Gene therapy for diseases with CNS manifestations

Abstract

The present disclosure relates generally to viral vectors containing engineered transgenes capable of crossing the blood-brain barrier and their use in treating diseases that manifest with central nervous system symptoms (such as, but not limited to, Hunter syndrome, Gaucher disease, and Sanfilippo syndrome).

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This PCT application claims the benefit of priority to U.S. Provisional Application No. 63 / 326,780, filed April 1, 2022, No. 63 / 350,822, filed June 9, 2022, and No. 63 / 478,342, filed January 3, 2023, each of which is incorporated by reference in its entirety.

[0002] References to sequence listings submitted electronically via EFS-WEB The contents of the Sequence Listing (Name: 3817_141PC03_SequenceListing_ST26, Size: 41,454 bytes; and Creation Date: March 30, 2023) submitted with this application as an electronically submitted ASCII text file are hereby incorporated by reference in their entirety.

[0003] The present disclosure relates generally to viral vectors containing engineered transgenes capable of crossing the blood-brain barrier and their use in treating diseases that manifest with central nervous system symptoms. [Background technology]

[0004] Diseases that affect the central nervous system (CNS) are some of the most difficult to treat. The body's own protections, including the blood-brain barrier (BBB), make it very difficult, if not impossible, for large amounts of systemically delivered drugs and biologics to have an effect within the CNS. In particular, the use of protein-based therapeutics is limited because of minimal exposure to the brain (see, e.g., Arguello and Mahon et al., J. Exp. Med. 219(3):e20211057 (2022); Kumar et al., Bioconjug. Chem.; 29(12):3937-3966 (2018); Stanimirovic et al., BioDrugs. 32(6):547-559 (2018)). Similarly, most polar small molecules (e.g., antibodies), and nearly all macromolecules, are effectively restricted from penetrating the brain at therapeutically relevant concentrations by physical and biochemical barriers, most notably the BBB (Arguello and Mahon et al., J. Exp. Med. 219(3):e20211057 (2022); Abbott et al., Acta. Neuropathol. (2018); Banks, Nat. Rev. Drug Discov. 15(4):275-92 (2016)).

[0005] This hurdle to effective treatment is particularly relevant for lysosomal storage diseases (LSDs). LSDs represent a family of more than 50 monogenic disorders, many of which are characterized by defects in a single lysosomal enzyme. Their combined prevalence is estimated at 1 in 8,000 births (see: Arguello and Mahon et al., J. Exp. Med. 219(3):e20211057(2022); Schultz et al., Trends Neurosci. 34(8):401-10(2011)), constituting a significant and underserved patient population. Disease-associated variants lead to reduced or lost enzyme activity, resulting in substrate accumulation and widespread lysosomal dysfunction (Platt et al., J. Cell Biol. 199(5):723-734(2012)), which can trigger pathogenic cascades affecting multiple tissues throughout the body, such as the CNS (Bellettato and Scarpa, J. Inherit. Metab. Dis. 33(4):347-62(2010)). Indeed, given that lysosomes are ubiquitous in all cells of the body, in addition to syndromic symptoms in peripheral organs, most LSDs include progressive CNS dysfunction. However, treatment of CNS symptoms in LSDs remains a major challenge.

[0006] The standard of care for many LSDs is systemically administered recombinant enzyme replacement therapy (ERT), but these first-generation enzymes do not readily cross the BBB and have typically been ineffective in treating CNS symptoms of the disease (Scarpa et al., Best Pract. Res. Clin. Endocrinol. Metab. 29(2):159-71 (2015)). Despite showing promise in reducing substrate levels outside the CNS, these therapies are often less effective at reducing substrate levels in the brain (see, e.g., Sonoda et al., Mol. Ther. 26:1366-74 (2018); Morimoto et al., Mol. Ther. 29:1853-61 (2021)). In addition to the paucity of treatments that effectively address the neurological symptoms of these diseases, direct CNS delivery approaches are invasive, susceptible to device issues, and may result in suboptimal distribution to the brain (Ullman et al. Sci. Transl. Med. 12(545):1163(2020)).

[0007] For example, mucopolysaccharidosis II (MPS II), also known as Hunter syndrome, is a lysosomal storage disease caused by mutations in iduronate-2-sulfatase (IDS or I2S) and is characterized by a variety of physical and neurological symptoms. Hunter syndrome is a debilitating disease that affects multiple organ systems (e.g., organomegaly (especially of the liver and spleen)), progressive joint and skeletal damage, and severe cognitive impairment in the neurological form of MPS II. Currently approved intravenous ERT using recombinant IDS is ineffective in treating CNS symptoms because it cannot cross the BBB (Noh and Lee, J. Clin. Pharm. Ther. 39(3):215-24(2014)).

[0008] Mucopolysaccharidoses (MPS) are a group of inherited lysosomal storage disorders, including, in addition to Hunter syndrome, Hurler syndrome (MPS I), Sanfilippo syndrome (MPS III), and Sly syndrome (MPS VII). Hurler syndrome is the most severe form of mucopolysaccharidoses and is characterized by a deficiency of the enzyme α-L-iduronidase, which leads to the accumulation of dermatan sulfate and heparan sulfate. Sanfilippo syndrome has four subtypes (A, B, C, and D), which are differentiated by four different enzyme deficiencies, respectively. Sly syndrome is characterized by a deficiency of β-glucuronidase, which leads to the accumulation of glycosaminoglycans, dermatan sulfate, heparan sulfate, and chondroitin sulfate. Other LSDs include Gaucher disease, metachromatic leukodystrophy, Krabbe disorder, and GM1 gangliosidosis. For example, Gaucher's disease is characterized by a deficiency of glucocerebrosidase, which leads to the accumulation of certain lipids (specifically glucocerebroside) throughout the body, particularly in the bone marrow, spleen, and liver. The disease can also affect the brain, lungs, eyes, and bones, resulting in a variety of symptoms.

[0009] Emerging strategies to improve delivery of protein therapeutics to the brain leverage receptor-mediated transcytosis (RMT) (Ullman et al. Sci. Transl. Med. 12(545):1163 (2020)). RMT is an endogenous process by which essential biomolecules that cannot passively diffuse from the bloodstream into the brain (e.g., insulin and transferrin-bound iron) are actively transported across the BBB through specific interactions with brain endothelial cell receptors (Johnsen et al., Prog. Neurobiol. 2019 181:101665 (2019)). The transferrin receptor (TfR) is an RMT target at the BBB, in part due to its abundant expression on brain endothelial cells (Jefferies et al., Nature. 312:162-163 (1984)). However, numerous imaging and biodistribution studies in mouse models suggest that antibodies targeting TfR may only be minimally released into the brain parenchyma (Paris-Robidas et al., Mol Pharmacol. 80(1):32-9 (2011); Paterson and Webster, Drug Discov. 20:49-52 (2016)).

[0010] Thus, for patients with CNS symptoms of diseases caused by deficiencies in a particular enzyme or protein, there is a need in the art for therapies that result in widespread CNS parenchymal exposure of the particular enzyme or protein. In particular, for LSD, there is a need in the art for therapeutic agents that enhance CNS penetration and ultimately reduce substrate accumulation. Summary of the Invention

[0011] Some embodiments of the present disclosure relate to a gene therapy vector comprising: (a) a 5' inverted terminal repeat (ITR); (b) a promoter; (c) a transgene comprising (i) a nucleotide sequence encoding a biologically active polypeptide and (ii) a nucleotide sequence encoding a TAG; and (d) a 3' ITR.

[0012] In some embodiments, the bioactive polypeptide comprises a therapeutic enzyme. In some embodiments, the bioactive polypeptide reduces substrate levels in the central nervous system. In some embodiments, the bioactive polypeptide comprises idursulfase activity, comprises glucocerebrosidase activity, comprises sulfoglucosamine sulfohydrolase activity, or comprises sulfamidase activity. In some embodiments, the bioactive polypeptide is idursulfase (IDS), glucocerebrosidase (GCB), N-sulfoglucosamine sulfohydrolase, or sulfamidase (SGSH).

[0013] In some embodiments, the TAG increases the translocation of the bioactive polypeptide across the blood-brain barrier. In some embodiments, the TAG comprises an antigen-binding molecule. In some embodiments, the TAG comprises an scFv, a VHH, a vNAR, a diabody, a nanobody, a camelid antibody, or a combination thereof. In some embodiments, the TAG comprises a VHH. In some embodiments, the TAG comprises an antigen-binding molecule that specifically binds to transferrin receptor 1 (TfR1). In some embodiments, the TAG comprises a VHH that specifically binds to TfR1.

[0014] In some embodiments, the TAG comprises a variable heavy (VH) domain comprising a VH complementarity determining region (CDR)1, a VH-CDR2, and a VH-CDR3. In some embodiments, the VH-CDR1 is encoded by the nucleic acid sequence set forth in SEQ ID NO: 11. In some embodiments, the VH-CDR2 is encoded by the nucleic acid sequence set forth in SEQ ID NO: 12. In some embodiments, the VH-CDR3 is encoded by the nucleic acid sequence set forth in SEQ ID NO: 13. In some embodiments, the nucleotide sequence encoding the TAG comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, or 21. In some embodiments, the nucleotide sequence encoding TAG comprises SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, or 21. In some embodiments, the nucleotide sequence encoding TAG comprises SEQ ID NO: 14. In some embodiments, the nucleotide sequence encoding TAG comprises SEQ ID NO: 15.

[0015] In some embodiments, the nucleotide sequence encoding a biologically active polypeptide is 3' to the nucleotide sequence encoding a TAG. In some embodiments, the nucleotide sequence encoding a biologically active polypeptide is 5' to the nucleotide sequence encoding a TAG.

[0016] In some embodiments, (i) the nucleotide sequence encoding the biologically active polypeptide is further linked to (ii) the nucleotide sequence encoding the TAG by (iii) a nucleotide sequence encoding a peptide linker, in some embodiments, the linker is a flexible linker, a cleavable linker, a processable linker, or any combination thereof.

[0017] In some aspects, the promoter is a ubiquitous promoter. In some aspects, the ubiquitous promoter comprises a chicken β-actin (CBA) promoter, an EF-1α promoter, a PGK promoter, a UBC promoter, a LSE β-glucuronidase (GUSB) promoter, or a ubiquitous chromatin opening element (UCOE) promoter. In some aspects, the ubiquitous promoter comprises a cytomegalovirus (CMV) enhancer, a chicken β-actin promoter (CBA), and a rabbit β-globin intron.

[0018] In some embodiments, the promoter is a tissue-specific promoter.In some embodiments, the promoter is a liver-specific promoter.In some embodiments, the promoter comprises hTTR, PGK, chicken beta actin (CBA) promoter, CAG promoter, EF-1α promoter, UBC promoter, LSE beta-glucuronidase (GUSB) promoter, or ubiquitous chromatin opening element (UCOE) promoter, or any combination thereof.

[0019] In some embodiments, the gene therapy vector is a recombinant AAV (rAAV). In some embodiments, the rAAV comprises an AAV capsid. In some embodiments, the AAV capsid is a pantropic AAV capsid. In some embodiments, the AAV capsid is a pantropic AAV capsid selected from AAV1 capsid, AAV2 capsid, AAV3 capsid, AAV4 capsid, AAV5 capsid, AAV6 capsid, AAV7 capsid, AAV8 capsid, AAV9 capsid, and variants thereof. In some embodiments, the AAV capsid is AAV9.

[0020] In some embodiments, the gene therapy vector further comprises a polyA sequence located 3' of the transgene. In some embodiments, the polyA is bovine growth hormone (BGH) polyA or a synthetic polyA. In some embodiments, the polyA is a synthetic polyA designed in silico. In some embodiments, the gene therapy vector further comprises a post-transcriptional regulatory element. In some embodiments, the post-transcriptional regulatory element is located 3' of the transgene. In some embodiments, the post-transcriptional regulatory element is located 5' of the polyA sequence. In some embodiments, the post-transcriptional regulatory element comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the WPRE sequence is modified. In some embodiments, the WPRE sequence is WPRE mut6delATG. In some embodiments, the promoter comprises a truncated EF-1α promoter and one or more introns. In some embodiments, the one or more introns are derived from CBA and / or rabbit β-globin genes.

[0021] In some embodiments, the transgene is codon optimized.

[0022] Some aspects of the present disclosure relate to methods of treating a disease or condition in a subject in need thereof, the method comprising administering to the subject a gene therapy vector encompassed by the present disclosure. In some aspects, the disease or condition comprises a neurological disease. In some aspects, the disease or condition comprises a mucopolysaccharidosis. In some aspects, the disease or condition comprises Hurler syndrome (MPS I), Hunter syndrome (MPS II), Sanfilippo syndrome (MPS III), Sly syndrome (MPS VII), Gaucher disease, metachromatic leukodystrophy, Krabbe disorder, and GM1 gangliosidosis.

[0023] Some aspects of the present disclosure relate to a method of delivering a biologically active polypeptide across the blood-brain barrier in a subject in need thereof, the method comprising administering to the subject a gene therapy vector contained in the present disclosure, such administration reducing substrate levels in the central nervous system of the subject.Some aspects of the present disclosure relate to a method of reducing substrate in the central nervous system of a subject, the method comprising administering to the subject a gene therapy vector disclosed herein.

[0024] Some aspects of the present disclosure relate to methods of treating mucopolysaccharidosis in a subject in need of such treatment, the method comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to methods of treating Hurler syndrome in a subject in need of such treatment (MPS I), the method comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to methods of treating Hunter syndrome in a subject in need of such treatment (MPS II), the method comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to methods of treating Sanfilippo syndrome in a subject in need of such treatment (MPS III), the method comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to methods of treating Sly syndrome in a subject in need of such treatment (MPS VII), the method comprising administering to the subject a gene therapy vector disclosed herein. Some aspects of the present disclosure relate to methods of treating Gaucher disease in a subject in need of such treatment, the method comprising administering to the subject a gene therapy vector disclosed herein.Some aspects of the present disclosure relate to methods of treating metachromatic leukodystrophy in a subject in need of such treatment, the method comprising administering to the subject a gene therapy vector disclosed herein.Some aspects of the present disclosure relate to methods of treating Krabbe disorder in a subject in need of such treatment, the method comprising administering to the subject a gene therapy vector disclosed herein.Some aspects of the present disclosure relate to methods of treating GM1 gangliosidosis in a subject in need of such treatment, the method comprising administering to the subject a gene therapy vector disclosed herein.

[0025] In some embodiments, the recombinant polypeptide is expressed from the transgene outside the central nervous system and the TAG facilitates passage of the recombinant polypeptide across the blood-brain barrier into the central nervous system.

[0026] In some aspects, the recombinant polypeptide reduces substrate levels in the central nervous system of the subject, hi some aspects, the recombinant polypeptide reduces substrate levels systemically.

[0027] Some aspects of the present disclosure relate to a method of treating Hunter syndrome in a subject in need of such treatment, the method comprising administering to the subject a gene therapy vector disclosed herein, wherein the biologically active polypeptide comprises an IDS.

[0028] Some aspects of the present disclosure relate to methods of treating Gaucher disease in a subject in need of such treatment, the method comprising administering to the subject a gene therapy vector disclosed herein, wherein the biologically active polypeptide comprises glucocerebrosidase (GCB).

