Allogeneic T cells for the treatment of hematological malignancies

Abstract

Methods for producing engineered T cells and methods for using the engineered T cells to treat hematological malignancies are described. The engineered T cells can be administered in conjunction with allogeneic stem cell transplantation to reduce the need for prophylactic immunosuppression.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 333,031, filed April 20, 2022, U.S. Provisional Application No. 63 / 333,035, filed April 20, 2022, U.S. Provisional Application No. 63 / 333,036, filed April 20, 2022, U.S. Provisional Application No. 63 / 392,738, filed July 27, 2022, U.S. Provisional Application No. 63 / 383,805, filed November 15, 2022, and U.S. Provisional Application No. 63 / 478,588, filed January 5, 2023, each of which is incorporated by reference herein.

[0002] The sequence listing set forth in the file BSB-0003WO01_SeqListing_ST26.xml is 110 kilobytes in size, was created on April 18, 2023, and is incorporated herein by reference. [Background technology]

[0003] Chemotherapy or chemotherapy combined with radiotherapy followed by infusion of hematopoietic stem cells harvested from related or unrelated allogeneic donors is a widely used therapeutic strategy to cure or extend survival of patients with hematologic malignancies such as acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), and high-risk myelodysplastic syndromes (MDS). Most of the efficacy of such allogeneic hematopoietic stem cell transplants (allo-SCT) is attributed to the activity of alloreactive T cells within the donor graft that can kill recipient leukemic cells, thereby reducing the risk of leukemia relapse. This immune effect is called the graft-versus-leukemia (GVL) response. More than 9000 allogeneic SCTs were performed in the United States (US) in 2019, primarily as a potentially curative treatment for patients with AML, MDS, and ALL. Although allogeneic SCT has been shown to be superior to no transplant due to the reduction of malignant disease recurrence, recurrent malignancy remains the largest single cause of graft failure, occurring in 20-40% of standard-risk and 40-80% of high-risk patients and accounting for more than half of deaths after allogeneic SCT. Thus, there is an urgent need to prevent and treat post-transplant relapse through novel strategies that can enhance the GVL effect without substantially increasing the risk of severe graft-versus-host disease (GVHD). Summary of the Invention

[0004] A method of treating a recipient subject having cancer is described, the method comprising: (a) administering to a recipient a CD8 + (b) isolating T cells from an apheresis product collected from a donor subject that is HLA-matched to the recipient subject; and (b) isolating isolated CD8 +The method includes: (c) activating the T cells; (d) genetically modifying the activated T cells to knock out the endogenous TCR and insert a nucleic acid sequence encoding a xenogeneic TCR or CAR, thereby generating an engineered T cell, where the engineered T cell expresses the xenogeneic TCR or CAR but not the endogenous TCR; (e) expanding the engineered T cells; and (f) administering or causing the administration of the engineered T cells to a recipient subject. In some embodiments, the apheresis product comprises a leukapheresis product. In some embodiments, peripheral blood mononuclear cells (PBMCs) are isolated from the apheresis product. Inserting a nucleic acid sequence encoding a xenogeneic TCR or CAR results in expression of the xenogeneic TCR or CAR in the T cells. In some embodiments, the engineered T cells are administered to the recipient subject in combination with an allogeneic SCT. In some embodiments, the allogeneic SCT comprises a CD34-selected allogeneic SCT graft. The allogeneic SCT graft or CD34-selected allogeneic SCT graft can be derived from the same donor as the apheresis product of step (a).In some embodiments, the recipient subject has hematopoietic malignancy (also called hematological malignancy).The hematopoietic cancer can be, but is not limited to, AML, ALL, or MDS.

[0005] A method of treating a recipient subject having a hematological malignancy is described, the method comprising: (a) administering to said recipient subject a CD34-selected allogeneic stem cell transplantation (allo-SCT) graft, the allogeneic SCT graft being obtained from a graft donor subject that is HLA-matched to the recipient subject; and (b) administering to the recipient subject engineered T cells, the engineered T cells expressing a xenogeneic TCR or chimeric antigen receptor (CAR) that recognizes a hematopoietic-restricted minor histocompatibility antigen (miHA) expressed by the recipient subject, the engineered T cells being administered to the recipient subject within 72 hours of administering the CD34-selected allogeneic SCT graft to the recipient subject, and an immunosuppressant targeting graft-versus-host disease (GVHD) is not prophylactically administered to the recipient subject to suppress immune activity of the T cells. In some embodiments, the engineered T cells do not express endogenous TRAC or TRBC genes, or both. The recipient subject may be administered a conditioning regimen prior to administration of the CD34-selected allogeneic SCT graft. In some embodiments, the recipient subject is in a condition for hematopoietic stem cell transplantation. In some embodiments, the engineered T cells are administered to the recipient subject within 48 hours of administering the CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 24 hours of administering the CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 18 hours of administering the CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 12 hours of administering the CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 6 hours of administering the CD34-selected allogeneic SCT graft to the recipient subject.

[0006] The donor subject can be a related donor with an HLA 10 / 10 match to the recipient subject, an unrelated donor with an HLA 10 / 10 match to the recipient subject, a related donor with an HLA 11 / 12 match to the recipient subject, an unrelated donor with an HLA 12 / 12 match to the recipient subject, a related donor with an HLA 11 / 12 match to the recipient subject, or an unrelated donor with an HLA 12 / 12 match to the recipient subject. A donor subject with an HLA 11 / 12 match to a recipient subject shares a single mismatch with the recipient subject at the HLA-DQ or HLA-DP locus in the graft-versus-host direction (i.e., the donor subject is homozygous for the mismatched allele and the recipient subject is heterozygous for the mismatched allele).

[0007] The engineered T cells may be derived from a T cell donor subject that is HLA-matched to the recipient subject. The allogeneic SCT graft donor subject and the T cell donor subject may be the same donor subject. In some embodiments, the donor subject may undergo a first apheresis procedure to collect an apheresis product for manufacturing engineered T cells, and a second apheresis procedure to collect an apheresis product for the graft that provides donor hematopoiesis to the recipient (e.g., allogeneic SCT graft). The first apheresis procedure may be performed without first administering a reagent known to mobilize hematopoietic stem cells (a mobilizing agent) to the donor subject. The donor subject may be administered a mobilizing agent prior to the second apheresis. The apheresis product collected for the allogeneic SCT graft may be treated to mobilize CD34 + The cells can be selected, thereby generating a CD34-selected allogeneic SCT graft. The apheresis product can be a leukapheresis product (e.g., PBMCs).

[0008] Exemplary hematopoietic-restricted miHAs include, but are not limited to, HA-1 epitopes or HA-2 epitopes. The HA-1 epitopes may have the amino acid sequence of SEQ ID NO: 3. The HA-2 epitopes may have the amino acid sequence of SEQ ID NO: 5.

[0009] Exemplary TCRs that recognize the HA-1 epitope include, but are not limited to, TCRs that include an alpha variable region having the amino acid sequence of SEQ ID NO: 14, and a beta variable region having the amino acid sequence of SEQ ID NO: 8. Such an anti-HA-1 TCR may include an alpha chain having the amino acid sequence of SEQ ID NO: 18, and a beta chain having the amino acid sequence of SEQ ID NO: 12. The alpha and beta chains may be expressed from a single promoter. In some embodiments, the alpha and beta TCR chains are encoded on a single transcript and separated by a 2A element (e.g., a p2A or T2A element). In some embodiments, an engineered T cell expressing an anti-HA-1 antigen TCR includes an expressible nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 20.

[0010] Exemplary TCRs that recognize the HA-2 epitope include: an alpha variable region having the amino acid sequence of SEQ ID NO:25, and a beta variable region having the amino acid sequence of SEQ ID NO:27; an alpha variable region having the amino acid sequence of SEQ ID NO:29, and a beta variable region having the amino acid sequence of SEQ ID NO:31; an alpha variable region having the amino acid sequence of SEQ ID NO: 33, and a beta variable region having the amino acid sequence of SEQ ID NO: 35; an alpha variable region having the amino acid sequence of SEQ ID NO:37, and a beta variable region having the amino acid sequence of SEQ ID NO:39; an alpha variable region having the amino acid sequence of SEQ ID NO: 41, and a beta variable region having the amino acid sequence of SEQ ID NO: 43; an alpha variable region having the amino acid sequence of SEQ ID NO: 45, and a beta variable region having the amino acid sequence of SEQ ID NO: 47; an alpha variable region having the amino acid sequence of SEQ ID NO:49, and a beta variable region having the amino acid sequence of SEQ ID NO:51; an alpha variable region having the amino acid sequence of SEQ ID NO:53, and a beta variable region having the amino acid sequence of SEQ ID NO:55; an alpha variable region having the amino acid sequence of SEQ ID NO:57, and a beta variable region having the amino acid sequence of SEQ ID NO:59; an alpha variable region having the amino acid sequence of SEQ ID NO:61, and a beta variable region having the amino acid sequence of SEQ ID NO:63; an alpha variable region having the amino acid sequence of SEQ ID NO:65, and a beta variable region having the amino acid sequence of SEQ ID NO:67; an alpha variable region having the amino acid sequence of SEQ ID NO:69, and a beta variable region having the amino acid sequence of SEQ ID NO:71; an alpha variable region having the amino acid sequence of SEQ ID NO: 73, and a beta variable region having the amino acid sequence of SEQ ID NO: 75; an alpha variable region having the amino acid sequence of SEQ ID NO: 77, and a beta variable region having the amino acid sequence of SEQ ID NO: 79; an alpha variable region having the amino acid sequence of SEQ ID NO: 81, and a beta variable region having the amino acid sequence of SEQ ID NO: 83; or This includes, but is not limited to, TCRs comprising an alpha variable region having the amino acid sequence of SEQ ID NO:85, and a beta variable region having the amino acid sequence of SEQ ID NO:87.

[0011] In some embodiments, the alpha and beta regions or anti-HA-2 TCRs are expressed from a single transcript in the engineered T cells. In some embodiments, the alpha and beta TCR chains are encoded on a single transcript and are separated by a 2A element (e.g., a p2A or T2A element).

[0012] Exemplary TCRs that recognize the HA-2 epitope include: an alpha chain having the amino acid sequence of SEQ ID NO:26, and a beta chain having the amino acid sequence of SEQ ID NO:28; an alpha chain having the amino acid sequence of SEQ ID NO: 30, and a beta chain having the amino acid sequence of SEQ ID NO: 32; an alpha chain having the amino acid sequence of SEQ ID NO: 34, and a beta chain having the amino acid sequence of SEQ ID NO: 36; an alpha chain having the amino acid sequence of SEQ ID NO: 38, and a beta chain having the amino acid sequence of SEQ ID NO: 40; an alpha chain having the amino acid sequence of SEQ ID NO: 42, and a beta chain having the amino acid sequence of SEQ ID NO: 44; an alpha chain having the amino acid sequence of SEQ ID NO: 46, and a beta chain having the amino acid sequence of SEQ ID NO: 48; an alpha chain having the amino acid sequence of SEQ ID NO: 50, and a beta chain having the amino acid sequence of SEQ ID NO: 52; an alpha chain having the amino acid sequence of SEQ ID NO: 54, and a beta chain having the amino acid sequence of SEQ ID NO: 56; an alpha chain having the amino acid sequence of SEQ ID NO:58, and a beta chain having the amino acid sequence of SEQ ID NO:60; an alpha chain having the amino acid sequence of SEQ ID NO: 62, and a beta chain having the amino acid sequence of SEQ ID NO: 64; an alpha chain having the amino acid sequence of SEQ ID NO: 66, and a beta chain having the amino acid sequence of SEQ ID NO: 68; an alpha chain having the amino acid sequence of SEQ ID NO: 70, and a beta chain having the amino acid sequence of SEQ ID NO: 72; an alpha chain having the amino acid sequence of SEQ ID NO: 74, and a beta chain having the amino acid sequence of SEQ ID NO: 76; an alpha chain having the amino acid sequence of SEQ ID NO: 78, and a beta chain having the amino acid sequence of SEQ ID NO: 80; an alpha chain having the amino acid sequence of SEQ ID NO: 82 and a beta chain having the amino acid sequence of SEQ ID NO: 84, or This includes, but is not limited to, TCRs comprising an alpha chain having the amino acid sequence of SEQ ID NO:86 and a beta chain having the amino acid sequence of SEQ ID NO:88.

[0013] In some embodiments, the nucleic acid sequences encoding the alpha and beta chains of the anti-HA-2 TCR are provided on a single vector or expression cassette and expressed from a single promoter. In some embodiments, the alpha and beta TCR chains are encoded on a single transcript and separated by a 2A element (e.g., a p2A or T2A element).

[0014] In some embodiments, the engineered T cells further express RQR8 peptide. The RQR8 peptide may be expressed from the same promoter as the heterologous TCR. In some embodiments, the alpha and beta TCR chains and the RQR8 peptide are encoded on a single transcript and are separated by a 2A element (e.g., a p2A or T2A element). In some embodiments, the engineered T cells expressing the anti-HA-1 antigen TCR and the RQR8 peptide comprise an expressible nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 22. In some embodiments, the engineered T cells expressing the anti-HA-1 antigen TCR and the RQR8 peptide comprise an expressible nucleic acid sequence comprising SEQ ID NO: 21.

[0015] The nucleic acid sequence encoding the heterologous TCR can be operably linked to a promoter to express the heterologous TCR in the engineered T cell. The promoter can be any promoter active in the T cell. The promoter can be, but is not limited to, the MNDU3 promoter. In some embodiments, the engineered T cell expressing the anti-HA-1 TCR and RQR8 peptide from the MNDU3 promoter comprises a nucleic acid sequence comprising SEQ ID NO:23.

[0016] In some embodiments, the methods described include (i) performing a first apheresis procedure on a T cell donor subject to collect an apheresis product; and (ii) isolating CD8 + (iii) isolating CD8 T cells; + (iv) activating T cells by using CD8 +(v) genetically modifying the cells to express a heterologous TCR or CAR; + (vi) genetically modifying the T cells, thereby generating an engineered T cell; and (vi) expanding the engineered T cells prior to administering the engineered T cells to the recipient subject.

[0017] A method of treating a recipient subject suffering from a hematological malignancy is described, the method comprising: (a) isolating CD8 + (b) genetically modifying the T cells to knock out the endogenous TRAC and TRBC genes and express a xenogeneic TCR that recognizes a hematopoietic-restricted miHA antigen expressed by the recipient subject, thereby generating engineered T cells, wherein the donor apheresis product is obtained from a donor subject that is HLA-matched to the recipient subject but does not express the hematopoietic-restricted miHA antigen; and (b) administering to the recipient subject a CD34-selected allogeneic SCT graft and the engineered T cells, wherein the CD34-selected allogeneic SCT graft is a CD34-selected allogeneic SCT graft obtained from the donor subject that does not express the hematopoietic-restricted miHA antigen. + The engineered T cells are administered to the recipient subject within 72 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject, and no immunosuppressant targeting GVHD is administered prophylactically to the recipient subject to suppress immune activity of the T cells. In some embodiments, the engineered T cells are administered to the recipient subject within 18 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 12 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 6 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject.

[0018] The described methods can be used to treat recipient subjects having hematological malignancies such as leukemia, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), myelodysplastic syndromes (MDS), chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myelogenous leukemia in blast crisis, chronic myelogenous leukemia in accelerated phase, multiple myeloma, or non-Hodgkin's lymphoma.

[0019] In some embodiments, the recipient subject has no measurable residual disease (MRD).

[0020] In some embodiments, the recipient subject has MRD or morphologically identifiable disease. In some embodiments, the recipient subject has ≧5% myeloblasts in the bone marrow and / or detectable myeloblasts in the peripheral blood. In some embodiments, the recipient subject has ≧10% myeloblasts in the bone marrow and / or detectable myeloblasts in the peripheral blood. In some embodiments, the recipient subject has ≧15% myeloblasts in the bone marrow and / or detectable myeloblasts in the peripheral blood. In some embodiments, the recipient subject has ≧20% myeloblasts in the bone marrow and / or detectable myeloblasts in the peripheral blood. In some embodiments, the recipient subject has ≦25% myeloblasts in the bone marrow. In some embodiments, the recipient subject has about 5% to about 25% myeloblasts in the bone marrow. In some embodiments, the recipient subject has AML, ALL, or MRD and has up to 25% myeloblasts in the bone marrow. The percentage of myeloblasts can be determined by any known method.

[0021] In some embodiments, the recipient subject is refractory to at least one previous therapy.At least one previous therapy can be, but is not limited to, induction therapy and / or consolidation therapy.Therefore, in some embodiments, the method described herein can be used to treat refractory hematological malignancies.

[0022] In some embodiments, the recipient subject has one or more risk factors or indicators of poor outcome typically associated with standard allogeneic SCT therapy. Risk factors or indicators of poor outcome include, but are not limited to, TP53 mutation, complex karyotype, typical complex karyotype, atypical complex karyotype, monosomal karyotype, 17p chromosomal abnormality, and Ph+ chromosomal abnormality. The risk factors or indicators of poor prognosis can be determined using methods available in the art. The risk factors or indicators of poor prognosis can be determined before or after diagnosis of hematopoietic malignancy. The risk factors or indicators of poor prognosis can be determined before or after administration of treatment for hematopoietic malignancy. The risk factors or indicators of poor prognosis can be determined before administering allogeneic SCT to the recipient subject. In some embodiments, the recipient subject suffering from hematopoietic malignancy is tested for the presence of one or more risk factors or indicators of poor prognosis before administering allogeneic SCT or allogeneic SCT in combination with engineered T cells. In some embodiments, the presence or absence of one or more risk factors or indicators of poor prognosis in a recipient subject suffering from a hematopoietic malignancy is determined, and the presence of one or more risk factors or indicators of poor prognosis indicates that the recipient subject is a candidate for treatment with allogeneic SCT in combination with the engineered T cells as described.

[0023] In some embodiments, the recipient subject has AML and at least one risk factor in blood or bone marrow, and / or detectable RUNX1-RUNX1T1 transcript, CBFB-MYH11 transcript, NPM1 mutation transcript, or FLT3-ITD transcript.The risk factor can be, but is not limited to, TP53 mutation, complex karyotype, monosomal karyotype, 17p chromosomal abnormality, Ph+ chromosomal abnormality, and MECOM (EVI1) rearrangement.

[0024] In some embodiments, the recipient subject has ALL and at least one risk factor.The risk factor can be, but is not limited to, cytogenetic abnormality, Ph+ chromosomal abnormality, CRLF2 mutation, Ikaros deletion, monosomy 7, or complex karyotype that defines persistent disease.In some embodiments, the recipient subject has ALL and persistent disease based on susceptibility molecular technology.

[0025] In some embodiments, the recipient subject has MDS and at least one risk factor.The risk factor can be but is not limited to complex karyotype, monosomal karyotype, TP53 mutation, RAS pathway mutation, JAK2 mutation, RUNX1 mutation, or ASXL1 mutation.

[0026] A method of producing engineered T cells for administration to a recipient subject is described, the method comprising: (a) identifying or having a donor subject that is HLA-matched to the recipient subject; (b) collecting an apheresis product from the donor subject or having an apheresis product collected from the donor subject; and (c) isolating CD8 T cells from the apheresis product. + Selecting and enriching CD8 T cells + (d) forming an enriched CD8 + CD8 in the T cell population + (e) activating the T cell; and (f) activating the CD8 T cell to express a nucleic acid encoding a xenogeneic TCR or a chimeric antigen receptor (CAR). + (f) genetically modifying T cells to thereby generate engineered T cells, the engineered T cells expressing a heterologous TCR or CAR; and (f) expanding the engineered T cells. The apheresis product can be a leukapheresis product. In some embodiments, PBMCs are isolated from the apheresis product prior to CD8+ selection. In some embodiments, apheresis is performed without prior administration of a mobilizing agent to the donor subject.

[0027] In some embodiments, T cells (e.g., CD8 + Isolating the T cells, knocking out the endogenous TCR, and inserting a nucleic acid encoding a xenogeneic TCR or CAR is performed within 36 to 72 hours of the collected apheresis product. In some embodiments, isolating the T cells, knocking out the endogenous TCR, and inserting a nucleic acid encoding a xenogeneic TCR or CAR is performed within 18 to 36 hours of contact that activates the CD8+ T cells. In some embodiments, the nucleic acid encoding a xenogeneic TCR or CAR is inserted into the CD8+ T cells within about 24 hours of knocking out the endogenous TCR. In some embodiments, steps (c), (d), and (e) are performed 24 to 48 hours after step (b). In some embodiments, expanding the engineered T cells includes incubating the engineered T cells under conditions suitable for expansion for about 7 to about 14 days.

[0028] The donor subject can be a related donor with an HLA 10 / 10 match to the recipient subject, an unrelated donor with an HLA 10 / 10 match to the recipient subject, a related donor with an HLA 11 / 12 match to the recipient subject, an unrelated donor with an HLA 12 / 12 match to the recipient subject, a related donor with an HLA 11 / 12 match to the recipient subject, or an unrelated donor with an HLA 12 / 12 match to the recipient subject. A donor subject with an HLA 11 / 12 match to a recipient subject shares a single mismatch with the recipient subject at the HLA-DQ or HLA-DP locus in the graft-versus-host direction (i.e., the donor subject is homozygous for the mismatched allele and the recipient subject is heterozygous for the mismatched allele).

[0029] In some embodiments, CD8 + Activating T cells is a process that activates the CD8 + This involves contacting T cells with a soluble anti-CD3 antibody in the absence of a CD28 agonist, a CD3 agonist and a CD28 agonist, or an immobilized CD3 agonist and a CD28 agonist.+ The T cells may be incubated with the activating agent for about 12 to about 24 hours.

[0030] In some embodiments, the method further comprises the step of: after step (d) and before step (e), administering activated CD8 + The method further comprises knocking out an endogenous T cell receptor (TCR) in the T cell. + Knocking out endogenous T cell receptors in T cells can be done using the CRISPR system. Both TCR alpha and beta chains can be knocked out using the CRISPR system. The CRISPR system can include an RNA-guided DNA endonuclease enzyme and a guide RNA. The RNA-guided DNA endonuclease enzyme can be, but is not limited to, a Cas9 enzyme. The guide RNA can be, but is not limited to, SEQ ID NO: 1 and SEQ ID NO: 2. In some embodiments, knocking out endogenous T cell receptors can be achieved by knocking out CD8 T cell receptors with a Cas9 / guide RNA preformulated ribonucleoprotein complex targeting the TRAC and TRBC genes. + The method can include transfecting the T cells, wherein the preformulated ribonucleoprotein complex comprises a guide RNA comprising SEQ ID NO:1 and a guide RNA comprising SEQ ID NO:2.

