Treatment of myelin disorders

JP2025516186A5Pending Publication Date: 2026-05-01MYRTELLE INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
MYRTELLE INC
Filing Date
2023-04-24
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Current therapies for hereditary and acquired disorders of myelin, such as Pelizaeus-Merzbacher disease, multiple system atrophy, and hypomyelination with basal ganglia and cerebellar atrophy, are limited due to the lack of effective disease-modifying treatments.

Method used

The use of adeno-associated virus (AAV) particles with preferential tropism for oligodendrocytes, encapsulating a polynucleotide comprising a 5' inverted terminal repeat (ITR), a promoter sequence region, a polynucleotide encoding a pri- or pre-miRNA targeting specific genes, and a 3' ITR, to reduce gene expression in oligodendrocytes and treat myelin-related disorders.

Benefits of technology

This approach effectively reduces gene expression in oligodendrocytes, potentially leading to improved therapeutic outcomes for myelin-related disorders by restoring oligodendrocyte function and promoting proper myelination.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure relates to RNA molecules, recombinant nucleic acids, and gene therapy vectors for use in the treatment of diseases and disorders associated with myelin deficiency or dysfunction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of priority of U.S. Provisional Application No. 63 / 363,529, filed Apr. 25, 2022. The content of this application is hereby incorporated by reference in its entirety.

[0002] Reference to Sequence Listing This application incorporates by reference a Sequence Listing submitted in computer - readable form as a file named Sequence_Listing_323429 - 00201.xml, created on Apr. 19, 2023, and containing 258,210 bytes.

[0003] The present disclosure relates to compositions and methods for treating hereditary and / or acquired disorders of myelin.

Background Art

[0004] The human central nervous system (CNS), including the brain and spinal cord, is composed of two types of cells: neurons and glia. A neuron has a cell body that holds a nucleus (where the cell's genes are located), an axon that extends away from the cell body (ending at an axon terminal), and dendrites that branch off from the cell body and connect to axon terminals from other neurons. Neurons receive information at the cell body and dendrites (from other neurons) and send this information along their axons to other neurons. The information travels the length of the axon in the form of an electrical signal known as an action potential. At the end of the axon, the action potential induces the release of neurotransmitters (into the synapse, a small space between cells where neurotransmitters move). All activities of the central nervous system, namely thinking, processing of sensory information, storage of memory, and control of muscles and glands, are performed by a network of interconnected neurons.

[0005] Glia cells in the CNS support the function of neurons. These cells include astrocytes, microglia, and oligodendrocytes. Astrocytes form the blood-brain barrier (BBB), supply nutrients to neurons, and maintain extracellular ion balance and neurotransmitter levels. Microglia are phagocytic cells that migrate through the CNS and are similar to macrophages that remove damaged or unwanted substances. Oligodendrocytes are the myelin-producing cells of the central nervous system.

[0006] Myelin is a structurally complex substance composed of high levels of saturated long-chain fatty acids, sphingolipids, cholesterol, and proteins. Oligodendrocytes create myelin by extending sheet-like projections, each of which contacts a segment of the axon and tightly wraps around it multiple times to create the unique architecture of the myelin sheath. On the same axon, adjacent myelin segments belong to different oligodendrocytes, and a single oligodendrocyte can myelinate up to 50 axon segments (Stadelmann et al., 2019). Oligodendrocyte myelin facilitates the rapid conduction of action potentials and supports the metabolic needs of the axon. Oligodendrocytes are also involved in extracellular fluid regulation and provide neurotrophic support through the production of neurotrophic factors such as glial cell line-derived neurotrophic factor (GDNF), brain-derived neurotrophic factor (BDNF), or insulin-like growth factor-1 (IGF-1) (Bradl and Lassmann, 2010).

[0007] The central nervous system is generally organized into "gray matter" that contains the cell bodies and dendritic networks of neurons, and "white matter" that consists of axon bundles wrapped by myelin produced by oligodendrocytes. The myelin sheath has a high lipid fat content and a whitish appearance. Myelin plays an important role in neurotransmission. Disorders of oligodendrocytes disrupt the integrity of white matter, leading to white matter degeneration (demyelination) and loss of neurotransmission in the brain and spinal cord.

[0008] Hereditary or acquired myelin-related disorders affect millions of people and impose a heavy burden on affected individuals and their families. The pathological processes underlying many of these disorders remain largely unknown, and disease-modifying therapies are scarce. Therefore, there is a need for therapeutic agents to treat these disorders. SUMMARY OF THE INVENTION

[0009] In some aspects, the present disclosure addresses the above-mentioned need.

[0010] One aspect of the invention provides a method for reducing gene expression in oligodendrocytes or a method for treating a hereditary or acquired disorder of myelin, the method comprising preparing a composition comprising adeno-associated virus (AAV) particles having preferential tropism for the cell surface of oligodendrocytes, the AAV particles encapsidating a polynucleotide comprising a 5' inverted terminal repeat (ITR), a promoter sequence region, a polynucleotide encoding a pri- or pre-miRNA targeting the gene, optionally a post-transcriptional regulatory element (e.g., the post-transcriptional regulatory element of woodchuck hepatitis), a polyA signal sequence region, and a 3' ITR.

[0011] In certain embodiments, the polynucleotide is a pri- or pre-miRNA scaffold derived from human mir-16-1, miR-21, miR-23a, miRNA-30a, miR-31, miR-122, miR-155, or miR-451, the pri- or pre-miRNA scaffold excluding the native sequences of the guide and passenger strands of the pre-miRNA, with a heterologous guide strand inserted into the scaffold as a replacement for the native sequence of the guide strand, the heterologous guide strand being complementary to the mRNA of the target gene, such that upon processing of the pri- or pre-miRNA by cytoplasmic nucleases, the heterologous guide strand is incorporated into the RISC complex, enabling the RISC complex to target the mRNA of the target gene and downregulate gene expression.

[0012] In certain embodiments, the heterologous guide strand is complementary to the mRNA of the protein, and its elimination improves the therapeutic outcome of hereditary or acquired disorders of myelin, such as Pelizaeus-Merzbacher disease, multiple system atrophy, or hypomyelination with basal ganglia and cerebellar atrophy.

[0013] In one aspect, the present disclosure provides a method of reducing the expression of a target gene in oligodendrocytes or a method of treating a hereditary or acquired disorder of myelin. The method includes: (1) preparing AAV particles having preferential tropism for the cell surface of oligodendrocytes, wherein the AAV particles encapsidate a nucleic acid comprising, from 5' to 3', a 5' ITR, a promoter sequence region, a polynucleotide encoding a pri- or pre-miRNA targeting the target gene, and a 3' ITR; and (2) contacting the AAV particles with the oligodendrocytes. In some embodiments, the nucleic acid may further include one or more of a post-transcriptional regulatory element and a polyA signal sequence region between the polynucleotide and the 3' ITR. The pri- or pre-miRNA may include: (a) a pri- or pre-miRNA scaffold; (b) a heterologous guide strand; and (c) a heterologous passenger strand.

[0014] In one embodiment, the pri- or pre-miRNA scaffold is a human pri- or pre-miRNA scaffold derived from a human microRNA. Examples of human microRNAs include those derived from human mir-16-1, miR-21, miR-23a, miRNA-30a, miR-31, miR-122, miR-155, or miR-451. Preferably, the human pri- or pre-miRNA scaffold does not contain the natural sequence of the natural guide strand and the natural sequence of the natural passenger strand of the human microRNA. A heterologous guide strand can be inserted into the human pri- or pre-miRNA scaffold as a replacement for the natural sequence of the natural guide strand. The heterologous guide strand can be complementary to the mRNA of the target gene. When the pri- or pre-miRNA is processed by a cytoplasmic nuclease, the heterologous guide strand is incorporated into the RISC complex, enabling the RISC complex to target the mRNA of the target gene and downregulate the expression of the target gene.

[0015] In the above method, the heterologous guide strand can be complementary to the mRNA of the protein, and its elimination improves the therapeutic outcome of hereditary or acquired disorders of myelin. In one example, the hereditary or acquired disorder of myelin can be Pelizaeus-Merzbacher disease. In that case, the protein can be PLP1. For that purpose, the heterologous guide strand can include a nucleotide sequence having at least 70%, 80%, 85%, 90%, or 95% identity to one of SEQ ID NOs: 42-80, such as SEQ ID NO: 54 or SEQ ID NO: 75. In another example, the hereditary or acquired disorder of myelin is multiple system atrophy. In that case, the targeted protein can be alpha-synuclein. For that purpose, the heterologous guide strand can include a nucleotide sequence having at least 70%, 80%, 85%, 90%, or 95% identity to one of SEQ ID NOs: 122-161. In a further example, the hereditary or acquired disorder of myelin is hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC). In that case, the targeted protein can be microtubule-associated protein tubulin beta-4a. Thus, the heterologous guide strand can include a nucleotide sequence having at least 70%, 80%, 85%, 90%, or 95% identity to one of SEQ ID NOs: 204-244. Preferably, the nucleotide sequence has a length of 21-30 nucleotides.

[0016] In another aspect, the present disclosure features an RNA molecule comprising a first RNA sequence and a second RNA sequence. The first and second RNA sequences are substantially complementary, and the first RNA sequence has a sequence length of at least 19 nucleotides and is at least 70%, 80%, 85%, 90%, or 95%, or 100% complementary to one target sequence selected from the group consisting of SEQ ID NOs: 2-40, 82-121, and 163-203. In one embodiment, the target sequence comprises or is SEQ ID NO: 14 or 35. In one embodiment, the RNA molecule may be included in a pre-miRNA scaffold or pri-miRNA scaffold derived from a human microRNA, for example, a human pri- or pre-miRNA scaffold. Examples of human microRNAs include human mir-16-1, miR-21, miR-23a, miRNA-30a, miR-31, miR-122, miR-155, and miR-451. In one example, the human microRNA is miRNA-30a. Preferably, the human pri- or pre-miRNA scaffold does not include the natural sequence of the natural guide strand and the natural sequence of the natural passenger strand of the human microRNA. In one example, the first strand is a heterologous guide strand inserted into a human pri- or pre-miRNA scaffold as a replacement for the natural sequence of the natural guide strand. In one embodiment, the RNA molecule comprises, consists essentially of, or consists of the sequence of SEQ ID NO: 284 or 285 shown in FIG. 11 or 12.

[0017] (1) The polynucleotide encoding the above RNA molecule, (2) an expression cassette or an expression vector containing the polynucleotide, and (3) a host cell containing the polynucleotide or the expression cassette or the expression vector are within the scope of the present disclosure. The expression cassette or the expression vector may further contain one or more of a 5' ITR, a promoter sequence region, a post-transcriptional regulatory element, a polyA signal sequence region, and a 3' ITR from 5' to 3'. In some embodiments, the expression vector is a viral vector such as an AAV vector. In one example, the AAV vector has a preferential tropism for oligodendrocytes. Examples of such AAV vectors include AAV / Olig001, AAV / Olig002, and AAV / Olig003. Another example is AAV9 having six glutamate residues inserted into the VP2 region as described in Powell SK et al. Mol Ther 28(5):1373-1380.

[0018] The above RNA molecule, or polynucleotide, or expression cassette, or expression vector, or host cell can be used to treat myelin-related disorders. Accordingly, the present disclosure further provides a pharmaceutical composition comprising (a) one or more of an RNA molecule, a polynucleotide, an expression cassette, an expression vector, and a host cell, and (b) a pharmaceutically acceptable carrier.

[0019] Also provided is a method of treating myelin disorders. The method comprises administering to a subject in need thereof one or more of the above RNA molecules, polynucleotides, expression cassettes, expression vectors, and host cells. The subject can be human. The administration can be carried out via injection. In some embodiments, the RNA molecule, or polynucleotide, or expression cassette, or expression vector, or host cell, or pharmaceutical composition can be administered to a region of the central nervous system selected from the group consisting of the brain parenchyma, spinal canal, subarachnoid space, brain ventricles, cisterns, and combinations thereof. The RNA molecule, or polynucleotide, or expression cassette, or expression vector, or host cell, or pharmaceutical composition can be administered by a method selected from the group consisting of parenchymal administration, intrathecal administration, intraventricular administration, intracisternal administration, and combinations thereof. In some embodiments, the disorder is Pelizaeus-Merzbacher disease, multiple system atrophy, or hypomyelination with basal ganglia and cerebellar atrophy.

[0020] The present disclosure also provides similar RNA molecules, or polynucleotides, or expression cassettes, or expression vectors, or host cells, or pharmaceutical compositions, or methods for treating other myelin disorders in a subject in the same manner as described above. In such cases, the RNA molecule can reduce or inhibit the level or function of a related gene, the gain of function of which results in the disorder. Examples of disorders and related genes include Alexander disease with a gain-of-function mutation in glial fibrillary acidic protein (GFAP), Michèle disease with a gain-of-function mutation in acyl-CoA oxidase 1 (ACOX1), autosomal dominant leukodystrophy with autonomic neuropathy (ADLD) associated with a genomic duplication of the lamin B1 gene (LMNB1) (or a deletion upstream of the gene, resulting in increased LMNB1 gene expression), central hypomyelinating leukodystrophy, Waardenburg syndrome, or Hirschsprung disease associated with a duplication of 22q11.2q13, including SOX10 (the gene encoding transcription factor SOX-10), adult polyglucosan body disease (APBD) with a mutation that modifies the folding of glycogen branching enzyme (GBE1) and results in a gain of function, hereditary diffuse leukoencephalopathy with spheroids associated with a gain-of-function mutation in CSF1R (the gene encoding colony-stimulating factor 1 receptor), or Aicardi–Goutières syndrome associated with a gain-of-function mutation in IFIH1 (the gene encoding interferon-induced helicase C domain-containing protein 1).

[0021] Accordingly, the present disclosure features an RNA molecule that reduces or inhibits the level or function of one of the genes described herein. The RNA molecule comprises a first RNA sequence and a second RNA sequence. The first sequence and the second RNA sequence are substantially complementary, and the first RNA sequence has a sequence length of at least 19 nucleotides and is at least 90% complementary to an mRNA encoding one of the genes described herein. In one embodiment, the RNA molecule may be included in a pre-miRNA scaffold or a pri-miRNA scaffold derived from a human microRNA, e.g., a human pri- or pre-miRNA scaffold. Examples of human microRNAs include human mir-16-1, miR-21, miR-23a, miRNA-30a, miR-31, miR-122, miR-155, and miR-451. Preferably, the human pri- or pre-miRNA scaffold does not include the native sequence of the native guide strand and the native sequence of the native passenger strand of the human microRNA. In one example, the first strand is a heterologous guide strand inserted into the human pri- or pre-miRNA scaffold as a replacement for the native sequence of the native guide strand.

[0022] In other embodiments, the disorder is canavan disease, Krabbe disease, globoid cell leukodystrophy, X-linked adrenoleukodystrophy, metachromatic leukodystrophy, hypomyelinating leukodystrophy-2, Niemann-Pick disease type C, 4H leukodystrophy / Pol III-related leukodystrophy, Zellweger spectrum disorder, childhood ataxia with central nervous system hypomyelination, cerebrotendinous xanthomatosis, SOX10-related peripheral demyelinating neuropathy, adult Refsum disease, autism spectrum disorder, Alzheimer's disease, Parkinson's disease, fragile X syndrome, schizophrenia, multiple sclerosis, neuromyelitis optica, progressive multifocal leukoencephalopathy, encephalomyelitis, central pontine myelinolysis, adrenoleukodystrophy, Wohlfart-Kugelberg-Welander disease, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis, Huntington's disease, spinal cord injury, traumatic brain injury, radiation-induced injury, neurological complications of chemotherapy, stroke, acute ischemic optic neuropathy, vitamin E deficiency, isolated vitamin E deficiency syndrome, Bassen-Kornzweig syndrome, Marchiafava-Bignami syndrome, metachromatic leukodystrophy, trigeminal neuralgia, acute disseminated encephalitis, Guillain-Barré syndrome, Charcot-Marie-Tooth disease, or Bell's palsy.

[0023] Details of one or more embodiments of the present disclosure are set forth in the following description. Other features, objects, and advantages of the present disclosure will be apparent from the description and claims.

Brief Description of the Drawings

[0024]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Mode for Carrying Out the Invention

[0025] The present disclosure relates to compositions and methods for treating hereditary and / or acquired disorders of myelin, such as demyelination.

[0026] 1. Myelin-Related Disorders Myelin-related disorders include any disease or condition associated with demyelination, insufficient myelination and remyelination, or hypomyelination in the subject. Such disorders can be genetic, acquired, or both. Demyelination in the CNS can occur in response to gene mutations (leukodystrophies), autoimmune diseases (e.g., multiple sclerosis), or trauma (e.g., traumatic brain injury, spinal cord injury, or ischemic stroke). Furthermore, disruption of myelin function can play an important role in neurological and psychiatric disorders such as autism spectrum disorder (ASD), Alzheimer's disease (Nasrabady et al., 2018), multiple system atrophy (Wenning et al., 2008), Parkinson's disease (Bohnen and Albin, 2011), fragile X syndrome (Filley, 2016), and schizophrenia (Najjar and Pearlman, 2015).

[0027] Leukodystrophy is a rare, mainly hereditary group of neurological disorders caused by abnormal production, processing, or development of myelin, and is the result of gene defects (mutations). Some forms are present at birth, while other forms may not show symptoms until the child is an infant. Some mainly affect adults. Examples of leukodystrophy include Canavan disease (MIM#271900), Pelizaeus-Merzbacher disease (MIM#312080), hypomyelinating leukodystrophy with basal ganglia and cerebellar atrophy (OMIM#612438), Krabbe disease (globoid cell leukodystrophy, MIM#245200), X-linked adrenoleukodystrophy (MIM#300100), metachromatic leukodystrophy (MLD, MIM#250100), Pelizaeus-Merzbacher-like disease (or hypomyelinating leukodystrophy-2, MIM#608804), Niemann-Pick disease type C (NPC, MIM#257220), autosomal dominant leukodystrophy with autonomic neuropathy (ADLD, MIM#169500), 4H leukodystrophy (Pol III-related leukodystrophy, MIM#607694), Zellweger spectrum disorder (ZSD, MIM#several), childhood ataxia with central nervous system hypomyelination or CACH (also called vanishing white matter disease, or VWMD, MIM#603896), cerebrotendinous xanthomatosis (CTX, MIM#213700), Alexander disease (AXD, MIM#203450), SOX10-related peripheral demyelinating neuropathy, central hypomyelinating leukodystrophy, Waardenburg syndrome, and Hirschsprung disease (PCWH, MIM#609136), adult polyglucosan body disease (APBD, MIM#263570), hereditary diffuse leukoencephalopathy with spheroid bodies (HDLS, MIM#221820), Aicardi-Goutières syndrome (AGS, MIM#many), and adult Refsum disease (MIM#266500).