[0029] Some embodiments of the present disclosure relate to a method of treating Sanfilippo syndrome in a subject in need of such treatment, the method comprising administering to the subject a gene therapy vector disclosed herein, wherein the biologically active polypeptide comprises N-sulfoglucosamine sulfohydrolase. [Brief description of the drawings]

[0030] [Figure 1] (A-C) Graphical representation of brain I2S activity (nmol / hr / mg of total protein, A), brain heparan sulfate levels (ng / mg of total protein, B), and CSF heparan sulfate levels (ng / mL of CSF, C) in 8-12 week old male IdsKO mice after a single intravenous dose of liver-targeted gene therapy constructs [rAAV9-GTH077(I2S), rAAV9-GTH071(I2S-VHH), or rAAV9-GTH074(VHH-I2S)] at 2.5×1012 vg / kg and 6.25×1012 vg / kg. Data from control rAAV9-MY011 (null)-treated and wild-type (WT:WT) littermate vehicle-treated groups are also shown. [Diagram 2]A–H are representative photomicrographs of thalamic neurons immunostained for I2S (A–D) and LAMP1 (E–H) from mice injected with liver-driven GT constructs rAAV9-GTH077 (I2S, A and E), rAAV9-GTH074 (VHH-I2S, B and F), or rAAV9-GTH071 (I2S-VHH, C and G), as well as negative controls (D and H). [Diagram 3] A–L are representative photomicrographs of LAMP1 immunostaining in the cortex (A–D), hippocampus (E–H), and thalamus (I–L) of IdsKO mice after intravenous administration of rAAV9-GTH077 (I2S; A, E, and I) or rAAV9-GTH074 (VHH-I2S; B, F, and J) compared with LAMP1 immunostaining in IdsKO control (C, G, and K) and WT control (D, H, and L) mice in the same brain regions. [Figure 4A] Graphical representation of hI2S activity (nmol / hr / mg of total protein) in terminal serum detected after administration of rAAV9-GTH077(I2S), rAAV9-GTH071(I2S-VHH), or rAAV9-GTH074(VHH-I2S) at 2.5×1012 vg / kg and 6.25×1012 vg / kg to IdsKO mice. [Figure 4B] Graphical representation of hI2S activity (nmol / hr / mg of total protein) in the liver detected after administration of rAAV9-GTH077(I2S), rAAV9-GTH071(I2S-VHH), or rAAV9-GTH074(VHH-I2S) at 2.5×1012 vg / kg and 6.25×1012 vg / kg to IdsKO mice. [Figure 4C] Graphical representation of hI2S activity (nmol / hr / mg of total protein) in the lungs detected after administration of rAAV9-GTH077(I2S), rAAV9-GTH071(I2S-VHH), or rAAV9-GTH074(VHH-I2S) at 2.5×1012 vg / kg and 6.25×1012 vg / kg to IdsKO mice. [Figure 4D]Graphical representation of hI2S activity (nmol / hr / mg of total protein) in bone marrow detected after administration of rAAV9-GTH077(I2S), rAAV9-GTH071(I2S-VHH), or rAAV9-GTH074(VHH-I2S) at 2.5×1012 vg / kg and 6.25×1012 vg / kg to IdsKO mice. [Figure 4E] Graphical representation of hI2S activity (nmol / hr / mg of total protein) in the heart detected after administration of rAAV9-GTH077(I2S), rAAV9-GTH071(I2S-VHH), or rAAV9-GTH074(VHH-I2S) at 2.5×1012 vg / kg and 6.25×1012 vg / kg to IdsKO mice. [Figure 4F] Graphical representation of hI2S activity (nmol / hr / mg of total protein) in the kidney detected after administration of rAAV9-GTH077(I2S), rAAV9-GTH071(I2S-VHH), or rAAV9-GTH074(VHH-I2S) at 2.5×1012 vg / kg and 6.25×1012 vg / kg to IdsKO mice. [Diagram 5] (A-C) Graphical representation of brain I2S activity (nmol / hr / mg of total protein, A), brain heparan sulfate levels (ng / mg of total protein, B), and CSF heparan sulfate levels (ng / mL of CSF, C) for animals administered rAAV9 vectors expressing I2S driven by a ubiquitous promoter [rAAV9-GTH075(I2S), rAAV9-GTH069(I2S-VHH), and rAAV9-GTH072(VHH-I2S)] at a dose of 2.5×1012 vg / kg. Data for control rAAV9-MY011 (null)-treated and wild-type (WT:WT) littermate vehicle-treated groups are also shown. [Figure 6A] Graphical representation of hI2S activity in terminal serum after administration of rAAV9-GTH075(I2S), rAAV9-GTH072(VHH-I2S), or rAAV9-GTH069(I2S-VHH) at 2.5×1012 vg / kg to IdsKO mice. [Figure 6B] Graphical representation of hI2S activity in liver after administration of rAAV9-GTH075(I2S), rAAV9-GTH072(VHH-I2S), or rAAV9-GTH069(I2S-VHH) at 2.5×1012 vg / kg to IdsKO mice. [Figure 6C] Graphical representation of hI2S activity in the lungs after administration of rAAV9-GTH075(I2S), rAAV9-GTH072(VHH-I2S), or rAAV9-GTH069(I2S-VHH) at 2.5×1012 vg / kg to IdsKO mice. [Figure 6D] Graphical representation of hI2S activity in bone marrow after administration of rAAV9-GTH075(I2S), rAAV9-GTH072(VHH-I2S), or rAAV9-GTH069(I2S-VHH) at 2.5×1012 vg / kg to IdsKO mice. [Figure 6E] Graphical representation of hI2S activity in the heart following administration of rAAV9-GTH075(I2S), rAAV9-GTH072(VHH-I2S), or rAAV9-GTH069(I2S-VHH) at 2.5×1012 vg / kg to IdsKO mice. [Figure 6F] Graphical representation of hI2S activity in the kidney following administration of rAAV9-GTH075(I2S), rAAV9-GTH072(VHH-I2S), or rAAV9-GTH069(I2S-VHH) at 2.5×1012 vg / kg to IdsKO mice. [Figure 7] A-B are graphical representations of sustained hI2S activity in serum throughout a 4-week study in IdsKO mice treated with gene therapy constructs expressing I2S with a liver-specific promoter (A) or a ubiquitous promoter (B). [Figure 8] AB are graphical representations of GCB activity (nmol / hr / mg) in cell lysates (A) and supernatants (B) after transfection of Huh7 cells with plasmids expressing tagged and untagged GCB. [Figure 9]A–C are graphical representations of GCB activity (nmol / hr / mg, A), GL-1 levels (normalized total GL1, ng / mg of protein, B), and lyso-GL1 levels (normalized lysoGL1, ng / mg of protein, C) in the brain of D409V mice after injection with buffer, pGTG077, or pGTG072. [Figure 10] AC show graphs of GCB activity (nmol / hr / ml) in serum (A), liver (B), and spleen (C) after injection of buffer, pGTG077, or pGTG072 into D409V mice. [Figure 11] 1 is a graphical representation of the percentage of SGSH activity after transfection of Huh7 cells with plasmids expressing tagged and untagged SGSH. [Figure 12] A–C are graphical representations of SGSH concentrations in the brain (ng of hSGSH / mg of total, A), serum (ng / mL, B), and liver (ng of SGSH / mg of total, C) of WT mice after injection with vehicle, SGSH, SGSH-BBB1, or BBB1-SGSH, as indicated. [Figure 13] Shown is the brain exposure to serum ratio of SGSH in WT mice after injection with SGSH, SGSH-BBB1, or BBB1-SGSH. [Figure 14] 5A-D are schematic diagrams of examples of vector constructs of the present disclosure. AB show constructs containing an IDS transgene sequence under control of a ubiquitous promoter ("Ubiq", A) or a liver-specific promoter ("LSP") and liver-specific enhancer ("LSE", B). C-D show constructs containing an SGSH transgene sequence under control of a liver-specific promoter ("LSP") and liver-specific enhancer ("LSE"). SP = signal peptide. [Figure 15] AB are bar graphs showing the percentage of SGSH protein measured to cross the in vitro Mimetas system membrane at high (A) and low (B) concentrations of the SGSH BBB1 fusion construct. [Figure 16] A-E are graphical representations of transcytosis measured using the transwell model. A is a representative image of TEER values ​​3 days after seeding hBMEC cells compared to cell-free wells. B-E are bar graphs showing SGSH activity (B) and transcytosed SGSH protein (C) using transfected medium, and transcytosed SGSH protein (D) and SGSH activity (E) using purified protein. [Figure 17] AC are bar graphs showing GAG concentrations in cultured fibroblasts compared to normal cells (A) and dose-dependent accumulation of SGSH in fibroblasts on days 3 (B) and 5 (C) of culture. [Figure 18] A–J are representative images of control (A–D) and MPSIIIA patient-derived (E–J) fibroblasts stained with Lysotracker Red (A, C, E, G, and I) and Hoechst (B, D, F, H, and J). [Figure 19] A-D are bar graphs showing liver (A), serum (B), and brain (C) SGSH levels and relative brain SGSH activity (D) in control and wild-type mice administered SGSH BBB1 fusion constructs via hydrodynamic tail vein injection. [Figure 20] A–F are sample images of immunohistochemistry of SGSH in brain samples obtained from wild-type mice administered SGSH C-terminal (C–D) and N-terminal (E–F) fusion constructs by hydrodynamic tail vein injection compared to mice administered control SGSH. [Figure 21] A-G show the characteristics of MPSIIIA mouse model. A-D show SGSH activity in brain (A), kidney (B), liver (C), and spleen (D) in wild-type mice and mice heterozygous or homozygous for a knock-in point mutation in the Sgsh gene. E-G show sample histological images of anti-LAMP1 staining in the cortex of wild-type mice (E) and mice heterozygous (F) or homozygous (G) for a knock-in point mutation in the Sgsh gene. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] Some aspects of the present disclosure relate to viral vectors containing transgenes capable of crossing the blood-brain barrier and their use in treating diseases that present with CNS symptoms. Diseases that affect the CNS can be very difficult to treat, especially when the disease mechanism involves a deficiency or absence of a protein, such as an enzyme. This is the case for various lysosomal storage disorders (LSDs), many of which are characterized by a defect in a single lysosomal enzyme. Administration of recombinant enzyme replacement therapy (ERT) remains the standard treatment for various LSDs, but these enzymes do not readily cross the blood-brain barrier, greatly limiting their effectiveness for LSD patients. Furthermore, these treatments must be delivered periodically to maintain the reduced substrate levels required to alleviate symptoms. Thus, the compositions and methods disclosed herein provide a novel and effective means to deliver recombinant proteins (e.g., enzymes) across the blood-brain barrier and reduce and / or ameliorate the devastating CNS symptoms of various LSDs. These include, but are not limited to, mucopolysaccharidoses (e.g., Hurler syndrome (MPS I), Hunter syndrome (MPS II), Sanfilippo syndrome (MPS III), Sly syndrome (MPS VII), Gaucher disease, metachromatic leukodystrophy, Krabbe disorder, and GM1 gangliosidosis).

[0032] The compositions and methods described herein allow for increased localization across the BBB of proteins that correct cellular dysfunction within the CNS (e.g., lysosomal enzymes that are otherwise deficient in the case of LSDs). These compositions further utilize viral vector gene therapy as a means to provide continuous expression of proteins in subjects, thereby eliminating the need for repeated re-administration and providing patients with sustained substrate reduction and alleviation of disease symptoms.

[0033] I. Definition As used herein, the term "about" or "approximately" refers to a value similar to the stated reference value when applied to one or more target values. In certain embodiments, the term "about" or "approximately" refers to a range of values ​​that falls within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater or less) of the stated reference value, unless otherwise stated or otherwise clear from the context (except when such value exceeds 100% of possible values). When the term "about" or "approximately" is used to modify a stated reference value, it is understood that the stated reference value itself is encompassed along with values ​​that lie near either side of the stated reference value.

[0034] As used herein, the term "active" or "activity" refers to forms of a therapeutic protein that retain a biological activity of the corresponding native or naturally occurring polypeptide. Activity may be greater than, equal to, or less than the activity observed in the corresponding native or naturally occurring polypeptide.

[0035] As used herein, the terms "administer", "administration" and "administering" refer to providing a composition of the present disclosure to a subject in need thereof (e.g., one suffering from the effects of Hunter's disease). The composition can be administered by any route. In some aspects, the composition is administered intravenously, intraperitoneally, intraocularly, orally, by inhalation, intrathecally, intracranially, intracarotid, intracisternomagna (ICM), intracerebroventricularly (ICV), intraarterially, or any combination thereof.

[0036] As used herein, the term "allogeneic" refers to any material that is derived from a different animal of the same species as the individual to whom the material is introduced. Two or more individuals are said to be allogeneic to each other when the genes at one or more loci are not identical. In some embodiments, allogeneic materials from individuals of the same species may be genetically sufficiently different to interact antigenically.

[0037] As used herein, the term "amino acid substitution" refers to the replacement of an amino acid residue present in a parent or reference sequence with another amino acid residue. An amino acid can be substituted in a parent or reference sequence, for example, by chemical peptide synthesis or recombinant methods known in the art. Thus, a reference to a "substitution at position X" means replacing an amino acid present at position X of a reference sequence with an alternative amino acid residue. In some embodiments, the substitution pattern can be described according to the diagram AnY, where A is a one-letter code corresponding to the amino acid naturally or originally present at position n, and Y is a replacement amino acid residue. In other embodiments, the substitution pattern can be described according to the diagram An(YZ), where A is a one-letter code corresponding to the amino acid residue replacing the naturally or originally present amino acid at position X, and Y and Z are alternative replacement amino acid residues.

[0038] The abbreviations used for the genetically encoded amino acids are conventional and are as follows: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamic acid (Glu or E), glutamine (Gln or Q), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V). When a three-letter abbreviation is used, the amino acid is referred to as having an α-carbon (C α ) may be in either the L- or D-configuration.

[0039] Substitutions in the amino acid sequence of a protein or polypeptide can be either conservative or non-conservative in nature. Conservative amino acid substitutions refer to the replacement of a residue with a different residue having a similar side chain, and thus usually involve replacing an amino acid in a polypeptide with an amino acid within the same or a similar defined amino acid class. By way of example and not limitation, an amino acid having an aliphatic side chain may be replaced with another aliphatic amino acid (e.g., alanine, valine, leucine, and isoleucine), an amino acid having a hydroxyl side chain may be replaced with another amino acid having a hydroxyl side chain (e.g., serine and threonine), an amino acid having an aromatic side chain may be replaced with another amino acid having an aromatic side chain (e.g., phenylalanine, tyrosine, tryptophan, and histidine), an amino acid having a basic side chain may be replaced with another amino acid having a basic side chain (e.g., lysine and arginine), an amino acid having an acidic side chain may be replaced with another amino acid having an acidic side chain (e.g., aspartic acid or glutamic acid), and / or a hydrophobic or hydrophilic amino acid may be replaced with another hydrophobic or hydrophilic amino acid, respectively. Non-conservative substitutions refer to the replacement of an amino acid in a polypeptide with an amino acid having significantly different side chain properties. By way of example and not limitation, exemplary non-conservative substitutions can be an acidic amino acid substituted with a basic or aliphatic amino acid, an aromatic amino acid substituted with a small amino acid, and a hydrophilic amino acid substituted with a hydrophobic amino acid.

[0040] In some embodiments, substitutions (even when referred to as amino acid substitutions) are made at the nucleic acid level, i.e., replacing an amino acid residue with an alternative amino acid residue is made by replacing a codon encoding a first amino acid with a codon encoding a second amino acid.

