic acid constructs described herein can be derived from a pathogenic rabies virus strain or a non-pathogenic rabies virus strain.

[0075] Anti-rabies vaccines currently in use are vaccines made from inactivated virus or consist of pathogenicity-attenuated virus strains or recombinant viruses.

[0076] The virus can be inactivated by a variety of methods, particularly chemical methods such as treatment with formaldehyde or 3-propiolactone.

[0077] Attenuation of the pathogenicity of viral strains is well known; for example, attenuation can be achieved by serial passage of the viral strain in different hosts, vector types (e.g., rabbits or mice), or in cell culture, i.e., the strain is less pathogenic to the host due to its reduced fitness to the host source, but maintains the ability to vaccinate.

[0078] Nonpathogenic rabies strains often contain one or more mutations in the envelope glycoprotein G (see, e.g., Flamand et al., "Avirulent Mutants of Rabies Virus and Their Use as Live Vaccine," Trends Microbiol. 1(8):317-20 (1993); Coulon et al., "An Avirulent Mutant of Rabies Virus is Unable to Infect Motorneurons In Vivo and In Vitro," J. Virol. 72(1): 273-278 (1998)). For example, antigenic variants of RABV-G isolated from either the challenge virus standard strain (CVS), CVS derivatives, or the Street-Alabama-Dufferin (SAD) Bern strain, in which arginine (Arg) at position 333 in G is replaced by either glutamine (Gln), glycine (Gly), leucine, isoleucine, methionine, cysteine, or serine, are nonpathogenic (Tuffereau et al., Arginine or lysine in position 333 of ERA and CVS glycoprotein is necessary for rabies virulence in adult mice. Virology. 1989; 172: 206- 212; Seif et al., Rabies virulence: effect on pathogenicity and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein. J Virol. 1985; 53: 926-934).In addition, recombinant viruses in which Arg at position 333 in G was replaced with glutamic acid were also nonpathogenic (McGettigan et al., Second-generation rabies virus-based vaccine vectors expressing human immunodeficiency virus type 1 gag have greatly reduced pathogenicity but are highly immunogenic. J Virol. 2003; 77: 237-244). In other words, generally, RABV becomes nonpathogenic when Arg or Lys at position 333 in G is changed to another amino acid.

[0079] In principle, there is no particular limitation on the rabies virus strain that can induce the envelope glycoprotein G. Non-limiting examples of rabies virus strains suitable for the compositions and methods disclosed herein include the Flury LEP strain, the Flury LEP-C strain, the Flury HEP strain, 1088 strain, AT6 strain, CQ92 strain, CVS-11 strain, CVS-26 strain, CVS-26(G-N204S) strain, CYN1009D strain, CYN1026D strain, CYN1029D strain, CYN1138D strain, CYN1140D strain, CYN1141D strain, CYN1242H strain, CYN1243D strain, CYN1244D strain, CYN1245D strain, CYN1247D strain, CYN1249D strain, CYN1250D strain, CYN1251D strain, CYN1252D strain, CYN1253D strain, CYN1255D strain, CYN1256D strain, CYN1257D strain, CYN1259D strain, CYN1260D strain, CYN1261D strain, CYN1262D strain, CYN1263D strain, CYN1264D strain, CYN1265D strain, CYN1266D strain, CYN1267D strain, CYN1268D strain, CYN1269D strain, CYN1270D strain, CYN1271D strain, CYN1272D strain, CYN1273D strain, CYN1274D strain, CYN1275D strain, CYN1276D strain, CYN1277D strain, CYN1278D strain, CYN1279D strain, CYN1280D strain, CYN1281D strain, CYN1282D strain, CYN1283D strain, CYN1284D strain, CYN1285D strain N1257D strain, CYN1259D strain, CYN1260D strain, CYN1261D strain, GX4 strain, H-08-1320 strain, H-1413-09 strain, IP1586 / 10 strain, IP2990 / 13 strain, IP2991 / 13 strain, IP2992 / 13 strain, IP3176 / 09 Stock, IP4005 / 12 stock, IP412 / 10 stock, IP542 / 10 stock, IP7941 / 09 stock, J stock, JX-08-47 stock, JX08-48 stock, Kyoto stock, Kyoto (G-S204N) stock, N.HL stock, RC.HL stock, rHEP5.0-CVSG stock, RRV Examples of such strains include ON-99-2, SAD-B19, SH06, SHRBV-18, SNK-CTN, SRV9, Street Alabama Dufferin (HCP-SAD), VRC-RZ2, ZJ-LA, and ZJ-QZ. In some embodiments, the envelope glycoprotein G is the envelope glycoprotein G of the Flury LEP strain.

[0080] A non-limiting full-length amino acid sequence of the RABV-G protein is set forth in SEQ ID NO:1 and is as follows: MVPQVLLFVPLLGFSLCFGKFPIYTIPDKLGPWSPIDIHHLSCPNNLVVEDEGCTNLSEFSYMELKVGYISAIKVNGFTCTGVVTEAETYTNFVGYVTTTFKRKHFRPTPDACRAAYNWKMAGDPRYEESLHNPYPDYHWLRTVKTTKESLVIISPSVTDLDPYDKSLHSRVFPGGNCSGITVSTYCSTNHDYTIWMPENLRLGTSCDIFTNSRGKRASKGGKTCGFVDERGLYKSLKGACKLKLCGVLGLRLMDGTWVAMQTSDETKWCPPGQLVNLHDFRSDEIEHLVVEELVKKREECLDALESIMTTKSVSFRRLSHLRKLVPGFGKAYTIFNKTLMEADAHYKSVRTWNEIIPSKGCLRVGGRCHPHVNGVFFNGIILGSDGHVLIPEMQSSLLQQHMELLESSVIPLMHPLADPSTVFKDGDEVEDFVEVHLPDVHEQVSGVELGLPNWGKYVLMIAGALIALMLIIFLMTCCRVNRPESTQSSLGETGRNVSVTQSGKVISSWESYKSGGETRL

[0081] In some embodiments, the coding sequence for RABV-G in the nucleic acid constructs described herein encodes the amino acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid constructs of the present disclosure comprise a nucleic acid sequence encoding RABV-G that has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 1. In some embodiments, the nucleic acid constructs of the present disclosure comprise a nucleic acid sequence encoding RABV-G having the amino acid sequence of SEQ ID NO: 1, in which one, two, three, four, or five of the amino acid residues in SEQ ID NO: 1 are replaced with different amino acid residues. In some embodiments, the coding sequence for RABV-G encodes smaller portions of the amino acid sequence of SEQ ID NO: 1. For example, these smaller portions may include at least 8, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20, at least 30, or more amino acids of SEQ ID NO: 1.

[0082] In some embodiments, a nucleic acid construct as described herein comprises a nucleic acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleic acid sequence of SEQ ID NOs:6-11.

[0083] In some embodiments, the coding sequence of RABV-G is redesigned and / or optimized to obtain desired properties, e.g., increased stability, potency, and expression (e.g., translation efficiency), thereby maximizing the impact of biotherapeutic production, delivery, and administration. For example, in some embodiments, the coding sequence is optimized to be expressed at a level higher than that of a reference coding sequence. With respect to sequence optimization of a nucleotide sequence, the degeneracy of the genetic code creates the possibility of replacing at least one base of a protein coding sequence of a gene with a different base without changing the amino acid sequence of a polypeptide produced from the gene. Thus, the nucleic acid construct of the present disclosure may have any base sequence that is altered by substitution according to the degeneracy of the genetic code from any polynucleotide sequence disclosed herein. References describing codon usage are readily available in the public domain. In some embodiments, variants of polynucleotide sequences may be generated for various reasons, such as to optimize expression for a particular host (e.g., to change the codon usage in alphavirus mRNA to that preferred by other organisms, such as humans, non-human primates, hamsters, mice, or monkeys). Thus, in some embodiments, coding sequences are minimized for expression in a target host cell through the use of codons optimized for expression. Methods for constructing synthetic nucleic acid sequences encoding genes with optimal preferred codons for host cell expression may be determined by computational methods that analyze the commonality of codon usage and their relative abundance encoding native proteins in the host cell genome, using methods well known in the art. A codon usage database (http: / / www.kazusa.or.jp / codon) may be used to generate codon-optimized sequences in a mammalian cell environment.Additionally, various software tools are available to convert sequences from one organism to optimal codon usage for a different host organism, such as the JCat Codon Optimizer (www.jcat.de), the Integrated DNA Technologies (IDT) Codon Optimizer (https: / / www.idtdna.com / CodonOpt), or the Optimizer Online Codon Optimizer (http: / / genomes.urv.es / OPTIMIZER). Such synthetic sequences may be constructed by techniques known in the art for constructing synthetic nucleic acid molecules and may be obtained from a variety of commercial vendors.

