Oligonucleotides

Abstract

The present invention relates to the field of oligonucleotides that bind to polyomavirus RNA. Such oligonucleotides can be used in the treatment of any disease or condition caused by or associated with such viruses.

Description

[Technical field]

[0001] Field The present invention relates to the field of oligonucleotides that bind to polyomavirus RNA. Such oligonucleotides can be used in the treatment of any disease or condition caused by or associated with such viruses. [Background technology]

[0002] 2. Background of the Invention Polyomaviruses are small, non-enveloped, double-stranded DNA viruses that usually inhabit mammalian and avian hosts. Infections in adults are mostly asymptomatic, but can become pathological if the immune system is compromised. Examples of human polyomaviruses include BK virus (BKV), JC virus (JCV), and Merkel cell virus (MCV).

[0003] Both JCV and BKV are opportunistic pathogens that infect humans during early childhood (Leploeg, MD et.al., Clinical Infectious Diseases, 2001). They have a high seroprevalence in adults. Both viruses are thought to remain latent in the host's kidney cells (Wunderink, HF .et.al., American Journal of Transplantation, 2017). Reactivation can occur, for example, in immunosuppressed individuals (Wunderink, HF et.al., American Journal of Transplantation, 2017;Parajuli, S.et. al., Clinical Transplantation, 2018;Gard, L. et.al., PLoS One, 2017).

[0004] Polyomaviruses share a common genomic structure. They have genes that are expressed both early and late in the infection cycle. Both early and late genes produce RNA from which various proteins are translated by differential splicing. Late genes usually code for three capsid proteins, whereas early genes code for small and large T antigens and often contain one or more alternatively spliced ​​coding regions (Helle, F. et.al., Viruses, (2017), 3; 9(17): 327, 1-18).

[0005] WO 2019 / 168402 describes antisense oligonucleotides for modulating splicing of the pre-mRNA of the large T antigen of polyomavirus. Such antisense oligonucleotides may have sequences complementary to splice donor and / or splice acceptor sites in said pre-mRNA. Summary of the Invention [Problem to be solved by the invention]

[0006] However, there remains a need for new and improved antisense oligonucleotides for the treatment of diseases or conditions caused by or associated with polyomaviruses. [Means for solving the problem]

[0007] Summary of the Invention In a first aspect, the present invention relates to an oligonucleotide comprising a nucleobase sequence according to one of SEQ ID NOs: 1 to 11 or a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11, characterized in that at least one nucleobase of said SEQ ID NO: is replaced by a nucleobase analogue which has the same base-pairing specificity as the substituted nucleobase.

[0008] In a second aspect, the present invention relates to a vector comprising (i) an oligonucleotide as defined in the first aspect, (ii) the reverse complement of an oligonucleotide as defined in the first aspect, or (iii) DNA capable of being transcribed into an oligonucleotide as defined in the first aspect.

[0009] In a third aspect, the present invention relates to a pharmaceutical composition comprising an oligonucleotide as defined in the first aspect or a vector as defined in the second aspect.

[0010] In a fourth aspect, the present invention relates to an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect or a pharmaceutical composition as defined in the third aspect for use as a medicament, in particular for use in the treatment of a polyomavirus infection in a subject.

[0011] In a fifth aspect, the present invention relates to an ex vivo method, including an ex vivo method of inhibiting polyomavirus replication in a cell and an ex vivo method of producing a graft, both of which comprise the use of an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect or a pharmaceutical composition as defined in the third aspect. [Brief description of the drawings]

[0012] Text description of the illustration image024.gif. [Figure 1]BKV T-Ag splice sites are conserved across genotypes, allowing for a "universal" ASO approach. We downloaded the full genome sequences of publicly available BKV isolates and aligned the T-Ag whole gene sequences to examine conservation across genotypes. Genotypes were identified using reference isolates listed in the literature. Findings revealed that the donor splice site of T-Ag is largely conserved across genotypes, while the acceptor splice site is more variable in non-coding intronic regions. Based on these findings, we identified nucleotide ranges overlapping with donor splice sites that show 100% sequence conservation across genotypes. A condensed phylogenetic tree of BKV T-Ag (left) and sequence logos showing splice site conservation by genotype (right). The size of the letters (nucleotides) indicates the relative occurrence of that nucleotide at that position for all genotypes. Deletions are represented as blanks or gaps in the sequence logo. Sequences are shown in Table 1. [Table 1] [Diagram 2]Multiple ASOs were designed to target the exon 1-intron donor site of the BK virus large T antigen. The targeted large T antigen donor splice sites were defined as SEQ ID NOs: 1-10 and were designed using a design algorithm developed in-house. Briefly, the algorithm considers the GC content (40-60%), melting temperature (above 48°C) and absence of CpG motifs of the antisense oligonucleotide (ASO). Each ASO candidate is assigned a score that increases if requirements are not met. In general, low-scoring ASOs are preferred over high-scoring ASOs, but the predicted secondary structure of the target RNA and the ASO as well as binding to splicing (RESCUE) enhancers and / or silencers in the target RNA are also considered. Importantly, the score considers whether the design requirements were met, but does not predict efficacy. Finally, the targetable sequence had to contain at least one exon or intron nucleotide. The light boxes define 2'-OMe-fully modified ASOs (SEQ ID NO: 12-21) derived from each of SEQ ID NO: 1-10, and the dark boxes define GapmeR oligonucleotides targeting either the exon-intron junction (SEQ ID NO: 42) or the exon 1 sequence SEQ ID NO: 43-45. A truncated ASO is shown in SEQ ID NO: 11. The ASO represented by SEQ ID NO: 11 forms part of SEQ ID NO: 5. The ASO represented by SEQ ID NO: 11 has been further modified as a 2'-OMe fully modified ASO (all nucleotides have a 2'-O-methyl base) and each internucleotide bond is a phosphorothioate bond. This further modified ASO is represented by SEQ ID NO: 22). [Diagram 3]Chemically modified ASOs targeting the BKV large T antigen exon 1-intron junction suppress BKV parameters 10-100-fold. Human primary renal tubular epithelial cells (PTECs) were treated with novel candidate 2'-OMe modified ASOs (SEQ ID NOs: 12-21) and then infected with BKV. BKV mRNA and protein expression and release of viral particles into the supernatant were examined using PCR or Western blot (n=3 replicates). Plots show fold change over scrambled control for individual ASOs in various outcome measures such as T-Ag mRNA, VP1 mRNA, VP1 protein and virus production. The dark grey thick line shows the average of the overall reduction observed with HYB_03 (20-mer, 2'O-methyl nucleotides and phosphorothioate backbone, represented by SEQ ID NO: 68), which serves as a reference. SEQ ID NO: 67 is the native RNA sequence derived from SEQ ID NO: 68. SEQ ID NO: 67 is represented by 5'-CAGCACAAACCUCUGAGCUA-3'. Variability in SEQ ID NO:12 activity is attributed to its nuclear localization and poor cell viability. Selection of new candidate sequences (SEQ ID NOs:16-19) stood out due to their high potency in suppressing BKV mRNA and protein expression as well as virus production. In general, mRNA expression and virus particle production were suppressed at least 10-fold and protein expression was reduced 100-fold upon treatment with these new 2'-OMe-modified ASO candidates compared to the 2'-OMe-modified scrambled control. [Figure 4]2'-OMe chemistry, when targeting exon 1-intron junctions, results in a greater reduction in BKV parameters than ASOs with 2'-MOE chemistry. Human primary renal tubular epithelial cells (PTEC) were treated with chemical variants of novel candidate ASOs (SEQ ID NOs: 16-19) and then infected with BKV. Expression of BKV proteins and release of viral particles into the supernatant were examined using PCR or Western blot. FAM-labeled scrambled control, HYB_03 with FAM conjugated (i.e. SEQ ID NO: 68 (+FAM)) and unlabeled HYB_03 (-FAM) (i.e. SEQ ID NO: 68 (-FAM)) were taken as references or controls (n=3 replicates). Plots show fold changes for individual ASOs relative to FAM-labeled scrambled control in various outcome measures such as VP1 protein and virus production. Interestingly, ASOs containing MOE-PS (SEQ ID NO: 23, 24, 25, 27, 28, 29, 31, 32, 33, 35, 36, 37, 38, or 69) showed significantly lower BKV-inhibitory activity, whereas mutants of OMe-PS (SEQ ID NO: 17, 18, 19, 22, 26, 30, 34, 38, and 68, HYB_03) showed strong inhibition of protein expression and virus production. The presence of 5'-methylcytidine did not seem to inhibit the efficacy of the ASOs. Besides HYB_03 (SEQ ID NO: 68), the four most effective ASOs were SEQ ID NO: 30, 18, 34, and 19, which were selected as the most promising candidates. [Diagram 5] Oligonucleotide SEQ ID NO:19 strongly reduces BKV-infected cells after "reinfection". A reinfection assay was performed to determine whether ASOs limit the generation of active virus. Thereby, human proximal tubule epithelial cells were treated with a scrambled control and one of several ASOs showing activity against BKV (HYB_03 (SEQ ID NO:68), SEQ ID NO:26, SEQ ID NO:17, SEQ ID NO:34, SEQ ID NO:19). Human PTECs were pretreated with ASOs (24 hours prior to infection) and infected with BKV, after which the cells were cultured for 7 days. Culture supernatants were harvested on day 7 and 10-fold diluted and placed on freshly plated PTECs for 3 days. Cells were stained for nuclei (DAPI) and protein expression of large T antigen. [Figure 6] Oligonucleotide SEQ ID NO:19 strongly reduces BKV-derived RNA, protein and viral DNA after "reinfection". A reinfection assay was performed to determine whether ASOs limit the production of active virus. Thereby, human proximal tubular epithelial cells were treated with a scrambled control and one of several ASOs that show activity against BKV (HYB_03 (SEQ ID NO:68), SEQ ID NO:26, SEQ ID NO:17, SEQ ID NO:34, SEQ ID NO:19). Human PTECs were pretreated with ASOs (24 hours prior to infection) and infected with BKV, after which the cells were cultured for 7 days. Culture supernatants were harvested on day 7 and 10-fold diluted and placed on freshly plated PTECs for 3 days, at which point we assessed the production levels of large T mRNA, VP1 mRNA and protein, and viral DNA. [Figure 7]Splice-targeting ASO induces aberrant splicing of early coding region pre-mRNA with a shift from large T antigen to small t antigen. Mouse Balb / c cells were transformed with pRPc vector containing the early coding region of the Gardner strain of BK virus (Negrini, M. et al., Cancer Research, 1992). This promotes constitutive expression of the early coding region of BKV in these cells, as evidenced by abundant expression of large T antigen mRNA (product 1) and small t antigen mRNA (product 3). Scrambled control, HYB_03 (SEQ ID NO: 68) and SEQ ID NO: 19 were administered at a concentration of 25 nM by lipofectamine, and RNA was harvested 24 hours after treatment. Mismatch controls of SEQ ID NO:19 (single mismatch at 10 nucleobase (SEQ ID NO:39), double mismatch at 5 and 10 nucleobase (SEQ ID NO:40) and triple mismatch at 5, 10 and 15 nucleobase (SEQ ID NO:41)) were administered at 25 nM by lipofectamine and RNA was harvested 24 hours after treatment. Note: These cells were kindly provided by Professor Massimo Negrini (University of Ferrara, Italy). Treatment with HYB_03 and SEQ ID NO:19 dramatically affected the splicing and expression levels of early coding region pre-mRNA, clearly shifting it from large T antigen as the major product (band 1) to various RNA products including an increase in small t antigen (band 3). Introduction of one mismatch partially restores normal splicing, whereas 2-3 mismatches almost completely restore splicing of the major RNA species, large T antigen. These data provide clear evidence of target engagement and specificity. [Figure 8]Large T antigen splice targeting GapmeR does not induce aberrant splicing and causes a modest reduction in large T antigen mRNA. Mouse Balb / c cells were transformed with a pRPc vector containing the early coding region of the Gardner strain of BK virus (Negrini, M. et al., Cancer Research, 1992). This promotes constitutive expression of the early coding region of BKV in these cells, as evidenced by abundant expression of large T antigen mRNA (product 1) and small t antigen mRNA (product 3). In contrast to antisense oligonucleotides that use steric hindrance to regulate splicing, a GapmeR derived from the sequence of SEQ ID NO: 19 was designed and administered by lipofectamine at a concentration of 25 nM, and RNA was harvested 24 hours after treatment. A version of the GapmeR of SEQ ID NO: 19 was administered by lipofectamine at a concentration of 25 nM, and RNA was harvested 24 hours after treatment (SEQ ID NO: 42), but no significant activity was observed in terms of large T antigen RNA expression levels or small t antigen RNA expression levels. Additional GapmeRs (SEQ ID NO: 43-45) targeting exon 1 of the early coding region (pre)-mRNA did not induce a significant reduction in early coding region mRNA. Thus, GapmeRs did not affect T antigen splicing as much as previously observed with ASOs HYB_03 (SEQ ID NO: 68) and SEQ ID NO: 19 targeting splice sites. These findings indicate that GapmeRs can degrade target mRNAs, but splicing of the target mRNA is largely unaffected. Note: These cells were kindly provided by Professor Massimo Negrini (University of Ferrara, Italy). [Figure 9]PBMC viability is not affected by treatment with SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:19. Healthy human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of four different donors and incubated in the presence of increasing concentrations of ASO for 48 hours. After incubation, cell viability was measured using the CellTiter-Blue viability assay. PBMCs were incubated at 65°C for 10 minutes as a positive control. As an additional control, PBMCs were activated with 1 μM R848 (TLR7 / 8 agonist) and all conditions were compared to saline-treated controls. Cell viability is expressed as a percentage of saline-treated controls. As shown, no viable cells were detected in the positive control incubated at 65°C, while ASO-treated PBMCs had no significant effect on cell viability after 48 hours. [Figure 10] Treatment with SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:19 minimizes activation of inflammatory cytokine responses in PBMCs. Healthy human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of four different donors and incubated in the presence of increasing concentrations of ASOs for 48 hours. After incubation, supernatants were harvested to measure cytokine production. As a positive control, PBMCs were activated with 1 μM R848 (TLR7 / 8 agonist, data not shown) and all conditions were compared to saline-treated controls. The relative production and release of six cytokines in response to exposure to SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:19 is shown in the left figure. In response to ASO treatment, a mild, transient increase in the levels of some cytokines is observed, but never to the same extent as in the R848-treated control. The data represent that cytokines were within the limits of detection in all four donors. [Figure 11]Treatment with SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:19 minimizes activation of pro- and anti-inflammatory cytokines in PBMCs. Healthy human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of four different donors and incubated for 48 hours in the presence of increasing concentrations of SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:19. After incubation, supernatants were harvested to measure cytokine production. As a positive control, PBMCs were activated with 1 μM R848 (TLR7 / 8 agonist, data not shown) and all conditions were compared to saline-treated controls. The relative production and release of six cytokines in response to treatment with SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 and SEQ ID NO:19 is shown in the left panel. In response to ASO treatment, a mild, transient increase in the levels of some cytokines is observed, but never to the same extent as in the R848-treated control. The data represent that cytokines were within the detection limits in two of the four donors. [Figure 12] Exposure of human plasma to oligonucleotides with SEQ ID NO:19, SEQ ID NO:30, SEQ ID NO:18, or SEQ ID NO:34 has only minimal effect on plasma clotting time. Increasing concentrations of ASO were added to normal human plasma, and then the intrinsic pathway of the coagulation cascade was activated using the activated partial thromboplastin time (aPTT) test. ASO conditions were compared to saline-treated control plasma. Activation of the intrinsic coagulation cascade in saline-treated control plasma resulted in a clotting time of 33.8 seconds. Addition of SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34, and SEQ ID NO:19 to plasma prolonged the clotting time in a dose-dependent manner. Data represent n=1. [Figure 13] BKV-targeted ASO is clearly taken up by the proximal and distal tubules of mouse renal cortex. [Figure 13-A]Nine week old male C57BL6 mice were injected intravenously with 40 mg / kg of HYB_03 (SEQ ID NO:68), SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 or SEQ ID NO:19 on days 0, 3, 7 and 10. These mice were compared to saline treated mice. Group size was 5 mice per group for each time point. [Figure 13-B] Visual evidence of high levels of SEQ ID NO:19 distribution in the kidney, particularly in the proximal tubule epithelial cells, as evidenced by staining with a specific Cy5-labeled FISH probe (SEQ ID NO:19). Individual segments of the nephron are defined as glomerulus ("glom"), proximal tubule epithelial cells ("prox"), distal tubule epithelial cells ("dist"), and collecting duct epithelium ("coll") based on immunohistochemical staining for nephron ("glom"), LTL ("prox"), E-cadherin ("dist"), and aquaporin-2 ("coll"). In B) (right image), trace amounts of SEQ ID NO:19 are detected in the medullary portion of the kidney (see arrow). [Figure 14] Hybridization ELISA analysis of SEQ ID NO: 19 uptake for kidney and high blood flow organs. 9 week old male C57BL6 mice were intravenously injected with 40 mg / kg HYB_03 (SEQ ID NO: 68), SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19 on days 0, 3, 7, 10 and compared to saline treated animals (n=5 mice / group). Results of experiments performed with SEQ ID NO: 19 are shown. Left panel: Quantification of SEQ ID NO: 19 levels in both kidney (left and right), liver, spleen and lungs is shown. It was found that there was approximately 2.5-fold (relative) uptake in kidney compared to liver per gram of tissue. Similarly, a higher relative uptake was observed in kidney compared to lung and spleen. Right panel: Tissue levels of individual mice are shown, showing a consistent tissue distribution profile in vivo. [Figure 15]No signs of kidney or liver damage were observed in the serum of mice after multiple doses of SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 or SEQ ID NO:19 over a 2 week period. Nine week old male C57BL6 mice were intravenously injected with 40 mg / kg of HYB_03 (SEQ ID NO:68), SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 or SEQ ID NO:19 on days 0, 3, 7 and 10 and compared to saline treated animals. 14 days after the first dose, serum levels of kidney and liver function markers were examined (n=5 mice / group). Top panel: serum biomarker values ​​indicative of organ function and / or injury for kidney (creatinine, urea, albumin) and liver (AST, ALT). Although slight differences were detected between some groups, no signs of kidney or liver damage were observed as all levels were within normal range. [Figure 16] Repeated administration of SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 or SEQ ID NO:19 over a 2 week period shows no signs of kidney damage. Nine week old male C57BL6 mice were intravenously injected with 40 mg / kg HYB_03 (SEQ ID NO:68), SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 or SEQ ID NO:19 on days 0, 3, 7, 10 and compared to saline treated animals (n=5 mice / group). Representative images of Sirius Red staining (upper panel) and KIM-1 staining (lower panel) of kidneys at sacrifice. As can be seen from the figures above, administration of saline (0.9% NaCl) or ASO showed no signs of ASO-associated kidney damage. Images were compared to positive control (ischemia-reperfusion injury, IRI). B. Quantification of Sirius Red staining in kidneys on day 14. Three animals administered ASO showed increased collagen content in the kidney (HYB_03: n=2, SEQ ID NO:34: n=1), but this was not clearly attributable to ASO administration, but rather to a possible higher number of major blood vessels in the images used for quantification. [Figure 17] ASO according to the present invention has improved antiviral activity. PTECs were treated with ASO 24 hours before BKV infection, and BKV RNA expression was quantified 5 days after infection. [Figure 17-A]Relative T-Ag and VP1 RNA expression of cells treated with ASO8 (SEQ ID NO: 8), ASO23 (SEQ ID NO: 23 in WO 2019 / 168402) and ASO24 (SEQ ID NO: 24 in WO 2019 / 168402). [Figure 17-B] Relative VP1 protein expression in cells treated with ASO8, ASO23 and ASO24. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] Detailed Description of the Invention Before the present invention is described in detail below, it should be understood that the present invention is not limited to the specific methodology, protocols, and reagents described herein, which may vary. It should also be understood that the terms used herein are for the purpose of describing specific embodiments only, and are not intended to limit the scope of the present invention, which is limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.