[0041] As used herein, the term "animal" refers to any member of the animal kingdom. In some aspects, "animal" refers to humans at any stage of development. In some aspects, "animal" refers to non-human animals at any stage of development. In particular aspects, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, or pig). In some aspects, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and insects. In some aspects, the animal is a transgenic animal, a genetically engineered animal, or a clone.

[0042] As used herein, the term "antibody" refers to an immunoglobulin molecule that recognizes and specifically binds to a target (e.g., a protein, a polypeptide, a peptide, a carbohydrate, a polynucleotide, a lipid, or a combination of the above) through at least one antigen recognition site in the variable region of the immunoglobulin molecule. As used herein, the term "antibody" includes: polyclonal antibodies, monoclonal antibodies, antibody fragments (e.g., Fab, Fab', F(ab')2, and Fv fragments), single-chain Fv (scFv) variants, multispecific antibodies (e.g., bispecific (e.g., generated from at least two intact antibodies)), chimeric antibodies, humanized antibodies, human antibodies, fusion proteins containing an antigenic determining portion of an antibody, and any other modified immunoglobulin molecule containing an antigen recognition site, so long as the antibody exhibits the desired biological activity. Antibodies can be of any isotype (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass. Both light and heavy chains are divided into regions of structural and functional homology. Different classes of immunoglobulins have different and well-known subunit structures and three-dimensional configurations. Antibodies can be naked or conjugated to other molecules (e.g., toxins, radioisotopes, etc.).

[0043] "VHH" as used herein refers to the variable domain of a heavy chain only VHH molecule. In some embodiments, the VHH is a camelid heavy chain only VHH molecule. In some embodiments, the VHH is generated from a human antibody, a humanized antibody, or a synthetic antibody. A VHH is typically about 15 kDa in size and contains a single chain molecule that can bind to a cognate antigen using a single domain. A VHH is typically composed of four framework regions (FR) and three complementarity determining regions (or CDRs), which are highly variable in both sequence content and structural conformation, and are involved in antigen binding and provide antigen specificity. In some embodiments, a VHH is modified to increase affinity, stability, solubility, and / or resistance to aggregation. For example, compared to a conventional human antibody VH, one or more amino acids in the FR2 region and CDRs of the VHH can be substituted in the FR2 region and complementarity determining regions (CDRs) of the VHH. In some embodiments, one or more highly conserved hydrophobic amino acids in the FR2 region (e.g., Val47, Gly49, Leu50, and / or Trp52) are replaced with hydrophilic amino acids (e.g., Phe42, Glu49, Arg50, Gly52) to make the overall structure more hydrophilic, contributing to increased stability, solubility, and resistance to aggregation.

[0044] As used herein, in the context of sequence optimization, the term "codon substitution" or "codon exchange" refers to the replacement of a codon present in a reference nucleic acid sequence with another codon. For example, a codon in a reference nucleic acid sequence can be replaced by chemical peptide synthesis or recombinant methods known in the art. Thus, reference to "substitution" or "exchange" at a particular position in a nucleic acid sequence (e.g., mRNA) or within a particular region or subsequence of a nucleic acid sequence (e.g., mRNA) refers to the replacement of the codon at such position or region with an alternative codon.

[0045] As used herein, "codon optimized" or "codon optimization" refers to the alteration of codons in a polynucleotide encoding a protein such that the encoded protein is more efficiently expressed, e.g., in a cell or organism. In some aspects, the nucleotide sequences (e.g., transgenes) disclosed herein are codon optimized for expression in human cells (e.g., in vivo).

[0046] The term "gene" as used herein refers to a DNA region that codes for a protein or polypeptide, as well as all DNA regions that regulate the production of a protein or polypeptide (whether or not such regulatory sequences are adjacent to the coding and / or transcribed sequences). Thus, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences (e.g., ribosome binding sites and internal ribosome entry sites), enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions. As used herein, the term "transgene" refers to a heterologous DNA region that codes for a polypeptide. A transgene does not necessarily include promoter sequences, terminators, translational regulatory sequences (e.g., ribosome binding sites and internal ribosome entry sites), enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions. In some embodiments, a transgene consists of a polypeptide coding region. In some embodiments, the transgene comprises a nucleic acid encoding a biologically active polypeptide (e.g., an enzyme) linked to a nucleic acid encoding a tag (e.g., a nucleic acid encoding an antigen-binding molecule). In some embodiments, the transgene comprises a nucleic acid molecule encoding a biologically active polypeptide linked to a nucleic acid molecule encoding a tag, with a linker sequence between the nucleic acid encoding the polypeptide and the nucleic acid encoding the tag. In some embodiments, the nucleic acid encoding the tag is 5' to the nucleic acid encoding the polypeptide. In other embodiments, the nucleic acid encoding the tag is 3' to the nucleic acid encoding the polypeptide.

[0047] The term "genomic particles (gp)" or "genome equivalent" as used herein with respect to viral titer refers to the number of virions containing the recombinant AAV (rAAV) DNA genome, regardless of infectivity or functionality.

[0048] The terms "idursulfase", "IDS", "iduronate-2-sulfatase", and "I2S" are used interchangeably to refer to lysosomal enzymes involved in the dermatan sulfate and heparan sulfate degradation pathways (see UniProtKB-P22304).

[0049] The terms "lysosomal acid glucosylceramidase", "β-glucocerebrosidase", "GBA", "acid β-glucosidase", "cholesterol glucosyltransferase", "cholesteryl-β-glucosidase", "D-glucosyl-N-acylsphingosine glucohydrolase", and "GCB" are used interchangeably to refer to lysosomal enzymes involved in the pathway that degrades glucosylceramide to free ceramide and glucose (see UniProtKB-P04062).

[0050] The terms "N-sulfoglucosamine sulfohydrolase", "sulfoglucosamine sulfamidase", "SGSG", "HNS", and "sulfamidase" are used interchangeably to refer to lysosomal enzymes involved in the lysosomal heparan sulfate degradation pathway (see: UniProtKB-P51688).

[0051] As used herein, the term "linker" refers to any molecule or bond that connects two or more moieties. In some embodiments, the linker is a peptide linker, e.g., the linker comprises one or more peptide bonds. In some embodiments, the peptide linker comprises one or more peptides (e.g., polypeptides). In some embodiments, the linker is a chemical linker.

[0052] As used herein, the term "nervous system" includes both the central nervous system and the peripheral nervous system. The term "central nervous system" or "CNS" includes all cells and tissues of the vertebrate brain and spinal cord. The term "peripheral nervous system" refers to all cells and tissues of parts of the nervous system other than the brain and spinal cord. Thus, the term "nervous system" includes, but is not limited to, neuronal cells, glial cells, astrocytes, cells in the cerebrospinal fluid (CSF), cells in the interstitial space, cells in the protective membrane of the spinal cord, epidural cells (i.e., cells outside the dura), cells of non-neural tissue adjacent to, in contact with, or innervated by nervous tissue, cells of the epineurium, perineurium, endoneurium, cords, fascicles, etc.

[0053] As used herein, the terms "nucleic acid," "polynucleotide," and "oligonucleotide" are used interchangeably and refer to deoxyribonucleotide or ribonucleotide polymers in either single- or double-stranded form, in linear or circular configuration. For purposes of this disclosure, these terms should not be construed as limiting with respect to the length of the polymer. The terms can encompass known analogs of natural nucleotides, as well as nucleotides that are modified at the base, sugar, and / or phosphate moieties (e.g., phosphorothioate backbones). In general, analogs of a particular nucleotide have the same base-pairing specificity, i.e., an analog of A will base pair with T.

[0054] As used herein, the terms "operably linked" and "operably linked" (or "operably linked") are used interchangeably to refer to the juxtaposition of two or more components (e.g., sequence elements) that are positioned to allow for the normal function of both components and the possibility that at least one component may mediate a function exerted by at least one other component. By way of illustration, a transcriptional regulatory sequence (e.g., a promoter) is operably linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence depending on the presence or absence of one or more transcriptional regulators. A transcriptional regulatory sequence is usually operably linked in cis with a coding sequence, but need not be directly adjacent to it. For example, an enhancer is a transcriptional regulatory sequence that is operably linked to a coding sequence, even if it is not adjacent to it.

[0055] The terms "polypeptide" and "protein", or the nucleotide sequence encoding same, used interchangeably herein, refer to a protein or nucleotide sequence, respectively, representing either the native sequence, a variant thereof, or a fragment thereof. Full-length proteins and fragments thereof, with or without a signal sequence, as well as proteins having modifications (e.g., deletions, additions, and substitutions (conservative or non-conservative in nature) relative to the native sequence, are contemplated for use herein so long as the protein maintains the desired activity. These modifications may be deliberate, e.g., by site-directed mutagenesis, or accidental, e.g., due to mutations of the host producing the protein or errors due to PCR amplification. Thus, active proteins substantially homologous to the parent sequence (e.g., proteins having 70...80...85...90...95...98...99% etc. identity that retains the desired activity of the native molecule) are contemplated for use herein.

[0056] As used herein, the term "promoter" encompasses a DNA sequence that induces the binding of RNA polymerase, thereby facilitating RNA synthesis, i.e., a minimal sequence sufficient to induce transcription. The promoter and expression of the corresponding protein or polypeptide can be ubiquitous, meaning that it is strongly active in a wide range of cells, tissues, and species, or cell type-specific, tissue-specific, or species-specific. In some embodiments, liver-specific promoters include, for example, the transthyretin promoter (TTR), the thyroxine-binding globulin (TBG) promoter, the hybrid liver-specific promoter (HLP), and the alpha-1-antitrypsin (AAT) promoter. Promoters can be "constitutive," meaning that they are continuously active, or "inducible," meaning that the promoter can be activated or deactivated by the presence or absence of a biotic or abiotic factor. The nucleic acid construct or vector of the present disclosure also includes enhancer sequences, which may or may not be contiguous with the promoter sequence. Enhancer sequences affect promoter-dependent gene expression and can be located in the 5' or 3' region of the native gene. In some aspects, the enhancer is a tissue-specific enhancer. In some aspects, the enhancer is a liver-specific enhancer. In certain aspects, the construct comprises a liver-specific enhancer and a liver-specific promoter upstream of the transgene.

[0057] As used herein, the term "sequence optimization" refers to a process or set of processes in which nucleobases in a reference nucleic acid sequence are replaced with alternative nucleobases to obtain a nucleic acid sequence having improved properties (e.g., improved protein expression or increased activity).

[0058] The terms "subject," "individual," and "patient" are used interchangeably herein and refer to a vertebrate, preferably a mammal, including, but not limited to, murines, rodents, apes, humans, farm animals, sport animals, and pets.

[0059] The term "TAG" or "tag" as used herein refers to a polypeptide that facilitates target localization of an associated second polypeptide to which it is attached. In some aspects, the TAG comprises an antibody or antigen-binding portion thereof that specifically binds to human transferrin receptor 1 (TfR1). In some aspects, the TAG comprises a VHH that specifically binds to human TfR1. In some embodiments, the transgene contained in the viral vector encompassed by the disclosure herein comprises a nucleic acid encoding a polypeptide (e.g., an enzyme mutated or absent in an LSD) that is linked (directly or indirectly (e.g., via a linker nucleic acid sequence)) to a nucleic acid encoding a TAG. In some embodiments, the tag is at the N-terminus of the polypeptide. In other embodiments, the tag is at the C-terminus of the polypeptide. In still other embodiments, the tag is present at both the N-terminus and the C-terminus of the polypeptide. In some embodiments, multiple tags may be linked (directly or indirectly via linkers) to a polypeptide.

[0060] As provided herein, the terms "therapeutic," "effective amount," or "therapeutically effective amount" of a composition or agent refer to a sufficient amount of a composition or agent to provide a desired response (e.g., preventing, delaying the onset of, or ameliorating symptoms in a subject, or achieving a desired biological outcome).

[0061] The term "transferrin receptor" or "TfR" refers to a type II homodimeric transmembrane glycoprotein consisting of two identical subunits (90 kDa) linked by two disulfide bridges (Jing and Trowbridge, EMBO J. 6(2):327-31 (1987); McClelland et al., Cell 39(2):267-74 (1984)). Each monomer has a short cytoplasmic N-terminal domain of 61 amino acids containing a YTRF (tyrosine-threonine-arginine-phenylalanine) internalization motif, a single hydrophobic transmembrane segment of 27 amino acids, and an extensive C-terminal extracellular domain of 670 amino acids containing a trypsin cleavage site and a transferrin binding site. Each subunit is capable of binding to a transferrin molecule. The extracellular domain has one O-glycosylation site and three N-glycosylation sites, the latter of which is particularly important for proper folding and transport of the receptor to the cell surface. The intramembrane domain also contains a palmitylation site that may anchor the receptor and allow endocytosis. In addition, there is an intracellular phosphorylation site that is of unknown function and does not play a role in endocytosis.

[0062] As used herein, the term "vector" refers to a nucleic acid molecule capable of introducing a gene sequence into a target cell. In general, "vector construct", "expression vector", and "gene transfer vector" refer to any nucleic acid construct capable of inducing expression of a gene of interest, which can introduce a gene sequence into a target cell. Thus, the term includes cloning and expression vehicles, as well as integrating vectors. In some aspects, the vector is a virus, including, for example, encapsulated forms of vector nucleic acid and viral particles in which the vector nucleic acid is packaged. In some aspects, the vector is not a wild-type strain of virus, as it includes artificial mutations or modifications. In some aspects, the vector is derived from a wild-type virus strain by genetic engineering (i.e., deletions) to include a conditionally replicating virus, as further described herein. In some aspects, the vector is delivered by non-viral means. In some aspects, the vectors described herein are gene therapy vectors used as carriers to deliver polynucleotide sequences to cells. In some embodiments, the gene therapy vector is a viral vector. In other embodiments, the gene therapy vector is a non-viral vector. In certain embodiments, the gene therapy vectors described herein are recombinant AAV vectors (e.g., AAV8 or AAV9).

[0063] The recitations herein of numerical ranges by endpoints include all numbers and fractions subsumed within that range (e.g., 1 to 5, including 1, 1.5, 2, 2.75, 3, 3.9, 4, and 5). It is also to be understood that all numbers and fractions thereof are deemed to be modified by the term "about."

[0064] Various aspects of the disclosure are described in detail in the following sections. The use of the sections is not intended to limit the disclosure. Each section may be applicable to any aspect of the disclosure. In this application, the use of "or" means "and / or" unless otherwise indicated. As used herein, the singular forms "a," "an," and "the" include both the singular and the plural unless the context clearly indicates otherwise.

[0065] II. Compositions of the Disclosure Some aspects of the disclosure relate to a viral vector comprising a promoter and a transgene, the transgene comprising (i) a nucleotide sequence encoding a biologically active polypeptide, and (ii) a nucleotide sequence encoding a TAG. In some aspects, the viral vector comprises an adeno-associated virus, a lentivirus, a retrovirus, a variant thereof, or a combination thereof. Some aspects of the disclosure relate to a recombinant AAV (rAAV) vector comprising: (a) a 5' inverted terminal repeat (ITR), (b) a promoter, (c) a transgene comprising (i) a nucleotide sequence encoding a biologically active polypeptide and (ii) a nucleotide sequence encoding a TAG, and (d) a 3' ITR. In some aspects, the TAG increases translocation of the biologically active polypeptide across the blood-brain barrier. In some embodiments, a linker nucleic acid sequence is present between (i) and (ii).