[0084] In some embodiments, the coding sequence is optimized to enhance RNA stability and / or expression. RNA stability is usually related to the "half-life" of the RNA. "Half-life" refers to the period required to remove half of the activity, amount, or number of a molecule. In the context of the present disclosure, the half-life of an RNA refers to the stability of the RNA. The half-life of an RNA may affect the "duration of expression" of the RNA. Further information on principles, strategies, and methods for use in enhancing RNA stability can be found, for example, in Leppek K. et al., Combinatorial optimization of mRNA structure, stability, and translation for RNA-based therapeutics. bioRxiv. (Preprint). Mar 30, 2021. doi: 10.1101 / 2021.03.29.437587.

[0085] Recombinant cells The nucleic acid constructs of the present disclosure can be introduced into a host cell to generate a recombinant cell containing the nucleic acid molecule. Thus, prokaryotic or eukaryotic cells containing a nucleic acid construct encoding a modified alphavirus genome as described herein are also a feature of the present disclosure. In a related aspect, some embodiments disclosed herein relate to a method of transforming a cell, comprising introducing a nucleic acid construct as provided herein into a host cell, such as an animal cell, and then selecting or screening for transformed cells. Introduction of the nucleic acid constructs of the present disclosure into a cell can be accomplished by methods known to those of skill in the art, such as, for example, viral infection, transfection, conjugative transfer, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethylenimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0086] In one aspect, some embodiments of the present disclosure relate to a recombinant cell, e.g., a recombinant animal cell, comprising a nucleic acid construct as described herein. The nucleic acid construct may be stably integrated into the host genome, or may be replicated as an episome, or may be present in the recombinant host cell as a minicircle expression vector for stable or transient expression. Thus, in some embodiments of the present disclosure, the nucleic acid construct is maintained and replicated in the recombinant host cell as an episomal unit. In some embodiments, the nucleic acid construct is stably integrated into the genome of the recombinant cell. Stable integration can be achieved using classical random genetic recombination methods, or by more precise genome editing methods, such as using guide RNA-guided CRISPR / Cas9 or TALEN genome editing. In some embodiments, the nucleic acid construct is present in the recombinant host cell as a minicircle expression vector for stable or transient expression.

[0087] In some embodiments, the recombinant cell is a prokaryotic cell, such as E. coli, or a eukaryotic cell, such as an insect cell (e.g., a mosquito cell or an Sf21 cell), or a mammalian cell (e.g., a COS cell, an NIH 3T3 cell, or a HeLa cell). In some embodiments, the cell is an in vivo cell. In some embodiments, the cell is an ex vivo cell. In some embodiments, the cell is an in vitro cell. In some embodiments, the recombinant cell is a eukaryotic cell. In some embodiments, the recombinant cell is an animal cell. In some embodiments, the animal cell is a vertebrate cell or an invertebrate cell. In some embodiments, the recombinant cell is a mammalian cell. Suitable recombinant cells include SV40 transformed monkey kidney CV1 cells (COS-7), human embryonic kidney cells (e.g., HEK293 or HEK293 cells), baby hamster kidney cells (BHK), mouse Sertoli cells (e.g., TM4 cells), monkey kidney cells (CV1), human cervical carcinoma cells (HeLa), canine kidney cells (MDCK), buffalo rat liver cells (BRL3A), human lung cells (W138), human liver cells (Hep G2), mouse mammary tumor (MMT060562), TRI cells, FS4 cells, Chinese hamster ovary cells (CHO cells), African green monkey kidney cells (Vero cells), human A549 cells, human cervical cells, human CHME5 cells, human PER.C6 cells, NS0 mouse myeloma cells, human laryngeal epidermoid cells, human fibroblast cells, human HUH-7 cells, human MRC-5 cells, human muscle cells, human endothelial cells, human astrocyte cells, human macrophage cells, human RAW264.7 cells, mouse 3T3 cells, mouse L929 cells, mouse connective tissue cells, mouse muscle cells, and rabbit kidney cells.

[0088] In some embodiments, the recombinant cell is an insect cell, such as a cell of an insect cell line. In some embodiments, the recombinant cell is an Sf21 cell. Additional suitable insect cell lines include, but are not limited to, cell lines established from insect Diptera, Lepidoptera, and Hemiptera, and can be obtained from a variety of tissue sources. In some embodiments, the recombinant cell is a cell of a lepidopteran insect cell line. Over the past few decades, the availability of lepidopteran insect cell lines has increased at a rate of about 50 lines / decade. Further information on available lepidopteran insect cell lines can be found, for example, in Lynn DE, Available lepidopteran insect cell lines. Methods Mol Biol. 2007;388:117-38, which is incorporated herein by reference. In some embodiments, the recombinant cell is a mosquito cell, e.g., a cell of a mosquito species included in the genera Anopheles (An.), Culex (Cx.), and Aedes (Ae.). Exemplary mosquito cell lines suitable for the compositions and methods described herein include cell lines obtained from the following mosquito species: Aedes aegypti, Aedes albopictus, Aedes pseudoscutellaris, Aedes triseriatus, Aedes vexans, Anopheles gambiae, Anopheles stephensi, Anopheles albimanus, Culex quinquefasciatus, Culex theileri, Culex tritaeniorhynchus, Culex quinquefasciat ... bitaeniorhynchus, and Toxorhynchites amboinensis.Suitable mosquito cell lines include, but are not limited to, CCL-125, Aag-2, RML-12, C6 / 26, C6 / 36, C7-10, AP-61, AtGRIP-1, AtGRIP-2, UM-AVE1, Mos.55, Sua1B, 4a-3B, Mos.43, MSQ43, and LSB-AA695BB. In some embodiments, the mosquito cell is a cell of the C6 / 26 cell line.

[0089] In another aspect, provided herein is a cell culture comprising at least one recombinant cell as disclosed herein and a medium. Typically, the medium may be any medium suitable for culturing the cells described herein. Techniques for transforming the various host cells and species mentioned above are known in the art and described in the technical and scientific literature. Thus, also within the scope of the present application is a cell culture comprising at least one recombinant cell as disclosed herein. Suitable methods and systems for producing and maintaining cell cultures are known in the art.

[0090] Recombinant polypeptides produced by the methods disclosed herein are also within the scope of the disclosure.

[0091] Non-limiting and preferred embodiments of the disclosed methods for producing a recombinant polypeptide can include one or more of the following features: In some embodiments, the disclosed methods for producing a recombinant polypeptide further include isolating and / or purifying the produced polypeptide. In some embodiments, the disclosed methods for producing a polypeptide further include structurally modifying the produced polypeptide to extend its half-life.

[0092] Pharmaceutical Compositions The nucleic acid constructs, recombinant cells, recombinant polypeptides of the present disclosure may be incorporated into compositions, including pharmaceutical compositions. Such compositions typically include one or more of the nucleic acid constructs, recombinant cells, recombinant polypeptides described and provided herein and a pharma- ceutically acceptable excipient, such as a carrier. In some embodiments, the compositions of the present disclosure are formulated for the prevention, treatment, or management of rabies infections. For example, the compositions of the present disclosure may be formulated as prophylactic compositions, therapeutic compositions, or pharmaceutical compositions that include a pharma- ceutically acceptable excipient or mixtures thereof. In some embodiments, the compositions of the present disclosure are formulated for use as a vaccine. In some embodiments, the compositions of the present application are formulated for use as an adjuvant.