[0028] A. Pelizaeus-Merzbacher disease Pelizaeus-Merzbacher disease (PMD) is a rare and fatal X-linked recessive leukodystrophy that often presents in the first year of life. Symptoms include hypotonia, nystagmus, and particularly delays in developmental milestones, especially in motor function. PMD is progressive, with a decline in coordination, motor ability, and intellectual function, often leading to early death before adulthood. There are approximately 3,500 patients with PMD in the United States (Schmidt et al., 2020), and there is no effective treatment.

[0029] The most common form of PMD (Elitt et al., 2020) is caused by a duplication mutation in the gene encoding proteolipid protein 1 (PLP1), one of the most abundant protein components of myelin. PLP1 contributes to the adhesion of the outer membrane surface and creates the unique architecture of the myelin sheath.

[0030] Overexpression of the PLP1 protein in oligodendrocytes induces dysfunction, prevents proper myelination, and leads to widespread loss of myelinating oligodendrocytes in the CNS (Osorio and Goldman, 2018). Reducing the expression of PLP1 to normal levels in patients with gene duplication can be used to restore oligodendrocyte function and improve outcomes.

[0031] The overexpression of PLP1 is an example of "gain of toxic function". In this case, the overexpressed protein causes cytotoxicity. One way to address the overexpression of PLP1 is by using RNA interference to reduce the expression of the PLP1 gene. This can be achieved with microRNA-based gene therapy. By using a single administration of an AAV vector that delivers an expression cassette of a therapeutic miRNA precursor targeting PLP1 mRNA, the endogenous mRNA silencing mechanism can be activated to reduce PLP1 translation in oligodendrocytes. Furthermore, since the overexpression of PLP1 is mainly limited to oligodendrocytes, the use of AAV vectors with higher tropism for oligodendrocytes can be used to improve safety and therapeutic efficacy.

[0032] The overexpression of PLP1 can be suppressed in jimpy mice (which express abnormal PLP and model PMD by reproducing the cellular, molecular, and neurological features seen in severe PMD) using an antisense oligonucleotide strategy. A single dose administration of a PPL1-targeted antisense oligonucleotide in postnatal jimpy mice restored the number of oligodendrocytes, increased myelination, improved motor performance, normalized respiratory function, and extended lifespan up to an 8-month endpoint (Elitt et al., 2020).

[0033] The overexpression of PLP1 can also be reduced in Plp1-Tg mice (a PMD model caused by PLP1 duplication) using a miRNA strategy. By direct intracerebral injection (into brain tissue, specifically the striatum and internal capsule enriched in oligodendrocytes) of an AAV vector with a transgene encoding an artificial miRNA (synthetic miR-155 with a PLP1-directed short hairpin) targeting PLP1 mRNA under the control of an oligodendrocyte-specific (human CNP), the depletion of oligodendrocytes in a mouse PMD model (Plp1 transgenic mice, PLP1 duplication model) was prevented, myelin was restored, and the neurological phenotype and survival were improved (Li et al., 2019).

[0034] Combining an AAV vector that efficiently targets oligodendrocytes with a miRNA strategy to reduce overexpression of the PLP1 gene, a therapeutic approach to PMD may be advantageous for treating PMD.

[0035] B. Multiple system atrophy Multiple system atrophy (MSA) is a rare and fatal progressive neurodegenerative disorder characterized by symptoms similar to those of Parkinson's disease, including slowness of movement, tremors, rigidity, incoordination, and speech impairment. Symptoms typically appear when a person is between 50 and 60 years old and progress rapidly. Most MSA patients die from the disease or its complications within 6 to 10 years of symptom onset. There are approximately 15,000 to 50,000 patients with MSA in the United States (Multiple System Atrophy Fact Sheet|National Institute of Neurological Disorders and Stroke, n.d.). Although some medications provide symptom relief, there is no treatment that slows the progression of the disease or cures it.

[0036] The pathology of MSA, like that of Parkinson's disease, is characterized by the accumulation and aggregation of the synaptic protein alpha-synuclein (a protein involved in the release of neurotransmitters). However, unlike Parkinson's disease, in which alpha-synuclein accumulates and aggregates within neurons, MSA is characterized by abnormal accumulation of alpha-synuclein, called glial cytoplasmic inclusions, within oligodendrocytes. The destruction of the oligodendrocyte-myelin-axon complex by the toxic accumulation of alpha-synuclein in the form of glial cytoplasmic inclusions leads to inflammation, demyelination, and subsequent nerve loss.

[0037] Accumulation of alpha-synuclein protein in oligodendrocytes induces dysfunction, impairs proper myelination, and leads to secondary neurodegeneration in the CNS (Marmion et al., 2021). Reducing the level of alpha-synuclein in oligodendrocytes of MSA patients is expected to restore the suppression of glial cytoplasmic inclusion formation and improve the outcome.

[0038] One way to address the overexpression of alpha-synuclein is the use of RNA interference to reduce the expression of the alpha-synuclein gene. This can be achieved with microRNA-based gene therapy. Single administration of an AAV vector delivering an expression cassette of a therapeutic miRNA targeting alpha-synuclein mRNA is expected to activate the endogenous mRNA silencing mechanism and reduce the translation and subsequent accumulation of alpha-synuclein in oligodendrocytes. Furthermore, since the accumulation of alpha-synuclein in MSA is mainly limited to oligodendrocytes, the use of AAV vectors with higher tropism for oligodendrocytes is expected to improve safety and therapeutic efficacy.

[0039] Recently, AAV-Olig001 (Powell et al., 2016), an AAV vector with unique tropism for oligodendrocytes, was used to generate a model of MSA in mice. AAV-Olig001 with the alpha-synuclein transgene resulted in selective overexpression of alpha-synuclein in oligodendrocytes, had >95% oligodendrocyte tropism in the dorsal striatum, and led to demyelination and neuroinflammation similar to human MSA (Williams et al., 2020). Similarly, intrastriatal injection of AAV-Olig001 expressing the alpha-synuclein transgene in rhesus monkeys resulted in widespread expression of alpha-synuclein throughout the striatum. Demyelination was observed in the corpus callosum and white matter tracts of the striatum in animals injected with AAV-Olig001-alpha-synuclein, similar to human disease (not observed with AAV-Olig001-GFP) (Mandel et al., 2017).

[0040] Recently, Mavroeidi et al. showed that administration of alpha-synuclein to cultured mouse oligodendrocytes mobilized endogenous oligodendrocyte alpha-synuclein into toxic aggregates (Mavroeidi et al., 2019). Similarly, endogenous oligodendrocyte alpha-synuclein was incorporated into pathological aggregates brought about by alpha-synuclein administration to the mouse brain in vivo (Mavroeidi et al., 2019). Furthermore, this was alleviated in alpha-synuclein knockout mice. These results demonstrate that endogenous alpha-synuclein is required for the formation of intracellular alpha-synuclein aggregates. Manipulation of alpha-synuclein expression in oligodendrocytes may provide a rational approach to reducing the accumulation of alpha-synuclein in glial cytoplasmic inclusions and thereby delaying or halting the rapid progression of MSA.

[0041] As disclosed herein, the use of a novel therapeutic approach for MSA that combines an AAV vector that efficiently targets oligodendrocytes with an miRNA strategy to reduce alpha-synuclein gene expression may be advantageous.

[0042] C. Hypomyelination with basal ganglia and cerebellar atrophy Hypomyelination with basal ganglia and cerebellar atrophy (H-ABC) is a rare, autosomal dominant, hypomyelinating pediatric leukodystrophy. H-ABC typically presents with symptoms such as dystonia, progressive gait disorder, and language and cognitive impairment in infancy. The symptoms and progression of H-ABC are more severe when onset occurs in the first few months of life, but less severe when symptoms begin in the second half of childhood. Magnetic resonance imaging (MRI) typically shows characteristic hypomyelination and atrophy of the caudate and putamen along with cerebellar atrophy (Simons et al., 2013). There are approximately 2,600 patients with H-ABC in the United States (Schmidt et al., 2020), and there is no effective treatment.

[0043] H-ABC is caused by a gain-of-toxicity function mutation in the TUBB4A gene, which encodes the microtubule-associated protein tubulin beta-4a, which heterodimerizes with alpha-tubulin to form a subunit that assembles into microtubules. Microtubules are intracellular cables that help support cell shape and move proteins to where they are needed. The tubulin beta-4a protein is a microtubule component that is highly expressed in mature oligodendrocytes. Mutations in the Tubb4a gene alter and disrupt microtubule dynamics, ultimately leading to the loss of oligodendrocytes (Curiel et al., 2017, Sase et al., 2020).

[0044] Overexpression of the tubulin beta-4a protein alters microtubule dynamics in oligodendrocytes, induces dysfunction, prevents proper myelination, and leads to widespread loss of myelinating oligodendrocytes in the CNS (Curiel et al., 2017, Sase et al., 2020). Normalization of tubulin beta-4a protein expression in patients can be used to restore oligodendrocyte function and improve outcomes.

[0045] Overexpression of the tubulin beta-4a protein is another example of "gain-of-toxicity function". In this case, the overexpressed protein causes disruption of microtubule dynamics that leads to cytotoxicity. One way to address overexpression of the tubulin beta-4a protein is by using RNA interference to reduce expression of the TUBB4A gene. This can be achieved with microRNA-based gene therapy. The endogenous mRNA silencing mechanism can be activated to reduce TUBB4A translation in oligodendrocytes using a single administration of an AAV vector that delivers an expression cassette for a therapeutic miRNA precursor targeting TUBB4A mRNA. Furthermore, because overexpression of TUBB4A is mainly limited to oligodendrocytes, the use of AAV vectors with higher tropism for oligodendrocytes can be used to improve safety and therapeutic efficacy.

[0046] The most common mutation in patients with H-ABC is TUBB4A D249N is. Like all proteins, the tubulin beta-4a protein is composed of amino acids linked together like a chain and then folded into an exact conformation. Mutations in the gene encoding the protein can result in the incorporation of an incorrect chain of amino acids. In this case, tubulin beta-4a usually has the amino acid aspartic acid at position 249 of the chain. The mutation results in a switch to the amino acid asparagine at this position. This small change often has a major impact on the function of the protein.

[0047] Recently, Sase et al. developed a mouse model of H-ABC that has the same mutation in the mouse Tubb4A gene (Sase et al., 2020). These mice (Tubb4a D249N / D249N mice) showed progressive motor dysfunction with abnormal gait, poor coordination, and involuntary movements such as single contractions and reduced reflexes similar to those in H-ABC patients. Tubb4a D249N / D249N also showed a shortened lifespan compared to controls, loss of myelin staining compared to control mice, changes in microtubule behavior and formation, and a dramatic loss of oligodendrocytes. These results demonstrate that Tubb4a D249N / D249N mice share many of the same symptoms and pathologies as the H-ABC disease in humans. A therapeutic approach to H-ABC that combines an AAV vector that efficiently targets oligodendrocytes with miRNA and / or gene replacement strategies to normalize TUBB4A gene expression may be advantageous.

[0048] The present disclosure uses viral vectors such as AAV vectors to efficiently deliver therapeutic nucleic acids such as siRNA to cells, targeting one or more genes or RNAs encoding proteins with gain-of-toxic-function. In some embodiments, an AAV vector encoding an RNAi molecule, such as an siRNA molecule of the present disclosure, can increase delivery to oligodendrocytes of an active agent. The therapeutic nucleic acid or polynucleotide may be capable of significantly inhibiting gene expression (e.g., at the mRNA level) of the gain-of-toxic-function protein within the cell, and thus improving defects induced or caused by intracellular proteins such as protein aggregation and inclusion body formation.

[0049] Such inhibitory nucleic acids, such as siRNA, may be used to treat various hereditary and / or acquired disorders of myelin such as demyelination. According to the present disclosure, a method for treating and / or ameliorating a disorder in a patient comprises administering to the patient an effective amount of at least one therapeutic nucleic acid (e.g., a polynucleotide encoding one or more siRNA duplexes) to a cell to enable inhibition / silencing of gene expression.

[0050] 2. Nucleic Acids Certain aspects of the present disclosure provide one or more inhibitory nucleic acids (e.g., inhibitory RNA molecules), polynucleotides encoding such inhibitory nucleic acids, and transgenes engineered to express such inhibitory nucleic acids. The one or more inhibitory nucleic acids may target the same gene (e.g., hybridize to or specifically bind to the same mRNA sequence or different mRNA sequences of the same gene) or different genes (e.g., hybridize to or specifically bind to the mRNA of different genes).

[0051] A. Inhibitory Nucleic Acids An inhibitory nucleic acid refers to a nucleic acid that can bind to a target nucleic acid (e.g., target RNA) in a cell and reduce or inhibit the level or function of the target nucleic acid in the cell. Examples of inhibitory nucleic acids include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, small interfering (si)RNA compounds, single-stranded or double-stranded RNA interference (RNAi) compounds, modified bases / locked nucleic acids (LNA), peptide nucleic acids (PNA), and other oligomeric compounds or oligonucleotide mimetics that specifically hybridize to at least a portion of the target nucleic acid and regulate its level or function. In some embodiments, the inhibitory nucleic acid can be antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides containing modified linkages, interfering RNA (iRNA), short or small interfering RNA (siRNA), microRNA or micro interfering RNA (miRNA), small temporal RNA (stRNA), short hairpin RNA (shRNA), small RNA-induced gene activator (RNAa), small activating RNA (saRNA), or combinations thereof. In some examples, the inhibitory nucleic acid is an inhibitory RNA molecule that mediates RNA interference.

[0052] RNA interference (RNAi) is a process discovered in 1998 by which cells regulate gene expression (Fire et al., 1998). Double-stranded RNA (dsRNA) in the cytoplasm of a cell induces an RNAi pathway in which the dsRNA is processed by the RNAse III-like enzyme DICER into small double-stranded fragments approximately 21-23 nucleotides in length. These double-stranded fragments are incorporated into a multi-subunit protein called the RNA-induced silencing complex (RISC). RISC unwinds the double-stranded fragment into a passenger strand that is removed from the complex and a guide strand that is complementary to a target sequence within a specific mRNA and instructs the RISC complex to cleave or suppress the translation of the specific target mRNA molecule (Kotowska-Zimmer et al., 2021). In this way, the gene encoding the mRNA molecule is essentially inactivated or "silenced".

[0053] RNAi technology can utilize three tools: synthetic siRNA, vector-based shRNA, and artificial miRNA (amiRNA). Synthetic siRNA is an exogenous double-stranded RNA that must be delivered into cells and overcome stability and pharmacokinetic challenges. shRNA is an artificial RNA molecule with a tight hairpin loop structure that is delivered into cells using plasmid or viral expression vectors. shRNA is typically transcribed from a strong pol III promoter (e.g., U6 or H1) and enters the RNAi pathway as a hairpin. However, transcription driven by a strong pol III promoter can produce supra-physiological levels of shRNA that saturate the endogenous miRNA biogenesis machinery and result in toxicity. amiRNA embeds a scaffold-target specific shRNA insert based on the natural primary miRNA (pri-miRNA). This ensures proper processing and transport similar to endogenous miRNA and reduces toxicity (Kotowska-Zimmer et al., 2021).

[0054] In some embodiments of the present disclosure, the inhibitory RNA molecule can be siRNA, miRNA (including amiRNA), or shRNA.

[0055] siRNA is known in the art as a double-stranded RNA molecule approximately 19 - 25 (e.g., 19 - 23) base pairs in length that induces RNAi intracellularly. In some embodiments, the siRNA sequence can also be inserted into an artificial miRNA scaffold (''shmiRNA'').

[0056] shRNA is known in the art as an RNA molecule containing a double-stranded RNA of approximately 19 - 25 (e.g., 19 - 23) base pairs linked by a short loop (e.g., about 4 - 11 nucleotides) that induces RNAi intracellularly.

[0057] miRNAs are known in the art as RNA molecules that induce RNAi intracellularly, comprising double-stranded RNA of short (e.g., 19-25 base pairs) sequences linked by a loop, and double-stranded RNA of one or more additional sequences comprising one or more bulges (e.g., mismatched or unpaired base pairs). As used herein, the term “miRNA” encompasses endogenous miRNAs, as well as exogenous or heterologous miRNAs. In some embodiments, “miRNA” can refer to pri-miRNA or pre-miRNA. During miRNA processing, pri-miRNA transcripts are produced. The pri-miRNA is processed by Drosha-DGCR8 to excise one or more sequences to produce a pre-miRNA having a 5′ flanking region, guide strand, loop region, non-guide strand, and 3′ flanking region, or to leave a 5′ flanking region, non-guide strand, loop region, guide strand, and 3′ flanking region, thereby producing a pre-miRNA. The pre-miRNA is then exported to the cytoplasm and processed by Dicer to obtain an siRNA having a guide strand and a non-guide (or passenger) strand. The guide strand is then used by the RISC complex to catalyze gene silencing, for example, by recognizing a target RNA sequence complementary to the guide strand. Further descriptions of miRNAs can be found, for example, in WO2008 / 150897. Recognition of the target sequence by the miRNA is mainly determined by the pairing between the target and the seed sequence of the miRNA, e.g., nucleotides 1-8 (from 5′ to 3′) of the guide strand (see, e.g., Boudreau, R.L. et al. (2013) Nucleic Acids Res. 41:e9).

[0058] In some embodiments of the present disclosure, the inhibitory RNA molecule forms a hairpin structure. Generally, a hairpin-forming RNA comprises a single nucleic acid encoding a stem portion having a duplex with a sense strand (e.g., a passenger strand) connected to an antisense strand (e.g., a guide strand) by a loop sequence, and is arranged within a self-complementary "stem-loop" structure. The passenger strand and the guide strand share complementarity. In some embodiments, the passenger strand and the guide strand share 100% complementarity. In some embodiments, the passenger strand and the guide strand share at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% complementarity. The passenger strand and the guide strand may lack complementarity due to base pair mismatches. In some embodiments, the passenger strand and the guide strand of the hairpin-forming RNA may have at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 mismatches. Generally, the first 2-8 nucleotides of the stem (relative to the loop) are referred to as "seed" residues and play an important role in target recognition and binding. The first residue of the stem (relative to the loop) is referred to as the "anchor" residue. In some embodiments, the hairpin-forming RNA has a mismatch at the anchor residue.

[0059] In some embodiments, the inhibitory RNA molecule is processed within the cell (or subject) to form a "mature miRNA". The mature miRNA is the result of a multi-step pathway that begins with the transcription of the primary miRNA from the miRNA gene or intron by RNA polymerase II or III, which generates the first precursor molecule in the biological pathway leading to the miRNA. Once transcribed, the pri-miRNA (often over 1000 nucleotides in length with a hairpin structure) is processed by the Drosha enzyme, which cleaves the pri-miRNA near the junction between the hairpin structure and the ssRNA, resulting in the precursor miRNA (pre-miRNA). The pre-miRNA is exported to the cytoplasm and further reduced by the Dicer enzyme at the pre-miRNA loop, resulting in the double-stranded miRNA strands.