[0066] In some aspects, the transgene comprises, in 5' to 3' order, (i) a nucleotide sequence encoding a biologically active polypeptide, and (ii) a nucleotide sequence encoding a TAG. Thus, in some aspects, the nucleotide sequence encoding the biologically active polypeptide is 5' to the nucleotide sequence encoding the TAG. In some aspects, the transgene comprises, in 5' to 3' order, (i) a nucleotide sequence encoding a TAG, and (ii) a nucleotide sequence encoding a biologically active polypeptide. Thus, in some aspects, the nucleotide sequence encoding the biologically active polypeptide is 3' to the nucleotide sequence encoding the TAG. In some embodiments, a linker nucleic acid sequence is present between (i) and (ii).

[0067] In some embodiments, the nucleotide sequence encoding the biologically active polypeptide is linked to the nucleotide sequence encoding the TAG by a nucleotide sequence encoding a peptide linker. In some embodiments, the linker is a flexible linker, a cleavable linker, a processable linker, or any combination thereof. In some embodiments, the linker is a flexible linker. In some embodiments, the linker is a cleavable linker.

[0068] A. Bioactive Polypeptides In some aspects, the bioactive polypeptide comprises a therapeutic enzyme, an antibody or antigen-binding portion thereof, a growth factor, a hormone, a cytokine, a chemokine, an inhibitory ligand, an agonistic ligand, or any combination thereof. In some aspects, the bioactive polypeptide comprises a protein that corrects a cellular dysfunction (e.g., in the CNS). In some aspects, the bioactive polypeptide comprises a therapeutic enzyme. In some embodiments, the bioactive polypeptide comprises an enzyme that is otherwise mutated or absent in the case of a metabolic disorder, such as a lysosomal storage disease. In some aspects, the bioactive polypeptide has an activity, binds to a target, interacts with a receptor, interacts with a ligand, catalyzes a reaction, or acts as a substrate in the central nervous system (CNS).

[0069] In some embodiments, the biologically active polypeptide comprises a therapeutic enzyme. In some embodiments, the therapeutic enzyme has activity in the CNS. In some embodiments, the therapeutic enzyme catalyzes the processing of a substrate in the CNS, thereby reducing substrate levels in the CNS. In some embodiments, the therapeutic enzyme has activity in the CNS and one or more other parts of the body. In some embodiments, the therapeutic enzyme catalyzes the processing of a substrate in the CNS and one or more other parts of the body, thereby reducing substrate levels.

[0070] In some embodiments, the biologically active polypeptide has idursulfase activity. In some embodiments, the biologically active polypeptide is idursulfase (I2S) or a functional variant thereof. In some embodiments, the biologically active polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the amino acid sequence set forth in SEQ ID NO:1, and the biologically active polypeptide has idursulfase activity. In some embodiments, the biologically active polypeptide comprises the amino acid sequence set forth in SEQ ID NO:1.

[0071] In some embodiments, the nucleotide sequence encoding the biologically active polypeptide comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO:2, and the biologically active polypeptide encoded by the nucleotide sequence has idursulfase activity. In some embodiments, the nucleotide sequence encoding the biologically active polypeptide comprises the nucleic acid sequence set forth in SEQ ID NO:2.

[0072] In some embodiments, the nucleotide sequence encoding the biologically active polypeptide is codon-optimized. In some embodiments, the nucleotide sequence encoding the biologically active polypeptide is codon-optimized for in vivo expression in humans. In some embodiments, the codon-optimized nucleotide sequence encoding the biologically active polypeptide comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the nucleic acid sequence set forth in SEQ ID NO: 3 or 4, and the biologically active polypeptide encoded by the nucleotide sequence has idursulfase activity. In some embodiments, the codon-optimized nucleotide sequence encoding the biologically active polypeptide comprises the nucleic acid sequence set forth in SEQ ID NO: 3 or 4.

[0073] [Table 1-1]

[0074] [Table 1-2]

[0075] [Table 1-3]

[0076] [Table 1-4]

[0077] [Table 1-5]

[0078] In some embodiments, the bioactive polypeptide has glucocerebrosidase activity. In some embodiments, the bioactive polypeptide is glucocerebrosidase (GCB) or a functional variant thereof. In some embodiments, the bioactive polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the amino acid sequence set forth in SEQ ID NO: 41, and the bioactive polypeptide has glucocerebrosidase activity. In some embodiments, the bioactive polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 41.

[0079] In some embodiments, the nucleotide sequence encoding the biologically active polypeptide comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 42, and the biologically active polypeptide encoded by the nucleotide sequence has glucocerebrosidase activity. In some embodiments, the nucleotide sequence encoding the biologically active polypeptide comprises the nucleic acid sequence set forth in SEQ ID NO: 42.

[0080] In some embodiments, the biologically active polypeptide has N-sulfoglucosamine sulfohydrolase (sulfamidase) activity. In some embodiments, the biologically active polypeptide is N-sulfoglucosamine sulfohydrolase (SGSH) or a functional variant thereof. In some embodiments, the biologically active polypeptide comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:43, and the biologically active polypeptide has N-sulfoglucosamine sulfohydrolase (sulfamidase) activity. In some embodiments, the biologically active polypeptide comprises the amino acid sequence set forth in SEQ ID NO:43.

[0081] In some embodiments, the nucleotide sequence encoding the biologically active polypeptide comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 44, and the biologically active polypeptide encoded by the nucleotide sequence has N-sulfoglucosamine sulfohydrolase (sulfamidase) activity. In some embodiments, the nucleotide sequence encoding the biologically active polypeptide comprises the nucleic acid sequence set forth in SEQ ID NO: 44.

[0082] B.TAG part In some embodiments, the TAG increases the translocation of the bioactive polypeptide across the blood-brain barrier. In some embodiments, the TAG interacts with a receptor on the outer surface of an endothelial cell of the blood-brain barrier. In some embodiments, the TAG comprises an antibody, an antigen-binding portion of an antibody, a ligand, or any combination thereof. In some embodiments, the TAG comprises an antibody, the antibody comprising a VHH, a vNAR, a scFv, a diabody, a nanobody, a camelid antibody, an antigen-binding portion thereof, or any combination thereof. In some embodiments, the TAG comprises a VHH. In some embodiments, the TAG comprises a vNAR. In some embodiments, the TAG comprises a scFv. In some embodiments, the TAG comprises a nanobody.

[0083] In some embodiments, the TAG interacts with a transferrin receptor on the outer surface of an endothelial cell of the blood-brain barrier. In some embodiments, the TAG comprises an antigen-binding molecule that specifically binds to a transferrin receptor on the outer surface of an endothelial cell of the blood-brain barrier. In some embodiments, the TAG comprises an antigen-binding portion of an antibody that specifically binds to a transferrin receptor on the outer surface of an endothelial cell of the blood-brain barrier. In some embodiments, the TAG comprises a VHH that specifically binds to a transferrin receptor on the outer surface of an endothelial cell of the blood-brain barrier. In some embodiments, the VHH specifically binds to human transferrin receptor 1 (TfR1).

[0084] In some aspects, the TAG comprises an antigen binding molecule comprising a variable heavy (VH) domain, wherein the VH comprises a VH-CDR1, a VH-CDR2, and a VH-CDR3. In some aspects, the VH-CDR-3 comprises an amino acid sequence encoded by the nucleic acid sequence set forth in SEQ ID NO: 13. In some aspects, the VH-CDR-2 comprises an amino acid sequence encoded by the nucleic acid sequence set forth in SEQ ID NO: 12. In some aspects, the VH-CDR-1 comprises an amino acid sequence encoded by the nucleic acid sequence set forth in SEQ ID NO: 11. In some aspects, the TAG comprises a VH-CDR1 comprising an amino acid sequence encoded by the nucleic acid sequence set forth in SEQ ID NO: 11, a VH-CDR2 comprising an amino acid sequence encoded by the nucleic acid sequence set forth in SEQ ID NO: 12, and a VH-CDR3 comprising an amino acid sequence encoded by the nucleic acid sequence set forth in SEQ ID NO: 13, wherein the TAG specifically binds to TfR1.

[0085] In some aspects, the TAG comprises a VHH comprising a VH-CDR1 having an amino acid sequence encoded by the nucleic acid sequence set forth in SEQ ID NO: 11, a VH-CDR2 having an amino acid sequence encoded by the nucleic acid sequence set forth in SEQ ID NO: 12, and a VH-CDR3 having an amino acid sequence encoded by the nucleic acid sequence set forth in SEQ ID NO: 13, wherein the VHH specifically binds to TfR1.

[0086] In some embodiments, the VHH is encoded by a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the nucleic acid sequence set forth in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, or 21. In some embodiments, the VHH is encoded by a nucleic acid sequence set forth in SEQ ID NO: 14. In some embodiments, the VHH is encoded by a nucleic acid sequence set forth in SEQ ID NO: 15. In some embodiments, the VHH is encoded by a nucleic acid sequence set forth in SEQ ID NO: 16. In some embodiments, the VHH is encoded by a nucleic acid sequence set forth in SEQ ID NO: 17. In some embodiments, the VHH is encoded by a nucleic acid sequence set forth in SEQ ID NO: 18. In some embodiments, the VHH is encoded by a nucleic acid sequence set forth in SEQ ID NO: 19. In some embodiments, the VHH is encoded by a nucleic acid sequence set forth in SEQ ID NO: 20. In some embodiments, the VHH is encoded by a nucleic acid sequence set forth in SEQ ID NO: 21.

[0087] In some embodiments, the TAG is any anti-TfR binding protein disclosed in International Publication No. WO / 2020 / 144233, which is incorporated by reference in its entirety.

[0088] [Table 2-1]

[0089] [Table 2-2]

[0090] [Table 2-3]

[0091] C. Viral Vectors The transgene delivered by the vector can be introduced into the cells of interest using a variety of methods. For example, either viral or non-viral vectors can be used to deliver the transgene of interest. Both viral and non-viral vector delivery methods are contemplated in the methods provided herein. Thus, in some aspects, the vectors described herein are delivered by viral vectors. In some aspects, the vectors described herein are delivered by non-viral vectors.

[0092] The vectors described herein can be introduced into cells as part of a viral or non-viral vector molecule with additional sequences (e.g., an origin of replication, a promoter, and one or more genes). In some aspects, the vector can be introduced as a naked nucleic acid or as a nucleic acid complexed with an agent (e.g., a liposome or poloxamer), or can be delivered with a virus (e.g., adenovirus, adeno-associated virus (AAV), herpes virus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)). In some aspects, the vector is introduced using a viral vector.

[0093] Various viral vectors are known in the art, including, for example, either integrating or non-integrating vectors. In some aspects, the viral vector is a non-integrating viral vector. Non-integrating viral vectors include, for example, non-integrating lentiviral vectors and AAV vectors. Thus, in some aspects, the viral vector is an adeno-associated viral (AAV) vector.

[0094] In some embodiments, the AAV vector is modified in one or more regions (e.g., AAV capsid).In some embodiments, the viral vector is selected from one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 with ubiquitous promoter.In some embodiments, suitable viral vectors with broad tropism can be designed using the combined elements of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 with ubiquitous promoter.

[0095] In some embodiments, a viral vector encompassed by the present disclosure comprises a tissue-specific promoter (eg, a liver-specific promoter) upstream of a nucleic acid sequence encoding an I2S polypeptide that is linked to an anti-TfR1 VHH.

[0096] In some embodiments, the endogenous transgene expression system provided herein includes a viral vector that improves the exposure or distribution of a transgene (e.g., encoding an I2S polypeptide linked to an anti-TfR1 VHH) in various tissues of a mammal. In some embodiments, the improved exposure or distribution of an I2S polypeptide linked to an anti-TfR1 VHH in various tissues improves symptoms associated with, for example, Hunter syndrome. In some embodiments, the use of a viral vector complements the use of a ubiquitous promoter in providing robust tissue distribution of an I2S polypeptide linked to an anti-TfR1 VHH. In some embodiments, the viral vector is selected from one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 with a ubiquitous promoter. In some embodiments, suitable viral vectors with broad tropism can be designed using combined elements of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 with ubiquitous promoters. In some embodiments, the rAAV vector is a rAAV9 vector.

[0097] In some aspects, the rAAV vectors described herein comprise one or more of the following: (a) a 5' inverted terminal repeat (ITR); (b) a promoter sequence; (c) a transgene encompassed by the disclosure herein, including a nucleic acid sequence encoding a biologically active polypeptide and a nucleic acid encoding a tag; (d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); (e) a polyA; and (f) a 3'ITR sequence. In some aspects, the rAAV vectors described herein comprise one or more of the following: (a) a 5' inverted terminal repeat (ITR); (b) an enhancer sequence; (c) a promoter sequence; (d) a transgene encompassed by the disclosure herein, (e) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); (f) a polyA; and (g) a 3'ITR sequence. In some embodiments, the transgene further comprises a nucleic acid linker sequence between the nucleic acid encoding the polypeptide and the nucleic acid sequence encoding the tag.

[0098] In various embodiments, the rAAV vectors described herein for delivering transgenes encompassed by the disclosure herein can be packaged using techniques known in the art and described herein. For example, in some embodiments, rAAV packaging utilizes packaging cells to form viral particles that can infect host cells. Such cells include, for example, HEK293, HeLa, HEK293T, Sf9 cells, or A549 cells, which are used for packaging adenovirus. Viral vectors used in gene therapy are usually generated by producer cell lines that package nucleic acid vectors into viral particles. The vectors usually contain the minimum viral sequences required for packaging the nucleic acid and subsequent transduction into the host, with other viral sequences being replaced by expression cassettes that code for proteins to be expressed. In this case, the transgene includes a nucleotide sequence that codes for a biologically active polypeptide and a nucleotide sequence that codes for TAG. Missing viral functions can be supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy usually only have the inverted terminal repeat (ITR) sequences of the AAV genome, which are necessary for packaging and transduction into host cells. The viral DNA is packaged into cell lines, which contain a helper plasmid encoding other AAV genes (i.e., rep and cap), but lack the ITR sequences. The cell lines are also transfected with adenovirus plasmids as helpers. The helper plasmids facilitate the replication of the AAV vector and the encapsidation of the nucleic acid into protein capsids. The helper plasmids are not packaged into AAV due to the lack of ITR sequences and packaging size constraints. Contamination with adenovirus or adenovirus-derived plasmids can be reduced by inactivation during purification (e.g., heat treatment, to which adenovirus is more sensitive than AAV).

[0099] In many gene therapy applications, it is desirable to deliver gene therapy vectors with specificity to a particular tissue type.Therefore, the vector designs provided herein have a wide tissue and cell type distribution when administered to a subject in need thereof.The rAAV vectors described herein can contain any tissue-specific or constitutively active promoter, which allows for systemic expression or specific expression in a particular tissue (e.g., liver).

[0100] In some aspects, the disclosure encompasses gene therapy vectors that include the sequence of a gene (e.g., an I2S gene) that encodes a biologically active polypeptide that has been modified. Such modifications may be made to improve expression characteristics. Such modifications may include, but are not limited to, the insertion of a translation start site (e.g., a methionine), the addition of a Kozak sequence, the insertion of a signal peptide, and / or codon optimization. Thus, in some aspects, a gene (e.g., an I2S gene) that encodes a biologically active polypeptide has been modified to include the insertion of a translation start site. In some aspects, a gene (e.g., an I2S gene) that encodes a biologically active polypeptide has been modified to include the addition of a Kozak sequence. In some aspects, a gene (e.g., an I2S gene) that encodes a biologically active polypeptide has been modified to include a signal peptide. In some aspects, the signal peptide includes an immunoglobulin signal peptide. In some aspects, the signal peptide includes an IgG signal peptide. In some aspects, a gene (e.g., an I2S gene) that encodes a biologically active polypeptide has been codon optimized. In other aspects, a gene (e.g., an I2S gene) that encodes a biologically active polypeptide has been engineered. In yet other embodiments, the gene encoding the biologically active polypeptide (eg, the I2S gene) is codon optimized and engineered.

