Pathology-responsive recombinant cells and uses thereof
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- RGT UNIV OF CALIFORNIA
- Filing Date
- 2023-04-27
- Publication Date
- 2026-05-08
AI Technical Summary
The prior art is difficult to effectively cross the blood-brain barrier, resulting in limited delivery and effectiveness of drugs when treating brain diseases.
By modifying human microglia cells to express therapeutically effective molecules that can be activated upon exposure to β-aminoamide (Aβ)-related pathology, thereby reducing or eliminating Aβ aggregation, thereby treating related neurodegenerative diseases such as Alzheimer's disease.
It is achieved to effectively reduce Aβ aggregation and delay or alleviate related pathological processes and symptoms when Aβ-related pathology such as Alzheimer's disease exists.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 335,585, filed April 27, 2022, the specification of which is incorporated herein by reference in its entirety.
[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant No. DA048813 and Grant No. AG073787 awarded by the National Institutes of Health. The Government has certain rights in this invention.
[0003] Sequence Listing Reference The contents of the electronic sequence listing (file name UCI_22_14_PCT.xml; size: 27,817 bytes; and creation date April 26, 2023) are incorporated herein by reference in their entirety.
[0004] The present invention relates to cells modified to express at least one therapeutic molecule capable of treating or ameliorating pathology and / or symptoms associated with a particular condition, such as Alzheimer's disease. The present invention may also relate to compositions and kits comprising said cells, as well as methods of use thereof for treating Alzheimer's disease. [Background technology]
[0005] Several common neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis (ALS), are characterized by the progressive accumulation of insoluble proteinaceous aggregates. In Alzheimer's disease, amyloid beta (Aβ) adopts various conformations, including insoluble fibrillar Aβ plaques and soluble Aβ oligomers, which can promote the development of additional downstream pathologies, including neurofibrillary tangles and gliosis. Together, these pathologies result in neuronal and synaptic loss, as well as brain atrophy, leading to memory loss, cognitive impairment, behavioral changes, and dementia. In the United States, approximately 6 million people over the age of 65 currently suffer from Alzheimer's disease. Alzheimer's disease is primarily a late-life condition. As such, the incidence of the disease is predicted to increase as the population ages. Therefore, new therapeutic agents must be developed to address this increased need. However, one challenge to developing drugs to treat brain disorders is the blood-brain barrier (BBB), which presents a major obstacle to delivery and therefore drug efficacy. Both small and large molecules have been investigated as effective therapeutic agents to treat brain diseases. However, due to physical constraints on molecules being able to cross the BBB, most macromolecules cannot pass through the brain endothelium. Therefore, despite decades of research to develop safe and effective treatments for brain diseases, delivering drugs that cross the BBB at appropriate concentrations for target engagement remains a fundamental obstacle.
[0006] In recent years, CAR T cell therapy has demonstrated the ability to use engineered cells to directly and selectively deliver therapeutic agents to cancer pathology sites. In central nervous system disorders, neural stem cells and bone marrow stem cells have been investigated as vehicles to deliver therapeutic agents. Unfortunately, human neural stem cells have concerning tumorigenic potential, and bone marrow stem cells require a dangerous preconditioning step to deliver cells to the brain. Therefore, there is still a critical need for a safe cell delivery vehicle to selectively deliver therapeutic agents directly to CNS pathology sites.
[0007] Microglia are the primary innate immune cells of the brain and play a key role in maintaining neuronal homeostasis and monitoring their local environment for pathogens and neuronal damage. Recently, a chimeric mouse model has been developed that allows for the investigation of the interplay between human iPSC-derived microglia and neuropathology. In this model, after xenotransplantation, human iPSC-derived microglia (xMG) disperse widely, exhibit an in vivo-like transcriptional profile, and mature into proliferating homeostatic microglia. This disclosure describes how such cells can be modified for the treatment of Alzheimer's disease and other Aβ-related neurodegenerative disorders. Summary of the Invention
[0008] The object of the present invention is to provide compositions and methods that allow for treating or preventing diseases or conditions associated with amyloid beta-related pathology, including but not limited to Alzheimer's disease (AD), or ameliorating or delaying symptoms and / or pathological processes associated with amyloid beta-related pathology. In some embodiments, the amyloid beta-related pathology is associated with Alzheimer's disease. In some embodiments, the amyloid beta-related pathology is associated with Parkinson's disease. In some embodiments, the amyloid beta-related pathology is associated with Huntington's disease. In some embodiments, the amyloid beta-related pathology is associated with amyotrophic lateral sclerosis (ALS). The present invention is not limited to the aforementioned diseases or conditions associated with amyloid beta pathology.
[0009] The embodiments of the invention may be freely combined with each other if they are not mutually exclusive.
[0010] Immunodeficient mice with deletions in the Rag2 and il2 receptor gamma (il2rγ) genes have been used previously to transplant human cells, but initial attempts to generate human microglial chimeric mice using standard immunodeficient mice failed. Surprisingly, after multiple crosses and experiments, it was discovered that a mouse model with humanized CSF-1 alleles was necessary to allow long-term engraftment and survival of human xenografted microglia (Hasselmann et.al., Neuron, 2019; Supp Fig S2). Not only was the creation of this model a challenge, but additional difficulties included backcrossing the model to an amyloidogenic line (5XFAD mice) and restoring homozygosity for the Rag2, il2rγ humanized CSF-1 alleles.
[0011] For mouse microglia, it has been shown that isolation procedures are highly constrained (Marsh et.al., Nat Neurosci. 2022). Despite this challenge, we were able to develop a rapid method to purify engrafted human microglia while minimizing their destruction. This was achieved using a negative magnetic sorting method that depletes total mouse cells and leaves intact but highly pure and viable human microglia. Details and validation of this novel isolation method are provided in Hasselmann et.al., Neuron, 2019. Our method for isolation enabled us to isolate human microglia from chimeric mouse brains to investigate gene expression and identify candidate microglial genes that show changes in expression in response to beta-amyloid pathology.
[0012] The isolation approach described above enabled single-cell sequencing that provided a partial inventory of plaque-responsive microglial genes. However, single-cell sequencing is less sensitive than bulk RNA sequencing and typically captures only the most abundantly expressed transcripts. Despite these challenges, we were able to develop a method to isolate plaque-responsive versus non-plaque-responsive microglia from the same chimeric mouse brain, which allowed us to further understand the response of human microglia to plaques. Single-cell sequencing data, and subsequent immunohistochemical validation (see Figure 1A-P), demonstrated that CD9 and HLA-DRB are highly enriched in plaque-associated human microglia. We also developed a fluorescence-activated cell sorting (FACS) approach to isolate double-positive versus CD9 / HLA-DRB double-negative homeostatic microglia. This was achieved using mice transplanted with four independent human microglial samples, followed by bulk RNA sequencing. This analysis provided a more complete data set of plaque-induced human microglial genes described herein (see Figures 20A-D).
[0013] One aspect of the present disclosure provides modified cells for treating amyloid beta-related pathology (e.g., Alzheimer's disease (AD), Parkinson's disease, Huntington's disease, ALS, other neurodegenerative disorders, e.g., other Aβ-related neurodegenerative disorders) or ameliorating symptoms and / or pathological processes associated with the amyloid beta-related pathology. The cells are susceptible to amyloid beta (Aβ)-related pathology. For example, in some embodiments, the modified cells express, present, secrete, or perform a combination of therapeutic molecules when the modified cells are in proximity to or in contact with Aβ-related pathology (which may also be referred to herein as Alzheimer's disease-related pathology), e.g., β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, fibrils containing Aβ of various lengths, or combinations thereof. In some embodiments, the modified cells express and secrete therapeutic molecules when the modified cells are in proximity to or in contact with amyloid beta-related pathology (e.g., Alzheimer's disease-related pathology). In some embodiments, the modified cells express, present and secrete therapeutic molecules when the modified cells are in proximity to or in contact with amyloid beta-related pathology. The therapeutic molecules alter one or more amyloid beta-related pathology phenotypes, or at least one aspect of amyloid beta-related pathology. For example, in some embodiments, the therapeutic molecules reduce the size and / or number of Aβ aggregates. The present invention is not limited to the aforementioned examples of altering amyloid beta-related pathology phenotypes.
[0014] The amyloid beta-related pathology phenotype or amyloid beta-related symptoms may include one or a combination of memory impairment, learning deficits, cognitive impairment, visual impairment, behavioral changes, personality changes, depression, or seizures. In some embodiments, the Aβ-related pathology may include β-amyloid (Aβ) peptide plaques. In some embodiments, the Aβ-related pathology may include soluble Aβ monomers. In some embodiments, the Aβ-related pathology may include insoluble Aβ monomers. In some embodiments, the Aβ-related pathology may include Aβ oligomers. In some embodiments, the Aβ-related pathology may include prefibrils. In some embodiments, the Aβ-related pathology may include fibrils containing Aβ of various lengths. In some embodiments, the Aβ-related pathology may include one or a combination of β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, fibrils containing Aβ of various lengths, or combinations thereof.
[0015] The modified cells may include a nucleic acid sequence encoding a therapeutic molecule. The nucleic acid sequence may be operably linked to a pathology-responsive promoter, e.g., a promoter responsive to a pathology associated with Alzheimer's disease, Parkinson's disease, Huntington's disease, ALS, etc., e.g., an amyloid beta-responsive promoter. As a non-limiting example, the nucleic acid may be operably linked to a promoter responsive to Aβ peptide, e.g., the promoter may be activated upon the cell's proximity to or contact with Aβ peptide. In some embodiments, the therapeutic molecule may cleave Aβ peptide. In some embodiments, the therapeutic molecule may reduce the amount of Aβ peptide in Aβ peptide plaques in the brain of an individual. In some embodiments, the therapeutic molecule may reduce the size or number of soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths. In some embodiments, the therapeutic molecule may reduce the size and / or number of Aβ aggregates. In some embodiments, the therapeutic molecule may enhance amyloid protein degradation. In some embodiments, the therapeutic molecule may enhance microglial phagocytosis of amyloid beta. The present invention is not limited to the aforementioned mechanism of action for altering amyloid beta-associated pathological phenotypes.
[0016] One aspect is a modified cell comprising a nucleic acid sequence encoding a therapeutic molecule, the nucleic acid sequence being operably linked to a promoter that activates transcription of the therapeutic molecule upon the cell's proximity to or contact with β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils comprising Aβ of various lengths. In some embodiments, the therapeutic molecule cleaves Aβ peptides. In some embodiments, the therapeutic molecule reduces the amount of Aβ peptides in Aβ peptide plaques in the brain of the individual. In some embodiments, the therapeutic molecule reduces the size or number of soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils comprising Aβ of various lengths. In some embodiments, the therapeutic molecule reduces the size and / or number of Aβ aggregates. In some embodiments, the therapeutic molecule enhances amyloid proteolysis. In some embodiments, the therapeutic molecule enhances microglial phagocytosis of amyloid beta.
[0017] In some embodiments, the therapeutic molecule is a therapeutic mRNA molecule. In some embodiments, the therapeutic molecule is a therapeutic protein. The therapeutic protein can be a membrane-bound protein or a secreted protein. Secreted therapeutic proteins can include modified proteins. For example, in some embodiments, the therapeutic protein is a protein modified to lack a cytoplasmic domain. In some embodiments, the therapeutic protein is a protein modified to lack a transmembrane domain. In other embodiments, the therapeutic protein is a protein modified to lack a transmembrane domain and a cytoplasmic domain. In some embodiments, the therapeutic molecule includes an enzyme or an immunomodulatory protein. In some embodiments, the therapeutic molecule includes TREM2. In some embodiments, the therapeutic molecule includes insulin degrading enzyme. In some embodiments, the therapeutic molecule includes MSR1 (SCARA1). In some embodiments, the therapeutic molecule includes LRP1. In some embodiments, the therapeutic molecule includes APOE. In some embodiments, the therapeutic molecule includes IL4. In some embodiments, the therapeutic molecule includes IL-10. In some embodiments, the therapeutic molecule comprises an endothelin-converting enzyme (ECE). In some embodiments, the therapeutic molecule comprises a protease enzyme, e.g., cathepsin B or cathepsin D. In some embodiments, the therapeutic molecule comprises cathepsin B. In some embodiments, the therapeutic molecule comprises cathepsin D. In some embodiments, the therapeutic molecule comprises a matrix metalloproteinase (MMP) enzyme, e.g., MMP2 or MMP9. In some embodiments, the therapeutic molecule comprises matrix metalloproteinase 2 (MMP2). In some embodiments, the therapeutic molecule comprises matrix metalloproteinase 9 (MMP9).Certain therapeutic molecules are described in the following disclosures, the entireties of which are incorporated herein by reference: Leissring et al., Neuron 2003;40:1087-1093; Eckman et al., J Biol Chem 2001;276:24540-24548; Hernandez-Guillamon et al., J Biol Chem 2015;290(24):15078-15091; Suire and Leissing, J Exp Neurol.2021;2(1):10-15; Wang et al., J Biol Chem 2012;287(47):39843-41; Zhao et al., J Exp Med.2022;219(12):e20212479; Frenkel et al., Nat Commun. 2013;4:2030; N'Songo et al., Mol Neurodegener. 2013;8(Suppl 1):P33; Ulrich et al., J Exp Med. 2018;215(4):1047-1058; Yi et al., Cytotechnology 2020;72(4):589-602. In some embodiments, the therapeutic molecule comprises a metalloprotease that may comprise neprilysin activity. In some embodiments, the therapeutic molecule comprises neprilysin. In some embodiments, the therapeutic protein comprises neprilysin or a derivative thereof. For example, the therapeutic protein may comprise an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. For example, in some embodiments, the therapeutic protein comprises a membrane-bound neprilysin according to SEQ ID NO: 1. In some embodiments, the therapeutic protein comprises a membrane-bound neprilysin according to SEQ ID NO: 2. In some embodiments, the therapeutic protein comprises a secreted neprilysin according to SEQ ID NO: 3.
[0018] The pathology-responsive promoter may be, but need not be, an endogenous promoter. In some embodiments, the promoter is an endogenous promoter. In some embodiments, the promoter is not an endogenous promoter. In some embodiments, the promoter is an endogenous promoter, but is exogenously (separately) incorporated into the cell, e.g., as a proximal promoter, and the therapeutic molecule is operably linked to the proximal promoter. In some embodiments, the promoter is the wild-type (unmodified) form of the promoter. In some embodiments, the promoter is modified (relative to its wild-type form). As a non-limiting example, a CD9 proximal promoter can be generated and incorporated into an AAV safe harbor locus.
[0019] The pathology-responsive promoter may comprise a promoter from a gene selected from the group consisting of DCSTAMP gene, CD9 gene, CD44 gene, LGALS3 gene, SPP1 gene, GPNMB gene, HLA-DRB gene, LPL gene, LIPA, FABP3 gene, MS4A6A gene, CXCR4 gene, CHI3L1 gene, OLR1 gene, CD36 gene, SLAMF8 gene, TREM2 gene, MSR1 gene, B2M gene, ITGAX gene and MITF gene. For example, in some embodiments, the promoter comprises a promoter of the CD9 gene. In some embodiments, the promoter comprises a promoter of the LGALS3 gene. In some embodiments, the promoter comprises a promoter of the HLA-DRB gene. In some embodiments, the promoter comprises a promoter of the CD11c (ITGAX) gene. In some embodiments, the promoter comprises a promoter of a gene selected from CD9, LGALS3, HLA-DRB and CD11c. In some embodiments, the promoter comprises a promoter of a gene selected from CD9, LGALS3, HLA-DRB, TREM2, and CD11c. In some embodiments, the promoter comprises a promoter of the DCSTAMP gene. In some embodiments, the promoter comprises a promoter of the CD44 gene. In some embodiments, the promoter comprises a promoter of the SPP1 gene. In some embodiments, the promoter comprises a promoter of the GPNMB gene. In some embodiments, the promoter comprises a promoter of the LPL gene. In some embodiments, the promoter comprises a promoter of the LIPA gene. In some embodiments, the promoter comprises a promoter of the FABP3 gene. In some embodiments, the promoter comprises a promoter of the MS4A6A gene. In some embodiments, the promoter comprises a promoter of the CXCR4 gene. In some embodiments, the promoter comprises a promoter of the CHI3L1 gene. In some embodiments, the promoter comprises a promoter of the OLR1 gene. In some embodiments, the promoter comprises a promoter of the CD36 gene.In some embodiments, the promoter comprises the promoter of the SLAMF8 gene. In some embodiments, the promoter comprises the promoter of the TREM2 gene. In some embodiments, the promoter comprises the promoter of the MSR1 gene. In some embodiments, the promoter comprises the promoter of the B2M gene. In some embodiments, the promoter comprises the promoter of the MITF gene. The present invention is not limited to the promoters mentioned above. Although no data is presented for the promoters from DCSTAMP gene, CD44 gene, SPP1 gene, GPNMB gene, LPL gene, LIPA, FABP3 gene, MS4A6A gene, CXCR4 gene, CHI3L1 gene, OLR1 gene, CD36 gene, SLAMF8 gene, TREM2 gene, MSR1 gene, B2M gene and MITF gene, those skilled in the art will understand that these promoters can be used instead of the promoters from CD9, LGALS3, HLA-DRB and CD11c with reasonable prediction of success.
[0020] Other non-limiting examples of pathology-responsive promoters useful for generating modified cells of the present disclosure include, but are not limited to, HLA-DRB3, HLA-DRB5, HLA-DRA, CHIT1, DKK2, HLA-DQB1, PLXNA1, CCR7, HLA-DPA1, RGCC, COX6A2, HLA-DRB1, HLA-DPB1, TAFA3, FAIM2, ZNF804A, LGALS1, DOK2, HLA-DOA, GPR153, SLPI, ADGRF5, MYOZ1, HBEGF, BHLHE40, TMEM37, SLC16A8, G RM5, S100A4, GABRB1, LONRF3, PIGR, RAB7B, BIRC7, FABP5, CA2, FCMR, GABRB3, ATF7-NPFF, ANXA2, EGR2, OR9G1, IFNLR1, APOC1, CD200R1, PKD2L1, TDRD6 , HLA-DMA, KCNJ5, GLDN, PREX2, OLFM2, PADI2, COL1A2, RRAGD, ROR2, PTCRA, EDN1, RAMP1, BCL2A1, CD83, CHST2, DAGLA, MAFB, DUSP2, FPR3, DPYD, PHLDA1, PTPRG, IER5L, CPNE8, MPDZ, RNF152, PTGER4, MCF2, SDS, CIITA, RGS16, ANGPTL6, PLA2G7, CCL3, ATF3, RAB42, TBX18, STARD13, NR4A3, S100A13, TRDN, GA DD45G, ADRA1B, LYPD1, FXYD6, EPHB6, FERMT2, ART4, TNFSF18, TNFSF15, SLC38A4, CDH6, SCIN, FGR, ZNF385B, FUT9, SORCS1, KLF10, CFD, TRPM1, FLVCR2, N FIL3, MYO1E, ITPRID1, SLC47A1, LITAF, RASGEF1B, DENND2D, ADCY3, SYTL3, ARL4C, IL4I1, CDCP1, TRERF1, VAT1, INPP1, ARRDC4, ENPP1, GSDME, APOC2, C OL4A1, CDKN1A, KCNC4, KCNJ2, USP2, UNC13B, VEGFB, TNFAIP2, SLC35F2, HLA-DMB, NAB2, ACP5, CYTL1, FXYD5, ALDH1A2, TMEM176B, TAGLN2, TIMD4, MEP1A,ADGRL2, FAM20C, LRRC39, CD74, RASGRP3, HEG1, TNFRSF14, ADGRE2, FAM110B, GADD45B, TSKU, ID2, ADGRD1, DUSP10, TNFSF13B, FKBP5, MYC, BCL6, TNFAIP8L3, ARID5B, APOC4-APOC2, PMAIP1, P2RY8, CCRL2, RNASE1, LSP1, ARHGEF3, CLEC19A, KCNQ5, DTNA, PILRA, WIPF3, CSTB, XYLT1, DBI, SDC2, KCNMA1, ALCAM, TSPAN4, RPS28, KLHDC8B, MBOAT1, FAM20A, CDH8, NAP1L1, SMIM4, ALAS1, PDLIM7, IQGAP2, INPP4B, TRIM58, SLC36A1, TXN, HLA-B, HSPB1, AP1S2, PLAU, HLA-DQA1, CYSTM1, IER5, MS4A7, SPN, CTSD, SELENOP, SDSL, CD14, HLA-F, B3GALNT1, GAPT, RASSF3, GAS7, GAS2L3, GPD2, CPM, SGPP1, LILRA4, NEB, PRXL2C, SNX24, PPARG, CAPG, CD6, INHBA, PTPN7, LYRM9, ATOX1, UGCG, TMSB10, IFI30, M1AP, SH3BGRL3, CMYA5, PRKCH, NIBAN1, GK, HSD3B7, GPR65, LGALS9, RPL36, SH3RF1, WWC3, ALDH5A1, SNTB2, HACD4, LTA4H, SCIMP, SLC11A1, PTPDC1, CPNE2, CALHM2, PRDX1, APOE, IQGAP1, OSBPL3, GRK3, DPEP2, TMEM154, FOXP1, GYPC, SLC15A3, NENF, HPSE, TNFRSF11A, PPM1M, HPCAL1, SLC46A1, SLC1A3, MORC1, GABARAPL1, MGLL, TGIF1, ZYX, MAP4, or MFSD2A.