[0093] Thus, in one aspect, provided herein is a pharmaceutical composition comprising a pharma- ceutical acceptable excipient and a) a nucleic acid construct of the present disclosure; b) a recombinant cell of the present disclosure; and / or c) a recombinant polypeptide of the present disclosure.

[0094] Non-limiting and preferred embodiments of the pharmaceutical composition of the present disclosure may include one or more of the following features: The nucleic acid construct of the present disclosure may be used in naked form or may be formulated with a delivery vehicle. Exemplary routes include using in free form, e.g., nucleic acid, e.g., inserted into a vector. For example, as described in more detail below, the nucleic acid construct as described herein may be used as a vaccine.

[0095] For use in the pharmaceutical compositions of the present disclosure, the nucleic acid or recombinant cells as described herein may be formulated in or with a delivery vehicle. Exemplary delivery vehicles suitable for the compositions and methods of the present disclosure include, but are not limited to, liposomes (e.g., neutral or anionic liposomes), microspheres, immune stimulating complexes (ISCOMS), lipid nanoparticles (LNPs), polymeric nanoparticles, viral replicon particles (VRPs), or conjugated with bioactive ligands that can facilitate delivery and / or enhance immune responses. These compounds are readily available to those skilled in the art; see, for example, Liposomes: A Practical Approach, RCP New Ed, IRL press (1990). Adjuvants other than liposomes and the like are also used and known in the art. Adjuvants may protect antigens (e.g., srRNA constructs) from rapid dispersion by sequestering them in a localized precipitate, or may contain substances that stimulate the host to secrete immune system components, such as macrophage chemotactic factors. A suitable selection, for example from the following, can be made by one skilled in the art:

[0096] Thus, in some embodiments, a composition of the present disclosure may comprise one or more of the following: a physiological buffer, a liposome, a lipid nanoparticle (LNP), a polymeric nanoparticle, a viral replicon particle (VRP), a microsphere, an immune stimulating complex (ISCOM), a conjugate of a biologically active ligand, or any combination thereof.

[0097] In some embodiments, the nucleic acid construct of the present disclosure may be delivered to cells or subjects by lipid nanoparticles (LNPs). LNPs are generally less immunogenic than viral particles. Many people have pre-existing immunity to viral particles, but not to LNPs. In addition, adaptive immune responses to LNPs are unlikely to occur, which allows repeated administration of LNPs.

[0098] Lipids suitable for the compositions and methods described herein can be cationic lipids, ionizable cationic lipids, anionic lipids, or neutral lipids.

[0099] In some embodiments, the LNPs of the present disclosure may include one or more ionizable lipids. As used herein, the term "ionizable lipid" refers to a lipid that becomes cationic or ionic (protonated) when the pH is lower than the pKa of the ionizable group of the lipid, but becomes neutral at higher pH values. At pH values ​​below the pKa, the lipid is capable of associating with negatively charged nucleic acids (e.g., oligonucleotides). As used herein, the term "ionizable lipid" encompasses lipids that assume a positive charge when the pH is lowered from physiological pH, and any of a number of lipid species that carry a net positive charge at a selected pH, such as physiological pH. Permanently cationic lipids, such as DOTMA, have been found to be too toxic for clinical use. Ionizable lipids may be present in the lipid formulation in other embodiments, preferably in the range of about 30 to about 70 mol% in some embodiments, about 30 mol% in other embodiments, about 40 mol% in other embodiments, about 45 mol% in other embodiments, about 47.5 mol% in other embodiments, about 50 mol% in still other embodiments, and about 60 mol% in still other embodiments ("mol%" refers to the percentage of the total moles of a particular component). The term "about" in this paragraph refers to a range of ±5 mol%. DODMA, i.e. 1,2-dioleyloxy-3-dimethylaminopropane, is an ionizable lipid, as is DLin-MC3-DMA or 0-(Z,Z,Z,Z-heptatriaconta-6,9,26,29-tetraen-19-yl)-4-(N,N-dimethylamino) ("MC3").

[0100] Exemplary ionizable lipids suitable for the compositions and methods of the present disclosure include those described in WO2020252589 and WO2021000041, U.S. Patent Nos. 8,450,298 and 10,844,028, and Love KT et al., Proc Natl Acad Sci USA, Feb. 2, 2010 107 (5) 1864-1869, all of which are incorporated herein by reference in their entirety. Thus, in some embodiments, the LNPs of the present disclosure comprise one or more lipid compounds described in Love KT et al. 2010, supra, such as C16-96, C14-110, and C12-200. In some embodiments, the LNPs comprise ionizable cationic lipids. Suitable ionizable cationic lipids include the group consisting of ALC-0315, C12-200, LN16, MC3, MD1, SM-102, and any combination thereof. In some embodiments, the LNPs of the present disclosure include C12-200. The structure of C12-200 lipids is known in the art and described, for example, in U.S. Pat. Nos. 8,450,298 and 10,844,028, which are incorporated herein by reference in their entirety. In some embodiments, the C12-200 is combined with cholesterol, C14-PEG2000, and DOPE. In some embodiments, the C12-200 is combined with DSPC and DMG-PEG2000.

[0101] In some embodiments, the LNPs of the present disclosure comprise one or more cationic lipids. Suitable cationic lipids include, but are not limited to, 98N12-5, C12-200, C14-PEG2000, DLin-KC2-DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1, and 7C1. In some embodiments, the LNPs of the present disclosure comprise one or more neutral lipids. Non-limiting neutral lipids suitable for the compositions and methods of the present disclosure include DPSC, DPPC, POPC, DOPE, and SM. In some embodiments, the LNPs of the present disclosure comprise one or more ionizable lipid compounds described in International Publication Nos. WO2020252589 and WO2021000041, which are incorporated by reference in their entirety.

[0102] Any number of other lipids or combinations of lipids known in the art can be used to generate LNPs. Non-limiting examples of lipids suitable for use in generating LNPs include DOTMA, DOSPA, DOTAP, DMRIE, DC-cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE, and GL67A-DOPE-DMPE-polyethylene glycol (PEG). Non-limiting examples of cationic lipids include 98N12-5, C12-200, C14-PEG2000, DLin-KC2-DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1, 7C1, and any combination thereof. Non-limiting examples of neutral lipids include DPSC, DPPC, POPC, DOPE, and SM. Non-limiting examples of PEG-modified lipids include PEG-DMG, PEG-CerC14, and PEG-CerC20.

[0103] In some embodiments, the LNPs of the present disclosure include at least one lipid. Suitable lipids include C12-200, C14-PEG2000, DOPE, DMG-PEG2000, DSPC, DOTMA, DOSPA, DOTAP, DMRIE, DC-cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE, and GL67A-DOPE-DMPE-polyethylene glycol (PEG). In some embodiments, the C12-200 is combined with cholesterol, C14-PEG2000, and DOPE. In some embodiments, the C12-200 is combined with DSPC and DMG-PEG2000.

[0104] In some embodiments, the mass ratio of lipid to nucleic acid in the LNP delivery system is about 100:1 to about 3:1, about 70:1 to 10:1, or 16:1 to 4:1. In some embodiments, the mass ratio of lipid to nucleic acid in the LNP delivery system is about 16:1 to 4:1. In some embodiments, the mass ratio of lipid to nucleic acid in the LNP delivery system is about 20:1. In some embodiments, the mass ratio of lipid to nucleic acid in the LNP delivery system is about 8:1. In some embodiments, the lipid nanoparticles have an average diameter of less than about 1000 nm, less than about 500 nm, less than about 250 nm, less than about 200 nm, less than about 150 nm, less than about 100 nm, less than about 75 nm, less than about 50 nm, or less than about 25 nm. In some embodiments, the LNPs have an average diameter in the range of about 70 nm to 100 nm. In some embodiments, the LNPs have an average diameter ranging from about 88 nm to about 92 nm, 82 nm to about 86 nm, or about 80 nm to about 95 nm.