[0101] In some embodiments, the vector comprises an ID tag (e.g., a stuffer sequence). The purpose of the ID tag includes, for example, the ability to allow a technician to identify the vector. In certain embodiments, the vector comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the vector comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). Various optimized or variant forms of WPRE are known in the art, including WPRE3, WPREmut6delATG, among others. Other variant WPRE forms include, for example, WPRE2, WPRE_wt (GenBank Accession No. J04514); WPRE_wt (GenBank Accession No. J02442), and WPREmut6. The WPRE may comprise a wild-type sequence or a modified WPRE sequence. Various mutant versions of WPRE are known, including, for example, mut6delATG. In some embodiments, the vector comprises mut6delATG.

[0102] The vectors described herein include one or more promoter sequences. In some aspects, the promoter sequence is a ubiquitous promoter sequence. Any suitable promoter region or promoter sequence can be used, so long as the promoter region promotes the expression of the coding sequence in mammalian cells. In certain aspects, the promoter region promotes the expression of the coding sequence in mammalian cells. In some aspects, the promoter controlling the expression of the transgene is a ubiquitous promoter. In some aspects, the ubiquitous promoter is selected from one or more of GAPDH promoter, mini-EF1 promoter, CMV promoter, EF-1α promoter, PGK promoter, UBC promoter, LSE β-glucuronidase (GUSB) promoter, or ubiquitous chromatin opening element (UCOE) and / or chicken β-actin promoter. In some aspects, the ubiquitous promoter includes a cytomegalovirus (CMV) enhancer, a chicken β-actin promoter (CBA), and a ubiquitous promoter including a rabbit β-globin intron.

[0103] In some embodiments, the promoter sequence is a tissue-specific promoter sequence.In certain embodiments, the promoter region promotes the expression of the coding sequence in the liver, i.e., is a liver-specific promoter.In some embodiments, the promoter comprises human TTR, PGK, chicken β-actin (CBA) promoter, CAG promoter, EF-1α promoter, UBC promoter, LSE β-glucuronidase (GUSB) promoter, or ubiquitous chromatin opening element (UCOE) promoter.

[0104] In some embodiments, the ubiquitous promoter comprises CBh (CMV enhancer, chicken β-actin promoter, chicken β-actin-MVM hybrid intron). Thus, in some embodiments, the ubiquitous promoter is a chicken β-actin (CBA) promoter. In some embodiments, the ubiquitous promoter is an EF-1α promoter. In some embodiments, the EF-1α promoter is combined with a chimeric intron from chicken β-actin and rabbit β-globin genes. In some embodiments, the ubiquitous promoter is a UBC promoter. In some embodiments, the ubiquitous promoter is a LSE β-glucuronidase (GUSB) promoter. In some embodiments, the ubiquitous promoter is a ubiquitous chromatin opening element (UCOE) promoter. (Powell SK, et al. Discov Med. 2015 Jan;19(102):49-57).

[0105] In some embodiments, the ubiquitous promoter comprises a cytomegalovirus (CMV) enhancer, a chicken β-actin promoter, and a rabbit β-globin intron.

[0106] In some embodiments, the ubiquitous promoter comprises a truncated EF-1α promoter and one or more introns.

[0107] In some embodiments, the one or more introns are derived from a chicken β-actin and / or rabbit β-globin gene.

[0108] In some embodiments, the promoter comprises the following nucleic acid sequence: ggggttggggttgcgccttttccaaggcagccctgggtttgcgcagggacgcggctgctctgggcgtggttccgggaaacgcagcggtgccgaccctgggtctcgcacattcttcacgtccgttcgcagc gtcacccggatcttcgccgctacccttgtgggccccccggcgacgcttcctgctccgcccctaagtcgggaaggttccttgcggttcgcggcgtgccggacgtgacaaacggaagccgcacgtctcacta gtaccctcgcagacggacagcgccagggagcaatggcagcgcgccgaccgcgatgggctgtggccaatagcggctgctcagcggggcgcgccgagagcagcggccgggaaggggcggtgcgggaggcggg gtgtggggcggtagtgtgggccctgttcctgcccgcgcggtgttccgcattctgcaagcctccggagcgcacgtcggcagtcggctccctcgttgaccgaatcaccgacctctctccccag (SEQ ID NO: 30).

[0109] In some embodiments, the promoter comprises the following nucleic acid sequence: aaatgacctattaagaatatttcatagaacgaatgttccgatgctctaatctctctagacaaggttcatatttgtatgggttacttattctctctttgttgactaagtcaataatcagaat cagcaggtttgcagtcagattggcagggataagcagcctagctcaggagaagtgagtataaaagccccaggctgggagcagccatcacagaagtccactcattcttggcagg (SEQ ID NO: 31).

[0110] In some embodiments, the vectors described herein comprise one or more polyA sequences, hi some embodiments, the polyA is selected from human growth hormone polyA (hGHpA), synthetic polyA (SPA), Simian Virus 40 late polyA (SV40pA), and bovine growth hormone (BGH) polyA.

[0111] In some aspects, the present disclosure provides an expression cassette comprising a polynucleotide sequence comprising: (a) a 5' inverted terminal repeat (ITR); (b) an AAT enhancer and an hTTR promoter; (c) a transgene comprising (i) a nucleotide sequence encoding an I2S and a linker polypeptide and (ii) a nucleotide sequence encoding a VHH that specifically binds to hTfR1; (d) optionally a Woodchuck Hepatitis Virus post-transcriptional regulatory element (WPRE) comprising a mut6delATG mutation; (e) polyA; and (f) a 3'ITR. In some aspects, the elements in the expression cassette are in 5' to 3' order. In some aspects, one or more of (a) to (f) are operably linked in 5' to 3' order.

[0112] In some embodiments, the vector is introduced into a cell. Thus, in some embodiments, a cell is provided, the cell comprising a vector described herein. In some embodiments, the cell is present in vitro, in situ, or in vivo. Thus, in some embodiments, the cell comprising a vector described herein is present in vitro. In some embodiments, the cell comprising a vector described herein is present in situ. In some embodiments, the cell comprising a vector described herein is present in vivo.

[0113] D. Pharmaceutical Compositions Exemplary pharmaceutical compositions containing the vectors described herein are detailed below.

[0114] Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Thus, there are a wide variety of suitable formulations of pharmaceutical compositions available.

[0115] Formulations for both ex vivo and in vivo administration include suspensions in liquids or emulsions. Active ingredients are often mixed with excipients that are pharma- ceutically acceptable and compatible with the active ingredients. Suitable excipients include, for example, water, saline, dextrose, glycerol, ethanol, and the like, and combinations thereof. In addition, the composition may contain minor amounts of auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, stabilizers, or other agents that enhance the effectiveness of the pharmaceutical composition.

[0116] III. Methods of the Disclosure Some embodiments of the present disclosure relate to a method of treating a disease or condition in a subject in need of such treatment, comprising administering to the subject a viral vector (e.g., an rAAV vector) disclosed herein.Some embodiments of the present disclosure relate to a method of delivering a biologically active polypeptide across the blood-brain barrier in a subject, comprising administering to the subject a viral vector (e.g., an rAAV vector) disclosed herein.

[0117] In some embodiments, the disease or condition comprises a neurological disease. In some embodiments, the disease or condition comprises one or more symptoms affecting the CNS. In some embodiments, the disease or condition comprises a defect in the CNS. In some embodiments, the disease or condition comprises a defect in the CNS.

[0118] In some embodiments, the disease or condition comprises accumulation of a high concentration of a substrate in the CNS of the subject. In some embodiments, the disease or condition comprises accumulation of a high concentration of an I2S substrate (e.g., lysosomal glycosaminoglycan (GAG)) in the CNS of the subject. In some embodiments, the disease or condition comprises a mucopolysaccharidosis (MPS). In some embodiments, the disease or condition comprises Hurler syndrome (also known as MPS I). In some embodiments, the disease or condition comprises Hunter syndrome (also known as MPS II). In some embodiments, the disease or condition comprises Sanfilippo syndrome (also known as MPS III). In some embodiments, the disease or condition comprises Sly syndrome (also known as MPS VII). In some embodiments, the disease or condition comprises Gaucher disease. In some embodiments, the disease or condition comprises Metachromatic Leukodystrophy. In some embodiments, the disease or condition comprises Krabbe Disorder. In some embodiments, the disease or condition comprises GM1 Gangliosidosis.

[0119] In some embodiments, the disease or condition comprises an I2S deficiency (e.g., Hunter syndrome). In some embodiments, administration of a viral vector (e.g., rAAV vector) disclosed herein increases the I2S level in the subject. In some embodiments, an increase in I2S level is observed systemically. In some embodiments, administration of a viral vector (e.g., rAAV vector) disclosed herein increases the I2S level in the CNS of the subject. In some embodiments, the increased I2S level persists for at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 6 weeks, at least about 8 weeks, at least about 10 weeks, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 9 months, at least about 12 months, at least about 15 months, at least about 18 months, at least about 21 months, at least about 2 years, or more. In some embodiments, functional levels of an I2S polypeptide are detectable in CSF, plasma, serum for at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, or at least about 20 years after administration of the viral vector (e.g., an rAAV vector).

[0120] In some embodiments, administration of a viral vector (e.g., an rAAV vector) disclosed herein reduces GAG levels in a subject. In some embodiments, GAG levels are reduced systemically and in the CNS. In some embodiments, the GAG ​​level after administration of a viral vector (e.g., an AAV vector) disclosed herein is less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of the GAG ​​level in the subject before administration. In some embodiments, GAG levels in a subject after administration of a viral vector (e.g., an AAV vector) are comparable to GAG levels in a healthy subject, e.g., less than ± about 10%, less than ± about 9%, less than ± about 8%, less than ± about 7%, less than ± about 6%, less than ± about 5%, less than ± about 4%, less than ± about 3%, less than ± about 2%, or less than ± about 1%.

[0121] In some embodiments, the GAG ​​level in the brain of a subject after administration of a viral vector (e.g., an AAV vector) disclosed herein is less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% compared to the level of I2S substrate in the brain of the subject prior to administration. In some embodiments, GAG levels in the brain of a subject after administration of a viral vector (e.g., an AAV vector) are comparable to GAG levels in the brain of a healthy subject, e.g., less than ± about 10%, less than ± about 9%, less than ± about 8%, less than ± about 7%, less than ± about 6%, less than ± about 5%, less than ± about 4%, less than ± about 3%, less than ± about 2%, or less than ± about 1%.

[0122] In some embodiments, the administered rAAV comprising an I2S transgene reduces the subject's GAG levels for at least about 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 12 months, 1 year, 2 years, 3 years, 4 years, 5 years, or more than 5 years. In some embodiments, the administered rAAV comprising an I2S transgene reduces the subject's GAG levels in the brain for at least about 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 12 months, 1 year, 2 years, 3 years, 4 years, 5 years, or more than 5 years.

[0123] The viral vectors (e.g., rAAV vectors) disclosed herein can be administered using any route. In some embodiments, the viral vectors (e.g., rAAV vectors) are administered intravenously, intraperitoneally, intraarterially, intrathecally (cisterna magna, lumbar puncture), subcutaneously, or intradermally. In some embodiments, the viral vectors (e.g., rAAV vectors) are administered intravenously. In some embodiments, intradermal administration includes administration by using a "gene gun" or biolistic particle delivery system. In some embodiments, the viral vectors (e.g., rAAV vectors) are administered via non-viral lipid nanoparticles. For example, a composition comprising a viral vector (e.g., rAAV vector) may include one or more diluents, buffers, liposomes, lipids, lipid complexes. In some embodiments, the viral vectors (e.g., rAAV vectors) are contained within microspheres or nanoparticles (e.g., lipid nanoparticles).

[0124] The compositions and methods of the present invention can also be used in combination with other therapeutic agents known in the art that are used to treat Hunter Syndrome or its complications, such as, but not limited to, enzyme replacement therapy (e.g., I2S).

[0125] Methods for generating and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, for example, U.S. Patent No. 7,790,449; U.S. Patent No. 7,282,199; WO2003 / 042397; WO2005 / 033321; WO2006 / 110689; and U.S. Patent No. 7,588,772B2. In one system, a producer cell line is transiently transfected with a construct encoding a transgene flanked by ITRs and a construct(s) encoding rep and cap. In a second system, a packaging cell line that stably supplies rep and cap is transiently transfected with a construct encoding a transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with a helper adenovirus or herpesvirus, which rAAV must separate from contaminating viruses. More recently, systems have been developed that do not require infection with helper viruses to rescue AAV (i.e., adenovirus E1, E2a, VA, and E4, or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase), which may be supplied in trans by the system. In these new systems, helper functions can be supplied by transiently transfecting cells with constructs encoding the necessary helper functions, or cells can be engineered to stably contain genes encoding helper functions, the expression of which can be controlled at the transcriptional or post-transcriptional level.

[0126] In some embodiments, the expression cassette flanked by the ITRs and the rep / cap genes is introduced into a desired cell or cell line by infection with a baculovirus-based vector.

[0127] In some embodiments, the expression cassette flanked by the ITRs and rep / cap genes is introduced into insect cells by infection with a baculovirus-based vector. For a review of these production systems, see generally, e.g., Zhang et al., 2009, "Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of which are incorporated herein by reference in their entirety. Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of each of which are incorporated by reference herein in their entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065. See generally, e.g., Grieger & Samulski, 2005, "Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications," Adv. Biochem. Engin / Biotechnol. 99:119-145; Buning et al., 2008, "Recent developments in adeno-associated virus vector technology," J. Gene Med 10:717-733; and the references listed below, each of which is incorporated by reference in its entirety.

[0128] The methods used to construct the vectors described herein are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012). Similarly, methods for producing rAAV virions are well known and the selection of a suitable method is not a limitation of the present invention. See, e.g., K. Fisher et al., (1993) J. Virol, 70:520-532 and U.S. Patent No. 5,478,745.

[0129] Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those of skill in the art. Moreover, those of skill in the art can readily construct any number of other plasmids suitable for use in the present invention. The properties, construction, and use of such plasmids and other vectors of the present invention will be readily apparent to those of skill in the art from the present disclosure.

[0130] In one aspect, the production plasmid is a plasmid described herein or described in WO2012 / 158757, which is incorporated herein by reference. A variety of plasmids used to generate rAAV vectors are known in the art and are useful herein. The production plasmid is cultured in a host cell that expresses AAV cap and / or rep proteins. In the host cell, each rAAV genome is rescued and packaged into capsid or envelope proteins to form infectious viral particles.