[0021] A nucleic acid sequence encoding a therapeutic molecule may be inserted into the genome of the modified cell (see Example 3). The nucleic acid sequence may be inserted into the genome of the modified cell such that transcription of the nucleic acid sequence is under the control of an endogenous pathology-responsive promoter in the genome of the modified cell. The insertion site of the nucleic acid sequence may be within, upstream or downstream of the gene controlled by the pathology-responsive promoter such that the nucleic acid sequence encoding the therapeutic molecule is in frame with the coding sequence in the exon of the gene. The nucleic acid sequence may be inserted into the gene controlled by the pathology-responsive promoter such that the nucleic acid sequence encoding the therapeutic molecule is linked to at least a portion of the coding sequence of the exon of the gene. The exon may be any exon in the gene, including the first or last exon. A first polynucleotide encoding a protease cleavage site, a ribosomal skipping sequence or a self-cleaving peptide may be inserted between the coding sequence of the exon and the therapeutic molecule encoding nucleic acid sequence. As an example, in some embodiments, the self-cleaving peptide comprises a P2A sequence. To generate a secreted therapeutic molecule, a second polynucleotide encoding a secreted peptide signal sequence can be linked to the nucleic acid sequence encoding the therapeutic molecule. In the embodiment of the present disclosure in which the therapeutic molecule is a therapeutic protein, the coding sequence of the exon and the nucleic acid sequence encoding the therapeutic protein can be linked in frame. Similarly, the first polynucleotide encoding a protease cleavage site, a ribosome skipping sequence or a self-cleaving peptide and the second polynucleotide encoding a secreted peptide signal sequence can be linked in frame with each other and with the coding sequence of the exon and the nucleic acid sequence encoding the therapeutic protein.
[0022] The modified cells of the present disclosure may be generated using cells from a cell lineage that can differentiate into migratory cells. For example, in some embodiments, the modified cells are generated using pluripotent stem cells (PSCs). In some embodiments, the modified cells are generated using induced pluripotent stem cells (iPSCs). In some embodiments, the modified cells are generated using bone marrow progenitors. In some embodiments, the modified cells are generated using erythromyeloid progenitors. In some embodiments, the modified cells are generated using hematopoietic stem cells. In some embodiments, the modified cells are generated using hematopoietic progenitor or hematopoietic precursor cells (HSPCs). In some embodiments, the modified cells are generated using lymphoid progenitors. In some embodiments, the modified cells are generated using megakaryocyte-erythroid (mk-ery) cells. In some embodiments, the modified cells are generated using umbilical cord blood stem cells. In some embodiments, the modified cells are generated using embryonic stem cells. In some embodiments, the modified cells are generated using bone marrow progenitor cells, hematopoietic stem cells or hematopoietic progenitor cells. In some embodiments, the modified cells are generated using pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), bone marrow progenitor cells, erythromyeloid progenitor cells, hematopoietic stem cells, hematopoietic progenitor or precursor cells (HSPCs), lymphoid progenitor cells, megakaryocyte-erythroid (mk-ery) cells, umbilical cord blood stem cells or embryonic stem cells.
[0023] The modified cells may be microglia-like (MGL) cells, which may be inducible MGL (iMGL), which may be human induced pluripotent stem cell-derived MGL cells (hiMGL). The hiMGL may express P2RY12 and TREM2. The hiMGL may express TMEM119 or Iba1. The hiMGL may express higher levels of AXL, STAB1, P2RY6, CCR6 or GPR84 than mature microglia endogenous to the individual. The hiMGL may express lower levels of CTSL, CTSD or NPL than mature microglia endogenous to the individual. The hiMGL may express lower levels of FFAR2 and COL26A1 than mature microglia endogenous to the individual. The hiMGL may express lower levels of Siglec11 and Siglec12 than mature microglia endogenous to the individual. The hiMGL may express P2RY13 or OLFML3. hiMGL may be capable of phagocytosing β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, and / or fibrils containing Aβ of various lengths. hiMGL may be capable of phagocytosing Aβ-40 or Aβ-42 in either soluble or insoluble forms.
[0024] One aspect of the disclosure provides a composition comprising the modified cells of the disclosure.
[0025] One aspect of the present disclosure provides a method for treating Alzheimer's disease in an individual in need thereof, or ameliorating symptoms or pathological processes associated with Alzheimer's disease in the individual. The method includes administering to the individual a modified cell of the present disclosure, or a composition of the present disclosure. The method includes administering (e.g., transplanting) a modified cell of the present disclosure, or a composition of the present disclosure (e.g., hiMGL) to the brain tissue of the individual.
[0026] One aspect of the present disclosure provides a method for treating Parkinson's disease in an individual in need thereof, or ameliorating symptoms or pathological processes associated with Parkinson's disease in the individual. The method comprises administering to the individual a modified cell of the present disclosure, or a composition of the present disclosure. The method comprises administering (e.g., transplanting) a modified cell of the present disclosure, or a composition of the present disclosure (e.g., hiMGL) to the brain tissue of the individual.
[0027] One aspect of the present disclosure provides a method for treating Huntington's disease in an individual in need thereof, or ameliorating symptoms or pathological processes associated with Huntington's disease in the individual. The method includes administering to the individual a modified cell of the present disclosure, or a composition of the present disclosure. The method includes administering (e.g., transplanting) a modified cell of the present disclosure, or a composition of the present disclosure (e.g., hiMGL) to brain tissue of the individual.
[0028] One aspect of the present disclosure provides a method for treating amyotrophic lateral sclerosis (ALS) in an individual in need thereof, or ameliorating symptoms or pathological processes associated with ALS in the individual. The method comprises administering the modified cells of the present disclosure or the composition of the present disclosure to the individual. The method comprises administering (e.g., transplanting) the modified cells of the present disclosure or the composition of the present disclosure (e.g., hiMGL) to the brain tissue of the individual.
[0029] One aspect of the present disclosure provides a method for treating a neurodegenerative disorder, such as amyloid beta-associated neurodegenerative disorder, or ameliorating symptoms or pathological processes associated with ALS in an individual in need thereof.The method comprises administering the modified cell of the present disclosure or the composition of the present disclosure to the individual.The method comprises administering (e.g., transplanting) the modified cell of the present disclosure or the composition of the present disclosure (e.g., hiMGL) to the brain tissue of the individual.
[0030] One aspect of the present disclosure provides a kit comprising the modified cells or compositions of the present disclosure. For example, the kit can comprise the modified cells described herein, where the modified cells comprise a nucleic acid sequence encoding a therapeutic molecule described herein.
[0031] One aspect of the disclosure provides a method of reducing the amount of Aβ peptide in Aβ peptide plaques and / or the size or number of soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths in the brain of an individual, the method comprising administering to the individual a modified cell or composition of the disclosure.
[0032] One aspect of the present disclosure is a method of producing a modified cell of the present disclosure, the method comprising introducing into the cell a nucleic acid sequence encoding a therapeutic molecule, wherein the nucleic acid sequence is operably linked to a promoter responsive to amyloid beta associated pathology, and wherein the therapeutic protein alters the amyloid beta associated pathology phenotype, or at least one aspect of the amyloid beta associated pathology.
[0033] Any feature or combination of features described herein is encompassed within the scope of the present invention, unless the features encompassed in any such combination are mutually inconsistent, as becomes apparent from the context, the specification, and the knowledge of one of ordinary skill in the art. Additional advantages and aspects of the present invention are apparent in the following detailed description and claims.
[0034] The features and advantages of the present invention will become apparent from consideration of the following detailed description taken in conjunction with the accompanying drawings. [Brief description of the drawings]
[0035] [Figure 1A]Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1B] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1C] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1D] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1E] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1F] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1G]Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1H] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1I] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1J] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1K] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1L] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1M]Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1N] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1O] Shown is the relative position of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques. [Figure 1P] The relative locations of expression of HLA-DRB, CD9 (tetraspanin), CD11c (ITGAX), and LGALS3, as well as amyloid plaques in xMG that are proximal to fibrillar amyloid plaques versus amyloid plaques in xMG that are distal to fibrillar amyloid plaques, are shown in Figure 1A, Figure 1E, Figure 1I, and Figure 1M. Beta amyloid (Aβ) expression is shown. Figure 1B, Figure 1F, Figure 1J, and Figure 1N show xMG expressing cytosolic green fluorescent protein (cytoGFp), which was used as a genetic marker for human cells. Figure 1C, Figure 1G, Figure 1K, and Figure 1O show expression of HLA-DRB, CD9, CD11c, and LGALS3 proteins, respectively. Figure 1A, Figure 1E, Figure 1I, and Figure 1M show the location of fibrillar amyloid plaques. Figure 1D shows an overlay of Figure 1A, Figure 1B, and Figure 1C. Figure 1H shows an overlay of Figures 1E, 1F and 1G. Figure 1L shows an overlay of Figures 1I, 1J and 1K. Figure 1P shows an overlay of Figures 1M, 1N and 1O.
[0036] Brains were fixed with 4% paraformaldehyde and then cut into 40 micron coronal sections using a freezing microtome. Immunofluorescent labeling was then utilized with antibodies against the indicated proteins and Amylo-Glo, which recognizes fibrillar beta-amyloid plaques. Confocal microscopy was then used to visualize human microglial proteins and amyloid pathology.
[0037] [Figure 2A] Similar to Figures 1E-H, but showing the relative location of CD9 (tetraspanin) expression and a closer view of amyloid plaques in xMG that are proximal to or distal to fibrillar amyloid plaques. [Figure 2B] Similar to Figures 1E-H, but showing the relative location of CD9 (tetraspanin) expression and a closer view of amyloid plaques in xMG that are proximal to or distal to fibrillar amyloid plaques. [Figure 2C] Similar to Figures 1E-H, but showing the relative location of CD9 (tetraspanin) expression and a closer view of amyloid plaques in xMG that are proximal to or distal to fibrillar amyloid plaques. [Figure 2D] Similar to Figures 1E-H, but showing the relative location of CD9 (tetraspanin) expression and a closer view of amyloid plaques in xMG that are proximal to or distal to fibrillar amyloid plaques. [Figure 2E] Similar to Figures 1E-H, but showing the relative location of CD9 (tetraspanin) expression and a closer view of amyloid plaques in xMG that are proximal to or distal to fibrillar amyloid plaques. [Figure 2F]Similar to Figures 1E-H, but showing the relative location of CD9 (tetraspanin) expression and a closer view of amyloid plaques in xMG that are proximal to or distal to fibrillar amyloid plaques. [Figure 2G] Similar to Figures 1E-H, but showing the relative location of CD9 (tetraspanin) expression and a closer view of amyloid plaques in xMG that are proximal to or distal to fibrillar amyloid plaques. [Figure 2H] Similar to Figures 1E-H, but showing the relative location of CD9 (tetraspanin) expression and amyloid plaques in xMG that are proximal to or distal to fibrillar amyloid plaques. Figures 1A and 1E show xMG expressing cytosolic green fluorescent protein (cytoGFp), used as a genetic marker for human cells. Figures 1B and 1F show expression of CD9 protein. Figures 1C and 1G show the location of fibrillar amyloid plaques. Figures 1E, 1F, and 1G show high-powered views of Figures 1A, 1B, and 1C, respectively. Figure 1D shows an overlay of Figures 1A, 1B, and 1C, and Figure 1H shows an overlay of Figures 1E, 1F, and 1G.
[0038] [Figure 3A] We show the design used to modify the genome of human iPSCs using a P2A element to insert neprilysin (NEP) downstream of the endogenous CD9 locus, such that CD9 expression remains under the control of the endogenous CD9 promoter and NEP expression is also co-regulated and co-expressed under the control of the CD9 promoter. [Figure 3B]Figure 3 shows the design used to modify the genome of human iPSCs using P2A elements to insert neprilysin (NEP) downstream of the endogenous CD9 locus, such that CD9 expression remains under the control of the endogenous CD9 promoter, and NEP expression is also co-regulated and co-expressed under the control of the CD9 promoter. Figure 3A shows a construct in which NEP is membrane-anchored. Figure 3B shows a construct in which NEP is secreted (sNEP). SP = secreted peptide signal sequence. P2A = self-cleaving peptide used to enable polycistronic expression.
[0039] [Figure 4A] 1 shows microglial cells according to the present disclosure digesting and phagocytosing fluorescently labeled fibrillarized human Aβ42 amyloid in vitro. [Figure 4B] 1 shows microglial cells according to the present disclosure digesting and phagocytosing fluorescently labeled fibrillated human Aβ42 amyloid in vitro. [Figure 4C] 4A shows microglial cells according to the present disclosure digesting and phagocytosing fluorescently labeled fibrillated human Aβ42 amyloid in vitro. FIG. 4A shows membrane-anchored neprilysin-expressing microglial cells digesting and phagocytosing digested Aβ. FIG. 4B shows secreted neprilysin-expressing microglial cells digesting and phagocytosing digested Aβ. FIG. 4C shows Aβ phagocytosis by wild-type (WT) microglial cells (wild-type cells differentiated from a human parental iPSC line and not CRISPR-edited to contain a neprilysin construct), membrane-anchored neprilysin-expressing microglial cells (NEP) and secreted neprilysin-expressing microglial cells (sNEP). An increase over time on the Y-axis indicates increased internalization and phagocytosis of Aβ. As observed in the sNEP and NEP data, a decrease in slope over time indicates increased degradation of Aβ after internalization.
[0040] [Figure 5A]1 shows the expression of neprilysin in the cortex and hippocampus of wild-type (WT) mice or amyloid plaque-expressing AD mice (5x-MITRG). [Figure 5B] 1 shows the expression of neprilysin in the cortex and hippocampus of wild-type (WT) mice or amyloid plaque-expressing AD mice (5x-MITRG). [Figure 5C] Expression of neprilysin in the cortex and hippocampus of wild-type (WT) or amyloid plaque-expressing AD mice (5x-MITRG). Figure 5A and Figure 5B show the levels of human neprilysin in soluble cortical and hippocampal brain extracts, respectively, obtained from mice transplanted with PBS (n=13), wild-type microglia (WT; n=9), membrane-bound neprilysin-expressing microglia (NEP; n=11) and secreted neprilysin-expressing microglia (sNEP; n=9), analyzed by Human Neprilysin DuoSet ELISA. Figure 5C shows the levels of neprilysin (monoclonal antibody, SN5C) normalized to GAPDH levels / lane (n=3) obtained from soluble hippocampal samples of 5x-MITRG (5x) and MITRG-WT (WT) transplanted mice. This antibody preferentially detects membrane-bound NEP and not sNEP. This Western blot confirms a significant upregulation of NEP levels only in 5x-MITRG mice transplanted with CD9-NEP microglial progenitor cells. Data are presented as mean ± SEM. Statistical significance was calculated using a two-way ANOVA test. ns = not significant or p > 0.05; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.
[0041] [Figure 6A] 1 shows the reduction of soluble amyloid species in the brain upon treatment with microglial cells of the present disclosure. [Figure 6B] 1 shows the reduction of soluble amyloid species in the brain upon treatment with microglial cells of the present disclosure. [Figure 6C]1 shows the reduction of soluble amyloid species in the brain upon treatment with microglial cells of the present disclosure. [Figure 6D] Figure 6 shows the reduction of soluble amyloid species in the brain treated with microglial cells of the present disclosure. Levels of human Aβ-42 and human Aβ-40 peptides were measured in soluble extracts of cortical (Figure 6A, Figure 6C) and hippocampal (Figure 6B and Figure 6D) samples taken from mice transplanted with PBS (n=13), wild-type microglia (WT; n=9), membrane-bound neprilysin-expressing microglia (NEP; n=11) and secreted neprilysin-expressing microglia (sNEP; n=9) analyzed by MSD assay. Data are expressed as mean ± SEM. Statistical significance is calculated using ANOVA with Tukey's post-hoc test. ns=not significant or p≧0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0042] [Figure 7A] 1 shows the reduction of insoluble amyloid species in brains treated with microglial cells of the present disclosure. [Figure 7B] 1 shows the reduction of insoluble amyloid species in brains treated with microglial cells of the present disclosure. [Figure 7C] 1 shows the reduction of insoluble amyloid species in brains treated with microglial cells of the present disclosure. [Figure 7D]7A-7D show the reduction of insoluble amyloid species in brains treated with microglial cells of the present disclosure. Insoluble amyloid species provide a biochemical measure of amyloid plaques, and Aβ-42 is believed to be a highly neurotoxic and aggregation-prone Aβ species. Human Aβ-42 and human Aβ-40 peptides were measured in insoluble extracts of cortical (FIG. 7A, FIG. 7C) and hippocampal (FIG. 7B and FIG. 7D) samples taken from mice transplanted with PBS (n=13), wild-type microglia (WT; n=9), membrane-bound neprilysin-expressing microglia (NEP; n=11) and secreted neprilysin-expressing microglia (sNEP; n=9) analyzed by the Mesoscale Devices (MSD) Aβ multiplex assay. Data are presented as mean ± SEM. Statistical significance is calculated using ANOVA with Tukey's post-hoc test. ns=not significant or p<0.05; *p≥0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0043] [Figure 8A] 1 shows the reduction of soluble Aβ oligomers in the brain following treatment with microglial cells of the present disclosure. [Figure 8B] Figure 8 shows the reduction of soluble Aβ oligomers in brains treated with microglial cells of the present disclosure. Human Aβ oligomers collected from soluble extracts of cortical (Figure 8A) and hippocampal (Figure 8B) samples from mice transplanted with PBS (n=13), wild-type microglia (WT; n=9), membrane-bound neprilysin-expressing microglia (NEP; n=11), and secreted neprilysin-expressing microglia (sNEP; n=9) were analyzed by MSD assay. Data are presented as mean ± SEM. Statistical significance is calculated using ANOVA with Tukey's post-hoc test. ns=not significant or p≧0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0044] [Figure 9A]We show that delivery of neprilysin by the methods of the present disclosure has no effect on synaptic density in wild-type MITRG mice (FIGS. 9A-9D), but reduces synaptic loss in 5x-MITRG (9E-9H) mice. [Figure 9B] We show that delivery of neprilysin by the methods of the present disclosure has no effect on synaptic density in wild-type MITRG mice (FIGS. 9A-9D), but reduces synaptic loss in 5x-MITRG (9E-9H) mice. [Figure 9C] We show that delivery of neprilysin by the methods of the present disclosure has no effect on synaptic density in wild-type MITRG mice (FIGS. 9A-9D), but reduces synaptic loss in 5x-MITRG (9E-9H) mice. [Figure 9D] We show that delivery of neprilysin by the methods of the present disclosure has no effect on synaptic density in wild-type MITRG mice (FIGS. 9A-9D), but reduces synaptic loss in 5x-MITRG (9E-9H) mice. [Figure 9E] We show that delivery of neprilysin by the methods of the present disclosure has no effect on synaptic density in wild-type MITRG mice (FIGS. 9A-9D), but reduces synaptic loss in 5x-MITRG (9E-9H) mice. [Figure 9F] We show that delivery of neprilysin by the methods of the present disclosure has no effect on synaptic density in wild-type MITRG mice (FIGS. 9A-9D), but reduces synaptic loss in 5x-MITRG (9E-9H) mice. [Figure 9G] We show that delivery of neprilysin by the methods of the present disclosure has no effect on synaptic density in wild-type MITRG mice (FIGS. 9A-9D), but reduces synaptic loss in 5x-MITRG (9E-9H) mice. [Figure 9H]We show that delivery of neprilysin by the disclosed method does not affect synapse density in wild-type MITRG mice (Figures 9A-9D), but reduces synapse loss occurring in 5x-MITRG (9E-9H) mice. Levels of the presynaptic marker, synaptophysin (SYP1), and the postsynaptic marker, PSD-95, in soluble cortical (9A, 9C, 9E, 9G) and hippocampal (9B, 9D, 9F, 9H) samples from mice transplanted with PBS (n=13), wild-type microglia (WT; n=9), membrane-bound neprilysin-expressing microglia (NEP; n=11), and secreted neprilysin-expressing microglia (sNEP; n=9) were analyzed by ELISA. Data are presented as mean ± SEM. Statistical significance is calculated using ANOVA with Tukey's post hoc test. ns=not significant or p≥0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0045] [Figure 10A] 13 shows that delivery of neprilysin by the methods of the present disclosure reduces astrogliosis in 5x-MITRG mice. [Figure 10B] 10A and 10B show that delivery of neprilysin by the disclosed method reduces astrogliosis in 5x-MITRG mice. 10A shows the levels of glial fibrillary acidic protein (GFAP) in soluble cortical (FIG. 10A) and hippocampal (FIG. 10B) samples of 5x-MITRG mice transplanted with PBS (n=13), wild-type microglia (WT; n=9), membrane-bound neprilysin-expressing microglia (NEP; n=11), and secreted neprilysin-expressing microglia (sNEP; n=9), analyzed by ELISA. Data are presented as mean±SEM. Statistical significance is calculated using ANOVA with Tukey's post-hoc test. ns=not significant or p≧0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0046] [Figure 11A]The present disclosure shows that targeted induction of neprilysin in response to Aβ pathology in microglial cells limits neprilysin's off-target degradation of additional neuropeptide substrates in vivo. [Figure 11B] The present disclosure shows that targeted induction of neprilysin in response to Aβ pathology in microglial cells limits neprilysin's off-target degradation of additional neuropeptide substrates in vivo. [Figure 11C] The present disclosure shows that targeted induction of neprilysin in response to Aβ pathology in microglial cells limits neprilysin's off-target degradation of additional neuropeptide substrates in vivo. [Figure 11D] We show that targeted induction of neprilysin in response to Aβ pathology in microglial cells limits off-target degradation of additional neuropeptide substrates of neprilysin in vivo. Levels of non-targeted neprilysin substrates bradykinin (FIGS. 11A-11B) and somatostatin (FIGS. 11C-11D) in soluble cortical (FIGS. 11A, 11C) and hippocampal (FIGS. 11B, 11D) samples from mice transplanted with PBS (n=13), wild-type microglia (WT; n=9), membrane-bound neprilysin-expressing microglia (NEP; n=11) and secreted neprilysin-expressing microglia (sNEP; n=9) were analyzed by ELISA. Data are presented as mean ± SEM. Statistical significance is calculated using ANOVA with Tukey's post-hoc test. ns=not significant or p≥0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0047] [Figure 12A] 1 shows in schematic form the in vivo experimental design described in the present disclosure. [Figure 12B] 1 shows in schematic form the in vivo experimental design described in the present disclosure.