[0060] Of the two strands of the miRNA duplex, one arm, the guide strand (miR), is typically found at a higher concentration and binds and associates with the Argonaute protein that is ultimately loaded into the RNA-induced silencing complex. The guide strand miRNA-RISC complex often helps to regulate gene expression by binding to its complementary sequence in the mRNA, often in the 3′UTR of the mRNA. The non-guide strand of the miRNA duplex, known as the passenger strand, is often degraded but may persist and act either intact or after partial degradation to have a functional role in gene expression.

[0061] In some embodiments, the transgene is engineered to express an inhibitory nucleic acid (e.g., miRNA) having a guide strand that targets a human gene. "Targeting" refers to the hybridization or specific binding of the inhibitory nucleic acid to its cognate (e.g., complementary) sequence on the target gene (e.g., the mRNA transcript of the target gene). In some embodiments, the inhibitory nucleic acid that targets a gene transcript shares a region of complementarity with the target gene that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the region of complementarity is 30 or more nucleotides in length.

[0062] Typically, the guide strand can target a human gene transcript associated with a myelin disease or disorder. Examples include PLP1 (associated with PMD), SNCA (associated with MSA), or TUBB4A (associated with H-ABC). In some embodiments, the guide strand that targets any of these gene transcripts is encoded by an isolated nucleic acid comprising the sequences described below.

[0063] The sequence encoding the mRNA of Homo sapiens proteolipid protein 1 (PLP1), transcript variant 1, is shown below.

[0064] NCBI reference sequence: PLP1 (NM_000533.5) coding sequence (SEQ ID NO: 1) ATGGGCTTGTTAGAGTGCTGTGCAGTGGCACTGTTCTGTGGCTGTGGACATGAAGCCCTCACTGGCACAGAAAAGCTAATTGAGACCTATTTCTCCAAAAACTACCAAGACTATGAGTATCTCATCAATGTGATCCATGCCTTCCAGTATGTCATCTATGGAACTGCCTCTTTCTTCTTCCTTTATGGGGCCCTCCTGCTGGCTGAGGGCTTCTACACCACCGGCGCAGTCAGGCAGATCTTTGGCGACTACAAGACCACCATCTGCGGCAAGGGCCTGAGCGCAACGGTAACAGGGGGCCAGAAGGGGAGGGGTTCCAGAGGCCAACATCAAGCTCATTCTTTGGAGCGGGTGTGTCATTGTTTGGGAAAATGGCTAGGACATCCCGACAAGTTTGTGGGCATCACCTATGCCCTGACCGTTGTGTGGCTCCTGGTGTTTGCCTGCTCTGCTGTGCCTGTGTACATTTACTTCAACACCTGGACCACCTGCCAGTCTATTGCCTTCCCCAGCAAGACCTCTGCCAGTATAGGCAGTCTCTGTGCTGATGCCAGAATGTATGGTGTTCTCCCATGGAATGCTTTCCCTGGCAAGGTTTGTGGCTCCAACCTTCTGTCCATCTGCAAAACAGCTGAGTTCCAAATGACCTTCCACCTGTTTATTGCTGCATTTGTGGGGGCTGCAGCTACACTGGTTTCCCTGCTCACCTTCATGATTGCTGCCACTTACAACTTTGCCGTCCTTAAACTCATGGGCCGAGGCACCAAGTTCTGA

[0065] Exemplary target sequences and guide strands for targeting PLP1 are shown in Table 1 below. [Table 1]

[0066] The sequence encoding the transcript variant 1 of Homo sapiens synuclein alpha (SNCA) mRNA is shown below.

[0067] NCBI Reference Sequence: NM_000345.4 Coding sequence (SEQ ID NO: 81) ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA

[0068] Exemplary target sequences and guide strands for targeting human alpha-synuclein are shown in Table 2 below. [Table 2]

[0069] The sequence encoding the transcript variant 1 of Homo sapiens tubulin beta class IVa (TUBB4A) is shown below. NCBI Reference Sequence: NM_001289123.2 (SEQ ID NO: 162).

[0070] Exemplary target sequences and guide strands for targeting human TUBB4A are shown in Table 3 below. [Table 3]

[0071] In some embodiments, the inhibitory nucleic acid is 5 to 300 bases in length (e.g., nucleotide lengths such as 10 - 30, 15 - 25, 19 - 22, 25 - 50, 40 - 90, 60 - 90, 75 - 100, 90 - 150, 110 - 200, 150 - 250, 200 - 300). The inhibitory nucleic acid sequence encoding pre-miRNA or mature miRNA may be 10 - 50, or 5 - 50 bases in length. In some embodiments, the inhibitory nucleic acid encodes, comprises, consists essentially of, or consists of the sequence of SEQ ID NO: 284 or 285 shown in FIG. 11 or 12.

[0072] B. Scaffold In certain embodiments, the inhibitory RNA molecule can be encoded by an inhibitory nucleic acid comprising a molecular scaffold. As used herein, a "molecular scaffold" is a framework or starting molecule that forms a sequence or structural basis for designing or creating subsequent molecules.

[0073] In some embodiments, the molecular scaffold comprises at least one 5' flanking region, or one 3' flanking region, or both. As a non-limiting example, the 5' or 3' flanking region may be of any length, may be derived from all or part of a wild-type microRNA sequence, or may be a completely artificial sequence, and may include a 5' or 3' flanking sequence. In some embodiments, one or both of the 5' and 3' flanking sequences may be absent. In some embodiments, the 5' and 3' flanking sequences may be of the same length or different lengths. In some embodiments, the 5' or 3' flanking sequence may be 1 to 10 nucleotides in length, 5 to 15 nucleotides in length, 10 to 30 nucleotides in length, 20 to 50 nucleotides in length, greater than 40 nucleotides in length, greater than 50 nucleotides in length, greater than 100 nucleotides in length, or greater than 200 nucleotides in length.

[0074] In some embodiments, the inhibitory nucleic acid sequence comprising or encoding the pri-miRNA scaffold is at least 200, 250, 260, 270, 280, 290, or 300 bases in length. In some embodiments, the inhibitory nucleic acid comprises, consists of, or consists essentially of a sequence of bases that is at least 80% or 90% complementary to, for example, at least 5, 10, 15, 20, 25, or 30 bases, or up to 30 or 40 bases, of a target nucleic acid (e.g., a human mRNA, e.g., of PLP1, SNCA, or TUBB4A), or has a sequence of bases with up to 3 mismatches (e.g., up to 1, or up to 2 mismatches) over 10, 15, 20, 25, or 30 bases of the target nucleic acid.

[0075] In some embodiments, the inhibitory nucleic acid is an artificial miRNA (amiRNA). AmiRNAs are derived by modifying natural miRNAs to replace the natural targeting region of the pre-mRNA with a targeting region of interest. For example, a naturally occurring and expressed miRNA can be used as a scaffold or backbone (e.g., a pri-miRNA scaffold) using a stem sequence replaced by the stem sequence of a miRNA targeting a gene of interest. Artificial precursor microRNAs (pre-amiRNAs) are typically processed such that one single stable small RNA is preferentially produced.

[0076] Forming the stem of the stem-loop structure is a minimum requirement for the inhibitory nucleic acid encoding at least one siRNA, miRNA, shRNA, or other RNAi agent described herein. In some embodiments, the siRNA, miRNA, shRNA, or other RNAi agent described herein comprises at least one nucleic acid sequence that is partially complementary to or hybridizes to the target sequence. In some embodiments, the 5' arm of the stem-loop structure of the inhibitory nucleic acid comprises a nucleic acid sequence encoding an antisense sequence (i.e., the guide sequence / strand). In some other embodiments, the 3' arm of the stem-loop structure of the inhibitory nucleic acid comprises a nucleic acid sequence encoding an antisense / guide sequence.

[0077] In certain embodiments, separating the sense and antisense sequences of the stem-loop structure of the inhibitory nucleic acid is a loop sequence (also known as a loop motif, linker, or linker motif). The loop sequence can be of any length, 4 to 30 nucleotides, 4 to 20 nucleotides, 4 to 15 nucleotides, 5 to 15 nucleotides, 6 to 12 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, and / or 15 nucleotides.

[0078] Some aspects of the present disclosure relate to nucleic acid sequences encoding guide strands that target human genes and are inserted into a human or non-human (e.g., mouse) pri-miRNA scaffold. In some embodiments, the pri-miRNA scaffold can be selected from mir-16-1, miR-21, miR-23a, miRNA-30a, miR-31, miR-122, miR-155, or miR-451. In some embodiments, the pri-miRNA scaffold is adjacent to an inhibitory nucleic acid that targets a human mRNA (e.g., of PLP1, SNCA, or TUBB4A) or its target sequence (e.g., as encoded by those described in Tables 1-3 above such as SEQ ID NO: 14 and SEQ ID NO: 35). In some embodiments, the pri-miRNA scaffold contains or is adjacent to an inhibitory nucleic acid that contains a guide strand (e.g., corresponding to or encoded by those described in Tables 1-3 above such as SEQ ID NO: 54 and SEQ ID NO: 75). In some embodiments, the pri-miRNA scaffold can be human miRNA-30a (Figure 11, left). The associated guide strand RNA sequence can be in either the 5' arm or the 3' arm of the stem-loop. In one example, the guide strand RNA sequence corresponding to or encoded by SEQ ID NO: 75 can be in the 5' arm (see Figure 11, right). In another example, the guide strand RNA sequence corresponding to or encoded by SEQ ID NO: 54 can be in the 3' arm (see Figure 12).

[0079] C. Recombinant Nucleic Acids The recombinant nucleic acids of the present disclosure include the inhibitory nucleic acids described above, as well as plasmids and vector genomes containing the inhibitory nucleic acids. The recombinant nucleic acid, plasmid, or vector genome may include regulatory sequences for regulating the propagation (e.g., of a plasmid) and / or controlling the expression of a transgene (e.g., an inhibitory nucleic acid). The recombinant nucleic acid may also be provided as a component of a viral vector (e.g., an rAAV vector). Generally, a viral vector includes a vector genome containing a recombinant nucleic acid packaged in a capsid.

[0080] D. Regulatory Element The present disclosure includes recombinant nucleic acids comprising a transgene (e.g., one encoding RNA) and various regulatory or control elements (e.g., the woodchuck hepatitis post-transcriptional regulatory element). Typically, a regulatory element is a nucleic acid sequence that affects the expression of an operably linked polynucleotide. For example, the exact nature of regulatory elements useful for gene expression, including promoters, enhancers, introns, etc., varies from organism to organism and from cell type to cell type, with the intention of promoting transcription and / or translation of an appropriate heterologous polynucleotide. Regulatory control can be affected at levels such as transcription, translation, splicing, message stability, etc. Typically, regulatory control elements that regulate transcription are juxtaposed near the 5' end (i.e., upstream) of the polynucleotide to be transcribed. Regulatory control elements may also be located at the 3' end (i.e., downstream) of the transcriptional sequence or within the transcript (e.g., within an intron). Regulatory control elements can be located at a distance from the transcriptional sequence (e.g., 1-100, 100-500, 500-1000, 1000-5000, 5000-10000, or more nucleotides). However, due to the length of the vector genome (e.g., the AAV vector genome), regulatory control elements typically are within 1-1000 nucleotides from the polynucleotide.

[0081] a. Promoter As used herein, the term "promoter", such as "eukaryotic promoter", refers to a nucleotide sequence that initiates transcription of a particular gene or one or more coding sequences in a eukaryotic cell (e.g., oligodendrocyte). A promoter can, in cooperation with other regulatory elements or regions, direct the level of transcription of a gene or coding sequence. These regulatory elements include, for example, transcription binding sites, repressor and activator protein binding sites, and other nucleotide sequences known to act directly or indirectly to regulate the amount of transcription from a promoter, including, for example, attenuators, enhancers, and silencers. A promoter is often located on the same strand and near the transcription start site of the gene or coding sequence to which it is operably linked, typically within about 100 to 1000 nucleotides upstream of the transcription start site. A promoter typically increases gene expression compared to the expression of the same gene in the absence of the promoter.

[0082] As used herein, "core promoter" or "minimal promoter" refers to the minimal portion of the promoter sequence necessary to appropriately initiate transcription. This may include any of the transcription start site, the binding site for RNA polymerase, and the binding sites for general transcription factors. A promoter may also include a proximal promoter sequence (5' of the core promoter) containing other primary regulatory elements (e.g., enhancers, silencers, boundary elements, insulators) and distal promoter sequences (3' of the core promoter).

[0083] Examples of suitable promoters include adenoviral promoters such as the adenovirus major late promoter; heterologous promoters such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus promoter; the Rous sarcoma virus (RSV) promoter; the albumin promoter; inducible promoters such as the mouse mammary tumor virus (MMTV) promoter; the metallothionein promoter; the heat shock promoter; the α-1 antitrypsin promoter; the hepatitis B surface antigen promoter; the transferrin promoter; the apolipoprotein A-1 promoter; the chicken β-actin (CBA) promoter; the elongation factor 1a promoter (EF1a), a hybrid form of the CBA promoter (CBh promoter), and the CAG promoter (cytomegalovirus early enhancer element and promoter, and the first exon and first intron of the tri-beta-actin gene, and the splice acceptor of the rabbit beta-globin gene) (Alexopoulou et al. (2008) BioMed. Central Cell Biol. 9:2).

[0084] The promoter may be constitutive, tissue-specific, or regulated. A constitutive promoter is one that always expresses an operably linked gene. In some embodiments, a constitutive promoter is active in most eukaryotic tissues under most physiological and developmental conditions.

[0085] A regulated promoter is one that can be activated or inactivated. Regulated promoters include inducible promoters, which are normally "off" but can be induced to be "on", and "repressible" promoters, which are normally "on" but can be turned "off". Many different regulatory factors are known, including temperature, hormones, cytokines, heavy metals, and regulatory proteins. The distinction is not absolute, and constitutive promoters can often be regulated to some extent. In some cases, for example, an endogenous pathway can be utilized to provide regulation of transgene expression using a promoter that is naturally downregulated when a pathological condition improves.

[0086] Tissue-specific promoters are promoters that are active only in specific types of tissues, cells, or organs. Typically, tissue-specific promoters are recognized by transcription activation elements specific to a particular tissue, cell, and / or organ. For example, a tissue-specific promoter may be more active in one or more specific tissues (e.g., two, three, or four) than in other tissues. In some embodiments, the expression of a gene regulated by a tissue-specific promoter is much higher in the tissue to which the promoter is specific than in other tissues. In some embodiments, the promoter may be almost or substantially inactive in any tissue other than the tissue to which it is specific.

[0087] b. Enhancer In another aspect, the recombinant nucleic acids described herein may further comprise an enhancer that increases the expression of a transgene (e.g., an RNA molecule disclosed herein). Typically, enhancer elements are located upstream of the promoter element, but may also be located downstream or within another sequence (e.g., a transgene). The enhancer may be located 100 nucleotides, 200 nucleotides, 300 nucleotides, or more upstream or downstream of the modified nucleic acid. The enhancer typically increases the expression of a transgene (e.g., encoding an inhibitory nucleic acid) beyond the increased expression provided by the promoter element alone.

[0088] Many enhancers are known in the art, including, but not limited to, the cytomegalovirus major immediate early enhancer. More specifically, the CMV MIE promoter contains three regions: the modulator, the unique region, and the enhancer (Isomura and Stinski (2003) J. Virol. 77(6):3602-3614). The CMV enhancer region can be combined with another promoter, or a portion thereof, to form a hybrid promoter that can further increase the expression of a nucleic acid operably linked thereto. For example, the CBA promoter or a portion thereof can be combined with the CMV promoter / enhancer or a portion thereof to generate a version of CBA called the "CBh" promoter, which represents a chicken beta-actin hybrid promoter as described in Gray et al. (2011, Human Gene Therapy 22:1143-1153). Similar to promoters, enhancers can be constitutive, tissue-specific, or regulated.

[0089] c. Fillers, spacers, and stuffers As disclosed herein, the recombinant nucleic acid can be used in an rAAV vector. In that case, the recombinant nucleic acid may include additional nucleic acid elements to adjust the length of the nucleic acid to a size close to the normal size of the viral genomic sequence (e.g., approximately 4.7-4.9 kilobases) that is acceptable for AAV packaging into the rAAV vector, or to its normal size (Grieger and Samulski (2005) J. Virol. 79(15):9933-9944). Such sequences may equivalently be referred to as fillers, spacers or stuffers. In some embodiments, the filler DNA is a non-translated (non-protein-coding) segment of the nucleic acid. In some embodiments, the filler or stuffer polynucleotide sequence is a sequence of about 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90-90-100, 100-150, 150-200, 200-250, 250-300, 300-400, 400-500, 500-750, 750-1000, 1000-1500, 1500-2000, 2000-3000, or longer than that.

[0090] AAV vectors typically accept DNA inserts in the size range of about 4 kb to about 5.2 kb or about 4.1 to 4.9 kb for optimal packaging of the nucleic acid into the AAV capsid. In some embodiments, the rAAV vector comprises a vector genome having a full length between about 3.0 kb and about 3.5 kb, about 3.5 kb and about 4.0 kb, about 4.0 kb and about 4.5 kb, about 4.5 kb and about 5.0 kb, or about 5.0 kb and about 5.2 kb. In some embodiments, the rAAV vector comprises a vector genome having a full length of about 4.7 kb. In some embodiments, the rAAV vector comprises a self-complementary vector genome. The full length of the self-complementary (sc) vector genome in the rAAV vector is equal to that of the single-stranded (ss) vector genome (i.e., about 4 kb to about 5.2 kb), but the nucleic acid sequence encoding the sc vector genome (i.e., including the transgene, regulatory elements, and ITRs) must be half the length of the nucleic acid sequence encoding the ss vector genome for the sc vector to be packaged within the capsid.

[0091] d. Introns and exons In some embodiments, the recombinant nucleic acids disclosed herein include, for example, introns, exons, and / or portions thereof. Introns can function as filler or stuffer polynucleotide sequences to achieve an appropriate length for vector genome packaging into the rAAV vector. Intron and / or exon sequences can also enhance the expression of a transgene (e.g., an RNA disclosed herein) as compared to expression in the absence of intron and / or exon elements (Kurachi et al. (1995) J. Biol. Chem. 270(10):576 - 5281, WO2017 / 074526). Additionally, filler / stuffer polynucleotide sequences (also referred to as "insulators") are well known in the art and include, but are not limited to, those described in WO2014 / 144486 and WO2017 / 074526.

[0092] e. Polyadenylation signal sequence (polyA) Additional regulatory elements can include, but are not limited to, stop codons, termination sequences, and polyadenylation (polyA) signal sequences such as the bovine growth hormone polyA signal sequence (BGH polyA). The polyA signal sequence drives the efficient addition of a polyadenosine “tail” at the 3′ end of eukaryotic mRNA, which induces termination of gene transcription (see, for example, Goodwin and Rottman J. Biol. Chem. (1992) 267(23):16330-16334). The polyA signal functions as a signal for endonucleolytic cleavage of the newly formed precursor mRNA at its 3′ end and addition of an RNA stretch consisting only of adenine bases to this 3′ end. The polyA tail is important for nuclear export, translation, and stability of mRNA. In some embodiments, the polyA is the SV40 early polyadenylation signal, the SV40 late polyadenylation signal, the HSV thymidine kinase polyadenylation signal, the protamine gene polyadenylation signal, the adenovirus 5 E1b polyadenylation signal, the growth hormone polyadenylation signal, the PBGD polyadenylation signal, or a polyadenylation signal designed in silico.