[0131] In certain embodiments, the rAAV expression cassette, vector (e.g., rAAV vector), virus (e.g., rAAV), production plasmid comprises an AAV inverted terminal repeat sequence, and the codon-optimized nucleic acid sequence encoding an I2S polypeptide linked to an anti-TfR1 VHH sequence and the expression control sequence directing expression of the encoded protein are present in the host cell. In other embodiments, the rAAV expression cassette, virus, vector (e.g., rAAV vector), production plasmid further comprises one or more of an enhancer, a promoter, an intron, a Kozak sequence, a polyA, a post-transcriptional regulatory element, and the like. In one embodiment, the post-transcriptional regulatory element is a woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE). In various embodiments, the nucleic acid sequence comprises a signal peptide upstream of the transgene encoding the I2S polypeptide linked to the anti-TfR1 VHH sequence. In some embodiments, the signal peptide is at the N-terminus of the I2S polypeptide linked to the anti-TfR1 VHH sequence. In some embodiments, the signal peptide is at the C-terminus of the I2S polypeptide linked to the anti-TfR1 VHH sequence.

[0132] Various methods are known in the art for the production and purification of AAV vectors. See, for example, Mizukami, Hiroaki, et al. A Protocol for AAV vector production and purification (available at dnaconda.riken.jp / rvd / SOP / AAV / AAVProtocol.pdf); US Patent Publication Nos. US20070015238 and US20120322861. For example, a plasmid containing a gene of interest can be combined with one or more helper plasmids containing, for example, rep genes (e.g., encoding Rep78, Rep68, Rep52, and Rep40) and cap genes (encoding VP1, VP2, and VP3, including the modified VP2 region described herein), and transfected into a recombinant cell so that the rAAV can be packaged and subsequently purified.

[0133] In some embodiments, packaging is performed in a helper or producer cell (e.g., a mammalian cell or an insect cell). Exemplary mammalian cells include, but are not limited to, HEK293 cells, COS cells, HeLa cells, BHK cells, or CHO cells (see, e.g., ATCC® CRL-1573™, ATCC® CRL-1651™, ATCC® CRL-1650™, ATCC® CCL-2, ATCC® CCL-10™, or ATCC® CCL-61™). Exemplary insect cells include, but are not limited to, Sf9 cells (see, e.g., ATCC® CRL-1711™). Helper cells may contain rep and / or cap genes encoding Rep and / or Cap proteins used in the methods described herein. In some embodiments, packaging is performed in vitro.

[0134] In some embodiments, a plasmid containing a gene of interest is combined with one or more helper plasmids (e.g., containing a rep gene of a first serotype and a cap gene of the same serotype or a different serotype) and transfected into a helper cell such that the rAAV is packaged.

[0135] In some embodiments, the one or more helper plasmids include a first helper plasmid that includes the rep gene and the cap gene, and a second helper plasmid that includes one or more of the following helper genes: Ela gene, Elb gene, E4 gene, E2a gene, and VA gene. For clarity, the helper genes are genes that encode the helper proteins Ela, Elb, E4, E2a, and VA. In some embodiments, the cap gene is modified such that one or more of the proteins VP1, VP2, and VP3 are not expressed. In some embodiments, the cap gene is modified such that VP2 is not expressed. Methods for making such modifications are known in the art (Lux et al. (2005), J. Virology, 79:11776-87).

[0136] Helper plasmids, and methods for making such plasmids, are generally known in the art and are generally commercially available (see, e.g., pDF6, pRep, pDM, pDG, pDPlrs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E / R585E), and pDP8.ape plasmids from PlasmidFactory (Bielefeld, Germany); other products and services are available from Vector Biolabs (Philadelphia, PA); Cellbiolabs (San Diego, CA); Agilent Technologies (Santa Clara, Ca); and Addgene (Cambridge, MA); pxx6; Grimm et al. (1998), Novel Tools for Production and Purification of Recombinant Adeno associated Virus Vectors, Human Gene Therapy, Vol. 9, 2745-2760; Kem, A. et al. al.(2003),Identification of a Heparin-Binding Motif on Adeno- Associated Virus Type2 Capsids,Journal of Virology,Vol.77,11072-11081;Grimm et al.(2003),Helper Virus-Free,Optically Controllable,and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1 to 6, Molecular Therapy, Vol. 7, 839-850; Kronenberg et al., J. Virol. 79(9):5296-5303(2005)). EXAMPLES

[0137] Example 1 - Evaluation of gene therapy constructs expressing either liver-specific or ubiquitous promoter-driven VHH-I2S in a mouse model of Hunter's disease Hunter disease is characterized by defective activity of the lysosomal enzyme iduronate-2-sulfatase (I2S). Defective enzymatic activity leads to the pathological accumulation of lysosomal glycosaminoglycans (GAGs), which ultimately causes progressive damage and dysfunction to cells, tissues, and organs throughout the body.

[0138] This example shows that gene therapy constructs expressing either liver-specific or ubiquitous promoter-driven VHH-I2S achieve significantly higher brain activity and GAG clearance in a mouse model of Hunter disease than constructs expressing untagged I2S.

[0139] The presence of the VHH tag does not interfere with I2S expression or catalytic activity Plasmids expressing VHH-tagged and VHH-untagged I2S (Table 3) were first transfected into Huh7 cells before being tested in a mouse model of Hunter's disease. The molecular weight of the protein products of these plasmids confirms that the tagged I2S is intact. The purified proteins were then analyzed for I2S activity. Notably, the activity of the tagged I2S protein was similar to that of the untagged I2S (Table 4). These results indicate that the presence of the VHH tag does not interfere with I2S catalytic activity.

[0140] The binding affinity of VHH-I2S and I2S-VHH to mouse and human TfR1 receptors was evaluated by surface plasmon resonance analysis (Table 5). VHH-I2S binds to hTfR1 with subnanomolar affinity and to mouse TfR1 with single-digit nanomolar affinity.

[0141] [Table 3]

[0142] [Table 4]

[0143] [Table 5]

[0144] Liver-directed gene therapy constructs expressing VHH-I2S show significantly higher brain activity and GAG clearance than constructs expressing untagged I2S. Plasmids expressing tagged and untagged I2S were then packaged into rAAV9 capsids and evaluated in 8- to 12-week-old male IdsKO mice. rAAV9-MY011 (null)-treated and wild-type (WT:WT) littermate vehicle-treated groups were used as controls, and 2.5 × 10 12 vg / kg and 6.25×10 12 vg / kg dose, as well as 2.5 × 10 for tool molecules with ubiquitous promoters (GTH075, GTH069, GTH072). 12 A single intravenous dose of vg / kg was used and evaluated in a 4-week study.

[0145] Mice treated with rAAV9-GTH071(I2S-VHH) and rAAV9-GTH074(VHH-I2S) exhibited significantly higher brain hI2S activity compared to mice treated with the untagged control rAAV9-GTH077(I2S) (Figure 1A), which led to a substantial reduction (>90%) of heparan sulfate (HS) GAGs in the brain (Figure 1B and Table 6) and normalization of CSF GAGs to WT levels (Figure 1C and Table 6).

[0146] [Table 6]

[0147] Immunohistochemical analysis of brain tissue confirmed exposure of hI2S in neurons in deep brain regions (e.g., thalamus and hippocampus) and subsequent reduction in lysosomal burden (measured by LAMP1 staining) (Figures 2 and 3). Specifically, intravenous administration of rAAV9-GTH074(VHH-I2S) normalized LAMP1 staining in the cortex, hippocampus, and thalamus of I2SKO mice to WT levels. This clearly demonstrated that N-terminally tagged VHH-I2S protein produced in the liver can cross the BBB more efficiently than untagged I2S and cross-correct HS GAG accumulation in the brain and CSF.

[0148] In contrast, circulating hI2S levels were lowest after administration of rAAV9-GTH074 (VHH-I2S) compared to administration of rAAV9-GTH077 (I2S) or rAAV9-GTH071 (I2S-VHH) at comparable doses (Figure 4). This may be due to increased uptake by tissues. Strong hI2S activity was detected in all major tissues tested, e.g., lung (Figure 4C), liver (Figure 4B), bone marrow (Figure 4D), heart (Figure 4E), and kidney (Figure 4F). hI2S activity in peripheral tissues normalized heparan sulfate levels to WT levels in these tissues as well as in spleen and quadriceps (Table 7). This clearly demonstrated that N-terminally tagged VHH-I2S proteins produced in the liver were able to cross the BBB more efficiently, were taken up by neurons, cross-corrected HS GAG accumulation in the brain and CSF significantly more potently than untagged I2S, and were substantially cleared from vital peripheral organs of GAGs within 4 weeks of administration.

[0149] Gene therapy constructs expressing ubiquitous promoter-driven VHH-I2S show significantly higher brain activity and GAG clearance than constructs expressing untagged I2S. 2.5 × 10 rAAV9 vectors expressing I2S driven by a ubiquitous promoter 12The same pattern of I2S expression and GAG reduction was observed in animals treated with doses of 10000 vg / kg. Significantly higher hI2S activity was observed in the brains of mice treated with rAAV9-GTH069 (I2S-VHH) or rAAV9-GTH072 (VHH-I2S) than in mice treated with rAAV9-GTH075 (I2S) (Figure 5). Consequently, significantly greater reductions in GAGs were also observed in the brain and CSF of animals treated with rAAV9-GTH072 (VHH-I2S) compared to the other groups (Figure 5). Robust hI2S exposure was measured in all tissues tested (Figures 6A-F), with normalization of GAG levels in peripheral tissues (e.g., liver and spleen) (Table 7).

[0150] [Table 7-1]

[0151] [Table 7-2]

[0152] Sustained hI2S activity observed in serum throughout a 4-week study of IdsKO mice treated with a gene therapy construct expressing I2S All rAAV9-based GT constructs carrying either promoter led to stable supraphysiological levels of circulating hI2S activity from weeks 1 to 4 of the study period compared to WT normal mice (Figures 7A-7B). 12 At a dose of vg / kg, gene targeting (GT) constructs with ubiquitous promoters (GTH075, GTH069, GTH072) resulted in higher serum hI2S activity than GT constructs with liver-specific promoters (GTH077, GTH071, GTH074).

[0153] Methods and Materials Identification of single domain anti-TfR1 antibodies: Various approaches using phage and yeast display techniques are used for the identification of anti-TfR1 single domain antibodies (sdAbs) utilizing a combination of in vivo and in vitro approaches to secure a large and diverse set of binders from the library.

[0154] The discovery of sdAbs can result from llama immunization (immune libraries) or from a naive synthetic library approach.

[0155] sdAbs can be derived from llamas, alpacas, camelids, or can be obtained from synthetically designed sources. They can have fully llama, humanized, or human frameworks, depending on the library used. They can have camelid, human, or combinations of CDR sequences.

[0156] Generation of recombinant enzyme-antibody fusion proteins: Plasmids containing the polynucleotide sequences of various His-tagged enzyme-sd antibody (sdAb) fusion proteins (e.g., VHH-I2S and I2S-VHH) were generated. The sdAb was fused to either the N- or C-terminus of the enzyme and linked with a short linker (5G).

[0157] The plasmid was introduced into host cells (CHO cells) using a flow electroporation system (e.g., MaxCyte GT®, MaxCyte VLX®, or MaxCyte STX® Transfection System). The transfected host cells expressed the enzyme-sdAb protein at sufficient levels to allow fed-batch cell culture. Conditioned medium of the transfected cells was collected 6 days after transfection and used for purification.

[0158] The protein was purified using an affinity column followed by a SEC column. A 5ml complete His-tag purification column (cat. no. 06781535001) was pre-equilibrated with PBS. 1L of CM was loaded onto the column and chased with PBS. The column was washed with PBS, 1M NaCl, followed by PBS. The protein was eluted with PBS, 250mM imidazole, pH 7.5. The elution peak was collected and loaded onto a HiLoad® 16 / 600 Superdex® 200pg (cat. no. 28-9893-35) pre-equilibrated with PBS. 2ml fractions were collected along 1.2CV. The elution peak fractions were analyzed by SDS-PAGE and pooled based on peak shape and appearance on the gel. The purified protein was formulated in 1x PBS, pH 7.4.

[0159] Surface Plasmon Resonance (SPR) Assay: A Biacore 8K+ instrument (Cytiva, Danaher Corporation) was used to measure the binding affinity of human / mouse receptors with iduronate 2-sulfatase or idursulfase (I2S) tagged with anti-transferrin receptor binding single domain antibodies (VHH). In this experiment, samples were immobilized on a Series S Sensor Chip CM5 (Cat. No. 29104988) via amine coupling. The immobilized samples (ligands) were i) I2S-VHH, ii) VHH-I2S, iii) I2S as a negative control, and iv) holo-transferrin peptide as a positive control. 1ug / mL of ligand reconstituted in acetic acid (pH 4.0) was immobilized on each flow cell for 420 seconds, resulting in a final immobilization level of approximately 350 response units. Recombinant human TfR protein (R&D Systems, Cat. No. 2474-TR) and mouse TfR1 (TR06671428-001, Takeda) were injected (as analytes) onto this surface at concentrations ranging from 5, 2.5, 1.25, 0.625, and 0.156 ug / mL. The analyte series was injected for 120 seconds, followed by a dissociation phase during which the analyte was at least 10% dissociated. The resulting sensorgrams were analyzed using a 1:1 binding model.

[0160] Plasmids: Plasmids expressing human idursulfase (I2S) with and without anti-hTfR1 receptor-binding single domain antibodies (VHH) under a liver-specific promoter were first tested in Huh7 cells by transfection. Plasmids expressing human idursulfase (I2S) with and without anti-hTfR1 receptor-binding single domain antibodies (VHH) under a liver-specific or ubiquitous promoter were tested in a mouse model of Hunter's disease.

[0161] Transfection: Huh7 (human hepatoma) cells were transfected with a plasmid expressing hI2S using Lipofectamine 3000 Reagent Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Briefly, 125,000 cells were seeded per well in a 12-well plate format with 1 mL of growth medium per well and incubated at 37°C, 5% CO. 2 The wells were then kept at 4°C overnight. The next day, fresh medium (1 mL per well) was added before transfection. For each plasmid, 1 ug of plasmid DNA was added to 2 ul of P3000 reagent, 1.5 ul of Lipofectamine 3000, and enough OptiMEM medium to make 100 ul and incubated at room temperature for 10-15 minutes. This mixture was then added to the cells and incubated at 37°C, 5% CO 2 The following day, the medium was changed and the cells were incubated for an additional day before the supernatant was collected for idursulfase (I2S) activity analysis.

[0162] Viral Vectors: rAAV9 stocks were generated using HEK-293T cells by adenovirus-free triple plasmid co-transfection method and purified using column chromatography and cesium chloride ultracentrifugation. Viral genome (vg) particle number titers were determined by droplet digital PCR. The following recombinant adeno-associated viral vectors expressing I2S under either a liver-specific promoter (GTH071, GTH074, and GTH077) or a ubiquitous promoter (GTH069, GTH072, and GTH075) were incubated in 1.5 mM KH 2 PO 4 , 2.7 mM KCl, 8.1 mM Na 2 HPO 4 The plasmids were prepared in a formulation buffer consisting of 100 mM NaCl, 136.9 mM NaCl, and 0.001% Pluronic F-68. Constructs GTH069 and GTH071 expressed I2S with a C-terminal single domain antibody (VHH) tag that binds to the transferrin receptor (TfR1), whereas GTH072 and GTH074 expressed I2S with an N-terminal VHH tag. Plasmids GTH075 and GTH077 expressed untagged I2S. A null vector (rAAV9-MY011) with the rAAV9 capsid was used as a control.