[0048] [Figure 13]We show that amyloid pathology induces CD9 expression in human microglia, which results in highly localized induction of the neprilysin payload. Nuclei of many transplanted human microglia are shown (Ku80). However, CD9 expression, and therefore neprilysin induction, is restricted to human microglia adjacent to Amylo-Glo positive beta-amyloid plaques.
[0049] [Figure 14] 13 shows that hippocampal Aβ pathology is reduced by sNEP-expressing human microglia in vivo.
[0050] [Figure 15] Figure 1 shows that the number of medium and large AmyloGlo positive plaques is significantly reduced in vivo. Statistical significance is calculated using ANOVA with Tukey's post-hoc test. ns=not significant or p>0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0051] [Figure 16A] FIG. 1 shows the effect of human iPSC-microglia transplantation on Aβ protein in 5x-MITRG mice. [Figure 16B] FIG. 1 shows the effect of human iPSC-microglia transplantation on Aβ protein in 5x-MITRG mice. [Figure 16C] FIG. 1 shows the effect of human iPSC-microglia transplantation on Aβ protein in 5x-MITRG mice. [Figure 16D]Figure 16 shows the effect of human iPSC-microglia transplantation on Aβ protein in 5x-MITRG mice. Levels of human Aβ-42 peptide (Figures 16A-B) and human Aβ-40 peptide (Figures 16C-D) collected from soluble extracts of cortical (Figures 16A-C) and hippocampal (Figures 16B-D) samples from mice transplanted with PBS (n=13) and wild-type microglia (WT; n=9) analyzed by MSD assay. Data are presented as mean ± SEM. Statistical significance calculated using unpaired T-test. ns=not significant or p≧0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0052] [Figure 17A] FIG. 1 shows the effect of human iPSC-microglia transplantation on Aβ protein in 5x-MITRG mice. [Figure 17B] FIG. 1 shows the effect of human iPSC-microglia transplantation on Aβ protein in 5x-MITRG mice. [Figure 17C] FIG. 1 shows the effect of human iPSC-microglia transplantation on Aβ protein in 5x-MITRG mice. [Figure 17D] Figure 17 shows the effect of human iPSC-microglia transplantation on Aβ protein in 5x-MITRG mice. Levels of human Aβ-42 peptide (Figures 17A-B) and human Aβ-40 peptide (Figures 17C-D) collected from insoluble extracts of cortical (Figures 17A-C) and hippocampal (Figures 17B-D) samples from mice transplanted with PBS (n=13) and wild-type microglia (WT; n=9) analyzed by MSD assay. Data are presented as mean ± SEM. Statistical significance calculated using unpaired T-test. ns=not significant or p≧0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0053] [Figure 18A]FIG. 1 shows the effect of targeted delivery of neprilysin to Aβ protein in 5x-MITRG mice. [Figure 18B] FIG. 1 shows the effect of targeted delivery of neprilysin to Aβ protein in 5x-MITRG mice. [Figure 18C] FIG. 1 shows the effect of targeted delivery of neprilysin to Aβ protein in 5x-MITRG mice. [Figure 18D] Figure 18 shows the effect of targeted delivery of neprilysin on Aβ protein in 5x-MITRG mice. Levels of human Aβ-42 peptide (Figures 18A-B) and human Aβ-40 peptide (Figures 18C-D) collected from soluble extracts of cortical (Figures 18A-C) and hippocampal (Figures 18B-D) samples from mice transplanted with wild-type microglia (WT; n=9), membrane-bound neprilysin-expressing microglia (NEP; n=11) and secreted neprilysin-expressing microglia (sNEP; n=9) analyzed by MSD assay. Data are presented as mean ± SEM. Statistical significance was calculated using ANOVA with Tukey's post-hoc test. ns=not significant or p≧0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0054] [Figure 19A] FIG. 1 shows the effect of targeted delivery of neprilysin to Aβ protein in 5x-MITRG mice. [Figure 19B] FIG. 1 shows the effect of targeted delivery of neprilysin to Aβ protein in 5x-MITRG mice. [Figure 19C] FIG. 1 shows the effect of targeted delivery of neprilysin to Aβ protein in 5x-MITRG mice. [Figure 19D]Figure 19 shows the effect of targeted delivery of neprilysin on Aβ protein in 5x-MITRG mice. Levels of human Aβ-42 peptide (Figures 19A-B) and human Aβ-40 peptide (Figures 19C-D) collected from soluble extracts of cortical (Figures 19A-C) and hippocampal (Figures 19B-D) samples from mice transplanted with wild-type microglia (WT; n=9), membrane-bound neprilysin-expressing microglia (NEP; n=11) and secreted neprilysin-expressing microglia (sNEP; n=9) analyzed by MSD assay. Data are presented as mean ± SEM. Statistical significance was calculated using ANOVA with Tukey's post-hoc test. ns=not significant or p≧0.05; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001.
[0055] [Figure 20A] Volcano plots obtained from bulk RNA sequencing of four independent xMG strains are shown. [Figure 20B] Volcano plots obtained from bulk RNA sequencing of four independent xMG strains are shown. [Figure 20C] Volcano plots obtained from bulk RNA sequencing of four independent xMG strains are shown. [Figure 20D]Volcano plots obtained from bulk RNA sequencing of four independent xMG lines are shown. 5x-MITRG pups were transplanted with human microglial progenitor cells generated from four independent induced pluripotent stem cell lines. At 6 months of age, xMG were isolated from the brains of 5x-MITRG mice and subpopulations of xMG were separated by fluorescence-activated cell sorting (FACS). To enrich for plaque-associated disease-associated microglia (DAM), xMG were FACS sorted to isolate CD9 / HLA-DRB double positive microglia. In contrast, homeostatic microglia were isolated as negative for both CD9 and HLA-DRB expression. RNA was isolated from each of these samples and then analyzed by bulk RNA sequencing. The resulting bulk sequencing comparison between homeostatic and DAM xMG subpopulations revealed numerous genes that were significantly upregulated within DAM microglia. Nearly all DAM genes previously identified by single cell sequencing were again identified as enriched within the bulk sequenced DAM subpopulation. However, because bulk sequencing provided a much greater sequencing depth, many other significantly enriched DAM genes were identified, including those shown in
[0020] . Figures 20A-D provide volcano plots from these bulk sequencing comparisons from xMG derived from each of four independent induced pluripotent stem cell lines, with a subset of significantly enriched genes labeled. This analysis provided a more complete data set of plaque-induced human microglial genes described herein.
[0056] These plots compare flow cytometry (FAC) sorted CD9+ / HLA-DRB+ double positive plaque associated microglia to double negative homeostatic microglia. A subset of significant genes (FDR ≤ 0.05) with log2(fold change) ≥ 1 (at least a 2-fold increase) when comparing DAM to homeostatic subpopulations across patient lineages are shown in the plots, and the remainder are described below. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0057] The present disclosure relates to compositions and methods for treating diseases or conditions associated with amyloid beta-related pathology, such as, but not limited to, Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), and the like. More specifically, the present disclosure describes cells modified to express (and present or secrete) at least one therapeutic molecule that can alter at least one amyloid beta-related pathology phenotype. Such cells are modified such that the therapeutic molecule is expressed when the modified cells contact or are in close proximity to an amyloid beta-related pathology. Thus, one embodiment of the present disclosure may be generally implemented by generating cells that express a therapeutic molecule when the cells contact or are in close proximity to an amyloid beta-related pathology. Thus, the present disclosure also describes methods of making such cells, and methods of using such cells to treat diseases.
[0058] Before the present disclosure is further described, it should be understood that the present invention is not limited to the specific embodiment described, and therefore may of course vary.For example, the present invention is not limited to the embodiment related to Alzheimer's disease.It should also be understood that the terms used herein are only for the purpose of describing specific embodiments, and are not intended to be limiting, since the scope of the present invention is limited only by the claims.
[0059] It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, a compound refers to one or more compound molecules. Thus, the terms "a," "an," "one or more," and "at least one" may be used interchangeably. Similarly, the terms "comprising," "including," and "having" may be used interchangeably. It should be further noted that the claims may be drafted to exclude any element. Thus, this statement is intended to serve as a predicate for the use of exclusive terms such as "solely," "only," and the like in connection with the recitation of elements in the claims or the use of a "negative" limitation.
[0060] The publications described herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publications by prior invention. Further, the publication dates provided may be different from the actual publication dates, which may need to be independently confirmed. All publications mentioned herein are incorporated by reference to disclose and describe the related methods and / or materials for which the publications are cited.
[0061] The present disclosure relates to modified cells that express therapeutic molecules for treating diseases associated with amyloid beta-related pathology when the cells are in contact with or in close proximity to amyloid beta-related pathology.As used herein, "modified cells" are cells that have been intentionally altered, for example, using recombinant DNA technology, CRISPR technology, etc.The modified cells of the present disclosure can be generated, for example, by introducing at least one nucleotide sequence that codes for a therapeutic molecule that can change at least one amyloid beta-related pathology phenotype into a cell, and the nucleic acid sequence is inserted into the cell such that transcription of the nucleotide sequence occurs when the cells are in close proximity to or in contact with amyloid beta-related pathology.
[0062] The cells used to generate the modified cells of the present disclosure may be obtained commercially (i.e., purchased), may be obtained from cell culture (e.g., of previously banked cells), or may be obtained from an individual. As used herein, the terms "individual," "subject," and "patient" are well recognized in the art and are used interchangeably herein to refer to any human or other animal that may be treated using the cells of the present disclosure. Examples include, but are not limited to, humans and other primates, e.g., non-human primates, e.g., chimpanzees and other ape and monkey species; farm animals, e.g., cows, sheep, pigs, seals, goats, and horses; domestic mammals, e.g., dogs and cats; and laboratory animals, including rodents such as mice, rats, and guinea pigs. The terms "individual," "subject," and "patient" do not, by themselves, denote a particular age, sex, race, or the like. Thus, individuals of any age, whether male or female, are intended to be covered by the present disclosure, including, but not limited to, elderly, adults, children, infants, toddlers and infants.Similarly, unless otherwise specified, the cells and methods of the present disclosure may be derived from and / or applied to any race, including, for example, Caucasian (white), African American (black), Native American, Native Hawaiian, Hispanic, Latino, Asian, African (e.g., of African descent), and European.
[0063] To generate the modified cells of the present disclosure, any type of cell can be used that can be modified to express a therapeutic molecule when the cell is in close proximity to or in contact with Alzheimer's disease-related pathology. In some embodiments, the modified cells are generated using cells from a cell lineage that can differentiate into migratory cells. Examples of cells useful for generating the modified cells of the present disclosure include, but are not limited to, pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCSs), bone marrow progenitor or progenitor cells, erythromyeloid progenitor cells, hematopoietic stem and progenitor cells (HSPCs), umbilical cord blood stem cells, lymphoid progenitor cells, and megakaryocyte-erythroid (mk-ery) progenitor cells. In some embodiments, the cells used to generate the modified cells of the present disclosure can be pluripotent stem cells (PSCs), including induced PSCs (iPSCSs), progenitor cells, embryonic stem cells, or cells derived therefrom. As used herein, "pluripotent stem cells" (PSCs) refer to cells that have the ability to self-renew by division and develop into the three primary germ cell layers of the early embryo and thus into every cell of the adult. As used herein, "induced pluripotent stem cells" or "iPSCs" refer to a type of pluripotent stem cell that can be generated directly from somatic cells. In some embodiments, the cells used to generate the modified cells of the present disclosure can be circulating blood progenitor cells (e.g., bone marrow progenitor cells, CD34+ hematopoietic progenitor cells, or monocytes).
[0064] In some embodiments, the cells used to generate the modified cells of the present disclosure are inducible MGL (iMGL) cells, such as human iMGL (hiMGL) or microglia-like cells (MGL), including microglia progenitor cells. As used herein, "microglia progenitor cells" refers to biological cells that can differentiate into microglia or microglia-like cells. Microglia progenitor cells can include hematopoietic progenitor cells, erythromyeloid progenitor cells, primitive macrophages, and the like. Microglia progenitor cells can also be derived from pluripotent stem cells (PSCs), including induced pluripotent stem cells (iPSCs) and embryonic stem cells (ESCs). iMGL is further described in U.S. Patent No. 20200239844 and Abud et.al., Neuron, 2017:PMID:28426964, the disclosures of which are incorporated herein by reference in their entirety. In some embodiments, iMGL expresses microglial cell marker proteins such as P2RY12 and TREM2. In some embodiments, iMGL has higher expression of AXL, P2RY6, CCR6 or GPR84 than adult microglia. In some embodiments, iMGL has lower expression of CTSL, CTSD or NPL than adult microglia. In some embodiments, iMGL expresses mRNA sequences that indicate mitotic cell cycle process gene ontology. In some embodiments, iMGL decreases expression of FFAR2 and COL26A1 when cultured with rat hippocampal neurons. In some embodiments, iMGL increases expression of Siglec11 and Siglec12 when cultured with rat hippocampal neurons. In some embodiments, iMGL is differentiated in vitro. In some embodiments, iMGL expresses P2RY13 and OLFML3. In some embodiments, iMGL can phagocytose human synaptosomes. In some embodiments, iMGL has lower phagocytic activity against E. coli particles than macrophages. iMGL can phagocytose amyloid Aβ fibrils or tau oligomers. In some embodiments, IFNγ induces the secretion of TNFα, IL-8, CCL2, and CCL4 from iMGL.In some embodiments, IL-1β induces the secretion of TNFα, IL-8, CCL3, CCL4, and CXCL10 from iMGL. In some embodiments, ADP induces a transient calcium influx into iMGL. In some embodiments, iMGL migrates in response to ADP. In some embodiments, iMGL migrates into human brain organoids (BORG). In some embodiments, iMGL extends branching processes with BORG. In some embodiments, iMGL clusters near the site of injury in BORG. In some embodiments, iMGL is generated by contacting human induced hematopoietic progenitor cells (iHPCs) with a microglial differentiation medium that includes CSF-1, IL-34, and TGFβ1 or includes a CSF-1 mimetic, an IL-34 mimetic, and a TGFβ mimetic. In some embodiments, iMGLs are generated by plating human induced hematopoietic progenitor cells (iHPCs) onto a culture dish coated with a basement membrane protein and contacting the human iHPCs with a microglial differentiation medium comprising CSF-1; IL-34; CSF-1, IL-34, and TGFβ1; or a CSF-1 mimetic, an IL-34 mimetic, and a TGFβ mimetic.
[0065] As used herein, "microglia-like cells" or "iMGL" refers to microglia-like cells similar to fetal and adult microglia that can be derived from pluripotent stem cells (PSCs), including iPSCs and embryonic stem cells (ESCs). As used herein, "microglia" refers to the resident innate immune cells of the CNS that play a role in synaptic plasticity, neurogenesis, homeostatic function and immune activity.
[0066] Progenitor cells can be generated from PSCs, including iPSCs, using processes known in the art. Such progenitor cells can include, but are not limited to, hematopoietic progenitor cells, erythromyeloid progenitor cells, or primitive macrophages.
[0067] As used herein, "iPSC-derived microglial lineage cells" refers to human microglia-like cells (iMGL) or microglial progenitor cells that can be derived from iPSCs.
[0068] In various embodiments, the iMGL or microglial progenitor cells of the present disclosure can be generated from PSCs using processes known in the art. In some embodiments, the iMGL or microglial progenitor cells of the present disclosure can be generated from iPSCs or ESCs using processes known in the art. In some embodiments, the microglial progenitor cells can include hematopoietic progenitor cells, erythromyeloid progenitor cells or primitive macrophages. In some embodiments, the iMGL can be derived from microglial progenitor cells.
[0069] In some embodiments, the iMGL of the present disclosure can be generated by (i) differentiating PSCs using a medium supplemented with hematopoietic differentiation factors to generate inducible hematopoietic progenitor cells (iHPCs); (ii) isolating CD43+ iHPCs; (iii) differentiating the CD43+ iHPCs into human iMGLs using a microglial differentiation medium; and (iv) maturing the iMGLs. In some embodiments, the HPC generation technique allows for collection of the medium in which the precursors are enriched and delivered to (iii) without isolating the CD43+ iHPCs.
[0070] In some aspects, human microglia-like cells (hiMGL) of the present disclosure can be generated by (i) differentiating PSCs using medium supplemented with hematopoietic differentiation factors; and (ii) differentiating CD43+ iHPCs into iMGLs using microglia differentiation medium.
[0071] In some embodiments, the human microglia-like cells (hiMGL) of the present disclosure can be generated from a first type of cell, comprising (i) differentiating the first type of cell into an iHPC; and (ii) differentiating the iHPC to generate an iMGL. In some embodiments, the first type of cell is not a PSC or an ESC.
[0072] In some aspects, the human microglia-like cells (hiMGL) of the present disclosure may be generated by a method comprising differentiating iHPCs to generate iMGL.
[0073] In some aspects, the human microglia-like cells (hiMGL) of the present disclosure can be generated by a method comprising differentiating engineered iHPCs to generate engineered hiMGL, wherein the engineered iHPCs and the engineered hiMGL express a therapeutic molecule (e.g., membrane-bound neprilysin, soluble neprilysin, etc.).
[0074] The iMGL generated by any of the methods described herein may express any factor or any combination of factors that typical canonical microglial cells express. In some embodiments, the generated iMGL is c-kit- / CD45+. In some embodiments, the c-kit- / CD45+iMGL is detected using flow cytometry, immunofluorescence microscopy, qPCR, RNA-seq, or proteomics. In some embodiments, other cell types are detected using flow cytometry, immunofluorescence microscopy, qPCR, RNA-seq, or proteomics. In some embodiments, the generated iMGL comprises two distinct populations of iMGL: (1) CD45+ / CX3CR1-, and (2) CD45+ / CX3CR1+. In some embodiments, the generated iMGL is CD43+, CD235a+, or CD41+. In some embodiments, the generated iMGLs are CD43+ / CD235a+ / CD41+.
[0075] In some embodiments, the expression of TRIM14, CABLES1, MMP2, SIGLEC 11 and 12, MITF and / or SLC2A5 mRNA and / or protein may be enriched in the generated iMGL. In some embodiments, the expression of COMT, EGR2, EGR3 and / or FFAR2 mRNA and / or protein is enriched in the generated iMGL.
[0076] In some embodiments, iMGL can be provided that expresses a specific gene profile. Any of the iMGLs described herein can include gene expression profiles similar to canonical microglial cells. In some embodiments, any of the compositions of iMGLs described herein include expression of any of the following genes: RUNX1, PU.1, CSF1R, CX3CR1, TGFBR1, RSG10, GAS6, PROS1, P2RY12, GPR34, C1Q, CR3, CABLES1, BHLHE41, TREM2, ITAM, APOE, SLCO2B1, SLC7A8, PPARD, C9orf72, GRN, LRRK2, TARDBP, and CRYBB1. Any of the iMGLs disclosed herein may include expression of any of these genes, namely, RUNX1, SPI1, CSF1R, CX3CR1, TGFBR1, RSG10, GAS6, MERTK, PSEN2, PROS1, P2RY12, P2RY13, OLFML3, GPR34, C1Q, CR3, CABLES1, BHLHE41, TREM2, TYROBP, ITGAM, APOE, SLCO2B1, SLC7A8, PPARD, TMEM119, GPR56, C9orf72, GRN, LRRK2, TARDBP, and CRYBB1, in any combination.
[0077] In some embodiments, any of the compositions of iMGL described herein may co-express TREM2 and P2RY12. In some embodiments, any of the compositions of iMGL described herein may not express any one or more of the genes KLF2, TREM1, MPT, ITGAL and ADGRE5.
[0078] The cells used to generate the modified cells of the present disclosure can be autologous, allogeneic or xenogeneic. The term "autologous" as used herein refers to cells or tissues derived from one subject, and one subject can be both a donor and a recipient. The term "allogeneic" as used herein refers to cells of the same species that are genetically different from the cells being compared. The term "xenogeneic" as used herein refers to cells derived from a species different from the recipient. In certain embodiments, the modified cells can be autologous. In certain embodiments, the modified cells can be allogeneic. In certain embodiments, the modified cells can be xenogeneic.