[0105] In some embodiments, the compositions of the present disclosure are formulated as liposomes. In some embodiments, the compositions of the present disclosure are formulated as lipid nanoparticles (LNPs). In some embodiments, the compositions of the present disclosure are formulated as polymer nanoparticles.

[0106] As mentioned above, neural lipids, also known as "structured lipids" or "helper lipids", may also be incorporated into lipid formulations and lipid particles in some embodiments. Lipid formulations and lipid particles may include one or more structured lipids at about 10-40 mol% of the composition. Suitable structured lipids support the formation of particles during manufacture. Structured lipids refer to any one of a number of lipid species that exist in either anionic, uncharged, or neutral zwitterionic form at physiological pH. Exemplary structured lipids include diacylphosphatidylcholine, diacylphosphatidylethanolamine, diacylphosphatidylglycerol, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, and cerebrosides.

[0107] Exemplary structured lipids include zwitterionic lipids, such as distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, and 18-1-trans PE. PE), 1-stearoyl-2-oleoyl-phosphatidyethanol amine (SOPE), and 1,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (trans-DOPE).

[0108] In another embodiment, the structured lipid can be any lipid that has a negative charge at physiological pH.These lipids include phosphatidylglycerol, such as dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylglycerol (POPG), cardiolipin, phosphatidylinositol, diacylphosphatidylserine, diacylphosphatidic acid, and other anionic modifying groups attached to neutral lipids.Other suitable structured lipids include glycolipids (e.g., monosialoganglioside GM1).

[0109] To ensure the integrity of the mixture, embodiments of the lipid formulation may include a stabilizer. Stabilizers are a class of molecules that disrupt or aid in the formation of hydrophobic-hydrophilic interactions between molecules. Suitable stabilizers include, but are not limited to, polysorbate 80 (also known as Tween 80, 1UPAC name 2-[2-[3,4-bis(2-hydroxyethoxy)oxolan-2-yl]-2-(2-hydroxyethoxy)ethoxy]ethyl octadec-9-enoate), Myrj52 (polyoxyethylene(40) stearate), and Brij™ S10 (polyoxyethylene(10) stearyl ether). Polyethylene glycol-linked lipids may also be used. These stabilizers may be used alone or in combination with each other.

[0110] In some embodiments, the stabilizer comprises about 0.1-3 mol% of the total lipid mixture. In some embodiments, the stabilizer comprises about 0.5-2.5 mol% of the total lipid mixture. In some embodiments, the stabilizer is present at greater than 2.5 mol%. In some embodiments, the stabilizer is present at 5 mol%. In some embodiments, the stabilizer is present at 10 mol%. In some embodiments, the stabilizer is about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, etc. In other embodiments, the stabilizer is present at 2.6-10 mol% of the lipid mixture. In other embodiments, the stabilizer is present at greater than 10 mol% of the lipid mixture.

[0111] For certain applications, steroids may be included in the lipid composition, and lipid particles made therefrom include sterols, such as cholesterol and phytosterols.

[0112] In some embodiments, the therapeutic compositions described herein, e.g., nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions, are incorporated into a therapeutic composition for use in a method of preventing or treating a subject having or suspected of having a rabies infection, which may have been bitten by an animal having or suspected of having a rabies infection, such as a raccoon, skunk, fox, coyote, bat, dog, cat, etc.

[0113] In some embodiments, the composition is an immunogenic composition, e.g., a composition capable of stimulating an immune response in a subject. In some embodiments, the immunogenic composition is formulated as a vaccine. In some embodiments, the pharmaceutical composition is formulated as an adjuvant. In some embodiments, the immunogenic composition is formulated as a biotherapeutic agent, e.g., as a vehicle for gene delivery of different biologically active molecules. Non-limiting examples of biotherapeutic agents include cytokines, chemokines, and other soluble immunomodulators, enzymes, peptide and protein agonists, peptide and protein antagonists, hormones, receptors, antibodies and antibody derivatives, growth factors, transcription factors, and gene silencing / editing molecules. In some embodiments, the pharmaceutical composition is formulated as an adjuvant.

[0114] In some embodiments, an immunogenic composition is substantially non-immunogenic or minimally immunogenic (e.g., a composition that minimally stimulates an immune response in a subject. In some embodiments, a non-immunogenic or minimally immunogenic composition is formulated as a biotherapeutic. In some embodiments, a pharmaceutical composition is formulated for one or more of intranasal, transdermal, intraperitoneal, intramuscular, intralymphatic, intratumoral, intraarticular, intravenous, subcutaneous, intravaginal, and oral administration.

[0115] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). In these cases, the composition should be sterile and fluid to the extent that it exhibits easy syringability. The composition can be stable under the conditions of manufacture and storage and can be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants, for example, sodium dodecyl sulfate. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, the composition will usually include an isotonic agent, such as sugar, polyalcohol such as mannitol, sorbitol, sucrose, trehalose, and / or sodium chloride. In some embodiments, the composition includes tris and sucrose. Prolonged absorption of the injectable composition can be achieved by including in the composition an agent that delays absorption, such as aluminum stearate and gelatin.

[0116] Sterile injectable solutions can be prepared by mixing the required amount of the active compound in an appropriate solvent with one or a combination of ingredients as required above, followed by filtered sterilization. Usually, dispersions are prepared by mixing the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.

[0117] In some embodiments, the composition is formulated for one or more of intranasal, transdermal, intramuscular, intralymphatic, intravenous, intraperitoneal, oral, or intracranial administration.

[0118] Methods of the Disclosure Administration of any one of the therapeutic compositions described herein, e.g., nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions, can be used in the treatment of related health conditions, such as rabies virus infection. In some embodiments, the nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions as described herein can be useful for inducing an immune response in a subject in need thereof. In some embodiments, the nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions as described herein can be incorporated into a therapeutic agent for use in a method of treating a subject having, suspected of having, or potentially at risk of developing a rabies infection. In some embodiments, the subject is a patient receiving medical treatment from a physician.

[0119] Thus, in one aspect, provided herein is a method for inducing an immune response in a subject in need thereof, comprising administering to the subject a composition comprising: a) a nucleic acid construct of the present disclosure; b) a recombinant cell of the present disclosure; c) a recombinant polypeptide of the present disclosure; and / or d) a pharmaceutical composition of the present disclosure.

[0120] In some embodiments, the immune response comprises a T cell response. The T cell response may comprise the production of interferon gamma (IFNγ). The production of IFNγ may be measured using several methods known in the art, including but not limited to, an ELISpot assay.

[0121] In some embodiments, the immune response is a neutralizing antibody response. A neutralizing antibody response is an immune response in which specialized cells of the immune system recognize a presentation of an antigen and generate a specific immune response to prevent infection of a target cell from a pathogen, such as a virus (e.g., rabies virus). Methods for detecting a neutralizing antibody response are known in the art and may include, for example, assays such as those described in the Examples herein. For example, a neutralizing antibody response may be measured by the RFFIT method 14 days after a single administration of a nucleic acid construct disclosed herein. A neutralizing antibody response may also be demonstrated by injecting an animal, such as a mouse or a non-human primate, with an srRNA construct described herein and testing the ability of serum obtained from the animal to neutralize the ability of the virus to infect cells. In some embodiments, a neutralizing antibody response comprises a neutralizing antibody titer of 0.5 IU / mL or greater.

[0122] In another aspect, provided herein is a method for preventing and / or treating a rabies infection in a subject in need thereof, comprising administering to said subject a) a nucleic acid construct of the present disclosure; b) a recombinant cell of the present disclosure; c) a recombinant polypeptide of the present disclosure; and / or d) a composition comprising any one of the pharmaceutical compositions of the present disclosure for prophylactic or therapeutic purposes.