[0031] Insertion of a nucleic acid sequence encoding a xenogeneic TCR (or antigen-binding fragment thereof) or CAR can be performed using methods available in the art for introducing xenogeneic nucleic acid sequences into T cells. In some embodiments, CD8 T cells are transfected to express a xenogeneic TCR or CAR. + Genetically modifying T cells involves the insertion of vectors encoding heterologous TCRs or CARs into CD8 + In some embodiments, inserting the nucleic acid sequence encoding heterologous TCR or CAR comprises transducing T cell with a viral vector that contains the heterologous nucleic acid sequence encoding heterologous TCR or CAR.The viral vector can be, but is not limited to, a lentiviral vector.

[0032] In some embodiments, CD8 + The genetically engineered T cells contain 5 or fewer copies of a nucleic acid encoding a heterologous TCR or CAR. In some embodiments, the CD8 + T cells are transduced with a lentiviral vector encoding a heterologous TCR or CAR at a multiplicity of infection that results in T cells containing 5 or fewer copies of the nucleic acid encoding the heterologous TCR or CAR.

[0033] The heterologous TCR may be, but is not limited to, an αβ TCR or an antigen-binding fragment thereof. The heterologous TCR may be, but is not limited to, an anti-miHA antigen TCR, an anti-miHA HA-1 TCR, an anti-miHA HA-2, an anti-viral antigen TCR, or an anti-tumor neoantigen TCR. The CAR may be, but is not limited to, a first, second, third, or fourth generation CAR. The CAR may bind, for example, to a tumor neoantigen, or a viral antigen, or a miHA antigen. In some embodiments, the heterologous TCR is derived from a tumor-infiltrating T cell from a subject.

[0034] The engineered T cells produced using the described methods can be administered to recipient subjects who need or will benefit from therapeutic T cell therapy. In some embodiments, the engineered T cells are used in combination with allogeneic SCT or CD34-selected allogeneic SCT. The engineered T cells produced using the described methods can be used to increase graft-versus-leukemia effect in recipient subjects treated with allogeneic hematopoietic stem cell transplantation (allo-SCT) and / or reduce the risk of graft-versus-host disease in recipient subjects treated with allogeneic SCT.

[0035] In some embodiments, the heterologous TCR or CAR comprises a TCR or CAR that has affinity for the hematopoietic-restricted miHA antigen expressed by the recipient subject.Exemplary hematopoietic-restricted miHA antigens include, but are not limited to, HA-1 epitope or HA-2 epitope.The HA-1 epitope can have the amino acid sequence of SEQ ID NO:3.The HA-1 epitope can have the amino acid sequence of SEQ ID NO:5.

[0036] Exemplary TCRs that recognize the HA-1 epitope include, but are not limited to, TCRs that include an alpha variable region having the amino acid sequence of SEQ ID NO: 14, and a beta variable region having the amino acid sequence of SEQ ID NO: 8. Such an anti-HA-1 TCR may include an alpha chain having the amino acid sequence of SEQ ID NO: 18, and a beta chain having the amino acid sequence of SEQ ID NO: 12. The alpha and beta chains may be expressed from a single promoter. In some embodiments, the alpha and beta TCR chains are encoded on a single transcript and separated by a 2A element (e.g., a p2A or T2A element). In some embodiments, an engineered T cell expressing an anti-HA-1 antigen TCR includes an expressible nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 20.

[0037] In some embodiments, an exemplary engineered T cell expressing an anti-HA-2 antigen TCR comprises: an alpha variable region having the amino acid sequence of SEQ ID NO:25, and a beta variable region having the amino acid sequence of SEQ ID NO:27; an alpha variable region having the amino acid sequence of SEQ ID NO:29, and a beta variable region having the amino acid sequence of SEQ ID NO:31; an alpha variable region having the amino acid sequence of SEQ ID NO: 33, and a beta variable region having the amino acid sequence of SEQ ID NO: 35; an alpha variable region having the amino acid sequence of SEQ ID NO:37, and a beta variable region having the amino acid sequence of SEQ ID NO:39; an alpha variable region having the amino acid sequence of SEQ ID NO: 41, and a beta variable region having the amino acid sequence of SEQ ID NO: 43; an alpha variable region having the amino acid sequence of SEQ ID NO: 45, and a beta variable region having the amino acid sequence of SEQ ID NO: 47; an alpha variable region having the amino acid sequence of SEQ ID NO:49, and a beta variable region having the amino acid sequence of SEQ ID NO:51; an alpha variable region having the amino acid sequence of SEQ ID NO:53, and a beta variable region having the amino acid sequence of SEQ ID NO:55; an alpha variable region having the amino acid sequence of SEQ ID NO:57, and a beta variable region having the amino acid sequence of SEQ ID NO:59; an alpha variable region having the amino acid sequence of SEQ ID NO:61, and a beta variable region having the amino acid sequence of SEQ ID NO:63; an alpha variable region having the amino acid sequence of SEQ ID NO:65, and a beta variable region having the amino acid sequence of SEQ ID NO:67; an alpha variable region having the amino acid sequence of SEQ ID NO:69, and a beta variable region having the amino acid sequence of SEQ ID NO:71; an alpha variable region having the amino acid sequence of SEQ ID NO: 73, and a beta variable region having the amino acid sequence of SEQ ID NO: 75; an alpha variable region having the amino acid sequence of SEQ ID NO: 77, and a beta variable region having the amino acid sequence of SEQ ID NO: 79; an alpha variable region having the amino acid sequence of SEQ ID NO: 81, and a beta variable region having the amino acid sequence of SEQ ID NO: 83; or The present invention encodes an expressible nucleic acid sequence that encodes an alpha variable region having the amino acid sequence of SEQ ID NO:85, and a beta variable region having the amino acid sequence of SEQ ID NO:87.

[0038] In some embodiments, the alpha and beta regions of the anti-HA-2 TCR are expressed from a single transcript in the engineered T cells. In some embodiments, the alpha and beta TCR chains are encoded on a single transcript and are separated by a 2A element (e.g., a p2A or T2A element).

[0039] In some embodiments, the engineered T cells further express RQR8 peptide. The RQR8 peptide may be expressed from a sample promoter as a heterologous TCR. In some embodiments, the alpha and beta TCR chains and the RQR8 peptide are encoded on a single transcript and separated by a 2A element (e.g., a p2A or T2A element). In some embodiments, the engineered T cells expressing the anti-HA-1 antigen TCR and the RQR8 peptide comprise an expressible nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 22. In some embodiments, the engineered T cells expressing the anti-HA-1 antigen TCR and the RQR8 peptide comprise an expressible nucleic acid sequence comprising SEQ ID NO: 21.

[0040] The nucleic acid sequence encoding the heterologous TCR can be operably linked to a promoter to express the heterologous TCR in the engineered T cell. The promoter can be any promoter active in the T cell. The promoter can be, but is not limited to, the MNDU3 promoter. In some embodiments, the engineered T cell expressing the anti-HA-1 antigen TCR and RQR8 peptide from the MNDU3 promoter comprises a nucleic acid sequence comprising SEQ ID NO:23.

[0041] In some embodiments, about 10% to about 90%, or at least 50%, of the engineered T cells produced using the described methods have a stem cell-like phenotype. In some embodiments, the engineered T cells kill cells expressing an antigen recognized by a xenogeneic TCR or CAR at an effector:target ratio of less than 1:1, or less than 0.5:1. In some embodiments, the engineered T cells maintain at least 50% of their cytolytic capacity for at least 20 days.

[0042] In some embodiments, the engineered T cells are generated, expanded, and cryopreserved within about 9 to about 15 days of collecting the apheresis product from the donor subject. If cryopreserved, the engineered T cells are thawed prior to administration to the recipient subject. In some embodiments, at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the thawed engineered T cells have a stem cell-like phenotype. In some embodiments, the thawed engineered T cells kill cells expressing an antigen recognized by the heterologous TCR or CAR at an effector:target ratio of less than 1:1. In some embodiments, the thawed engineered T cells kill cells expressing an antigen recognized by the heterologous TCR or CAR at an effector:target ratio of less than 0.5:1. In some embodiments, the thawed engineered T cells maintain at least 50% of their cytolytic power for at least 20 days.

[0043] The engineered T cells produced using the described methods can be used in T cell therapy. The T cell therapy can be used to treat recipient subjects suffering from hematological malignancies, including. In some embodiments, the engineered T cells are administered to the recipient subject in combination with allogeneic SCT. The allogeneic SCT can be a CD34-selected allogeneic SCT. In some embodiments, the engineered T cells are administered to the recipient subject in combination with a CD34-selected allogeneic SCT, the engineered T cells are administered to the recipient subject on the same day as the CD34-selected allogeneic SCT, and no immunosuppressant targeting GVHD is administered prophylactically to the recipient subject to suppress the immune activity of the T cells. The hematological malignancies can be, but are not limited to, acute myeloid leukemia, myelodysplastic syndrome, or acute lymphoblastic leukemia.

[0044] Nucleic acids encoding anti-HA-1 TCRs are also described. In some embodiments, the nucleic acid comprises a sequence encoding SEQ ID NO:20 or SEQ ID NO:22. In some embodiments, the nucleic acid comprises a sequence having at least 75% identity to SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, or SEQ ID NO:24 and encoding the amino acid sequence of SEQ ID NO:20 or SEQ ID NO:22, or a sequence comprising SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, or SEQ ID NO:24. In some embodiments, the nucleic acid comprises a sequence of SEQ ID NO:7 or SEQ ID NO:11. In some embodiments, the nucleic acid comprises a sequence of SEQ ID NO:13 or SEQ ID NO:17.

[0045] Nucleic acids encoding anti-HA-2 TCRs are also described. In some embodiments, an exemplary nucleic acid encoding an anti-HA-2 TCR is an alpha variable region having the amino acid sequence of SEQ ID NO:25, and a beta variable region having the amino acid sequence of SEQ ID NO:27; an alpha variable region having the amino acid sequence of SEQ ID NO:29, and a beta variable region having the amino acid sequence of SEQ ID NO:31; an alpha variable region having the amino acid sequence of SEQ ID NO: 33, and a beta variable region having the amino acid sequence of SEQ ID NO: 35; an alpha variable region having the amino acid sequence of SEQ ID NO:37, and a beta variable region having the amino acid sequence of SEQ ID NO:39; an alpha variable region having the amino acid sequence of SEQ ID NO: 41, and a beta variable region having the amino acid sequence of SEQ ID NO: 43; an alpha variable region having the amino acid sequence of SEQ ID NO: 45, and a beta variable region having the amino acid sequence of SEQ ID NO: 47; an alpha variable region having the amino acid sequence of SEQ ID NO:49, and a beta variable region having the amino acid sequence of SEQ ID NO:51; an alpha variable region having the amino acid sequence of SEQ ID NO:53, and a beta variable region having the amino acid sequence of SEQ ID NO:55; an alpha variable region having the amino acid sequence of SEQ ID NO:57, and a beta variable region having the amino acid sequence of SEQ ID NO:59; an alpha variable region having the amino acid sequence of SEQ ID NO:61, and a beta variable region having the amino acid sequence of SEQ ID NO:63; an alpha variable region having the amino acid sequence of SEQ ID NO:65, and a beta variable region having the amino acid sequence of SEQ ID NO:67; an alpha variable region having the amino acid sequence of SEQ ID NO:69, and a beta variable region having the amino acid sequence of SEQ ID NO:71; an alpha variable region having the amino acid sequence of SEQ ID NO: 73, and a beta variable region having the amino acid sequence of SEQ ID NO: 75; an alpha variable region having the amino acid sequence of SEQ ID NO: 77, and a beta variable region having the amino acid sequence of SEQ ID NO: 79; an alpha variable region having the amino acid sequence of SEQ ID NO: 81, and a beta variable region having the amino acid sequence of SEQ ID NO: 83; or It includes a sequence encoding an alpha variable region having the amino acid sequence of SEQ ID NO:85, and a beta variable region having the amino acid sequence of SEQ ID NO:87.

[0046] In some embodiments, the nucleic acid sequences encoding the alpha and beta regions of the anti-HA-2 TCR are provided on a single vector or expression cassette and expressed from a single promoter. In some embodiments, the alpha and beta TCR chains are encoded on a single transcript and separated by a 2A element (e.g., a p2A or T2A element).

[0047] Also described are lentiviral vectors suitable for use in transducing T cells to insert a nucleic acid encoding a heterologous anti-HA-1 TCR. In some embodiments, the lentiviral vector comprises a nucleic acid sequence encoding SEQ ID NO:20 or SEQ ID NO:22, a nucleic acid sequence having at least 75% identity to SEQ ID NO:19, SEQ ID NO:21, or SEQ ID NO:23 and encoding the amino acid sequence of SEQ ID NO:20 or SEQ ID NO:22, or a nucleic acid sequence comprising SEQ ID NO:19, SEQ ID NO:21, or SEQ ID NO:23.

[0048] Also described are engineered T cells expressing a heterologous anti-HA-1 TCR. In embodiments, the engineered T cells comprise a nucleic acid sequence encoding SEQ ID NO:20 or SEQ ID NO:22, a nucleic acid sequence having at least 75% identity to SEQ ID NO:19, SEQ ID NO:21, or SEQ ID NO:23 and encoding the amino acid sequence of SEQ ID NO:20 or SEQ ID NO:22, or a nucleic acid sequence comprising SEQ ID NO:19, SEQ ID NO:21, or SEQ ID NO:23. [Brief description of the drawings]

[0049] [Figure 1A] FIG. 1A depicts an exemplary embodiment of a TCR expression cassette. [Figure 1B] FIG. 1B shows an exemplary embodiment of a lentiviral vector for inserting nucleic acid encoding a heterologous TCR expression into a T cell. [Diagram 2] FIG. 2 is a graph showing knockout efficiency in T cells activated with OKT3, OKT3 plus activating anti-CD28 antibody, and TRANSACT™. [Diagram 3] FIG. 3 is a graph showing the percentage of transduced T cells (insertion of a xenogeneic TCR) as determined by CD44 expression. [Figure 4] FIG. 4 is a graph showing the percentage of viable LCL224 (top panel, cells expressing R antigens) or LCL222 (bottom panel, cells expressing H antigens) cells after co-culture with various ratios of engineered T cells. [Diagram 5] FIG. 5 is a graph showing the percentage of live LCL224 (cells expressing R antigens) or LCL222 (cells expressing H antigens) cells after co-culture with various ratios of engineered T cells. [Figure 6] 6 is a graph showing ELISpot cytokine release assay followed by IL-2 secretion detected by co-culturing engineered T cells with LCL224 (expressing "R" antigen) or LCL222 (expressing "H" antigen) cells. Engineered T cells were produced using T cells from two different donors. [Figure 7]FIG. 7 is a graph showing intracellular cytokine staining as determined by flow cytometry in engineered T cells following contact with cells presenting the HA-1 “H” peptide (LC222) or the HA-1 “R” peptide (LC224). [Figure 8] FIG. 8 is a graph showing activation of engineered T cells by LCL cells expressing the indicated HLA and HA-1 epitopes. [Figure 9] FIG. 9 is a graph showing the cytotoxicity of engineered T cells against THP-1 cells (an AML cell line) and NALM-6 cells (a B-ALL cell line). [Figure 10] FIG. 10 depicts an exemplary engineered T cell manufacturing and allogeneic SCT+T cell therapy timeline. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0050] definition The singular forms "a," "an," and "an" include plural references unless the context clearly dictates otherwise. For example, "a" or "an" means "at least one" or "one or more." It is understood that the embodiments and variations described herein include "consisting of" and / or "consisting essentially of" embodiments and variations.

[0051] In general, the term "about" indicates variations in the amount of a component of a composition that do not have any significant effect on the activity or stability of the composition. When the specification discloses a particular value for a parameter, the specification should be understood as alternatively disclosing the parameter at "approximately" that value. All ranges should be interpreted as including the endpoint in the absence of an express exclusion, such as "not including the endpoint," thus, for example, "within 10 to 15" or "10 to 15" includes the values ​​10 and 15. Additionally, the use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "inclusive," "ampors," "ampors," and "including" is not intended to be limiting. Both the foregoing general and detailed description are exemplary and explanatory only, and should not be understood as limiting the teachings. To the extent that any material incorporated by reference is inconsistent with the express content of this disclosure, the express content controls.

[0052] The terms "polypeptide" and "protein" are used interchangeably to refer to a polymer of amino acid residues and are not limited to a minimum length. The polypeptides, including the T cell receptors, antigen-binding fragments thereof, and other peptides, such as linkers, provided may contain amino acid residues, including natural and / or non-natural amino acid residues. The term also includes post-expression modifications of the polypeptide, such as glycosylation, sialylation, acetylation, phosphorylation, and the like. In some embodiments, the polypeptide may contain modifications relative to the native or natural sequence, so long as the protein maintains the desired activity. These modifications may be deliberate, such as through site-directed mutagenesis, or may be accidental, such as through mutations of the host that produces the protein or errors due to PCR amplification.

[0053] "Vector" refers to a nucleic acid (e.g., RNA or DNA) that encodes one or more expression products (e.g., a peptide (i.e., a polypeptide or protein)). A vector may be, but is not limited to, a virus or attenuated virus (viral vector), a plasmid, a linear DNA molecule, an mRNA, a CRISPR RNA, a CISPR system, or a composition comprising a nucleic acid that encodes an expression product. A vector can express one or more polypeptides in a cell, such as a mammalian cell. A vector may contain one or more sequences necessary for expression of an encoded expression product. Various sequences can be incorporated into a vector to alter expression of a coding sequence. A vector may include one or more of a 5' untranslated region (5'UTR), an enhancer, a promoter, an intron, a 3' untranslated region (3'UTR), a terminator, and a polyA signal operably linked to a DNA coding sequence. A vector may also include one or more sequences that alter messenger RNA (mRNA) stability, RNA processing, or efficiency of translation. Any of the described nucleic acids encoding a TCR or CAR can be part of an expression vector designed to express a TCR or CAR in a cell. The viral vector can be, but is not limited to, an AAV vector, adenovirus, retrovirus, gammaretrovirus, lentivirus, vaccinia virus, alphavirus, or herpes virus.

[0054] The term "plasmid" refers to a nucleic acid that includes at least one sequence that encodes a polypeptide (e.g., an expression vector) that can be expressed in a mammalian cell. A plasmid may be a closed circular DNA molecule. Various sequences can be incorporated into a plasmid to alter the expression of the coding sequence or to facilitate replication of the plasmid in the cell. Sequences that affect the efficiency of transcription, messenger RNA (mRNA) stability, RNA processing, or translation can be used. Such sequences include, but are not limited to, 5' untranslated regions (5'UTRs), promoters, introns, and 3' untranslated regions (3'UTRs). In some embodiments, the plasmids can be transformed into bacteria, such as Escherichia coli (E. coli). The plasmids can also be packaged into viruses for viral vectors (e.g., lentiviral vectors).

[0055] "Operable linkage" or "operably linked" refers to the juxtaposition of two or more components (e.g., a promoter and another sequence element) such that both components normally function and allow the possibility that at least one of the components may mediate a function exerted on at least one of the other components. For example, a promoter may be operably linked to a coding sequence if the promoter controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. Operable linkage may include sequences that are contiguous with each other or that act in trans (e.g., regulatory sequences may act at a distance to control transcription of the coding sequence).

[0056] A "promoter" is a DNA regulatory region capable of binding RNA polymerase in a cell (e.g., directly or through other promoter-binding proteins or substances) and initiating transcription of a coding sequence. A promoter may contain one or more additional regions or elements that affect the rate of transcription initiation, including, but not limited to, enhancers. A promoter can be, but is not limited to, a constitutively active promoter, a conditional promoter, an inducible promoter, or a cell type-specific promoter.

[0057] A "translation modification element" allows the translation of two or more genes from a single transcript. Translation modification elements include internal ribosome entry sites (IRES), which allow translation initiation from internal regions of an mRNA, and 2A peptides derived from picornaviruses, which cause ribosomes to skip synthesis of a peptide bond at the C-terminus of the element. The incorporation of translational regulatory elements results in the co-expression of two or more polypeptides from a single multicistronic mRNA. 2A regulators include, but are not limited to, P2A, T2A, E2A, or F2A. 2A regulators contain a PG / P cleavage site.

[0058] A "heterologous" sequence is a sequence that is not normally present in a cell, genome, or gene in the genetic context in which the sequence is currently found. Heterologous sequences may be sequences that originate from the same gene (e.g., different alleles) and / or cell type, but are introduced into a cell or similar cells in a different context, such as on an expression vector, or on a different chromosomal location, or from a different promoter. Heterologous sequences may be sequences that originate from a gene or species that is different from the reference gene or species. Heterologous sequences may be from homologous genes from different species, from different genes of the same species, or from different genes from different species. For example, a regulatory sequence may be heterologous in that it is linked to a different coding sequence relative to the natural regulatory sequence.

[0059] A "CRISPR system" comprises a guide RNA, either as a crRNA and a tracrRNA (dual guide RNA) or an sgRNA, and an RNA-guided DNA endonuclease. The guide RNA directs sequence-specific binding of the RNA-guided DNA endonuclease to a target sequence. In some embodiments, the RNA-guided DNA endonuclease contains a nuclear localization sequence. In some embodiments, the CRISPR system further comprises one or more fluorescent proteins and / or one or more endosomal escape agents. In some embodiments, the gRNA and the RNA-guided DNA endonuclease are provided in a complex. In some embodiments, the gRNA and the RNA-guided DNA endonuclease are provided in one or more expression constructs (CRISPR constructs) that encode the gRNA and the RNA-guided DNA endonuclease. Delivery of the CRISPR construct into a cell results in expression of the gRNA and the RNA-guided DNA endonuclease in the cell. The CRISPR system can be, but is not limited to, a CRISPR class 1 system, a CRISPR class 2 system, a CRISPR / Cas system, a CRISPR / Cas9 system, a CRISPR / zCas9 system, and a CRISPR / Cas3 system.