[0079] In certain embodiments, the method includes administering (e.g., transplanting) modified cells of the present disclosure or compositions of the present disclosure (e.g., hiMGL) to the brain tissue of an individual. The methods disclosed herein may involve obtaining and modifying cells from a subject, and then administering (e.g., transplanting) the modified cells, e.g., hiMGL, back to the same subject. In other embodiments, the method may involve obtaining and modifying cells from a donor subject, and administering (e.g., transplanting) the modified cells (e.g., hiMGL) to a recipient subject. Furthermore, in some embodiments, the method may include obtaining and modifying cells from a donor species, and administering (e.g., transplanting) the modified cells (e.g., hiMGL) to a recipient species.
[0080] As used herein, "nucleic acid molecule," "nucleic acid," "nucleic acid sequence," and the like refer to polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, fragments produced by polymerase chain reaction (PCR), and fragments produced by either ligation, cleavage, endonuclease action, or exonuclease action. A nucleic acid molecule or nucleic acid sequence can be composed of monomers that are naturally occurring nucleotides (such as DNA and RNA), analogs of naturally occurring nucleotides (e.g., α-enantiomeric forms of naturally occurring nucleotides), or a combination of both. A nucleic acid molecule or nucleic acid sequence can be either single-stranded or double-stranded.
[0081] The introduction of nucleic acid molecules or sequences into cells to generate modified cells can be achieved using nucleic acid transfer methods known in the art. In some aspects, nucleic acid molecules or sequences can be introduced into cells using transfection, including viral vector-mediated transfection, conjugation, electroporation, liposome-mediated gene transfer, transduction, and direct transfer methods such as microinjection or particle bombardment. The nucleic acid molecules or sequences can be double-stranded or single-stranded linear nucleic acid molecules or sequences or circular nucleic acid molecules or sequences. In some aspects, the nucleic acid molecules or sequences can be in vectors such as plasmids or viral vectors.
[0082] In some embodiments, the nucleic acid or sequence comprises a nucleic acid vector. The terms "nucleic acid vector", "vector" and the like are used herein to refer to a nucleic acid molecule or sequence that can transfer or carry another nucleic acid molecule or sequence. The nucleic acid to be transferred can generally be linked to, e.g., inserted into, a vector nucleic acid molecule or vector nucleic acid sequence. The vector can contain a sequence that directs autonomous replication in the cell or can contain a sequence sufficient to allow integration into the host cell DNA. Useful vectors can include, for example, plasmids (e.g., DNA plasmids or RNA plasmids), transposons, cosmids, bacterial artificial chromosomes, and viral vectors. Useful viral vectors can include, for example, replication-defective retroviruses and replication-defective lentiviruses. In some embodiments, the nucleic acid vector that includes the nucleic acid molecule or nucleic acid sequence can remain in the cytoplasm of the modified cell.
[0083] In some embodiments, the nucleic acid sequence may be inserted into the genome of the modified cell. In some embodiments, the nucleic acid sequence may be inserted into the genome of the cell to form a "synthetic allele" of the cellular gene. The term "synthetic allele" refers to an allele of a gene in the genetic material of a cell that is modified compared to one or both alleles of the same gene in the genetic material of a reference cell from the same subject. In one non-limiting example, the reference cell is a diploid germline cell from the same subject. In another non-limiting example, the reference cell is a cell taken from the subject prior to therapeutic intervention according to the present disclosure. Synthetic alleles may be created by gene editing techniques known in the art and may differ genetically (e.g., in their nucleic acid sequences) and / or epigenetically (e.g., in their DNA methylation state, histone acetylation state, chromatin structure, or in other aspects that do not substantially change the coding sequence) from the non-synthetic allele of the same gene in the reference cell from the subject. Synthetic alleles may be modified in their coding and / or non-coding sequences. In some embodiments, the nucleic acid sequence may be inserted into the genome of the modified cell such that it is under the control of an endogenous promoter in the genome of the modified cell. In some embodiments, the nucleic acid sequence may be inserted within or downstream (i.e., following the 3' end) of a locus in the genome of the modified cell such that the nucleic acid sequence in the inserted nucleic acid sequence is under the control of a promoter of the locus. As used herein, a "locus" refers to a location in a genome that contains a particular gene, which may contain one or more exons and / or introns. Thus, the terms "locus" and "gene" may be used interchangeably herein. In some embodiments, the nucleic acid sequence is inserted within a gene or replaces all or a portion of a gene. In some embodiments, the nucleic acid sequence comprises a nucleic acid sequence that encodes a therapeutic protein, and the nucleic acid sequence is inserted into the locus such that the nucleic acid sequence is in frame with the coding sequence of the exon in the locus. In some embodiments, the nucleic acid sequence is inserted into the locus such that the nucleic acid sequence is in frame with any exon in the locus to produce a desired result. For example, in some embodiments, the exon may be the first exon in the locus.In some embodiments, the exon may be the last exon in the locus. As used herein, "in frame with the coding sequence of the exon," "in frame with the exon," and the like, mean that when an exon sequence and a nucleic acid sequence encoding a protein, such as a therapeutic protein, are linked, the linked sequences form a single open reading frame (ORF). In some embodiments, a first polynucleotide encoding a protease cleavage sequence or a self-cleaving peptide (e.g., a 2A peptide) may be inserted in frame between the exon sequence and the nucleic acid sequence encoding the therapeutic protein. The resulting encoded protein contains the protease cleavage sequence or the self-cleaving peptide between the amino acid sequence encoded by the exon sequence and the therapeutic protein, thereby allowing the therapeutic protein to be produced separately from, or independently of, the amino acid sequence encoded by the exon sequence. In some embodiments, a second polynucleotide encoding a secretory peptide signal sequence (SP) may be linked to the nucleic acid sequence encoding the therapeutic protein such that the sequence encoding the signal peptide is in frame with the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the nucleotide sequence encoding one or domains of a Therapeutic protein, e.g., the cytoplasmic domain and / or the transmembrane domain, may be deleted such that the Therapeutic protein lacks such domains.
[0084] Suitable gene editing techniques for inserting nucleic acid sequence into genome of modified cell can include any gene editing system known in the art.In some embodiments, suitable gene editing techniques can include conventional genome editing systems, such as conventional homologous recombination, ssODN homologous recombination; chemical systems, such as peptide NA systems; protein-based nuclease systems, such as meganuclease systems, zinc finger nuclease systems and TALEN systems; homing endonuclease (HE) systems, such as adeno-associated virus (AAA) systems; and RNA-protein-based systems, such as CRISPR systems, PRIME editing, etc.
[0085] As used herein, a "therapeutic molecule" refers to a molecule that, when administered to or expressed in an individual, reduces and / or eliminates and / or ameliorates and / or treats and / or prevents at least one amyloid beta-associated pathology phenotype. In some aspects, a therapeutic molecule may treat the primary cause of a disease. For example, a therapeutic molecule may reduce the number or amount of soluble or insoluble β-amyloid (Aβ) peptide oligomers, pyroglutamate Aβ, prefibrils, fibrils, and / or total plaque burden. In some embodiments, a therapeutic molecule may enhance amyloid proteolysis. In some embodiments, a therapeutic molecule may enhance microglial phagocytosis of amyloid beta. The present invention is not limited to the mechanism by which a therapeutic molecule affects (e.g., reduces, eliminates, ameliorates, treats, prevents, etc.) an amyloid beta-associated pathology phenotype. When generating the modified cells of the present disclosure, any type of therapeutic molecule may be used. The therapeutic molecule may be a therapeutic protein that may be a therapeutic RNA molecule or may be a membrane-bound or secreted protein. Therapeutic proteins useful for generating the modified cells of the present disclosure include, but are not limited to, enzymes, peptide or protein binding domains (e.g., antibodies or fragments thereof), nucleic acid binding proteins, chimeric proteins such as chimeric antigen receptors, anti-inflammatory proteins, thrombolytic proteins, immunomodulatory molecules, proteases, and metalloendopeptidases, one example of which is neprilysin. In some embodiments, the therapeutic protein is selected from the group consisting of enzymes, peptide or protein binding domains, nucleic acid binding proteins, chimeric proteins such as chimeric antigen receptors, anti-inflammatory proteins, thrombolytic proteins, proteases, and metalloendopeptidases. In some embodiments, the therapeutic protein is a metalloendopeptidase. In some embodiments, the therapeutic protein is neprilysin, and neprilysin may be membrane-bound or secreted neprilysin.
[0086] The therapeutic molecule can be a therapeutic RNA. The therapeutic RNA useful for generating the modified cell of the present disclosure includes, but is not limited to, inhibitors of mRNA translation (e.g., antisense molecules), molecules that interfere with RNA (e.g., RNAi), catalytically active RNA molecules (e.g., ribozymes), and RNA that binds to proteins and other ligands (e.g., aptamers). Methods for producing such molecules are known to those of skill in the art and are also disclosed in U.S. Patent Application Publication Nos. 2014 / 0303073, 2012 / 0232128, 2011 / 0118334, 2011 / 0033859, 2006 / 0089323, 2012 / 0263782, 2012 / 0301449, and 2004 / 0137429, the disclosures of which are incorporated herein by reference in their entireties.
[0087] In some embodiments, the therapeutic molecules of the present disclosure may affect (e.g., reduce) at least one amyloid beta-associated pathology phenotype. As used herein, the term "Alzheimer's disease-associated phenotype" refers to any observable characteristic or trait of Alzheimer's disease, e.g., behavior, which may include memory impairment, cognitive impairment, visual impairment, behavioral changes, personality changes, depression, and seizures. In some embodiments, the therapeutic molecules may alter (e.g., reduce, eliminate, prevent, ameliorate, etc.) at least one aspect of Alzheimer's disease-associated pathology. As used herein, "pathology" refers to anatomical and / or physiological changes resulting from disease. In Alzheimer's disease, β-amyloid (Aβ) protein is believed to play a critical role in the development of the disease. For example, fragments of β-amyloid (Aβ) peptide can aggregate to form plaques observed in the brains of Alzheimer's patients. The presence of such Aβ plaques may be considered Alzheimer's disease-associated pathology. Similarly, species of Aβ known as Aβ oligomers (AβOs) have been observed to increase significantly in the early stages of Alzheimer's disease and localize to or within synapses. The presence of such AβOs may also be considered Alzheimer's disease-related pathology. In addition, another characteristic of Alzheimer's patients is the presence of neurofibrillary tangles that contain threads of tau protein. The presence of such neurofibrillary tangles may also be considered Alzheimer's disease-related pathology. Thus, in some embodiments, at least one embodiment of Alzheimer's disease-related pathology may include the formation or presence of Aβ plaques, AβOs and / or neurofibrillary tangles.
[0088] As used herein, the term "amyloid beta-associated pathology phenotype" refers to any observable characteristic or trait of a disease or condition associated with amyloid beta-associated pathology, such as memory impairment, cognitive impairment, visual impairment, behavioral changes, personality changes, depression, and behavioral changes that may include seizures. In some embodiments, a therapeutic molecule can change (e.g., reduce, eliminate, prevent, ameliorate, etc.) at least one aspect of amyloid beta-associated pathology.
[0089] In certain embodiments, the therapeutic molecule is a therapeutic protein. Such a protein may have enzymatic activity and / or anti-inflammatory activity. In some embodiments, the therapeutic protein may have protease activity. In some embodiments, the therapeutic protein may be a metalloprotease, one example of which is neprilysin. In some embodiments, the therapeutic protein may be neprilysin. In some embodiments, the therapeutic protein comprises or consists of an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the therapeutic protein has neprilysin activity. In some embodiments, the therapeutic protein comprises or consists of an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, the therapeutic protein has neprilysin activity and the sequence differences are due to conservative amino acid substitutions. In some embodiments, the therapeutic protein comprises or consists of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3. In some embodiments, the therapeutic protein comprises SEQ ID NO:1. In some embodiments, the therapeutic protein comprises SEQ ID NO:2. In some embodiments, the therapeutic protein comprises SEQ ID NO:3. In some embodiments, the therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97% or at least 99% identical to SEQ ID NO:1. In some embodiments, the therapeutic protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97% or at least 99% identical to SEQ ID NO:2.In some embodiments, the therapeutic protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97% or at least 99% identical to SEQ ID NO:3.
[0090] [Table 1-1] [Table 1-2]
[0091] In the modified cells of the present disclosure, the nucleic acid sequence encoding the therapeutic molecule is operably linked to a pathology-responsive promoter. For example, expression of the encoded therapeutic molecule by the operably linked promoter can be induced by the presence of amyloid beta-related pathology. As used herein, "induced by the presence of amyloid beta-related pathology," "amyloid beta-related pathology-responsive," "pathology-responsive," and the like, mean that expression of the therapeutic molecule occurs when the modified cell is in proximity to or in contact with amyloid beta-related pathology. Without being bound by theory, it is believed that activation of the promoter operably linked to the nucleic acid sequence encoding the therapeutic molecule occurs in response to intrinsic and / or extrinsic signals resulting from contact of the cell with pathology or with molecules resulting from the presence of a degree of pathology. One example of such a signal is a signal that induces an "activated" or "disease-associated microglia" phenotype. In some embodiments, expression of the encoded therapeutic molecule is dependent on the modified cell being in proximity to or in contact with amyloid beta-related pathology. In some embodiments, expression of the encoded therapeutic molecule is dependent on the modified cell being in contact with amyloid beta-related pathology. In some embodiments, expression of the encoded therapeutic molecule is dependent on the modified cells being in proximity to or in contact with β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths.
[0092] In some embodiments, the nucleic acid sequence encoding a therapeutic molecule may be operably linked to a pathology-responsive promoter. As used herein, the term operably linked refers to two or more nucleic acid sequences or subsequences arranged such that they functionally interact to perform their intended function. For example, a promoter may be operably linked to a nucleic acid (e.g., coding) molecule if it is capable of controlling or regulating the transcription of a nucleic acid sequence in cis position within the nucleic acid sequence. Generally, but not necessarily, operably linked nucleic acid sequences are contiguous to each other. An operably linked promoter may generally be located upstream of the coding sequence, but is not necessarily contiguous to it. For example, a nucleic acid sequence encoding a therapeutic molecule may be inserted into a gene that contains several exons, placing the transcription of the nucleic acid sequence under the control of the promoter of the gene. When a nucleic acid sequence encoding a therapeutic molecule is linked in frame with the last exon of the gene, the nucleic acid sequence is under the control of the promoter of the gene, but potentially at a considerable distance from the promoter. Enhancers do not need to be contiguous to each other, as long as they aid in the transcription of the nucleic acid sequence. For this purpose, the enhancer may be located both upstream and / or downstream of the nucleic acid sequence, and in some cases at some distance from the nucleic acid sequence. A polyadenylation site is operably linked to a polynucleotide sequence if it is located at the 3' end of the sequence, so that transcription proceeds through the coding sequence to the polyadenylation signal. Thus, two or more operably linked nucleic acid sequences may or may not be in direct contact (i.e., may or may not be directly adjacent to each other in the viral vector genome).
[0093] As used herein, "amyloid beta-associated pathology-responsive promoter," "pathology-responsive promoter," and the like, refer to a promoter in a cell that activates transcription of a nucleotide sequence operably linked to the promoter when the cell is in proximity to or in contact with an amyloid beta-associated pathology. Thus, a nucleic acid sequence that encodes a therapeutic molecule for a disease and is operably linked to a pathology-responsive promoter in a cell is transcribed when the cell is in proximity to or in contact with an amyloid beta-associated pathology. Any promoter can be considered a pathology-responsive promoter, so long as the transcription of the promoter is activated when the cell containing the promoter is in proximity to or in contact with an amyloid beta-associated pathology. In some aspects, the pathology-responsive promoter is exogenous to the modified cell. In some aspects, the pathology-responsive promoter is endogenous to the modified cell. In some aspects, a nucleic acid sequence encoding a therapeutic molecule is inserted into the genome of the modified cell such that transcription of the sequence encoding the therapeutic molecule is under the control of a pathology-responsive promoter in the genome. Examples of pathology-responsive promoters useful for generating modified cells of the present disclosure include, but are not limited to, Dendrocyte Expressed Seven Transmembrane Protein (DCSTAMP) gene (Gene ID: 81501; MIM: 605933) promoter, CD9 (tetraspanin) gene (Gene ID: 928; MIM: 143030) promoter, CD44 gene (Gene ID: 960; MIM: 107269) promoter, Galectin3 (LGALS3) gene (Gene ID: 3958; MIM: 153619) promoter, Secreted Phosphoprotein 1 (SPP1) gene (Gene ID: 81502; MIM: 607106) promoter, Glycoprotein Nmb (GPNMB) gene (Gene ID: 10457; MIM: 604368) promoter, Major Histocompatibility Complex, Class II, DR Beta (HLA-DRB1) gene (Gene ID: 3123; MIM: 142857) promoter, Lipoprotein Lipase (LPL) gene (Gene ID: 4023;MIM:609708) promoter, Lipase A (LIPA) gene (gene ID:3988; MIM:613497) promoter, Fatty Acid Binding Protein 3 (FABP3) gene (gene ID:2170; MIM:134651) promoter, Membrane Spanning 4-Domains A6A (MS4A6A) gene (gene ID:64231; MIM:606548) promoter, CXC Motif Chemokine Receptor 4 (CXCR4) gene (gene ID:7852; MIM:162643) promoter, Chitinase-3-like protein 1 (CHI3L1) gene (gene ID:1116; MIM:601525) promoter, Oxidized low-density lipoprotein receptor 1 (OLR1) gene (gene ID: 4973; MIM: 602601) promoter, CD36 gene (gene ID: 948; MIM: 173510) promoter, Signaling Lymphocyte Activating Molecule (SLAM) F8 (SLAMF8) gene (gene ID: 56833; MIM: 606620) promoter, Triggering Receptor Expressed On Myeloid Cells 2 (TREM2) gene (gene ID: 54209; MIM: 605086) promoter, Macrophage Scavenger Receptor 1 (MSR1) gene (gene ID: 4481; MIM: 153622) promoter, Beta-2 Microglobulin (B2M) gene (gene ID: 567; MIM: 109700) promoter, Integrin Subunit Alpha X (ITGAX) gene (Gene ID: 3687; MIM: 151510) promoter, and Melanocyte Inducing Transcription Factor (MITF) gene (Gene ID: 4286; MIM: 156845) promoter.
[0094] Other non-limiting examples of pathology-responsive promoters useful for generating modified cells of the present disclosure include, but are not limited to, HLA-DRB3, HLA-DRB5, HLA-DRA, CHIT1, DKK2, HLA-DQB1, PLXNA1, CCR7, HLA-DPA1, RGCC, COX6A2, HLA-DRB1, HLA-DPB1, TAFA3, FAIM2, ZNF804A, LGALS1, DOK2, HLA-DOA, GPR153, SLPI, ADGRF5, MYOZ1, HBEGF, BHLHE40, TMEM37, SLC16A8, G RM5, S100A4, GABRB1, LONRF3, PIGR, RAB7B, BIRC7, FABP5, CA2, FCMR, GABRB3, ATF7-NPFF, ANXA2, EGR2, OR9G1, IFNLR1, APOC1, CD200R1, PKD2L1, TDRD6 , HLA-DMA, KCNJ5, GLDN, PREX2, OLFM2, PADI2, COL1A2, RRAGD, ROR2, PTCRA, EDN1, RAMP1, BCL2A1, CD83, CHST2, DAGLA, MAFB, DUSP2, FPR3, DPYD, PHLDA1, PTPRG, IER5L, CPNE8, MPDZ, RNF152, PTGER4, MCF2, SDS, CIITA, RGS16, ANGPTL6, PLA2G7, CCL3, ATF3, RAB42, TBX18, STARD13, NR4A3, S100A13, TRDN, GA DD45G, ADRA1B, LYPD1, FXYD6, EPHB6, FERMT2, ART4, TNFSF18, TNFSF15, SLC38A4, CDH6, SCIN, FGR, ZNF385B, FUT9, SORCS1, KLF10, CFD, TRPM1, FLVCR2, N FIL3, MYO1E, ITPRID1, SLC47A1, LITAF, RASGEF1B, DENND2D, ADCY3, SYTL3, ARL4C, IL4I1, CDCP1, TRERF1, VAT1, INPP1, ARRDC4, ENPP1, GSDME, APOC2, C OL4A1, CDKN1A, KCNC4, KCNJ2, USP2, UNC13B, VEGFB, TNFAIP2, SLC35F2, HLA-DMB, NAB2, ACP5, CYTL1, FXYD5, ALDH1A2, TMEM176B, TAGLN2, TIMD4, MEP1A,ADGRL2, FAM20C, LRRC39, CD74, RASGRP3, HEG1, TNFRSF14, ADGRE2, FAM110B, GADD45B, TSKU, ID2, ADGRD1, DUSP10, TNFSF13B, FKBP5. MYC, BCL6, TNFAIP8L3, ARID5B, APOC4-APOC2, PMAIP1, P2RY8, CCRL2, RNASE1, LSP1, ARHGEF3, CLEC19A, KCNQ5, DTNA, PILRA, WIPF3, C.S STB, XYLT1, DBI, SDC2, KCNMA1, ALCAM, TSPAN4, RPS28, KLHDC8B, M.S BOAT1, FAM20A, CDH8, NAP1L1, SMIM4, ALAS1, PDLIM7, IQGAP2, INPP 4B, TRIM58, SLC36A1, TXN, HLA-B, HSPB1, AP1S2, PLAU, HLA-DQA1 CYSTM1, IER5, MS4A7, SPN, CTSD, SELENOP, SDSL, CD14, HLA-F, B3GA LNT1, GAPT, RASSF3, GAS7, GAS2L3, GPD2, CPM, SGPP1, LILRA4, NEB PRXL2C, SNX24, PPARG, CAPG, CD6, INHBA, PTPN7, LYRM9, ATOX1, UG CG, TMSB10, IFI30, M1AP, SH3BGRL3, CMYA5, PRKCH, NIBAN1, GK, HS D3B7, GPR65, LGALS9, RPL36, SH3RF1, WWC3, ALDH5A1, SNTB2, HACD4 LTA4H, SCIMP, SLC11A1, PTPDC1, CPNE2, CALHM2, PRDX1, APOE, IQ GAP1, OSBPL3, GRK3, DPEP2, TMEM154, FOXP1, GYPC, SLC15A3, NENF. HPSE, TNFRSF11A, PPM1M, HPCAL1, SLC46A1, SLC1A3, MORC1, GABARA PL1, MGLL, TGIF1, ZYX, MAP4, and MFSD2A are the same (range 20A~range 20D).