[0014] Preferably, the terms used herein are defined as set forth in “A multilingual glossary of biotechnological terms: (IUPAC Recommendations)”, Leuenberger, HGW, Nagel, B. and Koelbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland).

[0015] Throughout the text of this specification, several documents are cited. Each document cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, is hereby incorporated by reference in its entirety.

[0016] The elements of the present invention are described below. Although these elements are listed with specific embodiments, it should be understood that they can be combined in any manner and in any number to create additional embodiments. The various described examples and preferred embodiments should not be construed as limiting the present invention to only the embodiments explicitly described. The description should be understood to support and encompass embodiments combining the explicitly described embodiments with any number of the disclosed and / or preferred elements. Furthermore, any permutation and combination of all elements described in this application should be considered to be disclosed by the description of this application unless the context dictates otherwise.

[0017] Throughout this specification and the claims that follow, unless the context clearly dictates otherwise, the word "comprise" and variations such as "comprises" and "comprising" are understood to mean the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of other integers or steps or group of integers or steps. In a preferred embodiment, "comprise" means "consisting of." As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the content clearly dictates otherwise.

[0018] In a first aspect, the present invention relates to an oligonucleotide, in particular an oligonucleotide comprising a nucleobase sequence having the base-pairing specificity of a nucleobase sequence according to one of SEQ ID NOs: 1-11.

[0019] Typically, this oligonucleotide comprises a nucleobase sequence according to one of SEQ ID NOs: 1 to 11 or a nucleobase sequence similar to any one of SEQ ID NOs: 1 to 11, characterized in that at least one nucleobase of said SEQ ID NO: is replaced by a nucleobase analogue, which has the same base-pairing specificity as the substituted nucleobase.

[0020] The basic structure of an oligonucleotide The oligonucleotide of the present invention can specifically bind to polyomavirus pre-mRNA ("target RNA") produced upon polyomavirus infection of human cells. It can therefore also be described as a polyomavirus oligonucleotide or antisense oligonucleotide ("ASO") or polyomavirus antisense oligonucleotide. A portion of the target RNA (i.e., a stretch of contiguous nucleobases) to which an oligonucleotide can specifically bind is referred to herein as a "target region."

[0021] In a preferred embodiment, at least a portion of the oligonucleotide is at least substantially complementary to the target region. Thus, the oligonucleotide comprises at least 12 contiguous nucleobases having a sequence that is the reverse complement of the sequence of at least 12 contiguous nucleobases of the target region. Preferably, the target region is 12-30 nucleobases long, i.e. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases long or 12-28 nucleobases long. More preferably, the target region is 17-26, i.e. 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleobases long. Even more preferably, the target region is 18-22, i.e. 18, 19, 20, 21 or 22 nucleobases long. Most preferably, the target region is 20 nucleobases long.

[0022] Typically, the target region comprises a polyomavirus pre-RNA. The target region preferably comprises the splice donor site of intron 1 (or a part thereof) and / or exon 1 (or a part thereof) of the large T antigen of the respective polyomavirus. Preferably, the target region comprises up to 30 contiguous nucleobases of intron 1 and / or (preferably and) exon 1, with 0 to 30 of the 30 contiguous nucleobases, i.e. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleobases being those of the splice donor site of intron 1 and the remaining contiguous nucleobases being those of exon 1. In a preferred embodiment, the target region comprises one or two intronic nucleobases adjacent to the splice donor site. In a preferred embodiment, the target region comprises 1 to 28, i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 intronic nucleobases adjacent to the splice donor site. In another preferred embodiment, the target region comprises 1 to 28, i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 exon nucleobases adjacent to the splice donor site.

[0023] It is understood that the total number of nucleobases in the introns and exons does not exceed the total number of nucleobases in the oligonucleotide.

[0024] In one embodiment, an oligonucleotide is not capable of specifically binding to a target RNA and may contain nucleobases that are not reverse complementary to the target RNA, particularly in relation to a contiguous sequence that is reverse complementary to the target RNA.

[0025] The length of the oligonucleotide may be up to 200, up to 175 or up to 150, preferably up to 100, more preferably up to 50 nucleobases in length (including nucleotides and nucleotide analogues), for example 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleobases in length. When the oligonucleotide is longer than 50 nucleotides in length (e.g. when it is 75, or 100, or 150 or 200 nucleotides in length), the oligonucleotide may alternatively be referred to as a polynucleotide. In a preferred embodiment, the oligonucleotide is 12 to 27, preferably 12 to 22, i.e. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 nucleobases, more preferably 17, 18, 19 or 20 to 22 nucleobases, i.e. 17, 18, 19, 20, 21 or 22 nucleotides. In a preferred embodiment, the oligonucleotide is 20 nucleobases in length.

[0026] Specifically, the first aspect relates to an oligonucleotide comprising a nucleobase sequence (or nucleotide sequence) having the base pairing specificity of a nucleobase sequence according to one of SEQ ID NOs: 1 to 11. This means that the nucleobase sequence of the oligonucleotide comprises a nucleobase sequence according to one of SEQ ID NOs: 1 to 11 or comprises a nucleobase sequence similar to one of SEQ ID NOs: 1 to 11. By "similar" it is meant that at least one nucleobase of said SEQ ID NO is characterized in that it is replaced by a nucleobase analogue having the same base pairing specificity as the replaced nucleobase. The nucleobase analogue is a modification as explained below. Preferred embodiments relate to SEQ ID NOs: 5, 6, 7, 8 and 10, preferably SEQ ID NO: 8. Wherever compatible, the above-mentioned oligonucleotide embodiments apply. In a preferred embodiment, the nucleobase sequence (or nucleotide sequence) of the oligonucleotide consists of a nucleobase sequence according to one of SEQ ID NOs: 1 to 11 or the nucleobase sequence of the oligonucleotide consists of a nucleobase sequence similar to one of SEQ ID NOs: 1 to 11.

[0027] Oligonucleotide Modifications Oligonucleotides may be modified (herein referred to as "modified oligonucleotides"), which is expected to improve their stability, particularly their resistance to nucleases, which is advantageous when the oligonucleotide is administered directly to a patient (i.e., naked).

[0028] Thus, in one embodiment, the oligonucleotide is a modified oligonucleotide. In one embodiment, the modification of said oligonucleotide is compared to a (natural) RNA oligonucleotide. The modified oligonucleotide comprises a modified internucleotide bond and / or a modified nucleotide. Modified nucleotide is synonymous with nucleotide analogue.

[0029] In a preferred embodiment, the oligonucleotide comprises a modification capable of rendering the RNA duplex resistant to nucleases (preferably exonucleases, in particular RNase H), the RNA duplex comprising an oligonucleotide and an oligonucleotide at least partially complementary thereto (complementary oligonucleotide, i.e. target RNA). In other words, the oligonucleotide provides resistance to nuclease degradation of the RNA duplex comprising the oligonucleotide and the oligonucleotide at least partially complementary thereto. This is preferably provided by internucleotide bond modifications (e.g. phosphorothioate modified nucleotides and / or sugar (backbone) modifications (e.g. 2'-O-modified sugar modifications)) as described above. Thus, the oligonucleotide preferably comprises a region (i.e. at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 modified nucleotides) having a modification that provides nuclease resistance to the duplex.

[0030] Modified oligonucleotides may contain nucleotide analogs and / or modified internucleotide linkages. When each of the internucleotide linkages is modified, the oligonucleotide is said to be "backbone modified."

[0031] A nucleotide analogue is preferably a nucleotide that contains a base modification (a "modified base") and / or a sugar modification (a "modified sugar", also called a backbone modification). In one embodiment, the base modifications are modified versions of natural purine and pyrimidine bases (e.g., adenine, uracil, guanine, cytosine and thymine), such as hypoxanthine, pseudouracil, pseudocytosine, 1-methylpseudouracil, orotic acid, agmatidine, lysine, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), G-clamps and derivatives thereof, 5-substituted pyrimidines (e.g., 5-halouracil, 5-halomethyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5'-methylcytosine, 5'-methylcytidine, 5-hydroxymethylcytosine, Super T, or bases such as those described in, for example, Kumar et al. J. Org. Chem. 2014, 79, 5047;Leszczynska et al. Org. Biol. Chem. 2014, 12, 1052), pyrazolo[1,5-a]-1,3,5-triazine C-nucleosides (e.g., as described in Lefoix et al. J.Org.Chem.2014,79,3221), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, boronated cytosine (e.g., as described in Niziol et al. Bioorg. Med. Chem. 2014, 22, 3906), pseudoisocytidine, C(Pyc) (e.g., as described in Yamada et al. Org. Biomol. Chem. 2014, 12, 2255) and N4-ethylcytosine or their derivatives; 2 -Cyclopentylguanine (cPent-G), N 2 -Cyclopentyl-2-aminopurine (cPent-AP) and N 22-propyl-2-aminopurine (Pr-AP), sugar-modified uracil (e.g., as in Kaura et al. Org. Lett. 2014, 16, 3308), amino acid-modified uracil (e.g., as in Guenther et al. Chem. Commun. 2014, 50, 9007); or derivatives thereof; or degenerate bases, e.g., 2,6-difluorotoluene, or deleted bases, e.g., universal bases or abasic sites (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen is replaced by nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in US Patent No. 6,683,173 (Epoch Biosciences), and cPent-G, cPent-AP and Pr-AP have been shown to reduce the immunostimulatory effect when incorporated into siRNA (Peacock H. et al. J. Am. Chem. Soc. 2011, 133, 9200). Further examples of modified bases are described, for example, in WO 2014 / 093924.

[0032] Preferred modified bases are 5'-methylcytosine and 5'-methylcytidine. In a preferred embodiment, all cytosines in the oligonucleotide are modified (ie substituted) as 5'-methylcytosine or, preferably, 5'-methylcytidine.

[0033] In general, nucleobase analogues are used to replace the nucleobases with the same base pairing specificity in at least a portion of the oligonucleotides that are complementary to the target region. "Base pairing" refers to two nucleobases bonded to each other by hydrogen bonds.Specifically, the nucleobase analogues that are replaced by cytosine can base pair with guanine, the nucleobase analogues that are replaced by guanine can base pair with cytosine, the nucleobase analogues that are replaced by adenine can base pair with uracil, and the nucleobase analogues that are replaced by uracil can base pair with adenine.

[0034] An oligonucleotide may contain at least one, such as at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 base modifications. These may all be the same type of modification or may contain two or more different modifications.

[0035] The sugar (backbone) modification may be a modification of the ribosyl moiety, such as 2'-O-modified nucleotides, such as 2'-O-alkyl or 2'-O-(substituted) alkyl, e.g., 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2'-O-acetal esters (e.g., Biscans et al. Bioorg. Med. Chem. 2015, 23, 5360), 2'-O-allyl, 2'-O-(2S-methoxypropyl), 2'-O-(N-(aminoethyl)carbamoyl)methyl) (2'-AECM), 2'-O-(2-carboxyethyl) and carbamoyl derivatives (Yamada et al. Org. Biomol. Chem. 2014, 12, 6457), 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy(DNA); 2'-O-(haloalkoxy)methyl (Arai K. et al. Bioorg. Med. Chem. 2011, 21, 6285) such as 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy)methyl (DCEM); 2'-O-alkoxycarbonyl such as 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] (DCME), 2'-O-[2-(methylthio)ethyl] (2'-MTE), 2'-(ω- O-serinol); 2'-halo, e.g., 2'-F, FANA (2'-F arabinosyl nucleic acid); 2',4'-difluoro-2'-deoxy; carba- and aza-sugar modifications; other modified RNA nucleotides such as 3'-O-substituted (e.g., 3'-O-methyl, 3'-O-butyryl, 3'-O-propargyl), 4'-substituted (e.g., 4'-aminomethyl-2'-O-methyl or 4'-aminomethyl-2'-fluoro; 5'-substituted, e.g., 5'-methyl) or CNA (Ostergaard et al. ACS Chem. Biol. 2014, 22, 6227).Derivatives of the foregoing are also contemplated.