[0123] In some embodiments, the compositions of the present disclosure are formulated to be compatible with their intended route of administration. For example, the nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions of the present disclosure may be given orally, by inhalation, or via a parenteral route. Examples of parenteral routes of administration include, for example, intramuscular, intraocular, intravenous, intralymphatic, intradermal, subcutaneous, transdermal (topical), transmucosal, intravaginal, and intrarectal administration. In some embodiments, the compositions are administered intramuscularly. Solutions or suspensions used for parenteral application may contain the following components: a sterile diluent such as water for injection, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparaben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, or phosphates, tris, sucrose, and tonicity adjusters such as sodium chloride or glucose. The pH can be adjusted (e.g., to about pH 7.2-7.8, e.g., pH 7.5) with acids or bases such as mono- and / or di-sodium phosphate, hydrochloric acid, or sodium hydroxide. Parenteral preparations can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass or plastic.

[0124] The therapeutic compositions, e.g., nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions described herein, may be administered one or more times per day to one or more times per week; including once every other day. Treatment of a subject with a therapeutically effective amount of a nucleic acid construct, recombinant cell, recombinant polypeptide, and / or pharmaceutical composition of the subject matter of the present disclosure may include one treatment or may include a series of treatments. In some embodiments, the compositions are administered weekly, e.g., 1-2, 2-3, or 3-4 administrations at intervals of 1-2 weeks, 2-3 weeks, or 3-4 weeks. Additional administrations may then be administered every month, 2 months, 3 months, or 4 months. In some embodiments, three intramuscular administrations are administered at intervals of 3-8 weeks, followed by intramuscular administrations every 3 months, 6 months, 9 months, or 12 months. Additional administrations may then be administered every year, 2 years, 3 years, or 4 years. With respect to nucleic acid constructs and recombinant polypeptides, a therapeutically effective amount (eg, an effective pharmaceutical amount) of a nucleic acid construct or recombinant polypeptide of the present disclosure will depend on the nucleic acid construct or recombinant polypeptide selected.

[0125] As discussed above, a therapeutically effective amount includes an amount of a therapeutic composition sufficient to promote a particular effect when administered to a subject, such as a subject having, suspected of having, or at risk for a health condition, e.g., a rabies infection. In some embodiments, an effective amount includes an amount sufficient to prevent or delay the onset of a disease symptom, alter the course of a disease symptom (such as, but not limited to, to slow the progression of a disease symptom), or reverse a disease symptom.

[0126] A treatment is considered effective if at least any one or all of the signs or symptoms of the disease are improved or ameliorated. Efficacy can also be measured by the individual not getting worse (e.g., the progression of the disease is stopped or at least slowed) as assessed by the need for hospitalization or medical intervention. Methods for measuring these indicators are known to those of skill in the art and / or described herein. Treatment includes any treatment of a disease in a subject or animal (some non-limiting examples include humans or mammals), including (1) inhibiting the disease, e.g., stopping or slowing the progression of a symptom; or (2) relieving the disease, e.g., causing regression of a symptom; and (3) inhibiting the onset of a symptom or reducing the likelihood of onset of a symptom.

[0127] In some embodiments, the ability of the compositions, e.g., nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions described herein to function in treating rabies infection may be tested in appropriate animal model systems prior to use in humans. Such animal model systems include, but are not limited to, mice, rats, hamsters, monkeys, etc. This may be measured by the ability to protect against disease and death due to rabies virus infection by post-exposure prophylactic vaccination.

[0128] In some embodiments, a rabies virus strain as described herein is used to expose an animal that is subsequently administered a composition, e.g., a nucleic acid construct, a recombinant cell, a recombinant polypeptide, and / or a pharmaceutical composition, described herein. Exemplary rabies virus strains include the Flury LEP strain, the Flury LEP-C ... HEP strain, 1088 strain, AT6 strain, CQ92 strain, CVS-11 strain, CVS-26 strain, CVS-26(G-N204S) strain, CYN1009D strain, CYN1026D strain, CYN1029D strain, CYN1138D strain, CYN1140D strain, CYN1141D strain, CYN1242H strain, CYN1243D strain, CYN1244D strain, CYN1245D strain, CYN1247D strain, CYN1249D strain, CYN1250D strain, CYN1251D strain, CYN1252D strain, CYN1253D strain, CYN1255D strain, CYN1256D strain, CYN1257D strain, CYN1259D strain, CYN1260D strain, CYN1261D strain, CYN1262D strain, CYN1263D strain, CYN1264D strain, CYN1265D strain, CYN1266D strain, CYN1267D strain, CYN1268D strain, CYN1269D strain, CYN1270D strain, CYN1271D strain, CYN1272D strain, CYN1273D strain, CYN1274D strain, CYN1275D strain, CYN1276D strain, CYN1277D strain, CYN1278D strain, CYN1279D strain, CYN1280D strain, CYN1281D strain, CYN1282D strain, CYN1283D strain, CYN1284D strain, CYN1285D strain N1257D strain, CYN1259D strain, CYN1260D strain, CYN1261D strain, GX4 strain, H-08-1320 strain, H-1413-09 strain, IP1586 / 10 strain, IP2990 / 13 strain, IP2991 / 13 strain, IP2992 / 13 strain, IP3176 / 09 Stock, IP4005 / 12 stock, IP412 / 10 stock, IP542 / 10 stock, IP7941 / 09 stock, J stock, JX-08-47 stock, JX08-48 stock, Kyoto stock, Kyoto (G-S204N) stock, N.HL stock, RC.HL stock, rHEP5.0-CVSG stock, RRV Examples of rabies virus include, but are not limited to, ON-99-2, SAD-B19, SH06, SHRBV-18, SNK-CTN, SRV9, Street Alabama Dufferin (HCP-SAD), VRC-RZ2, ZJ-LA, and ZJ-QZ. In some embodiments, the rabies virus used is Challenge Virus Standard (CVS)-11.

[0129] As an example, animals are infected with a rabies virus strain and administered a composition described herein, e.g., a nucleic acid construct, a recombinant cell, a recombinant polypeptide, and / or a pharmaceutical composition, on days 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and / or 14 post-infection. In some embodiments, the composition is in a LNP formulation. In some embodiments, the addition of human rabies immune globulin (HRIG) or a similar rabies neutralizing immune globulin (e.g., equine rabies immune globulin, ERIG) may be combined with the srRNA treatment. In some embodiments, the recommended dose (20 IU / kg body weight of HRIG or 40 IU / kg body weight of ERIG) is administered. Animals are monitored daily for signs of disease until approximately 35 days post-inoculation (DPI) or loss of control in untreated groups. Rabies virus infection may be monitored by real-time reverse transcriptase-mediated polymerase chain reaction (RT-qPCR) or by using direct fluorescent antibody (DFA) testing to determine rabies virus staining in fixed tissues according to standard methods.

[0130] In some embodiments, the nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions of the present disclosure may be administered to a subject in a composition comprising a pharma- ceutically acceptable carrier and in an amount effective to stimulate an immune response. Typically, a subject is immunized through an initial series of injections (or administration via one of the other routes described below), after which a booster may be given to augment the protection provided by the initial series. This initial series of injections and subsequent boosters are administered at dosages and for periods of time necessary to stimulate an immune response in the subject. In some embodiments of the methods of the present disclosure, the subject is a mammal. In some embodiments, the mammal is a human subject. As noted above, pharma- ceutically acceptable carriers suitable for injectable use include sterile aqueous solutions (if water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In these cases, the compositions must be sterile and fluid to the extent that they exhibit easy passability through a needle. The compositions must further be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating material, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.

[0131] Sterile injectable solutions can be prepared by mixing the required amount of nucleic acid constructs, recombinant cells, and / or recombinant polypeptides in an appropriate solvent with one or a combination of above ingredients, as required, followed by filtered sterilization.