[0060] The term "CRISPR RNA (crRNA)" has been described in the art (see, e.g., Makarova et al. (2011) Nat Rev Microbiol 9:467-477; Makarova et al. (2011) Biol Direct 6:38; Bhaya et al. (2011) Annu Rev Genet 45:273-297; Barrangou et al. (2012) Annu Rev Food Sci Technol 3:143-162; Jinek et al. (2012) Science 337:816-821; Cong et al. (2013) Science 339:819-823; Mali et al. (2013) Science 339:823-826; and Hwang et al. (2013) Nature Biotechnol 31:227-229). The crRNA contains a sequence (spacer sequence or guide sequence) that hybridizes to a target sequence in the genome. The target sequence is unique compared to the rest of the genome and can be any sequence adjacent to a protospacer adjacent motif (PAM).

[0061] A "trans-activating CRISPR RNA" (tracrRNA) is an RNA species that promotes the binding of an RNA-guided DNA endonuclease (e.g., Cas) to a guide RNA.

[0062] A "protospacer adjacent motif" (PAM) is a short sequence recognized by the CRISPR complex. Although the exact sequence and length requirements of the PAM vary depending on the CRISPR system used, the PAM is typically a 2-5 base pair sequence adjacent to the protospacer (i.e., the target sequence). Non-limiting examples of PAMs include NGG, NNGRRT, NN[A / C / T]RRT, NGAN, NGCG, NGAG, NGNG, NGC, and NGA.

[0063] An "engineered," "genetically modified," or simply "modified" cell is a cell in which one or more endogenous genes have been altered or disrupted, and / or an exogenous (e.g., heterologous) nucleic acid (such as a TCR) has been introduced and integrated into the genome of the cell. Engineered cells are distinguishable from naturally occurring cells that do not have a genetic modification (e.g., disruption of one or more endogenous genes and / or insertion of one or more heterologous nucleic acid sequences).

[0064] Knockout (also known as gene deletion or gene inactivation) refers to genetic manipulation or modification that involves the targeted removal or inactivation of a specific gene within the genome of an organism. Knockouts can be accomplished through a variety of methods, including homologous recombination, CRISPR-Cas9, and TALEN.

[0065] As used herein, "percent (%) amino acid sequence identity" and "percent identity" when used in reference to an amino acid sequence (reference polypeptide sequence) include a candidate sequence (e.g., a subject T cell receptor or fragment that is identical to the amino acid residue in the reference polypeptide sequence), and do not consider conservative substitutions as part of the sequence identity to achieve maximum percent sequence identity after aligning sequences and introducing gaps, if necessary. Alignment for purposes of determining percent amino acid sequence identity can be achieved in a variety of ways that are within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment over the full length of the sequences being compared.

[0066] Amino acid substitutions may involve replacing one amino acid in a polypeptide with another amino acid. Amino acid substitutions may be introduced into a subject TCR or antigen-binding fragment thereof and the products screened for a desired activity, e.g., retained / improved antigen binding, reduced immunogenicity, or improved cytolytic activity.

[0067] Amino acids can generally be grouped according to the following common side chain properties: (1) Hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile, (2) Neutral hydrophilicity: Cys, Ser, Thr, Asn, Gln, (3) Acid: Asp, Glu, (4) Bases: His, Lys, Arg, (5) Residues that influence chain orientation: Gly, Pro, and (6) Aromatic: Trp, Tyr, Phe.

[0068] In some embodiments, conservative substitutions may involve exchanging a member of one of these classes for another member of the same class, while non-conservative amino acid substitutions may involve exchanging a member of one of these classes for another class.

[0069] Throughout this disclosure, various aspects of the claimed subject matter are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the claimed subject matter. Thus, the description of a range should be considered to have specifically disclosed all possible subranges as well as individual numerical values ​​within that range. For example, when a range of values ​​is provided, it is understood that each intervening value between the upper and lower limits of that range, and any other stated or intervening value in that stated range, is encompassed within the claimed subject matter. The upper and lower limits of these smaller ranges may be independently included in the smaller ranges, and are also encompassed within the claimed subject matter, subject to any specifically excluded limit in the stated range. When a stated range includes one or both of the limits, ranges excluding one or both of those included limits are also encompassed within the claimed subject matter. This applies regardless of the breadth of the range.

[0070] A cell or cell population may be characterized by the expression of a particular marker (e.g., CD8) if the detectable marker can be detected on or within the cell. + or CD34 + ) is "positive" (+) for a surface marker. When referring to a surface marker, the term refers to the presence of surface expression detected, e.g., by flow cytometry, by staining with an antibody that specifically binds to the marker and detecting the antibody, where the staining is detectable under otherwise identical conditions at a level substantially greater than that detected running the same procedure using an isotype-matched control, and / or at a level substantially similar to that for cells known to be positive for the marker, and / or at a level substantially greater than that for cells known to be negative for the marker.

[0071] "HLA match" is used to match patients and donors for blood or bone marrow transplants. If two people share an HLA allele, they are considered HLA matched for that HLA allele. HLA match can refer to the match of one or more HLA alleles. HLA (human lymphocyte antigen) is a type of molecule present on the surface of most cells in the body. HLA plays an important role in the body's immune response to foreign substances. HLAs corresponding to major histocompatibility complex (MHC) class I include HLA-A, HLA-B, and HLA-2. HLAs corresponding to MHC class II include HLA-DR, HLA-DQ, and HLA-DP. The subject has two alleles for each HLA. An HLA 10 / 10 match indicates the donor and recipient share two alleles for each of HLA-A, HLA-B, HLA-C, and HLA-DR, and either the HLA-DP or HLA-DQ locus. An HLA 12 / 12 match indicates the donor and recipient share two alleles for each of the HLA-A, HLA-B, HLA-C, HLA-DR, HLA-DQ, and HLA-DP loci. An HLA 11 / 12 match indicates the donor and recipient share a single mismatch at the HLA-DQ or HLA-DP locus in the graft-versus-host direction (heterozygous recipient / homozygous donor).

[0072] "Hematopoietic-restricted miHA" includes antigens that are expressed on cells of hematopoietic origin, e.g., white blood cells, but are not expressed or are expressed at very low levels on other cells (cells other than cells of hematopoietic origin).

[0073] The terms "treat", "treatment" and like terms refer to a method or step taken to reduce, or provide an improvement or alleviation of, the number, severity, adverse effects, and / or frequency of one or more symptoms or pathological consequences of a disease, disorder, or condition in a subject. Treating can include inhibiting a disease, disorder, or condition, e.g., preventing its progression, and alleviating a disease, disorder, or condition, e.g., causing regression of a disease, disorder, and / or condition. Treatment can also mean prolonging survival compared to expected survival in the absence of treatment. Treatment can be therapeutic in terms of a partial or complete cure of a disease, condition, symptom, or adverse effects caused by a disease, disorder, or condition. The term treatment can include (a) preventing a disease from occurring in a subject who may be susceptible to the disease but has not yet been diagnosed as having the disease, (b) inhibiting a disease, i.e., halting its occurrence, and (c) relieving a disease, i.e., reducing or improving a disease and / or its symptoms or condition.

[0074] An "effective dose" or "effective amount" of an agent, e.g., engineered T cells, in the context of administration of a pharmaceutical formulation containing engineered T cells, refers to an amount effective, at dosages / amounts and for periods of time necessary, to achieve a desired result, such as a therapeutic result.

[0075] A treatment or therapy, such as an immunosuppressive therapy, can be prophylactic in that it prevents or partially prevents a condition or disease, or a symptom of a disease state, such as GVHD. Prophylactic administration of a therapy includes administering the therapy to a subject before the onset of a condition or disease, before the appearance or detection of a symptom of a condition or disease, or before diagnosis of a condition or disease in a subject.

[0076] II. Engineered T Cells A method for generating engineered T cells is described. The method provides for rapid manipulation and expansion of T cells expressing a xenogeneic TCR or CAR. Using the described method, engineered T cells suitable for administration to a recipient subject can be generated within 21 days. The engineered T cells are suitable for use by themselves in T cell therapy or in combination with other treatments, such as, but not limited to, allogeneic SCT. In some embodiments, the described method is used to generate allogeneic, HLA-matched, TCR-edited T cells. In some embodiments, the described method is used to generate allogeneic, HLA-matched, CAR T cells. In some embodiments, the engineered T cells express a xenogeneic TCR or CAR that binds to (has affinity for) a target antigen that is expressed in the recipient subject but not expressed in the donor subject. The recipient can be homozygous or heterozygous for the gene encoding / expressing the target antigen. In some embodiments, the engineered T cells express a xenogeneic TCR that binds to (has affinity for) a miHA antigen. In some embodiments, the engineered T cells express a heterologous TCR that binds (has affinity for) a miHA antigen, where the miHA antigen is a hematopoietic-restricted miHA antigen. In some embodiments, the engineered T cells express a heterologous TCR that binds (has affinity for) a peptide epitope expressed on the surface of cancer cells and / or cells associated with hematological disorders. In some embodiments, the engineered T cells express a heterologous TCR that binds (has affinity for) a peptide epitope expressed on the surface of cancer cells and / or cells associated with hematological disorders, in the context of an MHC molecule.

[0077] In some embodiments, the method of generating engineered T cells comprises: (a) collecting an apheresis product from a donor subject (or collecting an apheresis product from a donor subject); (b) CD8 from the apheresis product + Isolating T cells; (c)CD8 + Activating T cells and (d) CD8 + Knocking out endogenous TCR in T cells; (e) inserting a nucleic acid sequence encoding a heterologous TCR (or CAR) to form an engineered T cell expressing the heterologous TCR (or CAR); (f) expanding the engineered T cells.

[0078] In some embodiments, PBMCs are isolated from the apheresis product prior to isolating the T cells.

[0079] In some embodiments, the method of generating engineered T cells comprises: (a) collecting an apheresis product from a donor subject (or collecting an apheresis product from a donor subject); (b) CD8 in apheresis product + Activating T cells and (c) Activated CD8 from the apheresis product + Isolating T cells; (d) CD8 + Knocking out endogenous TCR in T cells; (e) inserting a nucleic acid sequence encoding a heterologous TCR (or CAR) to form an engineered T cell expressing the heterologous TCR (or CAR); (f) expanding the engineered T cells.

[0080] In some embodiments, PBMCs are isolated from the apheresis product prior to activating the T cells.

[0081] In some embodiments, the method of generating engineered T cells comprises: (a) collecting an apheresis product from a donor subject (or collecting an apheresis product from a donor subject); (b) CD8 from the apheresis product + Isolating T cells; (c)CD8 + Activating T cells and (d) inserting a nucleic acid sequence encoding a heterologous TCR (or CAR) to form an engineered T cell expressing the heterologous TCR (or CAR); (e) expanding the engineered T cells.

[0082] In some embodiments, the PBMCs are CD8 + Prior to isolation, T cells are isolated from the apheresis product.

[0083] In some embodiments, the method of generating engineered T cells comprises: (a) collecting an apheresis product from a donor subject (or collecting an apheresis product from a donor subject); (c) CD8 in apheresis product + Activating T cells and (b) Activated CD8 from the apheresis product + Isolating T cells; (c) inserting a nucleic acid sequence encoding a heterologous TCR (or CAR) to form an engineered T cell expressing the heterologous TCR (or CAR); (d) expanding the engineered T cells.

[0084] In some embodiments, the PBMCs are CD8 + Prior to activation, T cells are isolated from the apheresis product.

[0085] The apheresis product includes white blood cells or PBMCs obtained from a subject by performing apheresis or leukapheresis.

[0086] Collecting the apheresis product from the donor subject can be performed using methods available in the art for apheresis. Collecting PBMCs from the donor subject can be performed using methods available in the art for collecting PBMCs. Such methods include, but are not limited to, apheresis and leukapheresis. In some embodiments, the apheresis product is collected from a healthy donor subject using apheresis on day -1. In some embodiments, the donor subject is administered a mobilizing agent prior to apheresis. In some embodiments, the donor subject is not administered a mobilizing agent prior to apheresis. The donor subject can be, but is not limited to, a healthy donor subject, a healthy allogeneic donor subject, or a subject (recipient subject, i.e., autologous donor subject) that is treated with engineered T cells. In some embodiments, the donor subject is HLA-matched to the recipient subject. In some embodiments, the HLA-matched donor subject is HLA-A, HLA-B, and HLA-C matched to the recipient subject. In some embodiments, the donor subject is HLA 10 / 10 matched to the recipient subject. In some embodiments, the donor subject is a related donor subject that is HLA 10 / 10 matched to the recipient subject. In some embodiments, the donor subject is an unrelated donor subject that is HLA 10 / 10 matched to the recipient subject. In some embodiments, the donor subject is HLA 11 / 12 matched to the recipient subject. In some embodiments, the donor subject is a related donor subject that is HLA 11 / 12 matched to the recipient subject. In some embodiments, the donor subject is an unrelated donor subject that has an HLA 11 / 12 match to the recipient subject. In some embodiments, the donor subject is HLA 12 / 12 matched to the recipient subject. In some embodiments, the donor subject is a related donor subject that is HLA 12 / 12 matched to the recipient subject. In some embodiments, the donor subject is an unrelated donor subject that has an HLA 11 / 12 match to the recipient subject. In some embodiments, the donor subject does not express the antigen expressed by the recipient subject (the target antigen).In some embodiments, the donor subject does not express the hematopoietic-restricted miHA antigen expressed by the recipient subject.In some embodiments, the donor subject does not express the antigen recognized by the xenogeneic TCR expressed in the engineered T cell derived from the donor subject.The xenogeneic TCR or CAR expressed by the engineered T cell has affinity for the antigen expressed by the recipient subject but not by the donor subject.The recipient subject may be homozygous or heterozygous for the gene encoding / expressing the target antigen.

[0087] CD8 + T cells (activated CD8 + T cells) are expressed in peripheral blood and other CD8 + T cells can be isolated from the apheresis product using methods available in the art for isolating, purifying, or selecting T cells. Such methods include, but are not limited to, cell sorting or fluorescence-assisted cell sorting. CD8 + T cells are classified as naive T cells (T naive cells), effector T cells, effector memory T cells (T em cells), CD4 + / CD8 + T cells, helper T cells, CD4 + T cells, CD4 + Helper T cells, Th1 T cells, Th2 T cells, cytotoxic T cells, memory T cells, central memory T cells (T cm In some embodiments, the T cells may be, but are not limited to, CD8 T cells, regulatory T cells, αβ T cells, γδ T cells, or a combination thereof. + T cells are isolated from the apheresis product prior to activation. In some embodiments, CD8 + The T cells are isolated from the apheresis product after activation. In some embodiments, the apheresis product comprises PBMCs or purified PBMCs. In some embodiments, the CD8 + T cells are isolated from the apheresis product on day 0 of the manufacturing process. +T cells are isolated from the apheresis product on day 1 of the manufacturing process.

[0088] CD8 + T cell activation is mediated by CD8 + This can be done using methods available in the art for activating T cells. Such methods include activating CD8+ T cells (or CD8 + In some embodiments, the T cells are contacted with a CD3 and / or CD28 agonist. + Activating T cells includes contacting T cells with CD3 and CD28 agonists. In some embodiments, the CD3 agonist and the CD28 agonist are immobilized. CD3 agonists include, but are not limited to, activating anti-CD3 antibodies. CD28 agonists include, but are not limited to, activating anti-CD28 antibodies. The activating anti-CD3 antibody can be any anti-CD3 antibody that prevents or reduces the interaction between CD3 and TCR. The anti-CD3 antibody can be, but is not limited to, OKT3 antibody, 17A2 antibody, 145-2C11 antibody, or UCHT1 antibody. In some embodiments, the anti-CD3 antibody is an OKT3 antibody. The activating anti-CD28 antibody can be any antibody that acts as a costimulator in activating T cells in vitro.

[0089] In some embodiments, CD8 +The T cells are activated by contacting the apheresis product or PBMCs with a soluble anti-CD3 antibody. In some embodiments, the apheresis product or PBMCs are contacted with the soluble anti-CD3 antibody beginning on day 0 of the manufacturing process. In some embodiments, the apheresis product or PBMCs are incubated with the soluble anti-CD3 antibody for about 16 to about 36 hours. In some embodiments, the apheresis product or PBMCs are incubated with the soluble anti-CD3 antibody for about 12 hours, about 13 hours, about 14 hours, about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours, about 24 hours, about 25 hours, about 26 hours, about 27 hours, about 28 hours, about 29 hours, about 30 hours, about 31 hours, about 32 hours, about 33 hours, about 34 hours, about 35 hours, or about 36 hours. In some embodiments, the apheresis product or PBMCs are incubated with soluble anti-CD3 antibody for 24±4 hours. In some embodiments, the apheresis product or PBMCs are incubated with soluble anti-CD3 antibody for about 20 to about 28 hours. In some embodiments, the apheresis product or PBMCs are incubated with soluble anti-CD3 antibody until at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells are activated T cells. The percentage of activated T cells can be determined by methods available in the art, such as, but not limited to, analysis of CD69 expression. In some embodiments, the apheresis product or PBMCs are incubated with soluble anti-CD3 antibody until at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells are activated T cells. + T cells are incubated with soluble anti-CD3 antibody until they become T cells.

[0090] In some embodiments, CD8 + T cells are isolated from the apheresis product PBMCs prior to activation. In some embodiments, the apheresis product or PBMCs are collected from a donor subject who has not received a mobilizing agent prior to apheresis. CD8 +T cells can be isolated from the apheresis product or PBMCs on day 0 of the manufacturing process. + T cells are CD8 + T cells are activated by contacting (incubating) with CD3 and CD28 agonists. In some embodiments, the CD3 and CD28 agonists are immobilized. CD3 agonists include, but are not limited to, activating anti-CD3 antibodies. CD28 agonists include, but are not limited to, activating anti-CD28 antibodies. CD8 + T can be contacted with CD3 and CD28 agonists beginning on day 0. In some embodiments, isolated CD8 + The T cells are contacted with the CD3 agonist and the CD28 agonist overnight (i.e., about 12 to about 24 hours). The CD3 agonist and the CD28 agonist may be linked to beads (e.g., DYNABEADS™). CD3 / CD28 agonist T cell activation reagents include, but are not limited to, TRANSACT™ beads. In some embodiments, CD8 + The T cells are incubated with a CD3 agonist and a CD28 agonist for 12 hours. + The T cells are incubated with a CD3 agonist and a CD28 agonist for 14 hours. + The T cells are incubated with a CD3 agonist and a CD28 agonist for 16 hours. + The T cells are incubated with a CD3 agonist and a CD28 agonist for 18 hours. + The T cells are incubated with a CD3 agonist and a CD28 agonist for 19 hours. + The T cells are incubated with a CD3 agonist and a CD28 agonist for 20 hours. + The T cells are incubated with a CD3 agonist and a CD28 agonist for 21 hours. +The T cells are incubated with a CD3 agonist and a CD28 agonist for 22 hours. + The T cells are incubated with a CD3 agonist and a CD28 agonist for 23 hours. + The T cells are incubated with a CD3 agonist and a CD28 agonist for 24 hours. + The T cells are incubated with a CD3 agonist and a CD28 agonist until at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells are activated T cells. The percentage of activated T cells can be determined by methods available in the art, such as, but not limited to, analysis of CD69 expression. In some embodiments, CD8 + T cells may be characterized as having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells expressing CD69 + T cells are incubated with CD3 and CD28 agonists.

[0091] In some embodiments, the endogenous TCR is an isolated, activated CD8 +Knock out in T cells. Knock out of endogenous TCR can be performed using methods available in the art for knocking out the expression of endogenous genes in mammalian cells. Such methods include, but are not limited to, CRISPR, ARCUS (Precision BioSciences), zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and microbial meganuclease. Knock out of endogenous TCR can (a) eliminate the mispairing of endogenous TCR chain with the chain of introduced heterologous TCR, (b) reduce the potential activity of endogenous TCR on host cells, which can contribute to or cause GVHD, or (c) reduce the possibility of competition between endogenous TCR and exogenous TCR. Knock out of endogenous TCR includes any modification that results in T cells that do not express functional endogenous TCR. The modification may be a deletion of all or part of the endogenous TCR gene, or the introduction of a mutation (e.g., a frameshift or nonsense mutation), or an insertion into the endogenous TCR gene such that a functional endogenous TCR is not expressed. In some embodiments, the modification does not result in the α or β chain (or the γ or δ chain) of the endogenous TCR being expressed. In some embodiments, the modification does not result in the expression of the α or β chain constant region (or the γ or δ chain constant region) of the endogenous TCR. In some embodiments, the modification does not result in the expression of any part of the endogenous TCR protein being expressed. In some embodiments, the endogenous TCR is an activated CD8 T cell isolated on day 1 of the manufacturing process. + Knocked out in T cells.

[0092] In some embodiments, knocking out endogenous T cell receptor in isolated T cells is performed using a CRISPR system. Both TCR alpha (TRAC gene) and TCR beta (TRBC1 and TRBC2 genes) chains can be knocked out using a CRISPR system. The CRISPR system includes an RNA-guided DNA endonuclease enzyme and a guide RNA. The RNA-guided DNA endonuclease enzyme can be, but is not limited to, a Cas9 enzyme (e.g., SpCas9). In some embodiments, two guide RNAs are used, one targeting the TRAC gene (TRAC guide RNA) and one targeting the TRBC gene (TRBC guide RNA). The Cas9 / TRBC guide RNA knocks out both the TRBC1 and TRBC2 genes. The endonuclease and guide RNA can be provided in a preformed ribonucleoprotein (RNP complex). In some embodiments, the CRISPR system includes a Cas9 / guide RNA preformulated ribonucleoprotein (RNP). In some embodiments, the CRISPR system comprises two Cas9 / guide RNA preformulated RNPs. In some embodiments, the CRISPR system generates a double-stranded break in the coding region of the TCR constant chain. Repair of the break generates a short (1-5 nucleotide) insertion and / or deletion in the genomic sequence. In some embodiments, the CRISPR system can be designed to delete a portion or up to all of an endogenous gene. The Cas9 / guide RNA preformulated RNPs can be introduced into T cells using methods known in the art for introducing CRISPR RNPs into mammalian cells.