[0036] Additionally, sugar (backbone) modifications may include bicyclic nucleic acid monomers (BNAs), which may be bridged nucleic acid monomers. Each occurrence of said BNA can be a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, a xylo-LNA monomer, an α-LNA monomer, an α-L-LNA monomer, a β-D-LNA monomer, a 2'-amino-LNA monomer, a 2'-(alkylamino)-LNA monomer, a 2'-(acylamino)-LNA monomer, a 2'-N-substituted-2'-amino-LNA monomer, a 2'-thio-LNA monomer, a (2'-O,4'-C) constrained ethyl (cEt) BNA monomer, a (2'-O,4'-C) constrained methoxyethyl (cMOE) BNA monomer, a 2',4'-BNANC(NH) monomer, a 2',4'-BNANC(N-Me) monomer, a 2',4'-BNANC(N-Bn) monomer, an ethylene-bridged nucleic acid (ENA) monomer, a carba LNA (cLNA) monomer, a 3,4-dihydro- This may result in monomers independently selected from the group consisting of 2H-pyran nucleic acid (DpNA) monomers, 2'-C-bridged bicyclonucleotide (CBBN) monomers, heterocyclic bridged BNA monomers (such as triazolyl or tetrazolyl linkages), amide bridged BNA monomers, urea bridged BNA monomers, sulfonamide bridged BNA monomers, bicyclic carbocyclic nucleotide monomers, TriNA monomers, α-L-TriNA monomers, bicycloDNA (bcDNA) monomers, F-bcDNA monomers, tricycloDNA (tcDNA) monomers, F-tcDNA monomers, oxetane nucleotide monomers, locked PMO monomers derived from 2'-amino-LNA, guanidine bridged nucleic acid (GuNA) monomers, spirocyclopropylene bridged nucleic acid (scpBNA) monomers and derivatives thereof.

[0037] Preferred sugar modifications are selected from the group consisting of 2'-O-modifications, preferably 2'-O-alkyl or 2'-O-(substituted)alkyl, more preferably 2'-O-methyl or 2'-O-(2-methoxy)ethyl (2'-MOE) and modifications to BNA monomers, preferably CRN monomers or locked nucleic acid (LNA) monomers. More preferred is a combination of 2'-O-methyl sugar modifications and modifications to LNA. Even more preferred is 2'-O-methyl as the only sugar modification.

[0038] An oligonucleotide can comprise at least one, such as at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 sugar modifications. These can all be the same type of modification or can comprise two or more different modifications.

[0039] Internucleotide linkage modifications include phosphorothioate (PS), chirally pure phosphorothioate, (R)-phosphorothioate, (S)-phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate (thioPACE), thiophosphonoacetamide, phosphorothioate prodrug, H-phosphonate, methyl phosphonate, methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, borane phosphate, borane phosphorothioate, methyl borane phosphate, methyl borane phosphorothioate, methyl borane phosphonate, methyl borane phosphonothioate. Further modifications that may be selected from the group consisting of modified phosphodiesters of RNA, such as phosphates, phosphotriesters, aminoalkylphosphotriesters and derivatives thereof include phosphorylguanidine, phosphoramidite, phosphoramidate, N3'→P5' phosphoramidate, phosphorodiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, formacetyl, thioformacetyl, methyleneformacetyl, alkenyl, methylenehydrazino, sulfonamide, amide, triazole, oxalyl, carbamate, methyleneimino (MMI), thioacetamide nucleic acid (TANA); and derivatives thereof. Examples of chirally pure phosphorothioate bonds are described, for example, in WO 2014 / 010250 or WO 2017 / 062862 (WaVe Life Sciences). Examples of phosphorylguanidine linkages are described in WO 2016 / 028187 (Noogen). As well as 3'→3' and 2'→5' linkages, various salts, mixed salts and free acid forms are also included.

[0040] An oligonucleotide may comprise at least one, such as at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 internucleotide linkage modifications. These may all be the same type of modification or may comprise two or more different modifications.

[0041] Preferred internucleotide bond modifications are PS, PS2, phosphoramidate or phosphorodiamidate, preferably PS. In a preferred embodiment, all internucleotide bonds of the oligonucleotide are PS bonds. In other words, the backbone of the oligonucleotide is PS.

[0042] In one embodiment, one or more nucleotides at the 5'-end of the oligonucleotide and / or one or more nucleotides at the 3'-end of the oligonucleotide are modified (i.e., are nucleotide analogs and / or have modified internucleotide bonds), and nucleotides in the central portion of the oligonucleotide are unmodified. "5'-end or 3'-end nucleotides" encompass 20% of the nucleotides of the oligonucleotide at each end, and "central portion" encompasses the remaining nucleotides of the oligonucleotide. For example, if an oligonucleotide has a sequence of 20 nucleotides, the 4 nucleotides at the 5'-end of the oligonucleotide are 5'-end nucleotides, the 4 nucleotides at the 3'-end of the oligonucleotide are 3'-end nucleotides, and the remaining 12 nucleotides are central portion nucleotides of the oligonucleotide. If the number of nucleotides by percentage does not equal an integer, it is rounded to the nearest integer (down in the case of a first decimal up to 4 and up in the case of a first decimal at least 5). Thus, in one embodiment, at least one nucleotide and / or at least one internucleotide bond at the 5'-end and / or 3'-end of the oligonucleotide is modified, while the other nucleotides and other internucleotide bonds are unmodified.

[0043] All included modifications are as defined herein. It is expected that modifying an oligonucleotide at such locations may contribute to improving its stability or resistance to exonucleases, which may be advantageous when the oligonucleotide is administered directly to a patient (i.e., naked).

[0044] In one embodiment the last 1, 2, 3, 4 nucleotides and / or internucleotide linkages at the 5' of the oligonucleotide are modified.

[0045] In one embodiment the last 1, 2, 3, 4 nucleotides and / or internucleotide linkages at the 3' of the oligonucleotide are modified.

[0046] In one embodiment, the last 1, 2, 3, 4 nucleotides and / or internucleotide bonds at the 5' and 3' ends of the oligonucleotide are modified. Preferably, 2 nucleotides and / or 2 internucleotide bonds at the 5' and 3' ends of the oligonucleotide are modified. Preferably, 3 nucleotides and / or internucleotide bonds at the 5' and 3' ends of the oligonucleotide are modified. Preferably, 4 nucleotides and / or internucleotide bonds at the 5' and 3' ends of the oligonucleotide are modified.

[0047] For example, with respect to SEQ ID NOs: 1-10, the oligonucleotide comprises an unmodified internucleotide bond between nucleotides 5-16 of SEQ ID NOs: 1-10 and modified internucleotide bond between at least the two most 5'-terminal nucleotides of the oligonucleotide and between at least the two most 3'-terminal nucleotides of the oligonucleotide. For example, with respect to SEQ ID NO: 11, the oligonucleotide comprises an unmodified internucleotide bond between nucleotides 5-15 of SEQ ID NO: 11 and modified internucleotide bond between at least the two most 5'-terminal nucleotides of the oligonucleotide and between at least the two most 3'-terminal nucleotides of the oligonucleotide.

[0048] It is preferred that at least one, preferably two to four, more preferably four, and optionally all, nucleotides at the 5' and / or 3' end of the oligonucleotide are modified, particularly by having a modified internucleotide bond.

[0049] The modification of the nucleotide, especially at the 5' and / or 3' end, preferably comprises a modified internucleotide bond, more preferably a modified internucleotide bond to PS. Furthermore, the nucleotide is preferably a nucleotide analogue. The nucleotide analogue is characterized in that it comprises a modified sugar (preferably 2'-O-methyl), a modified base (preferably 5'-methylcytosine) and / or is an LNA monomer. For example, the following combinations characterizing a nucleotide analogue are envisaged: only modified sugar; modified sugar and modified base; only LNA monomer; LNA monomer and modified base.

[0050] In a preferred embodiment, all internucleotide bonds of the oligonucleotide are PS bonds, and all nucleotides of the oligonucleotide have 2'-O-methyl bases.Therefore, preferably, all cytidines of the oligonucleotide are modified to 5-methylcytidines (i.e., the oligonucleotide is composed of no cytidines, but 5-methylcytidines, particularly at positions that are paired with guanosines of the target RNA).

[0051] Thus, in one embodiment, when referring to modifications at the 5' and / or 3' ends of an oligonucleotide, such modifications are as follows: - the modified internucleotide linkage is PS, and / or - the modified sugar is 2'-O-methyl; - the modified base is 5-methylcytosine, and / or - the modified nucleotide is a Locked Nucleic Acid (LNA) monomer.

[0052] Thus, in one embodiment, when referring to modifications at the 5' and / or 3' ends of an oligonucleotide, such modifications are as follows: - the modified internucleotide linkage is PS, - the modified sugar is 2'-O-methyl; - the modified base is 5-methylcytosine, and / or - the modified nucleotide is a Locked Nucleic Acid (LNA) monomer.

[0053] Preferably, such modifications are as follows: - the modified internucleotide linkage is PS, and - the modified sugar is 2'-O-methyl.

[0054] Preferably, such modifications are as follows: - the modified internucleotide linkage is PS, - the modified sugar is 2'-O-methyl, and - The modified base is 5-methylcytosine.

[0055] Preferably, such modifications are as follows: - the modified internucleotide linkage is PS, and - the modified nucleotide is a Locked Nucleic Acid (LNA) monomer.

[0056] Preferably, such modifications are as follows: - the modified internucleotide linkage is PS, - the modified nucleotide is a locked nucleic acid (LNA) monomer, and - The modified base is 5-methylcytosine.

[0057] In one embodiment, the oligonucleotide is such that: the internucleotide linkages in the central portion of the oligonucleotide are unmodified and preferably the two to four most 5'-terminal and / or the two to four most 3'-terminal internucleotide linkages of the oligonucleotide are modified, preferably as phosphorothioate internucleotide linkages.

[0058] In one embodiment, the oligonucleotide is modified as follows: each internucleotide linkage is a phosphorothioate linkage and all nucleotides have a 2'-O-methyl base.

[0059] In a preferred embodiment, the oligonucleotide is modified as follows: each internucleotide linkage is a phosphorothioate linkage, all cytidines are 5'-methylcytidines, and all nucleotides have a 2'-O-methyl base.

[0060] Exemplary preferred oligonucleotides are characterized as follows. - each internucleotide bond is a phosphorothioate bond and all nucleotides have a 2'-O-methyl base, e.g. an oligonucleotide having a nucleotide sequence comprising or consisting of the sequence SEQ ID NO:12 (nucleobase sequence of SEQ ID NO:1), SEQ ID NO:13 (nucleobase sequence of SEQ ID NO:2), SEQ ID NO:14 (nucleobase sequence of SEQ ID NO:3), SEQ ID NO:15 (nucleobase sequence of SEQ ID NO:4), SEQ ID NO:16 (nucleobase sequence of SEQ ID NO:5), SEQ ID NO:17 (nucleobase sequence of SEQ ID NO:10), SEQ ID NO:18 (nucleobase sequence of SEQ ID NO:7), SEQ ID NO:19 (nucleobase sequence of SEQ ID NO:8), SEQ ID NO:20 (nucleobase sequence of SEQ ID NO:9), SEQ ID NO:21 (nucleobase sequence of SEQ ID NO:10) or SEQ ID NO:22 (nucleobase sequence of SEQ ID NO:11). - an oligonucleotide having a nucleotide sequence in which each internucleotide bond is a phosphorothioate bond, all cytidines are 5'-methylcytidines and all nucleotides have a 2'-O-methyl base, such as comprising or consisting of the sequence SEQ ID NO: 26 (nucleobase sequence of SEQ ID NO: 11), SEQ ID NO: 30 (nucleobase sequence of SEQ ID NO: 6) or SEQ ID NO: 34 (nucleobase sequence of SEQ ID NO: 7).

[0061] Thus, in a preferred embodiment, the oligonucleotide comprises a nucleotide sequence according to any one of SEQ ID NOs: 12 to 22, 26, 30 and 34. In a more preferred embodiment, the nucleotide sequence of the oligonucleotide consists of a nucleotide sequence according to any one of SEQ ID NOs: 12 to 22, 26, 30 and 34. In these embodiments, SEQ ID NOs: 17 to 19, 26, 30 and 34 are preferred, of which SEQ ID NOs: 19, 26, 30 and 34, in particular SEQ ID NO: 19 is preferred.

[0062] Thus, in one embodiment, the oligonucleotide consists of SEQ ID NO: 19, 34, 17, 18, 30 or 26 and shows attractive therapeutic activity as demonstrated in the experimental part (see, for example, Figures 4, 5, 6). In this embodiment, the oligonucleotide may be further modified as defined herein above.

[0063] Thus, in one embodiment, the oligonucleotide comprises SEQ ID NO: 19 or 8. In one embodiment, such an oligonucleotide is between 20 and 100 nucleotides in length. In one embodiment, the oligonucleotide consists of SEQ ID NO: 19 or 8. In this embodiment, the oligonucleotide may be further modified as defined herein above.

[0064] Thus, in one embodiment, the oligonucleotide comprises SEQ ID NO: 34 or 18 or 7. In one embodiment, such oligonucleotide is 20-100 nucleotides in length. In one embodiment, the oligonucleotide consists of SEQ ID NO: 34 or 18 or 7. In this embodiment, the oligonucleotide may be further modified as defined herein above.

[0065] Thus, in one embodiment, the oligonucleotide comprises SEQ ID NO: 30 or 17 or 6. In one embodiment, such an oligonucleotide is between 20 and 100 nucleotides in length. In one embodiment, the oligonucleotide consists of SEQ ID NO: 30 or 17 or 6. In this embodiment, the oligonucleotide may be further modified as defined herein above.

[0066] Thus, in one embodiment, the oligonucleotide comprises SEQ ID NO: 26 or 16 or 5. In one embodiment, such an oligonucleotide is 20-100 nucleotides in length. In one embodiment, the oligonucleotide consists of SEQ ID NO: 26 or 16 or 5. In this embodiment, the oligonucleotide may be further modified as defined herein above.

[0067] In one embodiment there is provided an oligonucleotide comprising one of SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, having a length of 20 to 100 nucleotides, or consisting of one of SEQ ID NOs: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22. In this embodiment, the oligonucleotide may be further modified as defined herein above.

[0068] In one embodiment there is provided an oligonucleotide comprising any of SEQ ID NOs: 34, 30 or 26 and having a length of 20 to 100 nucleotides, or consisting of any of SEQ ID NOs: 34, 30 or 26. In this embodiment the oligonucleotide may be further modified as defined herein above.

[0069] In one embodiment there is provided an oligonucleotide comprising SEQ ID NO: 19 or 34 and having a length of 20 to 100 nucleotides or consisting of SEQ ID NO: 19 or 34. In this embodiment, the oligonucleotide may be further modified as defined herein above.

[0070] Oligonucleotide binding In some embodiments, the oligonucleotides are conjugated to one or more ligands. Preferably, the ligands are capable of targeting and / or delivering the oligonucleotides to organs, tissues and / or cells, such as the kidney, kidney tissue or kidney cells or the bladder, bladder tissue or bladder cells, in particular bladder epithelial cells.