[0132] The nucleic acid construct, recombinant cell, recombinant polypeptide, and / or pharmaceutical composition, when properly protected, may be orally administered, for example, with an inert diluent or an assimilable edible carrier, as described above. The nucleic acid construct, recombinant cell, recombinant polypeptide, and / or pharmaceutical composition, and other ingredients, may also be enclosed in hard or soft shell gelatin capsules, compressed into tablets, or mixed directly into the individual's diet. For oral therapeutic administration, the active compound may be mixed with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.

[0133] Further treatments In some embodiments, the compositions of the present disclosure are administered to a subject individually as a single prophylactic or therapeutic method (monotherapy) or in combination with at least one additional therapeutic method (e.g., a second therapeutic method) as a first therapeutic method. In some embodiments, the second therapeutic method is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, targeted therapy, and surgery. In some embodiments, the second therapeutic method is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, or surgery. In some embodiments, the first therapeutic method and the second therapeutic method are administered simultaneously. In some embodiments, the first therapeutic method is administered simultaneously with the second therapeutic method. In some embodiments, the first therapeutic method and the second therapeutic method are administered sequentially. In some embodiments, the first therapeutic method is administered before the second therapeutic method. In some embodiments, the first therapeutic method is administered after the second therapeutic method. In some embodiments, the first therapeutic method is administered before and / or after the second therapeutic method. In some embodiments, the first therapeutic method and the second therapeutic method are administered sequentially. In some embodiments, the first and second therapies are administered together in a single formulation.

[0134] kit Also provided herein are various kits for practicing the methods described herein, as well as written instructions for making and using the same. In particular, some embodiments of the present disclosure provide kits for inducing an immune response in a subject. Some other embodiments relate to kits for methods of treating cancer in a subject in need of such treatment. For example, in some embodiments, kits are provided herein that include one or more of the nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions as provided and described herein, and written instructions for making and using the same.

[0135] In some embodiments, the kit of the present disclosure further comprises one or more means useful for administering any one of the provided nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions to a subject.For example, in some embodiments, the kit of the present disclosure further comprises one or more syringes (including pre-filled syringes) and / or catheters (including pre-filled syringes) that are used to administer any one of the provided nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions to a subject.In some embodiments, the kit may have one or more additional therapeutic agents that can be administered simultaneously or sequentially with other kit components for a desired purpose, for example, to diagnose, prevent, or treat a condition in a subject in need of the diagnosis, prevention, or treatment of the condition.

[0136] Any of the foregoing kits may further comprise one or more additional reagents, which may be selected from the following: dilution buffers, reconstitution solutions, wash buffers, control reagents, control expression vectors, negative controls, positive controls, reagents suitable for the in vitro production of the nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions of the present disclosure provided.

[0137] In some embodiments, the components of the kit may be in separate containers. In some other embodiments, the components of the kit may be combined in a single container. Thus, in some embodiments of the present disclosure, the kit includes one or more of the nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions as provided and described herein in one container (e.g., in a sterile glass or plastic vial) and an additional therapeutic agent in another container (e.g., in a sterile glass or plastic vial).

[0138] In another embodiment, the kit comprises a combination of compositions described herein including one or more nucleic acid constructs, recombinant cells, and / or recombinant polypeptides of the present disclosure, optionally in a pharmaceutical composition, combined with one or more additional therapeutic agents, formulated together in a single common container.

[0139] Where the kit includes a pharmaceutical composition for parenteral administration to a subject, the kit may include a device for performing such administration (e.g., an injection device or catheter). For example, the kit may include one or more hypodermic needles or other injection devices as described above, containing one or more of the nucleic acid constructs, recombinant cells, and / or recombinant polypeptides of the disclosure.

[0140] In some embodiments, the kit may further include instructions for carrying out the methods disclosed herein using the components of the kit. For example, the kit may include a package insert containing information about the pharmaceutical compositions and dosage forms in the kit. Typically, such information will assist patients and physicians in effectively and safely using the enclosed pharmaceutical compositions and dosage forms. For example, the following information about the combinations disclosed herein may be supplemented in the package insert: pharmacokinetics, pharmacodynamics, clinical studies, efficacy parameters, indications and usage, contraindications, warnings, precautions, adverse reactions, overdosage, appropriate dosage and administration, dosage forms, appropriate storage conditions, literature references, manufacturer / distributor information, and intellectual property information.

[0141] The instructions for carrying out the above-described methods are typically recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic. The instructions may be present in the kit as a package insert, in the label of the container of the kit or its components (e.g., associated with packaging or subpackaging), etc. The instructions may be present as an electronic storage data file present on a suitable computer-readable storage medium, such as a CD-ROM, diskette, flash drive, etc. In some cases, the actual instructions are not present in the kit, and a means for obtaining the instructions from a remote source (e.g., via the Internet) may be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions may be written on a suitable substrate.

[0142] All publications and patent applications mentioned in this disclosure are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0143] No admission is made that any reference cited herein constitutes prior art. The discussion of a reference states what its author asserts, and applicants reserve the right to challenge the accuracy and pertinence of the cited documents. Although a number of sources of information, including scientific journal articles, patent documents, and textbooks, have been referenced herein, it will be expressly understood that this reference is not an admission that any of these documents form part of the common general knowledge in the art.

[0144] The general method discussion provided herein is intended for illustrative purposes only: other alternative methods and substitutes will be apparent to those of skill in the art upon review of this disclosure, and are intended to be within the spirit and scope of this application.

[0145] Further embodiments are disclosed in more detail in the following examples, which are provided by way of illustration and are not intended to limit the scope of the disclosure or claims in any way. EXAMPLES

[0146] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology, which are well known to those of skill in the art. Such techniques are described in Sambrook, J., & Russell, DW (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russell, DW (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (jointly referred to herein as “Sambrook”); Ausubel, FM (1987). Current Protocols in Molecular Biology. New York, NY: Wiley (including supplements through 2014); Bollag, DM et al. (1996). Protein Methods. New York, NY: Wiley-Liss; Huang, L. et al. (2005). Nonviral Vectors for Gene Therapy. San Diego: Academic Press; Kaplitt, MG et al. (1995). Viral Vectors: Gene therapy and Neuroscience Applications. San Diego, CA: Academic Press; Lefkovits, I. (1997). The Immunology Methods Manual: The Comprehensive Sourcebook of Techniques. San Diego, CA: Academic Press; Doyle, A. et al. (1998).Cell and Tissue Culture: Laboratory Procedures in Biotechnology. New York, NY: Wiley; Mullis, KB, Ferre, F. & Gibbs, R. (1994). PCR: The Polymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, EA (2014). Antibodies: A Laboratory Manual (2nd ed.). New York, NY: Cold Spring Harbor Laboratory Press; Beaucage, SL et al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY: Wiley, (including supplements through 2014); and Makrides, SC (2003). Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences BV, the disclosures of which are incorporated herein by reference.

[0147] Further embodiments are disclosed in more detail in the following examples, which are provided by way of illustration and are not intended to limit the scope of the disclosure or claims in any way.

[0148] Example 1 Alphavirus vector construction This example describes experiments performed to construct a basic alphavirus vector (e.g., not containing a heterologous gene of interest) that was subsequently used to construct vectors expressing a gene of interest (e.g., RABV-G).