[0095] In certain embodiments, the pathology-responsive promoter comprises CD9 gene promoter or its functional variant.As used herein, "functional variant" refers to a promoter that has at least 95% identical nucleotide sequence with the native promoter and has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97% or at least 99% of the activity of the native promoter.The present invention is not limited to the above-mentioned pathology-responsive promoter.
[0096] Up to now, modified cells encoding therapeutic molecules have been generally described, and their expression is under the control of a pathology-responsive promoter.Here, a detailed embodiment of one such cell is described.It should be understood that such description is not intended to limit the present disclosure to a specific embodiment, but is provided only to help illustrate one possible embodiment using specific elements of the present disclosure.
[0097] One aspect of the present disclosure is a modified microglia-like (iMGL) cell comprising a nucleic acid sequence encoding a therapeutic molecule, which may be a therapeutic protein, wherein the nucleic acid sequence is operably linked to a pathology-responsive promoter, and the therapeutic protein is capable of reducing at least one amyloid beta-associated pathology phenotype. In some embodiments, the pathology-responsive promoter comprises a promoter from a gene selected from the group consisting of DCSTAMP gene, CD9 gene, CD44 gene, LGALS3 gene, SPP1 gene, GPNMB gene, HLA-DRB gene, LPL gene, LIPA, FABP3 gene, MS4A6A gene, CXCR4 gene, CHI3L1 gene, OLR1 gene, CD36 gene, SLAMF8 gene, TREM2 gene, MSR1 gene, B2M gene, ITGAX gene and MITF gene. In some embodiments, the nucleic acid sequence may be inserted into a gene selected from the group consisting of the DCSTAMP gene, the CD9 gene, the CD44 gene, the LGALS3 gene, the SPP1 gene, the GPNMB gene, the HLA-DRB gene, the LPL gene, the LIPA, the FABP3 gene, the MS4A6A gene, the CXCR4 gene, the CHI3L1 gene, the OLR1 gene, the CD36 gene, the SLAMF8 gene, the TREM2 gene, the MSR1 gene, the B2M gene, the ITGAX gene, and the MITF gene. In some embodiments, the nucleic acid sequence can be inserted into the genome of the iMGL cell such that the nucleic acid sequence is operably linked to an endogenous promoter of a gene selected from the group consisting of the DCSTAMP gene, the CD9 gene, the CD44 gene, the LGALS3 gene, the SPP1 gene, the GPNMB gene, the HLA-DRB gene, the LPL gene, the LIPA, the FABP3 gene, the MS4A6A gene, the CXCR4 gene, the CHI3L1 gene, the OLR1 gene, the CD36 gene, the SLAMF8 gene, the TREM2 gene, the MSR1 gene, the B2M gene, the ITGAX gene and the MITF gene.In some embodiments, the nucleic acid sequence may be inserted into a gene selected from the group consisting of DCSTAMP gene, CD9 gene, CD44 gene, LGALS3 gene, SPP1 gene, GPNMB gene, HLA-DRB gene, LPL gene, LIPA, FABP3 gene, MS4A6A gene, CXCR4 gene, CHI3L1 gene, OLR1 gene, CD36 gene, SLAMF8 gene, TREM2 gene, MSR1 gene, B2M gene, ITGAX gene and MITF gene, such that the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with an exon of the gene. In some embodiments, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the first exon of the gene. In some embodiments, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the last exon of the gene. In some embodiments, a first polynucleotide encoding a protease cleavage sequence or a self-cleaving peptide can be inserted between an exon and a nucleic acid sequence encoding a therapeutic protein, such that the first polynucleotide is in frame with the exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, a second polynucleotide encoding a secretory peptide signal sequence (SP) can be linked to a nucleic acid sequence encoding a therapeutic protein, and the second polynucleotide can be inserted between the first polynucleotide and a nucleic acid sequence encoding a therapeutic protein, such that the encoded signal peptide is in frame with the exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the therapeutic protein can be a metalloprotease. In some embodiments, the therapeutic protein can be neprilysin, and the neprilysin can be secretory neprilysin or membrane-bound neprilysin. In some embodiments, a therapeutic protein may comprise or consist of an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the encoded therapeutic protein has neprilysin activity.In some embodiments, the encoded therapeutic protein may comprise or consist of an amino acid sequence at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, wherein the encoded therapeutic protein has neprilysin activity, and wherein the differences between the amino acid sequence of the therapeutic protein and SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3 are due to conservative amino acid substitutions. In some embodiments, the encoded protein may comprise or consist of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3.
[0098] One aspect of the present disclosure is a modified microglia-like (iMGL) cell comprising a nucleic acid sequence comprising a nucleic acid sequence encoding a therapeutic protein, the nucleic acid sequence being operably linked to a pathology-responsive promoter, and the therapeutic protein being capable of reducing at least one amyloid beta-associated pathology. In some aspects, the pathology-responsive promoter is a CD9 gene promoter. In some aspects, the nucleic acid sequence can be inserted into the genome of the iMGL cell such that the nucleic acid sequence is operably linked to an endogenous CD9 promoter. In some aspects, the nucleic acid sequence can be inserted into the CD9 locus. In some aspects, the nucleic acid sequence can be inserted into the CD9 locus such that the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with an exon of the CD9 gene. In some aspects, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the first exon of the CD9 gene. In some aspects, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the last exon of the CD9 gene. In some embodiments, a first polynucleotide encoding a protease cleavage sequence or a self-cleaving peptide can be inserted between the CD9 exon and the nucleic acid sequence encoding the therapeutic protein, such that the first polynucleotide is in frame with the CD9 exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, a second polynucleotide encoding a secretory peptide signal sequence (SP) can be linked to the nucleic acid sequence encoding the therapeutic protein, and the second polynucleotide can be inserted between the first polynucleotide and the nucleic acid sequence encoding the therapeutic protein, such that the encoded signal peptide is in frame with the CD9 exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the therapeutic protein can be a metalloprotease. In some embodiments, the therapeutic protein can be neprilysin, and the neprilysin can be secretory neprilysin or membrane-bound neprilysin.In some embodiments, the therapeutic protein may comprise or consist of an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the encoded therapeutic protein has neprilysin activity. In some embodiments, the encoded therapeutic protein may comprise or consist of an amino acid sequence at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the encoded therapeutic protein has neprilysin activity, and the differences between the amino acid sequence of the therapeutic protein and SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3 are due to conservative amino acid substitutions. In some embodiments, the encoded protein may comprise or consist of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3. In some embodiments, the encoded therapeutic protein comprises SEQ ID NO:1. In some embodiments, the encoded therapeutic protein comprises SEQ ID NO:2. In some embodiments, the encoded therapeutic protein comprises SEQ ID NO:3. In some embodiments, the encoded therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO: 1. In some embodiments, the encoded therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO: 2. In some embodiments, the encoded therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO: 3.
[0099] One aspect of the present disclosure is a modified microglia-like (MGL) cell comprising a nucleic acid sequence encoding a therapeutic protein, the nucleic acid sequence being inserted into the CD9 locus of the genome of the cell such that the nucleic acid sequence encoding the therapeutic protein is in frame with at least a portion of the coding sequence of an exon of the CD9 gene, and a first polynucleotide encoding a protease cleavage sequence or self-cleaving peptide inserted between at least a portion of the coding sequence of an exon of the CD9 gene and the nucleic acid sequence encoding the therapeutic protein such that the encoded protease cleavage site or self-cleaving peptide is in frame with at least a portion of the coding sequence of an exon of the CD9 gene and the nucleic acid sequence encoding the therapeutic protein, wherein transcription from the CD9 promoter results in an mRNA encoding a hybrid protein comprising the amino acid sequence encoded by at least a portion of the coding sequence of the first exon of the CD9 gene, the protease cleavage sequence or self-cleaving peptide, and the therapeutic protein. In some aspects, the carboxyl terminus of at least a portion of the encoded CD9 amino acid sequence is linked to the amino terminus of the protease cleavage sequence or self-cleaving peptide sequence. In some embodiments, the carboxy terminus of the protease cleavage sequence or the self-cleaving peptide sequence is linked to the amino terminus of the therapeutic protein. In some embodiments, the modified MGL cell comprises a second polynucleotide encoding a secretory peptide signal sequence (SP) linked to the nucleic acid sequence encoding the therapeutic protein, and the encoded signal peptide is in frame with the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the modified MGL cell comprises a second polynucleotide encoding a secretory peptide signal sequence (SP) between the first polynucleotide and the nucleic acid sequence encoding the therapeutic protein, and the encoded signal peptide is in frame with the nucleic acid sequence encoding the therapeutic protein. Examples of such embodiments are shown in Figures 2A and 2B. In some embodiments, the therapeutic protein can be a metalloprotease. In some embodiments, the therapeutic protein can be neprilysin, and the neprilysin can be secretory neprilysin or membrane-bound neprilysin.In some embodiments, the therapeutic protein may comprise or consist of an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the encoded therapeutic protein has neprilysin activity. In some embodiments, the encoded therapeutic protein may comprise or consist of an amino acid sequence at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the encoded therapeutic protein has neprilysin activity, and the differences between the amino acid sequence of the therapeutic protein and SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3 are due to conservative amino acid substitutions. In some embodiments, the encoded protein may comprise or consist of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3. In some embodiments, the encoded protein comprises SEQ ID NO:1. In some embodiments, the encoded therapeutic protein comprises SEQ ID NO:2. In some embodiments, the encoded therapeutic protein comprises SEQ ID NO:3. In some embodiments, the encoded therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO: 1. In some embodiments, the encoded therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO: 2. In some embodiments, the encoded therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO: 3.
[0100] One aspect of the present disclosure is a therapeutic composition comprising an effective number of modified cells of the present disclosure.Such compositions can be formulated for administration to individuals with diseases that can be treated by the therapeutic protein expressed by the modified cells in the composition.In some aspects, the compositions of the present disclosure can be used to treat and / or improve and / or prevent diseases associated with amyloid beta-related pathology.
[0101] In some embodiments, the compositions of the present disclosure may include modified cells comprising a nucleic acid sequence that includes a nucleic acid sequence encoding a therapeutic protein, the nucleic acid sequence is operably linked to a pathology-responsive promoter, and the therapeutic protein can reduce at least one amyloid beta-related pathology phenotype. In some embodiments, the nucleic acid sequence may be inserted into a gene selected from the group consisting of DCSTAMP gene, CD9 gene, CD44 gene, LGALS3 gene, SPP1 gene, GPNMB gene, HLA-DRB gene, LPL gene, LIPA, FABP3 gene, MS4A6A gene, CXCR4 gene, CHI3L1 gene, OLR1 gene, CD36 gene, SLAMF8 gene, TREM2 gene, MSR1 gene, B2M gene, ITGAX gene and MITF gene. In some embodiments, the nucleic acid sequence can be inserted into the genome of the iMGL cell such that the nucleic acid sequence is operably linked to an endogenous promoter of a gene selected from the group consisting of the DCSTAMP gene, the CD9 gene, the CD44 gene, the LGALS3 gene, the SPP1 gene, the GPNMB gene, the HLA-DRB gene, the LPL gene, the LIPA, the FABP3 gene, the MS4A6A gene, the CXCR4 gene, the CHI3L1 gene, the OLR1 gene, the CD36 gene, the SLAMF8 gene, the TREM2 gene, the MSR1 gene, the B2M gene, the ITGAX gene and the MITF gene. In some embodiments, the nucleic acid sequence may be inserted into a gene selected from the group consisting of DCSTAMP gene, CD9 gene, CD44 gene, LGALS3 gene, SPP1 gene, GPNMB gene, HLA-DRB gene, LPL gene, LIPA, FABP3 gene, MS4A6A gene, CXCR4 gene, CHI3L1 gene, OLR1 gene, CD36 gene, SLAMF8 gene, TREM2 gene, MSR1 gene, B2M gene, ITGAX gene and MITF gene such that the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the first exon of the gene. In some embodiments, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the first exon of the gene.In some embodiments, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the last exon of the gene. In some embodiments, a first polynucleotide encoding a protease cleavage sequence or a self-cleaving peptide can be inserted between the exon and the nucleic acid sequence encoding the therapeutic protein such that the first polynucleotide is in frame with the exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, a second polynucleotide encoding a secretory peptide signal sequence (SP) can be linked to the nucleic acid sequence encoding the therapeutic protein, and the second polynucleotide can be inserted between the first polynucleotide and the nucleic acid sequence encoding the therapeutic protein such that the encoded signal peptide is in frame with the exon and the nucleic acid sequence encoding the therapeutic protein.
[0102] In some embodiments, the Alzheimer's disease-related pathology-responsive promoter is the CD9 gene promoter. In some embodiments, the nucleic acid sequence can be inserted into the genome of the iMGL cell such that the nucleic acid sequence is operably linked to the endogenous CD9 promoter. In some embodiments, the nucleic acid sequence can be inserted into the CD9 locus. In some embodiments, the nucleic acid sequence can be inserted into the CD9 locus such that the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with an exon of the CD9 gene. In some embodiments, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the first exon of the CD9 gene. In some embodiments, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the last exon of the CD9 gene. In some embodiments, the first polynucleotide encoding a protease cleavage sequence or a self-cleaving peptide can be inserted between the CD9 exon and the nucleic acid sequence encoding the therapeutic protein such that the first polynucleotide is in frame with the CD9 exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, a second polynucleotide encoding a secretory peptide signal sequence (SP) may be linked to the nucleic acid sequence encoding the therapeutic protein, and the second polynucleotide may be inserted between the first polynucleotide and the nucleic acid sequence encoding the therapeutic protein, such that the encoded signal peptide is in frame with the CD9 exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the therapeutic protein may be a metalloprotease. In some embodiments, the therapeutic protein may be neprilysin, and the neprilysin may be secretory neprilysin or membrane-bound neprilysin. In some embodiments, the therapeutic protein may comprise or consist of an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the encoded therapeutic protein has neprilysin activity.In some embodiments, the encoded therapeutic protein may comprise or consist of an amino acid sequence at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the encoded therapeutic protein has neprilysin activity, and the differences between the amino acid sequence of the therapeutic protein and SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3 are due to conservative amino acid substitutions. In some embodiments, the encoded protein may comprise or consist of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3. In some embodiments, the encoded therapeutic protein comprises SEQ ID NO:1. In some embodiments, the encoded therapeutic protein comprises SEQ ID NO:2. In some embodiments, the encoded therapeutic protein comprises SEQ ID NO:3. In some embodiments, the encoded therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1. In some embodiments, the encoded therapeutic protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO: 2. In some embodiments, the encoded therapeutic protein comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:3.
[0103] The therapeutic composition according to the present disclosure may be administered using any route suitable for the disease to be treated. Examples of administration routes that may be used include, but are not limited to, oral, parenteral, intravascular, intravenous, intramuscular, stereotactic, intracerebral, intracranial, intraventricular, and intradermal administration. In certain embodiments, it may be advantageous to apply the pharmaceutical composition described above via intravenous injection or by direct injection into the target tissue. For example, for systemic application, intravenous, intravascular, intramuscular, stereotactic, intraparenchymal, or intraventricular may be preferred. Subcutaneous, intradermal, intradermal, intralobally, intramedullary, or directly in or near the tissue to be treated, as well as localized application may be performed. Depending on the desired duration and effectiveness of the treatment, the composition according to the present disclosure may be administered once or several times, and also intermittently, for example, daily for several days, weeks, or months, and in different dosages.
[0104] In various embodiments, the therapeutic compositions described herein are administered on a monthly dosing schedule. In other embodiments, the therapeutic compositions are administered every other week. In still other embodiments, the therapeutic compositions are administered weekly. In certain embodiments, the therapeutic compositions are administered daily. In selected embodiments, the therapeutic compositions are administered twice daily. In certain embodiments, the therapeutic compositions are administered for at least 3 months, at least 6 months, at least 12 months, or more. In some embodiments, the therapeutic compositions are administered for at least 18 months, 2 years, 3 years, or more.
[0105] In some embodiments, the target tissue comprises brain tissue. In some embodiments, the target tissue comprises one or more target brain regions. In some embodiments, the target tissue comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more target brain regions.
[0106] In some embodiments, the target brain region comprises the cerebral cortex. In some embodiments, the target brain region comprises one or more subregions of the cerebral cortex. In some embodiments, the target brain region comprises the medial prefrontal cortex or a subregion thereof. In some embodiments, the target brain region comprises the anterior cingulate cortex or a subregion thereof. In some embodiments, the target brain region comprises the primary sensory cortex or the sensory association cortex.
[0107] In some embodiments, the target brain region comprises a ventricle, hi some embodiments, the ventricle comprises a lateral ventricle, a third ventricle, or a fourth ventricle.
[0108] In some embodiments, the target brain region comprises the hippocampus or a subregion thereof. In some embodiments, the target brain region comprises the CA1 region of the hippocampus. In some embodiments, the target brain region comprises the CA3 region of the hippocampus. In some embodiments, the target brain region comprises the dentate gyrus of the hippocampus. In some embodiments, the target brain region comprises the CA2 region of the hippocampus. In some embodiments, the target brain region comprises the septal area or fornix of the hippocampus. In some embodiments, the target brain region comprises the entorhinal cortex. In some embodiments, the target brain region comprises the amygdala or a subregion thereof.
[0109] In some embodiments, the target brain region comprises the basal ganglia nucleus. In some embodiments, the target brain region comprises the basal ganglia nucleus. In some embodiments, the basal ganglia nucleus comprises the globus pallidus. In some embodiments, the basal ganglia nucleus comprises the substantia nigra pars compacta or the substantia nigra pars reticulata. In some embodiments, the basal ganglia nucleus comprises the striatum. In some embodiments, the basal ganglia nucleus comprises the caudate-putamen. In some embodiments, the basal ganglia nucleus comprises the subthalamic nucleus.
[0110] The mode of administration, dosage, and optimal formulation can be determined according to criteria generally considered in establishing an appropriate treatment for an individual, such as age or weight, the severity of its general condition, tolerance to treatment, and any secondary effects described.
[0111] Formulations designed for injection into bodily fluid systems require appropriate isotonicity and pH buffering for the corresponding level of bodily fluids. Isotonicity can be appropriately adjusted as necessary using sodium chloride and other salts. Suitable solvents can be used to increase the solubility of the components in the formulation and the stability of liquid preparations. Additional additives that can be used in the composition include, but are not limited to, dextrose, conventional antioxidants, and conventional chelating agents. Parenteral dosage forms must also be sterilized before use.
[0112] One embodiment is a method of treating Alzheimer's in an individual, comprising administering to the individual a modified cell of the present disclosure or a composition comprising the modified cell of the present disclosure. As used herein, "treating Alzheimer's disease," "treating Alzheimer's," and the like, refers to reducing the frequency or severity of at least one Alzheimer's disease-related phenotype, and / or at least one aspect of Alzheimer's disease-related pathology. In some embodiments, treating Alzheimer's in an individual comprises reducing the incidence or severity of at least one observable characteristic or trait selected from the group consisting of memory impairment, learning deficits, cognitive impairment, visual impairment, behavioral changes, personality changes, depression, and seizures. In some embodiments, treating Alzheimer's in an individual can comprise reducing the amount of Aβ peptide in the individual's brain. In some embodiments, treating Alzheimer's in an individual can include reducing the size or number of Aβ peptide plaques or soluble or insoluble Aβ protein, oligomers, pyroglutamate Aβ, prefibrils or fibrils in the individual's brain, or the amount of Aβ peptide within Aβ peptide plaques in the individual's brain.
[0113] One embodiment is a method of treating a disease or condition associated with amyloid beta-related pathology in an individual, comprising administering to the individual a modified cell of the present disclosure or a composition comprising the modified cell of the present disclosure. As used herein, "treating a disease or condition associated with amyloid beta-related pathology," "treating amyloid beta-related pathology," and the like, refers to reducing the frequency or severity of at least one amyloid beta-related pathology phenotype, and / or at least one aspect of amyloid beta-related pathology. In some embodiments, treating a disease or condition associated with amyloid beta-related pathology in an individual comprises reducing the incidence or severity of at least one observable characteristic or trait selected from the group consisting of memory impairment, learning deficits, cognitive impairment, visual impairment, behavioral changes, personality changes, depression, and seizures. In some embodiments, treating a disease or condition associated with amyloid beta-related pathology in an individual may comprise reducing the amount of Aβ peptide in the brain of the individual. In some embodiments, treating a disease or condition associated with amyloid beta-related pathology in an individual can include reducing the size or number of Aβ peptide plaques or soluble or insoluble Aβ protein, oligomers, pyroglutamate Aβ, prefibrils or fibrils in the individual's brain, or the amount of Aβ peptide within Aβ peptide plaques in the individual's brain.