[0071] Examples of ligands are, for example, peptides, vitamins, aptamers, carbohydrates or mixtures of carbohydrates (Han et al., Nature Communications, 2016, doi: 10.1038 / ncomms10981; Cao et al., Mol. Ther. Nucleic Acids, 2016, doi: 10.1038 / mtna. 2016. 46), proteins, small molecules, antibodies (or antigen-binding fragments thereof), polymers, and drugs. Examples of carbohydrate conjugate group ligands include glucose, mannose, galactose, maltose, fructose, N-acetylgalactosamine (GalNac), glucosamine, N-acetylglucosamine, glucose-6-phosphate, mannose-6-phosphate, and maltotriose. Carbohydrates can be present in multiples, for example, as terminal groups on a dendritic or branched linker moiety that links the carbohydrate to a component of the composition. Carbohydrates can also be included in carbohydrate cluster moieties, such as GalNAc cluster moieties. The carbohydrate cluster portion can include a targeting moiety and, optionally, an attached linker. In some embodiments, the carbohydrate cluster portion includes one, two, three, four, five, six, or more GalNAc groups. As used herein, "carbohydrate cluster" refers to a compound having one or more carbohydrate residues attached to a backbone or linker group (see, e.g., Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate Chem., 2003, (14): 18-29; Rensen et al., "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem. 2004, (47): 5798-5808).As used herein, "modified carbohydrate" refers to a carbohydrate that has undergone one or more chemical modifications to a naturally occurring carbohydrate. As used herein, "carbohydrate derivative" refers to any compound that can be synthesized using a carbohydrate as a starting material or intermediate. As used herein, "sugar" refers to a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative. Both types of excipients can be combined together in one composition, as specified herein. Examples of trivalent N-acetylglucosamine clusters are described in WO 2017 / 062862 (Wave Life Sciences), as are clusters of sulfonamide small molecules. Examples of single conjugation of the small molecule sertraline as well as conjugation of protein-bound small molecules including ibuprofen (e.g., U.S. Pat. No. 6,656,730, ISIS / Ionis Pharmaceuticals), spermine (e.g., Noir et al., J. Am. Chem Soc. 2008, 130, 13500), anisamide (e.g., Nakagawa et al., J. Am. Chem. Soc. 2010, 132, 8848), and folic acid (e.g., Dohmen et al., Mol. Ther. Nucl. Acids 2012, 1, e7) have also been described (Ferres-Coy et al., Mol. Psych. 2016, 21, 328).

[0072] In one embodiment, the oligonucleotide is conjugated to lithocholic acid or eicosapentanoic acid.

[0073] In one embodiment, the oligonucleotide is conjugated (preferably via its 5' or 3' end, more preferably via its 3' end) to a peptide, vitamin, aptamer, carbohydrate or mixture of carbohydrates, protein, small molecule, antibody, polymer, drug, lithocholic acid, eicosapentanoic acid or cholesterol moiety.

[0074] In a preferred embodiment, the oligonucleotide is conjugated to a small molecule, an aptamer or an antibody (or an antigen-binding fragment thereof). Preferred antibodies (or antigen-binding fragments thereof) are described, for example, in WO 2016 / 179257 (CytoMx), such as the 3E10 antibody against CD71 (transferrin receptor) or the equilibrative nucleoside transporter (ENT), for example, as described in Weisbart et al., Mol. Cancer Ther. 2012, 11, 1.

[0075] In another preferred embodiment, the oligonucleotide is conjugated to a GalNac moiety and / or a cholesterol moiety, for example, the oligonucleotide is conjugated at its 3' end to a cholesterol moiety and at its 5' end to a GalNac moiety.

[0076] Generally, attachment is at the 5' or 3' end of the oligonucleotide, preferably the 3' end.

[0077] Effect of oligonucleotides Functionally, the oligonucleotides, optionally with modifications and / or conjugations as described above, can be characterized in that they are capable of exhibiting at least one of the following effects: 1) Regulation of T antigen pre-mRNA splicing, 2) decreased production of T antigen mRNA; 3) a reduction in the production of VP1 mRNA, and preferably VP1 protein; 4) inhibition of viral replication, preferably reducing the number of viral particles produced by the cell; and 5) Limitation of the virus's ability to reinfect, i.e., limiting the ability of infected cells to produce infectious viral particles.

[0078] 1) Modulation of splicing of T antigen pre-mRNA can be assessed by monitoring the formation of a given splicing product of the pre-mRNA. A lower amount of a given splicing product is an indication of inhibition of polyomavirus and is therefore an assessment target. A lower amount can mean at least 5% less or at least 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% less than the amount of the same splicing product at the start of treatment with the oligonucleotide. Assessment can be performed using PCR.

[0079] 2) The reduction in T antigen mRNA production can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the mRNA initially produced at the start of treatment with the oligonucleotide. Preferably, T antigen mRNA is no longer detectable. mRNA production can be detected using techniques known to those skilled in the art, such as RT-PCR or Northern blotting.

[0080] 3) The reduction in VP1 mRNA, preferably the reduction in VP1 protein production, can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the mRNA (or protein) initially produced at the start of treatment with the oligonucleotide. Preferably, VP1 mRNA (or protein) is no longer detectable. Production of mRNA and protein can be detected using techniques known to those skilled in the art, including RT-PCR or Northern blotting for mRNA and Western blotting for protein.

[0081] 4) Viral replication can be inhibited such that the amount of viral DNA is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the initial viral DNA at the beginning of treatment with oligonucleotide. In one embodiment, viral DNA is no longer detectable. The number of viral particles can be reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the initial number of viral particles at the beginning of treatment with oligonucleotide. In one embodiment, viral particles are no longer detectable. Viral replication or the number of viral particles produced can be evaluated using techniques known to those skilled in the art. For example, viral replication or the number of viral particles produced (viral load) can be detected using PCR. The experimental part of this specification provides an exemplary method for detecting viral load.

[0082] 5) The restriction of the ability of the virus to reinfect can also be quantified as a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% in the number of cells infected with virus produced from a single infected cell treated with the oligonucleotide compared to the number of cells infected with virus produced from a single infected cell not treated with the oligonucleotide.

[0083] Preferably, the oligonucleotide can exhibit at least effect 1. This effect on splicing is shown in the examples. Without being bound by theory, it is believed that the oligonucleotide inhibits the use of the splice site that it targets. As a result, the production of large T antigen is reduced, which affects the expression of capsid protein, thereby reducing the production of virus. Without being bound by theory, it is believed that the imbalance of T antigen-specific splice products induced by oligonucleotide has a more significant effect on virus growth than the reduction of T antigen mRNA by RNAi-like approaches.

[0084] In one embodiment, the oligonucleotide exhibits at least (i) effect 1 and / or effect 2, and (ii) effect 4. Or the oligonucleotide exhibits at least (i) effect 1 and / or effect 2, and (ii) effect 5. Preferably, the oligonucleotide exhibits at least (i) effect 1 and / or effect 2, (ii) effect 4, and (iii) effect 5.

[0085] In another embodiment, the oligonucleotide exhibits at least (i) effect 3 and (ii) effect 4, or the oligonucleotide exhibits at least (i) effect 3 and (ii) effect 5. Preferably, the oligonucleotide exhibits at least (i) effect 3, (ii) effect 4, and (iii) effect 5.

[0086] Therapeutic benefit is defined below in relation to medical applications.

[0087] Polyomavirus Within the context of this specification, the polyomavirus can be any polyomavirus. In one embodiment, the polyomavirus is a human polyomavirus, including all genera such as alpha, beta and delta. In a preferred embodiment, the polyomavirus is an alphavirus or a betavirus, preferably a betavirus. Non-limiting examples of human polyomaviruses are listed in Table 1 below. In a preferred embodiment, the polyomavirus is a BK polyomavirus (or BK virus, also referred to herein as BKPyV or BKV), a JC polyomavirus (or JC virus, also referred to herein as JCV) or a Merkel cell polyomavirus (MC polyomavirus, also referred to herein as MC virus or MCV). In a particularly preferred embodiment, the polyomavirus is a BK virus or a JC virus, preferably a BK virus.

[0088] [Table 2]

[0089] In a second aspect, the present invention relates to a vector comprising (i) an oligonucleotide as defined in the first aspect, (ii) the reverse complement of an oligonucleotide as defined in the first aspect, or (iii) DNA capable of being transcribed into an oligonucleotide as defined in the first aspect.

[0090] In a preferred embodiment, the vector is a nucleic acid vector. Thus, the vectors in (i) and (ii) are preferably RNA vectors, and the vector in (iii) is preferably a DNA vector. Nucleic acid vectors include plasmid vectors, cosmid vectors, phage vectors such as lambda phage, and viral vectors. A viral vector is preferred, and in some embodiments, the viral vector may be selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, a retroviral vector, and a lentiviral vector. A preferred viral vector is an adeno-associated viral vector (AAV). Examples include AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), and AAV serotype rh10 (AAVrh10). Examples of AAV include serotype rh8 AAV (AAVrh8), serotype Cb4 AAV (AAVCb4), serotype rh74 AAV (AAVrh74), serotype DJ AAV (AAVDJ), serotype 2 / 5 AAV (AAV2 / 5), serotype 2 / 1 AAV (AAV2 / 1), serotype 1 / 2 AAV (AAV1 / 2), and serotype Anc80 AAV (AAVAnc80). AAV2 is a preferred example.

[0091] However, non-nucleic acid vectors are also encompassed, including, for example, virus-like particles (VLPs) or "VLPs", which refers to non-replicative, empty viral shells. VLPs are generally composed of one or more viral proteins, including, but not limited to, proteins called capsid, coat, shell, surface and / or envelope proteins. They contain functional viral proteins involved in cell penetration by the virus, ensuring efficient cell entry. Methods for producing specific VLPs are known in the art.

[0092] In a third aspect, the present invention relates to a composition comprising an oligonucleotide as defined in the first aspect or a vector as defined in the second aspect. In a preferred embodiment, this composition is a pharmaceutical composition.

[0093] Pharmaceutical compositions preferably include one or more pharma- ceutically acceptable excipients, such as fillers, preservatives, solubilizers, carriers, diluents, excipients, salts, adjuvants and / or solvents, e.g., as described in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000.

[0094] The excipient may be an excipient capable of improving the stability, solubility, absorption, bioavailability, activity, pharmacokinetics, pharmacodynamics, cellular uptake and intracellular transport of the oligonucleotide, in particular capable of forming complexes, nanoparticles, microparticles, nanotubes, nanogels, hydrogels, poloxamers or Pluronics®, polymersomes, colloids, microbubbles, vesicles, micelles, lipoplexes and / or liposomes. Examples of nanoparticles include polymeric nanoparticles, (mixed) metal nanoparticles, carbon nanoparticles, gold nanoparticles, magnetic nanoparticles, silica nanoparticles, lipid nanoparticles, sugar particles, protein nanoparticles and peptide nanoparticles. Examples of nanoparticle-oligonucleotide combinations include spherical nucleic acids (SNAs), as described, for example, in Barnaby et al. Cancer Treat. Res. 2015, 166, 23.

[0095] Preferred excipients are targeting excipients, capable of targeting and / or delivering oligonucleotides to organs, tissues and / or cells, such as the kidney, kidney tissue or kidney cells or the bladder, bladder tissue or bladder cells, in particular bladder epithelial cells. Many of these excipients are known in the art (e.g., Bruno, K. et al, (2011), Adv. Drug. Deliv. Rev, 63 (13): 210-1226), examples of which include polymers (e.g., polyethyleneimine (PEI), polypropyleneimine (PPI), dextran derivatives, butyl cyanoacrylate (PBCA), hexyl cyanoacrylate (PHCA), polylactic-co-glycolic acid (PLGA), polyamines (e.g., spermine, spermidine, putrescine, cadaverine, etc.), chitosan, poly(amidoamine) (PAMAM), poly(esteramine), polyvinyl ether, polyvinylpyrrolidone (PVP), polyethylene glycol (PEG) cyclodextrin, hyaluronic acid, colominic acid, and derivatives thereof), dendrimers (e.g., poly(amidoamine)), etc.), lipids {e.g., 1,2-dioleoyl-3-dimethylammonium propane (DODAP), dioleoyldimethylammonium chloride (DODAC), phosphatidylinositol, ... lyso-phosphatidylcholine derivatives [e.g., 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and the like], lyso-phosphatidylcholine derivatives [e.g., 1-stearoyl-2-lyso-sn-glycero-3-phosphocholine (S-LysoPC) and the like], sphingomylin, 2-{3-[bis-(3-amino-propyl)-amino]-propylamino}-N-ditetracecylcarbamoylmethylacetamide (RPR209120), phosphoglycerol derivatives [e.g., 1,2-dipalmitoyl-sn-glycero-3-phosphoglycerol, sodium salt (DPPG-Na) and the like, phosphatidic acid derivatives [1,2-distearoyl-sn-glycero-3-phosphatidic acid, sodium salt (DSPA)], phosphatidylethanolamine derivatives [e.g., dioleoyl-LR-phosphatidylethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE), etc.], N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTMA), 1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylamide ( DOSPER), (1,2-Dimyristyloxypropyl-3-dimethylhydroxyethylammonium (DMRIE), (N1-Cholesteryloxycarbonyl-3,7-diazanonane-1,9-diamine (CDAN), Dimethyldioctadecylammonium bromide (DDAB), 1-Palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (POPC), (bL-Arginyl-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide trihydrochloride (AtuFE) CT01), N,N-dimethyl-3-aminopropane derivatives [e.g., 1,2-distearoyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DoDMA), 1,2-dilinoleyloxy-N,N-3-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl[1,3]-dioxolane (DLin-K-DMA), phosphatidylserine derivatives [1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DoDMA), 1,2-dilinoleyloxy-N,N-3-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl[1,3]-dioxolane (DLin-K-DMA), [L-sn-glycero-3-phospho-L-serine, sodium salt (DOPS), etc.], proteins (e.g., albumin, gelatin, atelocollagen, etc.), and linear or cyclic peptides (e.g., protamine, PepFect, NickFect, polyarginine, polylysine, CADY, MPG, cell penetrating peptides (CPPs), targeting peptides, cell transport peptides, endosomal escape peptides, etc.). Examples of such peptides include muscle targeting peptides (e.g., Jirka et al., Nucl. Acid Ther. 2014, 24, 25), CPPs (e.g., the Pip series and oligoarginine series, including those described in WO 2013 / 030569, e.g., U.S. Pat. No. 9,161,948 (Sarepta), WO 2016 / 187425 (Sarepta) and blood-brain barrier (BBB) ​​crossing peptides such as, for example, the M12 peptide of Gao et al., Mol. Ther. 2014, 22, 1333) or (branched) ApoE derivatives (Shabanpoor et al., Nucl. Acids Ther. 2017, 27, 130). The carbohydrates and carbohydrate clusters mentioned above for oligonucleotide conjugates are also suitable for use as excipients.

[0096] The pharmaceutical composition is formulated to contain a pharma- ceutical effective amount of the oligonucleotide, which may be formulated for administration by local, systemic and / or parenteral routes, such as intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ophthalmic, nasal, urogenital, intradermal, dermal, enteral, intravitreal, intracavitary, intracerebral, intrathecal, epidural or oral routes.

[0097] Preferably, the pharmaceutical compositions are formulated as emulsions, suspensions, pills, tablets, capsules or softgels for oral delivery or in the form of an aerosol or dry powder for delivery to the airways and lungs.

[0098] In one embodiment, the pharmaceutical composition further comprises an additional active ingredient for the treatment of a polyomavirus infection.

[0099] In a fourth aspect, the present invention relates to an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect or a pharmaceutical composition as defined in the third aspect for use as a medicament, in particular for use in the treatment of a polyomavirus infection in a subject.

[0100] The oligonucleotides, vectors and pharmaceutical compositions are hereinafter collectively referred to as "medicaments" for the sake of brevity.

[0101] Thus, the medicament is generally used for treating polyomavirus infection in subjects, but is also preferably used for treating diseases associated with polyomavirus.The meaning of polyomavirus is defined above with respect to the first aspect."Diseases associated with polyomavirus" include cystitis (especially hemorrhagic cystitis, for example in bone marrow transplant recipients), ureteritis, interstitial nephritis (also known as nephropathy; particularly transplant nephropathy) and progressive multifocal leukoencephalopathy (especially in immunocompromised subjects).