[0093] A TRAC guide RNA can be, but is not limited to, 5'-GAGAAUCAAAAUCGGUGAAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 1). A TRAC guide RNA can be provided in modified forms including GmsAmsGmsAAUCAAAAUCGGUGAAUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUmsUmsUm, where U, A, C, G represent RNA; m = 2'-O-methyl sugar analog, and s = 3' phosphorothioate internucleotide linkage (SEQ ID NO: 1).

[0094] The TRBC guide RNA can be, but is not limited to, 5'-CACCCAGAUCGUCAGCGCCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 2). The TRBC guide RNA can be provided in modified forms including CmsAmsCmsCCAGAUCGUCAGCGCCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUmsUmsUm, where U, A, C, G represent RNA; m = 2'-O-methyl sugar analog, and s = 3' phosphorothioate internucleotide linkage (SEQ ID NO: 2).

[0095] Both the TRAC and TRBC guide RNAs are 100 nucleotides (nt) in length and contain the sequence elements required for gene editing: a 20 nt target-specific recognition sequence ("guide"), a canonical 3 nt SpCas9 PAM sequence, and an approximately 80 nt tracrRNA scaffold that interacts with the Cas9 enzyme.

[0096] The CRISPR system (e.g., RNP) can be delivered to CD8+ T cells using methods available in the art for delivering RNP to mammalian cells, including, but not limited to, electroporation.

[0097] In some embodiments, about 1×10 5 ~Approx. 1×10 8 Activated CD8 + T cells are engineered to knock out endogenous TCR. In some embodiments, about 60×10 6 Activated CD8 + T cells are engineered to knock out the endogenous TCR, and knockout efficiency can be >90%.

[0098] In some embodiments, the donor T cells are not modified to knock out expression of an endogenous TCR. In such embodiments, the heterologous TCR may be modified to reduce mispairing of the heterologous TCR α or β chain with the endogenous TCR β or α chain, or to promote pairing between the heterologous TCR α and β chains.

[0099] Isolated CD8 +T cells are modified to express a heterologous TCR or CAR by introducing a heterologous nucleic acid sequence (TCR nucleic acid or CAR nucleic acid) to be expressed in the T cell and a heterologous nucleic acid sequence (TCR nucleic acid or CAR nucleic acid) encoding the TCR or CAR. The heterologous nucleic acid encoding the heterologous TCR (or antigen-binding fragment thereof) or CAR is introduced into the T cell (e.g., via lentiviral transduction). Insertion of the heterologous nucleic acid encoding the heterologous TCR (or antigen-binding fragment thereof) or CAR can be performed using methods available in the art for introducing heterologous nucleic acid sequences into mammalian cells. The heterologous nucleic acid encoding the heterologous TCR or CAR can be introduced into the T cell before knocking out the endogenous TCR, simultaneously with knocking out the endogenous TCR, or after knocking out the endogenous TCR. In some embodiments, the heterologous nucleic acid encoding the heterologous TCR or CAR is introduced into the isolated CD8 T cells after knocking out the endogenous TCR. + In some embodiments, the heterologous nucleic acid encoding the heterologous TCR or CAR is introduced into isolated CD8 T cells after knocking out the endogenous TCR on day 1 of the manufacturing process. + The heterologous nucleic acid is introduced into T cells. The introduction of heterologous nucleic acid into T cells can be carried out using methods available in the art. For example, TCR or CAR nucleic acid can be introduced into isolated CD8 T cells by various transfection or transformation methods known in the art. + Can be introduced into T cells. TCR or CAR nucleic acid can be introduced into isolated CD8+ T cells using viral or non-viral vectors. Methods for introducing nucleic acid into cells include, but are not limited to, viral vectors, microinjection, microprojectile bombardment (e.g., gene gun), electroporation, lipofection, and CRISPR (e.g., CRISPR-Cas9) system, CRISPR knock-in (LIFE EDIT), transposon-mediated, ARCUS (Precision BioSciences), zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), microbial meganuclease.

[0100] In some embodiments, inserting a nucleic acid sequence encoding a heterologous TCR or CAR comprises transducing the T cell with a viral vector containing a heterologous nucleic acid sequence encoding a heterologous TCR (or an antigen-binding fragment thereof) or CAR. The viral vector can be, but is not limited to, an adeno-associated virus (AAV), an adenovirus, a retrovirus, a gamma retrovirus, a lentivirus, a vaccinia virus, an alphavirus, or a herpes virus. In some embodiments, the viral vector is a lentiviral vector. In some embodiments, the viral vector is a lentiviral vector and is isolated CD8 + T cells are transduced at a multiplicity of infection of about 2.5. 5 ~Approx. 1×10 8 Isolated CD8 + T cells, or approximately 60 × 10 6 Isolated CD8 + The T cells are transduced to express the heterologous TCR or CAR. In some embodiments, a nucleic acid encoding a heterologous TCR or CAR is inserted into the CD8+ T cells within about 24 hours of knocking out the endogenous TCR.

[0101] In some embodiments, the engineered T cells are further modified to express a cell detection marker and / or ablation marker. A detection marker includes any gene or protein that, when expressed in a T cell, provides detection of the engineered T cell or can be used to select the engineered T cell. A detection marker can be used to monitor transfection / transduction efficiency or to assist in the selection of transfected / transduced T cells. A detection marker can be, but is not limited to, a CD34 polypeptide, or a polypeptide recognized by QBEnd10 monoclonal antibody (e.g., CD34 epitope). Ablation marker includes a gene or protein that, when expressed in a T cell, can be used to selectively kill or ablate the T cell. Ablation marker can be, but is not limited to, a polypeptide recognized by rituximab monoclonal antibody (e.g., CD20 epitope). In some embodiments, the engineered T cells are further modified to express a RQR8 marker. RQR8 contains a CD34 epitope and two CD20 mimotopes that can be targeted by the EMA-approved anti-CD20 antibody rituximab. Rituximab recognition of the CD20 epitope allows for selective elimination of engineered T cells in vivo. The detection / elimination marker can be encoded by the lentivirus used to transduce the heterologous TCR into the donor T cells. The nucleic acid sequence encoding the heterologous TCR can be on a polycistronic vector that also encodes the detection / elimination marker. In some embodiments, the nucleic acid sequence encoding the heterologous TCR is operably linked to the nucleic acid sequence encoding the detection / elimination marker. The nucleic acid sequence encoding the heterologous TCR can be linked to the nucleic acid sequence encoding the detection / elimination marker via a sequence encoding a 2A element. In some embodiments, the detection marker (e.g., the CD34 epitope) is used as a surrogate for potency measurement or as a surrogate marker for determining the number of transduced cells.

[0102] In some embodiments, the engineered T cells contain 5 or fewer copies of a nucleic acid encoding a heterologous TCR or CAR. In some embodiments, the engineered T cells contain 5 or fewer copies of a nucleic acid encoding a heterologous TCR or CAR. In some embodiments, the engineered T cells contain 1, 2, 3, 4, or 5 copies of a nucleic acid encoding a heterologous TCR or CAR. In some embodiments, sufficient viral particles are used to infect isolated CD8 + The T cells are transduced with an average of about 2 copies of the nucleic acid sequence encoding the heterologous TCR per cell.

[0103] In some embodiments, the engineered T cells are further modified. The further modifications can be performed before modifying the T cells to express a heterologous TCR or CAR, at the same time as modifying the T cells to express a heterologous TCR or CAR, or after modifying the T cells to express a heterologous TCR or CAR, or a combination thereof.

[0104] Further modifications can add one or more desired functions to the engineered T cells. In some embodiments, the T cells are further modified by the introduction of nucleic acids encoding additional genes. The T cells can be further modified by introducing one or more nucleic acids encoding, for example, secreted cytokines, cytokine receptors, fitness enhancing genes, or antibody-like proteins, or combinations thereof, into the T cells. In some embodiments, the T cells are further modified to modify or delete one or more genes that are normally expressed in T cells.

[0105] Following genetic modification of the T cells to express a heterologous TCR or CAR, the engineered T cells are expanded under conditions suitable for expansion of the engineered T cells. The engineered T cells are optionally purified using a detectable marker to select for those CD8+ T cells that express the detectable marker. In some embodiments, expanding the engineered T cells includes contacting the engineered T cells with at least one cytokine that targets the common gamma chain (interleukin-2 receptor subunit gamma or IL-2RG) family receptor and is known to stimulate T cell growth / proliferation. In some embodiments, the at least one cytokine includes IL-2. In some embodiments, the at least one cytokine includes IL-2 and one or more of IL-7, IL-15, IL-21, IL-9 (e.g., IL-2+IL-7). The engineered T cells can be incubated with the one or more cytokines beginning on day 2 of the manufacturing process. The engineered T cells can be incubated with the one or more cytokines for about 8 to about 14 days. In some embodiments, the engineered T cells are incubated with one or more cytokines for about 7, about 8, about 9, about 10, about 11, or about 12 days. In some embodiments, the engineered T cells are incubated with one or more cytokines for about 10 days. In some embodiments, the engineered T cells are expanded to provide at least 100 million, at least 200 million, at least 500 million, or at least 1 billion engineered T cells.

[0106] Expanded T cells can be evaluated by the production of cytokines IL-2 and IFN-γ after exposure to cells presenting target antigen. In some embodiments, engineered T cells are analyzed using an activation / degranulation marker assay to evaluate the ability of engineered T cells to express surface marker CD107a after exposure to cells presenting target antigen (e.g., T2 cells). CD107a is a marker of T cell degranulation, which is part of the cell killing response. Engineered T cells are incubated with cells loaded with target peptide antigen (e.g., T2 cells). As a control, APCs are loaded with the corresponding non-target peptide antigen or irrelevant peptide control. Degranulation response is analyzed by CD107a surface staining and analyzed by FACS.

[0107] After expansion, the engineered T cells can be assayed to determine the percentage of viable T cells and / or to represent T cells expressing a heterologous TCR or CAR. In some embodiments, the engineered T cells are formulated in an appropriate medium or solution (e.g., PLASMA-LYTE™, optionally with 5% human serum albumin) at a concentration twice that at which they are administered to the recipient subject. The concentration administered to the recipient subject is approximately 5×10 6 cells / mL ~ approx. 1×10 7 The engineered T cells may be 100% DMSO (i.e., 5% final concentration) in cryogenic medium. The 1× engineered T cells in cryogenic medium can be transferred to a cryogenic compatible infusion bag and cryopreserved. The engineered T cells can be cryopreserved using methods available in the art for cryopreservation of T cells or CAR T cells. Using the methods described, the expanded engineered T cells are expressed as CD8 +After activation, the T cells may be cryopreserved on one or more of days 8, 9, 10, 11, 12, 13, 14, or 15. In some embodiments, the engineered T cells are cryopreserved in CS10 medium. In some embodiments, the cells are cryopreserved in a control rate freezer (CRF).

[0108] In some embodiments, the engineered T cells are generated, expanded, and cryopreserved within about 9 to about 15 days of collection of the apheresis product or harvesting of the PBMCs from the donor subject. In some embodiments, the engineered T cells are generated, expanded, and cryopreserved within about 9, about 10, about 11, about 12, about 13, about 14, or about 15 days of collection of the apheresis product or harvesting of the PBMCs from the donor subject.

[0109] The engineered T cells may be cryopreserved (e.g., in an infusion bag) in a single dose suitable for administration to the intended recipient subject. In some embodiments, the engineered T cells are formulated in a format ready for infusion. A single dose of engineered T cells is approximately 1×10 per kg of recipient. 4 ~Approx. 3×10 6 The engineered T cells may be 10 ... v = w × x ÷ [y × % viable cells × % viable cells expressing heterologous TCR or CAR] Where: v = volume T cells (in mL) w = recipient weight (in kg) x=dose (T cells / kg) y=concentration T cells (number of cells / mL)

[0110] Optionally, at least two doses are packaged in separate infusion bags for each intended recipient subject. The at least two doses can be a dose and a replacement dose, a first dose and at least one second dose, or a first dose, at least one second dose, and a replacement dose.

[0111] In some embodiments, isolating T cells (e.g., CD8+ T cells), knocking out the endogenous TCR, and inserting a nucleic acid encoding a heterologous TCR or CAR is performed within 36-72 hours of the collected apheresis product. In some embodiments, isolating T cells (e.g., CD8+ T cells), knocking out the endogenous TCR, and inserting a nucleic acid encoding a heterologous TCR or CAR is performed within 24-48 hours of the collected apheresis product. In some embodiments, a nucleic acid encoding a heterologous TCR or CAR is inserted into the CD8+ T cells within about 24 hours of knocking out the endogenous TCR.

[0112] In some embodiments, the engineered T cells generally have a stem cell-like phenotype. In some embodiments, the thawed engineered T cells generally have a central memory (Tcm) T cell, effector memory (Tem) T cell, or stem memory (Tscm) T cell phenotype. In some embodiments, about 10% to about 90% of the engineered T cells have a stem cell-like phenotype. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, or at least 50%, at least 60%, at least 70%, or at least 80% of the engineered T cells have a stem cell-like phenotype. In some embodiments, the engineered T cells generally have a central memory (Tcm) T cell, effector memory (Tem) T cell, or stem memory (Tscm) T cell phenotype. In some embodiments, about 10% to about 90% of the engineered T cells have a Tcm, Tem, or Tscm phenotype. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, or at least 50%, at least 60%, at least 70%, or at least 80% of the engineered T cells have a Tcm, Tem, or Tscm phenotype. In some embodiments, at least 50% of the engineered T cells have a stem cell-like phenotype. In some embodiments, more than 50% of the engineered T cells have a Tcm, Tem, or Tscm phenotype. In some embodiments, at least 50% of the cryopreserved engineered T cells have a stem cell-like phenotype after thawing. In some embodiments, more than 50% of the cryopreserved engineered T cells have a Tcm, Tem, or Tscm phenotype after thawing.

[0113] In some embodiments, engineered T cells are analyzed for their ability to lyse cells presenting the target antigen using a killing assay. Engineered T cells are incubated with a mixture of fluorescently tagged cells (e.g., T2 cells) differentially loaded with target and control peptides to allow for on-target and off-target cytotoxicity. Fluorescently labeled cells are loaded with target miHA antigen (e.g., HA-1 "H" peptide) or non-target miHA antigen (e.g., HA-1 "R" peptide) or an irrelevant peptide control. Cell killing is analyzed by FACS. For example, for engineered T cells expressing an anti-HA-1 "H" antigen TCR, target cells are incubated with a mixture of fluorescently tagged cells (e.g., T2 cells) loaded with target HA-1 "H" peptide (e.g., HA-1 "R" peptide) or an irrelevant peptide control. Cell killing is analyzed by FACS. For example, for engineered T cells expressing an anti-HA-1 "H" antigen TCR, target cells are incubated with T2 cells (e.g., T2 cells) loaded with target HA-1 "H" peptide (e.g., HA-1 "R" peptide) or an irrelevant peptide control. - / HLA-A*:02:01 + As a control, T2 cells are loaded with the non-targeting HA-1 "R" peptide or an irrelevant peptide control. T cell IL-2 and IFN-γ responses are followed by intracellular cytokine staining and analysis by FACS.

[0114] The engineered T cells kill (are cytotoxic to) cells that express the antigen recognized by the xenogeneic TCR or CAR. In some embodiments, the engineered T cells are cytotoxic to cells that express both the target antigen and the cognate HLA for the target antigen.

[0115] In some embodiments, the engineered T cells kill (are cytotoxic to the cells) cells expressing the antigen recognized by the heterologous TCR or CAR at an effector (T cell): target (antigen-expressing cell) ratio of about 1:1. In some embodiments, the engineered T cells kill (are cytotoxic to the cells) cells expressing the antigen recognized by the heterologous TCR or CAR at an effector (T cell): target (antigen-expressing cell) ratio of less than 1:1. In some embodiments, the engineered T cells kill (are cytotoxic to the cells) cells expressing the antigen recognized by the heterologous TCR or CAR at an effector (T cell): target (antigen-expressing cell) ratio of 0.5:1 or less. In some embodiments, the engineered T cells kill (are cytotoxic to the cells) cells expressing the antigen recognized by the heterologous TCR or CAR at an effector (T cell): target (antigen-expressing cell) ratio of about 0.1:1 or less. In some embodiments, the engineered T cells kill (are cytotoxic to) cells expressing an antigen recognized by the heterologous TCR or CAR at an effector:target ratio of less than 0.1:1, less than 0.2:1, less than 0.3:1, less than 0.4:1, less than 0.5:1, or less than 1:1. In some embodiments, the engineered T cells maintain at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of their cytolytic capacity for at least 20 days. In some embodiments, the engineered T cells maintain at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of their cytolytic capacity after restimulation.

[0116] In some embodiments, the thawed cryopreserved engineered T cells kill (are cytotoxic to the cells) cells expressing an antigen recognized by a heterologous TCR or CAR at an effector:target ratio of about 1:1. In some embodiments, the thawed cryopreserved engineered T cells kill (are cytotoxic to the cells) cells expressing an antigen recognized by a heterologous TCR or CAR at an effector:target ratio of less than 1:1. In some embodiments, the thawed cryopreserved engineered T cells kill (are cytotoxic to the cells) cells expressing an antigen recognized by a heterologous TCR or CAR at an effector:target ratio of less than 0.5:1. In some embodiments, the thawed cryopreserved engineered T cells kill (are cytotoxic to the cells) cells expressing an antigen recognized by a heterologous TCR or CAR at an effector:target ratio of about 0.1:1 or less. In some embodiments, the thawed cryopreserved engineered T cells kill (are cytotoxic to) cells expressing an antigen recognized by the xenogeneic TCR or CAR at an effector:target ratio of less than 0.1:1, less than 0.2:1, less than 0.3:1, less than 0.4:1, less than 0.5:1, or less than 1:1. In some embodiments, the thawed cryopreserved engineered T cells maintain at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of their cytolytic power for at least an additional 20 days after thawing.

[0117] In some embodiments, engineered T cells generated using the described methods have improved effector / target ratios in killing assays. Such killing assays include incubating target cells with various ratios of effector cells (T cells) and determining the ratio of effector cells required to kill the target cells. Extended life span can be measured by analyzing cytotoxicity at various time points. In some embodiments, engineered T cells generated using the described methods maintain high levels of cytotoxicity over time and multiple exposures (restimulation) to target cells. In some embodiments, engineered T cells maintain at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of their cytolytic power over a period of at least 20 days and at least 3 exposures to target cells. In some embodiments, engineered T cells maintain at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of their cytolytic power over a period of at least 20 days and at least 3 exposures to target cells.

[0118] III. TCR or CAR The xenogeneic TCR may be, but is not limited to, an αβ TCR or an antigen-binding fragment thereof, or a γδ TCR or an antigen-binding fragment thereof, hi some embodiments, the TCR is an allogeneic TCR.

[0119] The CAR can be, but is not limited to, a first generation CAR (a CAR with a single signaling domain, such as a CD3ζ signaling domain), a second generation CAR (a CAR with a costimulatory domain), a third generation CAR (a CAR with multiple costimulatory domains), a fourth generation CAR (TRUCK or armored CAR), or a dual antigen receptor CAR.

[0120] In some embodiments, a TCR is a molecule containing an alpha chain comprising a Vα region and a beta chain comprising a Vβ region (also known as TCRα and TCRβ, respectively), or a gamma chain comprising a Vγ region and a delta chain comprising a δ, Vδ region (also known as TCRγ and TCR, respectively), or an antigen-binding portion thereof, which can specifically bind to an antigen, e.g., a peptide antigen or peptide epitope bound to an MHC molecule. In some embodiments, the TCR is in an αβ form (e.g., an αβ TCR). In some embodiments, the TCR is in a γδ form (e.g., a γδ TCR). Typically, TCRs present in an αβ or γδ form are generally structurally similar, although T cells expressing them may have distinct anatomical locations or functions. In general, TCRs are found on the surface of T cells and are generally involved in recognizing antigens, such as peptides bound to MHC molecules.

[0121] In some embodiments, the TCR is an intact or full-length TCR, such as a TCR containing a full-length α chain and a full-length β chain, or a TCR containing a full-length γ chain and a full-length δ chain. In some embodiments, the antigen-binding portion of the TCR is smaller than the full-length TCR, provided that it binds to a specific peptide bound to an MHC molecule, such as binding to an MHC-peptide complex. In some embodiments, the antigen-binding portion or fragment of the TCR may contain only a portion of the structural domain of the full-length or intact TCR, but still be able to bind to a peptide epitope, such as an MHC-peptide complex to which the full-length TCR binds. In some cases, the antigen-binding portion contains a variable domain of the TCR, such as the Vα and Vβ regions of the TCR, or the Vγ and Vδ regions of the TCRs provided herein, provided that the antigen-binding portion is sufficient to form a binding site for binding to a specific MHC-peptide complex.

[0122] The xenogeneic TCR may be derived from T cells isolated from an autologous subject or a donor subject. In some embodiments, the xenogeneic TCR is derived from tumor-infiltrating T cells from an autologous subject.

[0123] The heterologous TCR or CAR can be, but is not limited to, an anti-miHA antigen TCR or CAR, an anti-miHA HA-1 TCR or CAR, an anti-viral antigen TCR or CAR, or an anti-tumor neoantigen TCR or CAR. In some embodiments, the engineered T cells express a heterologous TCR or CAR against miHA that is relatively restricted to hematopoietic cells.

[0124] In some embodiments, the TCR or antigen-binding fragment thereof recognizes a peptide epitope of the minor histocompatibility antigen (miHA) HA-1 in the context of an MHC molecule. In some embodiments, the MHC molecule is a human leukocyte antigen (HLA)-A molecule. In some embodiments, the HLA-A molecule is a molecule of serotype HLA-A*02:01. In some embodiments, the HLA-A molecule is a molecule of serotype HLA-A*02:06. In some embodiments, the peptide epitope of HA-1 is VLHDDLLEA or VLRDDLLEA.