[0114] One aspect is a method of treating a disease or condition associated with amyloid beta-related pathology in an individual, comprising administering to the individual a modified cell comprising a nucleic acid sequence encoding a therapeutic protein, the nucleic acid sequence being operably linked to a pathology-responsive promoter, and the therapeutic protein being capable of reducing at least one amyloid beta-related pathology phenotype or amyloid beta-related pathology. In some aspects, the pathology-responsive promoter comprises a promoter from a gene selected from the group consisting of DCSTAMP gene, CD9 gene, CD44 gene, LGALS3 gene, SPP1 gene, GPNMB gene, HLA-DRB gene, LPL gene, LIPA, FABP3 gene, MS4A6A gene, CXCR4 gene, CHI3L1 gene, OLR1 gene, CD36 gene, SLAMF8 gene, TREM2 gene, MSR1 gene, B2M gene, ITGAX gene and MITF gene. For example, in some embodiments, the promoter comprises the promoter of the CD9 gene. In some embodiments, the promoter comprises the promoter of the LGALS3 gene. In some embodiments, the promoter comprises a promoter of the HLA-DRB gene. In some embodiments, the promoter comprises a promoter of the CD11c (ITGAX) gene. In some embodiments, the promoter comprises a promoter of a gene selected from CD9, LGALS3, HLA-DRB, and CD11c. In some embodiments, the promoter comprises a promoter of a gene selected from CD9, LGALS3, HLA-DRB, TREM2, and CD11c. In some embodiments, the promoter comprises a promoter of a gene selected from CD9, LGALS3, HLA-DRB, TREM2, and CD11c. In some embodiments, the promoter comprises a promoter of the DCSTAMP gene. In some embodiments, the promoter comprises a promoter of the CD44 gene. In some embodiments, the promoter comprises a promoter of the SPP1 gene. In some embodiments, the promoter comprises a promoter of the GPNMB gene. In some embodiments, the promoter comprises a promoter of the LPL gene. In some embodiments, the promoter comprises a promoter of the LIPA gene. In some embodiments, the promoter comprises a promoter of the FABP3 gene.In some embodiments, the promoter comprises the promoter of the MS4A6A gene. In some embodiments, the promoter comprises the promoter of the CXCR4 gene. In some embodiments, the promoter comprises the promoter of the CHI3L1 gene. In some embodiments, the promoter comprises the promoter of the OLR1 gene. In some embodiments, the promoter comprises the promoter of the CD36 gene. In some embodiments, the promoter comprises the promoter of the SLAMF8 gene. In some embodiments, the promoter comprises the promoter of the TREM2 gene. In some embodiments, the promoter comprises the promoter of the MSR1 gene. In some embodiments, the promoter comprises the promoter of the B2M gene. In some embodiments, the promoter comprises the promoter of the MITF gene. As explained above, the present invention is not limited to the promoters mentioned above.
[0115] In some embodiments, the nucleic acid sequence may be inserted into a gene selected from the group consisting of the DCSTAMP gene, the CD9 gene, the CD44 gene, the LGALS3 gene, the SPP1 gene, the GPNMB gene, the HLA-DRB gene, the LPL gene, the LIPA, the FABP3 gene, the MS4A6A gene, the CXCR4 gene, the CHI3L1 gene, the OLR1 gene, the CD36 gene, the SLAMF8 gene, the TREM2 gene, the MSR1 gene, the B2M gene, the ITGAX gene, and the MITF gene. In some embodiments, the nucleic acid sequence can be inserted into the genome of the iMGL cell such that the nucleic acid sequence is operably linked to an endogenous promoter of a gene selected from the group consisting of the DCSTAMP gene, the CD9 gene, the CD44 gene, the LGALS3 gene, the SPP1 gene, the GPNMB gene, the HLA-DRB gene, the LPL gene, the LIPA, the FABP3 gene, the MS4A6A gene, the CXCR4 gene, the CHI3L1 gene, the OLR1 gene, the CD36 gene, the SLAMF8 gene, the TREM2 gene, the MSR1 gene, the B2M gene, the ITGAX gene and the MITF gene. In some embodiments, the nucleic acid sequence may be inserted into a gene selected from the group consisting of DCSTAMP gene, CD9 gene, CD44 gene, LGALS3 gene, SPP1 gene, GPNMB gene, HLA-DRB gene, LPL gene, LIPA, FABP3 gene, MS4A6A gene, CXCR4 gene, CHI3L1 gene, OLR1 gene, CD36 gene, SLAMF8 gene, TREM2 gene, MSR1 gene, B2M gene, ITGAX gene and MITF gene, such that the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with an exon of the gene. In some embodiments, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the first exon of the gene. In some embodiments, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the last exon of the gene.In some embodiments, a first polynucleotide encoding a protease cleavage sequence or a self-cleaving peptide can be inserted between an exon and a nucleic acid sequence encoding a therapeutic protein such that the first polynucleotide is in frame with the exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, a second polynucleotide encoding a secretory peptide signal sequence (SP) can be linked to a nucleic acid sequence encoding a therapeutic protein, and the second polynucleotide can be inserted between the first polynucleotide and a nucleic acid sequence encoding a therapeutic protein such that the encoded signal peptide is in frame with the exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the Alzheimer's disease-related pathology-responsive promoter is a CD9 gene promoter. In some embodiments, a nucleic acid sequence can be inserted into the genome of an iMGL cell such that the nucleic acid sequence is operably linked to an endogenous CD9 promoter. In some embodiments, a nucleic acid sequence can be inserted into the CD9 locus. In some embodiments, a nucleic acid sequence can be inserted into the CD9 locus such that the nucleic acid sequence encoding a therapeutic protein is linked to an exon of the CD9 gene and is in frame with it. In some embodiments, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the first exon of the CD9 gene. In some embodiments, the nucleic acid sequence encoding the therapeutic protein is linked to and in frame with the last exon of the CD9 gene. In some embodiments, a first polynucleotide encoding a protease cleavage sequence or a self-cleaving peptide can be inserted between the CD9 exon and the nucleic acid sequence encoding the therapeutic protein such that the first polynucleotide is in frame with the CD9 exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, a second polynucleotide encoding a secretory peptide signal sequence (SP) can be linked to the nucleic acid sequence encoding the therapeutic protein, and the second polynucleotide can be inserted between the first polynucleotide and the nucleic acid sequence encoding the therapeutic protein such that the encoded signal peptide is in frame with the CD9 exon and the nucleic acid sequence encoding the therapeutic protein.In some embodiments, the therapeutic protein may be a metalloprotease. In some embodiments, the therapeutic protein may be neprilysin, and the neprilysin may be secreted neprilysin or membrane-bound neprilysin. In some embodiments, the therapeutic protein may comprise or consist of an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the encoded therapeutic protein has neprilysin activity. In some embodiments, the encoded therapeutic protein may comprise or consist of an amino acid sequence at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3, and the encoded therapeutic protein has neprilysin activity, and the differences between the amino acid sequence of the therapeutic protein and SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3 are due to conservative amino acid substitutions. In some embodiments, the encoded protein may comprise or consist of SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3. In some embodiments, the therapeutic protein comprises SEQ ID NO:1. In some embodiments, the therapeutic protein comprises SEQ ID NO:2. In some embodiments, the therapeutic protein comprises SEQ ID NO:3. In some embodiments, the therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97% or at least 99% identical to SEQ ID NO:1. In some embodiments, the therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97% or at least 99% identical to SEQ ID NO:2. In some embodiments, the therapeutic protein comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to SEQ ID NO:3.
[0116] One aspect of the present disclosure is a kit comprising the modified cells of the present disclosure, the modified cells comprising a nucleic acid sequence encoding a therapeutic protein, the nucleic acid sequence being operably linked to a pathology-responsive promoter, the therapeutic protein being capable of reducing at least one amyloid beta-associated pathology phenotype. The kit may also comprise additional components, such as, but not limited to, buffers, labels, containers, tubes, vials, syringes, instructions for administering the modified cells of the present disclosure, and the like.
[0117] The present invention may include methods of treating neurodegenerative diseases, disorders, or conditions associated with amyloid beta pathology, including, but not limited to, Alzheimer's disease, and alleviating associated symptoms or pathological processes. These methods may include administering a therapeutic composition comprising a sufficient number of modified cells of the present disclosure, or modified cells as described herein, to an individual in need of such treatment. The modified cells and / or therapeutic composition may be delivered directly to the brain of an individual or at least one specific target brain region. In some embodiments, the target brain region may include the cerebral cortex or a subregion thereof, the hippocampus or a subregion thereof, the basal ganglia or the basal ganglia, the ventricles, or a combination thereof. Furthermore, the target brain region may include a specific subregion, such as the anterior cingulate cortex, the entorhinal cortex, the dentate gyrus, the CA1, CA3, or CA2 regions of the hippocampus, the fornix, the primary sensory cortex, the sensory association cortex, the septum, the globus pallidus, the substantia nigra pars compacta, the substantia nigra pars reticulata, the striatum, the caudate putamen, or the subthalamic nucleus.
[0118] In some embodiments, the modified cells and / or therapeutic compositions may be administered after the appearance of Aβ disease pathology. In certain embodiments, administration may occur after the detection of β-amyloid (Aβ) peptide plaques, soluble or insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils comprising Aβ or fragments thereof in an individual. Administration of the modified cells and / or therapeutic compositions may occur by stereotactic injection directly into the brain of the individual.
[0119] The present invention may also include methods of preventing or attenuating the onset of neurodegenerative disorders or conditions associated with amyloid beta pathology, such as, but not limited to, Alzheimer's disease. These methods may include administering a therapeutic composition comprising a sufficient number of modified cells of the present disclosure, or modified cells as described herein, to an individual in need of such treatment. The modified cells and / or therapeutic composition may be delivered directly to the brain of an individual or at least one specific target brain region. In some embodiments, the target brain region may include the cerebral cortex or a subregion thereof, the hippocampus or a subregion thereof, the ventricles, or a combination thereof. Furthermore, the target brain region may include a specific region, such as the anterior cingulate cortex, the entorhinal cortex, the dentate gyrus, the CA1, CA3 or CA2 region of the hippocampus, the fornix, the primary sensory cortex, the sensory association cortex, the septum, the globus pallidus, the substantia nigra pars compacta, the substantia nigra pars reticulata, the striatum, the caudate putamen, or the subthalamic nucleus.
[0120] To effectively prevent or delay the onset of neurodegenerative disease pathology, the modified cells and / or therapeutic compositions can be administered before the appearance of Aβ disease pathology. In certain embodiments, administration can be performed before the detection of β-amyloid (Aβ) peptide plaques, soluble or insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ or fragments thereof in an individual. Administration of the modified cells and / or therapeutic compositions can be performed by direct stereotactic injection into the brain of an individual, and in some embodiments, can be performed before adulthood.
[0121] Individuals at risk of developing a neurodegenerative disease or condition, or individuals with a genetic mutation associated with a neurodegenerative disorder, may benefit from the methods disclosed herein. Thus, in some embodiments, the individual includes a subject at risk of developing a neurodegenerative disease or condition. Or, the individual may include a genetic mutation associated with a neurodegenerative disorder (e.g., a genetic mutation in apolipoprotein E (APOE4), presenilin 1 and 2, amyloid precursor protein (APP), or TREM2 (Triggering Receptor Expressed On Myeloid Cells 2). In certain embodiments, the neurodegenerative disease or condition may be Alzheimer's disease. In some embodiments, the disease or condition is Parkinson's disease. In some embodiments, the disease or condition is Huntington's disease. In some embodiments, the disease or condition is amyotrophic lateral sclerosis (ALS). In some embodiments, the disease or condition is another amyloid beta-associated neurodegenerative disorder. The present invention is not limited to the aforementioned diseases or conditions.
[0122] The invention may further feature compositions (e.g., therapeutic compositions) comprising a sufficient number of the modified cells described herein for use in a method of treating a neurodegenerative disorder or condition. In some embodiments, the invention features compositions (e.g., therapeutic compositions) comprising a sufficient number of the modified cells described herein for use in a method of treating a disease or condition associated with amyloid beta pathology.
[0123] In some embodiments, the invention features the use of modified cells described herein in the manufacture of a therapeutic composition for treating a neurodegenerative disorder or condition. In other embodiments, the invention features the use of modified cells described herein in the manufacture of a therapeutic composition for treating Alzheimer's disease. In other embodiments, the invention features the use of modified cells described herein in the manufacture of a therapeutic composition for treating Parkinson's disease. In other embodiments, the invention features the use of modified cells described herein in the manufacture of a therapeutic composition for treating Huntington's disease. In other embodiments, the invention features the use of modified cells described herein in the manufacture of a therapeutic composition for treating ALS.
[0124] As described herein, the present invention features human induced microglia-like (iMGL) cells that express and present therapeutic molecules including membrane-bound neprilysin or express and secrete therapeutic molecules including secreted neprilysin.
[0125] As described herein, the invention features human induced microglia-like (iMGL) cells that express and present or express and secrete therapeutic molecules including membrane-bound neprilysin, secreted neprilysin, TREM2, APOE, LRP1, insulin-degrading enzyme, endothelin-converting enzyme, plasminogen activator, angiotensin-converting enzyme, or matrix metalloproteinase.
[0126] With reference to the appropriate embodiments herein, in some embodiments, the promoter is configured to activate transcription of a therapeutic molecule (i) when the modified cell is in proximity to a β-amyloid (Aβ) peptide plaque, a soluble Aβ monomer, an insoluble Aβ monomer, an Aβ oligomer, a pyroglutamate Aβ, a prefibril, or a fibril comprising Aβ or a fragment thereof, or (ii) when the modified cell is in contact with a β-amyloid (Aβ) peptide plaque, a soluble Aβ monomer, an insoluble Aβ monomer, an Aβ oligomer, a pyroglutamate Aβ, a prefibril, or a fibril comprising Aβ or a fragment thereof. In some embodiments, the cell expresses P2RY12 and TREM2.
[0127] With reference to the appropriate embodiments herein, in some embodiments, the cell comprises a nucleic acid sequence encoding a therapeutic molecule and a promoter selected from a CD9 gene promoter, a LGALS3 gene promoter, a HLA-DRB gene promoter, or a CD11c gene promoter, the promoter being operably linked to the nucleic acid sequence encoding the therapeutic molecule. In some embodiments, the promoter comprises a CD9 gene promoter. In some embodiments, the promoter comprises a LGALS3 gene promoter. In some embodiments, the promoter comprises a HLA-DRB gene promoter. In some embodiments, the promoter comprises a CD11c gene promoter. In some embodiments, the promoter is one of the aforementioned promoters, and the therapeutic molecule comprises membrane-bound neprilysin or secreted neprilysin. In some embodiments, the promoter is one of the aforementioned promoters, and the therapeutic molecule comprises one of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3. In some embodiments, the promoter is one of the aforementioned promoters, and the therapeutic molecule comprises TREM2. In some embodiments, the promoter is one of the aforementioned promoters, and the therapeutic molecule comprises insulin-degrading enzyme.
[0128] With reference to the appropriate embodiments herein, in some embodiments, the nucleic acid sequence is inserted into the genome of the cell. In some embodiments, the nucleic acid sequence is inserted downstream of the promoter-controlled locus such that the nucleic acid sequence is in frame with the coding sequence in the exon of the locus. In some embodiments, the nucleic acid sequence is inserted into the promoter-controlled locus such that the nucleic acid sequence is linked in frame with at least a portion of the coding sequence of the locus. In some embodiments, a first polynucleotide encoding a protease cleavage site, a ribosome skipping sequence, or a self-cleaving peptide is inserted between the coding sequence of the exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the self-cleaving peptide is P2A. In some embodiments, a second polynucleotide encoding a secretory peptide signal sequence is inserted at the 5' end of the nucleic acid sequence encoding the therapeutic protein.
[0129] With reference to suitable embodiments herein, in some embodiments, the therapeutic protein affects one or more amyloid beta (Aβ)-related pathologies. In some embodiments, the Aβ-related pathologies include β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths. In some embodiments, the therapeutic molecule reduces the amount of Aβ peptides in Aβ peptide plaques in the brain of an individual. In some embodiments, the therapeutic molecule reduces the size or number of soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths. In some embodiments, the therapeutic molecule enhances amyloid proteolysis. In some embodiments, the therapeutic molecule enhances microglial phagocytosis of amyloid beta.
[0130] As described herein, the invention features modified cells that express and present or secrete therapeutic molecules when the cells are in proximity to or in contact with amyloid beta (Aβ)-related pathology, which reduce or eliminate the Aβ-related pathology phenotype or ameliorate symptoms of the Aβ-related pathology.
[0131] As described herein, the invention features modified cells that express and present or secrete a therapeutic molecule when the cells are in proximity to or in contact with amyloid beta (Aβ)-related pathology, where the therapeutic molecule reduces or eliminates at least one aspect of the Aβ-related pathology.
[0132] As described herein, the invention features modified cells that express and present or secrete therapeutic molecules when the cells are in proximity to or in contact with amyloid beta (Aβ) aggregates, which reduce or eliminate amyloid beta-associated pathology or ameliorate its symptoms.
[0133] As described herein, the invention features modified cells that express and present or secrete therapeutic molecules when the cells are in proximity to or in contact with amyloid beta (Aβ) aggregates, plaques, oligomers or fibrils, which reduce or eliminate amyloid beta-associated pathology or ameliorate symptoms thereof.
[0134] With reference to suitable embodiments herein, in some embodiments, the amyloid beta-related pathology phenotype comprises a phenotype selected from the group consisting of memory impairment, cognitive impairment, visual impairment, behavioral changes, personality changes, depression and seizures.
[0135] With reference to suitable embodiments herein, in some embodiments, the cells comprise a nucleic acid sequence encoding a therapeutic molecule, the nucleic acid sequence being operably linked to a promoter responsive to an amyloid beta-associated pathology.
[0136] As described herein, the invention features modified cells that express and present or secrete a therapeutic molecule, the modified cells comprising a nucleic acid sequence encoding a therapeutic molecule that cleaves amyloid beta, binds to amyloid beta, enhances amyloid proteolysis, enhances amyloid proteolysis, enhances microglial phagocytosis of amyloid beta, or combinations thereof, and a promoter selected from a CD9 gene promoter, a LGALS3 gene promoter, a HLA-DRB gene promoter, a TREM2 gene promoter, or a CD11c gene promoter, wherein the promoter is operably linked to the nucleic acid sequence encoding the therapeutic molecule.
[0137] As described herein, the invention features modified cells that express and present or secrete a therapeutic molecule, the modified cells comprising a nucleic acid sequence encoding a therapeutic molecule that cleaves amyloid beta, binds to amyloid beta, enhances amyloid proteolysis, enhances amyloid proteolysis, enhances microglial phagocytosis of amyloid beta, or combinations thereof, and a promoter selected from DCSTAMP gene promoter, CD9 gene promoter, CD44 gene promoter, LGALS3 gene promoter, SPP1 gene promoter, GPNMB gene promoter, HLA-DRB gene promoter, LPL gene promoter, LIPA gene promoter, FABP3 gene promoter, MS4A6A gene promoter, CXCR4 gene promoter, CHI3L1 gene promoter, OLR1 gene promoter, CD36 gene promoter, SLAMF8 gene promoter, TREM2 gene promoter, MSR1 gene promoter, B2M gene promoter, ITGAX gene promoter, and MITF gene promoter, wherein the promoter is operably linked to the nucleic acid sequence encoding the therapeutic molecule.
[0138] As described herein, the invention features modified cells that express and present or secrete a therapeutic molecule comprising membrane-bound or secreted neprilysin, the modified cells comprising a nucleic acid sequence encoding the therapeutic molecule and a promoter operably linked to the nucleic acid sequence encoding the therapeutic molecule, the promoter being configured to activate transcription of the therapeutic molecule (i) upon the cell being in proximity to β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils comprising Aβ or fragments thereof, or (ii) upon contact between the cell and β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils comprising Aβ or fragments thereof.
[0139] As described herein, the invention features modified cells that express and present or secrete a therapeutic molecule, including membrane-bound neprilysin, secreted neprilysin, TREM2 or insulin-degrading enzyme, the modified cells comprising a nucleic acid sequence encoding the therapeutic molecule and a promoter operably linked to the nucleic acid sequence encoding the therapeutic molecule, the promoter configured to activate transcription of the therapeutic molecule (i) upon the cell being in proximity to β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils comprising Aβ or fragments thereof, or (ii) upon contact between the cell and β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils comprising Aβ or fragments thereof.
[0140] As described herein, the invention features a microglia-like (MGL) cell that expresses and presents or secretes a therapeutic molecule that cleaves amyloid beta, binds to amyloid beta, enhances amyloid proteolysis, enhances microglial phagocytosis of amyloid beta, or combinations thereof, the cell comprising a nucleic acid sequence encoding the therapeutic molecule and a promoter operably linked to the nucleic acid sequence encoding the therapeutic molecule, the promoter being configured to activate transcription of the therapeutic molecule (i) upon the cell being in proximity to a β-amyloid (Aβ) peptide plaque, a soluble Aβ monomer, an insoluble Aβ monomer, an Aβ oligomer, a pyroglutamate Aβ, a prefibril, or a fibril comprising Aβ or a fragment thereof, or (ii) upon contact between the cell and a β-amyloid (Aβ) peptide plaque, a soluble Aβ monomer, an insoluble Aβ monomer, an Aβ oligomer, a pyroglutamate Aβ, a prefibril, or a fibril comprising Aβ or a fragment thereof.