[0163] Animals: The Mus musculus, IdsKO mouse model was generated with a targeted disruption of the X-linked I2S locus (replacement of exon 5 and part of exon 4 with a neomycin resistance gene expression cassette, deleting 1.5 kb), resulting in a complete loss of endogenous I2S enzyme activity (Muenzer et al. 2002). IdsKO mice display a progressive degenerative phenotype consisting of both peripheral and neurological symptoms corresponding to clinical disorders. Accumulation of glycosaminoglycans (GAGs), resulting from limited I2S activity, is evident in urine, liver, kidney, spleen, heart, and brain, accompanied by vacuolization and increased lysosomal size evidenced by LAMP-1 staining in the IdsKO model by 3 months (Garcia et al. 2007; Cardone et al. 2006).

[0164] In vivo studies: 10–12 week-old I2Sko male mice were injected with 2.5 × 10 12 vg / kg or 6.25 × 10 12 Mice were administered intravenously once at a dose of 10 ...

[0165] Idursulfase activity: Tissues were homogenized in lysis buffer containing 10 mM HEPES with 0.5% Triton-X 100 and 1.5x Halt protease inhibitor cocktail (EDTA-free), centrifuged, and the supernatants were collected for analytical assays. Idursulfase activity was measured in the supernatants or serum using a two-step activity assay with a fluorescent substrate. In the first step (1), the lysosomal enzyme idursulfase (I2S) hydrolyzes 4-methylumbelliferyl α-L-iduronide-2-sulfate (4-MUS) to 4-methylumbelliferyl α-L-iduronide (MUBI). During the second step (2), another lysosomal enzyme α-L-iduronidase (IDUA) hydrolyzes MUBI to the final product 4-methylumbelliferone (4-MU). 4-MU fluoresces and the signal can be quantified. Briefly, 10 ul of biological sample was incubated with 20 uL of 4-MUS solution for 60 minutes at 37°C. At the end of this hour, 45 ul of IDUA solution was added and incubated for 4 hours at 37°C. The enzymatic reaction was stopped by the addition of 200 uL of 0.5 M sodium carbonate stop solution (pH 10.7). 4-MU product was measured in a fluorescent plate reader at an excitation wavelength of 365 nm and an emission wavelength of 450 nm. 4-MU concentrations in test samples were calculated from a 4-MU standard curve on the same plate. Tissue activity was normalized to total protein concentration determined by BCA assay (Thermo Scientific, Cat. No. 23225).

[0166] Quantification of heparan sulfate glycosaminoglycans: An LC-MS method was used to analyze the substrates from serum and tissue samples. Samples were first extracted using chloroform:methanol (v / v 2:1) and formic acid before being run on HPLC and LC-MS / MS (Applied Biosystem API5000, Turbo Ion Spray Ionization, positive ion mode).

[0167] Statistical analysis methods: All statistical analyses were performed in GraphPad Prism software version 8 using one-way analysis of variance (ANOVA) or two-way ANOVA for multiple comparisons (e.g., but not limited to, Dunnette and Turkey post-hoc test). Analyses of treatment groups were compared to the control group as indicated on each graph. P values ​​<0.05 are labeled as "*", <0.01 as "**", <0.001 as "***", and <0.0001 as "****".

[0168] Example 2 - Evaluation of plasmids expressing GCB-VHH in a mouse model of Gaucher disease Gaucher disease is characterized by a deficiency of the lysosomal enzyme β-glucocerebrosidase (GCB) and the subsequent accumulation of the enzyme's substrate (glucocerebroside) primarily in the liver, spleen, and bone marrow.

[0169] This example shows that administration of GCB-VHHs resulted in high brain exposure of GCB in the D409V mouse model of Gaucher disease. The D409V mouse model harbors a homozygous single point mutation in the mouse Gba1 gene, resulting in 5% residual GCB activity in the periphery and 18% in the CNS, as well as accumulation of glycolipids GL1 and lyso-GL1 (Sardi et al., 2013, PNAS 110(9):3537-42). Substrate accumulation and associated neurological symptoms (e.g., seizures, motor dysfunction, and memory impairment) are progressive and begin to become evident from 10-14 weeks (Dai et al., 2016, PLoS One 11(9):e0162367).

[0170] The presence of the VHH tag does not interfere with the expression, secretion, or catalytic activity of GCB A plasmid expressing GCB with a C-terminal anti-transferrin receptor binding nanobody (VHH) tag (pGTG077) or without either tag (pGTG072) was transfected into Huh7 (human liver) cells, and then cell lysates and supernatants were collected for analysis of GCB activity. The fusion tag did not suppress the activity or secretion of GCB compared to untagged GCB, as assessed from cell lysates (Figure 8A) or supernatants (Figure 8B).

[0171] Hydrodynamic tail vein injection (HTV) of a plasmid expressing GCB-VHH resulted in significantly higher brain exposure of GCB compared with a plasmid expressing untagged GCB in D409V mice.

[0172] Using hydrodynamic tail vein injection (HTV) as described in the "Methods and Materials" section below, D409V mice injected with plasmid pGTG077 had significantly higher levels of GCB activity in the brain compared to mice injected with pGTG072 (Figure 9A). This was at the expense of slightly reduced levels of GL-1 (Figure 9B) and lyso-GL1 (Figure 9C) in the brain. This higher exposure to the brain was not due to increased production or secretion of GCB, as GCB levels in the liver (Figure 10B) and circulation (assessed in serum, Figure 10A) were similar between the two groups. GCB was also found in other tissues tested (e.g., spleen) (Figure 10C), suggesting uptake of GCB into such tissues.

[0173] Methods and Materials Plasmids: Plasmids expressing human glucocerebrosidase (GCB) under a liver-specific promoter with and without an anti-hTfR1 receptor-binding single domain antibody (VHH) tag were first tested in Huh7 cells by transfection and then in a mouse model of Gaucher disease. pGTG072 expressed untagged GCB, whereas pGTG077 expressed GCB-VHH.

[0174] Transfection: Huh7 (human hepatoma) cells were transfected with a plasmid expressing GCB using Lipofectamine 3000 Reagent Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Briefly, 125,000 cells were seeded per well in a 12-well plate format with 1 mL of growth medium per well and incubated at 37°C, 5% CO. 2 The wells were then kept at 4°C overnight. The next day, fresh medium (1 mL per well) was added before transfection. For each plasmid, 1 ug of plasmid DNA was added to 2 ul of P3000 reagent, 1.5 ul of Lipofectamine 3000, and enough OptiMEM medium to make 100 ul and incubated at room temperature for 10-15 minutes. This mixture was then added to the cells and incubated at 37°C, 5% CO 2 The following day, the medium was changed and the cells were incubated for an additional day before the supernatant was collected for GCB activity analysis.

[0175] Animals: In this example, the Mus musculus, D409V mouse model was used.

[0176] Hydrodynamic gene delivery: Hydrodynamic tail vein injection (HTV) was performed as described in: Zhang et al., Hum. Gene Ther. 10:1735-37 (1999) and Herweijer and Wolff, Gene Ther. 14:99-107 (2007). Briefly, mice were administered test substances (plasmids) in a solution volume equivalent to 8% of the animal's body weight on a gram per mL basis. Injection time was 8 seconds or less.

[0177] In vivo studies: 8-12 week old male D409V mice were administered 50ug of plasmid DNA each by hydrodynamic gene delivery via tail vein injection. A group of D409V mice injected with buffer only as a negative control was included in the study. Animals were sacrificed 2 days after injection. Serum was collected by cardiac puncture at the terminal point and tissues (e.g. brain, liver, and spleen) were collected after perfusion with PBS. Samples were flash frozen and stored at -80°C. Serum and tissue samples were analyzed for GCB activity and GL-1 and lyso-GL1 levels.

[0178] GCB activity assay: Tissues were lysed in cold lysis buffer (10 mM HEPES, 0.5% Triton-X 100 and 2× Halt protease inhibitor cocktail, EDTA-free (Thermo Fisher, Halt protease inhibitor cocktail, 100×, EDTA-free, Cat. No. 78425)) at a concentration of 250 mg tissue / mL and then freeze-thawed three times. Lysates were centrifuged at 16,000×g for 10 min at 4° C. and supernatants were collected for BCA (to normalize protein levels) and activity assays.

[0179] GCB activity was assessed using a fluorometric assay that measures the ability to hydrolyze the substrate 4-MU-glucopyranoside (4-MU-GPS, Sigma, Cat. No. M3633) to 4-methylumbelliferone (4-MU). Briefly, biological samples appropriately diluted in sample buffer (0.05 M citric acid, 0.1 M sodium phosphate, 2 mg / mL BSA, pH 5.0) were incubated with 4-MU-GPS in substrate solution (0.05 M citric acid, 0.1 M sodium phosphate, 0.3% Tween-20, 0.6% sodium taurocholate, pH 5.0, 5× Km=1 mM) for 60 min at 37°C. The enzymatic reaction was stopped by the addition of glycine carbonate stop solution (pH 10.7, 333 mM glycine, 207 mM sodium carbonate). The 4-MU product was measured by a fluorescence plate reader at an excitation wavelength of 360 nm and an emission wavelength of 465 nm. The 4-MU concentration in the test samples was calculated from a 4-MU standard curve on the same plate. To subtract any non-lysosomal residual activity in all biological samples, a parallel plate was tested with the lysosomal glucocerebrosidase inhibitor Conduritol B epoxide (CBE, MW: 162.1 g / mol, Millipore, Cat. No. 234599) at a final concentration of 3 mM. One activity unit is represented by the conversion of 4-MU-GPS (1 nmole) to 4-MU in 1 hour at 37°C.

[0180] Quantification of GL1 (glucosylceramide) and lyso-GL1 (glucosylsphingosine): An LC-MS method was used to analyze the substrates from serum and tissue samples. Samples were first extracted using chloroform:methanol (v / v 2:1) and formic acid before being run on HPLC and LC-MS / MS (Applied Biosystem API5000, Turbo Ion Spray Ionization, positive ion mode).

[0181] Example 3 - Mucopolysaccharidosis IIIA, Sanfilippo A (SanA) Disease Mucopolysaccharidosis type IIIA, also known as Sanfilippo A (SanA) disease, is characterized by mutations in the SGSH gene that result in reduced or abolished function of the associated enzyme, ultimately preventing the breakdown of heparan sulfate.

[0182] This example shows that injection of WT mice with a plasmid expressing SGSH-VHH results in high brain exposure of SGSH.

[0183] The presence of the VHH tag does not interfere with the expression, secretion, or catalytic activity of SGSH A plasmid expressing SGSH with an anti-transferrin receptor binding nanobody (VHH) tag was transfected into Huh7 (human liver) cells, and then cell lysates and supernatants were collected for analysis of SGSH activity. The fusion tag did not suppress the activity or secretion of SGSH compared to untagged SGSH (Figure 11).

[0184] HTV injection of a plasmid expressing SGSH-VHH significantly increased brain exposure of SGSH in WT mice compared with a plasmid expressing untagged SGSH.

[0185] WT mice injected with plasmid pBBB1-SGSH had significantly higher SGSH activity levels in the brain compared to mice injected with pSGSH (Figure 12A). Higher SGSH-VHH levels were also found in the liver (Figure 12C) and serum (Figure 12B) compared to SGSH or VHH-SGSH. However, SGSH-VHH and VHH-SGSH had significantly higher brain exposure to serum ratios compared to VHH alone (Figure 13).

[0186] Methods and Materials Plasmids: Plasmids expressing human sulfamidase (SGSH) under a ubiquitous promoter with and without anti-hTfR1 receptor-binding single domain antibody (VHH) were first tested by transfection in Huh7 cells and then in a mouse model of SanA disease. pSGSH-BBB1 expressed SGSH tagged with VHH at the C-terminus, whereas pBBB1-SGSH expressed SGSH with a VHH tag at the N-terminus. pSGSH expressed untagged SGSH. Exemplary constructs are presented in Figures 14A-14D.

[0187] Transfection: Huh7 (human hepatoma) cells were transfected with a plasmid expressing SgSh using Lipofectamine 3000 Reagent Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Briefly, 125,000 cells were seeded per well in a 12-well plate format with 1 mL of growth medium per well and incubated at 37°C, 5% CO. 2 The wells were then kept at 4°C overnight. The next day, fresh medium (1 mL per well) was added before transfection. For each plasmid, 1 ug of plasmid DNA was added to 2 ul of P3000 reagent, 1.5 ul of Lipofectamine 3000, and enough OptiMEM medium to make 100 ul and incubated at room temperature for 10-15 minutes. This mixture was then added to the cells and incubated at 37°C, 5% CO 2 The following day, the medium was changed and the cells were incubated for an additional day before the supernatant was collected for SgSh activity analysis.

[0188] Animals: In this example, Mus musculus, wild type C57Bl6 animals were used.

[0189] Hydrodynamic gene delivery: Hydrodynamic tail vein injection (HTV) was performed as described above.

[0190] In vivo studies: 8-12 week old male WT mice were administered 50ug of plasmid DNA each by hydrodynamic gene delivery via tail vein injection. A group of mice injected with buffer only was included in the study as a negative control. Animals were sacrificed 2 days after injection. Serum was collected by cardiac puncture at the terminal point and tissues (e.g. brain and liver) were collected after perfusion with PBS. Samples were flash frozen and stored at -80°C. Serum and tissue samples were analyzed for gSh concentration.

[0191] SgSh ELISA assay: Immunoquantification of SGSH was performed using Meso Scale Discovery (MSD) technology. A total of 100 μL of Shire anti-SGSH antibody R3074 (10 μg / mL) diluted in 0.05 M carbonate-bicarbonate buffer (pH 9.6) was used to coat multiwell plates overnight at 4°C and 200 rpm. After 1 h incubation with MSD-A blocking buffer, samples or standards were incubated for 1 h at 37°C, followed by 100 μL of sulfo-tag conjugated rabbit anti-SGSH antibody R3074 (10 μg / mL) for 1 h at 37°C. Plates were then incubated in 2× read buffer and read using the MSD instrument. Washing steps between incubations were performed using 0.05% PBS-Tween.

[0192] SgSh activity assay: 10 μl of sample (cell / tissue lysate) was diluted with Michaelis barbiturate (CH) 3 COONa buffer (29 mM sodium barbital, 29 mM CH 3SGSH activity was measured by mixing 20 μl of 1 mM 4MUGlcNS in COONa and 0.68% (w / v) NaCl, pH 6.5 and incubating at 37° C. for 17 h, followed by addition of 16 μl of PiCi buffer (400 mL milliQ HO, 10.36 g disodium phosphate, 2.3 g citric acid to pH 6.5) with 500 U / mL of a-glucosidase in HO. Samples were incubated for a further 5 h at 37° C. before addition of 0.2 mL of glycine buffer (0.5 M NaCl). 2 CO 3 / NaHCO 3 The reaction was stopped by adding 0.025% Triton X-100, pH 10.7. Samples were dispensed into black microtiter plates and fluorescence was measured using a Spectramax M3 reader with an excitation wavelength of 360 nm and an emission wavelength of 460 nm. Enzyme activity was determined by relating the fluorescence of the samples to that of a known concentration of 4 MU, expressed in nmol / mg protein.

[0193] Example 4 - In vitro model of blood-brain barrier transcytosis An in vitro model was used to test the transcytosis capabilities of SGSH-BBB1 (SGSH tagged with a VHH tag at the C-terminus) and BBB1-SGSH (SGSH tagged with a VHH tag at the N-terminus) described in Example 3 above, compared to a control SGSH construct that did not contain a VHH. First, the transcytosis of SGSH, SGSH-BBB1, and BBB1-SGSH was measured using the Mimetas 3D cell culture organ-on-chip approach. Figures 15A-15B show the percentage of protein that passed through the chambers after 7 days of treatment with 62.7 μg / ml (Figure 15A) or 31.25 μg (Figure 15B) of SGSH-BBB1 or BBB1-SGSH fusion protein. While there is some non-fusion protein measured from the transcytosed medium, it is clear that the fusion protein showed an almost 2-3 fold increase in the lower chamber, indicating that these constructs are capable of improving transcytosis compared to the control.