[0125] IV. Nucleic acid sequences Xenogeneic TCR, and optionally CD8 + A lentiviral vector carrying an expression cassette for the expression of a marker in T cells is described. The lentiviral vector described expresses a marker for CD8 + Used to transduce T cells and express heterologous TCR. Also provided is a plasmid for producing such vector. Lentiviral vector can be a third generation, replication-incompetent and self-inactivating vector.

[0126] In some embodiments, the expression cassette encoding the TCR comprises a nucleic acid sequence encoding an alpha (α) chain and a beta (β) chain or a gamma (γ) chain and a delta (δ) chain. The nucleic acid encoding the α (or γ) chain and the nucleic acid encoding the β (or δ) chain can be expressed from separate promoters or a single promoter. The nucleic acid encoding the α (γ) chain and the nucleic acid encoding the β (or δ) chain can be expressed from a single promoter. In some embodiments, the nucleotide sequence encoding the TCR α (or γ) chain and the nucleotide sequence encoding the TCR β (or δ) chain are separated by a nucleic acid sequence encoding a peptide sequence that causes ribosome skipping. The peptide sequence that causes ribosome skipping can be a 2A peptide. The 2A element can be, but is not limited to, a P2A peptide or a T2A peptide. In some embodiments, the nucleotide sequence encoding the TCR α (or γ) chain and the nucleotide sequence encoding the TCR β (or δ) chain are separated by an internal ribosome entry site (IRES).

[0127] In some embodiments, a vector encoding a TCR expression cassette contains a single promoter that drives expression of one or more nucleotide sequences encoding one or more polypeptides. In some embodiments, such vectors may be multicistronic (e.g., bicistronic or tricistronic, see, e.g., U.S. Pat. No. 6,060,273). For example, in some embodiments, a transcription unit may be engineered as a bicistronic unit containing an IRES that allows for co-expression of gene products (e.g., encoding the alpha and beta chains of the TCR) by messages from a single promoter. Alternatively, in some cases, a single promoter may direct expression of an RNA that contains two or three genes (e.g., encoding the alpha and beta chains of the TCR) in a single open reading frame (ORF) separated from each other by sequences encoding a self-cleaving peptide (e.g., 2A peptide) or a protease recognition site (e.g., furin). Thus, the ORF encodes a single polyprotein that is cleaved into individual proteins either during or after translation. In some cases, peptides such as 2A peptides can cause the ribosome to skip synthesis of the peptide bond at the C-terminus of the 2A element (ribosome skipping), resulting in separation between the end of the 2A sequence and the next downstream peptide (see, e.g., de Felipe. Genetic Vaccines and Ther. 2:13 (2004) and deFelipe et al. Traffic 5:616-626 (2004)). Examples of 2A truncation peptides, including those that can induce ribosome skipping, are 2A sequences from Thosea asigna virus (T2A), porcine teschovirus-1 (P2A), equine rhinitis A virus (E2A), and foot and mouth disease virus (F2A), as described in U.S. Patent Publication No. 2007 / 0116690.

[0128] In some embodiments, the nucleic acid sequence encoding the α or γ chain and the nucleotide sequence encoding the β or δ chain are present in any order, separated by the nucleotide sequence encoding the peptide sequence that causes ribosome skipping.For example, in some embodiments, the nucleotide sequence comprises the nucleic acid sequence encoding the β or δ chain, the nucleic acid sequence encoding the peptide sequence that causes ribosome skipping, such as the P2A sequence, and the nucleic acid sequence encoding the α or γ chain, in that order.In other embodiments, the nucleotide sequence contains the nucleic acid sequence encoding the α or γ chain, the nucleic acid sequence encoding the peptide sequence that causes ribosome skipping, such as the P2A sequence, and the nucleic acid sequence encoding the β or δ chain, in that order.

[0129] In some embodiments, the nucleic acid encoding the heterologous TCR or CAR is codon optimized.

[0130] A diagram showing exemplary TCR expression cassettes is shown in Figures 1A and 1B.

[0131] The promoter is CD8 + The promoter may be any promoter that is active in T cells. In some embodiments, the promoter is a constitutively active promoter. The promoter may be, but is not limited to, MNDU3 promoter, EF-1 alpha promoter, CMV promoter, Igκ promoter, mPGK, SV40 promoter, β-actin promoter (such as but not limited to human or chicken β-actin promoter), α-actin promoter, SRα promoter, herpes thymidine kinase promoter, herpes simplex virus (HSV) promoter, mouse mammary tumor virus long terminal repeat (LTR) promoter, adenovirus major late promoter (Ad MLP), or Rous sarcoma virus (RSV) promoter. In some embodiments, the promoter is MNDU3 promoter. In some embodiments, the promoter is EF-1 alpha promoter. In some embodiments, the promoter further comprises a Kozak sequence.

[0132] The construct in Figure 1 shows the TCR β chain in front of the TCR α chain, however the positions of the TCR β and TCR α chains can be switched.

[0133] 2A encodes a self-cleaving peptide. Each 2A peptide is independently selected from the group consisting of P2A, T2A, E2A and F2A. In some embodiments, the two 2A peptides are different (e.g., P2A and T2A). A linker, such as a GSG linker, can be inserted before and / or after each 2A element.

[0134] The marker is optional and, if present, encodes a detection marker and / or a removal marker or a combined detection / removal marker. In some embodiments, the detection / removal marker comprises RQR8.

[0135] The expression cassette may have a single stop codon, a pair or stop codons, or three stop codons (STOP in FIG. 1). If there are three stop codons, the three stop codons may be arranged such that there is a stop codon in each of the three forward reading frames.

[0136] The PRE comprises a post-transcriptional response element. The PRE can be, but is not limited to, a Woodchuck Hepatitis Virus Post-transcriptional Regulatory Element (WPRE).

[0137] In some embodiments, the plasmid for generating lentiviral vector is described.Such plasmid contains the heterologous TCR expression cassette described above.The plasmid for generating lentiviral vector further comprises one or more elements for packaging heterologous TCR expression cassette into lentiviral vector.

[0138] In some embodiments, such plasmids contain an RSV-LTR / HIV LTR element located 5' to the promoter and a Δ3' LTR element located 3' to the PRE. The Δ3'LTR contains a 3'LTR that has been modified to form a self-inactivating vector, to abolish the promoter / enhancer activity of the LTR, and to reduce the possibility of site-specific mutagenesis upon integration. The RSV-LTR / HIV LTR and 3'ΔLTR are expressed in the CD8 + The incorporation of the expression construct into T cells can be facilitated.

[0139] In some embodiments, the plasmid further comprises a central polypurine tract / central termination sequence (cPPT / CTS) element located 5' of the promoter, which can increase nuclear import of the viral genome during T cell transduction with the viral vector and / or improve lentiviral infection of human hematopoietic primary cells.

[0140] In some embodiments, four-plasmid transfection is used to produce self-inactivating (replication-incompetent) lentiviral vectors for use in transducing T cells with nucleic acid encoding a heterologous TCR.

[0141] Table 1 lists the elements in an exemplary lentiviral plasmid, including the location and size of each element.

[0142] [Table 1]

[0143] Nucleic acids encoding anti-HA-1 "H" epitope TCRs (anti-HA-1 TCRs) are also described. In some embodiments, the nucleic acid comprises a sequence encoding SEQ ID NO:20 or SEQ ID NO:22. In some embodiments, the nucleic acid comprises a sequence having at least 75% identity to SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, or SEQ ID NO:24 and encoding the amino acid sequence of SEQ ID NO:20 or SEQ ID NO:22, or a sequence comprising SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, or SEQ ID NO:24. In some embodiments, the nucleic acid comprises a sequence of SEQ ID NO:7 or SEQ ID NO:11. In some embodiments, the nucleic acid comprises a sequence of SEQ ID NO:13 or SEQ ID NO:17.

[0144] Nucleic acids encoding anti-HA-2 "V" epitope TCRs (anti-HA-2 TCRs) are also described. In some embodiments, an exemplary nucleic acid encoding an anti-HA-2 "V" epitope TCR is an alpha variable region having the amino acid sequence of SEQ ID NO:25, and a beta variable region having the amino acid sequence of SEQ ID NO:27; an alpha variable region having the amino acid sequence of SEQ ID NO:29, and a beta variable region having the amino acid sequence of SEQ ID NO:31; an alpha variable region having the amino acid sequence of SEQ ID NO: 33, and a beta variable region having the amino acid sequence of SEQ ID NO: 35; an alpha variable region having the amino acid sequence of SEQ ID NO:37, and a beta variable region having the amino acid sequence of SEQ ID NO:39; an alpha variable region having the amino acid sequence of SEQ ID NO: 41, and a beta variable region having the amino acid sequence of SEQ ID NO: 43; an alpha variable region having the amino acid sequence of SEQ ID NO: 45, and a beta variable region having the amino acid sequence of SEQ ID NO: 47; an alpha variable region having the amino acid sequence of SEQ ID NO:49, and a beta variable region having the amino acid sequence of SEQ ID NO:51; an alpha variable region having the amino acid sequence of SEQ ID NO:53, and a beta variable region having the amino acid sequence of SEQ ID NO:55; an alpha variable region having the amino acid sequence of SEQ ID NO:57, and a beta variable region having the amino acid sequence of SEQ ID NO:59; an alpha variable region having the amino acid sequence of SEQ ID NO:61, and a beta variable region having the amino acid sequence of SEQ ID NO:63; an alpha variable region having the amino acid sequence of SEQ ID NO:65, and a beta variable region having the amino acid sequence of SEQ ID NO:67; an alpha variable region having the amino acid sequence of SEQ ID NO:69, and a beta variable region having the amino acid sequence of SEQ ID NO:71; an alpha variable region having the amino acid sequence of SEQ ID NO: 73, and a beta variable region having the amino acid sequence of SEQ ID NO: 75; an alpha variable region having the amino acid sequence of SEQ ID NO: 77, and a beta variable region having the amino acid sequence of SEQ ID NO: 79; an alpha variable region having the amino acid sequence of SEQ ID NO: 81, and a beta variable region having the amino acid sequence of SEQ ID NO: 83; or The nucleic acids encoding the alpha variable region having the amino acid sequence of SEQ ID NO:85 and the beta variable region having the amino acid sequence of SEQ ID NO:87 are included.

[0145] In some embodiments, the nucleic acid sequences encoding the alpha and beta regions of the anti-HA-2 TCR are provided on a single vector or expression cassette and expressed from a single promoter. In some embodiments, the alpha and beta TCR chains are encoded on a single transcript and separated by a 2A element (e.g., a p2A or T2A element).

[0146] In some embodiments, an exemplary nucleic acid encoding an anti-HA-2 "V" epitope TCR is an alpha chain having the amino acid sequence of SEQ ID NO:26, and a beta chain having the amino acid sequence of SEQ ID NO:28; an alpha chain having the amino acid sequence of SEQ ID NO: 30, and a beta chain having the amino acid sequence of SEQ ID NO: 32; an alpha chain having the amino acid sequence of SEQ ID NO: 34, and a beta chain having the amino acid sequence of SEQ ID NO: 36; an alpha chain having the amino acid sequence of SEQ ID NO: 38, and a beta chain having the amino acid sequence of SEQ ID NO: 40; an alpha chain having the amino acid sequence of SEQ ID NO: 42, and a beta chain having the amino acid sequence of SEQ ID NO: 44; an alpha chain having the amino acid sequence of SEQ ID NO: 46, and a beta chain having the amino acid sequence of SEQ ID NO: 48; an alpha chain having the amino acid sequence of SEQ ID NO: 50, and a beta chain having the amino acid sequence of SEQ ID NO: 52; an alpha chain having the amino acid sequence of SEQ ID NO: 54, and a beta chain having the amino acid sequence of SEQ ID NO: 56; an alpha chain having the amino acid sequence of SEQ ID NO:58, and a beta chain having the amino acid sequence of SEQ ID NO:60; an alpha chain having the amino acid sequence of SEQ ID NO: 62, and a beta chain having the amino acid sequence of SEQ ID NO: 64; an alpha chain having the amino acid sequence of SEQ ID NO: 66, and a beta chain having the amino acid sequence of SEQ ID NO: 68; an alpha chain having the amino acid sequence of SEQ ID NO: 70, and a beta chain having the amino acid sequence of SEQ ID NO: 72; an alpha chain having the amino acid sequence of SEQ ID NO: 74, and a beta chain having the amino acid sequence of SEQ ID NO: 76; an alpha chain having the amino acid sequence of SEQ ID NO: 78, and a beta chain having the amino acid sequence of SEQ ID NO: 80; an alpha chain having the amino acid sequence of SEQ ID NO: 82 and a beta chain having the amino acid sequence of SEQ ID NO: 84, or The nucleic acids encoding the alpha chain having the amino acid sequence of SEQ ID NO:86 and the beta chain having the amino acid sequence of SEQ ID NO:88 are included.

[0147] In some embodiments, the nucleic acid sequences encoding the alpha and beta chains of the anti-HA-2 TCR are provided on a single vector or expression cassette and expressed from a single promoter. In some embodiments, the alpha and beta TCR chains are encoded on a single transcript and separated by a 2A element (e.g., a p2A or T2A element).

[0148] Also described are lentiviral vectors suitable for use in transducing T cells to insert a nucleic acid encoding a heterologous anti-HA-1 TCR. In some embodiments, the lentiviral vector comprises a nucleic acid sequence encoding SEQ ID NO:20 or SEQ ID NO:22, a nucleic acid sequence having at least 75% identity to SEQ ID NO:19, SEQ ID NO:21, or SEQ ID NO:23 and encoding the amino acid sequence of SEQ ID NO:20 or SEQ ID NO:22, or a nucleic acid sequence comprising SEQ ID NO:19, SEQ ID NO:21, or SEQ ID NO:23.

[0149] Also described are lentiviral vectors suitable for use in transducing T cells to insert a nucleic acid encoding a heterologous anti-HA-2 TCR. Lentiviral vectors suitable for transducing T cells to insert a nucleic acid encoding a heterologous anti-HA-2 TCR may comprise a nucleic acid sequence encoding any of those described in Table 2.

[0150] [Table 2]

[0151] V. How to use Described is an allogeneic ex vivo engineered TCR cell therapy that is individualized.The engineered T cells produced using the described method can be used in an allogeneic ex vivo engineered TCR cell therapy that is individualized.The engineered T cells are HLA-matched, indicating that they are derived from a donor that is HLA-matched to the recipient subject.

[0152] The engineered T cells can be used to provide immune response to the recipient subject, treat cancer, induce immune response against cancer, kill cancer cells in the recipient subject, reduce tumor burden in the recipient subject, reduce the growth of cancer cells in the recipient subject, or treat infection.The engineered T cells can be administered to the recipient subject to kill the cells of the recipient subject that express the antigen recognized by the heterologous TCR or CAR.The engineered T cells kill the cells that are homozygous or heterozygous to the antigen recognized by the heterologous TCR or CAR, but do not express the antigen recognized by the heterologous TCR or CAR.

[0153] The engineered T cells described are made using T cells from a donor subject that is HLA-matched to the recipient subject but does not express the antigen recognized by the xenogeneic TCR or CAR expressed by the engineered T cells. The recipient subject is HLA-matched to the donor subject and expresses the antigen recognized by the xenogeneic TCR or CAR expressed by the engineered T cells. The recipient subject can be homozygous or heterozygous for the gene encoding / expressing the antigen. In some embodiments, the donor subject is HLA 10 / 10-matched to the recipient subject. In some embodiments, the donor subject is a related donor that is HLA 10 / 10-matched to the recipient subject. In some embodiments, the donor subject is an unrelated donor that is HLA 10 / 10-matched to the recipient subject. In some embodiments, the donor subject is HLA 11 / 12-matched to the recipient subject. In some embodiments, the donor subject is a related donor that is HLA 11 / 12-matched to the recipient subject. In some embodiments, the donor subject is an unrelated donor that is HLA 11 / 12 matched to the recipient subject. In some embodiments, the donor subject is HLA 12 / 12 matched to the recipient subject. In some embodiments, the donor subject is a related donor that is HLA 12 / 12 matched to the recipient subject. In some embodiments, the donor subject is an unrelated donor that is HLA 11 / 12 matched to the recipient subject.

[0154] The engineered T cells produced using the described methods can be used in combination with one or more additional therapies. In some embodiments, the engineered T cells are administered to a recipient subject in combination with allogeneic hematopoietic stem cell transplantation (allo-SCT). In some embodiments, the engineered T cells are used in combination with CD34-selected allo-SCT. The engineered T cells described can be used to increase the efficacy of allo-SCT, increase the number of patients eligible for allo-SCT, increase the graft-versus-leukemia effect in recipient subjects undergoing allo-SCT, and / or reduce graft-versus-host disease in recipient subjects undergoing allo-SCT.

[0155] Allogeneic SCT involves the transfer of stem cells (grafts) from a healthy individual (donor) into the patient's body, typically after a conditioning regimen. Allogeneic SCT (also called hematopoietic cell transplantation (HCT)) can be used to treat hematopoietic disorders, including leukemia and myelodysplastic syndromes (MDS). In HLA-matched allogeneic SCT, alloreactive donor T cells target minor histocompatibility antigens (miHAs). MiHAs are peptide products of coding polymorphisms that distinguish the recipient from the donor. In standard hematopoietic cell transplantation (HCT), these miHA-reactive T cells can target leukemic cells and mediate the graft-versus-leukemia (GVL) effect. However, donor T cells can also cause graft-versus-host disease (GVHD). Mature αβ T cells contained in donor allografts can be considered in two broad classes. One class promotes the reconstitution of anti-pathogen immunity, particularly via the transfer of memory T cells. A second class of T cells, called alloreactive T cells, recognize the patient as non-self. When alloreactive SCT is used to treat hematologic malignancies, alloreactive donor T cells can kill malignant cells, thereby mediating the GVL effect. However, they can also cause GVHD, in which alloreactive T cells attack nonmalignant host tissues, including the skin, gut, and liver. Although alloreactive SCT can be a curative therapy for patients with hematologic malignancies, post-transplant relapse remains the largest single cause of post-transplant death, occurring in up to 80% of high-risk patients. Alloreactive SCT can also be used for nonmalignant but medically severe conditions, such as hemoglobinopathies, thalassemias, and autoimmune diseases. Alloreactive SCT can also be used to create tolerance to transplanted parenchymal organs.

[0156] The described method utilizes the described engineered T cells to target malignant cells in a recipient subject. The described engineered T cells mediate GVL while reducing the risk of GVHD compared to polyclonal donor T cells.

[0157] In some embodiments, the same donor subject is used as a source of apheresis product or PBMCs for use in manufacturing engineered T cells and as a source of allogeneic SCT graft. The donor subject can undergo a single apheresis to collect the apheresis product or PBMCs, and the graft or donor subject can undergo a first apheresis to collect the apheresis product or PBMCs and a second apheresis to provide the graft. In some embodiments, the donor subject is administered a mobilization agent prior to apheresis. In some embodiments, the donor subject is not administered a mobilization agent prior to apheresis. Mobilization is a process in which certain drugs (mobilization agents) are used to cause the movement of stem cells from the bone marrow to the blood of the donor subject. A "mobilization agent" stimulates the bone marrow to increase the number of granulocytes and stem cells (e.g., CD34 + The hematopoietic stem cell (hematopoietic stem cell) is produced and released into the bloodstream. The mobilizing agent is administered to the subject before blood collection (e.g., apheresis or leukapheresis) to increase the number of hematopoietic stem cells in the donor's blood before blood collection. The mobilizing agent can be, but is not limited to, granulocyte colony-stimulating factor (G-CSF), G-CSF+CXCR4 antagonist (e.g., plerixafor or YF-H-2015005), G-CSF+cytarabine, or G-CSF+cyclophosphamide.

[0158] In some embodiments, a donor subject undergoes a first apheresis to provide an apheresis product or PBMCs and a second apheresis to provide a graft, where the donor subject is not administered a mobilization agent prior to the first apheresis and is administered a mobilization agent prior to the second apheresis. The first apheresis can be a low-volume apheresis. The second apheresis can be performed about 7 to about 14 days after the first apheresis. In some embodiments, the second apheresis is a G-CSF mobilized apheresis.

[0159] In some embodiments, the allogeneic SCT graft is a CD34-selected allogeneic SCT graft. +Selection removes donor T cells from peripheral blood grafts. CD34 selection removes donor T cells from peripheral blood grafts. + In addition to reducing GVHD, the grafts were enriched in CD34 cells. + Selection provides for administration of engineered T cells at the nadir of the recipient lymphocyte population. By administering the engineered T cells in combination with a CD34-selected graft and by administering the engineered T cells on the same day as the CD34-selected graft, the engineered T cells can be expanded and propagated in the absence of competition from donor or recipient T cells or leukemia cells.

[0160] Positive CD34 + Selection can deplete T cells from the graft. + Selection can be performed using methods available in the art, including, but not limited to, ISOLEX 300i, CliniMACS CD34 Reagent System, and αβ+ TCR / CD19 depletion. + Selection can result in a 4-5 log reduction in T cells in the final graft. In some embodiments, the grafts are 6 For a graft dose of cells / kg, the graft contains less than 50,000, less than 25,000, less than 10,000, or less than 5,000 T cells / kg. In some embodiments, the graft contains less than 1% T cells. CD34 + The selection is performed prior to administration of the graft to the recipient subject.