[0141] With reference to the appropriate embodiment herein, in some embodiments, the promoter is configured to activate transcription of the therapeutic molecule when (i) the cell is in proximity to a β-amyloid (Aβ) peptide plaque, a soluble Aβ monomer, an insoluble Aβ monomer, an Aβ oligomer, a pyroglutamate Aβ, a prefibril, or a fibril comprising Aβ or a fragment thereof, or (ii) the cell is in contact with a β-amyloid (Aβ) peptide plaque, a soluble Aβ monomer, an insoluble Aβ monomer, an Aβ oligomer, a pyroglutamate Aβ, a prefibril, or a fibril comprising Aβ or a fragment thereof. In some embodiments, the cell expresses P2RY12 and TREM2.
[0142] With reference to the appropriate embodiments herein, in some embodiments, the cells are migratory cells or are generated from a cell lineage that can differentiate into migratory cells. In some embodiments, the cells are pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), myeloid progenitor cells, erythromyeloid progenitor cells, hematopoietic stem cells, hematopoietic progenitor cells, lymphoid progenitor cells, megakaryocyte-erythroid (mk-ery), umbilical cord blood stem cells or embryonic stem cells. In some embodiments, the cells are monocytes. In some embodiments, the cells are bone marrow derived hematopoietic progenitor cells. In some embodiments, the cells are neural stem cells. In some embodiments, the cells are iPSC-derived microglial cells. In some embodiments, the cells are iPSC-derived hematopoietic progenitor cells. In some embodiments, the cells are hematopoietic progenitor cells. In some embodiments, the cells are microglia-like (MGL) cells. In some embodiments, the cells are human induced microglia-like cells (hiMGL). In some embodiments, the MGL cells are human induced pluripotent stem cell-derived MGL cells. In some embodiments, the cells are microglia-like (MGL) cells that can phagocytose human synaptosomes. In some embodiments, the cells are microglia-like (MGL) cells that can phagocytose amyloid Aβ fibrils. In some embodiments, the cells are microglia-like (MGL) cells that can migrate to injury sites.
[0143] With reference to the appropriate embodiments herein, in some embodiments, the therapeutic protein is a membrane-bound protein. In some embodiments, the therapeutic protein is a secreted protein. In some embodiments, the therapeutic protein is a metalloprotease. In some embodiments, the therapeutic protein comprises neprilysin activity. In some embodiments, the therapeutic molecule comprises membrane-bound neprilysin or secreted neprilysin. In some embodiments, the therapeutic molecule comprises a peptide according to SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3. In some embodiments, the therapeutic molecule comprises TREM2, APOE, LRP1, or insulin-degrading enzyme, endothelin-converting enzyme, plasminogen activator, angiotensin-converting enzyme, or matrix metalloproteinase.
[0144] With reference to the appropriate embodiment herein, in some embodiments, the promoter is selected from CD9 gene promoter, LGALS3 gene promoter, TREM2 gene promoter, HLA-DRB gene promoter or CD11c gene promoter. In some embodiments, the promoter is selected from DCSTAMP gene promoter, CD9 gene promoter, CD44 gene promoter, LGALS3 gene promoter, SPP1 gene promoter, GPNMB gene promoter, HLA-DRB gene promoter, LPL gene promoter, LIPA gene promoter, FABP3 gene promoter, MS4A6A gene promoter, CXCR4 gene promoter, CHI3L1 gene promoter, OLR1 gene promoter, CD36 gene promoter, SLAMF8 gene promoter, TREM2 gene promoter, MSR1 gene promoter, B2M gene promoter, ITGAX gene promoter and MITF gene promoter. In some embodiments, the nucleic acid sequence is inserted into the genome of the cell. In some embodiments, the nucleic acid sequence is inserted downstream of the locus controlled by the promoter such that the nucleic acid sequence is in frame with the coding sequence in the exon of the locus. In some embodiments, the nucleic acid sequence is inserted into a locus controlled by a promoter such that the nucleic acid sequence is linked in frame with at least a portion of the coding sequence of the locus. In some embodiments, a first polynucleotide encoding a protease cleavage site, a ribosomal skipping sequence, or a self-cleaving peptide is inserted between the coding sequence of the exon and the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the self-cleaving peptide is P2A. In some embodiments, a second polynucleotide encoding a secretory peptide signal sequence is inserted at the 5' end of the nucleic acid sequence encoding the therapeutic protein. In some embodiments, the therapeutic protein affects one or more amyloid beta (Aβ)-related pathologies.In some embodiments, the Aβ-related pathology comprises β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths. In some embodiments, the therapeutic molecule reduces the amount of Aβ peptides in Aβ peptide plaques in the brain of an individual. In some embodiments, the therapeutic molecule reduces the size or number of soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths, enhances amyloid proteolysis, enhances microglial phagocytosis of amyloid beta, or a combination thereof.
[0145] As described herein, the invention features a composition comprising a cell of any of the embodiments disclosed herein.
[0146] As described herein, the invention features a kit including a cell of any of the embodiments disclosed herein or a composition of any of the embodiments disclosed herein.
[0147] As described herein, the invention features a composition for use in a method of treating a disease or condition associated with amyloid beta-associated pathology or ameliorating a symptom or pathological process associated with a disease or condition associated with amyloid beta-associated pathology, the composition comprising a cell of any of the embodiments disclosed herein.
[0148] As described herein, the present invention features a method of treating an individual having a disease or condition associated with amyloid beta-related pathology, the method comprising administering to at least one target brain region in the brain of the individual a cell of any of the embodiments disclosed herein, or a composition of any of the embodiments disclosed herein.
[0149] As described herein, the invention features a method of reducing the amount of Aβ peptide in Aβ peptide plaques and / or the size or number of soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths in the brain of an individual, comprising administering to the individual a cell of any of the embodiments disclosed herein, or a composition of any of the embodiments disclosed herein, to at least one target brain region in the brain of the individual.
[0150] As described herein, the invention features a method of reducing neuronal or synaptic loss in a subject in need thereof, the subject having amyloid beta-related pathology including Aβ plaques in brain tissue, the method comprising administering to the individual a cell of any of the embodiments disclosed herein, or a composition of any of the embodiments disclosed herein, to at least one target brain region in the individual's brain.
[0151] As described herein, the present invention features a method of preventing or attenuating the development of a neurodegenerative disorder or condition associated with amyloid beta pathology, the method comprising administering to at least one target brain region in the brain of an individual a cell of any of the embodiments disclosed herein, or a composition of any of the embodiments disclosed herein.
[0152] With reference to suitable embodiments herein, in some embodiments, at least one target brain region comprises the cerebral cortex or a subregion thereof, the hippocampus or a subregion thereof, the ventricle, the basal ganglia or a basal ganglia, the entorhinal cortex, the medial prefrontal cortex or a subregion thereof, the anterior cingulate cortex or a subregion thereof, the primary sensory cortex or sensory association cortex, the fornix, the septum, or a combination thereof. In some embodiments, the hippocampus or a subregion thereof comprises the CA1 region of the hippocampus, the CA3 region of the hippocampus, the dentate gyrus of the hippocampus, the CA2 region of the hippocampus, the septal area or the fornix. In some embodiments, the ventricle comprises the lateral ventricle, the third ventricle, the fourth ventricle, or a combination thereof. In some embodiments, the basal ganglia comprises the globus pallidus, the substantia nigra pars compacta, the substantia nigra pars reticulata, the striatum, the caudate putamen, or the subthalamic nucleus.
[0153] With reference to suitable embodiments herein, in some embodiments, the amyloid beta-related pathology is Alzheimer's disease. In some embodiments, the amyloid beta-related pathology is Parkinson's disease. In some embodiments, the amyloid beta-related pathology is Huntington's disease. In some embodiments, the amyloid beta-related pathology is amyotrophic lateral sclerosis (ALS). In some embodiments, the method inhibits the expansion or progression of amyloid beta-related pathology. In some embodiments, the method inhibits the expansion of Abeta fibers. In some embodiments, the method reduces synaptic loss.
[0154] With reference to suitable embodiments herein, in some embodiments, the cells are administered prior to the onset of Aβ-related pathology. In some embodiments, the cells are administered prior to the presence of β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils comprising Aβ or fragments thereof in the individual. In some embodiments, the cells are administered after the presence of β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils comprising Aβ or fragments thereof in the individual is detected. In some embodiments, the cells are administered via stereotactic injection into the brain of the individual. In some embodiments, the cells are administered to the individual prior to adulthood. In some embodiments, the individual is at risk of developing a neurodegenerative disease or condition. In some embodiments, the individual comprises a genetic mutation associated with a neurodegenerative disorder.
[0155] With reference to the appropriate embodiments herein, in some embodiments, the amount of Aβ peptide or Aβ peptide plaque is determined using amyloid beta PET imaging, histological methods, immunoblotting, amyloid beta staining, or a combination thereof. In some embodiments, the immunoblotting detects synaptic markers. In some embodiments, the staining detects amyloid beta. In some embodiments, the staining includes Golgi staining to measure synapse number. In some embodiments, the amount of Aβ peptide in Aβ peptide plaque is determined using magnetic resonance imaging (MRI).
[0156] As described herein, the present invention features the use of any of the cells of the embodiments disclosed herein, any of the compositions of the embodiments disclosed herein, or any of the kits of the embodiments disclosed herein in reducing the amount of Aβ peptide in Aβ peptide plaques and / or reducing the size or number of soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrillar Aβ peptide deposits including Aβ of various lengths. In some embodiments, the use is for a method comprising implanting hiMGL into brain tissue of an individual.
[0157] As described herein, the invention features the use of a cell of any of the embodiments disclosed herein, a composition of any of the embodiments disclosed herein, or a kit of any of the embodiments disclosed herein in treating a disease associated with amyloid beta-related pathology or ameliorating a symptom or pathological process associated with amyloid beta-related pathology.
[0158] As described herein, the present invention features human induced microglia-like (iMGL) cells that express and present or express and secrete therapeutic molecules, including membrane-bound neprilysin, secreted neprilysin, TREM2, APOE, LRP1, insulin-degrading enzyme, endothelin-converting enzyme, plasminogen activator, angiotensin-converting enzyme, or matrix metalloproteinase. In some embodiments, the cells express and present or express and secrete therapeutic molecules upon contact with β-amyloid (Aβ) peptide plaques, soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths. In some embodiments, the cells include a nucleic acid sequence encoding the therapeutic molecule and a promoter selected from a CD9 gene promoter, a LGALS3 gene promoter, a HLA-DRB gene promoter, or a CD11c gene promoter, wherein the promoter is operably linked to the nucleic acid sequence encoding the therapeutic molecule.
[0159] With reference to the appropriate embodiments herein, in some embodiments, the therapeutic molecule binds to the Aβ peptide. With reference to the appropriate embodiments herein, in some embodiments, the therapeutic molecule cleaves the Aβ peptide.
[0160] In some embodiments, the Aβ peptide refers to Aβ-40. The cell of claim 4, wherein the Aβ peptide refers to Aβ-42.
[0161] With reference to suitable embodiments herein, in some embodiments the therapeutic molecule cleaves amyloid beta, binds to amyloid beta, enhances amyloid proteolysis, enhances amyloid proteolysis, enhances microglial phagocytosis of amyloid beta, or combinations thereof.
[0162] As described herein, the present invention features cells, compositions and methods in which a nucleic acid sequence is inserted into the genome of a cell. For any of the suitable embodiments herein, in some embodiments, the nucleic acid sequence is inserted downstream of a locus controlled by a promoter such that the nucleic acid sequence is in-frame with the coding sequence in an exon of the locus. In some embodiments, the nucleic acid sequence is inserted into a locus controlled by a promoter such that the nucleic acid sequence is linked in-frame with at least a portion of the coding sequence of the locus. In some embodiments, the exon is the first exon in the locus. In some embodiments, the exon is the last exon in the locus.
[0163] As described herein, the invention features the use of a cell of any of the embodiments or claims herein, a composition of any of the embodiments or claims herein, or a kit of any of the embodiments or claims herein in a method of treating a disease or condition associated with amyloid beta-associated pathology or ameliorating a symptom or pathological process associated with a disease or condition associated with amyloid beta-associated pathology.
[0164] As described herein, the invention features a method of treating a neurodegenerative disease or condition, the method comprising administering to an individual a cell of any of the embodiments or claims herein, or a composition of any of the embodiments or claims herein.
[0165] With reference to any of the appropriate embodiments herein, in some embodiments, the neurodegenerative disease or condition is associated with amyloid beta-related pathology. In some embodiments, the amyloid beta-related pathology is Alzheimer's disease. In some embodiments, the amyloid beta-related pathology is Parkinson's disease. In some embodiments, the amyloid beta-related pathology is Huntington's disease. In some embodiments, the amyloid beta-related pathology is amyotrophic lateral sclerosis (ALS).
[0166] With reference to any of the suitable embodiments herein, the at least one target brain region comprises the cerebral cortex or a subregion thereof. In some embodiments, the at least one target brain region comprises the hippocampus or a subregion thereof. In some embodiments, the at least one target brain region comprises the CA1 region of the hippocampus. In some embodiments, the at least one target brain region comprises the CA3 region of the hippocampus. In some embodiments, the at least one target brain region comprises the dentate gyrus of the hippocampus. In some embodiments, the at least one target brain region comprises the CA2 region of the hippocampus. In some embodiments, the at least one target brain region comprises the septal field or the fornix of the hippocampus. In some embodiments, the at least one target brain region comprises a ventricle. In some embodiments, the ventricle comprises the lateral ventricle, the third ventricle, the fourth ventricle, or a combination thereof. In some embodiments, the at least one target brain region comprises the basal ganglia or a basal ganglia thereof. In some embodiments, the basal ganglia comprises the globus pallidus. In some embodiments, the basal ganglia comprises the substantia nigra pars compacta or the substantia nigra pars reticulata. In some embodiments, the basal ganglia comprises the striatum. In some embodiments, the basal ganglia comprises the caudate putamen. In some embodiments, the basal ganglia comprises the subthalamic nucleus. In some embodiments, the at least one target brain region comprises the entorhinal cortex. In some embodiments, the at least one target brain region comprises the medial prefrontal cortex or a subregion thereof. In some embodiments, the at least one target brain region comprises the anterior cingulate cortex or a subregion thereof. In some embodiments, the at least one target brain region comprises the primary sensory cortex or the sensory association cortex. In some embodiments, the at least one target brain region comprises the cerebral cortex or a subregion thereof, the hippocampus or a subregion thereof, the ventricles, or a combination thereof. In some embodiments, the at least one target brain region comprises the anterior cingulate cortex, the entorhinal cortex, the dentate gyrus, the CA1 region of the hippocampus, the CA3 region of the hippocampus, the fornix, the primary sensory cortex, the sensory association cortex, the septum, or the CA2 region of the hippocampus.
[0167] The invention also features a method of generating a therapeutic modified cell comprising introducing into a cell a nucleic acid sequence encoding a therapeutic molecule, the nucleic acid sequence being operably linked to a promoter responsive to amyloid beta associated pathology, and the therapeutic protein altering the amyloid beta associated pathology phenotype, or at least one aspect of amyloid beta associated pathology.
[0168] The invention also features a method of generating a cell population comprising human microglia-like cells (iMGL), the method comprising contacting human induced hematopoietic progenitor cells (iHPCs) with a microglia differentiation medium comprising CSF-1, IL-34 and TGFβ1, or a CSF-1 mimetic, an IL-34 mimetic and a TGFβ mimetic, to differentiate the iHPCs into iMGLs, and introducing into the iMGL a nucleic acid encoding a protease that cleaves amyloid Aβ fibers.
[0169] The invention also features a method of generating a cell population comprising human microglia-like cells (iMGL), the method comprising contacting human induced hematopoietic progenitor cells (iHPCs) with a microglia differentiation medium comprising CSF-1, IL-34 and TGFβ1, or a CSF-1 mimetic, an IL-34 mimetic and a TGFβ mimetic, to differentiate the iHPCs into iMGLs, and introducing into the iMGLs a nucleic acid encoding a therapeutic molecule that affects at least one aspect of amyloid beta-associated pathology.
[0170] The invention also features a method of generating a therapeutic cell population comprising human microglia-like cells (iMGL), the method comprising plating human induced hematopoietic progenitor cells (iHPCs) on a culture dish coated with a basement membrane protein, and contacting the human iHPCs with a microglia differentiation medium comprising CSF-1 or IL-34 to differentiate the iHPCs into iMGLs, and introducing into the iMGLs a nucleic acid encoding a therapeutic molecule that affects at least one aspect of amyloid beta-associated pathology.
[0171] The invention also features a method of generating a therapeutic cell population comprising human microglia-like cells (iMGL), the method including plating human induced hematopoietic progenitor cells (iHPCs) on a culture dish coated with a basement membrane protein, contacting the human iHPCs with a microglia differentiation medium comprising CSF-1 or IL-34 to differentiate the iHPCs into iMGLs, and introducing into the iMGLs a nucleic acid encoding a protease that cleaves amyloid Aβ fibers.
[0172] For any of the appropriate embodiments, in some embodiments the therapeutic molecule binds to Aβ peptide, cleaves Aβ peptide, reduces the amount of Aβ peptide in Aβ peptide plaques, reduces the size or number of soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths, enhances amyloid proteolysis, enhances microglial phagocytosis of amyloid beta, or combinations thereof.
[0173] For any of the appropriate embodiments, in some embodiments the cells comprise a nucleic acid sequence encoding a therapeutic molecule, wherein the nucleic acid sequence is operably linked to a promoter responsive to an amyloid beta-associated pathology.
[0174] For any of the appropriate embodiments, in some embodiments the promoter is an endogenous promoter. For any of the appropriate embodiments, in some embodiments the promoter is a non-endogenous promoter.
[0175] As described herein, the present invention features a method of treating an individual with a disease or condition associated with amyloid beta-related pathology, comprising administering to at least one target brain region in the brain of the individual a cell according to any of the embodiments or claims herein, or a composition according to any of the embodiments or claims herein.The present invention also features a method of reducing the amount of Aβ peptide in Aβ peptide plaques and / or the size or number of soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths in the brain of the individual, comprising administering to the individual a cell according to any of the embodiments or claims herein, or a composition according to any of the embodiments or claims herein, to at least one target brain region in the brain of the individual.The present invention also features a method of reducing neuronal or synaptic loss in a subject in need thereof, the subject having amyloid beta-related pathology including Aβ plaques in brain tissue, comprising administering to the individual a cell according to any of the embodiments or claims herein, or a composition according to any of the embodiments or claims herein, to at least one target brain region in the brain of the individual. The present invention also features a method for preventing or attenuating the development of a neurodegenerative disorder or condition associated with amyloid beta pathology, comprising administering to at least one target brain region in the brain of an individual a cell of any of the embodiments or claims herein, or a composition of any of the embodiments or claims herein. In some embodiments, the amyloid beta-related pathology is Alzheimer's disease. In some embodiments, the amyloid beta-related pathology is Parkinson's disease. In some embodiments, the amyloid beta-related pathology is Huntington's disease. In some embodiments, the amyloid beta-related pathology is amyotrophic lateral sclerosis (ALS). In some embodiments, the amyloid beta-related pathology is Alzheimer's disease, Parkinson's disease, Huntington's disease, or ALS. In some embodiments, the amyloid beta-related pathology is a variety of neurological diseases. In some embodiments, the method inhibits the spread or progression of amyloid beta-related pathology.In some embodiments, the method inhibits the expansion of amyloid beta fibrils. In some embodiments, the method reduces synapse loss. In some embodiments, the individual is a subject at risk of developing a neurodegenerative disease or condition. In some embodiments, the individual comprises a genetic mutation associated with a neurodegenerative disorder. In some embodiments, the cells are administered before adulthood.
[0176] The detection or monitoring of the level of amyloid beta peptide and / or plaques can be performed using imaging (e.g., amyloid beta PET imaging, MRI), histological methods, immunoblotting, amyloid beta staining, or a combination thereof. In some embodiments, immunoblotting detects synaptic markers. In some embodiments, staining detects amyloid beta. In some embodiments, staining includes Golgi staining to measure synapse number. In some embodiments, the amount of Aβ peptide in Aβ peptide plaques is determined using magnetic resonance imaging (MRI).