[0093] 3. Expression cassette and expression vector The present disclosure also provides an expression cassette comprising, or consisting of, a recombinant nucleic acid encoding the inhibitory nucleic acid as described above. If such a recombinant nucleic acid does not yet contain a promoter, the expression cassette may further comprise a promoter. Thus, an expression cassette according to the invention comprises, in the 5′ to 3′ direction, a promoter, a coding sequence, and optionally a terminator or other elements. The expression cassette allows for easy transfer of the nucleic acid sequence of interest into an organism, preferably a cell, preferably an affected cell.

[0094] The expression cassette of the present disclosure is preferably contained in a vector. Thus, the vector of the present disclosure enables transformation of cells having a nucleic acid sequence of interest. Correspondingly, the present disclosure provides a host cell containing the expression cassette according to the present disclosure or the recombinant nucleic acid according to the present disclosure. The recombinant nucleic acid may also contain a promoter or enhancer that enables expression of the nucleic acid sequence of interest.

[0095] Exogenous genetic material (e.g., nucleic acids, expression cassettes, or expression vectors encoding one or more therapeutic or inhibitory RNAs) can be introduced into target cells of interest in vivo by gene transfer methods such as transfection or transduction to provide genetically modified cells. Various expression vectors (i.e., vehicles for facilitating delivery of exogenous genetic material to target cells) are known to those skilled in the art. As used herein, "exogenous genetic material" refers to either a natural or synthetic nucleic acid or oligonucleotide that is not naturally found within the cell, or if it is naturally found within the cell, it is not transcribed or expressed at a biologically significant level by the cell. Thus, "exogenous genetic material" includes, for example, nucleic acids that do not naturally occur and can be transcribed into RNA.

[0096] As used herein, "cell transfection" refers to the acquisition of new genetic material by a cell through the incorporation of added nucleic acid (DNA, RNA, or hybrids thereof) without the use of a viral delivery vehicle. Thus, transfection refers to introducing nucleic acid into a cell using physical or chemical methods. Some transfection techniques are known to those skilled in the art and include calcium phosphate nucleic acid coprecipitation, strontium phosphate nucleic acid coprecipitation, DEAE-dextran, electroporation, cationic lipid-mediated transfection, and tungsten particle-facilitated microparticle bombardment. In contrast, "cell transduction" refers to the process of transferring nucleic acid into a cell using DNA or RNA viruses. RNA viruses (e.g., retroviruses) for transferring nucleic acid into a cell are referred to herein as transduction chimeric viruses. The exogenous genetic material contained within the virus can integrate into the genome of the transduced cell. Cells transduced with chimeric DNA viruses (e.g., adenoviruses carrying DNA encoding a therapeutic agent) may not have exogenous genetic material integrated into their genome but may be capable of expressing exogenous genetic material retained episomally within the cell.

[0097] Typically, the exogenous genetic material can include a heterologous gene (encoding a therapeutic RNA or protein) together with a promoter that controls transcription of the new gene. The promoter characteristically has the specific nucleotide sequence necessary to initiate transcription. Optionally, the exogenous genetic material further includes additional sequences (i.e., enhancers) necessary to obtain the desired gene transcription activity. The exogenous genetic material can be introduced into the cell genome immediately downstream of the promoter such that the promoter and the coding sequence are operably linked to enable transcription of the coding sequence. A retroviral expression vector may include an exogenous promoter element for controlling transcription of the inserted exogenous gene. Such exogenous promoters include both constitutive promoters and inducible promoters.

[0098] Naturally occurring constitutive promoters control the expression of essential cellular functions. As a result, genes under the control of a constitutive promoter are expressed under all conditions of cell growth. Exemplary constitutive promoters include the promoters of the following genes that encode certain constitutive or "housekeeping" functions: hypoxanthine phosphoribosyl transferase, dihydrofolate reductase, adenosine deaminase, phosphoglycerol kinase, pyruvate kinase, phosphoglycerol mutase, actin promoter, ubiquitin, elongation factor-1, and other constitutive promoters known to those of skill in the art. In addition, many viral promoters function constitutively in eukaryotic cells. These include, among others, the early and late promoters of SV40; the long terminal repeats (LTRs) of Moloney leukemia virus and other retroviruses; and the thymidine kinase promoter of herpes simplex virus. Thus, any of the above-described constitutive promoters can be used to control the transcription of a heterologous gene insert.

[0099] Genes under the control of an inducible promoter are expressed only in the presence of an inducer or are otherwise highly controlled thereby (for example, transcription under the control of the metallothionein promoter is greatly increased in the presence of certain metal ions). Inducible promoters contain responsive elements (REs) that stimulate transcription when their inducer factors bind. For example, there are REs for serum factors, steroid hormones, retinoic acid, and cyclic AMP. Promoters containing specific REs can be selected to obtain an inducible response, and in some cases, the RE itself can be ligated to a different promoter, thereby conferring inducibility to a recombinant gene. Thus, by selecting an appropriate promoter (constitutive vs. inducible, strong vs. weak), it is possible to control both the presence and the level of expression of a therapeutic agent in a genetically modified cell. When a gene encoding a therapeutic agent is under the control of an inducible promoter, in situ delivery of the therapeutic agent is induced, for example, by injecting a specific inducer of the inducible promoter that controls transcription of the agent and exposing the genetically modified cells in situ to conditions that allow transcription of the therapeutic agent. For example, in situ expression by genetically modified cells of a therapeutic agent encoded by a gene under the control of the metallothionein promoter is enhanced by contacting the genetically modified cells in situ with a solution containing the appropriate (i.e., inducing) metal ion.

[0100] Thus, the amount of therapeutic agent delivered in situ is regulated by controlling factors such as: (1) the nature of the promoter used to direct transcription of the inserted gene (i.e., whether the promoter is constitutive or inducible, strong or weak), (2) the number of copies of the exogenous gene inserted into the cell, (3) the number of transduced / transfected cells administered (e.g., transplanted) to the patient, (4) the size of the implant (e.g., graft or encapsulated expression system), (5) the number of implants, (6) the length of time the transduced / transfected cells or implants are left at a given location, and (7) the rate of production of the therapeutic agent by the genetically engineered cells. The selection and optimization of these factors for the delivery of a particular therapeutic agent at a therapeutically effective dose is considered to be within the scope of those skilled in the art without undue experimentation, taking into account the factors disclosed above and the patient's clinical profile.

[0101] In addition to at least one promoter and at least one heterologous nucleic acid encoding a therapeutic agent, the expression vector may contain a selectable gene, such as a neomycin resistance gene or a fluorescent protein gene, to facilitate the selection of cells transfected or transduced with the expression vector. Alternatively, the cells may be transfected with two or more expression vectors, with at least one vector containing the gene encoding the therapeutic agent and the other vector containing the selectable gene. The selection of suitable promoters, enhancers, selectable genes, and / or signal sequences is considered to be within the scope of those skilled in the art without undue experimentation.

[0102] The coding sequences of the present disclosure can be inserted into any type of target or host cell. In the context of expression vectors, the vectors can be readily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, by any method in the art. For example, the expression vectors can be introduced into host cells by physical, chemical, or biological means.

[0103] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).

[0104] Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from, for example, lentivirus, poxvirus, herpes simplex virus I, adenovirus, and adeno-associated virus. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.

[0105] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including water-in-oil emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0106] As disclosed herein, the above RNA molecules can be used to treat disorders in a subject. In some embodiments, the polynucleotide encoding the RNA molecule can be inserted into or encoded by a vector such as a plasmid or viral vector. Preferably, the polynucleotide is inserted into or encoded by a viral vector. The viral vector can be a herpes virus (HSV) vector, a retroviral vector, an adenoviral vector, an AAV vector, a lentiviral vector, etc. In some specific embodiments, the viral vector is an AAV vector. In some embodiments, the RNA may be encoded by a retroviral vector (see, e.g., U.S. Pat. Nos. 5,399,346, 5,124,263, 4,650,764, and 4,980,289, the contents of each of which are incorporated herein by reference in their entirety).

[0107] Adenovirus is a eukaryotic DNA virus that can be modified to efficiently deliver nucleic acids to various cell types in vivo and is widely used in gene therapy protocols, including for targeting genes to neurons and glial cells. Various replication-deficient adenoviruses and minimal adenovirus vectors have been described for nucleic acid therapeutics (see, e.g., PCT Patent Publications Nos. 1994 / 26914, 1995 / 02697, 1994 / 28152, 1994 / 12649, 1995 / 02697, and 1996 / 22378, the contents of each of which are incorporated by reference in their entirety). Such adenoviral vectors can also be used to deliver the RNA molecules of the present disclosure to cells.

[0108] 4. AAV Adeno-associated virus is a widely used gene therapy vector due to its record of clinical safety, non-pathogenic nature, ability to infect non-dividing cells (such as neurons), and ability to provide long-term gene expression after a single administration (Hocquemiller et al., 2016). Currently, many human and non-human primate AAV serotypes have been identified (Gao et al., 2004). AAV vectors have been demonstrated to be safe in hundreds of clinical trials worldwide, and clinical efficacy has been shown in trials for hemophilia B, spinal muscular atrophy, alpha-1 antitrypsin, and Leber congenital amaurosis (Keeler et al., 2017). Three AAV-based gene therapies have been approved. The first, Glybera, was approved by the European Medicines Agency (EMA) in 2012 (withdrawn in 2017 mainly due to commercial failure). Luxturna was approved by the FDA in 2017 for rare hereditary retinal dystrophy, and Zolgensma was approved by the FDA in 2019 for spinal muscular atrophy.

[0109] Due to their safety, non-pathogenic nature, and ability to infect neurons, AAVs, such as AAV1, AAV2, AAV4, AAV5, AAV6, AAV8, and AAV9, are commonly used gene therapy vectors for CNS applications. However, after direct CNS injection, these serotypes exhibit dominant neuron tropism, particularly when gene expression is driven by a constitutive promoter, and expression in oligodendrocytes is low, which limits their potential use in the treatment of white matter diseases. AAV1 / 2, AAV2, and AAV8 have been shown to transduce oligodendrocytes only when an oligodendrocyte-specific promoter is used (Chen et al., 1998, Lawlor et al., 2009, Li et al., 2019). Dependence on cell-specific promoters for expression specificity allows for the possibility of non-selective cell uptake in non-oligodendrocyte lineage cells and leaky expression of the transgene via potential promoter activity.

[0110] The approaches described herein to mitigate these issues include using AAV serotypes with high tropism for oligodendrocytes. Recently, a chimeric AAV capsid, AAV / Olig001, with strong selectivity for oligodendrocytes has been described using DNA shuffling and directed evolution (Powell et al., 2016). Subsequently, AAV / Olig001 has been shown to transduce neonatal oligodendrocytes in a mouse model of Canavan disease (Francis et al., 2021). Other approaches such as random mutagenesis and insertion of peptide libraries can be used to generate capsid libraries that can be screened for tropism and selectivity for oligodendrocytes.

[0111] As described above, the terms "adeno-associated virus" and / or "AAV" refer to parvoviruses having a linear single-stranded DNA genome and their variants. This term encompasses all subtypes, as well as both naturally occurring and recombinant forms, unless otherwise required. Parvoviruses, including AAV, are useful as gene therapy vectors because they can enter cells and introduce nucleic acids (e.g., transgenes) into the nucleus. In some embodiments, the introduced nucleic acid (e.g., the rAAV vector genome) forms a circular concatemer that persists as an episome in the nucleus of the transduced cell. In some embodiments, the transgene is inserted into a specific site within the host cell genome, e.g., a site on human chromosome 19. Site-specific integration is thought to be likely to result in a predictable long-term expression profile, in contrast to random integration. The site of AAV insertion into the human genome is designated AAVS1. Once introduced into a cell, the RNA or polypeptide encoded by the nucleic acid can be expressed by the cell. Since AAV is not associated with any pathogenic diseases in humans, therapeutic RNAs or polypeptides for the treatment of diseases, disorders, and / or conditions in human subjects can be expressed using the nucleic acids delivered by AAV.

[0112] Multiple serotypes of AAV exist in nature, and at least 15 wild-type serotypes have been identified from humans to date (i.e., AAV1 - AAV15). Naturally occurring and variant serotypes are distinguished by having protein capsids that are serologically different from other AAV serotypes. By way of example, among others, AAV1, AAV2, AAV, AAV3 (including AAV3A and AAV3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV12, AAVrh10, AAVrh74 (see WO2016 / 210170), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV, as well as recombinantly produced variants (e.g., capsid variants with insertions, deletions, and substitutions), such as variants designated AAV2i8, NP4, NP22, NP66, DJ, DJ / 8, DJ / 9, LK3, RHM4-1. For example, "primate AAV" refers to AAV that infects primates, "non-primate AAV" refers to AAV that infects non-primate mammals, and "bovine AAV" refers to AAV that infects bovine mammals.

[0113] Serotype uniqueness is determined based on the lack of cross-reactivity between antibodies to a given AAV compared to another AAV. Such differences in cross-reactivity are usually due to differences in the capsid protein sequence and antigenic determinants (e.g., due to differences in the VP1, VP2, and / or VP3 sequences of the AAV serotype). However, some naturally occurring AAVs or artificial AAV mutations (e.g., recombinant AAVs) may not show serological differences from any of the currently known serotypes. These viruses can then be considered corresponding types of subgroups, or more simply, variant AAVs. Thus, as used herein, the term "serotype" refers to both serologically different viruses and viruses that are not serologically different but can be within a subgroup or variant of a given serotype.

[0114] An extensive list and alignment of the amino acid sequences of the capsids of known AAV serotypes are provided by Marsic et al. (2014) Molecular Therapy 22(11):1900-1909. The genomic sequences of various serotypes of AAV, as well as the sequences of native ITRs, rep proteins, and capsid subunits, are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. For example, reference is made to GenBank accession numbers NC_002077 (AAV1), AF063497 (AAV1), NC_001401 (AAV2), AF043303 (AAV2), NC_001729 (AAV3), NC_001863 (AAV3B), NC_001829 (AAV4), U89790 (AAV4), NC_006152 (AAV5), NC_001862 (AAV6), AF513851 (AAV7), AF513852 (AAV8), and NC_006261 (AAV8), the disclosures of which are incorporated herein by reference. Also, for example, reference is made to Srivistava et al. (1983) J. Virology 45:555, Chiorini et al. (1998) J. Virology 71:6823, Chiorini et al. (1999) J. Virology 73:1309, Bantel-Schaal et al. (1999) J. Virology 73:939, Xiao et al. (1999) J. Virology 73:3994, Muramatsu et al. (1996) Virology 221:208, Shade et al. (1986) J. Virol. 58:921, Gao et al. (2002) Proc. Nat. Acad. Sci. USA 99:11854, Moris et al. (2004) Virology 33:375-383, International Patent Publications WO00 / 28061, WO99 / 61601, WO98 / 11244, WO2013 / 063379, WO2014 / 194132, WO2015 / 121501, and U.S. Patent Nos. 6,156,303 and 7,906,111.

[0115] As discussed herein, "recombinant adeno-associated virus" or "rAAV" is distinguished from wild-type AAV by replacing all or part of the endogenous viral genome with a non-native sequence. Incorporating a non-native sequence within the virus defines the viral vector as a "recombinant" vector and thus an "rAAV vector". An rAAV vector can contain a heterologous polynucleotide encoding a desired RNA or protein or polypeptide (e.g., an RNA molecule disclosed herein). The recombinant vector sequence may be encapsulated or packaged into an AAV capsid and is referred to as an "rAAV vector", "rAAV vector particle", "rAAV viral particle", or simply "rAAV".

[0116] For the production of rAAV vectors, the desired ratio of VP1:VP2:VP3 is in the range of about 1:1:1 to about 1:1:100, preferably in the range of about 1:1:2 to about 1:1:50, more preferably in the range of about 1:1:5 to about 1:1:20. The desired ratio of VP1:VP2 is 1:1, although the ratio of VP1:VP2 can vary in the range of 1:50 to 50:1.

[0117] The present disclosure provides rAAV vectors that contain polynucleotide sequences not of AAV origin (e.g., polynucleotides heterologous to AAV). The heterologous polynucleotide can be adjacent to at least one, and optionally two, AAV terminal repeats (e.g., inverted terminal repeats). The heterologous polynucleotide flanked by ITRs, also referred to herein as the "vector genome", typically encodes an RNA or polypeptide of interest, or a gene of interest, e.g., a target for therapeutic treatment. Delivery or administration of an rAAV vector to a subject (e.g., a patient) provides the encoded RNA / protein / polypeptide to the subject. Thus, rAAV vectors can be used to transcribe / deliver heterologous polynucleotides for expression, e.g., for treating various diseases, disorders, and conditions.

[0118] The rAAV vector genome generally retains the 145 - base ITR cis to a heterologous nucleic acid sequence replacing the viral rep and cap genes. Such ITRs are useful for producing recombinant AAV vectors, but modified AAV ITRs, as well as non - AAV terminal repeats including partially or fully synthetic sequences, can also serve this purpose. The ITR forms a hairpin structure and functions, for example, as a primer for host - cell - mediated synthesis of complementary DNA strands after infection. The ITR also plays a role in viral packaging, integration, etc. The ITR is the only AAV viral element required cis for AAV genome replication and packaging into rAAV vectors. The rAAV vector genome optionally contains two ITRs that are generally present at the 5' and 3' ends of the vector genome and contain a heterologous sequence (e.g., a transgene encoding a gene of interest, or a nucleic acid sequence of interest including, but not limited to, antisense and siRNA, and many others such as CRISPR molecules). The 5' and 3' ITRs may both contain the same sequence or each may contain a different sequence. The AAV ITR can be derived from any AAV, including, but not limited to, serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11, or any other AAV.

[0119] The rAAV vectors of the present disclosure can contain ITRs from an AAV serotype different from the serotype of the capsid (e.g., wild - type AAV2, a fragment or variant thereof, such as AAV8, Olig001). Such rAAV vectors that contain at least one ITR from one serotype but a capsid from a different serotype can be referred to as hybrid viral vectors (see U.S. Patent No. 7,172,893). The AAV ITR may contain the entire wild - type ITR sequence or may be a variant, fragment, or modification thereof, as long as it retains functionality.