[0102] The term "infection" as used herein refers to a viral infection, i.e. the entry of a virus into at least one cell of a host and its replication within at least one cell. An infection can be acute (i.e. active) or latent (i.e. inactive, latent, dormant), such as with polyomavirus. In an acute infection, the virus can replicate, infect cells and cause symptoms, whereas in a latent infection, the virus replicates independently of the genome of the host cell and does not infect additional cells, but rather "lies dormant" within the cell. A latent infection can be interrupted by an acute infection, where the latent virus begins to replicate and infect further cells. In the case of an existing latent infection, the use in treating the infection is preferably directed to preventing acute infection by preventing the latent virus from infecting additional cells, i.e. spreading. In other words, this is the theory as treating a latent infection, and the treatment is not necessarily curative (but suppresses the virus). In other words, the subject treated with the pharmaceutical agent can be asymptomatic. In one embodiment, the subject treated with the pharmaceutical agent is asymptomatic and seropositive. In another embodiment, the subject treated with the pharmaceutical agent is asymptomatic and seronegative.

[0103] The pharmaceutical agent is administered in a therapeutically effective amount. The induction of such a therapeutic effect can be assessed in vitro (i.e., acellular or intracellular) or in vivo (i.e., in an animal, such as an animal model, or in a patient). It can be assessed at the molecular and / or cellular level.

[0104] "Therapeutic effect" refers specifically to effects 1) to 5) defined with respect to the first aspect of the present invention above, i.e. these effects are also referred to as therapeutic effects 1) to 5), respectively. Further therapeutic effects are as follows: 6) prevention of cellular effects associated with infection; 7) reducing cellular effects associated with infection; 8) prevention of disease in infected subjects, and / or 9) Slowing, preferably halting, and more preferably reversing the progression of the disease.

[0105] 6) and 7): The cellular effect associated with the infection may be cell death (e.g. by apoptosis or cell lysis) and the alleviation may be a reduction in cell death. Such a reduction in cell death may be at least 5% compared to the level of cell death at the start of the treatment. Preferably, a reduction in cell death means at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 80%, at least 90% or 100%. Cell death may be determined by directly detecting cell death or by detecting cell survival, for example by harvesting a cell population and (immuno)staining for cell cycle markers, by FACS analysis to determine the cell cycle phase with appropriate markers or by PCR for the expression levels of cell cycle RNA.

[0106] 8) and 9): Whether disease is prevented or progression is slowed, stopped or reversed can be determined by assessing symptoms or parameters of disease associated with polyomavirus infection. Such symptoms are known in the art. For example, parameters such as glomerular filtration rate or creatinine levels can be measured to assess the progression of nephropathy.

[0107] Additional parameters that may be evaluated under 8) or 9) as (molecular) markers of the presence, status or progression of a disease or condition include cyclin E2 (CCNE2), cell division cycle 6 (CDC6), cyclin E2 (CCNA2), E2F transcription factor 8 (E2F8), survivin (BIRC5), RAD51-related protein-1 (RAD51AP1), BRCA1-interacting protein C-terminal helicase 1 (BRIP1), apolipoprotein B mRNA editing enzyme 3B (APOBEC3B).

[0108] Treatment with an oligonucleotide as defined herein may increase the downregulation or reduction of at least one of these genes (Abend, J. et al. (2010) Global effects of BKV infection of gene expression in human primary epithelial cells; 397 (1): 73). In one embodiment, the downregulation or reduction is induced following BKV infection or reinfection of cells.

[0109] In one embodiment, the downregulation or reduction is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% of the initial expression level of said gene at the start of treatment with the oligonucleotide. In one embodiment, expression is no longer detectable. Expression can be assessed using techniques known to those skilled in the art. In one embodiment, expression is assessed using Northern blot or PCR.

[0110] Thus, in one embodiment, the oligonucleotide, vector or pharmaceutical composition defined herein is for use as a medicament, preferably for use in treating a polyomavirus infection in a subject, wherein said oligonucleotide, vector or pharmaceutical composition is capable of exhibiting at least one of the following effects: 1) Regulation of T antigen pre-mRNA splicing, 2) decreased production of T antigen mRNA; 3) a reduction in the production of VP1 mRNA, and preferably VP1 protein; 4) inhibition of viral replication; 5) limiting the capacity for viral reinfection, i.e., limiting the ability of infected cells to produce infectious viral particles; 6) prevention of cellular effects associated with infection; 7) reducing cellular effects associated with infection; 8) prevention of disease in infected subjects; and 9) Slowing, preferably halting, and more preferably reversing the progression of the disease.

[0111] In one embodiment, the oligonucleotide, vector or pharmaceutical composition defined herein is preferably for use as a medicament for treating a polyomavirus infection in a subject, wherein the disease is prevented (8) or its progression is slowed, stopped or reversed (9) if at least one parameter of a disease associated with said polyomavirus infection is reduced, said parameter being selected from glomerular filtration rate, creatinine levels, cyclin E2 (CCNE2), cell division cycle 6 (CDC6), cyclin E2 (CCNA2), E2F transcription factor 8 (E2F8), survivin (BIRC5), RAD51-associated protein-1 (RAD51AP1), BRCA1-interacting protein C-terminal helicase 1 (BRIP1) and apolipoprotein B mRNA editing enzyme 3B (APOBEC3B).

[0112] The therapeutic effect is assumed to include at least one of the therapeutic effects 1) to 5) defined above in relation to the first embodiment, and preferably also includes at least one of the therapeutic effects 6) to 9). The effect is evaluated by comparison with the condition at the start of treatment.

[0113] The subject is preferably a human. Polyomaviruses usually infect and replicate in hosts that are permissive to the virus, i.e., hosts that allow the virus to evade its defenses and replicate, such as immunocompromised hosts. This can also be described as immunodeficiency, a state in which the immune system's ability to fight infectious diseases and cancer is impaired or completely absent. This state can be temporary or permanent. In one embodiment, the immunodeficiency is acquired ("secondary") and is usually due to exogenous factors that affect the patient's immune system. Examples of such exogenous factors include environmental factors such as HIV infection, (extreme) age, and malnutrition. Immunodeficiency can also be induced by drugs such as glucocorticoids, cytoactivators, antibodies, and compounds that act on immunophilins (e.g., calcineurin inhibitors, belatacept (an immunoglobulin-like molecule with the extracellular domain of CTLA-4) and similar molecules). This can be a desired effect in subjects suffering from an overactive immune system, such as, for example, organ transplant surgery as a rejection countermeasure and autoimmune diseases. However, this desirable effect sometimes has the additional effect of reducing the subject's ability to deal with polyomavirus infection. A subject with any type of immune deficiency is said to be immunocompromised. In another embodiment, the immune deficiency is hereditary. For example, it is a genetic abnormality, usually recessive, that affects the development of B-cell or T-cell lymphocytes, phagocytes, complement, cytokines or their receptors, antibodies, or other components of the innate or adaptive immune system.

[0114] Thus, in one embodiment, the subject is immunocompromised, for example, due to one of the factors above and / or the use of a drug administered to the subject to treat another infection, cancer, or another condition or disease. In one embodiment, the other condition is organ, tissue, or cell (particularly kidney) transplantation. Thus, in one embodiment, the subject is the recipient of an organ, tissue, or cell transplant (also collectively referred to herein as "transplant").

[0115] In a fifth aspect, the present invention relates to ex vivo methods, including ex vivo methods of inhibiting polyomavirus replication in cells and ex vivo methods of generating grafts.

[0116] An ex vivo method of inhibiting polyomavirus replication in a cell comprises (i) providing a cell infected with polyomavirus and contacting the cell with an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect or a pharmaceutical composition as defined in the third aspect, or (ii) providing a cell comprising an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect or a pharmaceutical composition as defined in the third aspect and contacting the cell with polyomavirus. An ex vivo method of producing a transplant comprises providing a donor organ, tissue or cells (preferably including kidney cells) and contacting the cells of the donor organ, tissue or cells with an oligonucleotide as defined in the first aspect, a vector as defined in the second aspect or a pharmaceutical composition as defined in the third aspect.

[0117] General definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly and customarily understood by one of ordinary skill in the art to which this invention belongs and when read in light of this disclosure.

[0118] "Nucleobases", sometimes referred to as bases, are generally adenine, cytosine, guanine, thymine, or uracil, or derivatives thereof. Cytosine, thymine, and uracil are pyrimidine bases, generally linked to the backbone via their 1-nitrogen. Adenine and guanine are purine bases, generally linked to the backbone via their 9-nitrogen. The RNA nucleobases referred to herein are adenine, cytosine, guanine, and uracil.

[0119] Unless otherwise indicated, the "nucleotide" referred to herein refers to an RNA nucleotide, preferably a naturally occurring RNA nucleotide. The most common naturally occurring nucleotides in RNA are adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, and uridine monophosphate. They consist of a pentose ribose, a 5'-linked phosphate group, and a 1'-linked base linked via a phosphate ester. The sugar is often referred to as the backbone of the nucleotide, since it connects the base and the phosphate. Thus, pentose modifications are often referred to as backbone modifications. Thus, sugar modifications may be referred to as backbone modifications. In severe modifications, the original pentose may be completely replaced with another moiety that also connects the base and the phosphate. Thus, it is understood that the pentose is often the backbone, but not necessarily the backbone. A nucleotide is generally linked to an adjacent nucleotide by condensing its 5'-phosphate moiety to the 3'-hydroxyl moiety of the adjacent nucleotide monomer. Similarly, its 3'-hydroxyl moiety is generally attached to the 5'-phosphate of the adjacent nucleotide monomer. This results in the formation of a phosphodiester bond. The phosphodiester and backbone form an alternating copolymer. The bases are attached to this copolymer, i.e., the backbone portion. Due to this feature, the alternating copolymer formed by the linked monomers of an oligonucleotide is often called the backbone of the oligonucleotide. The phosphodiester bond is often called the backbone bond because it connects adjacent monomers together. It is understood that if the phosphate group is modified to be an analogous moiety such as phosphorothioate instead, such a moiety is still called the backbone bond of the monomer. This is called backbone bond modification. In general terms, the backbone of an oligonucleotide comprises such alternating backbone and backbone bond.

[0120] The term "specifically bind" in the context of an oligonucleotide means that the oligonucleotide can anneal to its target. The term "bind" can be interchanged with "hybridize", "target", "opposite", "antisense" or "complementary". Binding of an oligonucleotide to a target pre-mRNA can be assessed using EMSA (electrophoretic mobility shift assay), in which the oligonucleotide is incubated with polyomavirus RNA.

[0121] The term "annealing", when used in reference to oligonucleotides, is understood as the binding of an oligonucleotide to a sequence that is at least substantially complementary in terms of base pairing involving hydrogen bonds, and may be Watson-Crick, Hoogsteen, or reverse Hoogsteen. Stringent hybridization conditions include hybridization in 5xSSC / 5xDenhardt's solution / 1.0%SDS at 68°C, followed by washing in 0.2xSSC / 0.1%SDS at room temperature, or equivalent conditions recognized in the art (e.g., hybridization in 2.5xSSC buffer at 60°C, followed by several washes in low concentration buffers at 37°C and keeping stable). Moderate conditions include washing in 3xSSC at 42°C, or equivalents recognized in the art. Salt concentration and temperature parameters can be varied to achieve optimal levels of identity between the probe and target nucleic acid. Guidance regarding such conditions is available in the art, for example, by Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, NY; and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, NY) at Unit 2.10.

[0122] Hybridization of complementary strands typically improves with the length of the sequence. Specific hybridization of the double strand is achieved by a continuous stretch of 12, 13, 14, 15, 16, 17, 18, 19 or 20 (preferably 18, 19 or 20) or more complementary nucleobases. The sequence of an oligonucleotide can be, but is not necessarily, 100% complementary to the sequence of its target sequence to which it hybridizes. Furthermore, an oligonucleotide can hybridize on one or more segments, whereby the intervening or adjacent segments are not involved in the hybridization. For example, an oligonucleotide comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence complementarity to the target region in the pre-mRNA. For example, an oligonucleotide in which 18 of the 20 nucleobases of the oligonucleotide are complementary to the target region and thus specifically hybridize shows 90% complementarity. If the 18 nucleotide oligonucleotide is a sequence that is the reverse complement of at least a contiguous stretch of 12 nucleobases of the large T antigen pre-mRNA of polyomavirus, the remaining 6 complementary nucleobases may be clustered with the 12 nucleobases or may not be contiguous with the 12 nucleobases. The percentage of complementarity of an oligonucleotide with a region of a target pre-mRNA can be routinely determined by methods known in the art using the BLAST program (basic local alignment search tool) and PowerBLAST program (Altschul et al, J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).

[0123] Preferably, an oligonucleotide can anneal to a target if a contiguous stretch of at least 12 nucleobases of the sequence is at least substantially complementary to the target. "Substantially complementary" means substantially identical to the reverse complement of the target sequence. "Substantially identical" means that the oligonucleotide need not be 100% identical to the reference sequence, but may contain mismatches and / or spacers as defined herein. To ensure that the intended annealing does not fail due to mismatches and / or spacers, it is preferred that substantially identical oligonucleotides, even if not 100% identical, contain 1 to 3, i.e. 1, 2 or 3 mismatches and / or spacers, preferably 1 mismatch or spacer per oligonucleotide. To allow annealing despite mismatches and / or spacers, it is preferred that the oligonucleotide does not contain more than 1 mismatch per 10 nucleotides of the oligonucleotide (rounded up if the first decimal is 5 or more, rounded down otherwise). The term "spacer" as used herein refers to a non-nucleotide spacer molecule which, when linking two nucleotides, increases the distance between the two nucleotides to a distance of about one nucleotide (i.e., the distance between the two nucleotides when they are linked by a third nucleotide). Non-limiting examples of spacers are inosine, d-uracil, halogenated bases, Amino-dT, C3, C12, Spacer 9, Spacer 18, and dSpacer.

[0124] The oligonucleotide may contain 3' and / or 5' overhangs, i.e., contiguous stretches of nucleobases that are not substantially complementary to the target region. Such overhangs do not prevent the oligonucleotide from specifically binding to its target region.

[0125] The terms "complement" and "reverse complement" are used interchangeably to mean that a complement to a target nucleic acid has a sequence that is the reverse complement of the target sequence, where "reverse" generally refers to the sequence beginning at the 5' end of the nucleic acid.

[0126] A "pre-mRNA" or "precursor mRNA" is an immature single strand of messenger ribonucleic acid (mRNA). Polyomavirus T antigen pre-mRNA is synthesized by transcription from a polyomavirus DNA template in the cell nucleus. The pre-mRNA contains one or more introns that are spliced ​​during the maturation of the pre-mRNA into mRNA. During splicing, introns are removed from the transcript and exons are joined together. Introns are typically flanked by a donor site (at the 5' end of the intron) and an acceptor site (at the 3' end of the intron). Splice sites are necessary for splicing and typically have the nearly invariant sequence GU at the 5' end of the intron and a splice acceptor site, usually with an invariant AG sequence, at the 3' end of the intron. The GU and AG sequences as well as the intervening sequence are spliced ​​out of the pre-mRNA. A characteristic feature of polyomavirus T antigen pre-mRNA is that it may or may not be spliced ​​to generate at least two, and often three, four, or five, alternatively spliced ​​mRNAs. Viral proliferation depends on the availability of viral genomes, the presence of viral proteins, and the cellular machinery, especially the delicate interplay between the various steps and components. The process of viral RNA splicing is an important way to regulate the viral proliferation process, influencing the levels and possibly also the timing of specific products formed in the cell. The term "splice site" refers to sequences that define the splice loci ("splice sequences").

[0127] As used herein, "transcribeable" means that the DNA nucleobase sequence is identical to the RNA nucleobase sequence, with the exception that DNA has a thymine in place of every uracil in RNA.

[0128] "Initiating an oligonucleotide treatment" as referred to herein with respect to the effect of an oligonucleotide means a treatment that includes contacting an infected cell with an oligonucleotide. Treatment can be in vitro (such as in cell culture) or in vivo (non-human animal or human) treatment.