[0177] As described herein, the present invention features a method of treating an individual with a disease or condition associated with amyloid beta-related pathology, comprising administering to at least one target brain region in the brain of the individual a cell according to any of the embodiments or claims herein, or a composition according to any of the embodiments or claims herein.The present invention also features a method of reducing the amount of Aβ peptide in Aβ peptide plaques and / or the size or number of soluble Aβ monomers, insoluble Aβ monomers, Aβ oligomers, pyroglutamate Aβ, prefibrils, or fibrils containing Aβ of various lengths in the brain of the individual, comprising administering to the individual a cell according to any of the embodiments or claims herein, or a composition according to any of the embodiments or claims herein, to at least one target brain region in the brain of the individual.The present invention also features a method of reducing neuronal or synaptic loss in a subject in need thereof, the subject having amyloid beta-related pathology including Aβ plaques in brain tissue, comprising administering to the individual a cell according to any of the embodiments or claims herein, or a composition according to any of the embodiments or claims herein, to at least one target brain region in the brain of the individual. The present invention also features a method for preventing or attenuating the development of a neurodegenerative disorder or condition associated with amyloid beta pathology, comprising administering to at least one target brain region in the brain of an individual a cell according to any of the embodiments or claims herein, or a composition according to any of the embodiments or claims herein. In some embodiments, the at least one target brain region comprises the cerebral cortex or a subregion thereof, the hippocampus or a subregion thereof, the ventricle, the basal ganglia or a subregion thereof, the entorhinal cortex, the medial prefrontal cortex or a subregion thereof, the anterior cingulate cortex or a subregion thereof, the primary sensory cortex or sensory association cortex, the fornix, the septum, or a combination thereof. In some embodiments, the hippocampus or a subregion thereof comprises the CA1 region of the hippocampus, the CA3 region of the hippocampus, the dentate gyrus of the hippocampus, the CA2 region of the hippocampus, the septal field of the hippocampus, or the fornix. In some embodiments, the ventricle comprises the lateral ventricle, the third ventricle, the fourth ventricle, or a combination thereof.
[0178] In some embodiments, the basal ganglia include the globus pallidus, substantia nigra pars compacta, substantia nigra pars reticulata, striatum, caudate-putamen, and subthalamic nucleus.
[0179] This specification uses examples to disclose the invention, including the best mode, and to enable those skilled in the art to practice the invention, including making and using any devices or systems, and performing any incorporated methods. The patentable scope of the invention is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements that do not differ substantially from the literal language of the claims.
[0180] example The following are non-limiting examples of the present invention. It should be understood that the examples are not intended to limit the present invention in any way. Equivalents or substitutes are within the scope of the present invention.
[0181] Example 1. Description of mouse model
[0182] Microglia are the primary innate immune cells of the brain and play a key role in maintaining neuronal homeostasis and monitoring their local environment for pathogens and neuronal damage. Recently, a chimeric mouse model could be developed that allows the investigation of the interplay between human iPSC-derived microglia and neuropathology (Hasselmann et.al., Neuron, 2019). This model has deletions in the Rag2 and il2rγ genes and a humanized CSF-1 allele, and thus has been shown to be necessary and sufficient to allow long-term engraftment and survival of xenografted human microglia in the mouse brain. This model was further crossed with 5XFAD mice (Oakley et.al., J Neurosci, 2006), which overexpress co-inserted transgenes for familial Alzheimer's disease (FAD) mutant APP (Swedish, Florida and London) and mutant FAD PS1 (M146L and L286V) and develop extensive amyloid plaque pathology. To generate chimeric mice, pups are transplanted with human pluripotent stem cell-derived microglia within 5 days of birth, resulting in robust human microglial chimerism of 60-80% in the forebrain (Hasselmann et.al., Neuron, 2019). In this model, after xenotransplantation, human iPSC-derived microglia (xMG) are widely distributed, exhibit an in vivo-like transcriptional profile, and mature into proliferating homeostatic microglia.
[0183] Example 2. Engrafted iMGLs migrate to and respond to Aβ pathology.
[0184] Understanding how iPSC-derived microglia respond to amyloid beta-related pathology, e.g., Alzheimer's disease-related (AD) pathology, will enable the rational design of gene expression modules that regulate the expression of therapeutic agents. To this end, 5xfAD transgenic mice were transfected with MITRG (M-CSF h , IL-3 / GM-CSF h , and TPO h Rag2 tm1.1Flv Il2rγ tm1.1Flv) background to express substantial Aβ pathology, as well as both synaptic and neuronal loss, h , IL-3 / GM-CSF h , and TPO h Rag2 tm1.1Flv Il2rγ tm1.1Flv We established a xenograft-compatible model called iPSC-derived microglia (iPSC-derived microglia) that migrates toward Aβ pathology and expresses a unique gene signature upon encountering Aβ plaques (Hasselmann et al., Neuron, 2019). Human xenograft microglia (xMG) were isolated from the brains of 9-10 month-old 5x-MITRG mice using a negative magnetic sorting technique to deplete total mouse cells. Single-cell RNA sequencing of isolated xMG was then performed using the 10X Genomics Chromium platform, which was used to distinguish disease-associated microglia (DAM) populations associated with Aβ pathology in 5x-MITRG mice and to identify mRNAs enriched within human DAM microglia. Immunohistochemistry and confocal microscopy were then used to validate and investigate the localization of a subset of these DAM genes at the protein level. Consistent with mouse models, and human microglia derived from the brains of AD patients, we observed that the tetraspanin protein, CD9, was highly and specifically expressed only within microglia in direct contact with Aβ plaques (Figures 1A-P and 2A-F). These indicate that iPSC-derived microglial cells can be transplanted into mouse models of AD and that Aβ pathology-associated iPSC-derived microglia exquisitely express CD9.
[0185] Example 3. Construction of iPSC-derived microglia expressing neprilysin (NEP) under the control of the CD9 promoter.
[0186] This example illustrates the construction of iPSC-derived microglial cells expressing NEP under the control of the endogenous promoter of CD9. Constructs for membrane-anchored neprilysin and secreted NEP were generated. Schematic diagrams showing the design of the CD9 locus containing the coding sequences for membrane-anchored and secreted NEP are shown in Figure 3A and Figure 3B, respectively.
[0187] iPSCs were harvested after Accutase enzyme digestion for 3 min at 37C. 250,000 cells were resuspended in 100 μL nucleofection buffer from Human Stem Cell Nucleofector™ Kit 2 (Lonza). RNP complexes formed by incubating CD9:NEP or CD9:sNEP plasmid templates (2 μg; sequences shown in Table 2) and Alt-R® SpHiFi Cas9 Nuclease V3 (50 μg; IDT DNA) fused with crRNA:tracrRNA (IDT DNA) duplex (gRNA: 5'GCTGACTCTAGACCATCTCG CGG (SEQ ID NO: 9)) were combined with the cell suspension and nucleofected using Amaxa Nucleofector program B-016. Cells were plated overnight on Matrigel-coated plates in TeSR™-E8™ medium containing 0.25 μM Thiazovivin (STEMCELL Technologies) and CloneR™ (STEMCELL Technologies) and allowed to recover. The next day, cells were mechanically replated on 96-well Matrigel-coated plates in TeSR™-E8™ medium containing 0.25 μM Thiazovivin and CloneR™ supplements for clonal isolation and expansion. Culture medium was replenished daily with fresh medium. After 5 days, plates were visually screened for single clone wells. After 10 days, visual clone wells were passaged using ReLeSR. Cell pellets were collected from each well where genomic DNA was extracted using Extracta DNA prep for PCR (Quantabio) amplification using Taq PCR Master Mix (Thermo Fisher Scientific) to confirm biallelic integration of the CD9:NEP or CD9:sNEP cassettes.
[0188] These two constructs were then used for differentiation into microglia using a fully defined and scalable generation of microglia derived from a human pluripotent cell line (WO 2018 / 160496).
[0189] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]
[0190] [Table 3-1] [Table 3-2] [Table 3-3]
[0191] Example 4. Expression of neprilysin in vitro by engineered iPSC-derived microglia
[0192] The digestion and phagocytosis characteristics of the designed iPSC-derived microglia were determined. The phagocytic activity of isogenic WT, CD9:NEP (Figure 4A) and CD9:sNEP (Figure 4B) iPS-derived microglia was investigated using the IncuCyte S3 Live-Cell Analysis System (Sartorius). iPS-microglia were plated in Matrigel-coated 96-well plates at 40K cells / well (6 wells / line). 45 min after plating, 500ng / ml, 1ug / ml and 2ug / ml of 488-labeled fibrillized Aβ(1-42) (Anaspec) were plated in the wells for recording. Image masks of the fluorescent signal (phagocytosis of 488-labeled fibrillized Aβ) were normalized to the cell body area using IncuCyte 2020B software. As shown in Figure 4C, significant phagocytosis by cells expressing and secreting neprilysin was observed (Figure 4B). Furthermore, a higher level of phagocytosis was observed in cells expressing tethered neprilysin than in wild-type microglia (Figure 4A and Figure 4C). These studies demonstrate that engineered microglia can express the therapeutic payload neprilysin and that the expressed neprilysin increases the phagocytosis of Aβ polymers.
[0193] Example 5. Demonstration of neprilysin expression in vivo by engineered iPSC-derived microglia.
[0194] As used herein, the term "xMG" refers to xenografted or reisolated cells from the brain. The term "iMGL" refers to in vitro or any pre-transplanted cells.
[0195] A series of engraftment studies in MITRG and 5x-MITRG mice investigated the activity of engrafted xMG according to the present disclosure. The design is shown in a schematic diagram in FIG. 12A. In summary, human iPSC-derived microglial progenitor cells were transplanted into the hippocampus and overlying cortex of 2-month-old WT and 5x-MITRG mice. At 6.5 months of age, mice were sacrificed, and the hippocampus and cortex were microdissected and investigated using an ELISA that detects both endogenous mouse neprilysin and human neprilysin and is more sensitive to soluble secreted NEP than membrane-bound NEP. As shown in Figures 5A-5B, xMG of the present disclosure specifically expressed both soluble (sNEP) and membrane-bound (NEP) (Figure 5C) species when transplanted into 5x-MITRG but not WT-MITRG mice, with the soluble species detectable above background in soluble extracts of both the cortex and hippocampus, as well as the membrane-bound species detectable in soluble extracts from hippocampal samples. sNEP levels were significantly increased only in 5x-MITRG but not WT mice, as a result of CD9-regulated expression of sNEP, which is specifically induced by proximity to amyloid pathology (see Figures 1A-1P and Figures 2A-2H).
[0196] We observed a statistically significant reduction in human Aβ-42 and human Aβ-40 peptides in the soluble and insoluble fractions of the cortex and hippocampus from 5x-MITRG mice treated with either NEP-expressing iMGL or sNEP-expressing iMGL, as shown in Figures 6A-6D, 7A-7D, 18A-18D, and 19A-19D. NEP-expressing microglia significantly reduced soluble Aβ-42 levels in the cortex (ANOVA with Tukey's post-hoc test, p<0.05). An additive trend toward reduced Aβ is observed in the hippocampus with NEP and sNEP expression. As shown in Figures 8A-8B, a statistically significant reduction in human Aβ oligomers in the soluble hippocampal and soluble cortical fractions was also observed in NEP-treated animals by MSD assay. These measurements also suggested a trend toward reduction in sNEP-treated animals, but did not reach statistical significance in the samples examined. Nevertheless, overall, these data indicate that both NEP- and sNEP-expressing iMGLs can reduce at least some AD-associated Aβ species in vivo.
[0197] The reduction in Aβ species was complemented by a reduction in phenotypic signals associated with AD. As shown in Figures 9A-H, sNEP-treated 5x-MITRG mice showed an increase in pre- and postsynaptic markers, suggesting a reduction or reversal of synaptic loss seen in untreated 5x-fAD mice and human patients. As shown in Figures 10A-B, a reduction in GFAP expression (a marker of the observed astrogliosis) was also seen in both NEP- and sNEP-treated 5xMITRG mice. Taken together, these data indicate that iMGL can reduce or correct cellular and molecular phenotypes associated with AD in vivo.
[0198] Importantly, the reduction in AD-related phenotypic signals shown in Figures 5A-10B was not accompanied by significant off-target effects of neprilysin expression (Figures 16A-16D and Figures 17A-17D). As shown in Figures 11A-11D, the levels of neprilysin, two non-Aβ substrates, bradykinin and somatostatin, were essentially constant in cortical and hippocampal samples from sham-treated (PBS) 5xMITRG mice, WT 5xMITRG mice, NEP 5xMITRG mice and sNEP-treated 5xMITRG mice, indicating that systemic neprilysin activity was not increased to a level that would cause off-target degradation by administration of NEP-expressing iMGL or sNEP-expressing iMGL according to the present disclosure.
[0199] Taken together, these data provide strong evidence that the disclosed systems and methods deliver pharma- tically effective doses of therapeutic payloads with high specificity to sites of AD pathology, and that the disclosed systems and methods may be effective in treating, alleviating or preventing amyloid beta-related pathology, e.g., Alzheimer's-related pathology.
[0200] Example 6. Amyloid pathology induces CD9 expression in human microglia, which leads to highly localized induction of neprilysin.
[0201] Two-month-old 5x-MITRG mice were transplanted into the hippocampus and overlying cortex with either PBS vehicle, unmodified human microglial progenitor cells, CD9-NEP-modified human microglial progenitor cells, or CD9-sNEP-modified human microglial progenitor cells. Mice were sacrificed at 6.5 months of age, and brains were examined using immunohistochemistry and confocal microscopy. To determine whether neprilysin expression is induced under the control of the CD9 promoter in plaque-associated human microglia, sections were labeled for Ku80 to detect human microglial nuclei, and Amylo-Glo to detect beta-amyloid plaques, CD9, and neprilysin.
[0202] As shown, Ku80+ human microglial nuclei are observed scattered throughout the tissue. However, CD9 expression is only upregulated in human Ku80+ microglia adjacent to Amylo-Glo positive amyloid plaques. Furthermore, neprilysin expression is highly correlated with CD9 expression and is only observed in microglia adjacent to plaques. Thus, these immunohistochemical images demonstrate that CD9-regulated expression of neprilysin is highly localized exclusively to plaque-adjacent human microglia. Thus, these data demonstrate that human microglia modified to introduce NEP and sNEP sequences under the control of the CD9 promoter are functioning as specifically designed.
[0203] As shown, Ku80+ human microglial nuclei are observed scattered throughout the tissue. However, CD9 expression is only upregulated in human Ku80+ microglia adjacent to Amylo-Glo positive amyloid plaques. Furthermore, neprilysin expression is highly correlated with CD9 expression and is only observed in microglia adjacent to plaques. Thus, these immunohistochemical images demonstrate that CD9-regulated expression of neprilysin is highly localized exclusively to plaque-adjacent human microglia. Thus, these data demonstrate that human microglia modified to introduce NEP and sNEP sequences under the control of the CD9 promoter are functioning as specifically designed.
[0204] The results shown in Figure 13 demonstrated that amyloid pathology induces CD9 expression in human microglia, leading to highly localized induction of neprilysin. Ku80 was used to visualize the nuclei of transplanted human microglia. Importantly, CD9 expression and the resulting neprilysin induction were observed only in human microglia located adjacent to Amylo-Glo positive beta-amyloid plaques.
[0205] Furthermore, Figure 14 demonstrates that hippocampal Aβ pathology can be reduced by sNEP-expressing human microglia in vivo, indicating the therapeutic potential of using genetically modified human microglia for the treatment of Alzheimer's disease. In addition, as shown in Figure 15, the number of medium and large AmyloGlo-positive plaques was significantly reduced in vivo by induction of neprilysin, further highlighting the potential of this approach as a therapeutic strategy for Alzheimer's disease.
[0206] Example 7: Use of the modified cells described herein to prevent Alzheimer's disease pathways.
[0207] A 45-year-old subject who has undergone genetic testing and has been found to be at high risk for developing Alzheimer's disease consults a physician for expert advice. The physician proposes a novel treatment involving iPSC-derived human microglial cells (iMGLs) that express and release a therapeutic molecule (e.g., neprilysin) upon proximity to Alzheimer's-related pathology (e.g., alpha-beta plaques). The physician explains that the therapeutic molecule (e.g., neprilysin) is predicted to prevent the formation of Aβ pathology. The subject agrees to undergo the treatment, but must first undergo a series of cognitive tests. After receiving the treatment, the subject is able to successfully complete annual cognitive tests during the medical examination. No adverse side effects were reported.
[0208] Example 8: Use of the modified cells described herein to ameliorate Alzheimer's disease pathology.
[0209] A 65-year-old individual was recently diagnosed with Alzheimer's disease after undergoing cognitive testing and multiple biopsies that reveal beta-amyloid plaques. The individual, along with his family, consults with his physician to explore possible treatment options. The physician recommends a therapeutic composition that includes modified iMGL cells. The physician explains that a sample of the subject's cells will be collected and modified to incorporate a therapeutic molecule with neprilysin activity. After modification, the cells are administered to the subject's hippocampus. After consenting to treatment, the subject undergoes two surgeries, one to collect the cells and one to administer the modified cells. The subject then undergoes regular cognitive testing and biopsies to evaluate the effectiveness of the treatment. After six months of treatment, the subject's cognitive test results show improvement and their biopsies show a reduction in amyloid plaques. The physician plans to monitor the subject every six months for the next five years and once a year thereafter. No adverse side effects have been reported.
[0210] Although preferred embodiments of the present invention have been shown and described, it will be readily apparent to one skilled in the art that modifications may be made without departing from the scope of the appended claims. Thus, the scope of the present invention should be limited only by the appended claims. In some embodiments, the figures presented in this patent application are drawn to scale, including angles, dimensional proportions, etc. In some embodiments, the figures are merely representative, and the claims are not limited by the dimensions of the figures. In some embodiments, the description of the invention described herein using the phrase "comprising" includes embodiments that may be described as "consisting essentially of" or "consisting of", and thus satisfies the written description requirement for claiming one or more embodiments of the invention using the phrase "consisting essentially of" or "consisting of".
Claims
1. Modified cells that express, present, or secrete therapeutic molecules, wherein the modified cells (a) A nucleic acid sequence encoding a therapeutic molecule that cleaves amyloid beta (Aβ), binds to Aβ, enhances Aβ proteolysis, enhances Aβ microglial phagocytosis, or a combination thereof, (b) Modified cells comprising a promoter selected from the DCSTAMP gene promoter, CD9 gene promoter, CD44 gene promoter, LGALS3 gene promoter, SPP1 gene promoter, GPNMB gene promoter, HLA-DRB gene promoter, LPL gene promoter, LIPA gene promoter, FABP3 gene promoter, MS4A6A gene promoter, CXCR4 gene promoter, CHI3L1 gene promoter, OLR1 gene promoter, CD36 gene promoter, SLAMF8 gene promoter, TREM2 gene promoter, MSR1 gene promoter, B2M gene promoter, ITGAX gene promoter, and MITF gene promoter, wherein the promoter is functionally linked to the nucleic acid sequence encoding the therapeutic molecule.
2. The modified cell according to claim 1, wherein the promoter is configured to activate the transcription of the therapeutic molecule when the cell is in close proximity to an Aβ peptide plaque, a soluble Aβ monomer, an insoluble Aβ monomer, an Aβ oligomer, pyroglutamate Aβ, a prefibrillary, or a fibrillary containing Aβ or a fragment thereof, or when the cell is in contact with an Aβ peptide plaque, a soluble Aβ monomer, an insoluble Aβ monomer, an Aβ oligomer, pyroglutamate Aβ, a prefibrillary, or a fibrillary containing Aβ or a fragment thereof.
3. The modified cells according to claim 1, expressing P2RY12 and TREM2.
4. The modified cell according to claim 1, which is a migratory cell or a cell produced from a cell lineage capable of differentiating into a migratory cell.
5. The modified cells according to claim 1, which are pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), bone marrow progenitor cells, erythromyeloid progenitor cells, hematopoietic stem cells, hematopoietic progenitor cells, lymphocyte progenitor cells, megakaryocyte-erythroblast cells, umbilical cord blood stem cells, neural stem cells, or embryonic stem cells, microglia-like cells, monocytes, human iPSC-derived microglia cells, or human iPSC-derived hematopoietic precursor cells.
6. The modified cell according to claim 1, which is a microglia-like cell.
7. The modified cells according to claim 1, which are hematopoietic precursor cells.
8. The modified cell according to claim 1, wherein the cell is a hematopoietic precursor cell derived from human iPSC.
9. The modified cell according to claim 1, wherein the cell is a human iPSC-derived microglia cell.
10. (a) capable of phagocytosing human synaptosomes; (b) It can phagocytose amyloid Aβ fibers; or (c) Able to migrate to the injured area, A modified cell according to claim 1, which is a cell.
11. The modified cell according to claim 1, wherein the therapeutic molecule is a membrane-bound protein or a secreted protein.
12. The modified cell according to claim 1, wherein the therapeutic molecule comprises membrane-bound neprilysin or secreted neprilysin.
13. The modified cell according to claim 1, wherein the therapeutic molecule comprises a peptide having an amino acid sequence identical to at least 70% of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO:
3.
14. The modified cell according to claim 1, wherein a first polynucleotide encoding a protease cleavage site, a ribosome skipping sequence, or a self-cleaving peptide is inserted between the exon coding sequence and the nucleic acid sequence encoding a therapeutic protein.
15. The modified cell according to claim 1, wherein the promoter is a CD9 promoter.
16. The modified cell according to claim 1, wherein the therapeutic molecule reduces the amount, size, or number of Aβ peptides in Aβ peptide plaques in vivo or in vitro.
17. A pharmaceutical composition comprising (i) modified cells according to any one of claims 1 to 16 and (ii) a pharmaceutically acceptable excipient.
18. The pharmaceutical composition according to claim 17, which is formulated for injection into a subject.
19. The pharmaceutical composition according to claim 17, formulated for parenteral injection, intravenous injection, or intracranial injection.
20. A pharmaceutical composition for use in the treatment of an individual having a disease or condition related to amyloid beta-associated pathology, comprising (i) modified cells as described in any one of claims 1 to 16 and (ii) a pharmaceutically acceptable excipient.