[0161] In some embodiments, the allogeneic SCT graft and engineered T cells are administered to the recipient subject in the absence of prophylactic immunosuppressive therapy targeting graft-versus-host disease (GVHD, e.g., acute GVHD) or immune activity of T cells. In other words, it is intended that the allogeneic SCT graft and engineered T cells are administered to the recipient subject without administering any immunosuppressive therapy targeting GVHD or suppressing immune activity of T cells before the observation of any symptoms of GVHC or GVHD in the recipient subject. In some embodiments, no immunosuppressive therapy targeting GVHD is administered prophylactically to the recipient subject before, simultaneously with, or after administration of the allogeneic SCT. In some embodiments, no immunosuppressive therapy targeting GVHD is administered prophylactically to the recipient subject before administration of the allogeneic SCT. In some embodiments, no immunosuppressive therapy targeting GVHD is administered prophylactically to the recipient subject simultaneously with administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject following administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject prior to or concurrently with administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject prior to or concurrently with administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject concurrently or subsequent to administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject from about 1 week prior to administration of the allogeneic SCT until at least 1 week after administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject from about 1 week prior to administration of the allogeneic SCT until at least 2 weeks after administration of the allogeneic SCT. In some embodiments, immunosuppressive therapy targeted to GVHD is not administered prophylactically to the recipient subject from about 1 week prior to administration of the allogeneic SCT until about 4 weeks after administration of the allogeneic SCT.In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject from about 1 week prior to administration of the allogeneic SCT until about 3 weeks after administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject from about 1 week prior to administration of the allogeneic SCT until about 2 weeks after administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject for at least 1 week after administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject for at least 2 weeks after administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject for at least 3 weeks after administration of the allogeneic SCT. In some embodiments, the GVHD-targeted immunosuppressive therapy is not administered prophylactically to the recipient subject for at least 4 weeks after administration of the allogeneic SCT. Immunosuppressive therapy targeting GVHD can be administered to the recipient subject after administration of allogeneic SCT if the recipient subject shows one or more symptoms of GVHD. Prophylactic immunosuppression is typically administered to the recipient subject undergoing allogeneic SCT. However, the need for prophylactic immunosuppression can be reduced or eliminated by selecting a donor that is 10 / 10 (related) or 11-12 / 12 (unrelated) HLA-matched to the recipient, selecting a donor that does not contain miHA antigens present in the recipient, and administering CD34-selected graft and engineered T cells that express TCR specific to the recipient's miHA antigen together on day 1.Immunosuppressants that target GVHD or inhibit T cell activation or proliferation include, but are not limited to, abatacept, antithymocyte globulin (ATG), alemtuzumab, T cell depleting antibody preparations, corticosteroids (e.g., methylprednisolone, prednisone, dexamethasone, beclomethasone, or budesonide), cyclophosphamide, cyclosporine, methotrexate, mycophenolate mofetil, sirolimus, tacrolimus, calcineurin inhibitors, kinase inhibitors, antiproliferative agents such as mycophenolic acid or alkylating agents, and anti-cytokine biologics.

[0162] One or more agents that suppress cytokine release syndrome can be administered to the recipient subject.The agent that suppresses cytokine release syndrome can be administered to the recipient subject as needed or prophylactically.The drug that suppresses cytokine release syndrome includes, but is not limited to, anti-IL-6 therapy, tocilizumab, sarilumab, anakinra, siltuximab, and corticosteroids.

[0163] A method of treating a recipient subject suffering from a hematological malignancy is described, comprising administering an effective dose of engineered T cells to the recipient subject within 5 days of administering an allogeneic stem cell transplant (allo-SCT), wherein an immunosuppressant targeting GVHD is prophylactically administered to the recipient subject to suppress immune activity of the T cells. The allogeneic SCT can be administered using a CD34-selected allogeneic SCT graft. In some embodiments, an effective dose of engineered T cells is administered to the recipient subject within 4 days of the allogeneic SCT. In some embodiments, an effective dose of engineered T cells is administered to the recipient subject within 3 days of the allogeneic SCT. In some embodiments, an effective dose of engineered T cells is administered to the recipient subject within 2 days of the allogeneic SCT. In some embodiments, an effective dose of engineered T cells is administered to the recipient subject within 72 hours of the allogeneic SCT. In some embodiments, the engineered T cells are administered to the recipient subject within 48 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 24 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 18 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 12 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 6 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. Administration of the described engineered T cells to a recipient subject undergoing allogeneic SCT reduces or eliminates the need to administer prophylactic immunosuppressive therapy to the recipient subject to prevent GVHD.

[0164] In some embodiments, the engineered T cells are administered to the recipient subject within one day (e.g., within 24 hours) of allogeneic SCT. In some embodiments, the engineered T cells are administered to the recipient subject on the same day as allogeneic SCT. In some embodiments, the engineered T cells are administered to the recipient subject after allogeneic SCT and on the same day as allogeneic SCT. Without wishing to be bound by theory, the simultaneous administration of the engineered T cells and administration of the graft allows the engineered T cells to grow and proliferate within the exhausted immune system of the recipient subject (e.g., in the absence of significant leukemia cell proliferation or T cell proliferation from the graft), thus allowing the engineered T cells to integrate with the developing immune system. In contrast, when the engineered T cells are administered to the recipient subject 2-4 weeks after allogeneic SCT, as is typically done, the engineered T cells must compete with proliferating residual host cells, proliferating leukemia cells, and / or proliferating allogeneic SCT cells.

[0165] In some embodiments, the recipient subject undergoes a conditioning regimen prior to allogeneic SCT. The conditioning regimen includes chemotherapy that kills the recipient subject's immune cells (including leukemia cells) and creates space in the recipient's bone marrow for donor stem cell engraftment. The conditioning regimen is a pre-transplant treatment that provides immune ablation to prevent graft rejection and reduce tumor burden. The conditioning regimen can be a high-dose (myeloablative), reduced-intensity, or non-myeloablative regimen. A high-dose regimen consisting of an alkylating agent (single or multiple) with or without total body irradiation is expected to ablate myelopoiesis. A high-dose regimen is not expected to allow autologous hematologic recovery. Exemplary high-dose regimens include, but are not limited to, TBI+cyclophosphamide, busulfan+cyclophosphamide, and busulfan+melphalan. A reduced-intensity regimen is a regimen that does not fit the definition of myeloablative or non-myeloablative conditioning. Reduced intensity regimens potentially result in prolonged cytopenias and require hematopoietic stem cell support. The dose of alkylating agent or total body irradiation in reduced intensity regimens is generally reduced by ≥30% compared to high dose regimens. Exemplary reduced intensity regimens include, but are not limited to, melphalan + fludarabine or melphalan + cladribine. Nonmyeloablative conditioning is not expected to require stem cell support. Conditioning regimens include: (a) TBI / Fludarabine / thiotepa (TBI 1375 cGy, hyperfractionated, fludarabine 25 mg / m 2 / day for 5 days (total 125 mg / m 2 ), thiotepa-5 mg / kg given over 2 days (total 10 mg / kg), and (b) busulfan / melphalan / fludarabine: (busulfan (>7.2 mg / kg IV), melphalan, 140 mg / m given over 2 days). 2 , fludarabine 25 mg / m for 5 days 2 / day (total 125mg / m 2 )) but are not limited to.

[0166] A method of treating a recipient subject suffering from a hematological malignancy is described, the method comprising administering an allogeneic SCT and administering to the recipient subject an effective dose of engineered T cells, the engineered T cells expressing a xenogeneic TCR that recognizes a hematopoietic-restricted miHA antigen expressed by the recipient subject, the engineered T cells are administered to the recipient subject on the same day as the allogeneic SCT (e.g., within 24 hours), and no immunosuppressant targeting GVHD is administered prophylactically to the recipient subject to suppress the immune activity of the T cells. The hematological malignancy can be, but is not limited to, acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), or acute lymphoblastic leukemia (ALL). In some embodiments, the recipient subject has a measurable disease or one or more risk factors or indicators of poor outcome prior to the allogeneic SCT. The allogeneic SCT can be administered using a CD34-selected allogeneic SCT graft. In some embodiments, the engineered T cells are derived from a related or unrelated donor that is HLA 10 / 10 matched to the recipient subject, or HLA 11 / 12 matched or 12 / 12 matched to the recipient subject, where the donor does not express a hematopoietic-restricted miHA antigen recognized by the xenogeneic TCR. In some embodiments, the engineered T cells and the T cells used to generate the allogeneic SCT graft are obtained from the same donor.

[0167] A method of treating a recipient subject suffering from a hematological malignancy is described, the method comprising administering a conditioning regimen to the recipient subject, administering an allogeneic SCT, and administering an effective dose of engineered T cells to the recipient subject, the engineered T cells expressing a xenogeneic TCR that recognizes a hematopoietic-restricted miHA antigen expressed by the recipient subject, the engineered T cells are administered to the recipient subject on the same day (e.g., within 24 hours) as the allSCT, and no immunosuppressant targeting GVHD is administered prophylactically to the recipient subject to suppress immune activity of the T cells. The hematological malignancy can be, but is not limited to, AML, MDS, or ALL. In some embodiments, the recipient subject has measurable disease or one or more risk factors or indicators of poor outcome prior to the allogeneic SCT. The conditioning regimen can be a high-dose (myeloablative) regimen, a reduced intensity regimen, or a non-myeloablative regimen. The recipient subject is not prophylactically treated with an immunosuppressant targeting GVHD or suppressing immune activity of the T cells. Allogeneic SCT can be administered using CD34-selected allogeneic SCT grafts. In some embodiments, the engineered T cells are derived from related or unrelated donors that are HLA 10 / 10 matched to the recipient subject, or related or unrelated donors that are HLA 11 / 12 matched or 12 / 12 matched to the recipient subject, and the donor does not express hematopoietic-restricted miHA antigens recognized by xenogeneic TCR. In some embodiments, the engineered T cells and the T cells used to generate the allogeneic SCT graft are obtained from the same donor.

[0168] A method is described for treating a recipient subject suffering from a hematological malignancy and having measurable residual disease after at least one prior therapy, the method comprising administering a conditioning regimen to the recipient subject, administering an allogeneic SCT, and administering an effective dose of engineered T cells, the engineered T cells expressing a xenogeneic TCR that recognizes a hematopoietic-restricted miHA antigen expressed by the recipient subject, the engineered T cells are administered to the recipient subject on the same day (e.g., within 24 hours) as the allSCT, and no immunosuppressant targeting GVHD is administered prophylactically to the recipient subject to suppress immune activity of the T cells. The hematological malignancy can be, but is not limited to, AML, MDS, or ALL. In some embodiments, the recipient subject has one or more risk factors or indicators of poor outcome prior to the allogeneic SCT. The conditioning regimen can be a high-dose (myeloablative) regimen, a reduced intensity regimen, or a non-myeloablative regimen. The allogeneic SCT can be administered using a CD34-selected allogeneic SCT graft. The recipient subject is not prophylactically treated with immunosuppressants that target GVHD or suppress immune activity of T cells. In some embodiments, the engineered T cells are derived from a related or unrelated donor that is HLA 10 / 10 matched to the recipient subject, or a related or unrelated donor that is HLA 11 / 12 matched or 12 / 12 to the recipient subject, where the donor does not express hematopoietic-restricted miHA antigens recognized by the xenogeneic TCR. In some embodiments, the engineered T cells and the T cells used to generate the allogeneic SCT graft are obtained from the same donor.

[0169] A method of treating a recipient subject suffering from a hematological malignancy and one or more risk factors or indicators of poor outcome is described, the method comprising administering a conditioning regimen to the recipient subject, administering an allogeneic SCT, and administering an effective dose of engineered T cells, the engineered T cells expressing a xenogeneic TCR that recognizes a hematopoietic-restricted miHA antigen expressed by the recipient subject, the engineered T cells being administered to the recipient subject on the same day as the allogeneic SCT, and no immunosuppressant targeting GVHD is administered prophylactically to the recipient subject to suppress immune activity of the T cells. The hematological malignancy may be, but is not limited to, AML, MDS, or ALL. The conditioning regimen may be a high-dose (myeloablative) regimen, a reduced intensity regimen, or a non-myeloablative regimen. The allogeneic SCT may be administered using a CD34-selected allogeneic SCT graft. The recipient subject is not prophylactically treated with an immunosuppressant targeting GVHD or suppressing immune activity of the T cells. In some embodiments, the engineered T cells are derived from a related donor with an HLA 10 / 10 match to the recipient subject, or a related or unrelated donor with an HLA 11 / 12 match or an HLA 12 / 12 match to the recipient subject, where the donor does not express a hematopoietic-restricted miHA antigen recognized by the xenogeneic TCR. In some embodiments, the engineered T cells and the T cells used to generate the allogeneic SCT graft are obtained from the same donor.

[0170] Methods are described for treating a recipient subject suffering from a hematological malignancy and having measurable residual disease after at least one prior therapy and / or having one or more risk factors or indicators of poor outcome, the methods comprising: selecting an HLA-matched donor and performing an apheresis procedure to collect an apheresis product from the donor; genetically modifying CD8+ T cells from the apheresis product to knock out the endogenous TRAC and TRBC genes and to express a xenogeneic TCR that recognizes a hematopoietic-restricted miHA antigen expressed in the recipient subject but not in the donor, thereby generating engineered T cells; administering a mobilization agent to the donor and performing a second apheresis procedure to collect a second apheresis product from the donor; CD34 from apheresis samples + selecting the cells to form a CD34-selected allogeneic SCT graft; administering a conditioning regimen to the recipient subject; administering to the recipient subject an effective dose of a CD34-selected allogeneic SCT graft and the engineered T cells, wherein the engineered T cells are administered to the recipient subject within 72 hours of administering the CD34-selected allogeneic SCT graft to the recipient subject; Immunosuppressants targeted at GVHD are not administered prophylactically to recipient subjects to suppress T cell immune activity.

[0171] In some embodiments, PBMCs are isolated from the apheresis product. The hematological malignancy can be, but is not limited to, AML, MDS, or ALL. The conditioning regimen can be a high-dose (myeloablative), reduced-intensity, or non-myeloablative regimen. The donor can be a related or unrelated donor that is HLA 10 / 10 matched to the recipient subject, or a related or unrelated donor that is HLA 11 / 12 matched or 12 / 12 to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 48 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 24 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 18 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 12 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject. In some embodiments, the engineered T cells are administered to the recipient subject within 6 hours of administering a CD34-selected allogeneic SCT graft to the recipient subject.

[0172] A method is described for treating a recipient subject suffering from a hematological malignancy and having measurable residual disease after at least one prior therapy and / or having one or more risk factors or indicators of poor outcome, the method comprising:

[0173] CD8 from donor apheresis products + Genetically modifying T cells to knock out the endogenous TRAC and TRBC genes and express a xenogeneic TCR that recognizes a hematopoietic-restricted miHA antigen expressed by a recipient subject, wherein a donor is HLA-matched to the recipient subject but does not express the hematopoietic-restricted miHA antigen, thereby generating engineered T cells. administering to the recipient subject an effective dose of the engineered T cells in combination with a CD34-selected allogeneic SCT graft, wherein the CD34-selected allogeneic SCT graft is from an HLA-matched donor, and wherein the effective dose of the engineered T cells is administered to the recipient subject within 72 hours, within 48 hours, within 24 hours, within 18 hours, within 12 hours, or within 6 hours of the CD34-selected allogeneic SCT graft; Immunosuppressants targeted at GVHD are not administered prophylactically to recipient subjects to suppress T cell immune activity.

[0174] The hematological malignancy may be, but is not limited to, AML, MDS, or ALL. The recipient subject may undergo a conditioning regimen prior to administration of the CD34-selected allogeneic SCT graft. The conditioning regimen may be a high-dose (myeloablative) regimen, a reduced intensity regimen, or a non-myeloablative regimen. The donor may be a related or unrelated donor that is HLA 10 / 10 matched to the recipient subject, or a related or unrelated donor that is HLA 11 / 12 matched or 12 / 12 matched to the recipient subject. The donor may undergo two apheresis procedures, where the donor is not administered a mobilization agent prior to the first apheresis, and the donor is administered a mobilization agent prior to the second apheresis. The first apheresis procedure is used to obtain a first apheresis product that is used to manufacture engineered T cells. A second apheresis procedure is used to obtain a second apheresis product that is used to generate a CD34-selected allogeneic SCT graft.

[0175] Allogeneic SCT is approximately 2 × 10 6 cells / kg ~ approx. 8×10 6 In some embodiments, the allogeneic SCT can comprise about 2×10 cells / kg. 6 CD34 + cells / kg ~ approx. 8×10 6 CD34 + The engineered T cell dose is approximately 0.1 x 10 6 cells / kg~3×10 6In some embodiments, the engineered T cell dose may be about 0.1×10 cells / kg. 6 In some embodiments, the engineered T cell dose is about 0.3×10 6 In some embodiments, the engineered T cell dose is about 1×10 6 In some embodiments, the engineered T cell dose is about 3×10 6 cells / kg.

[0176] In some embodiments, the engineered T cells express a heterologous TCR that recognizes the miHA antigen. In some embodiments, the engineered T cells express a heterologous TCR that recognizes the miHA antigen, the expression of which is relatively restricted to hematopoietic cells. The miHa antigen can be, but is not limited to, a miHA HA-1 antigen or a miHA HA-2 antigen. The miHA HA-1 antigen can be a miHA HA-1 "H" antigen or a miHA HA-1 "R" antigen. In some embodiments, the miHA-HA-1 antigen comprises a miHA HA-1 "H" antigen (VLHDDLLEA, SEQ ID NO: 3). In some embodiments, the miHA-HA-1 antigen comprises a miHA HA-1 "R" antigen (VLRDDLLEA, SEQ ID NO: 4). In some embodiments, the heterologous anti-miHA HA-1 TCR recognizes the miHA HA-1 antigen in the context of an MHC molecule. In some embodiments, the MHC molecule is a human leukocyte antigen (HLA)-A molecule. In some embodiments, the heterologous anti-miHA HA-1 TCR recognizes the miHA HA-1 antigen in the context of an HLA-A molecule of serotype HLA-A*02:01 or HLA-A*02:06. The miHA HA-2 antigen can be a miHA HA-2 "V" antigen or a miHA HA-2 "M" antigen. In some embodiments, the miHA HA-2 antigen comprises a miHA HA-2 "V" antigen (YIGEVLVSV, SEQ ID NO:5). In some embodiments, the miHA HA-2 antigen comprises a miHA HA-2 "M" antigen (YIGEVLVSM, SEQ ID NO:6). In some embodiments, the heterologous anti-miHA HA-2 TCR recognizes the miHA HA-2 antigen in the context of an MHC molecule. In some embodiments, the MHC molecule is a human leukocyte antigen (HLA)-A molecule. In some embodiments, the heterologous anti-miHA HA-2 TCR recognizes the miHA HA-2 antigen in the context of an HLA-A molecule of the serotype HLA-A*02:01.

[0177] The described method provides a more effective alloreactive T cell response that mediates GVL responses while reducing GVHD compared to polyclonal donor T cells. Administering the described engineered T cells to a recipient subject together with an allogeneic SCT (e.g., on the same day) can be used to reduce the relapse rate of hematological malignancies, reduce the severity of relapse of hematological malignancies, delay relapse of hematological malignancies, increase relapse-free survival, reduce toxicity associated with allogeneic SCT, reduce treatment-related mortality of allogeneic SCT, reduce or eliminate the need for immunosuppressive therapy in allogeneic SCT, reduce post-transplant morbidity caused by systemic immunosuppression, promote engraftment of allogeneic SCT, reduce immunological rejection of allogeneic SCT, reduce GVHD after allogeneic SCT, and / or reduce the risk of GVHD after allogeneic SCT compared to recipient subjects undergoing allogeneic SCT in the absence of engineered T cells.

[0178] The described method can be used to treat recipient subjects who are not typically eligible for allogeneic SCT therapy.Such subjects include, but are not limited to, subjects with measurable disease after at least one previous line of treatment (e.g., induction therapy), subjects with active disease, and subjects with one or more risk factors or poor prognosis indicators after allogeneic SCT.

[0179] VI. Recipient Subjects The recipient subject (e.g., a patient) is positive for the antigen recognized by the xenogeneic TCR or CAR expressed by the engineered T cells.

[0180] Recipient subjects suitable for treatment with the described engineered T cells and methods of using the engineered T cells include, but are not limited to, recipient subjects with hematological malignancies, hemoglobinopathies, thalassemias, solid organ transplants, or autoimmune diseases. Hematological malignancies can be, but are not limited to, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), myelodysplastic syndromes (MDS), chronic lymphocytic leukemia, chronic myeloid leukemia in blast crisis, chronic myeloid leukemia in accelerated phase, multiple myeloma, or non-Hodgkin's lymphoma. The autoimmune disease is, but is not limited to, multiple sclerosis, myasthenia gravis, systemic sclerosis, systemic lupus erythematosus, polymyositis-dermatomyositis, Sjogren's syndrome, rheumatoid arthritis, juvenile chronic arthritis, psoriatic arthritis, vasculitis, immune thrombocytopenia, autoimmune hemolytic anemia, Evans syndrome, true red / white blood cell aplasia, Crohn's disease, ulcerative colitis, refractory type II celiac disease, granulomatosis with polyangiitis, Behcet's disease, chronic inflammatory demyelinating polyneuropathy, neuromyelitis optica, or inflammatory bowel disease.

[0181] In some embodiments, the recipient subject has a hematological malignancy.

[0182] In some embodiments, the recipient subject has no measurable residual disease (MRD). In some embodiments, the recipient subject has no MRD after induction therapy. In some embodiments, the recipient subject has no MRD after consolidation therapy. The disease may be, but is not limited to, a hematological malignancy. Measurable disease or measurable residual may be determined by morphology, flow cytometry, or molecular testing or evaluation of bone marrow aspirates or biopsies. In some embodiments, the recipient subject has a morphologically identifiable disease (e.g., leukemia). Morphologically identifiable disease indicates that cancer cells can be detected by microscopic analysis or standard tests that examine cell samples under a microscope.

[0183] In some embodiments, the recipient subject suffers from a hematological malignancy and is refractory to at least one prior therapy, hi some embodiments, the recipient subject is refractory to at least two prior therapies.

[0184] In some embodiments, the recipient subject suffers from a hematological malignancy and is at risk of relapse after induction therapy. In some embodiments, the recipient subject is at risk of relapse after consolidation therapy. In some embodiments, the recipient subject is at risk of relapse after allogeneic SCT.

[0185] In some embodiments, the recipient subject suffers from a hematological malignancy and does not respond to induction therapy. Induction therapy (also called remission induction therapy) is the first-line treatment of cancer using chemotherapy drugs. For the treatment of leukemia and other hematopoietic disorders, induction therapy typically includes short (about 1 week) intensive therapy with the goal of removing leukemia cells (myeloblasts, also called blasts) from the blood and reducing the number of blasts in the bone marrow to normal (e.g., <5%). Induction therapy includes any induction therapy typically used in the art to treat hematopoietic disorders. Induction therapies include, but are not limited to, cytarabine (cytosine arabinoside or ara-C) plus an anthracycline drug (e.g., daunorubicin (daunomycin) or idarubicin), cladribine (2-CdA), fludarabine, mitoxantrone, etoposide (VP-16), 6-thioguanine (6-TG), hydroxyurea, a corticosteroid drug (e.g., prednisone or dexamethasone), methotrexate (MTX), 6-mercaptopurine (6-MP), azacitidine, decitabine, or clofarabine.