[0120] In some embodiments, the rAAV vector genome is linear single-stranded and adjacent to the AAV ITRs. Prior to transcription and translation of the heterologous gene, one of the free 3'-OHs of the self-priming ITRs is used to convert the approximately 4700 nucleotide single-stranded DNA genome into a double-stranded form by a DNA polymerase (e.g., a DNA polymerase within the transduced cell), initiating second-strand synthesis. In some embodiments, the full-length single-stranded vector genomes (i.e., sense and antisense) anneal to produce a full-length double-stranded vector genome. This can occur when multiple rAAV vectors carrying genomes of opposite polarities (i.e., sense or antisense) transduce the same cell simultaneously. Regardless of how they are produced, once the double-stranded vector genome is formed, the cell can transcribe and translate the double-stranded DNA and express the heterologous gene.

[0121] The efficiency of transgene expression from rAAV vectors can be hampered by the need to convert the single-stranded rAAV genome (ssAAV) to double-stranded DNA prior to expression. This step can be avoided by using self-complementary AAV genomes (scAAV) that can package an inverted-repeat genome that can fold into double-stranded DNA without the need for DNA synthesis or base pairing between multiple vector genomes. See, e.g., U.S. Patent No. 8,784,799; McCarty, (2008) Mol. Ther. 16(10):1648-1656, and McCarty et al., (2001) Gene Therapy 8:1248-1254, McCarty et al., (2003) Gene Therapy 10:2112-2118.

[0122] The viral capsid of the rAAV vector can be wild-type AAV or variant AAV, such as AAV1, AAV2, AAV3, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh10, AAVrh74 (see WO2016 / 210170), AAV12, AAV2i8, AAV1.1, AAV2.5, AAV6.1, AAV6.3.1, AAV9.45, RHM4-1 (SEQ ID NO: 5 of WO2015 / 013313), RHM15-1, RHM15-2, RHM15-3 / RHM15-5, RHM15-4, RHM15-6, AAV hu.26, AAV1.1, AAV2.5, AAV6.1, AAV6.3.1, AAV9,45, AAV2i8, AAV29G, AAV2,8G9, AVV-LK03, AAV2-TT, AAV2-TT-S312N, AAV3B-S312N, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, snake AAV, goat AAV, shrimp AAV, sheep AAV, and variants thereof (e.g., see Fields et al., VIROLOGY, volume 2, chapter 69 (4 th ed., Lippincott-Raven Publishers). The capsid can be derived from some AAV serotypes disclosed in U.S. Patent No. 7,906,111, Gao et al. (2004) J. Virol. 78:6381, Morris et al. (2004) Virol. 33:375, WO2013 / 063379, WO2014 / 194132, the Truetype AAV (AAV-TT) variants disclosed in WO2015 / 121501, and RHM4-1, RHM15-1 to RHM15-6, and variants thereof disclosed in WO2015 / 013313. The complete complement of the AAV cap protein includes VP1, VP2, and VP3. The ORF containing the nucleotide sequence encoding the AAV VP capsid protein may include less than the complete complement of the AAV Cap protein, or the complete complement of the AAV cap protein may be provided.

[0123] In some embodiments, an rAAV vector comprising a capsid protein encoded by a nucleotide sequence derived from two or more AAV serotypes (e.g., wild-type AAV serotypes, variant AAV serotypes) is referred to as a "chimeric vector" or "chimeric capsid" (see U.S. Patent No. 6,491,907, the entire disclosure of which is incorporated herein by reference). In some embodiments, the chimeric capsid protein is encoded by nucleic acid sequences derived from 2, 3, 4, 5, 6, 7, 8, 9, 10 or more AAV serotypes. In some embodiments, the recombinant AAV vector comprises, for example, a capsid sequence derived from AAV1, AAV2, AAV3, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVrh74, AAVrh10, AAV2i8, or variants thereof, resulting in a chimeric capsid protein comprising a combination of amino acids from any of the aforementioned AAV serotypes (see Rabinowitz et al. (2002) J. Virology 76(2):791-801). Alternatively, the chimeric capsid can include a mixture of VP1 from one serotype, VP2 from a different serotype, VP3 from yet a different serotype, and combinations thereof. For example, a chimeric viral capsid can include an AAV1 cap protein or subunit, and at least one AAV2 cap protein or subunit. The chimeric capsid can include, for example, an AAV capsid having one or more B19 cap subunits, and for example, the AAV cap protein or subunit can be replaced by a B19 cap protein or subunit. For example, in one embodiment, the VP3 subunit of the AAV capsid can be replaced by the VP2 subunit of B19. In some embodiments, the chimeric capsid is an Olig001 capsid as described in WO2021 / 221995 and WO2014 / 052789, which are incorporated herein by reference.

[0124] In some embodiments, the chimeric vector is engineered to exhibit altered tropism or tropism for a particular tissue or cell type. The term "tropism" refers to the preferential entry of a virus into a particular cell (e.g., oligodendrocyte) or tissue type and / or preferential interaction with a cell surface that facilitates entry into a particular cell or tissue type. AAV tropism is generally determined by specific interactions between different viral capsid proteins and their cognate cell receptors (Lykken et al. (2018) J. Neurodev. Disord. 10:16). Preferably, when the virus or viral vector enters a cell, the sequences carried by the vector genome (e.g., a heterologous sequence such as a transgene) are expressed by the rAAV vector genome).

[0125] "Tropism profile" refers to the pattern of transduction of one or more target cells in various tissues and / or organs. For example, a chimeric AAV capsid can have a tropism profile characterized by efficient transduction of oligodendrocytes with low transduction of neurons, astrocytes, and other CNS cells. See WO2014 / 052789, which is incorporated herein by reference. Such chimeric capsids can be considered "oligodendrocyte-specific" in that they exhibit tropism for oligodendrocytes and preferentially transduce oligodendrocytes over neurons, astrocytes, and other CNS cell types when administered directly to the CNS, and are referred to herein as "oligo-tropic." In some embodiments, at least about 80% of the cells transduced by an oligodendrocyte-specific capsid are oligodendrocytes, e.g., at least about 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of the transduced cells are oligodendrocytes.

[0126] In some embodiments, the rAAV vector is useful for treating or preventing a "disorder associated with oligodendrocyte dysfunction." As used herein, the term "associated with oligodendrocyte dysfunction" refers to a disease, disorder, or condition in which oligodendrocytes are damaged, lost, or function inappropriately as compared to otherwise identical normal oligodendrocytes. This term includes diseases, disorders, and conditions in which oligodendrocytes are directly affected, as well as diseases, disorders, or conditions in which oligodendrocytes secondarily become dysfunctional in response to damage to other cells. In some embodiments, the disorder associated with oligodendrocyte dysfunction is demyelination.

[0127] In some embodiments, a chimeric AAV capsid having tropism for oligodendrocytes and comprising sequences from AAV1, AAV2, AAV6, AAV8, and AAV9 is Olig001 (also known as BNP61), or a functional variant of Olig001 (see WO2021 / 221995 and WO2014 / 052789). The amino acid sequence of the Olig001 capsid protein is set forth in the following sequence, with VP1 beginning at amino acid residue 1 (methionine), VP2 beginning at amino acid residue 148 (threonine), and VP3 beginning at amino acid residue 203 (methionine).

[0128] Amino acid sequence of the Olig001 (BNP61) capsid (SEQ ID NO: 245) MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRLLEPLGLVEEAAKTAPGKKRPVEQSPQEPDSSSGIGKTGQQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISNGTSGGATNDNTYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLSFKLFNIQVKEVTQNEGTKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYHLNGRNSLANPGIAMATHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPHPIGTRYLTRPL

[0129] In some embodiments, the chimeric AAV capsids with tropism for oligodendrocytes are Olig002 (also known as BNP62) or Olig003 (also known as BNP63) (see WO2021 / 221995 and WO2014 / 052789). In some embodiments, the Olig002 capsid VP1 comprises, or consists of, the amino acid sequence shown below or a functional variant thereof.

[0130] Amino acid sequence of the Olig002 (BNP62) capsid (SEQ ID NO: 246) MAADGYLPDWLEDNLSEGIREWWDLKPGAPKPKANQQKQDDGRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLRYNHADAEFQERLQEDTSFGGNLGRAVFQAKKRVLEPLGLVEEGAKTAPGKKRPVEQSPQEPDSSSGIGKTGQQPAKKRLNFGQTGDTESVPDPQPIGEPPAAPSGVGSLTMASGGGAPVADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSDYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFTYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYHLNGRNSLANPGIAMATHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPHPIGTRYLTRPL

[0131] In some embodiments, the Olig003 capsid comprises or consists of the amino acid sequence shown below or a functional variant thereof.

[0132] Amino acid sequence of the Olig003 (BNP63) capsid (SEQ ID NO: 247) MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLQGDTSFGGNLGRAVFQAKKRVLEPLGLVEEGAKTAPGKKRPVEQSPQEPDSSSGIGETGQQPAKKRLNFGQTGDSESVPDPQPLGEPPATPAAVGPTTMASGGGAPMADNNEGADGVGSSSGNWHCDSQWLGDRVITTSTRTWALPTYNNHLYKQISSASTGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLSFKLFNIQVKEVTDNNGVKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTANTQTLGFSQGGPNTMANQAKNWLPGPCYRQQRVSTTTGQNNNSNFAWTAGTKYHLNGRNSLANPGIAMATHKDDKERFFPSNGILIFGKQNAARDNADYSDVMLTSEEEIKTTNPVATEEYGIVADNLQQQNTAPQIGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQSKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTSVDFAVNTEGVYSEPHPIGTRYLTRPL

[0133] In some embodiments, an rAAV vector comprising a chimeric AAV capsid (e.g., Olig001, Olig002, or Olig003) and a therapeutic transgene can be used to treat a disease, disorder, or condition associated with oligodendrocyte dysfunction. In such a disease, disorder or condition, the oligodendrocytes are damaged, lost, or function inappropriately. This can be the result of a direct effect on the oligodendrocytes or can occur when the oligodendrocytes become dysfunctional secondarily to damage to other cells. In some embodiments, an rAAV vector comprising an AAV / Olig001 capsid and a polynucleotide encoding an RNA molecule described herein is used to treat genetic and acquired disorders of myelin.

[0134] 5. Viral Particles and Production A viral vector (e.g., an rAAV vector) having a transgene (e.g., one encoding an RNA disclosed herein) can be assembled from a polynucleotide encoding the transgene, suitable regulatory elements, and elements necessary for the production of viral proteins that mediate cell transduction. Examples of viral vectors include, but are not limited to, adenovirus, retrovirus, lentivirus, herpesvirus, and AAV vectors, particularly rAAV vectors.

[0135] The vector genome components of the rAAV vector produced according to the method of the present disclosure include at least one transgene (e.g., a polynucleotide encoding an RNA molecule) and associated expression control sequences for controlling the expression of the RNA. In a preferred embodiment, the vector genome comprises a part of a parvovirus genome, such as an AAV genome in which rep and cap are deleted and / or replaced by a transgene and its associated expression control sequences. The transgene is typically inserted adjacent to (i.e., flanked by) one or two AAV ITRs or ITR elements sufficient for viral replication, instead of the nucleic acids encoding the viral rep and cap proteins. Other regulatory sequences suitable for use in promoting tissue-specific expression of the transgene in target cells (e.g., oligodendrocytes) may also be included.

[0136] A. Packaging cells Those skilled in the art will understand that an rAAV vector containing a transgene and lacking the viral proteins required for viral replication (e.g., cap and rep) cannot replicate because such proteins are required for viral replication and packaging. The cap and rep genes may be supplied to a cell (e.g., a host cell, e.g., a packaging cell) as part of a plasmid separate from the plasmid supplying the transgene to the vector genome.

[0137] Packaging cells or producer cells mean cells or cell lines that can be transfected with a vector, plasmid, or DNA construct, and provide in trans the lost functions necessary for the complete replication and packaging of viral vectors. Genes required for the assembly of rAAV vectors include the vector genome (e.g., a transgene encoding RNA, regulatory elements, and ITRs), the AAV rep gene, the AAV cap gene, and certain helper genes from other viruses (e.g., adenovirus). Those skilled in the art will understand that the genes required for AAV production can be introduced into packaging cells by various methods, including, for example, transfection of one or more plasmids. However, in some embodiments, some genes (e.g., rep, cap, helper) may already be present in the packaging cells, integrated into the genome, or carried episomally. In some embodiments, the packaging cells express one or more lost viral functions in a constitutive or inducible manner.

[0138] Any suitable packaging cells known in the art can be used for the production of packaged viral vectors. Mammalian cells or insect cells are preferred. In the practice of the present disclosure, examples of cells useful for the production of packaging cells include, for example, human cell lines such as PER.C6, WI38, MRC5, A549, HEK293 cells (expressing functional adenovirus E1 under the control of a constitutive promoter), B-50, or any other HeLa cells, HepG2, Saos-2, HuH7, and HT1080 cell lines. Suitable non-human mammalian cell lines include, for example, VERO, COS-1, COS-7, MDCK, BHK21-F, HKCC, or CHO cells.

[0139] In some embodiments, the packaging cells can grow in suspension culture. In some embodiments, the packaging cells can grow in serum-free medium. For example, HEK293 cells grow in suspension in serum-free medium. In another embodiment, the packaging cells are HEK293 cells as described in U.S. Patent No. 9,441,206 and are deposited as American Type Culture Collection (ATCC) number PTA13274. A number of rAAV packaging cell lines are known in the art, including but not limited to those disclosed in WO2002 / 46359.

[0140] Cell lines for use as packaging cells include insect cell lines. Any insect cell capable of allowing replication of AAV and being maintained in culture can be used according to the present disclosure. For example, Spodoptera frugiperda, such as Sf9 or Sf21 cell lines, Drosophila cell lines, or mosquito cell lines, such as cell lines derived from Aedes albopictus. A preferred cell line is the Spodoptera frugiperda Sf9 cell line. The following references are incorporated herein with respect to their teachings regarding the use of insect cells for expression of heterologous polypeptides, methods of introducing nucleic acids into such cells, and methods of maintaining such cells in culture: Methods in Molecular Biology, ed. Richard, Humana Press, NJ (1995); O’Reilly et al., Baculovirus Expression Vectors: A Laboratory Manual, Oxford Univ. Press (1994), Samulski et al. (1989) J. Virol. 63:3822-3828, Kajigaya et al. (1991) Proc. Nat’l. Acad. Sci. USA 88:4646-4650, Ruffing et al. (1992) J. Virol. 66:6922-6930, Kimbauer et al. (1996) Virol. 219:37-44, Zhao et al. (2000) Virol. 272:382-393, and U.S. Patent No. 6,204,059.

[0141] As a further alternative, the viral vectors of the present disclosure may be produced in insect cells using, for example, a baculovirus vector for delivering the rep / cap genes and the rAAV template as described by Urabe et al. (2002) Human Gene Therapy 13:1935-1943. When using baculovirus production for AAV, in some embodiments, the vector genome is self-complementary. In some embodiments, the host cell is optionally a baculovirus-infected cell (e.g., an insect cell) that contains additional nucleic acids encoding baculovirus helper functions, thereby facilitating the production of viral capsids.

[0142] Packaging cells generally contain one or more viral vector functions, along with packaging functions sufficient to provide helper functions and to effect replication and packaging of the viral vector. These various functions may be supplied to the packaging cells together or separately using gene constructs such as plasmids or amplicons, which may exist episomally within the cell line or may be integrated into the host cell's chromosome.

[0143] B. Helper Functions AAV cannot replicate in cells without co - infection with a helper virus. Helper functions include helper virus elements necessary to establish productive infection of packaging cells, which are required to initiate packaging of viral vectors. Helper viruses typically include adenovirus or herpes simplex virus. Adenovirus helper functions typically include adenovirus components, adenovirus early regions 1A (E1a), E1b, E2a, E4, and virus - associated (VA) RNAs. Helper functions (e.g., E1a, E1b, E2a, E4, and VA RNA) can be provided to packaging cells by transfecting the cells with one or more nucleic acids encoding the various helper elements. Alternatively, a host cell (e.g., a packaging cell) can contain a nucleic acid encoding a helper protein. For example, HEK293 cells are generated by transforming human cells with adenovirus 5 DNA and currently express several adenovirus genes including, but not limited to, E1 and E3 (see, e.g., Graham et al. (1977) J. Gen. Virol. Virol. 36:59 - 72). Thus, these helper functions can be provided by HEK293 packaging cells without the need to supply them to the cells, for example, by plasmids encoding them.

[0144] In some embodiments, the packaging cells are transfected with at least (i) a plasmid containing a vector genome comprising a transgene and AAV ITRs and further comprising at least one of enhancer, promoter, exon, intron, and polyA regulatory elements, (ii) a plasmid containing a rep gene (e.g., AAV2 rep) and a cap gene (e.g., Olig001 cap), and (iii) a plasmid containing helper functions.

[0145] Any method can be used to introduce a nucleotide sequence having helper functions for replication and packaging into a cell host, including, but not limited to, electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, and liposomes combined with a nuclear localization signal. In some embodiments, the helper function is provided by transfection using a viral vector or by infection using a helper virus, and standard methods for producing viral infection can be used.

[0146] The vector genome may be any suitable recombinant nucleic acid, such as a DNA or RNA construct, and may be single-stranded, double-stranded, or double-stranded (i.e., self-complementary as described in WO2001 / 92551).

[0147] C. Production of Packaged Viral Vectors Viral vectors can be produced by several methods known to those skilled in the art (see, for example, WO2013 / 063379). A preferred method is described in Grieger, et al. (2015) Molecular Therapy 24(2):287-297, the content of which is incorporated herein by reference for all purposes. Briefly, starting with efficient transfection of HEK293 cells, adherent HEK293 cell lines from a qualified clinical master cell bank are used and grown under suspension conditions without animal components in shaker flasks and WAVE bioreactors that enable rapid and expandable rAAV production. Using the triple transfection method (e.g., WO96 / 40240), the HEK293 cell line suspension, when harvested 48 hours after transfection, has 1×10 5 superior particle-containing vector genomes (vg) / cell, or 1×10 14Ultra vg / L (cell culture) can be generated. More specifically, triple transfection refers to a method of transfecting packaging cells with three plasmids (one plasmid encodes the AAV rep and cap (e.g., Olig001 cap) genes, another plasmid encodes various helper functions (e.g., adenovirus or HSV proteins, such as E1a, E1b, E2a, E4, and VA RNA), and another plasmid encodes the transgene (e.g., the RNA described herein) and various elements that control the expression of the transgene).

[0148] Single-stranded vector genomes are packaged into capsids in approximately equal proportions as plus-strands or minus-strands. In some embodiments of rAAV vectors, the vector genome is in plus-strand polarity (i.e., the sense or coding sequence of the DNA strand). In some embodiments of rAAV vectors, the vector is in minus-strand polarity (i.e., the antisense or template DNA strand). Given the nucleotide sequence of a plus-strand in 5' to 3' orientation, the nucleotide sequence of the minus-strand in 5' to 3' orientation can be determined as the reverse complement of the nucleotide sequence of the plus-strand.

[0149] To achieve the desired yield, several variables such as the selection of a compatible serum-free suspension medium that supports both growth and transfection, the selection of transfection reagents, transfection conditions, and cell density are optimized.