[0149] EEEV Basic Vector The basic EEEV vector (i.e., without a heterologous gene of interest) was constructed as follows: the basic EEEV vector was divided into four ~4 kb pieces (Twist Biosciences) and synthesized de novo from the reference sequence (Genbank EF151502) with some modifications. Restriction sites were eliminated by inserting the silent mutations G301A, A3550C, G4516A, G5725A, and G7399A. A unique restriction site (SpeI, 5'-A'CTAG,T-3') was inserted in place of the coding sequence of the native EEEV structural genes (where the 5' A corresponds to the position of the ATG start codon of the structural polyprotein and the 3' T corresponds to the position of the TAA stop codon of the structural polyprotein). A 5' adaptor sequence (5'-CTGGAGACGTGGAGGAGAACCCTGGACCT-3'; SEQ ID NO:2) was inserted upstream of the SpeI site and a 3' adaptor sequence (5'-GACCGCTACGCCCCAATGACCCGACCAGC-3'; SEQ ID NO:3) was inserted downstream of the SpeI site for the subsequent Gibson Assembly® procedure (Gibson et al., Nat. Methods 6, 343-345, 2009). A bacteriophage T7 RNA polymerase promoter (5'-TAATACGACTCACTATAG-3'; SEQ ID NO:4) was included upstream of the EEEV genomic sequence and downstream a polyA sequence followed by a SapI site that cuts upstream of the recognition site. Immediately downstream of the SapI site is a T7 transcription termination sequence (5'-AACCCCTCTCTAAACGGAGGGGTTTTTTT-3'; SEQ ID NO:5), followed by a unique restriction site (NotI, 5'-GC'GGCC,GC-3'). These parts were joined in a five-piece Gibson Assembly® reaction (linearized pYL backbone and four synthetic fragments) to generate the EEEV base vector.

[0150] CHIKV basic vector The basic CHIKV S27 vector was split into four ~4 kb pieces (Twist Biosciences, Thermo Fisher GeneArt) and synthesized de novo with the silent A5366G mutation from the reference sequence (Genbank AF369024) and a unique restriction enzyme cleavage site (SpeI, 5'-A'CTAG,T-3') in place of the coding sequence of the CHIKV structural genes (where the 5' A corresponds to the position of the ATG start codon of the structural polyprotein and the 3' T corresponds to the position of the TAA stop codon of the structural polyprotein). For the subsequent Gibson Assembly® step, a 5' adaptor sequence (5'-CTGGAGACGTGGAGGAGAACCCTGGACCT-3'; SEQ ID NO:2) was inserted upstream of the SpeI site and a 3' adaptor sequence (5'-GACCGCTACGCCCCAATGACCCGACCAGC-3'; SEQ ID NO:3) was inserted downstream of the SpeI site. The bacteriophage T7 RNA polymerase promoter (5'-TAATACGACTCACTATAG-3'; SEQ ID NO: 4) was included upstream of the CHIKV genomic sequence, followed downstream by a polyA sequence followed by a SapI site that cuts upstream of the recognition site. Immediately downstream of the SapI site is the T7 transcription termination sequence (5'-AACCCCTCTCTAAACGGAGGGGTTTTTTT-3'; SEQ ID NO: 5), followed by a unique restriction enzyme cleavage site (NotI, 5'-GC'GGCC,GC-3'). These parts were joined in a five-piece Gibson Assembly® reaction (linearized pYL backbone and four synthetic fragments) to yield the CHIKV S27 basic vector.

[0151] The CHIKV DRDE base vector was similarly constructed, except that the 3′UTR of S27 was used instead of the 3′UTR of DRDE from the reference sequence (Genbank EF210157).

[0152] SINV basic vector The basic SINV Girdwood vector was synthesized de novo as four ~4 kb segments (Twist Biosciences, Thermo Fisher GeneArt) from the Girdwood strain reference sequence (Genbank MF459683) with a unique restriction enzyme cleavage site (SpeI, 5'-A'CTAG,T-3') in place of the coding sequence of the SINV structural genes (where 5'A is the next nucleotide in the P2A sequence following nucleotide 93 of the structural polyprotein gene, and 3'T coincides with the location of the structural polyprotein stop codon TGA). The bacteriophage T7 RNA polymerase promoter (5'-TAATACGACTCACTATAG-3'; SEQ ID NO: 4) was included upstream of the SINV genomic sequence and downstream a polyA sequence followed by a SapI site that cleaves upstream of the recognition site. Immediately downstream of the SapI site is a T7 transcription termination sequence (5'-AACCCCTCTCTAAACGGAGGGGTTTTTTT-3'; SEQ ID NO:5), followed by a unique restriction site (NotI, 5'-GC'GGCC,GC-3'). These parts were joined in a five-piece Gibson Assembly® reaction (e.g., linearized pYL backbone and four synthetic fragments) to generate the SINV Girdwood base vector.

[0153] The basic SINV AR86 vector was constructed similarly from the reference sequence (Genbank U38305), except that the nsP2 coding sequence was derived from the Girdwood reference sequence.

[0154] VEE Basic Vector The basic VEE vector was divided into four ~4 kb pieces (Twist Biosciences, Thermo Fisher GeneArt) and synthesized de novo from the reference sequence of strain TC-83 (Genbank L01443) with the silent A2087G mutation and a unique restriction enzyme cleavage site (SpeI, 5'-A'CTAG,T-3') in place of the coding sequence of the VEE structural gene (where the 5' A is the next nucleotide of the P2A sequence following nucleotide 93 of the structural polyprotein gene and the 3' T corresponds to the position of the structural polyprotein stop codon TGA). A 5' adaptor sequence (5'-CTGGAGACGTGGAGGAGAACCCTGGACCT-3'; SEQ ID NO:2) was inserted upstream of the SpeI site and a 3' adaptor sequence (5'-GACCGCTACGCCCCAATGACCCGACCAGC-3'; SEQ ID NO:3) was inserted downstream of the SpeI site for the subsequent Gibson Assembly® procedure. The bacteriophage T7 RNA polymerase promoter (5'-TAATACGACTCACTATAG-3'; SEQ ID NO:4) was included upstream of the VEE genomic sequence and downstream a polyA sequence followed by a SapI site that cuts upstream of the recognition site. Immediately downstream of the SapI site is the T7 transcription termination sequence (5'-AACCCCTCTCTAAACGGAGGGGTTTTTTT-3'; SEQ ID NO:5), followed by a unique restriction enzyme cleavage site (NotI, 5'-GC'GGCC,GC-3'). These parts were joined in a five-piece Gibson Assembly® reaction (eg, the linearized pYL backbone and the four synthetic fragments) to generate the VEE base vector.

[0155] The RABV-G transgene was synthesized (IDT) with flanking regions homologous to the 5' and 3' adapter sequences and inserted into the basic vector linearized with SpeI using Gibson Assembly (registered trademark) to obtain the final vector.

[0156] Example 2 In vitro evaluation of modified alphavirus vectors This example describes the results of in vitro experiments performed to evaluate the RNA replication and RABV-G expression levels of the synthetic alphavirus srRNA constructs described in Example 1 above, and to further examine differences in their behavior (e.g., RNA replication and protein expression).

[0157] In vitro transcription: RNA was prepared in vitro by transcription from SapI-linearized plasmid templates with bacteriophage T7 polymerase with 5'ARCA cap (HiScribe™ T7 ARCA mRNA Kit, NEB) or without capping (HiScribe™ T7 High Yield RNA Synthesis Kit, NEB) followed by addition of 5' Cap 1 (Vaccinia Capping System, mRNA Cap 2´-O-Methyltransferase, NEB). RNA was then purified using phenol / chloroform extraction or column purification (Monarch® RNA Cleanup Kit, NEB). RNA concentration was measured by absorbance at 260 nm (Nanodrop, Thermo Fisher Scientific).

[0158] RNA replication: RNA was introduced into BHK-21 or Vero cells by electroporation (e.g., 4D-Nucleofector™, Lonza). 15-22 hours after transfection, cells were fixed and permeabilized (eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set, Invitrogen) and stained with a PE-conjugated anti-dsRNA mouse monoclonal antibody (J2, Cycon) to quantify the frequency of dsRNA+ cells and the mean fluorescence intensity (MFI) of dsRNA in individual cells by fluorescent flow cytometry. The results are shown in Figure 1.

[0159] Protein expression: RNA was electroporated into BHK-21 or Vero cells (e.g., 4D-Nucleofector™, Lonza). 15-22 hours after transfection, cells were fixed and permeabilized (eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set, Invitrogen) and stained using AF647-conjugated anti-RABV-G antibody (1c5). The mean fluorescence intensity (MFI) of AF647 was used as a readout for RABV-G expression. The results are shown in Figure 2.