[0186] In some embodiments, the recipient subject suffers from a hematological malignancy and has not responded to consolidation therapy. Consolidation therapy comprises chemotherapy administered to the recipient subject after the recipient subject has recovered from induction therapy. Consolidation therapy is intended to kill leukemia cells remaining after induction therapy.

[0187] In some embodiments, the recipient subject does not have MRD but has one or more risk factors or indicators of poor outcome. In some embodiments, the recipient subject does not have MRD after induction therapy but has one or more risk factors or indicators of poor outcome. In some embodiments, the recipient subject does not have MRD after consolidation therapy but has one or more risk factors or indicators of poor outcome. The disease can be, but is not limited to, a hematological malignancy. In some embodiments, the recipient subject has <5% blasts in the bone marrow but has one or more risk factors or indicators of poor outcome.

[0188] In some embodiments, the recipient subject is MRD positive as determined by multiparameter flow cytometry, which identifies myeloblasts with an aberrant immunophenotype.

[0189] In some embodiments, the recipient subject is not responding to induction therapy. In some embodiments, the recipient subject has ≧5% blasts in its bone marrow. In some embodiments, the recipient subject has ≧5% blasts in the bone marrow after induction therapy. In some embodiments, the recipient subject has ≦25% blasts in the bone marrow. In some embodiments, the recipient subject has ≦25% blasts in the bone marrow after induction therapy. In some embodiments, the recipient subject has about 5% to about 25% blasts in its bone marrow. In some embodiments, the recipient subject has about 5% to about 25% blasts in the bone marrow after induction therapy. In some embodiments, the recipient subject has detectable blasts in the peripheral blood. In some embodiments, the recipient subject has detectable blasts in the peripheral blood after induction therapy.

[0190] In some embodiments, the recipient subject is not in remission, has active disease, has MRD, is relapsing, or has circulating myeloblasts (blasts, abnormal immature white blood cells). In some embodiments, the recipient subject has active disease, has MRD, is relapsing, or has circulating myeloblasts (blasts) and has one or more risk factors or indicators of poor outcome. Recipient subjects suitable for administration of the described engineered T cell therapies have ≦10% blasts, ≦15% blasts, ≦20% blasts, ≦25% blasts, or ≦30% blasts in the bone marrow. In some embodiments, the recipient subject has ≦25% blasts. In some embodiments, the recipient subject has ≧5% blasts, ≧10% blasts, or ≧15% blasts in the bone marrow. In some embodiments, the recipient subject has 0% to about 25% blasts in the bone marrow. In some embodiments, the recipient subject has about 5% to about 25% blasts in the bone marrow. In some embodiments, the recipient subject has about 10% to about 25% blasts in the bone marrow. In some embodiments, the recipient subject has about 15% to about 25% blasts in the bone marrow. In some embodiments, the recipient subject has about 5% to about 20% blasts in the bone marrow. In some embodiments, the recipient subject has about 5% to about 15% blasts in the bone marrow. In some embodiments, the recipient subject has about 5% to about 10% blasts in the bone marrow. In some embodiments, the recipient subject has detectable blasts in the peripheral blood.

[0191] In some embodiments, the recipient subject is not in complete molecular remission, which is defined as no evidence of leukemia cells in the bone marrow using sensitive laboratory tests such as polymerase chain reaction (PCR) or flow cytometry.

[0192] In some embodiments, the recipient subject has one or more risk factors or indicators of poor outcome before undergoing allogeneic SCT therapy. In some embodiments, the recipient subject has one or more risk factors or indicators of poor outcome after induction therapy. In some embodiments, the recipient subject has one or more risk factors or indicators of poor outcome after consolidation therapy. In some embodiments, the recipient subject has one or more risk factors or indicators of poor outcome after prior SCT therapy. Risk factors or indicators of poor prognosis include, but are not limited to, TP53 mutation, complex karyotype, typical complex karyotype, atypical complex karyotype, monosomal karyotype, 17p chromosomal abnormality, or Ph+ chromosomal abnormality. Complex karyotype indicates that the recipient subject has ≧3 chromosomal abnormalities. Chromosomal abnormalities may include one or more of 5q, 7q, and 17p abnormalities. Monosomal karyotype indicates that the recipient subject has two autosomal monosomes (AM) (loss of a single chromosome of a pair) or a single AM ​​and one structural chromosomal abnormality. A Ph+ chromosomal abnormality indicates that the recipient subject has a translocation between chromosomes 9 and 22 creating the BCR-ABL1 fusion gene.

[0193] In some embodiments, the recipient subject has advanced leukemia or lymphoma and / or is predicted to have a poor outcome after transplant and is ineligible for allogeneic SCT.

[0194] In some embodiments, the recipient subject is in a state for hematopoietic stem cell transplantation. In some embodiments, the recipient subject is in a state for hematopoietic stem cell transplantation after undergoing a conditioning regimen.

[0195] In some embodiments, recipient subject is AML, ALL or MDS patient.In some embodiments, recipient subject is AML, ALL or MDS patient that is refractory to one or more previous treatment options.In some embodiments, recipient subject is AML, ALL or MDS patient that has one or more risk factors or indicators of poor outcome.

[0196] In some embodiments, the recipient subject is an AML patient with measurable residual disease or measurable residual disease with up to 25% myeloblasts in the bone marrow. In some embodiments, the recipient subject is an AML patient with one or more risk factors or indicators of poor prognosis. Risk factors or indicators of poor prognosis include, but are not limited to, TP53 mutation, complex karyotype, monosomal karyotype, 17p chromosomal abnormality, or Ph+ chromosomal abnormality. AML patients with one or more risk factors or indicators of poor prognosis may have MRD or no MRD after induction therapy. In some embodiments, the recipient subject is an AML patient with MRD positivity as determined by multiparameter flow cytometry that identifies myeloblasts with abnormal immunophenotype. In some embodiments, the recipient subject is an AML patient with cytogenetic abnormalities that define persistent disease or detectable core binding factor transcripts (RUNX1-RUNX1T1 or CBFB-MYH11) or NPM1 mutant transcripts as measured by qPCR or dPCR in blood or bone marrow, or any evidence of FLT3-ITD in blood or bone marrow. In some embodiments, the recipient subject is an AML patient who is MRD negative but has high-risk disease, such as TP53 mutation, complex karyotype, monosomal karyotype, abn(17p) or MECOM(EVI1) rearrangement. In some embodiments, the recipient subject is an AML patient who has failed to respond to at least one previous therapy. In some embodiments, the recipient subject is an AML patient who has failed to respond to two previous therapies.

[0197] In some embodiments, the recipient subject is an ALL patient with measurable residual disease or measurable residual disease with up to 25% myeloblasts in the bone marrow. In some embodiments, the recipient subject is an ALL patient with measurable residual disease or measurable residual disease with up to 25% myeloblasts in the bone marrow as determined by morphology or multi-parameter flow cytometry. In some embodiments, the recipient subject is an ALL patient with one or more risk factors or indicators of poor prognosis. Risk factors or indicators of poor prognosis include, but are not limited to, Ph+ chromosomal abnormalities. All patients with one or more risk factors or indicators of poor prognosis may or may not have MRD after induction therapy. In some embodiments, the recipient subject is an ALL patient who did not respond to induction therapy. In some embodiments, the recipient subject is an ALL patient who did not respond to induction therapy and consolidation therapy. In some embodiments, the recipient subject is an ALL patient who has not responded to induction therapy and has (a) any persistent disease-defining cytogenetic abnormalities, (b) MRD positivity as determined by multiparameter flow cytometry on bone marrow or peripheral blood, (c) Ph-like ALL with or without MRD, or (d) CRLF2 mutation, Ikaros deletion, monosomy 7, or complex karyotype.

[0198] In some embodiments, the recipient subject is an MDS patient with measurable residual disease or measurable residual disease with up to 25% myeloblasts in bone marrow. In some embodiments, the recipient subject is an MDS patient with high or very high risk as determined by the International Prognostic Scoring System-Revised (IPSS-R). In some embodiments, the recipient subject is an MDS patient with one or more risk factors or indicators of poor prognosis. Risk factors or indicators of poor prognosis include, but are not limited to, complex karyotype, monosomal karyotype, TP53 mutation, or mutations in the RAS pathway, JAK2, RUNX1, or ASXL1. MDS patients with one or more risk factors or indicators of poor prognosis may have MRD or no MRD after induction therapy.

[0199]

Table 3A-1

Table 3A-2

Table 3A-3

Table 3A-4

Table 3A-5

Table 3A-6

Table 3A-7

Table 3A-8

Table 3A-9

Table 3A-10

Table 3A-11

Table 3A-12

Table 3A-13

Table 3A-14

Table 3A-15

Table 3B-1

Table 3B-2

Table 3B-3

Table 3B-4

Table 3B-5

Table 3B-6

Table 3B-7

Table 3B-8

Table 3B-9

Table 3B-10

Table 3B-11

Table 3B-12

Example

[0200] Example 1. Production of T cells by operation The engineered T cells are produced from peripheral blood of allogeneic hematopoietic stem cell transplant donors obtained via an apheresis procedure. The T cells are enriched via CD8+ selection and cultured with cytokines. The cultured cells are activated in combination with supportive reagents (e.g., with activating anti-CD3 and anti-CD28 antibodies). After activation, the activated CD8+ T cells are electroporated to deliver CRISPR / Cas9 RNP guides to knock out the endogenous TCR of the cultured cells. The resulting cell population is returned to culture and genetically modified ex vivo using a lentiviral vector encoding a heterologous TCR (e.g., a TCR targeting a tumor epitope, e.g., a hematopoietic-restricted miHA epitope, e.g., miHA HA-1 "H" epitope). The transduced cell population is then expanded, harvested, formulated, loaded, terminated, and optionally cryopreserved. Engineered T cells are an allogeneic immune cell therapy that utilizes HLA-matched donor cells as the starting material. The manufacturing process is designed to generate a highly pure T cell population when endogenous TCR expression is removed via gene editing and replaced via lentiviral vector transduction to allow expression of heterologous TCR. An exemplary manufacturing process is summarized below.

[0201] Apheresis product or PBMCs are collected by apheresis (without prior mobilization) from a donor subject who is HLA-matched to the recipient subject and does not express the epitope expressed in the recipient subject.

[0202] CD8 + Cells were selected and enriched from apheresis products or PBMCs. + Form a T cell population.

[0203] Enriched CD8 + T cells were placed in culture and activated. Activation methods included CD8 +This includes, but is not limited to, contacting the T cells with immobilized recombinant CD3 and CD28 agonists, including, but not limited to, MACS® GMP T Cell TransAct™ (Miltenyi Biotec).

[0204] Endogenous TCR expression is ablated via multiplex gene editing of the TRAC and TRBC genes. Electroporation is used to introduce a ribonucleoprotein containing Spyfi SpCas9 and sgRNA into activated T cells, resulting in the expression of activated CD8 + The endogenous TCR in the donor T cells is knocked out to form edited T cells.

[0205] Transduction of the edited T cells with a self-inactivating minimal lentiviral vector introduces an expression cassette for a heterologous TCR or CAR, optionally together with a marker to form an engineered T cell, which can be, but is not limited to, RQR8.

[0206] The engineered T cells are expanded ex vivo by contacting the engineered T cells with cytokines, including but not limited to, IL-2, and optionally one or more of IL-7, IL-15, IL-21, IL-9, and incubating under conditions suitable for cell growth and proliferation.

[0207] The expanded engineered T cells are washed, placed into a containment (e.g., an infusion bag), and optionally cryopreserved.

[0208] Example 2. The effect of activation method on the production of engineered T cells expressing heterologous TCRs. PBMCs were collected from donor subjects and activated with OKT3 (anti-CD3 monoclonal antibody), OKT3 + anti-CD28 antibody, or TransACT™ (beads containing CD3 and CD28 agonists) to produce CD8 +Cells were selected. Alternatively, CD8+ cells were purified from PBMCs taken from donor subjects and activated with OKT3 (anti-CD3 monoclonal antibody), OKT3 antibody and anti-CD28 antibody, or TransACT™ (beads containing CD3 and CD28 agonists). After activation and selection (or selection and activation), cells were treated for knockout of endogenous TCR by CRISPR and transduced with lentivirus encoding heterologous TCR. Activation was performed on day 0. CD8 + Cells were selected, processed for knockout of endogenous TCR, and transduced with lentivirus on day 1. Cells were analyzed for marker expression, endogenous TCR knockout, and heterologous TCR expression on day 4. As shown in Table 4, activation of PBMCs using each of the methods significantly increased CD8 + More than 90% of the cells were CD8+ cells. Also, as shown in Table 4, 64-73% of the cells were CD8+ cells. + CD25 + and more than 98% of the cells were CD8 + CD69 + As shown in Figure 2, knockout of the endogenous TCR was highly efficient (>90%) in cells generated by each of the activation methods. Over 90% of the cells were also CD3+ TCR ... - It was found that the activation method of PBMCs appeared to have a significant effect on the percentage of cells that expressed the xenogeneic HA-1 TCR after transduction with lentivirus encoding the xenogeneic TCR (Figure 3). However, even with CD3 and CD3 / CD28 activation, more than 30% of the cells expressed the xenogeneic HA-1 TCR.

[0209] [Table 4]

[0210] Example 3. Effect of activation method on the cytolytic potential of engineered T cells. Engineered T cells generated from PBMCs activated as described above were analyzed for cytolytic potency. Cytolytic potency was tested against LCL222 cells (expressing the target MiHA HA-1 H antigen (H / H cells)) or control LCL224 cells (expressing the non-target MiHA HA-1 R antigen (R / R cells)). As shown in Figure 4, efficient killing was observed for engineered T cells against LCL222 cells expressing the HA-1 H antigen, but not against LCL224 cells expressing the HA-1 R antigen. Efficient killing was also observed for THP cells expressing the HA-1 H antigen. Engineered T cells formed using TransACT™ to activate donor PBMCs were more potent than engineered T cells formed using CD3 or CD3+CD28 activation. Enriched CD8 + Engineered T cells generated using TRANSACT™ to activate cells also express CD8 + were more potent compared to engineered T cells formed from activation of pre-enriched PBMCs (i.e., unpurified PBMC donor cells).

[0211] [Table 5]

[0212] Example 4. Functional activity of engineered T cells The engineered T cells are designed to kill target cells (e.g., leukemia cells in the patient). This is possible by matching a healthy donor subject with a suitable recipient subject. HLA-A*02:01 + / HA-1 H / R or H / H recipient subjects, +Engineered T cells were generated using T cells from a donor subject who was / HA-1 R / R. Engineered T cells were modified to express an anti-HA-1 "H" epitope-specific TCR. Flow cytometry was used to assess CD69 expression, which is rapidly induced on the surface of T lymphocytes following TCR / CD3 engagement, activating cytokines, and polyclonal mitogenic stimulation. Cytotoxicity and cytokine release assays were used to assess engineered T cell function.

[0213] Engineered T cells: Cryopreserved PBMCs from healthy donors were collected and activated with soluble anti-CD3 antibodies and cultured overnight again. The next day, the PBMCs were split, with a portion used as PBMCs and the remaining portion used as CD8 + The PBMCs and CD8+ cells were then enriched for T cells. Both the PBMCs and CD8+ cells were then nucleofected, transduced, placed in culture and expanded. The engineered T cells were then harvested on either day 6 or day 11. The cells were transduced with CD34 + Cells and CD3 + The % of cells bound to HA-1 dextramer were assayed, and the remaining cells were then used for cytotoxicity assays and cytokine release.

[0214] Target cells: LCLs were used that either naturally express the HA-1 VLHDDLLEA peptide (H peptide, H / H) (referred to as LCL222 cells) or were loaded with the immunogenic or non-immunogenic HA-1 VLRDDLLEA peptide (R peptide R / R) (referred to as LCL224 cells).

[0215] Cytotoxicity killing assay: LCL222 and LCL224 cells were differentially stained and could be distinguished with 0.5 μM CFDA-SE (5(6)-carboxyfluorescein diacetate succinimidyl ester, STEMCELL™ Technologies) (LCL222, "high") and 0.025 μM CFDA-SE (LCL224, "low"). LCL and engineered T cells were combined at the ratios shown in FIG. 5. Each assay contained 100,000 LCL cells (50,000 LCL222 cells and 50,000 LCL224 cells). Cells were combined in culture medium in 96-well U-bottom plates and incubated at 37° C. and 5% CO. 2 The cells were cultured overnight (16-18 hours) in an incubator at RT. Specific killing eliminates LCL224 cells while leaving LCL222 cells unaffected. Samples were run in triplicate and analyzed for cell number by flow cytometry and gating on the CFSE population. Specific killing was detected by the loss of LCL cells loaded with the immunogenic H peptide, but not LCL loaded with the R peptide. The data shown in Figure 5 clearly demonstrate the specificity of the engineered T cells in killing target cells, expressing the HA-1 "H" epitope (LC222 cells). The number of LCL222 cells was reduced to nearly undetectable levels at an E:T ratio of 1.38:1, whereas the number of LCL224 cells remained relatively unchanged. Using this data, an EC50 value of 0.49:1 was calculated.

[0216] IL-2 ELISpot cytokine release assay: activated CD8 +T cells secrete cytokines (e.g., IL-2, TNF-α, IFN-γ), perforin, or granzymes. Such proteins have antitumor effects. Enzyme-linked immunosorbent spot (ELISpot) was used to detect the frequency of cytokine secretion from engineered T cells. Engineered T cells and target cells were seeded onto PVDF or nitrocellulose membranes in 96-well plates that were pre-coated with antibodies specific to the secreted cytokines. Secreted cytokines were captured and further detected using biotinylated antibodies. Engineered T cells were mixed with LCL222 or LCL224 target cells at a 1:1 ratio and incubated for 16 ± 4 h at 37 °C and 5% CO2. 2 The cells were incubated for 1 h. In some samples, LCL224 cells (R / R) were also loaded with HA-1 "H" peptide. ELISpot analysis of IL-2 secretion was performed according to the manufacturer's recommended protocol (human IL-2 ELISpotbasic, MabTech). Engineered T cells alone and target cells alone were used as negative controls. Engineered T cells activated with PMA (50 ng / mL) and ionomycin (1 μM) were used as positive controls. The sensitivity of ELISpot allows the detection of low-frequency antigen-specific T cells secreting cytokines and effector molecules. Data for IL-2 from two independent experiments using PBMC from different donors are shown in Figure 6. High IL-2 secretion was observed upon activation with cells presenting HA-1 "H" peptide (LCL222) but not with HA-1 "R" peptide (LCL224).

[0217] Intracellular cytokine assay: LCL222 and LCL224 target cells were labeled with 0.1 μM CellTracker Red CMTPX for 30 min before use. Engineered T cells were co-cultured with either LCL222 or LCL224 at a 1:1 ratio for 6 h in the presence of Golgi and endosomal inhibitors to allow intracellular accumulation of cytokines and other proteins. Engineered T cells alone served as a negative control. Engineered T cells activated with phorbol 12-myristate 13-acetate (PMA, 50 ng / mL) and ionomycin (1 μM) served as a positive control. After incubation, cells were collected and washed by centrifugation. Cells were then stained with LIVE / DEAD Ghost 510, FITC-conjugated anti-CD8, and AF700-conjugated anti-CD34. After fixation and permeabilization, cells were stained with APC-conjugated anti-IL2, Brilliant Violet (BV) 421-conjugated INFγ, Phycoerythrin (PE)-Cyanine 7-conjugated anti-Granzyme B, and Phycoerythrin (PE)-Cy5-conjugated anti-CD107a. Cells were acquired and analyzed via an ACEA NovoCyte Quanteon flow cytometer with the following gating strategies: forward vs. side scatter for lymphocytes, singlets, live cells with Ghost 510, CellTracker Red CMTPX (PE channel) negative population, CD8+ cells, CD34+ cells, INFγ+ cells, IL2+ cells, CD107a+ cells, and Granzyme B positive cells.

[0218] Flow cytometry was used to analyze cytokine expression, as well as CD107a and granzyme B (GZM B) expression. As shown in Figure 7, in the presence of LCL222 cells (expressing the H peptide), but not LCL224 cells (expressing the H peptide), engineered T cells expressing a heterologous anti-HA-1 "H" epitope TCR are activated and show increased staining for CD69, IL-2, INF-γ, CD107a, and GZM B.

[0219] Example 5. Alloreactivity assay The HA-1 peptide epitope is presented on the cell surface of malignant hematopoietic cells in the context of HLA-A*02:01 or HLA-A*02:06. To demonstrate that engineered T cells expressing anti-HA-1 TCRs are not reactive to HLA types other than HLA-A*02:01 or HLA-A*02:06, a panel of LCL cells presenting restrictive HLA-A*02:01, HLA-A*02:06, as well as other HLA alleles, and genotyped for HA-1 haplotypes (R / R, H / R, or H / H) were co-cultured with engineered T cells expressing a heterologous anti-HA-1 "H" epitope TCR.

[0220] Engineered T cells expressing a heterologous anti-HA-1 "H" epitope TCR were prepared as described.

[0221] Lymphoblastoid cell lines (LCLs), EBV-immortalized B cells, were obtained from a commercial source and screened for HLA-A genotype and HA-1 genotype status. LCL cells expressing various HLA alleles and HA-1 "H" or HA-1 "R" epitopes were identified. LCL cells were loaded and labeled with CellTracker Red CMTPX to allow for separation of target cells by flow cytometry. Engineered T cells were co-cultured with LCLs at a ratio of 0.5–0.7:1 (TCR-expressing T cells to target cells) for 4 h. Cells were collected and stained with Live / Dead Violet 510 Ghost dye, FITC-anti-CD8, AF700-anti-CD34, and APC-anti-CD69 antibodies. Control samples of engineered T cells alone (CC) were included for background staining. Cells were acquired and analyzed with an ACEA NovoCyte Quanteon flow cytometer and the following gating strategies: lymphocytes, cell singlets, live cells with minimum Ghost 510 fluorescence intensity, CD8+ cells, CD34 + Cells, and CD69 + Forward scatter vs. side scatter for cells.