[0150] rAAV vectors can be purified by standard methods in the art such as column chromatography or cesium chloride gradient. Methods for purifying rAAV vectors are known in the art and include those described in Clark et al. (1999) Human Gene Therapy 10(6):1031-1039, Schenpp and Clark (2002) Methods Mol. Med. 69:427-443, U.S. Patent No. 6,566,118, and WO98 / 09657.

[0151] Using a universal purification strategy based on ion exchange chromatography, high-purity vector preparations of AAV serotypes 1-6, 8, 9, and various chimeric capsids (e.g., Olig001) can be generated. In some embodiments, this process can be completed within one week, resulting in a high total capsid to empty capsid ratio (>90% total capsids) and providing a post-purification yield (>1×10 13 vg / L) and purity suitable for clinical use. In some embodiments, such methods are universal for all serotypes and chimeric capsids. Using scalable manufacturing techniques, GMP clinical and commercial grade rAAV vectors (e.g., for the treatment of hereditary and acquired disorders of myelin) can be manufactured.

[0152] After the rAAV vectors of the present disclosure are produced and purified, they can be titered (e.g., the amount of rAAV vector in a sample can be quantified) to prepare compositions for administration to subjects such as human subjects having a hereditary or acquired disorder of myelin. Titering of rAAV vectors can be accomplished using methods known in the art.

[0153] In some embodiments, the number of virus particles comprising particles containing the vector genome and "empty" capsids not containing the vector genome can be determined by electron microscopy, e.g., transmission electron microscopy (TEM). Such TEM-based methods can provide the number of vector particles (or virus particles in the case of wild-type AAV) in a sample.

[0154] In some embodiments, the rAAV vector genome can be titrated using quantitative polymerase chain reaction (qPCR) using primers for sequences within the vector genome, such as ITR sequences, and / or sequences within the transgene or regulatory element. By performing qPCR in parallel on dilutions of a known concentration of a standard, such as a plasmid containing the sequence of the vector genome, a standard curve can be generated that enables calculation of the concentration of the rAAV vector as the number of vector genomes (vg) per unit volume, such as microliters or milliliters. For example, the number of empty capsids can be determined by comparing the number of vector particles measured by electron microscopy to the number of vector genomes in the sample. Since the vector genome contains the therapeutic transgene, the vg / kg or vg / ml of the vector sample can indicate a therapeutic dose rather than the number of vector particles the subject will receive, some of which may be empty and contain no vector genome. Once the concentration of the rAAV vector genome in the stock solution is determined, it can be diluted or dialyzed against a buffer suitable for use in preparing a composition for administration to a subject (e.g., a subject having a hereditary or acquired disorder of myelin).

[0155] 6. USE AND TREATMENT METHODS The nucleic acids disclosed herein (e.g., RNA molecules or polynucleotides encoding RNA molecules) can be used for the treatment and / or prevention of gene therapy of diseases, disorders, or conditions. In particular, by targeting specific target genes (e.g., PMD.MSA, or H-ABC), it can be used to treat or prevent diseases, disorders, or conditions associated with the lack or dysfunction of oligodendrocytes or myelin, and by reducing the expression of the associated target gene, a therapeutic benefit or improvement, e.g., compared to the level or function of a protein in an otherwise healthy individual, can be mediated by an increase in the level or function of an associated protein (e.g., PLP1, SNCA, or TUBB4A), or can be used for any other condition and / or disease that can result in a disease, disorder, or condition associated with it. The vector genomes and / or rAAV vectors described herein can be used for the treatment and / or prevention of gene therapy of the same diseases, disorders, or conditions.

[0156] In some embodiments, the methods of the present disclosure include the use of an rAAV vector or a pharmaceutical composition thereof in the treatment of a disease, disorder, or condition of a subject. In some embodiments, the methods of the present disclosure include the use of an rAAV vector (e.g., AAV / Olig001), or a pharmaceutical composition thereof, to reduce the level of a gene of interest (e.g., PMD.MSA, or H-ABC) in a subject in need of a reduction in the level of that gene of interest.

[0157] The above nucleic acids, vector genomes, and / or rAAV vectors can be used in the preparation of a medicament for use in the treatment and / or prevention of diseases, disorders, or conditions (e.g., PMD.MSA, or H-ABC) associated with or caused by the lack or dysfunction of oligodendrocytes or myelin, and any other condition or disease in which downregulation of an associated protein can result in a therapeutic benefit or improvement.

[0158] As used herein, the terms myelin disorder, myelin disease, myelin-related disorder, myelin-related disease, myelinopathy, and myelin disease are used interchangeably. These include any disease, condition (e.g., resulting from traumatic spinal cord injury and cerebral infarction), or disorder associated with demyelination, insufficient myelin and myelin regeneration, or hypomyelination in a subject. Such disorders can be genetic, acquired, or both. This can result from myelinogenesis-related disorders or demyelination caused by various neurotoxic disorders. As used herein, "demyelination" refers to the action of demyelination, or the loss of the myelin sheath that insulates nerves, and is a characteristic of several neurodegenerative autoimmune diseases, including multiple sclerosis, transverse myelitis, chronic inflammatory demyelinating polyneuropathy, and Guillain-Barré syndrome. Leukodystrophy is caused by a genetic enzyme deficiency, which causes abnormal formation, destruction, and / or abnormal turnover of the myelin sheath in the CNS white matter. Both acquired and genetic myelin disorders have a poor prognosis leading to severe disorders. Thus, some embodiments of the present disclosure may include methods of treating neurodegenerative autoimmune diseases in a subject. Myelination of neurons requires oligodendrocytes. As used herein, the term "myelination" refers to the regeneration of the myelin sheath of a nerve by replacing myelin-producing cells or restoring their function.

[0159] Myelin-related diseases or disorders that can be treated or ameliorated by the method of the present invention include diseases, disorders or injuries associated with hypomyelination or demyelination in the target brain cells, such as CNS neurons. Such diseases include, but are not limited to, diseases and disorders in which the myelin sheath surrounding the neurons is absent, incomplete, not properly formed, or degraded. Such diseases include multiple sclerosis (MS), neuromyelitis optica (NMO), progressive multifocal leukoencephalopathy (PML), encephalomyelitis (EPL), central pontine myelinolysis (CPM), adrenoleukodystrophy, Alexander disease, Pelizaeus-Merzbacher disease (PMD), Wohlfart disease, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis (ALS), Huntington's disease, Alzheimer's disease, Parkinson's disease, spinal cord injury, traumatic brain injury, radiation-induced injury, neurological complications of chemotherapy, stroke, acute ischemic optic neuropathy, vitamin E deficiency, isolated vitamin E deficiency syndrome, Bassen-Kornzweig syndrome, Marchiafava-Bignami syndrome, metachromatic leukodystrophy, trigeminal neuralgia, acute disseminated encephalitis, Guillain-Barré syndrome, Charcot-Marie-Tooth disease, and Bell's palsy, but are not limited thereto.

[0160] Myelin-related diseases or disorders that can be treated or improved by the method of the present invention include diseases or disorders characterized by myelin deficiency. Insufficient myelination in the central nervous system is involved in a wide range of neurological disorders. Among these are congenital deficits in forebrain myelination in children with periventricular leukomalacia, which contribute to forms of cerebral palsy that contribute to neurological morbidity (Goldman et al., 2008) Goldman, S.A., Schanz, S., and Windrem, M.S. (2008). Stem cell-based strategies for treating pediatric disorders of myelin. Hum Mol Genet. 17, R76-83. At the other end of the age spectrum, myelin loss and ineffective repair can contribute to age-related decline in cognitive function (Kohama et al., 2011) Kohama, S.G., Rosene, D.L., and Sherman, L.S. (2011) Age (Dordr). Age-related changes in human and non-human primate white matter: from myelination disturbances to cognitive decline. Therefore, effective compositions and methods for enhancing myelination and / or myelin regeneration are contemplated to have substantial therapeutic benefits in halting disease progression and restoring function in a wide range of myelin-related disorders.

[0161] In some embodiments, the compositions of the invention can be administered to a subject without and / or without suspicion of having a myelin-related disorder to enhance or promote myelin-dependent processes. In some embodiments, the compositions described herein can be administered to a subject to promote myelination of CNS neurons to enhance cognition, a myelin-dependent process known to occur in cognitively healthy subjects. In certain embodiments, the compositions described herein can be administered in combination with a cognitive enhancing (nootropic) agent. Exemplary agents include any drug, supplement, or other substance that improves cognitive function, particularly executive function, memory, creativity, or motivation, in healthy individuals. Non-limiting examples include racetams (e.g., piracetam, oxiracemat, and aniracetam), nutraceuticals (e.g., bacopa monnieri, panax ginseng, ginko biloba, and GABA), stimulants (e.g., amphetamine pharmaceuticals, methylphenidate, eugeroics, xanthines, and nicotine), L-theanine, tolcapone, levodopa, atomoxetine, and desipramine.

[0162] The total dosage of a therapeutic agent (e.g., an RNA molecule, a polynucleotide encoding an RNA molecule, a vector genome, or a vector such as rAAV, or a cell) is a therapeutically effective amount that depends on several factors including the overall health of the subject, the disease state of the subject, the severity of the condition, the observation of improvement, and the formulation and route of administration of the selected agent. Determination of a therapeutically effective amount is within the capabilities of those of ordinary skill in the art. The exact formulation, route of administration, and dosage can be chosen by an individual physician in view of the subject's condition.

[0163] In certain embodiments, the cell or nucleotide compositions described herein may be administered in an amount effective to enhance myelin production in the CNS of a subject by increasing the amount of myelin protein (e.g., MBP) by at least 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, or 1000% compared to the level of myelin protein in an untreated subject.

[0164] In other embodiments, the cell or nucleotide compositions may be administered in an amount effective to promote the survival of CNS neurons in a subject by increasing the number of viable neurons by at least 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, or 1000% compared to the number of viable CNS neurons in an untreated subject or the number of viable neurons in the subject.

[0165] Another strategy for treating a subject suffering from a myelin-related disorder is to administer a therapeutically effective amount of the oligodendrocyte differentiation and / or proliferation inducer and / or anti-neurodegenerative agent described herein, together with a therapeutically effective amount of the cell or nucleotide composition described herein. Examples of anti-neurodegenerative agents include L-DOPA, cholinesterase inhibitors, anti-cholinergic drugs, dopamine agonists, steroids, and immunomodulatory agents including interferon, monoclonal antibodies, and glatiramer acetate. Thus, in a further aspect of the present disclosure, the compositions described herein can be administered as part of a combination therapy with an adjuvant therapy for treating neurodegenerative and myelin-related disorders.

[0166] The phrase "combination therapy" encompasses the administration of the oligodendrocyte progenitor differentiation-inducing composition described herein and a therapeutic agent as part of a specific treatment regimen intended to provide a beneficial effect from the co-action of these therapeutic agents. When administered in combination, the oligodendrocyte progenitor differentiation-inducing compound and the therapeutic agent can be formulated as separate compositions. The administration of these therapeutic agents in combination is typically carried out over a defined period (usually, minutes, hours, days, or weeks depending on the combination selected).

[0167] 7. Pharmaceutical Composition The present disclosure provides a pharmaceutical composition or medicament for preventing or treating a hereditary or acquired disorder of myelin. In some embodiments, the pharmaceutical composition comprises one or more of the above RNA molecules, polynucleotides, expression cassettes, expression vectors (e.g., viral vector genomes, expression vectors, rAAV vectors), and host cells.

[0168] The pharmaceutical composition further comprises a pharmaceutically acceptable carrier, adjuvant, diluent, excipient, and / or other agent. The pharmaceutically acceptable carrier, adjuvant, diluent, excipient or other agent is not biologically or otherwise undesirable, e.g., the material can be administered to a subject without causing undesirable biological effects that outweigh the beneficial biological effects of the material. Any suitable pharmaceutically acceptable carrier or excipient can be used in the preparation of the pharmaceutical composition according to the present invention (see, e.g., Remington The Science and Practice of Pharmacy, Adeboye Adejare (Editor) Academic Press, November 2020).

[0169] The pharmaceutical composition is typically sterile, pyrogen-free, and stable under the conditions of manufacture and storage. The pharmaceutical composition may be formulated as a solution (e.g., water, saline, dextrose solution, buffer solution, or other pharmaceutically sterilized fluid), microemulsion, liposome, or other ordered structure suitable for containing high product (e.g., virus vector particles, microparticles, or nanoparticles) concentrations.

[0170] In some embodiments, the pharmaceutical compositions comprising the above-described RNA molecules, polynucleotides, expression cassettes, expression vectors, vector genomes, host cells, or rAAV vectors of the present disclosure are formulated in water or buffered saline aqueous solutions. The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by the use of coatings such as lecithin, by maintaining the required particle size in the case of dispersion, and by the use of surfactants. In some embodiments, it may be preferable to include in the composition an isotonic agent, such as sugar, polyhydric alcohol, such as mannitol, sorbitol, etc., or sodium chloride. Sustained adsorption of the injectable composition can be brought about by including in the composition an agent that delays absorption, such as monostearate and gelatin. In some embodiments, the nucleic acids, vectors, and / or host cells of the present disclosure are administered in a composition comprising a controlled release formulation, such as a sustained release polymer or other carrier that protects against rapid release, including implant and microencapsulation delivery systems.

[0171] In some embodiments, the pharmaceutical compositions of the present disclosure are parenteral pharmaceutical compositions comprising compositions suitable for intravenous, intraarterial, subcutaneous, intradermal, intraperitoneal, intramuscular, intraarticular, intrasubstantial (IP), intrathecal (IT), intracerebroventricular (ICV), and / or intracisternal (ICM) administration. In some embodiments, the pharmaceutical compositions of the present disclosure are formulated for administration by ICV injection. In some embodiments, the rAAV vector (e.g., AAV / Olig001) is formulated in PBS with 350 mM NaCl and 5% D-sorbitol.

[0172] 8. Method of Administration The above-described RNA molecule, polynucleotide, or vector (e.g., vector genome, rAAV vector) may be administered to a subject (e.g., a patient) for treating the subject. Administration of the vector to a human or animal subject in need thereof can be carried out by any means known in the art for administering the vector. The target cells of the vectors of the present disclosure include cells of the CNS, preferably oligodendrocytes.

[0173] The vector can be administered in addition to and as an adjunct to standard care treatment. That is, the vector can be co-administered with another agent, compound, drug, treatment, or treatment regimen simultaneously, contemporaneously, or at predetermined dosing intervals as determined by one of ordinary skill in the art using conventional methods. The uses disclosed herein include administration of the rAAV vectors of the present disclosure in addition to and / or based on a co-administration schedule with standard care for diseases known in the art.

[0174] In some embodiments, the combination composition comprises one or more immunosuppressive agents. In some embodiments, the combination composition comprises an rAAV vector comprising a transgene (e.g., a polynucleotide encoding an RNA molecule disclosed herein) and one or more immunosuppressive agents. In some embodiments, the method comprises administering or delivering an rAAV vector comprising a transgene to a subject and administering an immunosuppressive agent to the subject prophylactically before administration of the vector or after administration of the vector (i.e., before or after the vector and / or protein is provided and thereby the symptoms of the response thereto become apparent).

[0175] In one embodiment, the vectors of the present disclosure (e.g., rAAV vectors) are administered systemically. Exemplary methods of systemic administration include, but are not limited to, intravenous (e.g., portal vein), intraarterial (e.g., femoral artery, hepatic artery), intravascular, subcutaneous, intradermal, intraperitoneal, transmucosal, intralung, intralymphatic, and intramuscular administration, as well as injection into a direct tissue or organ. Those skilled in the art will understand that nucleic acids can be delivered to all tissues by systemic administration. In some embodiments, administration to a direct tissue or organ includes administration to areas directly affected by oligodendrocyte deficiency (e.g., the brain and / or central nervous system). In some embodiments, the vectors and pharmaceutical compositions of the present disclosure are administered into the brain parenchyma (i.e., by parenchymal administration), into the spinal canal or subarachnoid space to reach the cerebrospinal fluid (CSF) (i.e., by intrathecal administration), into the ventricles of the brain (i.e., by intraventricular administration), and / or into the cistern of the brain (i.e., by cisternal administration).

[0176] Thus, in some embodiments, the vectors of the present disclosure are administered by direct injection into the brain (e.g., into the parenchyma, ventricle, cistern, etc.) and / or into the CSF (e.g., into the spinal canal or subarachnoid space) to treat myelin disorders. Target cells of the vectors of the present disclosure include cells located in the cortex, subcortical white matter of the corpus callosum, striatum, and / or cerebellum. In some embodiments, the target cells of the vectors of the present disclosure are oligodendrocytes. Additional routes of administration may also include topical application of the vector under direct visualization, e.g., surface cortical application, or other stereotactic application.

[0177] In some embodiments, the vectors of the present disclosure are administered by at least two routes. For example, the vector is administered systemically and also directly to the brain. When administered via at least two routes, the administration of the vector can be simultaneous or contemporaneous, but it does not have to be. Instead, administration via different routes can be performed separately with a time interval between each administration.

[0178] The above-described RNA molecule, or polynucleotide encoding the RNA molecule, or vector genome, or rAAV vector comprising the polynucleotide can be used for ex vivo cell transduction or direct administration to a subject (e.g., directly to the CNS of a patient having a disease). In some embodiments, the transduced cells (e.g., host cells) are administered to a subject (e.g., for cell therapy for a disease) to treat or prevent a disease, disorder, or condition. An rAAV vector comprising a therapeutic nucleic acid (e.g., encoding RNA) is preferably administered to cells in a biologically effective amount. In some embodiments, a biologically effective amount of the vector is an amount sufficient to effect a reduction in the expression of a relevant gene in the target cells.

[0179] In some embodiments, the present disclosure includes a method of reducing the level and / or activity of a gene in a cell by administering, either alone or in any of a vector (including plasmid, viral vector, nanoparticle, liposome, or any known method for delivering nucleic acids to cells), a polynucleotide encoding the RNA molecule described herein to the cell (in vivo, in vitro, or ex vivo).

[0180] The dosage of the rAAV vector depends, for example, on the mode of administration, the disease or condition being treated, the stage and / or aggressiveness of the disease, the condition of the individual subject (age, sex, weight, etc.), the particular viral vector, the stability of the expressed protein, the host immune response to the vector, and / or the gene being delivered. Generally, the dosage is at least 1×10 8 or more, for example, 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , 1×10 13 , 1×10 14 , 1×10 15 or more vector genomes (vg).

[0181] In some embodiments, the polynucleotide encoding the RNA molecule described herein can be administered as a component of a DNA molecule (e.g., a recombinant nucleic acid) having regulatory elements (e.g., a promoter) appropriate for expression in a target cell (e.g., an oligodendrocyte). The polynucleotide can be administered as a component of a plasmid or viral vector, e.g., an rAAV vector. The rAAV vector can be administered in vivo by directly delivering the vector to a patient in need of treatment (e.g., directly to the CNS). The rAAV vector can be administered to a patient ex vivo by in vitro administration of the vector to cells from a donor patient in need of treatment, followed by reintroduction of the transduced cells into the donor (e.g., cell therapy).