[0194] Next, transcytosis was measured using a transwell model. Transwell plates were prepared with a total of 6, 12, or 24 wells containing a porous filter insert, which divides the transwell into an upper apical or blood compartment and a lower basolateral or brain compartment. A uniform layer of brain endothelial cells (BECs) was seeded on top of the filter membrane, coated with the extracellular matrix (ECM)-derived protein collagen I, with or without seeding on the apical or basolateral astrocytes. hBMEC cells were seeded in the upper chamber.

[0195] Figure 16C shows representative images of TEER values ​​3 days after seeding hBMEC cells compared to cell-free wells. SGSH activity measured from transfected media using both fusion and non-fusion SGSH plasmid constructs showed similar levels of activity (Figure 16B). The percentage of protein passing through the chamber after 3 days of treatment with transfected media collected from Huh7 cells was found to be more than 3-fold higher for the BBB1-SGSH construct compared to the SGSH-BB1 construct and control (Figure 16C), with a similar increase observed when purified BBB1-SGSH was used (Figure 16D). Transcytosis using this model was dose-dependent (Figure 16E).

[0196] Taken together, these results demonstrate that the proteins secreted after transfection of human hepatocytes closely mimic the BBB transcytosis observed with the purified proteins. Moreover, the N-terminal fusion proteins showed greater efficacy in terms of higher transcytosis.

[0197] Example 5 - Characterization of MPSIIIA patient fibroblasts Fibroblasts obtained from a patient with mucopolysaccharidosis type IIIA (MPSIIIA) were characterized by the accumulation of glycosaminoglycans (GAGs). After 2 days of culture, GAGs were detected using mass spectrometry. GAGs were observed to accumulate at higher levels in the patient's fibroblasts (P1, P2, and P3) compared to normal cells (C1 and C2) (Figure 17A). A time- and dose-dependent accumulation of SGSH was observed in the fibroblasts (Figures 17B-17C). An increase in SGSH activity was observed in both the healthy and patient's fibroblasts with increasing days of culture.

[0198] Next, the abundance of lysosomes in fibroblasts from MPSIIA patients was compared to healthy fibroblast controls. Cells were seeded at 75,000 / well in 12-well glass-bottom plates and cultured for 5 days. Cells were then stained with Lysotracker Red and Hoechst. Representative images show increased abundance of lysosomes in fibroblasts from patients (FIGS. 18E-18J) compared to cells from healthy controls (FIGS. 18A-18D).

[0199] Example 6 - In vivo mouse model of blood-brain barrier transcytosis A proof-of-concept study was designed in wild-type mice to evaluate the pharmacokinetics and BBB penetration of the TfRc binding tag fused to the SGSH protein. Liver transfection was performed via the hepatic vein by injecting a large amount of plasmid into the tail vein and applying pressure. Two days after injection, brain, liver, serum, spleen, and kidney samples were collected. Human SGSH protein levels and activity were assessed and compared to untreated controls.

[0200] Two days after injection, hydrodynamic tail vein injection successfully delivered the GGT plasmid to the liver of WT animals, resulting in expression of SGSH with or without the BBB1 fusion tag (Figure 19A). SGSH was secreted into the circulation, resulting in systemic delivery of SGSH protein (Figure 19B). The antibody used for this measurement was specific for human SGSH, resulting in little to no background levels in control mice. SGSH fused to BBB1 was quantified in the brain by MSD (Figure 19C). When animals were treated with the SGSH-BBB1 fusion construct, SGSH activity levels in the brain were found to be elevated above wild-type levels, with 2 days of HTV achieving an increase of at least 30% (total 130%) of wild-type brain activity (Figure 19D). As expected, some activity was observed in the control mice, which are healthy mice expected to have normal SGSH activity, as the assay detects both human and mouse SGSH activity. Immunohistochemistry of SGSH shows brain biodistribution of SGSH C-terminal and N-terminal fusion constructs in the cortex (FIGS. 20A, 20C, and 20E) and hippocampus (FIGS. 20B, 20D, and 20F).

[0201] Fluorescent immunohistochemistry was used to measure the biodistribution of SGSH in the brain 2 days after HTV administration. Throughout the sections, SGSH colocalized with GFAP staining, suggesting a strong biodistribution of astrocytes, the major target cell type of MPSIIIA (data not shown). Some neuronal colocalization of SGSH was also observed.

[0202] To further test the effect of the SGSH BBB1 construct, we developed an MPSIIIA mouse model that contains a knock-in point mutation that is homozygous and leaves the animal with SGSH activity levels at approximately 3-4% of wild type (Figures 21A-21D). The model was removed from cryopreservation and verified reduced SGSH activity and lysosomal dysfunction by LAMP1 IHC, a lysosomal marker (Figures 21E-21G). The mouse model can be used to further measure substrate reduction by the various plasmids described herein.

Claims

1. A gene therapy vector comprising: (a) 5′ inverted terminal repeat (ITR); (b) a promoter, (c) a transgene comprising (i) a nucleotide sequence encoding a biologically active polypeptide, and (ii) a nucleotide sequence encoding a TAG; and (d) a 3' ITR.

2. The gene therapy vector of claim 1 , wherein the biologically active polypeptide comprises a therapeutic enzyme.

3. The gene therapy vector of claim 1 or 2, wherein the biologically active polypeptide reduces substrate levels in the central nervous system.

4. The gene therapy vector according to any one of claims 1 to 3, wherein the biologically active polypeptide has idursulfase activity, glucocerebrosidase activity, or sulfamidase activity.

5. The gene therapy vector according to any one of claims 1 to 4, wherein the biologically active polypeptide is idursulfase (IDS), glucocerebrosidase (GCB), or sulfamidase (SGSH).

6. The gene therapy vector of any one of claims 1 to 5, wherein the TAG increases translocation of the biologically active polypeptide across the blood-brain barrier.

7. The gene therapy vector according to any one of claims 1 to 6, wherein the TAG comprises an antigen-binding molecule.

8. The gene therapy vector of any one of claims 1 to 7, wherein the TAG comprises an scFv, a VHH, a vNAR, a diabody, a nanobody, a camelid antibody, or a combination thereof.

9. The gene therapy vector according to any one of claims 1 to 8, wherein the TAG comprises VHH.

10. The gene therapy vector according to any one of claims 1 to 9, wherein the TAG comprises an antigen-binding molecule that specifically binds to transferrin receptor 1 (TfR1).

11. The gene therapy vector according to any one of claims 1 to 10, wherein the TAG comprises a VHH that specifically binds to TfR1.

12. The gene therapy vector of any one of claims 1 to 11, wherein the TAG comprises a variable heavy (VH) domain including complementarity determining region (VH) 1, VH-CDR2, and VH-CDR3.

13. The gene therapy vector of claim 12, wherein the VH-CDR1 is encoded by the nucleic acid sequence set forth in SEQ ID NO:

11.

14. The gene therapy vector of claim 12 or 13, wherein the VH-CDR2 is encoded by the nucleic acid sequence set forth in SEQ ID NO:

12.

15. The gene therapy vector according to any one of claims 12 to 14, wherein the VH-CDR3 is encoded by the nucleic acid sequence set forth in SEQ ID NO:

13.

16. The gene therapy vector of any one of claims 12 to 15, wherein the nucleotide sequence encoding the TAG comprises a nucleic acid sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, or 21.

17. The gene therapy vector of claim 16, wherein the nucleotide sequence encoding the TAG comprises SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, or 21.

18. The gene therapy vector of claim 16 or 17, wherein the nucleotide sequence encoding the TAG comprises SEQ ID NO:

14.

19. The gene therapy vector of any one of claims 1 to 18, wherein the nucleotide sequence encoding the TAG comprises SEQ ID NO:

15.

20. The gene therapy vector of any one of claims 1 to 19, wherein the nucleotide sequence encoding the biologically active polypeptide is 3' to the nucleotide sequence encoding the TAG.

21. The gene therapy vector of any one of claims 1 to 19, wherein the nucleotide sequence encoding the biologically active polypeptide is 5' to the nucleotide sequence encoding the TAG.

22. The gene therapy vector of any one of claims 1 to 21, wherein (i) the nucleotide sequence encoding the biologically active polypeptide is further (ii) linked to the nucleotide sequence encoding the TAG by (iii) a nucleotide sequence encoding a peptide linker.

23. The gene therapy vector of claim 22, wherein the linker is a flexible linker, a cleavable linker, a processable linker, or any combination thereof.

24. The gene therapy vector according to any one of claims 1 to 23, wherein the promoter is a ubiquitous promoter.

25. The gene therapy vector of claim 24, wherein the ubiquitous promoter comprises a chicken beta actin (CBA) promoter, an EF-1α promoter, a PGK promoter, a UBC promoter, a LSE beta-glucuronidase (GUSB) promoter, or a ubiquitous chromatin opening element (UCOE) promoter.

26. The gene therapy vector of claim 24 or 25, wherein the ubiquitous promoter comprises a cytomegalovirus (CMV) enhancer, a chicken beta actin promoter (CBA), and a rabbit beta globin intron.

27. The gene therapy vector according to any one of claims 1 to 26, wherein the promoter is a tissue-specific promoter.

28. The gene therapy vector of claim 27, wherein the promoter is a liver-specific promoter.

29. The gene therapy vector of claim 27 or 28, wherein the promoter comprises hTTR, PGK, chicken beta actin (CBA) promoter, CAG promoter, EF-1α promoter, UBC promoter, LSE beta-glucuronidase (GUSB) promoter, or ubiquitous chromatin opening element (UCOE) promoter, or any combination thereof.

30. The gene therapy vector according to any one of claims 1 to 29, which is a recombinant AAV (rAAV).

31. The gene therapy vector of claim 30, wherein the rAAV comprises an AAV capsid.

32. The gene therapy vector of claim 31 , wherein the AAV capsid is a pantropic AAV capsid.

33. The gene therapy vector of claim 31 or 32, wherein the AAV capsid is a pantropic AAV capsid selected from an AAV1 capsid, an AAV2 capsid, an AAV3 capsid, an AAV4 capsid, an AAV5 capsid, an AAV6 capsid, an AAV7 capsid, an AAV8 capsid, an AAV9 capsid, and variants thereof.

34. The gene therapy vector according to any one of claims 31 to 33, wherein the AAV capsid is AAV9.

35. The gene therapy vector according to any one of claims 1 to 34, further comprising a polyA sequence located 3' to the transgene.

36. The gene therapy vector of claim 35, wherein the polyA is bovine growth hormone (BGH) polyA or synthetic polyA.

37. The gene therapy vector of claim 36, wherein the synthetic polyA is designed in silico.

38. The gene therapy vector according to any one of claims 1 to 37, further comprising a post-transcriptional regulatory element.

39. The gene therapy vector of claim 38 , wherein the post-transcriptional regulatory element is located 3′ to the transgene.

40. 40. The gene therapy vector of claim 38 or 39, wherein the post-transcriptional regulatory element is located 5' to the polyA sequence.

41. The gene therapy vector according to any one of claims 38 to 40, wherein the post-transcriptional regulatory element comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

42. The gene therapy vector of claim 41 , wherein the WPRE sequence is modified.

43. The gene therapy vector of claim 41 or 42, wherein the WPRE sequence is WPRE mut6delATG.

44. The gene therapy vector according to any one of claims 1 to 43, wherein the promoter comprises a truncated EF-1α promoter and one or more introns.

45. The gene therapy vector of claim 44, wherein the one or more introns are derived from the CBA and / or rabbit β-globin gene.

46. The gene therapy vector of any one of claims 1 to 45, wherein the transgene is codon-optimized.

47. A method of treating a disease or condition in a subject in need of such treatment, comprising administering to the subject a gene therapy vector described in any one of claims 1 to 46.

48. 48. The method of claim 47, wherein the disease or condition comprises a neurological disease.

49. 49. The method of claim 47 or 48, wherein the disease or condition comprises a mucopolysaccharidosis.

50. 50. The method of any one of claims 47 to 49, wherein the disease or condition comprises Hurler syndrome (MPS I), Hunter syndrome (MPS II), Sanfilippo syndrome (MPS III), Sly syndrome (MPS VII), Gaucher disease, metachromatic leukodystrophy, Krabbe disorder, and GM1 gangliosidosis.

51. 47. A method for delivering a biologically active polypeptide across the blood-brain barrier in a subject, comprising administering to the subject a gene therapy vector according to any one of claims 1 to 46.

52. A method for reducing substrate levels in the central nervous system of a subject, comprising administering to said subject a gene therapy vector according to any one of claims 1 to 46.

53. A method for reducing substrates in the central nervous system of a subject, the method comprising administering to the subject a gene therapy vector according to any one of claims 1 to 46.

54. 47. A method for treating mucopolysaccharidosis in a subject in need of such treatment, comprising administering to said subject a gene therapy vector according to any one of claims 1 to 46.

55. 47. A method of treating Hurler Syndrome (MPS I) in a subject in need of such treatment, comprising administering to the subject a gene therapy vector according to any one of claims 1 to 46.

56. 47. A method of treating Hunter Syndrome (MPS II) in a subject in need thereof, comprising administering to the subject a gene therapy vector according to any one of claims 1 to 46.

57. 50. A method of treating Sanfilippo Syndrome (MPS III) in a subject in need thereof, comprising administering to the subject a gene therapy vector according to any one of claims 1 to 46.

58. 47. A method of treating Sly Syndrome (MPS VII) in a subject in need thereof, comprising administering to the subject a gene therapy vector according to any one of claims 1 to 46.

59. 47. A method of treating Gaucher disease in a subject in need thereof, comprising administering to said subject a gene therapy vector according to any one of claims 1 to 46.

60. 47. A method of treating metachromatic leukodystrophy in a subject in need thereof, comprising administering to the subject a gene therapy vector according to any one of claims 1 to 46.

61. A method of treating Krabbe disorder in a subject in need of such treatment, comprising administering to the subject a gene therapy vector described in any one of claims 1 to 46.

62. A method of treating GM1 gangliosidosis in a subject in need of such treatment, comprising administering to the subject a gene therapy vector described in any one of claims 1 to 46.

63. 63. The method of any one of claims 47-62, wherein a recombinant polypeptide is expressed from the transgene outside the central nervous system and the TAG facilitates passage of the recombinant polypeptide across the blood-brain barrier into the central nervous system.

64. The method of any one of claims 47 to 63, wherein the recombinant polypeptide reduces substrate levels in the central nervous system of the subject.

65. The method of any one of claims 47 to 64, wherein the recombinant polypeptide systemically reduces substrate levels.

66. A method for treating Hunter Syndrome in a subject in need of such treatment, comprising administering to the subject a gene therapy vector described in any one of claims 1 to 46, wherein the biologically active polypeptide comprises IDS.

67. 50. A method of treating Gaucher disease in a subject in need thereof, comprising administering to the subject a gene therapy vector according to any one of claims 1 to 46, wherein the biologically active polypeptide comprises glucocerebrosidase (GCB).

68. 50. A method of treating Sanfilippo syndrome in a subject in need thereof, comprising administering to the subject a gene therapy vector of any one of claims 1-46, wherein the biologically active polypeptide comprises N-sulfoglucosamine sulfohydrolase.

Images