[0160] Example 3 Evaluation of modified alphavirus vectors in vivo This example describes the results of in vivo experiments performed to evaluate the srRNA constructs described herein.

[0161] In these experiments, synthetic srRNA constructs derived from various alphavirus strains were designed and then evaluated.

[0162] Mice and injections BALB / c mice were purchased from Charles River Laboratories, Envigo, or Jackson Laboratories. On the day of dosing, 0.15 μg or 1.5 μg of material was injected intramuscularly into one or both quadriceps muscles in a split dose. Vectors were formulated as LNPs. Animals were monitored throughout the study for weight and other general observations. For immunogenicity studies, animals were dosed on day 0 only or on days 0 and 21.

[0163] LNP formulation srRNA was formulated into lipid nanoparticles using a microfluidic mixer for particle size analysis, polydispersity analysis using dynamic light scattering, and encapsulation efficiency analysis. Lipids were dispersed in ethanol. RNA was suspended in 250 mM NaOAc (pH 4.0) at a concentration of 82 ug / ml and mixed at a flow rate of 3:1 (aqueous:organic).

[0164] ELISpot To measure the magnitude of the RABV-G-specific T cell response, IFNγ ELISpot analysis was performed using the Mouse IFNγ ELISpot PLUS Kit (HRP) (Mabtech) according to the manufacturer's instructions. The results of the ELISpot assay for mouse IFNγ detection, measured as spot-forming units corresponding to responder splenic T cells 14 days after intramuscular injection of srRNA encoding RABV-G, are shown in Figure 3. The total T cell response (plotted as spot-forming units counted per million cells) is shown on the Y-axis.

[0165] Neutralizing antibody response by RFFIT: To measure the neutralizing antibody titers generated by the vaccine, serum was collected from mice 14 days after intramuscular injection and diluted, mixed, and incubated with a standard amount of rabies virus in a multichamber slide. After a short incubation period, cells susceptible to infection and replication by rabies virus were added to the serum-virus mixture and incubated overnight (approximately 16-24 hours) to allow the unneutralized virus to infect and grow in the cells. The cells were then fixed and stained for rabies virus production using a fluorescent microscope. A total of up to 20 microscopic fields per serum sample were read and compared against a slide containing a reference control serum-virus mixture. The number of infected cells was counted at each serum dilution and used to determine the neutralization titer. The final RFFIT result was calculated by multiplying the count by the serum dilution factor. The results of the RFFIT assay are either expressed as serum antibody titers or as international units (IU) of antibody per milliliter of serum, the latter being determined by comparing the neutralizing activity of the test serum with that of a reference serum of known IU concentration (Figure 4).

[0166] Example 4 In vivo evaluation of modified alphavirus vectors as rabies virus post-exposure prophylaxis to treat rabies infection This example describes in vivo experiments that were performed to evaluate the srRNA constructs described herein.

[0167] In these studies, synthetic srRNA constructs derived from various alphavirus strains have been designed and then evaluated for their ability to protect against illness and mortality due to rabies virus infection by post-exposure prophylactic vaccination.

[0168] Rabies virus attack Challenge virus standard (CVS)-11 was purchased from the American Type Culture Collection (ATCC) and propagated in baby hamster kidney (BHK)-21 cells.

[0169] LNP formulation The srRNA is formulated into lipid nanoparticles using a microfluidic mixer for particle size analysis, polydispersity analysis using dynamic light scattering, and encapsulation efficiency analysis. Lipids are dispersed in ethanol. RNA is suspended in 250 mM NaOAc (pH 4.0) at a concentration of 82 μg / ml and mixed at a flow rate of 3:1 (aqueous:organic).

[0170] Mice and injections BALB / c mice are purchased from Charles River Laboratories, Envigo, or Jackson Laboratories. The day before srRNA administration (day -1), mice were administered a single dose of 10 2.5 Animals are inoculated intranasally with a 50% cell culture infectious dose of CVS-11. On the day of srRNA administration (day 0, or days 0 and 14), 0.1 μg, 1 μg, or 10 μg of material are injected intramuscularly into one or both quadriceps muscles in split doses. srRNA is formulated as an LNP. Animals are monitored throughout the study for weight and clinical observations. In some groups, the addition of human rabies immune globulin (HRIG) or similar rabies neutralizing immunoglobulin may be combined with srRNA treatment.

[0171] Disease progression Mice are monitored daily for signs of disease until approximately 35 days post ingestion (DPI) or loss of control in the untreated group. Typical disease patterns are scored as they progress: isolation from the group (score 1), slowness / reduced activity (score 2), limb paresis (score 3), uncoordinated movements (score 4), lack of spontaneous movement (score 5), no response to stimuli (score 6), and a terminal stage characterized by mice burying their heads in the cage bedding and slowing breathing (score 7). Disease progression is represented by plotting the daily scores as a function of DPI. The incubation period is defined as the time from virus ingestion to the first appearance of disease signs. Mice are euthanized by cervical dislocation when they reach a score of 6. Results are represented by Kaplan-Meier survival curves.

[0172] Viral load Rabies virus infection in the brain is confirmed using real-time reverse transcriptase polymerase chain reaction (RT-qPCR). Brains are homogenized and RNA is extracted according to the manufacturer's instructions (RNeasy kit, Qiagen). Alternatively, direct fluorescent antibody (DFA) testing may be used to determine rabies virus staining in fixed tissues according to standard methods.

[0173] While certain alternatives of the present disclosure have been disclosed, it is to be understood that various modifications and combinations are possible and contemplated within the true spirit and scope of the appended claims, and therefore, it is not intended to be limited to the precise scope and disclosure presented herein.

Claims

1. A nucleic acid construct comprising a nucleic acid sequence encoding a modified alphavirus genome or self-replicating RNA (srRNA), wherein at least a portion of the nucleic acid sequence encoding a viral structural protein of the modified alphavirus genome or srRNA is replaced with a nucleic acid construct encoding a polypeptide construct comprising rabies virus envelope glycoprotein G (RABV-G), a variant thereof, or any of the antigenic determinants thereof.

2. The nucleic acid construct according to claim 1, wherein the polypeptide construct comprises a molecular modification that stabilizes the antigenic determinant of RABV-G, its variant, or any of the thereof.

3. The nucleic acid construct according to claim 1 or 2, wherein the modified alphavirus genome or srRNA does not contain a nucleic acid sequence encoding a viral structural protein.

4. The nucleic acid construct according to claim 1 or 2, wherein the nucleic acid sequence encoding the polypeptide construct is operably linked to a promoter sequence.

5. The nucleic acid construct according to claim 4, wherein the promoter sequence is a 26S subgenome (sg) promoter.

6. The nucleic acid construct according to claim 1 or 2, wherein the modified alphavirus genome or srRNA is of an alphavirus belonging to the VEEV / EEEV / WEEV group, the SFV group, or the SINV group.

7. The nucleic acid construct according to claim 1 or 2, wherein the nucleic acid sequence has at least 90% sequence identity with respect to a nucleic acid sequence selected from the group consisting of sequence numbers 6 to 11.

8. Recombinant cells comprising the nucleic acid construct according to claim 1 or 2.

9. A pharmaceutical composition comprising a pharmaceutically acceptable excipient and a nucleic acid construct according to claim 1 or 2.

10. The pharmaceutical composition according to claim 9, wherein the pharmaceutical composition is formulated together with a delivery medium into a delivery system, the delivery system comprising liposomes, viral replicon particles (VRPs), lipid nanoparticles (LNPs), polymer nanoparticles, physiological buffer, microspheres, immunostimulatory complexes (ISCOMs), conjugates of bioactive ligands, or any combination thereof.

11. A pharmaceutical composition for inducing an immune response in a subject requiring induction of an immune response or treatment or prevention of rabies infection, or for treating or preventing rabies infection, comprising the nucleic acid construct described in claim 1 or 2.

Images