[0129] "Ex vivo" means in vitro in its broadest sense, and in a preferred embodiment refers to experiments or measurements performed in or on the tissue of an organism, in an external environment with minimal alteration of natural conditions. EXAMPLES

[0130] Working Example Example 1 result ASO nanowalk and modification candidates Previously, we developed antisense oligonucleotides (ASOs) targeting the exon-intron junctions of the BKV early coding region pre-mRNA that lead to the generation of large T antigen, small T antigen and truncated T antigen mRNAs (WO 2019 / 168402). These studies yielded several ASOs that demonstrated the ability to suppress 1) large T antigen and VP1 mRNA, 2) VP1 protein expression, and 3) viral DNA production. Within the BKV early coding region pre-mRNA, the majority of 5' ASOs had a single nucleobase in the intronic region of the large T antigen sequence, and the majority of 3' ASOs had only a single nucleobase in the exonic portion of large T antigen exon 1. As shown in Figure 2, the placement of the ASOs was consistently shifted in the 5' to 3' direction two nucleotides downstream of SEQ ID NO: 1, allowing for effective tiling of the entire exon 1-intron junction with SEQ ID NOs: 1-11 (RNA sequences) and the corresponding 2'-OMe modified ASOs (SEQ ID NOs: 12-22) described herein. Therefore, in these studies, 11 additional ASOs (SEQ ID NOs: 12-22) were generated and screened for activity in human PTEC.

[0131] Surprisingly, some of these new 2'-OMe modified ASOs (Figure 2) showed excellent targeting activity against the large T antigen exon 1 and / or intron donor site (Figures 3, 4).

[0132] This insight was gained through screening studies using human proximal tubular epithelial cells (hPTEC), which showed strong efficacy against 1) TAg and VP1 mRNA, 2) VP1 protein, and 3) viral particle production, as shown in Figure 3. We then extensively tested various modifications of these lead candidates by substituting 5-methylcytidine for 2'OMe-cytosine (SEQ ID NOs: 26, 30, 34, and 38) and including various percentages of 2'-methoxy-ethyl (MOE) modified oligonucleotides (SEQ ID NOs: 23, 24, 25, 27, 28, 29, 31, 32, 33, 35, 36, 37). These studies consistently showed that ASOs with 2'-O-methyl modifications most reduced VP1 protein and BKV DNA replication (Figure 4). These data, together with our previous work in which we varied the amount of phosphorothioate incorporated into the ASO backbone, led us to continue using ASOs that are fully 2'-OMe phosphorothioated.

[0133] ASOs targeting BKV suppress "reinfection" Since we observed a reduction in viral DNA following treatment with ASOs targeting BKV, we decided to perform a "reinfection" study. To this end, we treated hPTECs with SEQ ID NO:26, SEQ ID NO:17, SEQ ID NO:34 or SEQ ID NO:19 and infected them with BKV 16 hours later. The cells were incubated in culture medium for 7 days, after which the conditioned medium containing active and inactive viral particles was collected. The conditioned medium was then diluted 10-fold and placed on untreated hPTECs. After 72 hours, the cells were fixed and immunostained for large T antigen positivity (Figure 5), revealing a significantly lower number of large T antigen positive cells following treatment with SEQ ID NO:19 (and HYB_03 (SEQ ID NO:68)) compared to control cells (left panel). Moreover, the degree of positivity following treatment with SEQ ID NO:19 (and HYB_03 (SEQ ID NO:68)) was lower than that observed in control cells (cells also treated with SEQ ID NO:26 and SEQ ID NO:17). As shown in Figure 6, assessment of TAg and VP1 mRNA levels, as well as VP1 protein, showed the greatest reduction following pretreatment with SEQ ID NO: 19. Viral DNA levels and the number of reinfected cells were significantly reduced following treatment with SEQ ID NO: 19.

[0134] BKV-targeting ASO induces aberrant splicing of BKV early coding region pre-mRNA We then investigated the ability of BKV-targeted ASOs to inhibit proper splicing of BKV early coding region pre-mRNA in pRPc cells. To this end, we administered ASOs to pRPc cells and harvested RNA 24 hours after gene transfer. As shown in Figure 7, these studies revealed that lipofectamine and scrambled control ASO-treated cells showed no changes in splicing profile (lanes 1-3). In contrast, HYB_03 (SEQ ID NO: 68) and SEQ ID NO: 19 both reduced large T antigen mRNA levels (product 1) and slightly increased small t antigen mRNA (product 3, lanes 4-5). At the same time, clear evidence of aberrant splicing products between product 1 and product 3 as well as mRNA products smaller than product 1 was evident. Furthermore, when we introduced mismatched nucleobases at positions 10 (SEQ ID NO:39), 5 and 10 (SEQ ID NO:40) and 5, 10 and 15 (SEQ ID NO:41) of SEQ ID NO:19, the splicing effect was titrated stepwise (Figure 7, lanes 6-8). These studies clearly show that SEQ ID NO:19 mediates inhibition of large T antigen mRNA in a hybridization-dependent manner. Next, we similarly evaluated whether SEQ ID NO:19 designed as a gapmer (RNA-DNA-RNA hybrid antisense oligonucleotide) could induce similar or higher levels of large T antigen (pre)mRNA degradation in an RNaseH-dependent manner. As shown in Figure 8 (lane 3), the GapmeR of sequence number 19 (sequence number 42) did not result in a strong reduction in large T antigen mRNA levels (product 1), but further GapmeRs targeting exon 1, early coding region pre-mRNA (sequence numbers 42-45) similarly did not result in a significant reduction in large T antigen mRNA expression levels or small t antigen mRNA expression levels.

[0135] Exposure of PBMCs to BKV-targeted ASOs does not affect viability Next, we assessed whether increasing concentrations of BKV-targeting ASOs would affect cell viability by exposing peripheral blood-derived monocytes (PBMCs) to 1 μM or 10 μM ASOs for 48 hours. As shown in Figure 9, we introduced multiple controls for cell viability, including exposure to 65°C for 30 minutes (which causes a decrease in cell viability) before culturing for 48 hours, as well as treatment with R848 (a TLR3 agonist) which increases PBMC viability (Doyle SL, et al (2007), J. Biol Chem. 282 (51): 36953-36960). Exposure to or increasing concentrations of SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 or SEQ ID NO:19 did not appear to affect PBMC viability.

[0136] Exposure of PBMCs to BKV-targeting ASOs moderately activates cytokine production To control for the potential for increasing concentrations of BKV-targeting ASO to activate pro-inflammatory cytokine expression by monocytes and macrophages, PBMCs were treated with 1 μM or 10 μM ASO for 48 hours and culture media was harvested for multiplex ELISA analysis of cytokine production. As shown in Figures 10 and 11, exposure to SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34, or SEQ ID NO:19 did not result in a significant increase in pro- or anti-inflammatory cytokine production.

[0137] Blood clotting times are unaffected by BKV-targeting ASOs It has been described that ASOs affect the time it takes for blood to physiologically clot. This can be detrimental in patients undergoing oligonucleotide-based therapy, including BKV-targeting ASOs, after kidney transplantation. Therefore, we assessed whether exposure of blood to increasing concentrations of our BKV-targeting ASOs could increase clotting time by measuring the activated partial thromboplastin time (aPTT). For this, human plasma was collected and exposed to SEQ ID NO: 30, SEQ ID NO: 18, SEQ ID NO: 34 or SEQ ID NO: 19 at concentrations of 1 and 10 μM. As shown in FIG. 12, clotting time was slightly increased when exposed to higher concentrations of BKV-targeting ASOs.

[0138] BKV-targeted ASOs show superior biodistribution to the kidney Since BKV resides primarily in the tubular epithelial cells of the kidney (and bladder epithelium), five candidate ASOs were administered intravenously four times (at a concentration of 40 mg / kg on days 0, 3, 7, and 10 and sacrificed on day 14, FIG. 13, left) to examine the biodistribution of BKV-targeting ASOs to the kidney, specifically to the proximal and distal tubular epithelial cells. As shown in FIG. 13 (left and center images), oligonucleotides with SEQ ID NO: 19 showed clear uptake in the proximal tubules, with weak staining observed in the distal compartment of the renal segment (FIG. 13, right image). We generated hybridization ELISA (hELISA) probes to quantitatively measure the levels of SEQ ID NO: 19 in various organs. As shown in FIG. 14, these studies revealed that the kidney was the major organ for uptake of SEQ ID NO: 19 (per gram of organ), with approximately 2.75-fold greater uptake than the liver and 4-fold greater uptake than the spleen. These extrarenal organs are widely considered to be excellent reservoirs for ASO uptake and have clearly demonstrated superior distribution of ASOs to the kidney.

[0139] BKV-targeted ASO treatment regimen does not affect kidney or liver function In a four dose intravenous study (at a concentration of 40 mg / kg on days 0, 3, 7 and 10, sacrificed on day 14), no obvious signs of kidney or liver toxicity / damage were observed. As shown in Figure 15, serum levels of creatinine and blood urea nitrogen, as well as urinary albumin levels, were well within the normal range after treatment with SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 or SEQ ID NO:19. Similarly, serum levels and ratios of aspartate aminotransferase and alanine aminotransferase showed no evidence of liver toxicity after four doses of SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 or SEQ ID NO:19.

[0140] BKV-targeted ASO treatment regimen does not result in overt renal injury Immunohistochemical staining for evidence of renal injury following four doses of SEQ ID NO:30, SEQ ID NO:18, SEQ ID NO:34 or SEQ ID NO:19 showed no signs of overt / acute renal injury. Initial assessment of KIM-1 and picrosirius red staining did not identify any renal injury or collagen deposition (see FIG. 16).

[0141] Materials and Methods Accession numbers used in phylogenetic analysis Complete genome sequences of BK polyomavirus isolates were downloaded from the public NCBI database. These records were used to examine the conservation of the splice sites of the large T antigen, including only isolates for which complete genomes were reported. Strain Dunlop was used as the reference genome. Isolates "MM" and "FNL-9" were excluded because they contained large deletions in introns or duplications overlapping the acceptor splice site, respectively. The accession numbers of the 245 unique genome sequences are as follows: AB211369.1; AB211370.1; AB211371.1; AB211372.1; AB211373.1; AB211374.1; AB211375.1; AB211376.1; AB211377.1; AB211378.1; AB211379.1; AB211381.1; AB211382.1; AB211383.1; AB211384.1; AB211385.1; AB211386.1; AB211387.1; AB211388.1; AB211389.1; AB211390.1; AB211391.1; AB211392.1; AB211393.1; AB211394.1; AB211395.1; AB211396.1; AB211397.1; AB211398.1; AB21139 ...7.1 11385.1;AB211386.1;AB211387.1;AB211388.1;AB211389.1;AB211390.1;AB211391.1;AB213487.1;AB217917.1;AB21 7918.1;AB217919.1;AB217920.1;AB217921.1;AB260028.1;AB260029.1;AB260030.1;AB260031.1;AB260032.1;AB260 033.1;AB263912.1;AB263913.1;AB263914.1;AB263915.1;AB263916.1;AB263917.1;AB263918.1;AB263919.1;AB2639 20.1;AB263921.1;AB263922.1;AB263923.1;AB263924.1;AB263925.1;AB263926.1;AB263927.1;AB263928.1;AB26392 9.1;AB263930.1;AB263931.1;AB263932.1;AB263934.1;AB263935.1;AB263936.1;AB263938.1;AB269825.1;AB269826 .1;AB269827.1;AB269828.1;AB269829.1;AB269830.1;AB269831.1;AB269832.1;AB269834.1;AB269836.1;AB269837.<h2 style=";text-align:left;direction:ltr">1;AB269838.1;AB269840.1;AB269841.1;AB269842.1;AB269843.1;AB269844.1;AB269845.1;AB269846.1;AB269847.1;AB269848.1;AB269849.1;AB269850.1;AB269851.1;AB269852.1;AB269853.1;AB269854.1;AB269855.1;AB269856.1;AB269857.1;AB269858.1;AB269859.1;AB269860.1;AB2698 61.1;AB269862.1;AB269863.1;AB269864.1;AB269865.1;AB269866.1;AB269867.1;AB269868.1;AB269869.1;AB298941.1;AB298942.1;AB298945.1;AB298946.1;AB298947.1;AB301086.1;AB301087.1;AB301089.1;AB301090.1;AB301091.1;AB301092.1;AB301093.1;AB301094.1;AB301095.1;AB3 01096.1;AB301097.1;AB301099.1;AB301100.1;AB301101.1;AB365130.1;AB365132.1;AB365133.1;AB365134.1;AB365136.1;AB365137.1;AB365138.1;AB365139.1;AB365140.1;AB365141.1;AB365142.1;AB365144.1;AB365145.1;AB365146.1;AB365148.1;AB365149.1;AB365150.1;AB365151.1; AB365153.1;AB365154.1;AB365156.1;AB365157.1;AB365158.1;AB365159.1;AB365160.1;AB365162.1;AB365164.1;AB365165.1;AB365166.1;AB365167.1;AB365168.1;AB365170.1;AB365173.1;AB365174.1;AB365175.1;AB365176.1;AB365178.1;AB369087.1;AB369088.1;AB369089.1;AB369090.<h2 style=";text-align:left;direction:ltr">1;AB369092.1;AB369093.1;AB369094.1;AB369095.1;AB369096.1;AB369097.1;AB369098.1;AB369099.1;AB369101.1;AB464953.1;AB464954.1;AB464956.1;AB464957.1;AB464958.1;AB464960.1;AB464961.1;AB464962.1;AB485695.1;AB485696.1;AB485697.1;AB485698 .1;AB485699.1;AB485700.1;AB485701.1;AB485703.1;AB485704.1;AB485707.1;AB485709.1;AB485710.1;AB485711.1;AB485712.1;AY628224.1;AY628225.1;AY628226.1;AY628227.1;AY628228.1;AY628229.1;AY628230.1;AY628231.1;AY628232.1;AY628233.1;AY628234 .1;AY628235.1;AY628236.1;AY628237.1;AY628238.1;DQ305492.1;EF376992.1;FR720308.1;FR720309.1;FR720310.1;FR720311.1;FR720312.1;FR720313.1;FR720315.1;FR720317.1;FR720318.1;FR720320.1;FR720321.1;JF894228.1;JN192431.1;JN192432.1;JN192433 .1;JN192435.1;JN192437.1;JN192438.1;JN192439.1;JN192440.1;JQ713822.1;KF055891.1;KF055892.1;KF055893.1;KP412983.1;KP984526.1;KY114802.1;KY114803.1;KY132094.1;KY487998.1;LC029413.1;LC309239.1;LC309240.1;LT960370.1;M23122.1;V01108.1。.<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0142] <h2 style=";text-align:left;direction:ltr"> Similarly, complete genome sequences were downloaded for 13 different prototypic human polyomaviruses, accession numbers are as follows: NC_001538; NC_001699; NC_009238; NC_009539; NC_010277; NC_014406; NC_014407; NC_014361; NC_015150; NC_018102; NC_020106; NC_020890; NC_024118.

[0143] Conservation of the large T antigen splice site The whole genome nucleotide sequences of all reference human polyomaviruses were downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / nuccore) on February 20, 2018 and aligned with WebPrank (available online at: https: / / www.ebi.ac.uk / goldman-srv / webprank / ) using default settings. A phylogenetic UPGMA tree was constructed and sequence logos of all splice sites were generated to show conservation among different human polyomaviruses. The accession numbers of all downloaded reference sequences are listed below. Reference sequences: NC_001538, NC_001699, NC_009238, NC_009539, NC_010277, NC_014406, NC _014407, NC_014361, NC_015150, NC_018102, NC_020106, NC_020890, NC_024118

[0144] The whole genome nucleotide sequences of all human polyomavirus isolates were downloaded from the NCBI website on February 20, 2018. The whole gene sequences of large T antigen were retrieved from unique genome sequences only and aligned using WebPrank with default settings. Sequence logos were generated for all splice sites of large T antigen to show conservation within and among different human polyomaviruses.