[0222] As shown in Figure 8, upregulation of CD69 occurred only in the presence of target cells expressing both the target miHA antigen (HA-1 "H" epitope) with cognate HLA alleles (HLA-A*02:01 or HLA-A*02:06). Engineered T cells were activated to target cells that were homozygous (H / H) or heterozygous (H / R) for the HA-1 "H" epitope.

[0223] Only target cell lines expressing both the antigen recognized by the xenogeneic TCR and the appropriate HLA-guided activation of engineered T cells.

[0224] Example 6. Cytotoxicity of indicator-specific cell lines. The ability of engineered T cells to kill marker-specific target cells was analyzed. Engineered T cells expressing heterologous anti-HA-1 "H" epitope TCRs were shown to be able to kill A*02:01 + / HA-1H + The ability to target and kill target cells was assessed.

[0225] THP-1 cells were derived from a patient with acute monocytic leukemia, A*02:01 + / HA-1H + (H / R) Human monocytic cells. NALM-6 cells were derived from a young male A*02:01 + / HA-1H + (H / R) B-cell precursor leukemia cells. NALM-6 cells express CD24 + Xenograft model. Non-immunogenic LCL224 cells were included as a control for non-specific killing in the presence of THP-1 cells. Engineered T cells (expressing or not expressing a xenogeneic TCR) and target / control cells were incubated at 37 °C and 5% CO. 2 The cells were co-cultured overnight (16-18 h) in 96U bottom plates in an incubator at 4°C. Samples were run in triplicate and analyzed for cell number by flow cytometry and gating on the CFSE population.

[0226] As shown in Figure 9, engineered T cells expressing xenogeneic TCRs effectively killed the indicator-specific cell lines THP-1 (AML) and NALM6 (B-ALL). T cells not expressing xenogeneic TCRs did not kill the indicator-specific cells.

[0227] Example 7. Naive (CD45RA) and memory (CD45RO) expression on engineered T cells PBMCs were harvested and engineered T cells expressing heterologous TCRs were prepared as described above using either OKT3 or TransACT™ as the activator. Engineered T cells were analyzed for CD45 markers before incubation with LCL222 target cells (after initial expansion) or after exposure to target cells and reactivation. As shown in Table 6, engineered T cells had a predominantly memory (Tscm or Tcm) phenotype. Engineered T cells generated using the described method maintained high levels of cytotoxicity over time and at least two exposures to target cells (restimulation). The IC50 values ​​for the first stimulation (day 12) and second restimulation (day 32 after the first restimulation on day 22) were 0.1556 and 0.11452, respectively.

[0228] [Table 6]

[0229] Example 8. Production of engineered T cells expressing heterologous TCRs using a single mobilized apheresis. PBMCs were collected from donor subjects and activated with OKT3 (anti-CD3 monoclonal antibody), OKT3 + anti-CD28 antibody, or TRANSACT™ (beads containing CD3 and CD28 agonists) to produce CD8 + / CD34 + After activation and selection, cells were treated for knockout of the endogenous TCR by CRISPR and transduced with lentivirus encoding a heterologous TCR. Activation was performed on day 0. CD8 + / CD34 +Cells were selected, processed for knockout of endogenous TCR, and transduced with lentivirus on day 1. Cells were then expanded for up to 11 days (until day 12). Expanded cells were harvested and cryopreserved prior to shipping (shipment to site for administration to recipient subjects).

[0230] Example 9. Treatment of hematopoietic malignancies. The engineered T cells expressing a xenogeneic TCR are administered to a recipient subject suffering from a hematopoietic malignancy in combination with an allogeneic hematopoietic stem cell transplant (allo-SCT). The xenogeneic TCR recognizes the miHA antigen expressed on the recipient subject's hematopoietic cells but not by the donor. The donor subject is screened to identify related or unrelated donor subjects with HLA 11 / 11 or HLA 12 / 12 matches to the recipient subject, and related or unrelated donor subjects with HLA 10 / 10 matches to the recipient subject.

[0231] The donor subject is then subjected to a first apheresis procedure to collect PBMCs. The first apheresis procedure is performed without prior mobilization of the donor subject. The first apheresis procedure is performed on day -1 (CD8 + For T cell activation, see FIG. 10 ).

[0232] After collection of non-mobilized PBMCs from donor subjects, CD8 + T cells are isolated from PBMCs (day 0). CD8+ T cells are activated overnight (12-24 h) by incubation with immobilized CD3 and CD28 agonists (TRANSACT™ beads).

[0233] After overnight activation, the activated CD8+ T cells are genetically modified to knock out the expression of endogenous TRAC and TRBC genes and insert a nucleic acid sequence encoding a heterologous TCR. Knocking out endogenous TRAC and TRBC genes is performed using CRISPR technology by transfecting T cells with an RNP complex containing TRAC guide RNA TRBC guide RNA and Cas9 nuclease. Inserting the nucleic acid sequence encoding a heterologous TCR is performed by transducing T cells with a lentiviral vector containing a nucleic acid sequence encoding a heterologous TCR. Genetically modifying T cells to form engineered T cells is performed on day 1.

[0234] The engineered T cells are then expanded to provide an effective dose for administration to a recipient subject. The T cells are expanded by incubating the engineered T cells under conditions suitable for T cell expansion for 8-14 days.

[0235] The mobilization agent is administered to the donor subject, and the donor subject is subjected to a second apheresis procedure to collect PBMCs. After collection of the mobilized PBMCs from the donor subject, CD34 + Cells are isolated from PBMC to generate the allogeneic SCT graft.

[0236] Both the CD34-selected allogeneic SCT graft and the effective dose of the engineered T cells are administered to the recipient subject on the same day.If necessary, the recipient subject is administered a conditioning regimen before receiving the CD34-selected allogeneic SCT graft and the engineered T cells.The allogeneic SCT graft and the engineered cells are administered to the recipient subject using the method typical in the art (Figure 10).

[0237] Alternatively, the donor subject may be transfected with CD8 + They may undergo a single mobilized apheresis procedure to provide the cells and provide a CD34-selected allogeneic SCT graft.

Claims

1. A method for treating a subject with a hematological malignancy, (a) Administering a CD34-selective allogeneic stem cell transplant (allogeneic SCT) graft to the subject, wherein the allogeneic SCT graft is obtained from a graft donor subject that is HLA-compatible with the subject, (b) Administering engineered T cells to the subject, wherein the engineered T cells express heterologous T cell receptors (TCRs) or chimeric antigen receptors (CARs) that recognize hematopoietic-restricting miHA antigens expressed by the subject, The manipulated T cells are administered to the subject within 72 hours of administering the CD34-selective allogeneic SCT graft to the subject. A method in which an immunosuppressant targeting graft-versus-host disease (GVHD) is not administered prophylactically to a subject in order to suppress the immune activity of T cells.

2. The method according to claim 1, wherein the manipulated T cells are administered to the subject within 24 hours after the subject is administered the CD34-selective allogeneic SCT graft.

3. The method according to claim 1, wherein the manipulated T cells are modified to knock out the endogenous TRAC and TRBC genes.

4. The method according to claim 1, wherein the manipulated T cells are derived from a T cell donor subject that is HLA-compatible with the subject.

5. The method according to claim 1, wherein the graft donor and the T cell donor are the same donor.

6. The method according to claim 5, wherein the donor subject is selected from the group consisting of related donors having HLA 10 / 10 compatibility with the subject, unrelated donors having HLA 10 / 10 compatibility with the subject, related donors having HLA 11 / 12 compatibility with the subject, related donors having HLA 12 / 12 compatibility with the subject, unrelated donors having HLA 11 / 12 compatibility with the subject, and unrelated donors having HLA 12 / 12 compatibility with the subject.

7. The method according to claim 6, wherein the donor subject is HLA 11 / 12 compatible with the recipient subject, and the donor subject and the subject share a single mismatch at the HLA-DQ locus or the HLA-DP locus in the graft-to-host direction.

8. The method according to claim 1, wherein the subject is administered the adjusted regimen before the administration of the CD34-selective allogeneic SCT graft.

9. The method according to claim 1, wherein the hematopoietic restriction type miHA antigen comprises an HA-1 epitope or an HA-2 epitope.

10. The method according to claim 9, wherein the HA-1 epitope includes SEQ ID NO:

3.

11. The method according to claim 9, wherein the HA-2 epitope includes Sequence ID No.

5.

12. The method according to claim 1, wherein the heterogeneous TCR includes SEQ ID NO: 8 and SEQ ID NO:

14.

13. The method according to claim 12, wherein the heterogeneous TCR includes sequence number 12 and sequence number 18.

14. The method according to claim 13, wherein the manipulated T cells express the nucleic acid sequence encoding SEQ ID NO:

20.

15. The method according to claim 1, wherein the manipulated T cells further express the RQR8 peptide.

16. The method according to claim 15, wherein the manipulated T cells express the nucleic acid sequence encoding SEQ ID NO:

22.

17. The method according to claim 16, wherein the manipulated T cells contain a nucleic acid sequence including SEQ ID NO: 21 or SEQ ID NO:

23.

18. Step (b) is performed before administering the manipulated T cells, (i) Perform an apheresis procedure on the T cell donor subject and collect the apheresis product, (ii) CD8 from the apheresis product ＋ Isolating T cells, (iii) CD8 ＋ Activating T cells, (iv) Said CD8 ＋ Genetically modifying T cells to knock out the endogenous TRAC gene and TRBC gene, (v) CD8 from step (iv) ＋ Genetically modifying T cells to express the heterologous TCR or CAR, thereby generating the manipulated T cells, (vi) The method according to claim 1, further comprising the proliferation of the manipulated T cells.

19. The method according to claim 18, wherein the number of stem cells in the apheresis product is not increased by the administration of a mobilizing agent to the T cell donor subject prior to the apheresis procedure.

20. Step (a) is performed before administering the CD34-selective allogeneic SCT graft. (i) Administering a recruitment agent to the graft donor, (ii) Performing an apheresis procedure on the graft donor subject and collecting the apheresis product, (iii) CD34 ＋ The method according to claim 1, further comprising isolating cells from the apheresis product to prepare the CD34-selective allogeneic SCT graft.

21. A method for treating subjects suffering from hematological malignancies, (a) CD8 from donor apheresis or leukocyte apheresis product ＋ The method involves genetically modifying T cells to knock out the endogenous TRAC and TRBC genes, thereby generating modified T cells by expressing a heterologous TCR that recognizes the hematopoietic restriction type miHA antigen expressed by the subject, wherein the donor apheresis or leukocyte removal product is obtained from a donor subject that is HLA-compatible with the subject but does not express the hematopoietic restriction type miHA antigen. (b) Administering the manipulated T cells and CD34-selective allogeneic SCT graft to the subject, wherein the CD34-selective allogeneic SCT graft is derived from the donor subject. ＋ The procedure includes administering the manipulated T cells to the subject within 72 hours after administering the CD34-selective allogeneic SCT graft to the subject, A method in which immunosuppressants targeting GVHD are not administered prophylactically to recipients in order to suppress the immune activity of T cells.

22. The method according to claim 21, wherein the manipulated T cells are administered to the subject within 24 hours after the CD34-selective allogeneic SCT graft is administered to the subject.

23. The method according to claim 1, wherein the target hematological malignancies are leukemia, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloid leukemia in acute transformation, chronic myeloid leukemia in the accelerated phase, multiple myeloma, or non-Hodgkin lymphoma.

24. The method according to claim 23, wherein the subject does not have measurable residual disease (MRD).

25. The method according to claim 23, wherein the subject has MRD or a morphologically identifiable disease.

26. The method according to claim 25, wherein the subject is refractory to at least one prior therapy.

27. The method according to claim 26, wherein the at least one prior therapy includes induction therapy and / or intensification therapy.

28. The method according to claim 25, wherein the subject has ≥ 5% myeloblasts in the bone marrow and / or detectable myeloblasts in the peripheral blood.

29. The method according to claim 28, wherein the subject has ≤25% myeloblasts in the bone marrow.

30. The method according to claim 23, wherein the subject has one or more risk factors or indicators for a poor outcome.

31. The method according to claim 30, wherein one or more risk factors or indicators for the poor outcome are selected from the group consisting of TP53 mutations, complex karyotypes, typical complex karyotypes, atypical complex karyotypes, monosomal karyotypes, 17p chromosome abnormalities, and Ph+ chromosome abnormalities.

32. The method according to claim 25, wherein the subject has up to 25% myeloblasts in the AML and bone marrow.

33. The method according to claim 23, wherein the subject comprises AML and at least one risk factor selected from the group consisting of TP53 mutation, complex karyotype, monosomal karyotype, 17p chromosome abnormality, Ph+ chromosome abnormality, and MECOM (EVI1) rearrangement.

34. The method according to claim 23, wherein the subject has AML and a detectable RUNX1-RUNX1T1 transcript, CBFB-MYH11 transcript, NPM1 mutant transcript, or FLT3-ITD transcript in the blood or bone marrow.

35. The method according to claim 25, wherein the subject has ALL and up to 25% myeloblasts in the bone marrow.

36. The method according to claim 23, wherein the subject comprises ALL and at least one risk factor selected from the group consisting of cytogenetic abnormalities defining persistent disease, Ph+ chromosome abnormalities, CRLF2 mutations, Icarus deletions, monosomy 7, and complex karyotypes.

37. The method according to any one of claims 25 to 31, wherein the subject comprises MDS, MRD, and up to 25% myeloblasts in the bone marrow.

38. The method according to claim 23, wherein the subject comprises MDS and at least one risk factor selected from the group consisting of complex karyotype, monosomal karyotype, TP53 mutation, RAS pathway mutation, JAK2 mutation, RUNX1 mutation, and ASXL1 mutation.

39. The method according to claim 1, wherein the subject is in a state suitable for hematopoietic stem cell transplantation.

40. The method according to claim 1, wherein administering the CD34-selective allogeneic SCT graft and the manipulated T cells to the subject reduces the recurrence rate of hematological malignancies, reduces the severity of recurrence of hematological malignancies, delays recurrence of hematological malignancies, increases recurrence-free survival, reduces toxicity associated with allogeneic SCT, reduces treatment-related mortality from allogeneic SCT, promotes engraftment of the CD34-selective allogeneic SCT graft, reduces immunological rejection of the CD34-selective allogeneic SCT graft, reduces GVHD after allogeneic SCT, and / or reduces the risk of GVHD after allogeneic SCT.

41. A method for producing engineered T cells for administration to a target, (a) Identifying a donor subject that is HLA-matched to the subject, or having a donor subject that is HLA-matched to the subject, (b) Collecting apheresis products from the donor subjects, or collecting apheresis products from the donor subjects, (c) Selecting CD8 ＋ T cells from the apheresis product and concentrating the CD8 ＋ T cell population to form a concentrated CD8 T cell population, and (d) In the enriched CD8+ T cell population, the CD8 ＋ Activating T cells, (e) The CD8 expresses nucleic acids encoding heterologous TCRs or chimeric antigen receptors (CARs). ＋ Genetically modifying T cells to generate the modified T cells, wherein the modified T cells express the heterologous TCR or CAR. (f) A method comprising: growing the manipulated T cells.

42. The method according to claim 40, wherein the donor subject is selected from the group consisting of related donors having HLA 10 / 10 compatibility with the subject, unrelated donors having HLA 10 / 10 compatibility with the subject, related donors having HLA 11 / 12 compatibility with the subject, related donors having HLA 12 / 12 compatibility with the subject, unrelated donors having HLA 11 / 12 compatibility with the subject, and unrelated donors having HLA 12 / 12 compatibility with the subject.

43. The method according to claim 42, wherein the donor subject is HLA 11 / 12 compatible with the recipient subject, and the donor subject and the subject share a single mismatch at the HLA-DQ locus or the HLA-DP locus in the graft-to-host direction.

44. The method according to claim 41, wherein the apheresis product is collected by apheresis or leukocyte apheresis without prior administration of a mobilizing agent to the donor subject.

45. The aforementioned CD8 ＋ Activating T cells is the CD8 ＋ T cells, (i) Soluble anti-CD3 antibody in the absence of CD28 agonist, (ii) CD3 agonist and CD28 agonist, or The method according to claim 40, comprising (iii) contacting immobilized CD3 and CD28 agonists.

46. CD8 ＋ The method according to claim 45, wherein T cells are activated for approximately 12 to approximately 24 hours.

47. The method described above involves the activation of CD8 after step (d) and before step (e). ＋ The method according to claim 41, further comprising knocking out the endogenous T cell receptor (TCR) in T cells.

48. Knocking out the endogenous T cell receptor is achieved by a Cas9 / guide RNA pre-formulated ribonucleoprotein complex targeting the TRAC and TRBC genes, and the CD8 ＋ The method according to claim 47, comprising transtransferring T cells, wherein the pre-formulated ribonucleoprotein complex comprises a guide RNA containing SEQ ID NO: 1 and a guide RNA containing SEQ ID NO:

2.

49. The CD8 expresses the heterologous TCR or CAR. ＋ The method according to claim 41, wherein the genetic modification of T cells includes introducing a vector encoding the heterologous TCR or CAR into the CD8+ T cells.

50. The method according to claim 49, wherein introducing the vector encoding the heterologous TCR or CAR into the CD8+ T cells, or transducing the CD8+ T cells with a lentiviral vector, comprises a nucleic acid sequence encoding the heterologous TCR or CAR.

51. The method according to claim 50, wherein the manipulated T cells contain five or fewer copies of the nucleic acid encoding the heterologous TCR or CAR.

52. The method according to claim 41, wherein the heterologous TCR includes a TCR having affinity for a hematopoietic restriction type miHA antigen expressed by the subject.

53. The method according to claim 52, wherein the hematopoietic restriction type miHA antigen comprises an HA-1 epitope or an HA-2 epitope.

54. The method according to claim 53, wherein the HA-1 epitope includes Sequence ID No.

3.

55. The method according to claim 53, wherein the HA-2 epitope includes Sequence ID No.

5.

56. The method according to claim 41, wherein the heterogeneous TCR includes SEQ ID NO: 8 and SEQ ID NO:

14.

57. The method according to claim 56, wherein the heterogeneous TCR includes sequence number 12 and sequence number 18.

58. The method according to claim 57, wherein the manipulated T cells express the nucleic acid sequence encoding sequence number 20.

59. The method according to claim 41, wherein the manipulated T cells further express the RQR8 peptide.

60. The method according to claim 59, wherein the manipulated T cells express the nucleic acid sequence encoding SEQ ID NO:

22.

61. The method according to claim 60, wherein the manipulated T cells contain a nucleic acid sequence comprising SEQ ID NO: 21 or SEQ ID NO:

23.

62. The method according to claim 41, wherein steps (c), (d), and (e) are performed 24 to 48 hours after step (b).

63. The method according to claim 41, wherein the propagation of the manipulated T cells comprises incubating the manipulated T cells under conditions suitable for growth for about 7 to about 14 days.

64. The method according to any one of claims 41 to 63, wherein at least 10% of the manipulated T cells have a stem cell-like phenotype.

65. The method according to claim 41, wherein the manipulated T cells kill cells expressing the antigen recognized by the heterologous TCR or CAR in an effector:target ratio of less than 0.5:

1.

66. The method according to claim 65, wherein the manipulated T cells maintain at least 50% of their cytolytic power for at least 20 days.

67. The method according to claim 41, further comprising cryopreserving the manipulated T cells after step (f).

68. The method according to claim 67, wherein the manipulated T cells are cryopreserved within approximately 9, 10, 11, 12, 13, 14, or 15 days after the apheresis product is collected from the donor subject.

69. The method according to claim 67, wherein the cryopreserved manipulated T cells, upon thawing, kill cells expressing an antigen recognized by the heterologous TCR or CAR in an effector:target ratio of less than 0.5:

1.

70. The method according to claim 67, wherein the cryopreserved manipulated T cells maintain at least 50% of their cytolytic power for at least 20 days after thawing.

71. The method according to claim 41, wherein the manipulated T cells increase the graft-versus-leukemia effect in subjects treated with allogeneic hematopoietic stem cell transplantation (allogeneic SCT) and / or reduce the risk of graft-versus-host disease in subjects treated with allogeneic SCT.

72. Ex vivo manipulated T cells produced by the method described in claim 41.

73. A method for treating a subject having a hematological malignancy, comprising administering the manipulated T cells described in claim 72 to the subject.

74. The method according to claim 73, wherein the manipulated T cells are administered to the subject in combination with allogeneic SCTs.

75. The method according to claim 74, wherein the homogeneous SCT includes a CD34-selective homogeneous SCT.

76. The method according to claim 75, wherein the manipulated T cells are administered to the subject on the same day as the CD34-selective allogeneic SCT, and no immunosuppressant targeting GVHD is administered prophylactically to the recipient subject to suppress the immune activity of the T cells.

77. The method according to claim 73, wherein the hematological malignancy includes acute myeloid leukemia, myelodysplastic syndrome, or acute lymphoblastic leukemia.

78. A nucleic acid containing a sequence that codes for SEQ ID NO: 20 or SEQ ID NO:

22.

79. The nucleic acid is (a) Sequences having at least 75% identity with sequence number 19, sequence number 21, sequence number 23, or sequence number 24, (b) The nucleic acid according to claim 78, comprising a sequence including SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO:

24.

80. It is a lentiviral vector, (a) A nucleic acid sequence encoding sequence number 20 or sequence number 22, (b) A nucleic acid sequence having at least 75% identity with SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23, and encoding the amino acid sequence of SEQ ID NO: 20 or SEQ ID NO: 22, or (c) A lentiviral vector comprising a nucleic acid sequence including SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO:

23.

81. These are manipulated T cells, (a) A nucleic acid sequence encoding sequence number 20 or sequence number 22, (b) A nucleic acid sequence having at least 75% identity with SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23, and encoding the amino acid sequence of SEQ ID NO: 20 or SEQ ID NO: 22, or (c) A lentiviral vector comprising a nucleic acid sequence including SEQ ID NO: 19, SEQ ID NO: 21, or SEQ ID NO: 23.

Images