[0182] 9. Kit The present disclosure provides a kit comprising a packaging material and one or more components. The kit typically includes a label or package insert containing instructions for the components, or for the in vitro, in vivo, or ex vivo use of the components therein. The kit can include a collection of such components, e.g., the RNA molecules, polynucleotides, nucleic acids, expression cassettes, expression vectors (e.g., viral vector genomes, expression vectors, rAAV vectors), and host cells described above, and optionally a second active agent, e.g., a compound, therapeutic agent, drug, or composition.

[0183] A kit refers to a physical structure containing one or more components of the kit. The packaging material can maintain the components in a sterile manner and can be made of materials commonly used for such purposes (e.g., paper, glass, plastic, foil, ampoules, vials, tubes, etc.).

[0184] The label or package insert may include the identification information of one or more components therein, the dosage, mechanism of action, pharmacokinetics, and the clinical pharmacology of the active ingredient including pharmacodynamics. The label or package insert may include information specifying the manufacture, lot number, place and date of manufacture, and expiration date. The label or package insert may include information regarding the diseases for which the kit components may be used (e.g., hereditary or acquired disorders of myelin, such as PMD, MSA, and H-ABC). The label or package insert may include instructions for the clinician or the subject for using one or more of the kit components in a method, use, or treatment protocol or treatment regimen. The instructions may include dosage, frequency of duration, and instructions for practicing any of the methods, uses, treatment protocols, or prophylactic or treatment regimens described herein.

[0185] The label or package insert may include information regarding potential side effects, complications or reactions, e.g., warnings to the subject or clinician regarding situations in which it is not appropriate to use a particular composition.

[0186] 10. Definitions As used herein, the terms "nucleic acid sequence," "nucleotide sequence," and "polynucleotide" refer interchangeably to any molecule composed of, or containing, monomeric nucleotides linked by phosphodiester bonds. Nucleic acids can be oligonucleotides or polynucleotides. Nucleic acid sequences are presented herein in the 5' to 3' direction. The nucleic acid sequences (i.e., polynucleotides) of the present disclosure can be deoxyribonucleic acid (DNA) molecules or ribonucleic acid (RNA) molecules, and include all forms of nucleic acids, e.g., double-stranded molecules, single-stranded molecules, small molecules or short hairpin RNAs (shRNAs), microinterference RNAs or microRNAs (miRNAs), small or short interfering RNAs (siRNAs), trans-splicing RNAs, antisense RNAs, messenger RNAs, transfer RNAs, ribosomal RNAs. When the polynucleotide is a DNA molecule, the molecule can be a gene, cDNA, antisense molecule, or a fragment of any of the foregoing molecules. Nucleotides are represented herein by the single letter codes: adenine (A), guanine (G), thymine (T), cytosine (C), inosine (I), and uracil (U). Nucleotide sequences can be chemically modified or artificial. Nucleotide sequences include peptide nucleic acids (PNAs), morpholinos, and locked nucleic acids (LNAs), as well as glycol nucleic acids (GNAs) and threose nucleic acids (TNAs). Each of these sequences is distinguished from naturally occurring DNA or RNA by changes to the molecular backbone. Also, phosphorothioate nucleotides may be used. Other deoxynucleotide analogs include methylphosphonate, phosphoramidate, phosphorodithioate, N3'-P5'-phosphoramidate, and oligoribonucleotide phosphorothioate, as well as their 2'-O-allyl analogs, and 2'-O-methyl ribonucleotide methylphosphonates that can be used in the nucleotide sequences of the present disclosure.

[0187] In some embodiments, a protein or nucleic acid is isolated. As used herein, the term "isolated" means being produced artificially. When used herein with respect to a nucleic acid, the term "isolated" means (i) amplified in vitro, for example, by polymerase chain reaction (PCR), (ii) recombinantly produced by cloning, (iii) purified by cleavage and gel separation, or (iv) synthesized, for example, by chemical synthesis. An isolated nucleic acid is readily manipulable by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector, where the 5' and 3' restriction sites are known or the polymerase chain reaction (PCR) primer sequences are disclosed, is considered isolated, but a nucleic acid sequence that exists in its native state in its natural host is not isolated. An isolated nucleic acid may be substantially purified, but need not necessarily be purified. For example, an isolated nucleic acid in a cloning or expression vector may not be pure in that it may contain a very small percentage of material within the cell in which it resides. However, such a nucleic acid is isolated as the term is used herein because it is readily manipulable by standard techniques known to those of skill in the art. When used herein with respect to a protein or peptide, the term "isolated" refers to a protein or peptide that has been isolated from its natural environment or produced artificially (e.g., by chemical synthesis, recombinant DNA technology, etc.). In some embodiments, any one or more thymidine (T) nucleotides or uridine (U) nucleotides of the sequences provided herein may be replaced with any other nucleotide suitable for base pairing with an adenosine nucleotide (e.g., via Watson-Crick base pairing). For example, T may be replaced with U, and U may be replaced with T.

[0188] "Heterologous" means that it is derived from an entity that is genetically different from the remainder of the entity to which it is being compared, or into which it is being introduced or incorporated. For example, by genetic engineering techniques, a polynucleotide introduced into different cell types is a heterologous polynucleotide (which, when expressed, may encode a heterologous polypeptide). Similarly, a cellular sequence (e.g., a gene or a part thereof) incorporated into a viral vector is a heterologous nucleotide sequence with respect to the vector.

[0189] The term "transgene" refers to a heterologous polynucleotide that is introduced into a cell, transcribed into RNA, and optionally, can be translated and / or expressed under appropriate conditions. In an aspect, it confers a desired property to the cell into which it is introduced, or otherwise results in a desired therapeutic or diagnostic outcome. In another aspect, it can be transcribed into a molecule that mediates RNA interference, such as miRNA, siRNA, or shRNA.

[0190] As used herein, the term "recombinant" refers to a vector, polynucleotide (e.g., a recombinant nucleic acid), polypeptide, or cell that is the product of various combinations of cloning, restriction, or ligation steps, and / or other procedures that result in a construct different from that found in nature. A recombinant virus or vector (e.g., an rAAV vector) contains a vector genome that includes a recombinant nucleic acid (e.g., a nucleic acid that includes a transgene and one or more regulatory elements). This term includes the replication of the original polynucleotide construct and the progeny of the original viral construct, respectively.

[0191] As used herein, the term "operably linked" refers to the linking of nucleic acid sequence (or polypeptide) elements in a functional relationship. Nucleic acids are operably linked when placed in a functional relationship with another nucleic acid sequence. For example, a promoter or other transcriptional regulatory sequence (e.g., enhancer) is operably linked to a coding sequence if it affects the transcription of the coding sequence. In some embodiments, being operably linked means that the linked nucleic acid sequences are contiguous. In some embodiments, being operably linked does not mean that the nucleic acid sequences are contiguous, but rather that intervening sequences exist between the linked nucleic acid sequences.

[0192] "Recombinant AAV vector (rAAV vector)" refers to a polynucleotide vector that contains at least one, and in some embodiments two, heterologous sequences (i.e., nucleic acid sequences not derived from AAV) flanked by at least one, and in some embodiments two, AAV inverted terminal repeats. Such rAAV vectors can be replicated and packaged into infectious virus particles when present in a host cell that is infected with a suitable helper virus (or expressing suitable helper functions) and expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When an rAAV vector is incorporated into a larger polynucleotide (e.g., a chromosome, or another vector such as a plasmid used for cloning or transfection), the rAAV vector may be referred to as a "pro-vector" that can be "rescued" by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions. The rAAV vector may be in any of several forms including, but not limited to, a plasmid, a linear artificial chromosome, complexed with lipids, encapsulated within liposomes, and encapsulated within virus particles, particularly AAV particles. The rAAV vector can be packaged into an AAV virus capsid to generate "recombinant adeno-associated virus particles (rAAV particles)".

[0193] As used herein, the term "vector" refers to a plasmid, virus (e.g., rAAV), cosmid, or other vehicle that can be manipulated by the insertion or incorporation of a nucleic acid (e.g., a recombinant nucleic acid). Vectors can be used for various purposes, including, for example, genetic manipulation (e.g., cloning vectors), to introduce / transfer nucleic acids into cells and to transcribe or translate the inserted nucleic acids within the cells. In some embodiments, the vector nucleic acid sequence contains at least an origin of replication for propagation in a cell. In some embodiments, the vector nucleic acid contains a heterologous nucleic acid sequence, expression control elements (e.g., a promoter, an enhancer), a selectable marker (e.g., antibiotic resistance), a polyadenosine (polyA) sequence, and / or an ITR. In some embodiments, the nucleic acid sequence is propagated when delivered to a host cell. In some embodiments, when delivered to a host cell, either in vitro or in vivo, the cell expresses a polypeptide encoded by the heterologous nucleic acid sequence. In some embodiments, when delivered to a host cell, the nucleic acid sequence or a portion of the nucleic acid sequence is packaged into a capsid. The host cell can be an isolated cell or a cell within a host organism. In addition to a nucleic acid sequence encoding an RNA or polypeptide or protein (e.g., a transgene), additional sequences (e.g., regulatory sequences) can be present within the same vector (i.e., cis to the gene) and adjacent to the gene. In some embodiments, the regulatory sequences can be present on a separate (e.g., second) vector that acts in trans to regulate the expression of the gene. A plasmid vector can be referred to herein as an "expression vector".

[0194] As used herein, the term "vector genome" refers to a recombinant nucleic acid sequence that is packaged or encapsulated to form an rAAV vector. Typically, the vector genome contains a heterologous polynucleotide sequence, such as a transgene, regulatory elements, and ITRs that are not originally present in the capsid. When constructing or manufacturing a recombinant vector (e.g., an rAAV vector) using a recombinant plasmid, the vector genome does not include the entire plasmid, but rather only the sequences intended for delivery by the viral vector. This non-vector genome portion of the recombinant plasmid is typically referred to as the "plasmid backbone," which is important for the cloning, selection, and amplification of the plasmid, a process required for the propagation of recombinant viral vector production, but which itself is not packaged or encapsulated into the rAAV vector.

[0195] As used herein, the term "viral vector" generally refers to a nucleic acid delivery vehicle that functions as such and contains a vector genome (e.g., containing a transgene instead of nucleic acids encoding AAV rep and cap) packaged within a viral particle (i.e., a capsid), and refers to viral particles including lentiviruses and parvoviruses, including AAV serotypes and variants (e.g., rAAV vectors). A recombinant viral vector does not contain a vector genome that includes the rep and / or cap genes.

[0196] As used herein, "miRNA scaffold" can refer to a polynucleotide comprising (i) a double-stranded sequence targeting a gene of interest for knockdown by RNAi, and (ii) an additional sequence that forms a stem-loop structure similar to the stem-loop structure of an endogenous miRNA. The sequence targeting the gene of interest for RNAi (e.g., a short, ~20 nt sequence) may be ligated to a sequence that creates a miRNA-like stem-loop and to a sequence that base pairs with the sequence of interest to form a duplex when the polynucleotide is assembled into a miRNA-like secondary structure. As described herein, this duplex may hybridize imperfectly; for example, it may contain one or more unpaired or mispaired bases. Upon cleavage of this polynucleotide by Dicer, this duplex containing the sequence targeting the gene of interest may be unwound and incorporated into the RISC complex. The miRNA scaffold can refer to the miRNA itself or a DNA polynucleotide encoding the miRNA. An example of a miRNA scaffold is the miR-155 sequence (Lagos-Quintana, M. et al. (2002) Curr. Biol. 12:735-9). Commercially available kits for cloning sequences into miRNA scaffolds are known in the art (e.g., the INVITROGEN BLOCK-IT Pol II miR RNAi Expression Vector Kit from Life Technologies, Thermo Fisher Scientific, Waltham, Mass.).

[0197] Functional variants or equivalents of a reference peptide, polypeptide, or protein refer to polypeptide derivatives of the reference peptide, polypeptide, or protein, such as proteins having one or more point mutations, insertions, deletions, truncations, fusion proteins, or combinations thereof. It substantially retains the activity towards the reference peptide, polypeptide, or protein. Generally, functional equivalents are at least 60% identical to the reference peptide, polypeptide, or protein (e.g., any number from 60% to 100% (including both end values), such as 60%, 70%, 80%, 85%, 90%, 95%, and 99%). In certain embodiments, the point mutations can be conservative modifications.

[0198] As used herein, the term "conservative modification" refers to amino acid modifications that do not significantly affect or change the biological characteristics of a polypeptide or protein. Such conservative modifications include amino acid substitutions, additions, and deletions. The modifications can be introduced into the polypeptide or protein by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are those in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are defined in the art. These families include amino acids having basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Non-conservative substitutions involve exchanging a member of one of these classes for another class.

[0199] As used herein, the terms "treat", "treating", or "treatment" refer to administering a therapy that partially or completely alleviates, ameliorates, mitigates, inhibits, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms, features, and / or causes of a particular disease, disorder, and / or condition.

[0200] As used herein, the term "ameliorate" means a detectable or measurable improvement in a subject's disease, disorder or condition, or its symptoms, or underlying cellular response. Detectable or measurable improvements include subjective or objective decreases, reductions, inhibitions, suppressions, limitations or controls of the incidence, frequency, severity, progression or duration of a disease, disorder or condition, the causes of complications resulting from or associated with them, improvement of their symptoms, or reversal of them.

[0201] As used herein, the term "associated with" refers to being linked to each other when the presence, level and / or form of one correlates with the presence, level and / or form of the other. For example, a particular entity (e.g., a polypeptide, gene signature, metabolite, microorganism, etc.) is considered to be associated with a particular disease, disorder, or condition if its presence, level and / or form correlates with the incidence and / or susceptibility of the disease, disorder, or condition (e.g., across the relevant population).

[0202] As used herein, the terms "prevent" or "prevention" refer to delaying the onset of one or more signs or symptoms of a particular disease, disorder, or condition (e.g., a myelin disease), and / or reducing its frequency and / or severity. In some embodiments, prevention is evaluated on a population basis such that a drug is considered to "prevent" a particular disease, disorder, or condition if a statistically significant decrease in the onset, frequency and / or intensity of one or more signs or symptoms of the disease, disorder, or condition is observed in a population susceptible to the disease, disorder or condition. Prevention may be considered complete if the onset of a disease, disorder, or condition is delayed for a predetermined period.

[0203] As used herein, the term "subject" refers to an organism, such as a mammal (e.g., human, non-human mammal, non-human primate, primate, laboratory animal, mouse, rat, hamster, gerbil, cat, dog). In some embodiments, the subject is a non-human disease model. In some embodiments, the human subject is an adult, adolescent, or pediatric subject. In some embodiments, the subject has a disease, disorder, or condition, such as a disease, disorder, or condition that can be treated as provided herein. In some embodiments, the subject has a disease, disorder, or condition associated with deficient or dysfunctional myelin. In some embodiments, the subject is susceptible to a disease, disorder, or condition. In some embodiments, a susceptible subject is likely to have and / or exhibit an increased risk of developing a disease, disorder, or condition (compared to the average risk observed in a reference subject or population). In some embodiments, the subject exhibits one or more symptoms of a disease, disorder, or condition. In some embodiments, the subject does not exhibit a particular symptom (e.g., a clinical symptom of a disease) or feature of a disease, disorder, or condition. In some embodiments, the subject does not exhibit any symptom or feature of a disease, disorder, or condition. In some embodiments, the subject is a human patient. In some embodiments, the subject is an individual and / or an individual on whom a diagnosis and / or therapy is performed.

[0204] As used herein, the term "therapeutically effective amount" refers to an amount that produces the desired therapeutic effect for which administration is sought. In some embodiments, the term refers to an amount sufficient to treat a disease, disorder, or condition when administered to a population afflicted with or susceptible to the disease, disorder, or condition according to a therapeutic dosing regimen. In some embodiments, a therapeutically effective amount is an amount that reduces the incidence and / or severity of one or more symptoms of a disease, disorder, and / or condition and / or delays the onset thereof. One of ordinary skill in the art will understand that the term "therapeutically effective amount" does not actually require that therapeutic success be achieved in a particular individual. Rather, a therapeutically effective amount can be an amount that provides a particular desired pharmacological response in a significant number of subjects when administered to patients in need of such treatment.

Example

[0205] Example 1. Construction of AAV Expression Cassette The 774 base pair coding sequence of human proteolipid protein 1 (PLP1), transcript variant 1, mRNA (NCBI reference sequence: NM_000533.5, SEQ ID NO: 1) was obtained from the National Center for Biotechnology Information (NCBI) at ncbi.nlm.nih.gov / refseq / .

[0206] Using a non-commercial web-based algorithm-based design tool, a target region was identified within the coding sequence of the gene of interest (see Figure 1, the sequence of red SEQ ID NO: 35). Such design tools include Designer of Small Interfering RNA (DSIR) (Vert et al., 2006) and the Genetic Perturbation Platform made available by the Broad Institute. Using the design tool, 19-21 nucleotide target sequences within the human PLP1 coding sequence were generated. A nucleotide sequence completely complementary to the target sequence was determined (see Figure 9, the sequence of blue SEQ ID NO: 75, italicized and underlined, aligned 3' to 5' to show complementarity). In this example, human miR-30a was used as the backbone (see Figure 4), and an artificial microRNA containing 3' and 5' flanking regions (50-100 nucleotides) and a loop region was designed. The 20-22 nucleotide sequence completely complementary to the target sequence was placed immediately after the 5' flanking sequence, followed by a loop sequence from a naturally occurring microRNA, the reverse complement of the 20-22 nucleotide guide strand (modified by a 10-11 nucleotide deletion to create a bulge that allows preferential loading of the guide strand into the RISC complex), and then the 3' flanking sequence (Figure 10).

[0207] Using a web-based software (mfold) (Zuker, 2003) for predicting the secondary structure of single-stranded nucleic acids, the folding of the sequences of both the endogenous miRNA (miR-30a in this experiment) and the designed sequence (miR-30a / PLP1 incorporating SEQ ID NO: 75) was predicted. In this case, the designed pre-miRNA has the same secondary structure as the natural sequence (having the same framework region but different guide and strand sequences) and has a free energy (dG) similar to the natural sequence (Figure 11). The resulting hairpin has a conserved loop region and contains the cleavage sites necessary for Dicer to remove the loop and leave a dsRNA duplex.

[0208] Synthesize the designed oligonucleotides and clone them into a plasmid containing the selected promoter. Select a cell line capable of expressing the PLP1 gene. A common selection is human embryonic kidney cells HEK293. Perform transfection and evaluate the knockdown.