[0145] All accession numbers downloaded are listed below: BKPyV: AB211369.1, AB211370.1, AB211371.1, AB211372.1, AB211373.1, AB211374.1, AB211375.1, AB211376.1, AB211377.1, AB211378.1, AB211379.1, AB211380.1, AB211381.1, AB211382.1, AB211383.1, AB211384.1, AB211385.1, AB211386.1, AB211387.1, AB211388.1, AB211389.1, AB211390.1, AB211391.1, AB211392.1, AB211393.1, AB211394.1, AB211395.1, AB211396.1, AB211397.1, AB211398.1, AB211399.1, AB211380.1, AB211381.1, AB211392.1, AB211393.1, AB211394.1, AB211395.1, AB211396.1, AB211397.1, AB211398.1, AB211399.1, AB211310.1, AB211310.1, AB211311.1, AB211312.1, 8.1, AB211389.1, AB211390.1, AB211391.1, AB213487.1, AB217917.1, AB217918.1, AB217919.1, AB217920.1, AB217921.1, AB260028.1, AB260029.1, AB260030.1, AB260031.1, AB260032.1, AB260033.1, AB260034.1, AB263912.1, AB263913.1, AB263914.1, AB263915.1, AB263916.1, AB263917.1, AB26 3918.1, AB263919.1, AB263920.1, AB263921.1, AB263922.1, AB263923.1, AB263924.1, AB263925.1, AB263926.1, AB263927.1, AB263928.1, AB263929 .1, AB263930.1, AB263931.1, AB263932.1, AB263933.1, AB263934.1, AB263935.1, AB263936.1, AB263937.1, AB263938.1, AB269822.1, AB269823.1, A B269824.1, AB269825.1, AB269826.1, AB269827.1, AB269828.1, AB269829.1, AB269830.1, AB269831.1, AB269832.1, AB269833.1, AB269834.1, AB269 835.1, AB269836.1, AB269837.1, AB269838.1, AB269839.1, AB269840.1, AB269841.1, AB269842.1, AB269843.1, AB269844.1, AB269845.1, AB269846.<h2 style=";text-align:left;direction:ltr">1、AB269847.1、AB269848.1、AB269849.1、AB269850.1、AB269851.1、AB269 852.1、AB269853.1、AB269854.1、AB269855.1、AB269856.1、AB269857.1、AB 269858.1, AB269859.1, AB269860.1, AB269861.1, AB269862.1, AB269863.1, AB269864.1, AB269865.1, AB269866.1, AB269867.1, AB269868.1, AB2698 69.1, AB298940.1, AB298941.1, AB298942.1, AB298943.1, AB298944.1, AB298945.1, AB298946.1, AB298947.1, AB301086.1, AB301087.1, AB301088.1 、AB301089.1、AB301090.1、AB301091.1、AB301092.1、AB301093.1、AB3010 94.1、AB301095.1、AB301096.1、AB301097.1、AB301098.1、AB301099.1、AB3 01100.1, AB301101.1, AB301102.1, AB301103.1, AB365130.1, AB365131.1, AB365132.1, AB365133.1, AB365134.1, AB365135.1, AB365136.1, AB36513 7.1, AB365138.1, AB365139.1, AB365140.1, AB365141.1, AB365142.1, AB365143.1, AB365144.1, AB365145.1, AB365146.1, AB365147.1, AB365148.1, AB365149.1, AB365150.1, AB365151.1, AB365152.1, AB365153.1, AB365154.1, AB365155.1, AB365156.1, AB365157.1, AB365158.1, AB365159.1, AB36 5160.1, AB365161.1, AB365162.1, AB365163.1, AB365164.1, AB365165.1, AB365166.1, AB365167.1, AB365168.1, AB365169.1, AB365170.1, AB365171.<h2 style=";text-align:left;direction:ltr">1, AB365172.1, AB365173.1, AB365174.1, AB365175.1, AB365176.1, AB365177.1, AB365178.1, AB369087.1, AB369088.1, AB369089.1, AB369090.1, AB 369091.1, AB369092.1, AB369093.1, AB369094.1, AB369095.1, AB369096.1, AB369097.1, AB369098.1, AB369099.1, AB369100.1, AB369101.1, AB4649 53.1、AB464954.1、AB464955.1、AB464956.1、AB464957.1、AB464958.1、AB 464959.1、AB464960.1、AB464961.1、AB464962.1、AB464963.1、AB485694.1 、AB485695.1、AB485696.1、AB485697.1、AB485698.1、AB485699.1、AB4857 00.1、AB485701.1、AB485702.1、AB485703.1、AB485704.1、AB485705.1、AB4 85706.1, AB485707.1, AB485708.1, AB485709.1, AB485710.1, AB485711.1, AB485712.1, AY628224.1, AY628225.1, AY628226.1, AY628227.1, AY62822 8.1, AY628229.1, AY628230.1, AY628231.1, AY628232.1, AY628233.1, AY628234.1, AY628235.1, AY628236.1, AY628237.1, AY628238.1, DQ305492.1 EF376992.1、FR720308.1、FR720309.1、FR720310.1、FR720311.1、FR72031 2.1、FR720313.1、FR720314.1、FR720315.1、FR720316.1、FR720317.1、FR72 0318.1, FR720319.1, FR720320.1, FR720321.1, FR720322.1, FR720323.1, JF894228.1, JN192431.1, JN192432.1, JN192433.1, JN192434.1, JN192435.1, JN192436.1, JN192437.1, JN192438.1, JN192439.1, JN192440.1, JN192441.1, JQ713822.1 , KF055891.1, KF055892.1, KF055893.1, KP412983.1, KP984526.1, KY114802.1, KY114803.1, K Y132094.1, KY487998.1, LC029411.1, LC029412.1, LC029413.1, LC029414.1, LC309239.1, LC3 09240.1, LT934539.1, LT960370.1, M23122.1, MF627830.1, MF627831.1, V01108.1, V01109.1. .

[0146] Splice site conservation and phylogenetic tree The entire gene sequence of large T antigen, including intron sequences, was aligned with 13 different polyomavirus reference sequences and all unique BK polyomavirus isolates using clustalW (package 'msa' in R). Phylogenetic trees were constructed using the UPGMA method (packages 'phangorn' and 'ggtree' in R). Sequence logos of acceptor and donor splice sites were generated to show nucleotide-specific conservation between subtypes (package 'msa' in R).

[0147] ASO Design Antisense oligonucleotides (ASOs) were designed to target the donor splice site of the BK virus large T antigen (SEQ ID NOs: 1-10). Additional ASOs derived from SEQ ID NOs: 1-10 and with chemical modifications were designed. They contain 2'-O-methyl bases, are 20 nucleotides long, and are further modified with a complete phosphorothioate backbone (*) and optionally with 5-methylcytidine. The secondary structure and binding energies of the ASOs were predicted using the RNA structure. All ASO sequences are shown below.

[0148] [Table 3]

[0149] [Table 4]

[0150] [Table 5]

[0151] cell culture Immortalized proximal tubule kidney epithelial HK2 cells (ATCC® CRL-2190™) were obtained from ATCC and maintained in Dulbecco's Modified Eagle Medium-F12, 1:1 mix with 15 mM Hepes, 2.5 mM L-glutamine (Lonza), triiodothyronine, epidermal growth factor (EGF), insulin-transferrin-selenium-ethanolamine (ITS-X), hydrocortisone, and 100 U / mL penicillin-streptomycin at 37°C and 5% CO2. Human renal proximal tubule epithelial cells (PTEpiC) (Sciencell, #4100) were maintained in complete epithelial cell medium (Sciencell, #4101) consisting of 500 ml of basal medium, 2% fetal bovine serum, and 1× epithelial cell growth supplement. Experiments with hPTECs were performed between passages 4 and 6. pRPc cells are a murine cell line transformed with the BKV early coding region (Negrini, M. et al., Cancer Research, 1992) and constitutively express the BKV large T antigen. pRPc cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% FCS. All cells were cultured at 37°C and 5% CO2 in the presence of 100 U / mL penicillin, 100 μg / mL streptomycin solution (Invitrogen, Breda, The Netherlands).

[0152] BK polyomavirus (ATCC® VR-837™) was obtained from ATCC and diluted in complete HK2 culture medium to reduce the infectious load. For treatment experiments, cells were plated in 6- or 12-well plates (Corning) at 32,000 cells / cm. 2Cells were seeded at a density of 1000 x 1000 and cultured overnight. ASO treatment was performed by incubating cells with Lipofectamine 3000 (Thermo Fisher) at an ASO concentration of 50 nM for 5 h, after which the Lipofectamine was washed away. Infection with BK polyomavirus was performed 24 h after washing of the cells by incubating the cells with BK polyomavirus-containing culture medium for 2 h, after which the cells were washed three times to remove excess viral particles. Supernatants were collected after these initial washes and at days 3, 5, and 7 post-infection to measure viral particle production using PCR. To measure the infectious load, samples for viral load were taken prior to infection. RNA and protein were harvested on day 7 to measure large T antigen and VP1 expression.

[0153] Measurement of viral load To measure viral load in culture supernatants, 200 μL was taken from each well at each time point. Pierce Universal Nuclease was added to each sample and incubated at room temperature for 15 min to degrade unpackaged DNA, followed by inactivation with 5 mM EDTA. Viral DNA was isolated from the supernatants using a DNA mini kit (Qiagen) and viral load was measured using Taqman PCR as described below (Wunderink, HF, et. al., J. Clin. Virol., 2017).

[0154] To monitor the quality of DNA extraction and potential PCR inhibition, a low concentration of phocine herpesvirus was added to the lysis buffer. DNA was eluted in a final volume of 100 μL elution buffer, of which 10 μL was used as input for real-time quantitative PCR (qPCR). A 90 bp fragment within the BKPyV VP1 gene was amplified using primers 440BKV 5'-GAAAAGGAGAGTGTCCAGGG-3' (SEQ ID NO: 46) and 441BKVas 5'-GAACTTCTACTCCTCCTTTTATTAGT-3' (SEQ ID NO: 47) and Taqman probe 576BKV-TQ-FAM FAM 5'-CCAAAAAGCCAAAGGAACCC-3'-BHQ1 (SEQ ID NO: 48) (sequence provided by the LUMC Department of Medical Microbiology). BKPyV qPCR and phocine herpesvirus PCR were run in duplicate to monitor DNA quality and potential PCR inhibition. Furthermore, BKPyV qPCR was also effective for detecting BKPyV genotypes I to IV.

[0155] Quantitative PCR reactions were performed in a total volume of 50 μL containing 25 μL HotStarTaq Master Mix (QIAGEN, Hilden, Germany), 0.5 μmol / L of each primer, 0.35 μmol / L of BKPyV probe, and 3.5 mmol / L of MgCl2. Reactions were performed using a CFX96 real-time detection system (Bio-Rad, Hercules, CA, USA) with the following cycle conditions: 15 min at 95°C, followed by 45 cycles of amplification (30 s at 95°C, 30 s at 55°C, 30 s at 72°C). Quantitation was performed using standards from quantified BKPyV-positive urine samples. The analytical sensitivity of the BKPyV qPCR was approximately 10 copies / mL. Three negative controls were included on each plate. These controls were negative in all PCR assays. PCR results with a cycle threshold of 40 or more were considered negative.

[0156] Antibodies and Western blotting Protein concentration was measured by the BCA method. Samples were electrophoresed on 4-15% TGX gels and transferred to nitrocellulose or PVDF membranes. The antibodies used were: rabbit polyclonal anti-actin-HRP (loading control), rabbit polyclonal anti-SV40 VP1 (ab53977, Abcam), mouse monoclonal anti-SV40 T antigen [PAb416] (ab16879, Abcam), mouse monoclonal anti-SV40 T antigen (PAb108, Thermo Fisher), rabbit polyclonal anti-SV40 VP1 (Abcam, ab53977), biotinylated Lotus Tetragonolobus Lectin (LTL; Vector Laboratories, B-1325), sheep polyclonal anti-nephrin (AF4269, R&D Systems), purified mouse anti-E-cadherin (Becton Dickinson, 610181), rabbit polyclonal anti-GAPDH (Cell Signalling, D16H11) and rabbit polyclonal anti-phosphorothioate (Dr. Jonathan (Courtesy of Watts, University of Massachusetts Medical School). Primary antibodies were incubated overnight at 4°C for large T antigen and VP1, and 30 min at room temperature for actin. Secondary antibodies for large T antigen and VP1 were goat polyclonal anti-mouse-HRP (P044701-2, Agilent) and goat polyclonal anti-rabbit-HRP (P044801-2, Agilent), respectively. Additionally, goat anti-rabbit 488 (Life Technologies, A-11008), donkey anti-rabbit 488 (Invitrogen, A21206), donkey anti-rat 647 (Invitrogen, ab150155), donkey anti-sheep 647 (Invitrogen, A21448), donkey anti-mouse IgG2a 647 (Invitrogen, A31571), streptavidin 568 (Invitrogen, S11226), and an isotype control rabbit IgG (Dako, X0936).Membranes were incubated with SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher) and protein bands were visualized using a ChemiDoc MP Imaging System (Bio Rad). Nuclei were counterstained with Hoechst.

[0157] Immunohistochemistry test Mice were sacrificed, and kidneys, liver, lungs, spleen, bladder, and heart were removed and perfused with PBS, then fixed in 10% buffered formalin and embedded in paraffin. Kidney tissues were sectioned at 4 μm thickness and mounted on glass slides. Freshly sliced ​​sections were deparaffinized in xylene for 10 min, after which sections were rehydrated in a graded ethanol series and placed in PBS. Sections were then stained for ASO (with antibodies detecting phosphorothioate backbones or by fluorescent in situ hybridization with RNA-based probes), tubular kidney injury marker-1 (KIM-1) staining for kidney injury, or interstitial collagen staining with Sirius Red staining.

[0158] Real-time qPCR ASO-treated and BKV-infected cells were lysed with Trizol, and RNA was isolated using the RNeasy kit (Qiagen). DNAse I (Qiagen) treatment was added to remove excess DNA during isolation, and cDNA was synthesized using Promega reverse transcriptase, DTT, dNTPs, and random primers. Real-time PCR was performed using the CFX384 Touch™ Real-Time PCR Detection System (Bio Rad) with SYBR™ Select Master Mix (Thermo Fisher) and the following primers:

[0159] [Table 6]

[0160] Activated partial thromboplastin time (aPTT) assay A magnetic ball was added to a StartMax cuvette (Diagnostica Stago). Plasma was diluted with Owren-Koller diluent (Diagnostica Stago) and then 50 μL of aPTT reagent (TriniClot) was added per cuvette. 50 μL of diluted plasma with 5 μL of ASO solution was then added to the aPTT reagent and incubated at 37°C for 170 seconds. The cuvette was then placed in a magnetic field and the magnetic field was activated to initiate clotting. At 180 seconds, a repeater pipette added 50 μL of 25 mM CaCl2 per cuvette and clotting time measurements were automatically recorded after each pipetting step.

[0161] Peripheral blood mononuclear cell cytokine production assay PBMCs were thawed, added to culture medium for 5 min, and collected by centrifugation. Cells were resuspended and initial viability was assessed by trypan blue exclusion, after which cells were diluted to 1.67 × 10 6 The cells were diluted to 1000 cells / mL. Negative and positive controls were then prepared in culture medium (R848 (Invivogen, USA)). Cytokine production in response to exposure to 1 μM or 10 μM ASO was assessed by adding 20 μL of negative or positive control or the appropriate ASO concentration to round-bottom wells, followed by 180 μL of culture medium containing PBMCs and incubating for 48 h at 37 °C (5% CO2). Cultures were then transferred to Eppendorf tubes, centrifuged at 1200 rpm for 6 min, and the supernatants were transferred to custom multiplex ELISA plates to detect GM-CSF, IFN-γ, IL-6, IL-12 (p70 subunit), MIP-1b, TNF-α, G-CSF, IFN-α2, IL-1b, IL-2, IL-10, and IL-17.

[0162] Cell viability was assessed by adding negative or positive control substances or ASO to flat-bottom wells, adding 190 μL of culture medium containing PBMCs, and incubating for 48 hours at 37°C (5% CO2). CellTiter-Blue reagent was then added to each well, mixed for 4 hours, incubated for 4 hours, and fluorescence was measured at 555 / 585 nm.

[0163] Hybridization ELISA (hELISA) Tissues from mice were placed in lysis buffer and diluted to non-saturating concentrations. Standard curves and tissue samples were diluted 1:50 in sample buffer by adding 1 μL of standard curve or tissue sample to 49 μL of sample buffer per well of a 96-well plate. Next, 50 μL of probe mix (consisting of 20 nM capture probe and 20 nM detection probe) was added per well, after which the 96-well plate was covered with a light-refractive seal. The probes were then hybridized in a thermal cycler at 95°C for 5 min, 40°C for 30 min, and finally maintained at 12°C. Next, MSD Gold plates (Mesoscale) were washed with KPL wash buffer, and the hybridized samples were transferred from the 96-well plate to the MSD Gold plate in duplicate. The MSD Gold plate was covered with a light-refractive seal and incubated at room temperature for 30 min on an orbital shaker at 650 rpm. Each well was then washed three times with KPL buffer, after which 0.5 μg / mL of SULFO-tag anti-digoxiginin antibody (in 1% Blocker A buffer) was added to each well. The plate was sealed with light refracting strips and incubated for 60 minutes on an orbital shaker at 650 rpm. The plate was then washed three times with KPL buffer, after which MSD Gold buffer was added to each well and the plate was read on a spectrophotometer.

[0164] animal C57Bl6 wild-type mice were housed in the animal facility of the Leiden University Medical Center. Mice had free access to food and water. For biodistribution and preliminary safety studies, ASOs were administered intravenously via the tail vein (40 mg / kg) on ​​days 0, 3, 7, and 10. At sacrifice (day 14), blood (and urine) was collected from each mouse and left at room temperature for 30 min, then centrifuged at 6,000 rpm at 4°C and the supernatants were collected. Creatinine, blood urea nitrogen (BUN or urea), albumin, aspartate aminotransferase (AST), and alanine aminotransferase (ALT) were measured in the clinical chemistry laboratory at LUMC.

[0165] Example 2 result The ASO according to the present invention has improved antiviral activity. To illustrate the antiviral activity of ASOs according to the invention, the antiviral activity of an ASO according to SEQ ID NO:8 (ASO8) was compared to that of structurally similar ASOs according to SEQ ID NOs:23 and 24, respectively, of WO 2019 / 168402 (ASO23 and ASO24). ASO23 and ASO24 differ from ASO8 only in that their target region of 20 nucleotides in the polyomavirus large T antigen pre-mRNA begins one nucleotide upstream or downstream, respectively.

[0166] Human renal proximal epithelial cells (PTECs) were treated with 50 nM ASO 24 h prior to BKV infection and BKV RNA and protein expression was quantified 5 days post-infection. In this in vitro model, T-Ag and VP1 mRNA were reduced by 93.8% and 96.5%, respectively, when treated with ASO8 compared to untreated controls. These reductions were superior to those achieved with ASO23 (T-Ag: 91.9%, VP1: 92.0%) and ASO24 (T-Ag: 92.4%, VP1: 90.4%). See Figure 17A. The improvement by ASO8 was confirmed by measuring downstream VP1 protein expression, which was more effectively inhibited (92.5%) by treatment with ASO8 compared to 80.7% by ASO23 and 89.4% by ASO24. See Figure 17B. Overall, these results show that ASO8 efficiently inhibits BKV replication with an improvement compared to structurally similar ASOs, which was entirely unexpected given the structural similarity and therefore the nearly identical target region.

[0167] Materials and Methods Transfection and infection of cells Human renal proximal epithelial cells (PTECS, Sciencell, Cat. No.: 4100) were maintained in REBM basal medium (Lonza, Cat. No.: CC-3191) supplemented with 0.5% FCS and REGM™ SingleQuots™ supplement (Lonza, Cat. No.: CC-4127, hereafter referred to as REGM) at 37°C and 5% CO2. Before gene transduction, PTECs were plated in 12-well plates (Corning, Cat. No.: 3512) at 21,000 cells / cm2. 2Cells were seeded overnight at a density of 1000 x 1000 (Invitrogen, Cat. No.: L3000075). Gene transduction of 50 nM ASO was achieved using Lipofectamine 3000 (Invitrogen, Cat. No.: L3000075) according to the manufacturer's instructions. After 5 h of incubation, all REGM was replaced with fresh REGM and cells were maintained overnight, after which cells were infected with BKV (ATCC, Cat. No.: VR-837; diluted 1:3000 from original stock) for 2 h. Virus-containing REGM was aspirated and all wells were washed three times before adding fresh REGM. Cells were maintained in culture for 5 days post-infection and REGM was replenished on day 3 post-infection. Untreated cells were harvested as controls.

[0168] Quantitative real-time PCR RNA was isolated using the RNeasy kit (Qiagen, Catalog No.: 74106) according to the manufacturer's instructions using RLT buffer and 1% 2-mercaptoethanol (Sigma-Aldrich, Catalog No.: M3148-100mL) and DNAse I treatment (Qiagen, Catalog No.: 1010395). After RNA elution, a DNA removal step was added to remove excess BKV DNA using the TURBO DNA-free™ Kit (Thermo Fisher Scientific, Catalog No.: AM1907). Synthesis of cDNA was performed using M-MLV reverse transcriptase (catalog number: M1708), 10 mM dNTP Mix (catalog number: U1518), RNasin® ribonuclease inhibitor (catalog number: N2518), oligo(dT)15 primer (catalog number: C110A) and molecular grade 0.1 M DTT (all from Promega, catalog number: Y00147) in M-MLV RT 5x buffer (catalog number: M531A). Quantitative real-time PCR analysis of BKV RNA expression was performed using a CFX Opus Real-Time PCR System (Bio-Rad) with SYBR Select Master Mix (Thermo Fisher Scientific, Cat. No.: 4472908) and the following primers according to the table below: T-Ag: GAGGAGGATGTAAAGGTAGCTCA (forward, SEQ ID NO: 70) and ACTGGCAAACATATCTTCATGGC (reverse, SEQ ID NO: 71); VP1: TGCAGGGTCACAAAAGTGC (forward, SEQ ID NO: 72) and AGCACTCCCTGCATTTCCAA (reverse, SEQ ID NO: 73); GAPDH: ACAACTTTGGTATCGTGGAAGG (forward, SEQ ID NO: 74) and GCCATCACGCCACAGTTTC (reverse, SEQ ID NO: 75). Changes in mRNA expression were measured by the ΔΔCt method.

[0169] [Table 7]

[0170] Quantification of VP1 protein by simple Western analysis Five days after infection, cells were lysed by adding 1:100 Pierce Protease and Phosphatase Inhibitor Mini Tablets (ThermoFisher Scientific, Catalog No.: A32959) in RIPA Lysis and Extraction Buffer (ThermoFisher Scientific, Catalog No.: 89901), and protein concentrations were measured using the Pierce™ BCA Protein Assay Kit (Thermo Scientific, Catalog No.: 23225). VP1 protein expression was quantified using the Jess Simple Western System (Biotechne). Briefly, 0.5 mg / mL protein lysate samples were analyzed using the 12-230 kDa Separation Module (ProteinSimple, Catalog No.: SM-W004-1) and Anti-Rabbit Detection Module (ProteinSimple, Catalog No.: DM-001). Antibodies were diluted in Antibody Diluent, if necessary. VP1 protein was detected using Anti-SV40 VP1 antibody (Abcam, Cat. No.: ab53977) at 1:20 and Goat Anti-Rabbit Immunoglobulins / HRP (Agilent, Cat. No.: P044801-2) at 1:20. β-Actin protein expression was detected using β-Actin Mouse monoclonal Antibody (Cell Signaling Technology, Cat. No.: #3700S) at 1:20 and Goat Anti-Mouse Immunoglobulins / HRP (Agilent, Cat. No.: P044701-2) at 1:20 as secondary antibody and loading control. The assay consisted of a separation time of 30 minutes at a voltage of 375V, followed by an antibody diluent time of 5 minutes, a primary antibody time of 60 minutes and a secondary antibody time of 30 minutes. Peak area calculation was performed using the high dynamic range chemiluminescence signal titration line. Peak finding threshold and width were adjusted for each capillary to ensure proper signal fit.

Claims

1. An oligonucleotide comprising a nucleic acid base sequence according to one of sequence numbers 8, 1, 2, 3, 4, 5, 6, 7, 9, 10, and 11, or a nucleic acid base sequence similar to any one of sequence numbers 1 to 11, characterized in that at least one nucleic acid base of the sequence number is substituted by a nucleic acid base analog, and the nucleic acid base analog has the same base pairing specificity as the substituted nucleic acid base.

2. The oligonucleotide according to claim 1, characterized in that the nucleic acid base sequence of the oligonucleotide consists of the nucleic acid base sequence of one of sequence numbers 1 to 11, or the nucleic acid base sequence of the oligonucleotide consists of a nucleic acid base sequence similar to any one of sequence numbers 1 to 11, and at least one nucleic acid base of the sequence number is substituted by a nucleic acid base analog, and the nucleic acid base analog has the same base pairing specificity as the substituted nucleic acid base.

3. The oligonucleotide according to claim 1 or 2, comprising a modification that can make the RNA duplex resistant to RNase H, wherein the RNA duplex comprises the oligonucleotide and a complementary oligonucleotide (complementary oligonucleotide).

4. The oligonucleotide according to claim 1 or 2, comprising modified nucleotide interbonding, preferably phosphorothioate nucleotide interbonding.

5. The oligonucleotide according to claim 1 or 2, comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 sugar modifications, wherein the sugar modification is a modification of the ribosyl moiety, preferably selected from the group consisting of 2'-O-modification, more preferably 2'-O-alkyl or 2'-O-(substituted)alkyl, and even more preferably 2'-O-methyl or 2'-O-(2-methoxy)ethyl (2'-MOE).

6. The oligonucleotide according to claim 4, comprising a nucleotide sequence according to one of SEQ ID NOs: 12 to 21, or a nucleotide sequence according to SEQ ID NO: 22, preferably the nucleotide sequence of the oligonucleotide comprising a nucleotide sequence according to one of SEQ ID NOs: 12 to 22.

7. The oligonucleotide according to claim 6, comprising the nucleotide sequence according to SEQ ID NO: 19, and preferably the nucleotide sequence of the oligonucleotide being the nucleotide sequence according to SEQ ID NO:

19.

8. The oligonucleotide according to claim 4, comprising unmodified nucleotide bonds between nucleotides 5 to 16 of sequence numbers 1 to 11, and modified nucleotide bonds between at least two of the most 5' terminal nucleotides of the oligonucleotide and between at least two of the most 3' terminal nucleotides of the oligonucleotide.

9. (i) an oligonucleotide according to claim 1 or 2, (ii) a reverse complement of an oligonucleotide according to claim 1 or 2, or (iii) A vector comprising DNA that can be transcribed into the oligonucleotide described in claim 1 or 2, preferably a viral vector.

10. A pharmaceutical composition comprising the oligonucleotide described in claim 1 or 2.

11. A pharmaceutical composition comprising the oligonucleotide described in claim 1 or 2 for use in the treatment of polyomavirus infection in a subject.

12. A pharmaceutical composition for use according to claim 11, administered to an immunocompromised subject.

13. The pharmaceutical composition for use according to claim 12, wherein the subject of the immunodeficient state is a transplant recipient, preferably a kidney transplant recipient.

14. An ex vivo method for inhibiting polyomavirus replication in cells, (i) providing cells infected with a polyomavirus, and contacting the cells with the oligonucleotide described in claim 1 or 2, or (ii) To provide cells containing the oligonucleotide described in claim 1 or 2, and to bring the cells into contact with a polyomavirus. Exvivo method including

15. An ex vivo method for preparing a graft, comprising: providing a donor organ, tissue, or cells, preferably including kidney cells; and contacting the cells of the donor organ, tissue, or cells with the oligonucleotide described in claim 1 or 2.

16. Oligonucleotides have the following effects: 1) Regulation of T antigen premRNA splicing, 2) Decreased production of T antigen mRNA, 3) Decreased production of VP1 mRNA and preferably VP1 protein. 4) Inhibition of viral replication, 5) Limitation of the ability of the virus to reinfect, 6) Prevention of cellular effects related to infection, 7) Reduction of cellular effects related to the aforementioned infection, 8) Prevention of disease in infected subjects, and 9) Slowing down, preferably stopping, and more preferably reversing the progression of the disease. A pharmaceutical composition comprising an oligonucleotide according to claim 1 or 2, for use in treating polyomavirus infection in a subject, which can demonstrate at least one of the above.

17. A pharmaceutical composition for use according to claim 16, wherein if at least one parameter of the disease associated with the polyomavirus infection is reduced, the disease is prevented (8) or its progression is slowed, stopped or reversed (9), and the parameter is selected from glomerular filtration rate, creatinine level, cyclin E2 (CCNE2), cell division cycle 6 (CDC6), cyclin E2 (CCNA2), E2F transcription factor 8 (E2F8), survivorbin (BIRC5), RAD51-related protein-1 (RAD51AP1), BRCA1 interacting protein C-terminal helicase 1 (BRIP1), and apolipoprotein B mRNA editing enzyme 3B (APOBEC3B).

18. A pharmaceutical composition comprising the vector described in claim 9.

19. A pharmaceutical composition comprising the vector according to claim 9 for use in the treatment of polyomavirus infection in a subject.

20. A pharmaceutical composition for use according to claim 19, administered to an immunocompromised subject.

21. The pharmaceutical composition for use according to claim 20, wherein the subject of the immunodeficient state is a transplant recipient, preferably a kidney transplant recipient.

22. The vector has the following effect: 1) Regulation of T antigen premRNA splicing, 2) Decreased production of T antigen mRNA, 3) Decreased production of VP1 mRNA and preferably VP1 protein. 4) Inhibition of viral replication, 5) Limitation of the ability of the virus to reinfect, 6) Prevention of cellular effects related to infection, 7) Reduction of cellular effects related to the aforementioned infection, 8) Prevention of disease in infected subjects, and 9) Slowing down, preferably stopping, and more preferably reversing the progression of the disease. A pharmaceutical composition comprising the vector according to claim 9, for use in treating polyomavirus infection in a subject, which can demonstrate at least one of the following.

23. A pharmaceutical composition for use according to claim 22, wherein if at least one parameter of the disease associated with the polyomavirus infection is reduced, the disease is prevented (8) or its progression is slowed, stopped or reversed (9), and the parameter is selected from glomerular filtration rate, creatinine level, cyclin E2 (CCNE2), cell division cycle 6 (CDC6), cyclin E2 (CCNA2), E2F transcription factor 8 (E2F8), survivorbin (BIRC5), RAD51-related protein-1 (RAD51AP1), BRCA1 interacting protein C-terminal helicase 1 (BRIP1), and apolipoprotein B mRNA editing enzyme 3B (APOBEC3B).

24. An ex vivo method for inhibiting polyomavirus replication in cells, (i) providing cells infected with a polyomavirus, and contacting the cells with the vector described in claim 9, or (ii) To provide cells containing the vector described in claim 9, and to bring the cells into contact with a polyomavirus. Exvivo method including

25. An ex vivo method for preparing a graft, comprising: providing a donor organ, tissue, or cells, preferably including kidney cells; and contacting the cells of the donor organ, tissue, or cells with the vector described in claim 9.

26. An ex vivo method for inhibiting polyomavirus replication in cells, (i) providing cells infected with a polyomavirus, and contacting the cells with the pharmaceutical composition described in claim 10, or (ii) To provide cells containing the pharmaceutical composition according to claim 10, and to bring the cells into contact with a polyomavirus. Exvivo method including

27. An ex vivo method for preparing a graft, comprising: providing a donor organ, tissue, or cells, preferably including kidney cells; and contacting the cells of the donor organ, tissue, or cells with the pharmaceutical composition described in claim 10.

Images