[0209] Example 2. Additional AAV expression cassettes Prepare additional AAV expression cassettes in the same manner as described in Example 1, using other suitable endogenous human miRNA structures as the backbone or scaffold. These human miRNA structures include human mir-16-1 NR_029486 (mbase accession MI0000070) (Han et al., 2006), human miR-21 NC_000017.11 (Yue et al., 2010) (mbase accession MI0000077), human miR-23a NR_029495 (mbase accession MI0000079) (van den Berg et al., 2016), human miRNA-30a NR_029504 (mbase accession MI0000088) (Zeng et al., 2002), human miR-31 NR_029505.1 (mbase accession MI0000089) (Ely et al., 2008), human miR-122 NR_029667 (mbase accession MI0000442) (Ely et al., 2008), human miR-155 NR_030784 NC_000021.9 (mbase accession MI0000681), and human miR-451 NR_029970 (mbase accession MI0001729) (Yoda et al., 2013).

[0210] Example 3 Downregulation of PLP1 protein expression by miRNA This example demonstrates that the miRNA construct can reduce the expression of the target protein. In the experiment, the ability of three artificial Plp1-miRNAs to inhibit the expression of Plp1 protein was evaluated in vitro. As described above in Example 1, a non-commercial web-based algorithm-based design tool for miRNA formation was used to identify the target regions of the PLP1 coding sequence (SEQ ID NO: 1). Three target sequences and guide strands for targeting PLP1 were selected for targeting using miRNAs (SEQ ID NOs: 14 and 54, SEQ ID NOs: 34 and 74, and SEQ ID NOs: 35 and 75). These three sets of target sequences and guide strands were incorporated into a miR30-based shRNA knockdown vector (constructed as a plasmid in E. coli). Each of the three plasmids consisted of a polycistronic expression cassette containing a CBh promoter, one of three miR30-based shRNA sequences targeting the mRNA of human Plp1, and a codon-optimized enhanced green fluorescent protein (eGFP) cloned between two inverted terminal repeats (ITRs). The fourth plasmid contained a scrambled shRNA (not present in humans or mice) and served as a control. Plasmid 1332 contained a miR30-based shRNA knockdown vector having SEQ ID NOs: 35 and 75, plasmid 1333 contained a miR30-based shRNA knockdown vector having SEQ ID NOs: 14 and 54, and plasmid 1336 contained a miR30-based shRNA knockdown vector having SEQ ID NOs: 34 and 74. Plasmid 1307 contained a scrambled shRNA (not targeting any mRNA in humans or mice) and served as a control.

[0211] Knockdown efficiency was evaluated in vitro in L cells by co-transfection with the cDNA expression plasmid vector of PLP1 using Lipofectamine 300. After 72 hours, Western blotting was performed on cell lysates to evaluate the expression of PLP1 protein (using alpha-tubulin as a control). 10 μg of protein per lane was electrophoresed on an SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. Western blotting was performed using standard techniques known to those skilled in the art. Briefly, the blocked membrane was incubated overnight with rat anti-PLP AA3 (1:250 dilution), followed by a secondary antibody conjugated with anti-rat horseradish peroxidase (1:1000 dilution). The blot was washed and immunodetection was performed.

[0212] The results of Western blotting, in which the PLP protein runs as two bands, a monomer of approximately 22 kDa and a dimer of 44 kDa, show that at 72 hours, plasmid 1332 (containing the miR30-based shRNA knockdown vector having SEQ ID NOs: 35 and 75) and plasmid 1333 (containing the miR30-based shRNA knockdown vector having SEQ ID NOs: 14 and 54) achieved a significant decrease in PLP1 expression, while plasmid 1336 (containing the miR30-based shRNA knockdown vector having SEQ ID NOs: 34 and 74) did not.

[0213] Two PLP1 bands of 22 kD and 44 kD were combined, and morphometric analysis showing the changes in folding was performed using data obtained from three replicate experiments normalized by eGFP from the blot. The results quantitatively demonstrated that the artificial PLP1 miRNA suppressed the expression of PLP1 protein in vitro. Specifically, plasmids 1332 and 1333 containing miR30-based shRNA knockdown vectors (having SEQ ID NO: 35 and 75 and SEQ ID NO: 14 and 54, respectively) achieved a significant decrease in the expression of PLP1, while plasmid 1336 containing a miR30-based shRNA knockdown vector (having SEQ ID NO: 34 and 74) did not.

[0214] Statistical significance was determined using one-way ANOVA followed by Tukey's multiple comparison test. Both plasmid 1332 and plasmid 1333 resulted in a decrease of more than 50% compared to plasmid 1307 (P < 0.01) and plasmid 1336 (P < 0.001). The greatest decrease was achieved by plasmid 1333 (containing SEQ ID NO: 14 and 54 and shown in Figure 12) containing a miR30-based shRNA knockdown vector.

[0215] References Chen H, McCarty DM, Bruce AT, Suzuki K, and Suzuki K (1998) Gene transfer and expression in oligodendrocytes under the control of myelin basic protein transcriptional control region mediated by adeno-associated virus. Gene Ther 5:50 - 58. Curiel J, Rodriguez Bey G, Takanohashi A, Bugiani M, Fu X, Wolf NI, Nmezi B, Schiffmann R, Bugaighis M, Pierson T, Helman G, Simons C, van der Knaap MS, Liu J, Padiath Q, and Vanderver A (2017) TUBB4A mutations result in specific neuronal and oligodendrocytic defects that closely match clinically distinct phenotypes. Hum Mol Genet 26:4506 - 4518. Elitt MS, Barbar L, Shick HE, Powers BE, Maeno - Hikichi Y, Madhavan M, Allan KC, Nawash BS, Gevorgyan AS, Hung S, Nevin ZS, Olsen HE, Hitomi M, Schlatzer DM, Zhao HT, Swayze A, LePage DF, Jiang W, Conlon RA, Rigo F, and Tesar PJ (2020) Suppression of proteolipid protein rescues Pelizaeus - Merzbacher disease. Nature 585:397 - 403. Ely A, Naidoo T, Mufamadi S, Crowther C, and Arbuthnot P (2008) Expressed Anti - HBV Primary MicroRNA Shuttles Inhibit Viral Replication Efficiently In vitro and In Vivo. Molecular Therapy 16:1105 - 1112. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, and Mello CC (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806-811. Francis JS, Markov V, Wojtas ID, Gray S, McCown T, Samulski RJ, Figueroa M, and Leone P (2021) Preclinical biodistribution, tropism, and efficacy of oligotropic AAV / Olig001 in a mouse model of congenital white matter disease. Mol Ther Methods Clin Dev 20:520-534. Han J, Lee Y, Yeom K-H, Nam J-W, Heo I, Rhee J-K, Sohn SY, Cho Y, Zhang B-T, and Kim VN (2006) Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex. Cell 125:887-901. Keeler A, ElMallah M, and Flotte T (2017) Gene Therapy 2017: Progress and Future Directions: Gene Therapy 2017: Progress and Future Directions. Clinical and Translational Science 10:242-248. Kotowska-Zimmer A, Pewinska M, and Olejniczak M (2021) Artificial miRNAs as therapeutic tools: Challenges and opportunities. Wiley Interdisciplinary Reviews: RNA 12: e1640, John Wiley & Sons, Ltd. Lawlor PA, Bland RJ, Mouravlev A, Young D, and During MJ (2009) Efficient gene delivery and selective transduction of glial cells in the mammalian brain by AAV serotypes isolated from nonhuman primates. Mol Ther 17: 1692 - 1702. Li H, Okada H, Suzuki S, Sakai K, Izumi H, Matsushima Y, Ichinohe N, Goto Y-I, Okada T, and Inoue K (2019) Gene suppressing therapy for Pelizaeus-Merzbacher disease using artificial microRNA. JCI Insight 4: 125052. Mandel RJ, Marmion DJ, Kirik D, Chu Y, Heindel C, McCown T, Gray SJ, and Kordower JH (2017) Novel oligodendroglial alpha synuclein viral vector models of multiple system atrophy: studies in rodents and nonhuman primates. Acta Neuropathol Commun 5: 47. Marmion DJ, Peelaerts W, and Kordower JH (2021) A historical review of multiple system atrophy with a critical appraisal of cellular and animal models. J Neural Transm, doi:10.1007 / s00702-021-02419-8. Mavroeidi P, Arvanitaki F, Karakitsou A-K, Vetsi M, Kloukina I, Zweckstetter M, Giller K, Becker S, Sorrentino ZA, Giasson BI, Jensen PH, Stefanis L, and Xilouri M (2019) Endogenous oligodendroglial alpha-synuclein and TPPP / p25α orchestrate alpha-synuclein pathology in experimental multiple system atrophy models. Acta Neuropathol 138:415-441. Multiple System Atrophy Fact Sheet | National Institute of Neurological Disorders and Stroke (n.d.). Osorio MJ, and Goldman SA (2018) Neurogenetics of Pelizaeus-Merzbacher disease. Handb Clin Neurol 148:701-722. Powell SK, Khan N, Parker CL, Samulski RJ, Matsushima G, Gray SJ, and McCown TJ (2016) Characterization of a novel adeno-associated viral vector with preferential oligodendrocyte tropism. Gene Ther 23:807-814. Sase S, Almad AA, Boecker CA, Guedes-Dias P, Li JJ, Takanohashi A, Patel A, McCaffrey T, Patel H, Sirdeshpande D, Curiel J, Shih-Hwa Liu J, Padiath Q, Holzbaur EL, Scherer SS, and Vanderver A (2020) TUBB4A mutations result in both glial and neuronal degeneration in an H-ABC leukodystrophy mouse model. Elife 9: e52986. Schmidt JL, Pizzino A, Nicholl J, Foley A, Wang Y, Rosenfeld JA, Mighion L, Bean L, da Silva C, Cho MT, Truty R, Garcia J, Speare V, Blanco K, Powis Z, Hobson GM, Kirwin S, Krock B, Lee H, Deignan JL, Westemeyer MA, Subaran RL, Thiffault I, Tsai EA, Fang T, Helman G, and Vanderver A (2020) Estimating the relative frequency of leukodystrophies and recommendations for carrier screening in the era of next-generation sequencing. Am J Med Genet A 182: 1906 - 1912. Simons C, Wolf NI, McNeil N, Caldovic L, Devaney JM, Takanohashi A, Crawford J, Ru K, Grimmond SM, Miller D, Tonduti D, Schmidt JL, Chudnow RS, van Coster R, Lagae L, Kisler J, Sperner J, van der Knaap MS, Schiffmann R, Taft RJ, and Vanderver A (2013) A de novo mutation in the β-tubulin gene TUBB4A results in the leukoencephalopathy hypomyelination with atrophy of the basal ganglia and cerebellum. Am J Hum Genet 92:767-773. Stadelmann C, Timmler S, Barrantes-Freer A, and Simons M (2019) Myelin in the Central Nervous System: Structure, Function, and Pathology. Physiological Reviews 99:1381-1431, American Physiological Society. Toro Cabrera G, and Mueller C (2016) Design of shRNA and miRNA for Delivery to the CNS. Methods Mol Biol 1382:67-80. van den Berg FT, Rossi JJ, Arbuthnot P, and Weinberg MS (2016) Design of Effective Primary MicroRNA Mimics With Different Basal Stem Conformations. Mol Ther Nucleic Acids 5:e278. Vert J-P, Foveau N, Lajaunie C, and Vandenbrouck Y (2006) An accurate and interpretable model for siRNA efficacy prediction. BMC Bioinformatics 7:520. Wenning GK, Stefanova N, Jellinger KA, Poewe W, and Schlossmacher MG (2008) Multiple system atrophy: A primary oligodendrogliopathy. Annals of Neurology 64:239 - 246. Williams GP, Marmion DJ, Schonhoff AM, Jurkuvenaite A, Won W-J, Standaert DG, Kordower JH, and Harms AS (2020) T cell infiltration in both human multiple system atrophy and a novel mouse model of the disease. Acta Neuropathol 139:855 - 874. Yoda M, Cifuentes D, Izumi N, Sakaguchi Y, Suzuki T, Giraldez AJ, and Tomari Y (2013) PARN mediates 3’-end trimming of Argonaute2-cleaved precursor microRNAs. Cell Rep 5:10.1016 / j.celrep.2013.09.029. Yue J, Sheng Y, Ren A, and Penmatsa S (2010) A miR-21 hairpin structure-based gene knockdown vector. Biochem Biophys Res Commun 394:667 - 672. Zeng Y, Wagner EJ, and Cullen BR (2002) Both Natural and Designed Micro RNAs Can Inhibit the Expression of Cognate mRNAs When Expressed in Human Cells. Molecular Cell 9:1327-1333, Elsevier. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31:3406-3415.

[0216] The descriptions of the foregoing examples and preferred embodiments are not intended to limit the present disclosure as defined by the claims, but should be understood as illustrative. As will be readily understood, numerous variations and combinations of the features described above can be utilized without departing from the present disclosure as set forth in the claims. Such variations are not regarded as departing from the scope of the present disclosure, and all such variations are intended to be included within the scope of the following claims. All references cited herein are hereby incorporated by reference in their entirety.

Claims

1. Adeno-associated virus (AAV) particles having preferential targeting to the cell surface of oligodendrocytes, for use in methods for reducing the expression of target genes in oligodendrocytes or for treating hereditary or acquired myelin disorders, The AAV particle is divided from 5' to 3', 5' inverted terminal repeat (ITR), promoter sequence region, A polynucleotide encoding a pri- or pre-miRNA that targets the aforementioned target gene, and 3'ITR Nucleic acids containing this substance are capsidized, The method includes contacting the AAV particles with the oligodendrocytes. AAV particles for use.

2. AAV particle for use according to claim 1, wherein the nucleic acid further comprises one or more of the post-transcriptional regulatory elements and polyA signal sequence regions between the polynucleotide and the 3'ITR.

3. The aforementioned pri- or pre-miRNA is (a) pri- or pre-miRNA scaffold, (b) Different guide strands, and (c) AAV particles for use according to claim 1, comprising a different passenger chain.

4. AAV particles for use according to claim 3, wherein the pri- or pre-miRNA scaffold is a human pri- or pre-miRNA scaffold derived from human miRNA.

5. AAV particles for use according to claim 3, wherein the heterologous guide strand is complementary to the mRNA of the protein, and its elimination improves the therapeutic outcome of the hereditary or acquired disorder of myelin.

6. AAV particles for use according to claim 5, wherein the hereditary or acquired disorder of myelin is Pelizaeus-Merzbacher disease.

7. AAV particles for use according to claim 6, wherein the protein is PLP1.

8. AAV particle for use according to claim 7, wherein the heterogeneous guide chain comprises a nucleotide sequence having at least 90% identity with one of sequence numbers 42 to 80.

9. AAV particles for use according to claim 5, wherein the hereditary or acquired disorder of myelin is multiple system atrophy.

10. AAV particles for use according to claim 9, wherein the targeted protein is alpha-synuclein.

11. AAV particle for use according to claim 10, wherein the heterogeneous guide chain comprises a nucleotide sequence having at least 90% identity with one of sequence numbers 122 to 161.

12. AAV particles for use according to claim 5, wherein the hereditary or acquired myelin disorder is hypomyelinosis with basal ganglia and cerebellar atrophy (H-ABC).

13. AAV particles for use according to claim 12, wherein the targeted protein is the microtubule-associated protein tubulin beta-4a.

14. AAV particle for use according to claim 13, wherein the heterogeneous guide chain comprises a nucleotide sequence having at least 90% identity with one of sequence numbers 204 to 244.

15. An RNA molecule comprising a first RNA sequence and a second RNA sequence, wherein the first and second RNA sequences are substantially complementary, and the first RNA sequence has a sequence length of at least 19 nucleotides and is at least 90% complementary to one selected from the group consisting of SEQ ID NOs: 2-40, 82-121, and 163-203.

16. A polynucleotide encoding the RNA molecule described in claim 15.

17. An expression cassette or expression vector comprising the polynucleotide described in claim 16.

18. The expression vector according to claim 17, which is a viral vector.

19. The expression vector according to claim 18, wherein the viral vector is an AAV vector.

20. The expression vector according to claim 19, wherein the AAV vector has preferential targeting to oligodendrocytes.

21. The expression vector according to claim 20, wherein the AAV vector is AAV-Olig001, AAV-Olig002, AAV-Olig003, or AAV9.

22. A host cell comprising the polynucleotide described in claim 16, or an expression cassette or expression vector containing the polynucleotide.

23. A polynucleotide according to claim 16, or an expression cassette or expression vector containing the polynucleotide, or a host cell containing the polynucleotide, A pharmaceutical composition comprising a pharmaceutically acceptable carrier.

24. For use in a method for reducing the expression of a target gene in oligodendrocytes, or for use in a method for treating hereditary or acquired myelin disorders, The polynucleotide described in claim 16, or an expression cassette or expression vector containing the polynucleotide, or a host cell containing the polynucleotide, or a pharmaceutical composition containing the polynucleotide, The polynucleotide, or the expression cassette or the expression vector, or the host cell, or the pharmaceutical composition, (i) To be administered to a region of the central nervous system selected from the group consisting of the brain parenchyma, spinal canal, subarachnoid space, ventricles of the brain, cisterna magna, and combinations thereof, (ii) Administered by a method selected from the group consisting of intraparenchymal administration, intrathecal administration, intraventricular administration, intracisional administration, and combinations thereof. The polynucleotide for use, or the expression cassette or the expression vector, or the host cell, or the pharmaceutical composition.

25. The aforementioned disorders include Alexander disease, Mitchell disease, autosomal dominant leukodystrophy with autonomic nervous system disorders (ADLD), central hypomyelination leukodystrophy, Waardenburg syndrome, Hirschsprung's disease, adult polyglucosan body disease (APBD), hereditary diffuse leukoencephalopathy with spheroid formation, or Ecardi-Goutier syndrome, Canavan disease, Krabbe disease, globoid cell leukodystrophy, X-linked adrenoleukodystrophy, metachromatic leukodystrophy, hypomyelinate leukodystrophy-2, Niemann-Pick disease type C, and 4H leukodystrophy / Pol III-related leukodystrophy, Zelweger spectrum disorder, childhood ataxia with central nervous system hypomyelination, cerebral tenosynovitis xanthomatous disease, SOX-10-associated peripheral demyelinating neuropathy, adult Refsum disease, autism spectrum disorder, Alzheimer's disease, Parkinson's disease, fragile X syndrome, schizophrenia, multiple sclerosis, neuromyelitis optica, progressive multifocal leukoencephalopathy, encephalomyelitis, central pontine myelinolysis, adrenoleukodystrophy, Wallerian degeneration, optic neuritis, transverse spinal cord syndrome AAV particles for use according to claim 5, which are for conditions such as inflammation, amyotrophic lateral sclerosis, Huntington's disease, spinal cord injury, traumatic brain injury, post-radiation injury, neurological complications of chemotherapy, stroke, acute ischemic optic neuropathy, vitamin E deficiency, isolated vitamin E deficiency syndrome, Bassen-Kohnzweig syndrome, Marquiafava-Bignami syndrome, trigeminal neuralgia, acute disseminated encephalitis, Gillian-Barré syndrome, Marie-Charcot-Tooth disease, or Bell's palsy.